A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.
A plant family of the order Violales, subclass Dilleniidae, class Magnoliopsida.
A plant genus of the family Caricaceae, order Violales, subclass Dilleniidae, class Magnoliopsida. It is the source of edible fruit and PAPAIN.
Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.
The mass or quantity of heaviness of an individual. It is expressed by units of pounds or kilograms.
A nitrosourea compound with alkylating, carcinogenic, and mutagenic properties.
Experiments designed to determine the potential toxic effects of one-time, short-term exposure to a chemical or chemicals.
The measurement of an organ in volume, mass, or heaviness.
A plant genus of the family LAMIACEAE that contains pimarane-type diterpenes. Several species of Orthosiphon are also called Java tea.
Concentrated pharmaceutical preparations of plants obtained by removing active constituents with a suitable solvent, which is evaporated away, and adjusting the residue to a prescribed standard.
'Benzoxazoles' are heterocyclic organic compounds, consisting of a benzene ring fused to an oxazole ring, which have been studied for their potential pharmacological activities including anti-inflammatory, analgesic, and antipyretic effects.
The relationship between the dose of an administered drug and the response of the organism to the drug.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Elements of limited time intervals, contributing to particular results or situations.
The observable response an animal makes to any situation.
A process involving chance used in therapeutic trials or other research endeavor for allocating experimental subjects, human or animal, between treatment and control groups, or among treatment groups. It may also apply to experiments on inanimate objects.
A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.
Body organ that filters blood for the secretion of URINE and that regulates ion concentrations.
A statistical technique that isolates and assesses the contributions of categorical independent variables to variation in the mean of a continuous dependent variable.
An array of tests used to determine the toxicity of a substance to living systems. These include tests on clinical drugs, foods, and environmental pollutants.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
A complex involuntary response to an unexpected strong stimulus usually auditory in nature.
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
The front part of the hindbrain (RHOMBENCEPHALON) that lies between the MEDULLA and the midbrain (MESENCEPHALON) ventral to the cerebellum. It is composed of two parts, the dorsal and the ventral. The pons serves as a relay station for neural pathways between the CEREBELLUM to the CEREBRUM.
Genetically identical individuals developed from brother and sister matings which have been carried out for twenty or more generations or by parent x offspring matings carried out with certain restrictions. This also includes animals with a long history of closed colony breeding.
Ventral part of the DIENCEPHALON extending from the region of the OPTIC CHIASM to the caudal border of the MAMMILLARY BODIES and forming the inferior and lateral walls of the THIRD VENTRICLE.
7,12-Dimethylbenzanthracene. Polycyclic aromatic hydrocarbon found in tobacco smoke that is a potent carcinogen.
Substances that increase the risk of NEOPLASMS in humans or animals. Both genotoxic chemicals, which affect DNA directly, and nongenotoxic chemicals, which induce neoplasms by other mechanism, are included.
Use of plants or herbs to treat diseases or to alleviate pain.
A pyrrolizidine alkaloid and a toxic plant constituent that poisons livestock and humans through the ingestion of contaminated grains and other foods. The alkaloid causes pulmonary artery hypertension, right ventricular hypertrophy, and pathological changes in the pulmonary vasculature. Significant attenuation of the cardiopulmonary changes are noted after oral magnesium treatment.
Drugs that bind to and activate dopamine receptors.
PRESSURE of the BLOOD on the ARTERIES and other BLOOD VESSELS.
F344 rats are an inbred strain of albino laboratory rats (Rattus norvegicus) that have been widely used in biomedical research due to their consistent and reliable genetic background, which facilitates the study of disease mechanisms and therapeutic interventions.
Diabetes mellitus induced experimentally by administration of various diabetogenic agents or by PANCREATECTOMY.
The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.
The physical activity of a human or an animal as a behavioral phenomenon.
Refers to animals in the period of time just after birth.
Experimentally induced mammary neoplasms in animals to provide a model for studying human BREAST NEOPLASMS.
ANIMALS whose GENOME has been altered by GENETIC ENGINEERING, or their offspring.
A potent androgenic steroid and major product secreted by the LEYDIG CELLS of the TESTIS. Its production is stimulated by LUTEINIZING HORMONE from the PITUITARY GLAND. In turn, testosterone exerts feedback control of the pituitary LH and FSH secretion. Depending on the tissues, testosterone can be further converted to DIHYDROTESTOSTERONE or ESTRADIOL.
The giving of drugs, chemicals, or other substances by mouth.
The surgical removal of one or both ovaries.
The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.
Consumption of excessive DIETARY FATS.
The consumption of edible substances.
Naturally occurring or synthetic substances that inhibit or retard the oxidation of a substance to which it is added. They counteract the harmful and damaging effects of oxidation in animal tissues.
Learning the correct route through a maze to obtain reinforcement. It is used for human or animal populations. (Thesaurus of Psychological Index Terms, 6th ed)
The gradual irreversible changes in structure and function of an organism that occur as a result of the passage of time.
An antibiotic that is produced by Stretomyces achromogenes. It is used as an antineoplastic agent and to induce diabetes in experimental animals.
Agents that reduce the frequency or rate of spontaneous or induced tumors independently of the mechanism involved.
Almond-shaped group of basal nuclei anterior to the INFERIOR HORN OF THE LATERAL VENTRICLE of the TEMPORAL LOBE. The amygdala is part of the limbic system.
A disturbance in the prooxidant-antioxidant balance in favor of the former, leading to potential damage. Indicators of oxidative stress include damaged DNA bases, protein oxidation products, and lipid peroxidation products (Sies, Oxidative Stress, 1991, pxv-xvi).
Regular course of eating and drinking adopted by a person or animal.
The consequences of exposing the FETUS in utero to certain factors, such as NUTRITION PHYSIOLOGICAL PHENOMENA; PHYSIOLOGICAL STRESS; DRUGS; RADIATION; and other physical or chemical factors. These consequences are observed later in the offspring after BIRTH.
The dialdehyde of malonic acid.
A highly specific (Leu-Leu) endopeptidase that generates ANGIOTENSIN I from its precursor ANGIOTENSINOGEN, leading to a cascade of reactions which elevate BLOOD PRESSURE and increase sodium retention by the kidney in the RENIN-ANGIOTENSIN SYSTEM. The enzyme was formerly listed as EC 3.4.99.19.
Chinese herbal or plant extracts which are used as drugs to treat diseases or promote general well-being. The concept does not include synthesized compounds manufactured in China.
An adrenocortical steroid that has modest but significant activities as a mineralocorticoid and a glucocorticoid. (From Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th ed, p1437)
A strain of Rattus norvegicus used as a normotensive control for the spontaneous hypertensive rats (SHR).
Azoles of two nitrogens at the 1,2 positions, next to each other, in contrast with IMIDAZOLES in which they are at the 1,3 positions.
The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.
Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.
Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.
Excision of kidney.
A curved elevation of GRAY MATTER extending the entire length of the floor of the TEMPORAL HORN of the LATERAL VENTRICLE (see also TEMPORAL LOBE). The hippocampus proper, subiculum, and DENTATE GYRUS constitute the hippocampal formation. Sometimes authors include the ENTORHINAL CORTEX in the hippocampal formation.
A strain of Rattus norvegicus with elevated blood pressure used as a model for studying hypertension and stroke.
The unfavorable effect of environmental factors (stressors) on the physiological functions of an organism. Prolonged unresolved physiological stress can affect HOMEOSTASIS of the organism, and may lead to damaging or pathological conditions.
An octapeptide that is a potent but labile vasoconstrictor. It is produced from angiotensin I after the removal of two amino acids at the C-terminal by ANGIOTENSIN CONVERTING ENZYME. The amino acid in position 5 varies in different species. To block VASOCONSTRICTION and HYPERTENSION effect of angiotensin II, patients are often treated with ACE INHIBITORS or with ANGIOTENSIN II TYPE 1 RECEPTOR BLOCKERS.
The male gonad containing two functional parts: the SEMINIFEROUS TUBULES for the production and transport of male germ cells (SPERMATOGENESIS) and the interstitial compartment containing LEYDIG CELLS that produce ANDROGENS.
Persistently high systemic arterial BLOOD PRESSURE. Based on multiple readings (BLOOD PRESSURE DETERMINATION), hypertension is currently defined as when SYSTOLIC PRESSURE is consistently greater than 140 mm Hg or when DIASTOLIC PRESSURE is consistently 90 mm Hg or more.
The ten-layered nervous tissue membrane of the eye. It is continuous with the OPTIC NERVE and receives images of external objects and transmits visual impulses to the brain. Its outer surface is in contact with the CHOROID and the inner surface with the VITREOUS BODY. The outer-most layer is pigmented, whereas the inner nine layers are transparent.
Either of the pair of organs occupying the cavity of the thorax that effect the aeration of the blood.
Increase in BODY WEIGHT over existing weight.
A compound formed in the liver from ammonia produced by the deamination of amino acids. It is the principal end product of protein catabolism and constitutes about one half of the total urinary solids.
Peroxidase catalyzed oxidation of lipids using hydrogen peroxide as an electron acceptor.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
An oxidoreductase that catalyzes the reaction between superoxide anions and hydrogen to yield molecular oxygen and hydrogen peroxide. The enzyme protects the cell against dangerous levels of superoxide. EC 1.15.1.1.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
A clear, colorless liquid rapidly absorbed from the gastrointestinal tract and distributed throughout the body. It has bactericidal activity and is used often as a topical disinfectant. It is widely used as a solvent and preservative in pharmaceutical preparations as well as serving as the primary ingredient in ALCOHOLIC BEVERAGES.
A strain of albino rat developed at the Wistar Institute that has spread widely at other institutions. This has markedly diluted the original strain.
Acute and chronic (see also BRAIN INJURIES, CHRONIC) injuries to the brain, including the cerebral hemispheres, CEREBELLUM, and BRAIN STEM. Clinical manifestations depend on the nature of injury. Diffuse trauma to the brain is frequently associated with DIFFUSE AXONAL INJURY or COMA, POST-TRAUMATIC. Localized injuries may be associated with NEUROBEHAVIORAL MANIFESTATIONS; HEMIPARESIS, or other focal neurologic deficits.
Those characteristics that distinguish one SEX from the other. The primary sex characteristics are the OVARIES and TESTES and their related hormones. Secondary sex characteristics are those which are masculine or feminine but not directly related to reproduction.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
An alkaloid ester extracted from the leaves of plants including coca. It is a local anesthetic and vasoconstrictor and is clinically used for that purpose, particularly in the eye, ear, nose, and throat. It also has powerful central nervous system effects similar to the amphetamines and is a drug of abuse. Cocaine, like amphetamines, acts by multiple mechanisms on brain catecholaminergic neurons; the mechanism of its reinforcing effects is thought to involve inhibition of dopamine uptake.
Restoration of integrity to traumatized tissue.
A free radical gas produced endogenously by a variety of mammalian cells, synthesized from ARGININE by NITRIC OXIDE SYNTHASE. Nitric oxide is one of the ENDOTHELIUM-DEPENDENT RELAXING FACTORS released by the vascular endothelium and mediates VASODILATION. It also inhibits platelet aggregation, induces disaggregation of aggregated platelets, and inhibits platelet adhesion to the vascular endothelium. Nitric oxide activates cytosolic GUANYLATE CYCLASE and thus elevates intracellular levels of CYCLIC GMP.
Glucose in blood.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Adverse functional, metabolic, or structural changes in ischemic tissues resulting from the restoration of blood flow to the tissue (REPERFUSION), including swelling; HEMORRHAGE; NECROSIS; and damage from FREE RADICALS. The most common instance is MYOCARDIAL REPERFUSION INJURY.
Fats present in food, especially in animal products such as meat, meat products, butter, ghee. They are present in lower amounts in nuts, seeds, and avocados.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
The muscle tissue of the HEART. It is composed of striated, involuntary muscle cells (MYOCYTES, CARDIAC) connected to form the contractile pump to generate blood flow.
The 17-beta-isomer of estradiol, an aromatized C18 steroid with hydroxyl group at 3-beta- and 17-beta-position. Estradiol-17-beta is the most potent form of mammalian estrogenic steroids.
Measurable and quantifiable biological parameters (e.g., specific enzyme concentration, specific hormone concentration, specific gene phenotype distribution in a population, presence of biological substances) which serve as indices for health- and physiology-related assessments, such as disease risk, psychiatric disorders, environmental exposure and its effects, disease diagnosis, metabolic processes, substance abuse, pregnancy, cell line development, epidemiologic studies, etc.
A 51-amino acid pancreatic hormone that plays a major role in the regulation of glucose metabolism, directly by suppressing endogenous glucose production (GLYCOGENOLYSIS; GLUCONEOGENESIS) and indirectly by suppressing GLUCAGON secretion and LIPOLYSIS. Native insulin is a globular protein comprised of a zinc-coordinated hexamer. Each insulin monomer containing two chains, A (21 residues) and B (30 residues), linked by two disulfide bonds. Insulin is used as a drug to control insulin-dependent diabetes mellitus (DIABETES MELLITUS, TYPE 1).
The custard-apple plant family of the order Magnoliales, subclass Magnoliidae, class Magnoliopsida. Some members provide large pulpy fruits and commercial timber. Leaves and wood are often fragrant. Leaves are simple, with smooth margins, and alternately arranged in two rows along the stems.
A cylindrical column of tissue that lies within the vertebral canal. It is composed of WHITE MATTER and GRAY MATTER.
The range or frequency distribution of a measurement in a population (of organisms, organs or things) that has not been selected for the presence of disease or abnormality.
A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Compounds that interact with ESTROGEN RECEPTORS in target tissues to bring about the effects similar to those of ESTRADIOL. Estrogens stimulate the female reproductive organs, and the development of secondary female SEX CHARACTERISTICS. Estrogenic chemicals include natural, synthetic, steroidal, or non-steroidal compounds.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
An NADPH-dependent enzyme that catalyzes the conversion of L-ARGININE and OXYGEN to produce CITRULLINE and NITRIC OXIDE.
Specialized connective tissue composed of fat cells (ADIPOCYTES). It is the site of stored FATS, usually in the form of TRIGLYCERIDES. In mammals, there are two types of adipose tissue, the WHITE FAT and the BROWN FAT. Their relative distributions vary in different species with most adipose tissue being white.
Age as a constituent element or influence contributing to the production of a result. It may be applicable to the cause or the effect of a circumstance. It is used with human or animal concepts but should be differentiated from AGING, a physiological process, and TIME FACTORS which refers only to the passage of time.
A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
A status with BODY WEIGHT that is grossly above the acceptable or desirable weight, usually due to accumulation of excess FATS in the body. The standards may vary with age, sex, genetic or cultural background. In the BODY MASS INDEX, a BMI greater than 30.0 kg/m2 is considered obese, and a BMI greater than 40.0 kg/m2 is considered morbidly obese (MORBID OBESITY).
The nonstriated involuntary muscle tissue of blood vessels.
Serum glycoprotein produced by activated MACROPHAGES and other mammalian MONONUCLEAR LEUKOCYTES. It has necrotizing activity against tumor cell lines and increases ability to reject tumor transplants. Also known as TNF-alpha, it is only 30% homologous to TNF-beta (LYMPHOTOXIN), but they share TNF RECEPTORS.
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
The segment of LARGE INTESTINE between the CECUM and the RECTUM. It includes the ASCENDING COLON; the TRANSVERSE COLON; the DESCENDING COLON; and the SIGMOID COLON.

Inducible long-term gene expression in brain with adeno-associated virus gene transfer. (1/68726)

Recombinant adeno-associated virus (rAAV) vectors hold promise for treating a number of neurological disorders due to the ability to deliver long-term gene expression without toxicity or immune response. Critical to these endeavors will be controlled expression of the therapeutic gene in target cells. We have constructed and tested a dual cassette rAAV vector carrying a reporter gene under the control of the tetracycline-responsive system and the tetracycline transactivator. Transduction in vitro resulted in stable expression from the vector that can be suppressed 20-fold by tetracycline treatment. In vivo experiments, carried out to 6 weeks, demonstrated that vector-transduced expression is sustained until doxycycline administration upon which reporter gene expression is reduced. Moreover, the suppression of vector-driven expression can be reversed by removal of the drug. These studies demonstrate long-term regulated gene expression from rAAV vectors. This system will provide a valuable approach for controlling vector gene expression both in vitro and in vivo.  (+info)

Adenoviral gene transfer into the normal and injured spinal cord: enhanced transgene stability by combined administration of temperature-sensitive virus and transient immune blockade. (2/68726)

This study characterized gene transfer into both normal and injured adult rat dorsal spinal cord using first (E1-/E3-) or second (E1-/E2A125/E3-, temperature-sensitive; ts) generation of replication-defective adenoviral (Ad) vectors. A novel immunosuppressive regimen aimed at blocking CD4/CD45 lymphocytic receptors was tested for improving transgene persistence. In addition, the effect of gene transfer on nociception was also evaluated. Seven days after treatment, numerous LacZ-positive cells were observed after transfection with either viral vector. By 21 days after transfection, beta-galactosidase staining was reduced and suggestive of ongoing cytopathology in both Ad-treated groups, despite the fact that the immunogenicity of LacZ/Adts appeared less when compared with that elicited by the LacZ/Ad vector. In contrast, immunosuppressed animals showed a significant (P < or = 0.05) increase in the number of LacZ-positive cells not displaying cytopathology. In these animals, a concomitant reduction in numbers of macrophages/microglia and CD4 and CD8 lymphocytes was observed. Only animals that received LacZ/Adts and immunosuppression showed transgene expression after 60 days. Similar results were observed in animals in which the L4-L5 dorsal roots were lesioned before transfection. Gene transfer into the dorsal spinal cord did not affect nociception, independent of the adenovirus vector. These results indicate that immune blockade of the CD4/CD45 lymphocytic receptors enhanced transgene stability in adult animals with normal or injured spinal cords and that persistent transgene expression in the spinal cord does not interfere with normal neural function.  (+info)

Daunorubicin-induced apoptosis in rat cardiac myocytes is inhibited by dexrazoxane. (3/68726)

-The clinical efficacy of anthracycline antineoplastic agents is limited by a high incidence of severe and usually irreversible cardiac toxicity, the cause of which remains controversial. In primary cultures of neonatal and adult rat ventricular myocytes, we found that daunorubicin, at concentrations /=10 micromol/L induced necrotic cell death within 24 hours, with no changes characteristic of apoptosis. To determine whether reactive oxygen species play a role in daunorubicin-mediated apoptosis, we monitored the generation of hydrogen peroxide with dichlorofluorescein (DCF). However, daunorubicin (1 micromol/L) did not increase DCF fluorescence, nor were the antioxidants N-acetylcysteine or the combination of alpha-tocopherol and ascorbic acid able to prevent apoptosis. In contrast, dexrazoxane (10 micromol/L), known clinically to limit anthracycline cardiac toxicity, prevented daunorubicin-induced myocyte apoptosis, but not necrosis induced by higher anthracycline concentrations (>/=10 micromol/L). The antiapoptotic action of dexrazoxane was mimicked by the superoxide-dismutase mimetic porphyrin manganese(II/III)tetrakis(1-methyl-4-peridyl)porphyrin (50 micromol/L). The recognition that anthracycline-induced cardiac myocyte apoptosis, perhaps mediated by superoxide anion generation, occurs at concentrations well below those that result in myocyte necrosis, may aid in the design of new therapeutic strategies to limit the toxicity of these drugs.  (+info)

Anti-monocyte chemoattractant protein-1/monocyte chemotactic and activating factor antibody inhibits neointimal hyperplasia in injured rat carotid arteries. (4/68726)

Monocyte chemoattractant protein-1 (MCP-1)/monocyte chemotactic and activating factor (MCAF) has been suggested to promote atherogenesis. The effects of in vivo neutralization of MCP-1 in a rat model were examined in an effort to clarify the role of MCP-1 in the development of neointimal hyperplasia. Competitive polymerase chain reaction analysis revealed maximum MCP-1 mRNA expression at 4 hours after carotid arterial injury. Increased immunoreactivities of MCP-1 were also detected at 2 and 8 hours after injury. Either anti-MCP-1 antibody or nonimmunized goat IgG (10 mg/kg) was then administered every 12 hours to rats that had undergone carotid arterial injury. Treatment with 3 consecutive doses of anti-MCP-1 antibody within 24 hours (experiment 1) and every 12 hours for 5 days (experiment 2) significantly inhibited neointimal hyperplasia at day 14, resulting in a 27.8% reduction of the mean intima/media ratio (P<0.05) in experiment 1 and a 43.6% reduction (P<0.01) in experiment 2. This effect was still apparent at day 56 (55.6% inhibition; P<0.05). The number of vascular smooth muscle cells in the neointima at day 4 was significantly reduced by anti-MCP-1 treatment, demonstrating the important role of MCP-1 in early neointimal lesion formation. However, recombinant MCP-1 did not stimulate chemotaxis of vascular smooth muscle cells in an in vitro migration assay. These results suggest that MCP-1 promotes neointimal hyperplasia in early neointimal lesion formation and that neutralization of MCP-1 before, and immediately after, arterial injury may be effective in preventing restenosis after angioplasty. Further studies are needed to clarify the mechanism underlying the promotion of neointimal hyperplasia by MCP-1.  (+info)

An alternative transcript of the rat renin gene can result in a truncated prorenin that is transported into adrenal mitochondria. (5/68726)

Characterization of the local renin-angiotensin system in the rat adrenal zona glomerulosa indicated a dual targeting of renin both to the secretory pathway and mitochondria. To investigate the transport of renin into mitochondria, we constructed a series of amino-terminal deletion variants of preprorenin. One of these variants, lacking the complete signal sequence for the endoplasmic reticulum and 10 amino acids of the profragment, was transported efficiently into isolated mitochondria. The transport was further shown to be dependent on mitochondrial membrane potential and ATP synthesis. Analysis of adrenal RNA revealed the existence of 2 renin transcripts. While one of the transcripts corresponds to the known full-length transcript, the other one lacks exon 1; instead, exon 2 is preceded by a domain of 80 nucleotides originating from intron 1. This domain, as well as the following region of intron 1 being excised, shows all essential sequence elements defining an additional, so-far-unknown exon. The second mRNA possibly derives from an additional transcription start in intron 1 and an alternative splicing process. Translation of this mRNA could result in a truncated prorenin representing a cytosolic form of renin, which is required for transport into mitochondria. This truncated prorenin corresponds exactly to the deletion variant being imported into mitochondria in vitro.  (+info)

Angiotensin II type 1 receptor-mediated inhibition of K+ channel subunit kv2.2 in brain stem and hypothalamic neurons. (6/68726)

Angiotensin II (Ang II) has powerful modulatory actions on cardiovascular function that are mediated by specific receptors located on neurons within the hypothalamus and brain stem. Incubation of neuronal cocultures of rat hypothalamus and brain stem with Ang II elicits an Ang II type 1 (AT1) receptor-mediated inhibition of total outward K+ current that contributes to an increase in neuronal firing rate. However, the exact K+ conductance(s) that is inhibited by Ang II are not established. Pharmacological manipulation of total neuronal outward K+ current revealed a component of K+ current sensitive to quinine, tetraethylammonium, and 4-aminopyridine, with IC50 values of 21.7 micromol/L, 1.49 mmol/L, and 890 micromol/L, respectively, and insensitive to alpha-dendrotoxin (100 to 500 nmol/L), charybdotoxin (100 to 500 nmol/L), and mast cell degranulating peptide (1 micromol/L). Collectively, these data suggest the presence of Kv2.2 and Kv3.1b. Biophysical examination of the quinine-sensitive neuronal K+ current demonstrated a macroscopic conductance with similar biophysical properties to those of Kv2.2 and Kv3.1b. Ang II (100 nmol/L), in the presence of the AT2 receptor blocker PD123,319, elicited an inhibition of neuronal K+ current that was abolished by quinine (50 micromol/L). Reverse transcriptase-polymerase chain reaction analysis confirmed the presence of Kv2.2 and Kv3.1b mRNA in these neurons. However, Western blot analyses demonstrated that only Kv2.2 protein was present. Coexpression of Kv2.2 and the AT1 receptor in Xenopus oocytes demonstrated an Ang II-induced inhibition of Kv2.2 current. Therefore, these data suggest that inhibition of Kv2.2 contributes to the AT1 receptor-mediated reduction of neuronal K+ current and subsequently to the modulation of cardiovascular function.  (+info)

Loss of endothelium and receptor-mediated dilation in pial arterioles of rats fed a short-term high salt diet. (7/68726)

A high salt diet often is regarded as an accessory risk factor in hypertension, coincidental to the deleterious effect of high blood pressure on vasodilator function. The aim of this study was to determine whether short-term ingestion of a high salt diet per se impairs vasodilator function in the cerebral circulation independent of blood pressure changes. Adult Sprague-Dawley rats were fed a normal salt (0.8%) or high salt (4%) diet for 3 days. Mean arterial pressures were similar in the normal and high salt groups (123+/-2 and 125+/-2 mm Hg, respectively). Subsequently, the responses of the in situ pial arterioles to acetylcholine, iloprost, and sodium nitroprusside were determined in cranial windows using intravital videomicroscopy. Pial arterioles of rats fed normal and high salt diets showed similar resting diameters of 69+/-2 and 72+/-3 microm, respectively, but their reactivity patterns to vasodilator stimuli were markedly different. Arterioles of rats fed a normal salt diet dilated progressively up to 17+/-3% in response to the endothelium-dependent agent acetylcholine (10(-9) to 10(-6) mol/L) and dilated by 22+/-2% in response to the prostaglandin I2 receptor agonist iloprost (3x10(-11) mol/L). In contrast, pial arterioles of rats fed a high salt diet constricted by 4+/-3% and 8+/-2% in response to acetylcholine and iloprost, respectively. Sodium nitroprusside (10(-6) mol/L), a nitric oxide donor, dilated pial arterioles of rats fed low and high salt diets by a similar amount (19+/-3% and 16+/-2%, respectively), suggesting that signaling mechanisms for dilation distal to the vascular smooth muscle membrane were intact after high salt intake. These results provide the first evidence that the short-term ingestion of a high salt diet may severely impair the vasodilator function of the in situ cerebral microcirculation independent of blood pressure elevation.  (+info)

Kidney aminopeptidase A and hypertension, part II: effects of angiotensin II. (8/68726)

Aminopeptidase A (APA) is the principal enzyme that metabolizes angiotensin II (Ang II) to angiotensin III. Previously, we showed that kidney APA was elevated in spontaneously hypertensive rats and was reduced after angiotensin-converting enzyme inhibition. In the present study, we sought to determine whether kidney APA expression was altered after chronically elevated Ang II, either exogenously delivered via osmotic minipumps or endogenously produced in two-kidney, one clip (2K1C) hypertensive rats. Ang II (200 ng. kg-1. min-1) was infused subcutaneously for 1 or 2 weeks by osmotic minipumps, and 2K1C rats were tested 4 weeks after unilateral renal artery clipping. Blood pressure was not significantly elevated in the Ang II-infused animals but was significantly increased at 3 and 4 weeks in the 2K1C animals. APA was significantly elevated approximately 2-fold in kidney cortical membranes from Ang II-infused animals but was decreased 45% in the clipped kidney and 18% in the nonclipped kidneys from 2K1C animals. Isolated glomeruli from Ang II-infused animals and the nonclipped kidneys from 2K1C animals had markedly higher APA activity and immunoreactivity. Likewise, histochemical and immunohistochemical studies indicated that APA levels were increased in glomeruli from angiotensin-infused animals and in both nonclipped and clipped kidneys from 2K1C animals. In contrast, tubular APA was decreased in tubular elements from 2K1C animals, most markedly in the clipped kidneys. Thus, despite the increase in glomerular APA expression in kidneys from 2K1C animals, the decrease in tubular APA expression is more extensive and accounts for the measured reduction in total APA in cortical homogenates. Because clipped kidneys are not exposed to high blood pressure, these results suggest that glomerular APA expression is positively regulated and tubular APA negatively regulated by Ang II. These results further suggest that changes in kidney APA expression could influence the progression of angiotensin-dependent hypertension.  (+info)

Sprague-Dawley rats are a strain of albino laboratory rats that are widely used in scientific research. They were first developed by researchers H.H. Sprague and R.C. Dawley in the early 20th century, and have since become one of the most commonly used rat strains in biomedical research due to their relatively large size, ease of handling, and consistent genetic background.

Sprague-Dawley rats are outbred, which means that they are genetically diverse and do not suffer from the same limitations as inbred strains, which can have reduced fertility and increased susceptibility to certain diseases. They are also characterized by their docile nature and low levels of aggression, making them easier to handle and study than some other rat strains.

These rats are used in a wide variety of research areas, including toxicology, pharmacology, nutrition, cancer, and behavioral studies. Because they are genetically diverse, Sprague-Dawley rats can be used to model a range of human diseases and conditions, making them an important tool in the development of new drugs and therapies.

I apologize for any confusion, but "Violaceae" is not a medical term. It is the biological name of a family of flowering plants, also known as the violet family. This family includes various plants that may have medicinal uses, such as violets and pansies, but "Violaceae" itself does not have a specific medical definition.

"Carica" is a genus name that refers to a group of plants commonly known as papayas. The most widely cultivated and well-known species in this genus is Carica papaya, which is native to Central America and southern Mexico. This plant produces large, edible fruits that are rich in nutrients such as vitamin C, vitamin A, and potassium.

The fruit of the Carica papaya tree is often used for its medicinal properties, including its anti-inflammatory and digestive benefits. The leaves, stems, and roots of the plant also have various traditional uses in different cultures, such as treating wounds, reducing fever, and alleviating symptoms of digestive disorders.

It's worth noting that while Carica papaya has been studied for its potential health benefits, more research is needed to fully understand its effects and safety profile. As with any treatment or supplement, it's important to consult with a healthcare provider before using Carica papaya for medicinal purposes.

Animal disease models are specialized animals, typically rodents such as mice or rats, that have been genetically engineered or exposed to certain conditions to develop symptoms and physiological changes similar to those seen in human diseases. These models are used in medical research to study the pathophysiology of diseases, identify potential therapeutic targets, test drug efficacy and safety, and understand disease mechanisms.

The genetic modifications can include knockout or knock-in mutations, transgenic expression of specific genes, or RNA interference techniques. The animals may also be exposed to environmental factors such as chemicals, radiation, or infectious agents to induce the disease state.

Examples of animal disease models include:

1. Mouse models of cancer: Genetically engineered mice that develop various types of tumors, allowing researchers to study cancer initiation, progression, and metastasis.
2. Alzheimer's disease models: Transgenic mice expressing mutant human genes associated with Alzheimer's disease, which exhibit amyloid plaque formation and cognitive decline.
3. Diabetes models: Obese and diabetic mouse strains like the NOD (non-obese diabetic) or db/db mice, used to study the development of type 1 and type 2 diabetes, respectively.
4. Cardiovascular disease models: Atherosclerosis-prone mice, such as ApoE-deficient or LDLR-deficient mice, that develop plaque buildup in their arteries when fed a high-fat diet.
5. Inflammatory bowel disease models: Mice with genetic mutations affecting intestinal barrier function and immune response, such as IL-10 knockout or SAMP1/YitFc mice, which develop colitis.

Animal disease models are essential tools in preclinical research, but it is important to recognize their limitations. Differences between species can affect the translatability of results from animal studies to human patients. Therefore, researchers must carefully consider the choice of model and interpret findings cautiously when applying them to human diseases.

Body weight is the measure of the force exerted on a scale or balance by an object's mass, most commonly expressed in units such as pounds (lb) or kilograms (kg). In the context of medical definitions, body weight typically refers to an individual's total weight, which includes their skeletal muscle, fat, organs, and bodily fluids.

Healthcare professionals often use body weight as a basic indicator of overall health status, as it can provide insights into various aspects of a person's health, such as nutritional status, metabolic function, and risk factors for certain diseases. For example, being significantly underweight or overweight can increase the risk of developing conditions like malnutrition, diabetes, heart disease, and certain types of cancer.

It is important to note that body weight alone may not provide a complete picture of an individual's health, as it does not account for factors such as muscle mass, bone density, or body composition. Therefore, healthcare professionals often use additional measures, such as body mass index (BMI), waist circumference, and blood tests, to assess overall health status more comprehensively.

Methylnitrosourea (MNU) is not a medical term per se, but it is a chemical compound that has been widely used in biomedical research, particularly in cancer studies. Therefore, I will provide you with a scientific definition of this compound.

Methylnitrosourea (MNU) is an alkylating agent and a nitrosourea compound. It is known to be highly mutagenic and carcinogenic. MNU acts by transferring its methyl group (-CH3) to DNA, RNA, and proteins, causing damage to these macromolecules. This methylation can lead to point mutations, chromosomal aberrations, and DNA strand breaks, which contribute to genomic instability and cancer initiation and progression.

In research settings, MNU has been used as a model carcinogen to induce tumors in various animal models, primarily rodents, to study the mechanisms of carcinogenesis and evaluate potential chemopreventive or therapeutic agents. However, due to its high toxicity and mutagenicity, handling and use of MNU require strict safety measures and precautions.

Acute toxicity tests are a category of medical or biological testing that measure the short-term adverse effects of a substance on living organisms. These tests are typically performed in a laboratory setting and involve exposing test subjects (such as cells, animals, or isolated organs) to a single high dose or multiple doses of a substance within a short period of time, usually 24 hours or less.

The primary objective of acute toxicity testing is to determine the median lethal dose (LD50) or concentration (LC50) of a substance, which is the amount or concentration that causes death in 50% of the test subjects. This information can be used to help assess the potential health hazards associated with exposure to a particular substance and to establish safety guidelines for its handling and use.

Acute toxicity tests are required by regulatory agencies around the world as part of the process of evaluating the safety of chemicals, drugs, and other substances. However, there is growing concern about the ethical implications of using animals in these tests, and many researchers are working to develop alternative testing methods that do not involve the use of live animals.

Organ size refers to the volume or physical measurement of an organ in the body of an individual. It can be described in terms of length, width, and height or by using specialized techniques such as imaging studies (like CT scans or MRIs) to determine the volume. The size of an organ can vary depending on factors such as age, sex, body size, and overall health status. Changes in organ size may indicate various medical conditions, including growths, inflammation, or atrophy.

Orthosiphon is a genus of plants in the family Lamiaceae, also known as the mint or deadnettle family. The most common species is Orthosiphon stamineus, also known as Cat's Whiskers or Java Tea. This plant is native to Southeast Asia and some parts of Australia.

In a medical context, Orthosiphon stamineus is used in traditional medicine for its diuretic, antioxidant, anti-inflammatory, and antibacterial properties. The leaves and stems of the plant are dried and prepared as an herbal infusion or decoction to treat various health conditions such as kidney stones, urinary tract infections, and high blood pressure. However, it is important to note that the scientific evidence supporting these claims is limited, and more research is needed to establish its safety and efficacy.

A plant extract is a preparation containing chemical constituents that have been extracted from a plant using a solvent. The resulting extract may contain a single compound or a mixture of several compounds, depending on the extraction process and the specific plant material used. These extracts are often used in various industries including pharmaceuticals, nutraceuticals, cosmetics, and food and beverage, due to their potential therapeutic or beneficial properties. The composition of plant extracts can vary widely, and it is important to ensure their quality, safety, and efficacy before use in any application.

Benzoxazoles are a class of heterocyclic organic compounds that consist of a benzene ring fused to an oxazole ring. The term "benzoxazoles" generally refers to the parent compound, but it can also refer to its derivatives that contain various functional groups attached to the benzene and/or oxazole rings.

Benzoxazoles have a wide range of applications in the pharmaceutical industry, as they are used in the synthesis of several drugs with anti-inflammatory, antifungal, and antiviral properties. They also have potential uses in materials science, such as in the development of organic light-emitting diodes (OLEDs) and organic photovoltaic cells (OPVs).

It is worth noting that benzoxazoles themselves are not used in medical treatments or therapies. Instead, their derivatives with specific functional groups and structures are designed and synthesized to have therapeutic effects on various diseases and conditions.

A dose-response relationship in the context of drugs refers to the changes in the effects or symptoms that occur as the dose of a drug is increased or decreased. Generally, as the dose of a drug is increased, the severity or intensity of its effects also increases. Conversely, as the dose is decreased, the effects of the drug become less severe or may disappear altogether.

The dose-response relationship is an important concept in pharmacology and toxicology because it helps to establish the safe and effective dosage range for a drug. By understanding how changes in the dose of a drug affect its therapeutic and adverse effects, healthcare providers can optimize treatment plans for their patients while minimizing the risk of harm.

The dose-response relationship is typically depicted as a curve that shows the relationship between the dose of a drug and its effect. The shape of the curve may vary depending on the drug and the specific effect being measured. Some drugs may have a steep dose-response curve, meaning that small changes in the dose can result in large differences in the effect. Other drugs may have a more gradual dose-response curve, where larger changes in the dose are needed to produce significant effects.

In addition to helping establish safe and effective dosages, the dose-response relationship is also used to evaluate the potential therapeutic benefits and risks of new drugs during clinical trials. By systematically testing different doses of a drug in controlled studies, researchers can identify the optimal dosage range for the drug and assess its safety and efficacy.

Species specificity is a term used in the field of biology, including medicine, to refer to the characteristic of a biological entity (such as a virus, bacterium, or other microorganism) that allows it to interact exclusively or preferentially with a particular species. This means that the biological entity has a strong affinity for, or is only able to infect, a specific host species.

For example, HIV is specifically adapted to infect human cells and does not typically infect other animal species. Similarly, some bacterial toxins are species-specific and can only affect certain types of animals or humans. This concept is important in understanding the transmission dynamics and host range of various pathogens, as well as in developing targeted therapies and vaccines.

In the field of medicine, "time factors" refer to the duration of symptoms or time elapsed since the onset of a medical condition, which can have significant implications for diagnosis and treatment. Understanding time factors is crucial in determining the progression of a disease, evaluating the effectiveness of treatments, and making critical decisions regarding patient care.

For example, in stroke management, "time is brain," meaning that rapid intervention within a specific time frame (usually within 4.5 hours) is essential to administering tissue plasminogen activator (tPA), a clot-busting drug that can minimize brain damage and improve patient outcomes. Similarly, in trauma care, the "golden hour" concept emphasizes the importance of providing definitive care within the first 60 minutes after injury to increase survival rates and reduce morbidity.

Time factors also play a role in monitoring the progression of chronic conditions like diabetes or heart disease, where regular follow-ups and assessments help determine appropriate treatment adjustments and prevent complications. In infectious diseases, time factors are crucial for initiating antibiotic therapy and identifying potential outbreaks to control their spread.

Overall, "time factors" encompass the significance of recognizing and acting promptly in various medical scenarios to optimize patient outcomes and provide effective care.

'Animal behavior' refers to the actions or responses of animals to various stimuli, including their interactions with the environment and other individuals. It is the study of the actions of animals, whether they are instinctual, learned, or a combination of both. Animal behavior includes communication, mating, foraging, predator avoidance, and social organization, among other things. The scientific study of animal behavior is called ethology. This field seeks to understand the evolutionary basis for behaviors as well as their physiological and psychological mechanisms.

"Random allocation," also known as "random assignment" or "randomization," is a process used in clinical trials and other research studies to distribute participants into different intervention groups (such as experimental group vs. control group) in a way that minimizes selection bias and ensures the groups are comparable at the start of the study.

In random allocation, each participant has an equal chance of being assigned to any group, and the assignment is typically made using a computer-generated randomization schedule or other objective methods. This process helps to ensure that any differences between the groups are due to the intervention being tested rather than pre-existing differences in the participants' characteristics.

The liver is a large, solid organ located in the upper right portion of the abdomen, beneath the diaphragm and above the stomach. It plays a vital role in several bodily functions, including:

1. Metabolism: The liver helps to metabolize carbohydrates, fats, and proteins from the food we eat into energy and nutrients that our bodies can use.
2. Detoxification: The liver detoxifies harmful substances in the body by breaking them down into less toxic forms or excreting them through bile.
3. Synthesis: The liver synthesizes important proteins, such as albumin and clotting factors, that are necessary for proper bodily function.
4. Storage: The liver stores glucose, vitamins, and minerals that can be released when the body needs them.
5. Bile production: The liver produces bile, a digestive juice that helps to break down fats in the small intestine.
6. Immune function: The liver plays a role in the immune system by filtering out bacteria and other harmful substances from the blood.

Overall, the liver is an essential organ that plays a critical role in maintaining overall health and well-being.

A kidney, in medical terms, is one of two bean-shaped organs located in the lower back region of the body. They are essential for maintaining homeostasis within the body by performing several crucial functions such as:

1. Regulation of water and electrolyte balance: Kidneys help regulate the amount of water and various electrolytes like sodium, potassium, and calcium in the bloodstream to maintain a stable internal environment.

2. Excretion of waste products: They filter waste products from the blood, including urea (a byproduct of protein metabolism), creatinine (a breakdown product of muscle tissue), and other harmful substances that result from normal cellular functions or external sources like medications and toxins.

3. Endocrine function: Kidneys produce several hormones with important roles in the body, such as erythropoietin (stimulates red blood cell production), renin (regulates blood pressure), and calcitriol (activated form of vitamin D that helps regulate calcium homeostasis).

4. pH balance regulation: Kidneys maintain the proper acid-base balance in the body by excreting either hydrogen ions or bicarbonate ions, depending on whether the blood is too acidic or too alkaline.

5. Blood pressure control: The kidneys play a significant role in regulating blood pressure through the renin-angiotensin-aldosterone system (RAAS), which constricts blood vessels and promotes sodium and water retention to increase blood volume and, consequently, blood pressure.

Anatomically, each kidney is approximately 10-12 cm long, 5-7 cm wide, and 3 cm thick, with a weight of about 120-170 grams. They are surrounded by a protective layer of fat and connected to the urinary system through the renal pelvis, ureters, bladder, and urethra.

Analysis of Variance (ANOVA) is a statistical technique used to compare the means of two or more groups and determine whether there are any significant differences between them. It is a way to analyze the variance in a dataset to determine whether the variability between groups is greater than the variability within groups, which can indicate that the groups are significantly different from one another.

ANOVA is based on the concept of partitioning the total variance in a dataset into two components: variance due to differences between group means (also known as "between-group variance") and variance due to differences within each group (also known as "within-group variance"). By comparing these two sources of variance, ANOVA can help researchers determine whether any observed differences between groups are statistically significant, or whether they could have occurred by chance.

ANOVA is a widely used technique in many areas of research, including biology, psychology, engineering, and business. It is often used to compare the means of two or more experimental groups, such as a treatment group and a control group, to determine whether the treatment had a significant effect. ANOVA can also be used to compare the means of different populations or subgroups within a population, to identify any differences that may exist between them.

Toxicity tests, also known as toxicity assays, are a set of procedures used to determine the harmful effects of various substances on living organisms, typically on cells, tissues, or whole animals. These tests measure the degree to which a substance can cause damage, inhibit normal functioning, or lead to death in exposed organisms.

Toxicity tests can be conducted in vitro (in a test tube or petri dish) using cell cultures or in vivo (in living organisms) using animals such as rats, mice, or rabbits. The results of these tests help researchers and regulators assess the potential risks associated with exposure to various chemicals, drugs, or environmental pollutants.

There are several types of toxicity tests, including:

1. Acute toxicity tests: These tests measure the immediate effects of a single exposure to a substance over a short period (usually 24 hours or less).
2. Chronic toxicity tests: These tests evaluate the long-term effects of repeated exposures to a substance over an extended period (weeks, months, or even years).
3. Genotoxicity tests: These tests determine whether a substance can damage DNA or cause mutations in genetic material.
4. Developmental and reproductive toxicity tests: These tests assess the impact of a substance on fertility, embryonic development, and offspring health.
5. Carcinogenicity tests: These tests evaluate the potential of a substance to cause cancer.
6. Ecotoxicity tests: These tests determine the effects of a substance on entire ecosystems, including plants, animals, and microorganisms.

Toxicity tests play a crucial role in protecting public health by helping to identify potentially harmful substances and establish safe exposure levels. They also contribute to the development of new drugs, chemicals, and consumer products by providing critical data for risk assessment and safety evaluation.

Messenger RNA (mRNA) is a type of RNA (ribonucleic acid) that carries genetic information copied from DNA in the form of a series of three-base code "words," each of which specifies a particular amino acid. This information is used by the cell's machinery to construct proteins, a process known as translation. After being transcribed from DNA, mRNA travels out of the nucleus to the ribosomes in the cytoplasm where protein synthesis occurs. Once the protein has been synthesized, the mRNA may be degraded and recycled. Post-transcriptional modifications can also occur to mRNA, such as alternative splicing and addition of a 5' cap and a poly(A) tail, which can affect its stability, localization, and translation efficiency.

A startle reaction is a natural, defensive response to an unexpected stimulus that is characterized by a sudden contraction of muscles, typically in the face, neck, and arms. It's a reflexive action that occurs involuntarily and is mediated by the brainstem. The startle reaction can be observed in many different species, including humans, and is thought to have evolved as a protective mechanism to help organisms respond quickly to potential threats. In addition to the muscle contraction, the startle response may also include other physiological changes such as an increase in heart rate and blood pressure.

Immunohistochemistry (IHC) is a technique used in pathology and laboratory medicine to identify specific proteins or antigens in tissue sections. It combines the principles of immunology and histology to detect the presence and location of these target molecules within cells and tissues. This technique utilizes antibodies that are specific to the protein or antigen of interest, which are then tagged with a detection system such as a chromogen or fluorophore. The stained tissue sections can be examined under a microscope, allowing for the visualization and analysis of the distribution and expression patterns of the target molecule in the context of the tissue architecture. Immunohistochemistry is widely used in diagnostic pathology to help identify various diseases, including cancer, infectious diseases, and immune-mediated disorders.

The pons is a part of the brainstem that lies between the medulla oblongata and the midbrain. Its name comes from the Latin word "ponte" which means "bridge," as it serves to connect these two regions of the brainstem. The pons contains several important structures, including nerve fibers that carry signals between the cerebellum (the part of the brain responsible for coordinating muscle movements) and the rest of the nervous system. It also contains nuclei (clusters of neurons) that help regulate various functions such as respiration, sleep, and facial movements.

"Inbred strains of rats" are genetically identical rodents that have been produced through many generations of brother-sister mating. This results in a high degree of homozygosity, where the genes at any particular locus in the genome are identical in all members of the strain.

Inbred strains of rats are widely used in biomedical research because they provide a consistent and reproducible genetic background for studying various biological phenomena, including the effects of drugs, environmental factors, and genetic mutations on health and disease. Additionally, inbred strains can be used to create genetically modified models of human diseases by introducing specific mutations into their genomes.

Some commonly used inbred strains of rats include the Wistar Kyoto (WKY), Sprague-Dawley (SD), and Fischer 344 (F344) rat strains. Each strain has its own unique genetic characteristics, making them suitable for different types of research.

The hypothalamus is a small, vital region of the brain that lies just below the thalamus and forms part of the limbic system. It plays a crucial role in many important functions including:

1. Regulation of body temperature, hunger, thirst, fatigue, sleep, and circadian rhythms.
2. Production and regulation of hormones through its connection with the pituitary gland (the hypophysis). It controls the release of various hormones by producing releasing and inhibiting factors that regulate the anterior pituitary's function.
3. Emotional responses, behavior, and memory formation through its connections with the limbic system structures like the amygdala and hippocampus.
4. Autonomic nervous system regulation, which controls involuntary physiological functions such as heart rate, blood pressure, and digestion.
5. Regulation of the immune system by interacting with the autonomic nervous system.

Damage to the hypothalamus can lead to various disorders like diabetes insipidus, growth hormone deficiency, altered temperature regulation, sleep disturbances, and emotional or behavioral changes.

9,10-Dimethyl-1,2-benzanthracene (DMBA) is a synthetic, aromatic hydrocarbon that is commonly used in research as a carcinogenic compound. It is a potent tumor initiator and has been widely used to study chemical carcinogenesis in laboratory animals.

DMBA is a polycyclic aromatic hydrocarbon (PAH) with two benzene rings fused together, and two methyl groups attached at the 9 and 10 positions. This structure allows DMBA to intercalate into DNA, causing mutations that can lead to cancer.

Exposure to DMBA has been shown to cause a variety of tumors in different organs, depending on the route of administration and dose. In animal models, DMBA is often applied to the skin or administered orally to induce tumors in the mammary glands, lungs, or digestive tract.

It's important to note that DMBA is not a natural compound found in the environment and is used primarily for research purposes only. It should be handled with care and appropriate safety precautions due to its carcinogenic properties.

Carcinogens are agents (substances or mixtures of substances) that can cause cancer. They may be naturally occurring or man-made. Carcinogens can increase the risk of cancer by altering cellular DNA, disrupting cellular function, or promoting cell growth. Examples of carcinogens include certain chemicals found in tobacco smoke, asbestos, UV radiation from the sun, and some viruses.

It's important to note that not all exposures to carcinogens will result in cancer, and the risk typically depends on factors such as the level and duration of exposure, individual genetic susceptibility, and lifestyle choices. The International Agency for Research on Cancer (IARC) classifies carcinogens into different groups based on the strength of evidence linking them to cancer:

Group 1: Carcinogenic to humans
Group 2A: Probably carcinogenic to humans
Group 2B: Possibly carcinogenic to humans
Group 3: Not classifiable as to its carcinogenicity to humans
Group 4: Probably not carcinogenic to humans

This information is based on medical research and may be subject to change as new studies become available. Always consult a healthcare professional for medical advice.

Phytotherapy is the use of extracts of natural origin, especially plants or plant parts, for therapeutic purposes. It is also known as herbal medicine and is a traditional practice in many cultures. The active compounds in these plant extracts are believed to have various medicinal properties, such as anti-inflammatory, analgesic, or sedative effects. Practitioners of phytotherapy may use the whole plant, dried parts, or concentrated extracts to prepare teas, capsules, tinctures, or ointments for therapeutic use. It is important to note that the effectiveness and safety of phytotherapy are not always supported by scientific evidence, and it should be used with caution and preferably under the guidance of a healthcare professional.

Monocrotaline is not a medical condition but a toxic compound that is found in certain plants, including the Crotalaria species (also known as "rattlebox" or "crowtoe"). It has been used in research to create laboratory models of pulmonary hypertension. Ingestion or inhalation of monocrotaline can lead to serious health effects, including lung damage and death.

Therefore, there is no medical definition for 'Monocrotaline' as it is not a disease or condition.

Dopamine agonists are a class of medications that mimic the action of dopamine, a neurotransmitter in the brain that regulates movement, emotion, motivation, and reinforcement of rewarding behaviors. These medications bind to dopamine receptors in the brain and activate them, leading to an increase in dopaminergic activity.

Dopamine agonists are used primarily to treat Parkinson's disease, a neurological disorder characterized by motor symptoms such as tremors, rigidity, bradykinesia (slowness of movement), and postural instability. By increasing dopaminergic activity in the brain, dopamine agonists can help alleviate some of these symptoms.

Examples of dopamine agonists include:

1. Pramipexole (Mirapex)
2. Ropinirole (Requip)
3. Rotigotine (Neupro)
4. Apomorphine (Apokyn)

Dopamine agonists may also be used off-label to treat other conditions, such as restless legs syndrome or certain types of dopamine-responsive dystonia. However, these medications can have significant side effects, including nausea, dizziness, orthostatic hypotension, compulsive behaviors (such as gambling, shopping, or sexual addiction), and hallucinations. Therefore, they should be used with caution and under the close supervision of a healthcare provider.

Blood pressure is the force exerted by circulating blood on the walls of the blood vessels. It is measured in millimeters of mercury (mmHg) and is given as two figures:

1. Systolic pressure: This is the pressure when the heart pushes blood out into the arteries.
2. Diastolic pressure: This is the pressure when the heart rests between beats, allowing it to fill with blood.

Normal blood pressure for adults is typically around 120/80 mmHg, although this can vary slightly depending on age, sex, and other factors. High blood pressure (hypertension) is generally considered to be a reading of 130/80 mmHg or higher, while low blood pressure (hypotension) is usually defined as a reading below 90/60 mmHg. It's important to note that blood pressure can fluctuate throughout the day and may be affected by factors such as stress, physical activity, and medication use.

F344 is a strain code used to designate an outbred stock of rats that has been inbreeded for over 100 generations. The F344 rats, also known as Fischer 344 rats, were originally developed at the National Institutes of Health (NIH) and are now widely used in biomedical research due to their consistent and reliable genetic background.

Inbred strains, like the F344, are created by mating genetically identical individuals (siblings or parents and offspring) for many generations until a state of complete homozygosity is reached, meaning that all members of the strain have identical genomes. This genetic uniformity makes inbred strains ideal for use in studies where consistent and reproducible results are important.

F344 rats are known for their longevity, with a median lifespan of around 27-31 months, making them useful for aging research. They also have a relatively low incidence of spontaneous tumors compared to other rat strains. However, they may be more susceptible to certain types of cancer and other diseases due to their inbred status.

It's important to note that while F344 rats are often used as a standard laboratory rat strain, there can still be some genetic variation between individual animals within the same strain, particularly if they come from different suppliers or breeding colonies. Therefore, it's always important to consider the source and history of any animal model when designing experiments and interpreting results.

I couldn't find a medical definition specifically for "Diabetes Mellitus, Experimental." However, I can provide you with information about experimental diabetes research and its relevance to understanding the disease.

Experimental diabetes models are used in biomedical research to study the pathophysiology of diabetes mellitus and to test potential therapies or treatments. These models can be broadly categorized into two types: chemically-induced and genetically modified.

1. Chemically-induced diabetes models: These involve administering chemicals, such as alloxan or streptozotocin, to animals (commonly mice or rats) to destroy their pancreatic β-cells, which produce insulin. This results in hyperglycemia and symptoms similar to those seen in type 1 diabetes in humans.
2. Genetically modified diabetes models: These involve altering the genes of animals (commonly mice) to create a diabetes phenotype. Examples include non-obese diabetic (NOD) mice, which develop an autoimmune form of diabetes similar to human type 1 diabetes, and various strains of obese mice with insulin resistance, such as ob/ob or db/db mice, which model aspects of type 2 diabetes.

These experimental models help researchers better understand the mechanisms behind diabetes development and progression, identify new therapeutic targets, and test potential treatments before moving on to human clinical trials. However, it's essential to recognize that these models may not fully replicate all aspects of human diabetes, so findings from animal studies should be interpreted with caution.

Pregnancy is a physiological state or condition where a fertilized egg (zygote) successfully implants and grows in the uterus of a woman, leading to the development of an embryo and finally a fetus. This process typically spans approximately 40 weeks, divided into three trimesters, and culminates in childbirth. Throughout this period, numerous hormonal and physical changes occur to support the growing offspring, including uterine enlargement, breast development, and various maternal adaptations to ensure the fetus's optimal growth and well-being.

"Motor activity" is a general term used in the field of medicine and neuroscience to refer to any kind of physical movement or action that is generated by the body's motor system. The motor system includes the brain, spinal cord, nerves, and muscles that work together to produce movements such as walking, talking, reaching for an object, or even subtle actions like moving your eyes.

Motor activity can be voluntary, meaning it is initiated intentionally by the individual, or involuntary, meaning it is triggered automatically by the nervous system without conscious control. Examples of voluntary motor activity include deliberately lifting your arm or kicking a ball, while examples of involuntary motor activity include heartbeat, digestion, and reflex actions like jerking your hand away from a hot stove.

Abnormalities in motor activity can be a sign of neurological or muscular disorders, such as Parkinson's disease, cerebral palsy, or multiple sclerosis. Assessment of motor activity is often used in the diagnosis and treatment of these conditions.

"Newborn animals" refers to the very young offspring of animals that have recently been born. In medical terminology, newborns are often referred to as "neonates," and they are classified as such from birth until about 28 days of age. During this time period, newborn animals are particularly vulnerable and require close monitoring and care to ensure their survival and healthy development.

The specific needs of newborn animals can vary widely depending on the species, but generally, they require warmth, nutrition, hydration, and protection from harm. In many cases, newborns are unable to regulate their own body temperature or feed themselves, so they rely heavily on their mothers for care and support.

In medical settings, newborn animals may be examined and treated by veterinarians to ensure that they are healthy and receiving the care they need. This can include providing medical interventions such as feeding tubes, antibiotics, or other treatments as needed to address any health issues that arise. Overall, the care and support of newborn animals is an important aspect of animal medicine and conservation efforts.

'Mammary neoplasms, experimental' is not a recognized medical term. However, I can provide definitions for the individual terms:

1. Mammary: Pertaining to the breast or mammary glands in females, which are responsible for milk production.
2. Neoplasms: Abnormal growths of tissue, also known as tumors or masses, that can be benign (non-cancerous) or malignant (cancerous).
3. Experimental: Relating to a scientific experiment or study, typically conducted in a controlled setting to test hypotheses and gather data.

In the context of medical research, 'experimental mammary neoplasms' may refer to artificially induced breast tumors in laboratory animals (such as rats or mice) for the purpose of studying the development, progression, treatment, and prevention of breast cancer. These studies can help researchers better understand the biology of breast cancer and develop new therapies and strategies for its diagnosis and management.

Genetically modified animals (GMAs) are those whose genetic makeup has been altered using biotechnological techniques. This is typically done by introducing one or more genes from another species into the animal's genome, resulting in a new trait or characteristic that does not naturally occur in that species. The introduced gene is often referred to as a transgene.

The process of creating GMAs involves several steps:

1. Isolation: The desired gene is isolated from the DNA of another organism.
2. Transfer: The isolated gene is transferred into the target animal's cells, usually using a vector such as a virus or bacterium.
3. Integration: The transgene integrates into the animal's chromosome, becoming a permanent part of its genetic makeup.
4. Selection: The modified cells are allowed to multiply, and those that contain the transgene are selected for further growth and development.
5. Breeding: The genetically modified individuals are bred to produce offspring that carry the desired trait.

GMAs have various applications in research, agriculture, and medicine. In research, they can serve as models for studying human diseases or testing new therapies. In agriculture, GMAs can be developed to exhibit enhanced growth rates, improved disease resistance, or increased nutritional value. In medicine, GMAs may be used to produce pharmaceuticals or other therapeutic agents within their bodies.

Examples of genetically modified animals include mice with added genes for specific proteins that make them useful models for studying human diseases, goats that produce a human protein in their milk to treat hemophilia, and pigs with enhanced resistance to certain viruses that could potentially be used as organ donors for humans.

It is important to note that the use of genetically modified animals raises ethical concerns related to animal welfare, environmental impact, and potential risks to human health. These issues must be carefully considered and addressed when developing and implementing GMA technologies.

Testosterone is a steroid hormone that belongs to androsten class of hormones. It is primarily secreted by the Leydig cells in the testes of males and, to a lesser extent, by the ovaries and adrenal glands in females. Testosterone is the main male sex hormone and anabolic steroid. It plays a key role in the development of masculine characteristics, such as body hair and muscle mass, and contributes to bone density, fat distribution, red cell production, and sex drive. In females, testosterone contributes to sexual desire and bone health. Testosterone is synthesized from cholesterol and its production is regulated by luteinizing hormone (LH) and follicle-stimulating hormone (FSH).

Oral administration is a route of giving medications or other substances by mouth. This can be in the form of tablets, capsules, liquids, pastes, or other forms that can be swallowed. Once ingested, the substance is absorbed through the gastrointestinal tract and enters the bloodstream to reach its intended target site in the body. Oral administration is a common and convenient route of medication delivery, but it may not be appropriate for all substances or in certain situations, such as when rapid onset of action is required or when the patient has difficulty swallowing.

Ovariectomy is a surgical procedure in which one or both ovaries are removed. It is also known as "ovary removal" or "oophorectomy." This procedure is often performed as a treatment for various medical conditions, including ovarian cancer, endometriosis, uterine fibroids, and pelvic pain. Ovariectomy can also be part of a larger surgical procedure called an hysterectomy, in which the uterus is also removed.

In some cases, an ovariectomy may be performed as a preventative measure for individuals at high risk of developing ovarian cancer. This is known as a prophylactic ovariectomy. After an ovariectomy, a person will no longer have menstrual periods and will be unable to become pregnant naturally. Hormone replacement therapy may be recommended in some cases to help manage symptoms associated with the loss of hormones produced by the ovaries.

The brain is the central organ of the nervous system, responsible for receiving and processing sensory information, regulating vital functions, and controlling behavior, movement, and cognition. It is divided into several distinct regions, each with specific functions:

1. Cerebrum: The largest part of the brain, responsible for higher cognitive functions such as thinking, learning, memory, language, and perception. It is divided into two hemispheres, each controlling the opposite side of the body.
2. Cerebellum: Located at the back of the brain, it is responsible for coordinating muscle movements, maintaining balance, and fine-tuning motor skills.
3. Brainstem: Connects the cerebrum and cerebellum to the spinal cord, controlling vital functions such as breathing, heart rate, and blood pressure. It also serves as a relay center for sensory information and motor commands between the brain and the rest of the body.
4. Diencephalon: A region that includes the thalamus (a major sensory relay station) and hypothalamus (regulates hormones, temperature, hunger, thirst, and sleep).
5. Limbic system: A group of structures involved in emotional processing, memory formation, and motivation, including the hippocampus, amygdala, and cingulate gyrus.

The brain is composed of billions of interconnected neurons that communicate through electrical and chemical signals. It is protected by the skull and surrounded by three layers of membranes called meninges, as well as cerebrospinal fluid that provides cushioning and nutrients.

A high-fat diet is a type of eating plan that derives a significant proportion of its daily caloric intake from fat sources. While there is no universally agreed-upon definition for what constitutes a high-fat diet, it generally refers to diets in which total fat intake provides more than 30-35% of the total daily calories.

High-fat diets can vary widely in their specific composition and may include different types of fats, such as saturated, monounsaturated, polyunsaturated, and trans fats. Some high-fat diets emphasize the consumption of whole, unprocessed foods that are naturally high in fat, like nuts, seeds, avocados, fish, and olive oil. Others may allow for or even encourage the inclusion of processed and high-fat animal products, such as red meat, butter, and full-fat dairy.

It's important to note that not all high-fat diets are created equal, and some may be more healthful than others depending on their specific composition and the individual's overall dietary patterns. Some research suggests that high-fat diets that are low in carbohydrates and moderate in protein may offer health benefits for weight loss, blood sugar control, and cardiovascular risk factors, while other studies have raised concerns about the potential negative effects of high-fat diets on heart health and metabolic function.

As with any dietary approach, it's important to consult with a healthcare provider or registered dietitian before making significant changes to your eating habits, especially if you have any underlying medical conditions or are taking medications that may be affected by dietary changes.

The medical definition of "eating" refers to the process of consuming and ingesting food or nutrients into the body. This process typically involves several steps, including:

1. Food preparation: This may involve cleaning, chopping, cooking, or combining ingredients to make them ready for consumption.
2. Ingestion: The act of taking food or nutrients into the mouth and swallowing it.
3. Digestion: Once food is ingested, it travels down the esophagus and enters the stomach, where it is broken down by enzymes and acids to facilitate absorption of nutrients.
4. Absorption: Nutrients are absorbed through the walls of the small intestine and transported to cells throughout the body for use as energy or building blocks for growth and repair.
5. Elimination: Undigested food and waste products are eliminated from the body through the large intestine (colon) and rectum.

Eating is an essential function that provides the body with the nutrients it needs to maintain health, grow, and repair itself. Disorders of eating, such as anorexia nervosa or bulimia nervosa, can have serious consequences for physical and mental health.

Antioxidants are substances that can prevent or slow damage to cells caused by free radicals, which are unstable molecules that the body produces as a reaction to environmental and other pressures. Antioxidants are able to neutralize free radicals by donating an electron to them, thus stabilizing them and preventing them from causing further damage to the cells.

Antioxidants can be found in a variety of foods, including fruits, vegetables, nuts, and grains. Some common antioxidants include vitamins C and E, beta-carotene, and selenium. Antioxidants are also available as dietary supplements.

In addition to their role in protecting cells from damage, antioxidants have been studied for their potential to prevent or treat a number of health conditions, including cancer, heart disease, and age-related macular degeneration. However, more research is needed to fully understand the potential benefits and risks of using antioxidant supplements.

Maze learning is not a medical term per se, but it is a concept that is often used in the field of neuroscience and psychology. It refers to the process by which an animal or human learns to navigate through a complex environment, such as a maze, in order to find its way to a goal or target.

Maze learning involves several cognitive processes, including spatial memory, learning, and problem-solving. As animals or humans navigate through the maze, they encode information about the location of the goal and the various landmarks within the environment. This information is then used to form a cognitive map that allows them to navigate more efficiently in subsequent trials.

Maze learning has been widely used as a tool for studying learning and memory processes in both animals and humans. For example, researchers may use maze learning tasks to investigate the effects of brain damage or disease on cognitive function, or to evaluate the efficacy of various drugs or interventions for improving cognitive performance.

Aging is a complex, progressive and inevitable process of bodily changes over time, characterized by the accumulation of cellular damage and degenerative changes that eventually lead to increased vulnerability to disease and death. It involves various biological, genetic, environmental, and lifestyle factors that contribute to the decline in physical and mental functions. The medical field studies aging through the discipline of gerontology, which aims to understand the underlying mechanisms of aging and develop interventions to promote healthy aging and extend the human healthspan.

Streptozocin is an antibiotic and antineoplastic agent, which is primarily used in the treatment of metastatic pancreatic islet cell carcinoma (a type of pancreatic cancer). It is a naturally occurring compound produced by the bacterium Streptomyces achromogenes.

Medically, streptozocin is classified as an alkylating agent due to its ability to interact with DNA and RNA, disrupting the growth and multiplication of malignant cells. However, it can also have adverse effects on non-cancerous cells, particularly in the kidneys and pancreas, leading to potential side effects such as nephrotoxicity (kidney damage) and hyperglycemia (high blood sugar).

It is essential that streptozocin be administered under the supervision of a healthcare professional, who can monitor its effectiveness and potential side effects. The drug is typically given through intravenous infusion, with the dosage and duration tailored to individual patient needs and treatment responses.

Anticarcinogenic agents are substances that prevent, inhibit or reduce the development of cancer. They can be natural or synthetic compounds that interfere with the process of carcinogenesis at various stages, such as initiation, promotion, and progression. Anticarcinogenic agents may work by preventing DNA damage, promoting DNA repair, reducing inflammation, inhibiting cell proliferation, inducing apoptosis (programmed cell death), or modulating immune responses.

Examples of anticarcinogenic agents include chemopreventive agents, such as nonsteroidal anti-inflammatory drugs (NSAIDs) and retinoids; phytochemicals found in fruits, vegetables, and other plant-based foods; and medications used to treat cancer, such as chemotherapy, radiation therapy, and targeted therapies.

It is important to note that while some anticarcinogenic agents have been shown to be effective in preventing or reducing the risk of certain types of cancer, they may also have potential side effects and risks. Therefore, it is essential to consult with a healthcare professional before using any anticarcinogenic agent for cancer prevention or treatment purposes.

The amygdala is an almond-shaped group of nuclei located deep within the temporal lobe of the brain, specifically in the anterior portion of the temporal lobes and near the hippocampus. It forms a key component of the limbic system and plays a crucial role in processing emotions, particularly fear and anxiety. The amygdala is involved in the integration of sensory information with emotional responses, memory formation, and decision-making processes.

In response to emotionally charged stimuli, the amygdala can modulate various physiological functions, such as heart rate, blood pressure, and stress hormone release, via its connections to the hypothalamus and brainstem. Additionally, it contributes to social behaviors, including recognizing emotional facial expressions and responding appropriately to social cues. Dysfunctions in amygdala function have been implicated in several psychiatric and neurological conditions, such as anxiety disorders, depression, post-traumatic stress disorder (PTSD), and autism spectrum disorder (ASD).

Oxidative stress is defined as an imbalance between the production of reactive oxygen species (free radicals) and the body's ability to detoxify them or repair the damage they cause. This imbalance can lead to cellular damage, oxidation of proteins, lipids, and DNA, disruption of cellular functions, and activation of inflammatory responses. Prolonged or excessive oxidative stress has been linked to various health conditions, including cancer, cardiovascular diseases, neurodegenerative disorders, and aging-related diseases.

A diet, in medical terms, refers to the planned and regular consumption of food and drinks. It is a balanced selection of nutrient-rich foods that an individual eats on a daily or periodic basis to meet their energy needs and maintain good health. A well-balanced diet typically includes a variety of fruits, vegetables, whole grains, lean proteins, and low-fat dairy products.

A diet may also be prescribed for therapeutic purposes, such as in the management of certain medical conditions like diabetes, hypertension, or obesity. In these cases, a healthcare professional may recommend specific restrictions or modifications to an individual's regular diet to help manage their condition and improve their overall health.

It is important to note that a healthy and balanced diet should be tailored to an individual's age, gender, body size, activity level, and any underlying medical conditions. Consulting with a healthcare professional, such as a registered dietitian or nutritionist, can help ensure that an individual's dietary needs are being met in a safe and effective way.

"Prenatal exposure delayed effects" refer to the adverse health outcomes or symptoms that become apparent in an individual during their development or later in life, which are caused by exposure to certain environmental factors or substances while they were still in the womb. These effects may not be immediately observable at birth and can take weeks, months, years, or even decades to manifest. They can result from maternal exposure to various agents such as infectious diseases, medications, illicit drugs, tobacco smoke, alcohol, or environmental pollutants during pregnancy. The delayed effects can impact multiple organ systems and may include physical, cognitive, behavioral, and developmental abnormalities. It is important to note that the risk and severity of these effects can depend on several factors, including the timing, duration, and intensity of the exposure, as well as the individual's genetic susceptibility.

Malondialdehyde (MDA) is a naturally occurring organic compound that is formed as a byproduct of lipid peroxidation, a process in which free radicals or reactive oxygen species react with polyunsaturated fatty acids. MDA is a highly reactive aldehyde that can modify proteins, DNA, and other biomolecules, leading to cellular damage and dysfunction. It is often used as a marker of oxidative stress in biological systems and has been implicated in the development of various diseases, including cancer, cardiovascular disease, and neurodegenerative disorders.

Renin is a medically recognized term and it is defined as:

"A protein (enzyme) that is produced and released by specialized cells (juxtaglomerular cells) in the kidney. Renin is a key component of the renin-angiotensin-aldosterone system (RAAS), which helps regulate blood pressure and fluid balance in the body.

When the kidney detects a decrease in blood pressure or a reduction in sodium levels, it releases renin into the bloodstream. Renin then acts on a protein called angiotensinogen, converting it to angiotensin I. Angiotensin-converting enzyme (ACE) subsequently converts angiotensin I to angiotensin II, which is a potent vasoconstrictor that narrows blood vessels and increases blood pressure.

Additionally, angiotensin II stimulates the adrenal glands to release aldosterone, a hormone that promotes sodium reabsorption in the kidneys and increases water retention, further raising blood pressure.

Therefore, renin plays a critical role in maintaining proper blood pressure and electrolyte balance in the body."

Chinese herbal drugs, also known as traditional Chinese medicine (TCM), refer to a system of medicine that has been practiced in China for thousands of years. It is based on the belief that the body's vital energy, called Qi, must be balanced and flowing freely for good health. TCM uses various techniques such as herbal therapy, acupuncture, dietary therapy, and exercise to restore balance and promote healing.

Chinese herbal drugs are usually prescribed in the form of teas, powders, pills, or tinctures and may contain one or a combination of herbs. The herbs used in Chinese medicine are typically derived from plants, minerals, or animal products. Some commonly used Chinese herbs include ginseng, astragalus, licorice root, and cinnamon bark.

It is important to note that the use of Chinese herbal drugs should be under the guidance of a qualified practitioner, as some herbs can interact with prescription medications or have side effects. Additionally, the quality and safety of Chinese herbal products can vary widely depending on the source and manufacturing process.

Corticosterone is a hormone produced by the adrenal gland in many animals, including humans. It is a type of glucocorticoid steroid hormone that plays an important role in the body's response to stress, immune function, metabolism, and regulation of inflammation. Corticosterone helps to regulate the balance of sodium and potassium in the body and also plays a role in the development and functioning of the nervous system. It is the primary glucocorticoid hormone in rodents, while cortisol is the primary glucocorticoid hormone in humans and other primates.

WKY (Wistar Kyoto) is not a term that refers to "rats, inbred" in a medical definition. Instead, it is a strain of laboratory rat that is widely used in biomedical research. WKY rats are an inbred strain, which means they are the result of many generations of brother-sister matings, resulting in a genetically uniform population.

WKY rats originated from the Wistar Institute in Philadelphia and were established as a normotensive control strain to contrast with other rat strains that exhibit hypertension. They have since been used in various research areas, including cardiovascular, neurological, and behavioral studies. Compared to other commonly used rat strains like the spontaneously hypertensive rat (SHR), WKY rats are known for their lower blood pressure, reduced stress response, and greater emotionality.

In summary, "WKY" is a designation for an inbred strain of laboratory rat that is often used as a control group in biomedical research due to its normotensive characteristics.

Pyrazoles are heterocyclic aromatic organic compounds that contain a six-membered ring with two nitrogen atoms at positions 1 and 2. The chemical structure of pyrazoles consists of a pair of nitrogen atoms adjacent to each other in the ring, which makes them unique from other azole heterocycles such as imidazoles or triazoles.

Pyrazoles have significant biological activities and are found in various pharmaceuticals, agrochemicals, and natural products. Some pyrazole derivatives exhibit anti-inflammatory, analgesic, antipyretic, antimicrobial, antiviral, antifungal, and anticancer properties.

In the medical field, pyrazoles are used in various drugs to treat different conditions. For example, celecoxib (Celebrex) is a selective COX-2 inhibitor used for pain relief and inflammation reduction in arthritis patients. It contains a pyrazole ring as its core structure. Similarly, febuxostat (Uloric) is a medication used to treat gout, which also has a pyrazole moiety.

Overall, pyrazoles are essential compounds with significant medical applications and potential for further development in drug discovery and design.

Neurons, also known as nerve cells or neurocytes, are specialized cells that constitute the basic unit of the nervous system. They are responsible for receiving, processing, and transmitting information and signals within the body. Neurons have three main parts: the dendrites, the cell body (soma), and the axon. The dendrites receive signals from other neurons or sensory receptors, while the axon transmits these signals to other neurons, muscles, or glands. The junction between two neurons is called a synapse, where neurotransmitters are released to transmit the signal across the gap (synaptic cleft) to the next neuron. Neurons vary in size, shape, and structure depending on their function and location within the nervous system.

Tissue distribution, in the context of pharmacology and toxicology, refers to the way that a drug or xenobiotic (a chemical substance found within an organism that is not naturally produced by or expected to be present within that organism) is distributed throughout the body's tissues after administration. It describes how much of the drug or xenobiotic can be found in various tissues and organs, and is influenced by factors such as blood flow, lipid solubility, protein binding, and the permeability of cell membranes. Understanding tissue distribution is important for predicting the potential effects of a drug or toxin on different parts of the body, and for designing drugs with improved safety and efficacy profiles.

Enzyme inhibitors are substances that bind to an enzyme and decrease its activity, preventing it from catalyzing a chemical reaction in the body. They can work by several mechanisms, including blocking the active site where the substrate binds, or binding to another site on the enzyme to change its shape and prevent substrate binding. Enzyme inhibitors are often used as drugs to treat various medical conditions, such as high blood pressure, abnormal heart rhythms, and bacterial infections. They can also be found naturally in some foods and plants, and can be used in research to understand enzyme function and regulation.

Nephrectomy is a surgical procedure in which all or part of a kidney is removed. It may be performed due to various reasons such as severe kidney damage, kidney cancer, or living donor transplantation. The type of nephrectomy depends on the reason for the surgery - a simple nephrectomy involves removing only the affected portion of the kidney, while a radical nephrectomy includes removal of the whole kidney along with its surrounding tissues like the adrenal gland and lymph nodes.

The hippocampus is a complex, curved formation in the brain that resembles a seahorse (hence its name, from the Greek word "hippos" meaning horse and "kampos" meaning sea monster). It's part of the limbic system and plays crucial roles in the formation of memories, particularly long-term ones.

This region is involved in spatial navigation and cognitive maps, allowing us to recognize locations and remember how to get to them. Additionally, it's one of the first areas affected by Alzheimer's disease, which often results in memory loss as an early symptom.

Anatomically, it consists of two main parts: the Ammon's horn (or cornu ammonis) and the dentate gyrus. These structures are made up of distinct types of neurons that contribute to different aspects of learning and memory.

SHR (Spontaneously Hypertensive Rats) are an inbred strain of rats that were originally developed through selective breeding for high blood pressure. They are widely used as a model to study hypertension and related cardiovascular diseases, as well as neurological disorders such as stroke and dementia.

Inbred strains of animals are created by mating genetically identical individuals (siblings or offspring) for many generations, resulting in a population that is highly homozygous at all genetic loci. This means that the animals within an inbred strain are essentially genetically identical to one another, which makes them useful for studying the effects of specific genes or environmental factors on disease processes.

SHR rats develop high blood pressure spontaneously, without any experimental manipulation, and show many features of human hypertension, such as increased vascular resistance, left ventricular hypertrophy, and renal dysfunction. They also exhibit a number of behavioral abnormalities, including hyperactivity, impulsivity, and cognitive deficits, which make them useful for studying the neurological consequences of hypertension and other cardiovascular diseases.

Overall, inbred SHR rats are an important tool in biomedical research, providing a valuable model for understanding the genetic and environmental factors that contribute to hypertension and related disorders.

Physiological stress is a response of the body to a demand or threat that disrupts homeostasis and activates the autonomic nervous system and hypothalamic-pituitary-adrenal (HPA) axis. This results in the release of stress hormones such as adrenaline, cortisol, and noradrenaline, which prepare the body for a "fight or flight" response. Increased heart rate, rapid breathing, heightened sensory perception, and increased alertness are some of the physiological changes that occur during this response. Chronic stress can have negative effects on various bodily functions, including the immune, cardiovascular, and nervous systems.

Angiotensin II is a potent vasoactive peptide hormone that plays a critical role in the renin-angiotensin-aldosterone system (RAAS), which is a crucial regulator of blood pressure and fluid balance in the body. It is formed from angiotensin I through the action of an enzyme called angiotensin-converting enzyme (ACE).

Angiotensin II has several physiological effects on various organs, including:

1. Vasoconstriction: Angiotensin II causes contraction of vascular smooth muscle, leading to an increase in peripheral vascular resistance and blood pressure.
2. Aldosterone release: Angiotensin II stimulates the adrenal glands to release aldosterone, a hormone that promotes sodium reabsorption and potassium excretion in the kidneys, thereby increasing water retention and blood volume.
3. Sympathetic nervous system activation: Angiotensin II activates the sympathetic nervous system, leading to increased heart rate and contractility, further contributing to an increase in blood pressure.
4. Thirst regulation: Angiotensin II stimulates the hypothalamus to increase thirst, promoting water intake and helping to maintain intravascular volume.
5. Cell growth and fibrosis: Angiotensin II has been implicated in various pathological processes, such as cell growth, proliferation, and fibrosis, which can contribute to the development of cardiovascular and renal diseases.

Angiotensin-converting enzyme inhibitors (ACEIs) and angiotensin receptor blockers (ARBs) are two classes of medications commonly used in clinical practice to target the RAAS by blocking the formation or action of angiotensin II, respectively. These drugs have been shown to be effective in managing hypertension, heart failure, and chronic kidney disease.

The testis, also known as the testicle, is a male reproductive organ that is part of the endocrine system. It is located in the scrotum, outside of the abdominal cavity. The main function of the testis is to produce sperm and testosterone, the primary male sex hormone.

The testis is composed of many tiny tubules called seminiferous tubules, where sperm are produced. These tubules are surrounded by a network of blood vessels, nerves, and supportive tissues. The sperm then travel through a series of ducts to the epididymis, where they mature and become capable of fertilization.

Testosterone is produced in the Leydig cells, which are located in the interstitial tissue between the seminiferous tubules. Testosterone plays a crucial role in the development and maintenance of male secondary sexual characteristics, such as facial hair, deep voice, and muscle mass. It also supports sperm production and sexual function.

Abnormalities in testicular function can lead to infertility, hormonal imbalances, and other health problems. Regular self-examinations and medical check-ups are recommended for early detection and treatment of any potential issues.

Hypertension is a medical term used to describe abnormally high blood pressure in the arteries, often defined as consistently having systolic blood pressure (the top number in a blood pressure reading) over 130 mmHg and/or diastolic blood pressure (the bottom number) over 80 mmHg. It is also commonly referred to as high blood pressure.

Hypertension can be classified into two types: primary or essential hypertension, which has no identifiable cause and accounts for about 95% of cases, and secondary hypertension, which is caused by underlying medical conditions such as kidney disease, hormonal disorders, or use of certain medications.

If left untreated, hypertension can lead to serious health complications such as heart attack, stroke, heart failure, and chronic kidney disease. Therefore, it is important for individuals with hypertension to manage their condition through lifestyle modifications (such as healthy diet, regular exercise, stress management) and medication if necessary, under the guidance of a healthcare professional.

The retina is the innermost, light-sensitive layer of tissue in the eye of many vertebrates and some cephalopods. It receives light that has been focused by the cornea and lens, converts it into neural signals, and sends these to the brain via the optic nerve. The retina contains several types of photoreceptor cells including rods (which handle vision in low light) and cones (which are active in bright light and are capable of color vision).

In medical terms, any pathological changes or diseases affecting the retinal structure and function can lead to visual impairment or blindness. Examples include age-related macular degeneration, diabetic retinopathy, retinal detachment, and retinitis pigmentosa among others.

A lung is a pair of spongy, elastic organs in the chest that work together to enable breathing. They are responsible for taking in oxygen and expelling carbon dioxide through the process of respiration. The left lung has two lobes, while the right lung has three lobes. The lungs are protected by the ribcage and are covered by a double-layered membrane called the pleura. The trachea divides into two bronchi, which further divide into smaller bronchioles, leading to millions of tiny air sacs called alveoli, where the exchange of gases occurs.

Weight gain is defined as an increase in body weight over time, which can be attributed to various factors such as an increase in muscle mass, fat mass, or total body water. It is typically measured in terms of pounds or kilograms and can be intentional or unintentional. Unintentional weight gain may be a cause for concern if it's significant or accompanied by other symptoms, as it could indicate an underlying medical condition such as hypothyroidism, diabetes, or heart disease.

It is important to note that while body mass index (BMI) can be used as a general guideline for weight status, it does not differentiate between muscle mass and fat mass. Therefore, an increase in muscle mass through activities like strength training could result in a higher BMI, but this may not necessarily be indicative of increased health risks associated with excess body fat.

Urea is not a medical condition but it is a medically relevant substance. Here's the definition:

Urea is a colorless, odorless solid that is the primary nitrogen-containing compound in the urine of mammals. It is a normal metabolic end product that is excreted by the kidneys and is also used as a fertilizer and in various industrial applications. Chemically, urea is a carbamide, consisting of two amino groups (NH2) joined by a carbon atom and having a hydrogen atom and a hydroxyl group (OH) attached to the carbon atom. Urea is produced in the liver as an end product of protein metabolism and is then eliminated from the body by the kidneys through urination. Abnormal levels of urea in the blood, known as uremia, can indicate impaired kidney function or other medical conditions.

Lipid peroxidation is a process in which free radicals, such as reactive oxygen species (ROS), steal electrons from lipids containing carbon-carbon double bonds, particularly polyunsaturated fatty acids (PUFAs). This results in the formation of lipid hydroperoxides, which can decompose to form a variety of compounds including reactive carbonyl compounds, aldehydes, and ketones.

Malondialdehyde (MDA) is one such compound that is commonly used as a marker for lipid peroxidation. Lipid peroxidation can cause damage to cell membranes, leading to changes in their fluidity and permeability, and can also result in the modification of proteins and DNA, contributing to cellular dysfunction and ultimately cell death. It is associated with various pathological conditions such as atherosclerosis, neurodegenerative diseases, and cancer.

'Gene expression regulation' refers to the processes that control whether, when, and where a particular gene is expressed, meaning the production of a specific protein or functional RNA encoded by that gene. This complex mechanism can be influenced by various factors such as transcription factors, chromatin remodeling, DNA methylation, non-coding RNAs, and post-transcriptional modifications, among others. Proper regulation of gene expression is crucial for normal cellular function, development, and maintaining homeostasis in living organisms. Dysregulation of gene expression can lead to various diseases, including cancer and genetic disorders.

Medical Definition:

Superoxide dismutase (SOD) is an enzyme that catalyzes the dismutation of superoxide radicals (O2-) into oxygen (O2) and hydrogen peroxide (H2O2). This essential antioxidant defense mechanism helps protect the body's cells from damage caused by reactive oxygen species (ROS), which are produced during normal metabolic processes and can lead to oxidative stress when their levels become too high.

There are three main types of superoxide dismutase found in different cellular locations:
1. Copper-zinc superoxide dismutase (CuZnSOD or SOD1) - Present mainly in the cytoplasm of cells.
2. Manganese superoxide dismutase (MnSOD or SOD2) - Located within the mitochondrial matrix.
3. Extracellular superoxide dismutase (EcSOD or SOD3) - Found in the extracellular spaces, such as blood vessels and connective tissues.

Imbalances in SOD levels or activity have been linked to various pathological conditions, including neurodegenerative diseases, cancer, and aging-related disorders.

Western blotting is a laboratory technique used in molecular biology to detect and quantify specific proteins in a mixture of many different proteins. This technique is commonly used to confirm the expression of a protein of interest, determine its size, and investigate its post-translational modifications. The name "Western" blotting distinguishes this technique from Southern blotting (for DNA) and Northern blotting (for RNA).

The Western blotting procedure involves several steps:

1. Protein extraction: The sample containing the proteins of interest is first extracted, often by breaking open cells or tissues and using a buffer to extract the proteins.
2. Separation of proteins by electrophoresis: The extracted proteins are then separated based on their size by loading them onto a polyacrylamide gel and running an electric current through the gel (a process called sodium dodecyl sulfate-polyacrylamide gel electrophoresis or SDS-PAGE). This separates the proteins according to their molecular weight, with smaller proteins migrating faster than larger ones.
3. Transfer of proteins to a membrane: After separation, the proteins are transferred from the gel onto a nitrocellulose or polyvinylidene fluoride (PVDF) membrane using an electric current in a process called blotting. This creates a replica of the protein pattern on the gel but now immobilized on the membrane for further analysis.
4. Blocking: The membrane is then blocked with a blocking agent, such as non-fat dry milk or bovine serum albumin (BSA), to prevent non-specific binding of antibodies in subsequent steps.
5. Primary antibody incubation: A primary antibody that specifically recognizes the protein of interest is added and allowed to bind to its target protein on the membrane. This step may be performed at room temperature or 4°C overnight, depending on the antibody's properties.
6. Washing: The membrane is washed with a buffer to remove unbound primary antibodies.
7. Secondary antibody incubation: A secondary antibody that recognizes the primary antibody (often coupled to an enzyme or fluorophore) is added and allowed to bind to the primary antibody. This step may involve using a horseradish peroxidase (HRP)-conjugated or alkaline phosphatase (AP)-conjugated secondary antibody, depending on the detection method used later.
8. Washing: The membrane is washed again to remove unbound secondary antibodies.
9. Detection: A detection reagent is added to visualize the protein of interest by detecting the signal generated from the enzyme-conjugated or fluorophore-conjugated secondary antibody. This can be done using chemiluminescent, colorimetric, or fluorescent methods.
10. Analysis: The resulting image is analyzed to determine the presence and quantity of the protein of interest in the sample.

Western blotting is a powerful technique for identifying and quantifying specific proteins within complex mixtures. It can be used to study protein expression, post-translational modifications, protein-protein interactions, and more. However, it requires careful optimization and validation to ensure accurate and reproducible results.

Ethanol is the medical term for pure alcohol, which is a colorless, clear, volatile, flammable liquid with a characteristic odor and burning taste. It is the type of alcohol that is found in alcoholic beverages and is produced by the fermentation of sugars by yeasts.

In the medical field, ethanol is used as an antiseptic and disinfectant, and it is also used as a solvent for various medicinal preparations. It has central nervous system depressant properties and is sometimes used as a sedative or to induce sleep. However, excessive consumption of ethanol can lead to alcohol intoxication, which can cause a range of negative health effects, including impaired judgment, coordination, and memory, as well as an increased risk of accidents, injuries, and chronic diseases such as liver disease and addiction.

"Wistar rats" are a strain of albino rats that are widely used in laboratory research. They were developed at the Wistar Institute in Philadelphia, USA, and were first introduced in 1906. Wistar rats are outbred, which means that they are genetically diverse and do not have a fixed set of genetic characteristics like inbred strains.

Wistar rats are commonly used as animal models in biomedical research because of their size, ease of handling, and relatively low cost. They are used in a wide range of research areas, including toxicology, pharmacology, nutrition, cancer, cardiovascular disease, and behavioral studies. Wistar rats are also used in safety testing of drugs, medical devices, and other products.

Wistar rats are typically larger than many other rat strains, with males weighing between 500-700 grams and females weighing between 250-350 grams. They have a lifespan of approximately 2-3 years. Wistar rats are also known for their docile and friendly nature, making them easy to handle and work with in the laboratory setting.

A brain injury is defined as damage to the brain that occurs following an external force or trauma, such as a blow to the head, a fall, or a motor vehicle accident. Brain injuries can also result from internal conditions, such as lack of oxygen or a stroke. There are two main types of brain injuries: traumatic and acquired.

Traumatic brain injury (TBI) is caused by an external force that results in the brain moving within the skull or the skull being fractured. Mild TBIs may result in temporary symptoms such as headaches, confusion, and memory loss, while severe TBIs can cause long-term complications, including physical, cognitive, and emotional impairments.

Acquired brain injury (ABI) is any injury to the brain that occurs after birth and is not hereditary, congenital, or degenerative. ABIs are often caused by medical conditions such as strokes, tumors, anoxia (lack of oxygen), or infections.

Both TBIs and ABIs can range from mild to severe and may result in a variety of physical, cognitive, and emotional symptoms that can impact a person's ability to perform daily activities and function independently. Treatment for brain injuries typically involves a multidisciplinary approach, including medical management, rehabilitation, and supportive care.

"Sex characteristics" refer to the anatomical, chromosomal, and genetic features that define males and females. These include both primary sex characteristics (such as reproductive organs like ovaries or testes) and secondary sex characteristics (such as breasts or facial hair) that typically develop during puberty. Sex characteristics are primarily determined by the presence of either X or Y chromosomes, with XX individuals usually developing as females and XY individuals usually developing as males, although variations and exceptions to this rule do occur.

Gene expression is the process by which the information encoded in a gene is used to synthesize a functional gene product, such as a protein or RNA molecule. This process involves several steps: transcription, RNA processing, and translation. During transcription, the genetic information in DNA is copied into a complementary RNA molecule, known as messenger RNA (mRNA). The mRNA then undergoes RNA processing, which includes adding a cap and tail to the mRNA and splicing out non-coding regions called introns. The resulting mature mRNA is then translated into a protein on ribosomes in the cytoplasm through the process of translation.

The regulation of gene expression is a complex and highly controlled process that allows cells to respond to changes in their environment, such as growth factors, hormones, and stress signals. This regulation can occur at various stages of gene expression, including transcriptional activation or repression, RNA processing, mRNA stability, and translation. Dysregulation of gene expression has been implicated in many diseases, including cancer, genetic disorders, and neurological conditions.

Cocaine is a highly addictive stimulant drug derived from the leaves of the coca plant (Erythroxylon coca). It is a powerful central nervous system stimulant that affects the brain and body in many ways. When used recreationally, cocaine can produce feelings of euphoria, increased energy, and mental alertness; however, it can also cause serious negative consequences, including addiction, cardiovascular problems, seizures, and death.

Cocaine works by increasing the levels of dopamine in the brain, a neurotransmitter associated with pleasure and reward. This leads to the pleasurable effects that users seek when they take the drug. However, cocaine also interferes with the normal functioning of the brain's reward system, making it difficult for users to experience pleasure from natural rewards like food or social interactions.

Cocaine can be taken in several forms, including powdered form (which is usually snorted), freebase (a purer form that is often smoked), and crack cocaine (a solid form that is typically heated and smoked). Each form of cocaine has different risks and potential harms associated with its use.

Long-term use of cocaine can lead to a number of negative health consequences, including addiction, heart problems, malnutrition, respiratory issues, and mental health disorders like depression or anxiety. It is important to seek help if you or someone you know is struggling with cocaine use or addiction.

Wound healing is a complex and dynamic process that occurs after tissue injury, aiming to restore the integrity and functionality of the damaged tissue. It involves a series of overlapping phases: hemostasis, inflammation, proliferation, and remodeling.

1. Hemostasis: This initial phase begins immediately after injury and involves the activation of the coagulation cascade to form a clot, which stabilizes the wound and prevents excessive blood loss.
2. Inflammation: Activated inflammatory cells, such as neutrophils and monocytes/macrophages, infiltrate the wound site to eliminate pathogens, remove debris, and release growth factors that promote healing. This phase typically lasts for 2-5 days post-injury.
3. Proliferation: In this phase, various cell types, including fibroblasts, endothelial cells, and keratinocytes, proliferate and migrate to the wound site to synthesize extracellular matrix (ECM) components, form new blood vessels (angiogenesis), and re-epithelialize the wounded area. This phase can last up to several weeks depending on the size and severity of the wound.
4. Remodeling: The final phase of wound healing involves the maturation and realignment of collagen fibers, leading to the restoration of tensile strength in the healed tissue. This process can continue for months to years after injury, although the tissue may never fully regain its original structure and function.

It is important to note that wound healing can be compromised by several factors, including age, nutrition, comorbidities (e.g., diabetes, vascular disease), and infection, which can result in delayed healing or non-healing chronic wounds.

Nitric oxide (NO) is a molecule made up of one nitrogen atom and one oxygen atom. In the body, it is a crucial signaling molecule involved in various physiological processes such as vasodilation, immune response, neurotransmission, and inhibition of platelet aggregation. It is produced naturally by the enzyme nitric oxide synthase (NOS) from the amino acid L-arginine. Inhaled nitric oxide is used medically to treat pulmonary hypertension in newborns and adults, as it helps to relax and widen blood vessels, improving oxygenation and blood flow.

Blood glucose, also known as blood sugar, is the concentration of glucose in the blood. Glucose is a simple sugar that serves as the main source of energy for the body's cells. It is carried to each cell through the bloodstream and is absorbed into the cells with the help of insulin, a hormone produced by the pancreas.

The normal range for blood glucose levels in humans is typically between 70 and 130 milligrams per deciliter (mg/dL) when fasting, and less than 180 mg/dL after meals. Levels that are consistently higher than this may indicate diabetes or other metabolic disorders.

Blood glucose levels can be measured through a variety of methods, including fingerstick blood tests, continuous glucose monitoring systems, and laboratory tests. Regular monitoring of blood glucose levels is important for people with diabetes to help manage their condition and prevent complications.

"Cells, cultured" is a medical term that refers to cells that have been removed from an organism and grown in controlled laboratory conditions outside of the body. This process is called cell culture and it allows scientists to study cells in a more controlled and accessible environment than they would have inside the body. Cultured cells can be derived from a variety of sources, including tissues, organs, or fluids from humans, animals, or cell lines that have been previously established in the laboratory.

Cell culture involves several steps, including isolation of the cells from the tissue, purification and characterization of the cells, and maintenance of the cells in appropriate growth conditions. The cells are typically grown in specialized media that contain nutrients, growth factors, and other components necessary for their survival and proliferation. Cultured cells can be used for a variety of purposes, including basic research, drug development and testing, and production of biological products such as vaccines and gene therapies.

It is important to note that cultured cells may behave differently than they do in the body, and results obtained from cell culture studies may not always translate directly to human physiology or disease. Therefore, it is essential to validate findings from cell culture experiments using additional models and ultimately in clinical trials involving human subjects.

Reperfusion injury is a complex pathophysiological process that occurs when blood flow is restored to previously ischemic tissues, leading to further tissue damage. This phenomenon can occur in various clinical settings such as myocardial infarction (heart attack), stroke, or peripheral artery disease after an intervention aimed at restoring perfusion.

The restoration of blood flow leads to the generation of reactive oxygen species (ROS) and inflammatory mediators, which can cause oxidative stress, cellular damage, and activation of the immune system. This results in a cascade of events that may lead to microvascular dysfunction, capillary leakage, and tissue edema, further exacerbating the injury.

Reperfusion injury is an important consideration in the management of ischemic events, as interventions aimed at restoring blood flow must be carefully balanced with potential harm from reperfusion injury. Strategies to mitigate reperfusion injury include ischemic preconditioning (exposing the tissue to short periods of ischemia before a prolonged ischemic event), ischemic postconditioning (applying brief periods of ischemia and reperfusion after restoring blood flow), remote ischemic preconditioning (ischemia applied to a distant organ or tissue to protect the target organ), and pharmacological interventions that scavenge ROS, reduce inflammation, or improve microvascular function.

Dietary fats, also known as fatty acids, are a major nutrient that the body needs for energy and various functions. They are an essential component of cell membranes and hormones, and they help the body absorb certain vitamins. There are several types of dietary fats:

1. Saturated fats: These are typically solid at room temperature and are found in animal products such as meat, butter, and cheese, as well as tropical oils like coconut and palm oil. Consuming a high amount of saturated fats can raise levels of unhealthy LDL cholesterol and increase the risk of heart disease.
2. Unsaturated fats: These are typically liquid at room temperature and can be further divided into monounsaturated and polyunsaturated fats. Monounsaturated fats, found in foods such as olive oil, avocados, and nuts, can help lower levels of unhealthy LDL cholesterol while maintaining levels of healthy HDL cholesterol. Polyunsaturated fats, found in foods such as fatty fish, flaxseeds, and walnuts, have similar effects on cholesterol levels and also provide essential omega-3 and omega-6 fatty acids that the body cannot produce on its own.
3. Trans fats: These are unsaturated fats that have been chemically modified to be solid at room temperature. They are often found in processed foods such as baked goods, fried foods, and snack foods. Consuming trans fats can raise levels of unhealthy LDL cholesterol and lower levels of healthy HDL cholesterol, increasing the risk of heart disease.

It is recommended to limit intake of saturated and trans fats and to consume more unsaturated fats as part of a healthy diet.

Apoptosis is a programmed and controlled cell death process that occurs in multicellular organisms. It is a natural process that helps maintain tissue homeostasis by eliminating damaged, infected, or unwanted cells. During apoptosis, the cell undergoes a series of morphological changes, including cell shrinkage, chromatin condensation, and fragmentation into membrane-bound vesicles called apoptotic bodies. These bodies are then recognized and engulfed by neighboring cells or phagocytic cells, preventing an inflammatory response. Apoptosis is regulated by a complex network of intracellular signaling pathways that involve proteins such as caspases, Bcl-2 family members, and inhibitors of apoptosis (IAPs).

The myocardium is the middle layer of the heart wall, composed of specialized cardiac muscle cells that are responsible for pumping blood throughout the body. It forms the thickest part of the heart wall and is divided into two sections: the left ventricle, which pumps oxygenated blood to the rest of the body, and the right ventricle, which pumps deoxygenated blood to the lungs.

The myocardium contains several types of cells, including cardiac muscle fibers, connective tissue, nerves, and blood vessels. The muscle fibers are arranged in a highly organized pattern that allows them to contract in a coordinated manner, generating the force necessary to pump blood through the heart and circulatory system.

Damage to the myocardium can occur due to various factors such as ischemia (reduced blood flow), infection, inflammation, or genetic disorders. This damage can lead to several cardiac conditions, including heart failure, arrhythmias, and cardiomyopathy.

Estradiol is a type of estrogen, which is a female sex hormone. It is the most potent and dominant form of estrogen in humans. Estradiol plays a crucial role in the development and maintenance of secondary sexual characteristics in women, such as breast development and regulation of the menstrual cycle. It also helps maintain bone density, protect the lining of the uterus, and is involved in cognition and mood regulation.

Estradiol is produced primarily by the ovaries, but it can also be synthesized in smaller amounts by the adrenal glands and fat cells. In men, estradiol is produced from testosterone through a process called aromatization. Abnormal levels of estradiol can contribute to various health issues, such as hormonal imbalances, infertility, osteoporosis, and certain types of cancer.

A biological marker, often referred to as a biomarker, is a measurable indicator that reflects the presence or severity of a disease state, or a response to a therapeutic intervention. Biomarkers can be found in various materials such as blood, tissues, or bodily fluids, and they can take many forms, including molecular, histologic, radiographic, or physiological measurements.

In the context of medical research and clinical practice, biomarkers are used for a variety of purposes, such as:

1. Diagnosis: Biomarkers can help diagnose a disease by indicating the presence or absence of a particular condition. For example, prostate-specific antigen (PSA) is a biomarker used to detect prostate cancer.
2. Monitoring: Biomarkers can be used to monitor the progression or regression of a disease over time. For instance, hemoglobin A1c (HbA1c) levels are monitored in diabetes patients to assess long-term blood glucose control.
3. Predicting: Biomarkers can help predict the likelihood of developing a particular disease or the risk of a negative outcome. For example, the presence of certain genetic mutations can indicate an increased risk for breast cancer.
4. Response to treatment: Biomarkers can be used to evaluate the effectiveness of a specific treatment by measuring changes in the biomarker levels before and after the intervention. This is particularly useful in personalized medicine, where treatments are tailored to individual patients based on their unique biomarker profiles.

It's important to note that for a biomarker to be considered clinically valid and useful, it must undergo rigorous validation through well-designed studies, including demonstrating sensitivity, specificity, reproducibility, and clinical relevance.

Insulin is a hormone produced by the beta cells of the pancreatic islets, primarily in response to elevated levels of glucose in the circulating blood. It plays a crucial role in regulating blood glucose levels and facilitating the uptake and utilization of glucose by peripheral tissues, such as muscle and adipose tissue, for energy production and storage. Insulin also inhibits glucose production in the liver and promotes the storage of excess glucose as glycogen or triglycerides.

Deficiency in insulin secretion or action leads to impaired glucose regulation and can result in conditions such as diabetes mellitus, characterized by chronic hyperglycemia and associated complications. Exogenous insulin is used as a replacement therapy in individuals with diabetes to help manage their blood glucose levels and prevent long-term complications.

Annonaceae is a family of flowering plants, also known as custard apple family. It includes several genera and species of tropical trees and shrubs that are native to the Americas, Africa, Asia, and Australia. The plants in this family are characterized by their large, often fragrant flowers and fleshy fruits. Some of the commercially important crops in this family include cherimoya, soursop, custard apple, and pawpaw. Many species of Annonaceae have also been studied for their potential medicinal properties, including the presence of alkaloids with anticancer and anti-malarial activities.

The spinal cord is a major part of the nervous system, extending from the brainstem and continuing down to the lower back. It is a slender, tubular bundle of nerve fibers (axons) and support cells (glial cells) that carries signals between the brain and the rest of the body. The spinal cord primarily serves as a conduit for motor information, which travels from the brain to the muscles, and sensory information, which travels from the body to the brain. It also contains neurons that can independently process and respond to information within the spinal cord without direct input from the brain.

The spinal cord is protected by the bony vertebral column (spine) and is divided into 31 segments: 8 cervical, 12 thoracic, 5 lumbar, 5 sacral, and 1 coccygeal. Each segment corresponds to a specific region of the body and gives rise to pairs of spinal nerves that exit through the intervertebral foramina at each level.

The spinal cord is responsible for several vital functions, including:

1. Reflexes: Simple reflex actions, such as the withdrawal reflex when touching a hot surface, are mediated by the spinal cord without involving the brain.
2. Muscle control: The spinal cord carries motor signals from the brain to the muscles, enabling voluntary movement and muscle tone regulation.
3. Sensory perception: The spinal cord transmits sensory information, such as touch, temperature, pain, and vibration, from the body to the brain for processing and awareness.
4. Autonomic functions: The sympathetic and parasympathetic divisions of the autonomic nervous system originate in the thoracolumbar and sacral regions of the spinal cord, respectively, controlling involuntary physiological responses like heart rate, blood pressure, digestion, and respiration.

Damage to the spinal cord can result in various degrees of paralysis or loss of sensation below the level of injury, depending on the severity and location of the damage.

Reference values, also known as reference ranges or reference intervals, are the set of values that are considered normal or typical for a particular population or group of people. These values are often used in laboratory tests to help interpret test results and determine whether a patient's value falls within the expected range.

The process of establishing reference values typically involves measuring a particular biomarker or parameter in a large, healthy population and then calculating the mean and standard deviation of the measurements. Based on these statistics, a range is established that includes a certain percentage of the population (often 95%) and excludes extreme outliers.

It's important to note that reference values can vary depending on factors such as age, sex, race, and other demographic characteristics. Therefore, it's essential to use reference values that are specific to the relevant population when interpreting laboratory test results. Additionally, reference values may change over time due to advances in measurement technology or changes in the population being studied.

Up-regulation is a term used in molecular biology and medicine to describe an increase in the expression or activity of a gene, protein, or receptor in response to a stimulus. This can occur through various mechanisms such as increased transcription, translation, or reduced degradation of the molecule. Up-regulation can have important functional consequences, for example, enhancing the sensitivity or response of a cell to a hormone, neurotransmitter, or drug. It is a normal physiological process that can also be induced by disease or pharmacological interventions.

Estrogens are a group of steroid hormones that are primarily responsible for the development and regulation of female sexual characteristics and reproductive functions. They are also present in lower levels in males. The main estrogen hormone is estradiol, which plays a key role in promoting the growth and development of the female reproductive system, including the uterus, fallopian tubes, and breasts. Estrogens also help regulate the menstrual cycle, maintain bone density, and have important effects on the cardiovascular system, skin, hair, and cognitive function.

Estrogens are produced primarily by the ovaries in women, but they can also be produced in smaller amounts by the adrenal glands and fat cells. In men, estrogens are produced from the conversion of testosterone, the primary male sex hormone, through a process called aromatization.

Estrogen levels vary throughout a woman's life, with higher levels during reproductive years and lower levels after menopause. Estrogen therapy is sometimes used to treat symptoms of menopause, such as hot flashes and vaginal dryness, or to prevent osteoporosis in postmenopausal women. However, estrogen therapy also carries risks, including an increased risk of certain cancers, blood clots, and stroke, so it is typically recommended only for women who have a high risk of these conditions.

Signal transduction is the process by which a cell converts an extracellular signal, such as a hormone or neurotransmitter, into an intracellular response. This involves a series of molecular events that transmit the signal from the cell surface to the interior of the cell, ultimately resulting in changes in gene expression, protein activity, or metabolism.

The process typically begins with the binding of the extracellular signal to a receptor located on the cell membrane. This binding event activates the receptor, which then triggers a cascade of intracellular signaling molecules, such as second messengers, protein kinases, and ion channels. These molecules amplify and propagate the signal, ultimately leading to the activation or inhibition of specific cellular responses.

Signal transduction pathways are highly regulated and can be modulated by various factors, including other signaling molecules, post-translational modifications, and feedback mechanisms. Dysregulation of these pathways has been implicated in a variety of diseases, including cancer, diabetes, and neurological disorders.

Nitric Oxide Synthase (NOS) is a group of enzymes that catalyze the production of nitric oxide (NO) from L-arginine. There are three distinct isoforms of NOS, each with different expression patterns and functions:

1. Neuronal Nitric Oxide Synthase (nNOS or NOS1): This isoform is primarily expressed in the nervous system and plays a role in neurotransmission, synaptic plasticity, and learning and memory processes.
2. Inducible Nitric Oxide Synthase (iNOS or NOS2): This isoform is induced by various stimuli such as cytokines, lipopolysaccharides, and hypoxia in a variety of cells including immune cells, endothelial cells, and smooth muscle cells. iNOS produces large amounts of NO, which functions as a potent effector molecule in the immune response, particularly in the defense against microbial pathogens.
3. Endothelial Nitric Oxide Synthase (eNOS or NOS3): This isoform is constitutively expressed in endothelial cells and produces low levels of NO that play a crucial role in maintaining vascular homeostasis by regulating vasodilation, inhibiting platelet aggregation, and preventing smooth muscle cell proliferation.

Overall, NOS plays an essential role in various physiological processes, including neurotransmission, immune response, cardiovascular function, and respiratory regulation. Dysregulation of NOS activity has been implicated in several pathological conditions such as hypertension, atherosclerosis, neurodegenerative diseases, and inflammatory disorders.

Adipose tissue, also known as fatty tissue, is a type of connective tissue that is composed mainly of adipocytes (fat cells). It is found throughout the body, but is particularly abundant in the abdominal cavity, beneath the skin, and around organs such as the heart and kidneys.

Adipose tissue serves several important functions in the body. One of its primary roles is to store energy in the form of fat, which can be mobilized and used as an energy source during periods of fasting or exercise. Adipose tissue also provides insulation and cushioning for the body, and produces hormones that help regulate metabolism, appetite, and reproductive function.

There are two main types of adipose tissue: white adipose tissue (WAT) and brown adipose tissue (BAT). WAT is the more common form and is responsible for storing energy as fat. BAT, on the other hand, contains a higher number of mitochondria and is involved in heat production and energy expenditure.

Excessive accumulation of adipose tissue can lead to obesity, which is associated with an increased risk of various health problems such as diabetes, heart disease, and certain types of cancer.

"Age factors" refer to the effects, changes, or differences that age can have on various aspects of health, disease, and medical care. These factors can encompass a wide range of issues, including:

1. Physiological changes: As people age, their bodies undergo numerous physical changes that can affect how they respond to medications, illnesses, and medical procedures. For example, older adults may be more sensitive to certain drugs or have weaker immune systems, making them more susceptible to infections.
2. Chronic conditions: Age is a significant risk factor for many chronic diseases, such as heart disease, diabetes, cancer, and arthritis. As a result, age-related medical issues are common and can impact treatment decisions and outcomes.
3. Cognitive decline: Aging can also lead to cognitive changes, including memory loss and decreased decision-making abilities. These changes can affect a person's ability to understand and comply with medical instructions, leading to potential complications in their care.
4. Functional limitations: Older adults may experience physical limitations that impact their mobility, strength, and balance, increasing the risk of falls and other injuries. These limitations can also make it more challenging for them to perform daily activities, such as bathing, dressing, or cooking.
5. Social determinants: Age-related factors, such as social isolation, poverty, and lack of access to transportation, can impact a person's ability to obtain necessary medical care and affect their overall health outcomes.

Understanding age factors is critical for healthcare providers to deliver high-quality, patient-centered care that addresses the unique needs and challenges of older adults. By taking these factors into account, healthcare providers can develop personalized treatment plans that consider a person's age, physical condition, cognitive abilities, and social circumstances.

Glucose is a simple monosaccharide (or single sugar) that serves as the primary source of energy for living organisms. It's a fundamental molecule in biology, often referred to as "dextrose" or "grape sugar." Glucose has the molecular formula C6H12O6 and is vital to the functioning of cells, especially those in the brain and nervous system.

In the body, glucose is derived from the digestion of carbohydrates in food, and it's transported around the body via the bloodstream to cells where it can be used for energy. Cells convert glucose into a usable form through a process called cellular respiration, which involves a series of metabolic reactions that generate adenosine triphosphate (ATP)—the main currency of energy in cells.

Glucose is also stored in the liver and muscles as glycogen, a polysaccharide (multiple sugar) that can be broken down back into glucose when needed for energy between meals or during physical activity. Maintaining appropriate blood glucose levels is crucial for overall health, and imbalances can lead to conditions such as diabetes mellitus.

Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) is a laboratory technique used in molecular biology to amplify and detect specific DNA sequences. This technique is particularly useful for the detection and quantification of RNA viruses, as well as for the analysis of gene expression.

The process involves two main steps: reverse transcription and polymerase chain reaction (PCR). In the first step, reverse transcriptase enzyme is used to convert RNA into complementary DNA (cDNA) by reading the template provided by the RNA molecule. This cDNA then serves as a template for the PCR amplification step.

In the second step, the PCR reaction uses two primers that flank the target DNA sequence and a thermostable polymerase enzyme to repeatedly copy the targeted cDNA sequence. The reaction mixture is heated and cooled in cycles, allowing the primers to anneal to the template, and the polymerase to extend the new strand. This results in exponential amplification of the target DNA sequence, making it possible to detect even small amounts of RNA or cDNA.

RT-PCR is a sensitive and specific technique that has many applications in medical research and diagnostics, including the detection of viruses such as HIV, hepatitis C virus, and SARS-CoV-2 (the virus that causes COVID-19). It can also be used to study gene expression, identify genetic mutations, and diagnose genetic disorders.

Obesity is a complex disease characterized by an excess accumulation of body fat to the extent that it negatively impacts health. It's typically defined using Body Mass Index (BMI), a measure calculated from a person's weight and height. A BMI of 30 or higher is indicative of obesity. However, it's important to note that while BMI can be a useful tool for identifying obesity in populations, it does not directly measure body fat and may not accurately reflect health status in individuals. Other factors such as waist circumference, blood pressure, cholesterol levels, and blood sugar levels should also be considered when assessing health risks associated with weight.

A smooth muscle within the vascular system refers to the involuntary, innervated muscle that is found in the walls of blood vessels. These muscles are responsible for controlling the diameter of the blood vessels, which in turn regulates blood flow and blood pressure. They are called "smooth" muscles because their individual muscle cells do not have the striations, or cross-striped patterns, that are observed in skeletal and cardiac muscle cells. Smooth muscle in the vascular system is controlled by the autonomic nervous system and by hormones, and can contract or relax slowly over a period of time.

Tumor Necrosis Factor-alpha (TNF-α) is a cytokine, a type of small signaling protein involved in immune response and inflammation. It is primarily produced by activated macrophages, although other cell types such as T-cells, natural killer cells, and mast cells can also produce it.

TNF-α plays a crucial role in the body's defense against infection and tissue injury by mediating inflammatory responses, activating immune cells, and inducing apoptosis (programmed cell death) in certain types of cells. It does this by binding to its receptors, TNFR1 and TNFR2, which are found on the surface of many cell types.

In addition to its role in the immune response, TNF-α has been implicated in the pathogenesis of several diseases, including autoimmune disorders such as rheumatoid arthritis, inflammatory bowel disease, and psoriasis, as well as cancer, where it can promote tumor growth and metastasis.

Therapeutic agents that target TNF-α, such as infliximab, adalimumab, and etanercept, have been developed to treat these conditions. However, these drugs can also increase the risk of infections and other side effects, so their use must be carefully monitored.

Cell proliferation is the process by which cells increase in number, typically through the process of cell division. In the context of biology and medicine, it refers to the reproduction of cells that makes up living tissue, allowing growth, maintenance, and repair. It involves several stages including the transition from a phase of quiescence (G0 phase) to an active phase (G1 phase), DNA replication in the S phase, and mitosis or M phase, where the cell divides into two daughter cells.

Abnormal or uncontrolled cell proliferation is a characteristic feature of many diseases, including cancer, where deregulated cell cycle control leads to excessive and unregulated growth of cells, forming tumors that can invade surrounding tissues and metastasize to distant sites in the body.

Phosphorylation is the process of adding a phosphate group (a molecule consisting of one phosphorus atom and four oxygen atoms) to a protein or other organic molecule, which is usually done by enzymes called kinases. This post-translational modification can change the function, localization, or activity of the target molecule, playing a crucial role in various cellular processes such as signal transduction, metabolism, and regulation of gene expression. Phosphorylation is reversible, and the removal of the phosphate group is facilitated by enzymes called phosphatases.

The colon, also known as the large intestine, is a part of the digestive system in humans and other vertebrates. It is an organ that eliminates waste from the body and is located between the small intestine and the rectum. The main function of the colon is to absorb water and electrolytes from digested food, forming and storing feces until they are eliminated through the anus.

The colon is divided into several regions, including the cecum, ascending colon, transverse colon, descending colon, sigmoid colon, rectum, and anus. The walls of the colon contain a layer of muscle that helps to move waste material through the organ by a process called peristalsis.

The inner surface of the colon is lined with mucous membrane, which secretes mucus to lubricate the passage of feces. The colon also contains a large population of bacteria, known as the gut microbiota, which play an important role in digestion and immunity.

Sprague Dawley, the trademark used by Envigo) is not. The average litter size of the Sprague Dawley rat is 11.0. These rats ... This breed of rat was first produced by the Sprague Dawley farms (later to become the Sprague Dawley Animal Company) in Madison ... Shorn rats were bred from Sprague Dawley rats in Connecticut in 1998. They also suffer from severe kidney problems. The Lewis ... Most are derived from the albino Wistar rat, which is still widely used. Other common strains are the Sprague Dawley, Fischer ...
... in Sprague Dawley rats". Pharmacognosy Research. 5 (2): 113-7. doi:10.4103/0974-8490.110541. PMC 3685759. PMID 23798886. Ali, ...
The study used 100 male and 100 female Sprague Dawley rats, divided into twenty groups with 10 rats each. Ten diets were tested ... if the survival of the rats is less than 50% at 104 weeks (which is likely for Sprague-Dawley rats) the recommended number of ... Sprague-Dawley rats have a lifespan of about two years and have a high risk of cancer over their lifespan (one study concluded ... Suzuki, H; Mohr, U; Kimmerle, G (1979). "Spontaneous endocrine tumors in Sprague-Dawley rats". Journal of Cancer Research and ...
Suzuki H, Mohr U, Kimmerle G (October 1979). "Spontaneous endocrine tumors in Sprague-Dawley rats". Journal of Cancer Research ... Criticisms included insufficient statistical power and that Séralini's Sprague-Dawley rats were inappropriate for a lifetime ... "Sprague Dawley" (PDF). Harlan. Archived from the original (PDF) on September 29, 2013. Retrieved October 26, 2012. Butler D ( ... "Mortality and In-Life Patterns in Sprague-Dawley" (PDF). Huntingdon Life Sciences. Archived from the original (PDF) on October ...
Sprague-Dawley rats (lab rats) were tested on. The oral median lethal dose in male lab rats was determined to be 23.58 mL/kg ... The median lethal dose in the female lab rats was found to be 19.52 mL/kg BW (15.64 mL/kg BW lower, 24.35 mL/kg BW upper). The ... Charlie ration or "C-Rats" was the name for the field meal then given to troops.) This cookbook came wrapped around a two-ounce ...
"Developmental toxicity evaluation of butylparaben in Sprague-Dawley rats". Birth Defects Research Part B: Developmental and ...
Wan J, Ernstgård L, Song B, Shoaf S (2006). "Chlorzoxazone metabolism is increased in fasted Sprague-Dawley rats". J Pharm ... Dong DL, Luan Y, Feng TM, Fan CL, Yue P, Sun ZJ, Gu RM, Yang BF (2006). "Chlorzoxazone inhibit contraction of rat thoracic ...
King C, Kendrick F (1962). "Teratogenic effects of thalidomide in the Sprague Dawley rat". The Lancet. 280 (7265): 409-17. doi: ... Similar results were also published showing these effects in rats and other species. Lynette Rowe, who was born without limbs, ... McColl JD, Globus M, Robinson S (1965). "Effect of some therapeutic agents on the developing rat fetus". Toxicology and Applied ...
Liu, T.Y.; Chen, C.C.; Chen, C.L.; Chi, C.W. (1999). "Safrole-induced Oxidative Damage in the Liver of Sprague-Dawley Rats". ... "Safrole-induced Oxidative Damage in the Liver of Sprague-Dawley Rats". Food and Chemical Toxicology. 37 (7): 697-702. doi: ... hydroxysafrole in rats. Further metabolites of safrole that have been found in urine of both rats and humans include 1,2- ... In rats, safrole and related compounds produced both benign and malignant tumors after intake through the mouth. Changes in the ...
"Acute oral toxicity studies of Swietenia macrophylla seeds in Sprague Dawley rats". Pharmacognosy Research. 7 (1): 38-44. doi: ...
"Pharmacokinetics of ketamine and xylazine in young and old Sprague-Dawley rats". Journal of the American Association for ... In young rats the half life is one hour. Xylazine has a large volume of distribution (Vd). The Vd = 1.9-2.5 for horses, cattle ... in rat and human urine using GC-MS, LC-MSn, and LC-HR-MSn". Analytical and Bioanalytical Chemistry. 405 (30): 9779-9789. doi: ... which is used in rats, mice, hamsters, and guinea pigs. Xylazine is widely used in veterinary medicine as a sedative, muscle ...
"Developmental toxicity of mangafodipir trisodium and manganese chloride in Sprague-Dawley rats". Teratology. 52 (2): 109-115. ... "Alteration of iron homeostasis following chronic exposure to manganese in rats". Brain Research. 833 (1): 125-132. doi:10.1016/ ...
For example, in one experiment, male Sprague-Dawley rats were given either a low fat or a high fat diet, with the high fat diet ... "Selective breeding for diet-induced obesity and resistance in Sprague-Dawley rats". American Journal of Physiology. 273. " ... Rats have also been used in the diet-induced obesity model. Commonly used in medical research, rats were specifically chosen to ... The results of the study illustrate that the high fat diet rats had a higher adiposity index than the low fat diet rats. Dogs ...
"Developmental toxicity of mangafodipir trisodium and manganese chloride in Sprague-Dawley rats". Teratology. 52 (2): 109-115. ... Furthermore, young rats who were choline-deficient performed as poorly on memory tasks as older rats while older rats that were ... VAD rats had more trouble learning a Radial arm maze than rats who had normal levels of the vitamin. The healthy rats were able ... while rats who had choline-enriched diets showed a diminished memory loss compared to both the choline-low diet and control rat ...
Babin, Michael (1997). "The uptake and distribution of diethyltoluenediamine in the male sprague dawley rat". Louisiana State ...
"In vivo mammary tumourigenesis in the Sprague-Dawley rat and microdosimetric correlates". Physics in Medicine and Biology. 49 ( ... Relative biological effectiveness factors comparing gamma rays to HZE ions were measured in mice or rats for tumors of the skin ... "The Low Carcinogenicity of Electron Radiation Relative to Argon Ions in Rat Skin". Radiation Research. 135 (2): 178-188. ...
Laham, S; Potvin M (1987). "Biological conversion of benzaldehyde to benzylmercapturic acid in the Sprague-Dawley rat". Drug ... Studies in rats have shown that p-cresol is primarily conjugated with glucuronide to produce p-cresylglucuronide, though this ...
"Acrylonitrile-induced oxidative stress and oxidative DNA damage in male Sprague-Dawley rats". Toxicol. Sci. 111 (1): 64-71. doi ... Using rat studies, withdrawal after repeated exposure to nicotine results in less responsive nucleus accumbens cells, which ... "Imaging localised dynamic changes in the nucleus accumbens following nicotine withdrawal in rats". NeuroImage. 22 (2): 847-854 ...
"Acrylonitrile-induced oxidative stress and oxidative DNA damage in male Sprague-Dawley rats". Toxicol. Sci. 111 (1): 64-71. doi ...
Acrylonitrile-induced oxidative stress and oxidative DNA damage in male Sprague-Dawley rats. Toxicol Sci. 2009;111(1):64-71. ...
"Acrylonitrile-induced oxidative stress and oxidative DNA damage in male Sprague-Dawley rats". Toxicol. Sci. 111 (1): 64-71. doi ...
... -induced oxidative stress and oxidative DNA damage in male Sprague-Dawley rats. Toxicol Sci. 2009;111(1):64-71. ... Acrylonitrile increases cancer in high dose tests in male and female rats and mice and induces apoptosis in human umbilical ... Routes of exposure include inhalation, oral, and to a certain extent dermal uptake (tested with volunteer humans and in rat ... Acrylonitrile is moderately toxic with LD50 = 81 mg/kg (rats). It undergoes explosive polymerization. The burning material ...
... in male Sprague-Dawley rats". Journal of Toxicology and Environmental Health, Part A. 64 (8): 645-60. doi:10.1080/ ...
"Acrylonitrile-induced oxidative stress and oxidative DNA damage in male Sprague-Dawley rats". Toxicological Sciences. 111 (1): ...
Acrylonitrile-induced oxidative stress and oxidative DNA damage in male Sprague-Dawley rats. Toxicol Sci. 2009 Sep;111(1):64-71 ... especially in rats' blood cells. Comet assays are one of the most common tests for genotoxicity. The technique involves lysing ...
In Sprague Dawley rats, atomoxetine reduces NR2B protein content without altering transcript levels. Aberrant glutamate and ... In addition to rats, atomoxetine has also been found to induce similar region-specific catecholamine level alteration in mice. ... In rats, atomoxetine increased prefrontal cortex catecholamine concentrations without altering dopamine levels in the striatum ... However, both mouse and rat microdialysis studies have failed to find an increase in extracellular serotonin in the prefrontal ...
"Urinary tract effects of phensuximide in the Sprague-Dawley and Fischer 344 rat". J Appl Toxicol. 6 (5): 349-56. doi:10.1002/ ...
... is a species of oral Streptococcus bacteria first isolated from Sprague-Dawley rats, hence its name. ... "A new species of oral Streptococcus isolated from Sprague--Dawley rats, Streptococcus orisratti sp. nov". International Journal ...
"Subchronic toxicity study of eastern black nightshade (Solanum ptychanthum) berries in Sprague-Dawley rats." Journal of Food ... A. Davis, K. Renner, C. Sprague, L. Dyer, D. Mutch (2005). Integrated Weed Management. MSU. (Articles containing Ancient Greek ...
"Phospholipid metabolism in livers of young and old fisher 344 and Sprague-Dawley rats". Experimental Gerontology. 16 (2): 163- ... These conclusions are based on the models that were used during these studies as these effects were caused in rats instead of ... During the studies it was also concluded that mice are more resilient to MCT than rats, meaning that more mice survived the ... MCA and retronecine are then condensed to form MCT via an unknown mechanism: MCT is detoxified in rats by the liver via ...
... International Journal of Cancer Research ... The Role of Phaseolus vulgaris in DMBA-Induced Sprague-Dawley Rat Mammary Carcinomas table, th, td { border: 0px solid #ececec ... A total of 72 female rats 50 days old were divided in three groups and hold in constant conditions temperature, light and ...
In the first, male rats { Rattus nonvgicus , Sprague Dawley strain) with enriched (EC) or impoverished ( IC) experience ( ... EC rats escaped significantly more quickly than IC rats, and a composite .score derived from pre-challenge behavior in the ... EC rats escaped significantly more quickly than IC rats. In an analysis of the combined results from the two experiments, both ... In the first, male rats { Rattus nonvgicus , Sprague Dawley strain) with enriched (EC) or impoverished ( IC) experience ( ...
Rats, Sprague-Dawley * Reverse Transcriptase Polymerase Chain Reaction * Signal Transduction * Time Factors ... Materials and methods: We analysed LCN2 expression in livers of rats subjected to bile duct ligation or repeated doses of ... Results: By using primary cultures of hepatic stellate cells and hepatocytes isolated from normal and injured rat livers, we ...
other: Sprague-Dawley rat. Type of coverage:. semiocclusive. Vehicle:. other: Sterile Codex liquid paraffin. Duration of ... The test substance was not acutely toxic to Sprague-Dawley rats (LD50 , 2000 mg/kg, dermally) in an OECD 402 and EU B.3 test ... other: Albino rat. Vehicle:. corn oil. Sex:. male/female. Dose descriptor:. LD50. Effect level:. >= 5 000 mg/kg bw. Mortality: ... The test substance was not acutely toxic to Crl CDBR rats (LD50 > 5000 mg/kg) in a EU B.1 test conducted under GLP. The test ...
Adult male Sprague-Dawley rats (n=163; 200-220 g; 8-10-weeks-old) were purchased from the Experimental Animal Center of ... Rats in the naïve group received neither surgery nor ligation. Each group contains 6 rats. Rats in the CCI group exhibiting no ... Rats were assigned to sham, CCI, CCI + DMSO, and CCI + ML221 groups, respectively. A single intrathecal injection of ML221 (10 ... Sham-operated rats underwent the same surgery, but without ligation. Following the surgery, muscle and skin tissue was sutured ...
Sprague Dawley, the trademark used by Envigo) is not. The average litter size of the Sprague Dawley rat is 11.0. These rats ... This breed of rat was first produced by the Sprague Dawley farms (later to become the Sprague Dawley Animal Company) in Madison ... Shorn rats were bred from Sprague Dawley rats in Connecticut in 1998. They also suffer from severe kidney problems. The Lewis ... Most are derived from the albino Wistar rat, which is still widely used. Other common strains are the Sprague Dawley, Fischer ...
Sprague-Dawley rats (lungs) 2/501 208/501 IFA Seoul, Korea Wistar rats (lungs) 1/480 165/480 IFA ... Other isolations: laboratory rat, 1 Japan (25); laboratory rat tumor, 1 Japan (26); Rattus nitidus 1 China (27); Bandicota ... It has not been established that the bandicoot rat isolate is identical to other rat isolates or to Hantaan virus. ... Clinically severe and moderate hospitalized cases in Seoul City where only urban rats were found. The patients have never been ...
Sprague-Dawley rats for 40 weeks. The safety of IP6 has also been confirmed in human studies. Researchers at Harvard Medical ... Compared to untreated rats, animals on IP6 had 27% fewer tumors and the tumors were approximately two-thirds smaller in size. ... DMBA). Rats were fed a diet containing, 5%, 10% or 20% Kelloggs All Bran; another group received 0.4% IP6 in drinking water ... However, rats fed 0.4% IP6 in drinking water had a whopping 33.5% reduction in tumor incidence and nearly 50% fewer tumors. ...
Sprague Dawley F0 weaning rats (30 per sex per group) were exposed to furan orally at 0, 1, 2.5, 5, and 10 mg kg-1 for 10 weeks ... Effects of endocrine disruptor furan on reproductive physiology of Sprague Dawley rats: An F1 Extended One-Generation ... Effects of endocrine disruptor furan on reproductive physiology of Sprague Dawley rats: An ... Ratos Sprague-Dawley; Testículo/efeitos dos fármacos; Testículo/patologia; Testosterona/sangue; Testes de Toxicidade Crônica ...
Twelve male Sprague-Dawley rats (weight range, 250-280 g) were used for this study. Bipolar electrical-stimulation electrodes ... Supplemental Video 1 shows an example of this BCI-guided rat navigation. In the directions indicated by the arrows, the rat in ... To our knowledge, this was the first PET imaging study on BCI-based stimulation in a rat model with electrodes implanted in the ... This study aimed to use PET mapping for BCI-based stimulation in a rat model with electrodes implanted in the ventroposterior ...
Transcript Profiling in the Testes and Prostates of Postnatal Day 30 Sprague-Dawley Rats Exposed Prenatally and Lactationally ... Maternal and Lactational Exposure to 2-Hydroxy-4-Methoxybenzone on Development and Reproductive Organs in Male and Female Rat ...
2.1 Fructose-induced hypertensive rats. Male Sprague-Dawley (SD) rats (240-280 g) were provided by the Experimental Animal ... G) Summary data show that the baseline blood pressure is higher in fructose-fed rats than that in vehicle-treated rats. (H,I) ... E) The baseline firing rate of NTS neurons in fructose-fed rats was lower than that in vehicle-treated rats. (F) L-arginine ... Fructose-fed rats had a significantly higher systolic blood pressure and plasma glucose levels than the vehicle-treated rats ( ...
1990] Embryofetal effects of pentamidine isethionate administered to pregnant Sprague-Dawley rats. Am J Obstet Gynecol. 163(3): ...
Lifetime carcinogenicity studies were conducted in ICR mice, Sprague-Dawley (SD) rats and F344 rats. Aripiprazole was ... Animal reproduction studies were conducted with aripiprazole in rats and rabbits during organogenesis, and in rats during the ... and most of the drug effects in juvenile rats were also observed in adult rats from previously conducted studies. ... Female rats were treated with oral doses of 2 mg/kg/day, 6 mg/kg/day, and 20 mg/kg/day (0.6 times, 2 times, and 6 times the ...
Joint toxicity of a multi-heavy metal mixture and chemoprevention in Sprague Dawley rats. ... Male Sprague Dawley (SD) rats (n = 30) were treated orally once a week for six months with 500mg/kg.bw of eight heavy metals ... The Morris water maze test was used to evaluate spatial learning and memory in the treated rats. Then the rats were ... Sprague Dawley rats ...
A descriptive, prospective, experimental and comparative study of some 20 white Sprague-Dawley rats was performed from may to ... They were divided into 2 groups: study, 10 rats with autologous cartilage wrapped with fascia, and control, 10 rats with ...
... diindolylmethane in sprague-dawley rats.. Toxicol Sci. 74(1):10-21. ... Tumors from rats given 1,2-dimethylhydrazine plus chlorophyllin or indole-3-carbinol contain transcriptional changes in beta- ...
The pathophysiology of ACPO has been studied in Sprague-Dawley male rats. [18] Partial colonic obstruction was created by ... The sham control rats underwent the same procedure with immediate removal of the ring at the completion of the procedure. ... Accumulation of stool pellets created the partial colonic pseudo-obstruction in rats with silicon rings. ... placing a medical-grade silicon ring that was 3 mm wide and 1-2 mm longer than the outer circumference of the rat colon. ...
Rats, Rats, Sprague-Dawley, Journal Article, Research Support, Non-U.S. Govt. in European Journal of Neuroscience. volume. 38 ... Rats; Rats, Sprague-Dawley; Journal Article; Research Support, Non-U.S. Govt}}, language = {{eng}}, number = {{1}}, pages = {{ ... Myelin loss and oligodendrocyte pathology in white matter tracts following traumatic brain injury in the rat. *Mark ... Myelin loss and oligodendrocyte pathology in white matter tracts following traumatic brain injury in the rat}}, url = {{http:// ...
A probiotic strain of L. acidophilus reduces DMH-induced large intestinal tumors in male Sprague-Dawley rats. Nutr Cancer 1999; ... The effect of Lactobacillus GG on the initiation and promotion of DMH-induced intestinal tumors in the rat. Nutr Cancer 1996;25 ... The effects of Lactobacillus strains and oat fiber on methotrexate-induced enterocolitis in rats. Gastroenterology 1996;111:334 ...
Conclusion: In Sprague-Dawley rats maternal toxicity (reduced food consumption and reduced body weight gain) and a decrease in ... 2007; not available for OECD SIDS 2006) 25 pregnant Sprague-Dawley rats per dose were gavaged once daily with 0, 430, 1290, ... No effects on female gonads were observed in the 90 day gavage study on rats at doses up to 5000 mg/kg bw/day (see section ... However, the body weight of male rats was significantly reduced in this dose group. The absolute testes weight was not altered ...
We divided Sprague-Dawley (SD) rats into three groups: the sham group, IR group and IR + HFMSCs group. A small intestinal IR ... Healthy male Sprague-Dawley (SD) rats, weighing 180-200 grams, were used to establish the model used in this experiment. The ... IR: Ischaemia-reperfusion; MSCs: Mesenchymal stem cells; HFMSCs: Hair follicle mesenchymal stem cells; SD: Sprague-Dawley; SMA ... Rats in the IR+HFMSCs group were subjected to intestinal IR via operation, and the same volume of a suspension containing 1×106 ...
Pregnant Sprague Dawley (SD) rat and ICR mice were purchased from Hyochang Science (Daegu, South Korea) and used for primary ... Primary cultured rat hippocampal neurons were subjected to transfection at either 9 or 48 hr after plating. The neurons were ... Primary cultures of hippocampal neurons were established by isolating E18 SD rat embryo or E15 ICR mouse embryo hippocampal ... responsible to both human NDEL1 and mouse and rat Ndel1, and hTARA shRNA were GCAGGTCTCAGTGTTAGAA and GCTGACAGATTCAAGTCTCAA, ...
METHODS Animals Man Sprague-Dawley rats weighing 300-330 g had been found in all tests. In all research pets received humane ...
METHODS: Twenty-four Sprague-Dawley rats were divided into four groups, with six rats in each group. To induce the collagen- ... CAC extract (100 mg/kg) was orally administered to rats. The anti-RA effects were evaluated in CIA rats by arthritis score, ... METHODS: We initially validated the in vivo efficacy of TCG in alleviating OA using a rat OA model. Subsequently, we isolated ... RESULTS: CAC extract was found to obviously down-regulate hind paw volume of CIA rats, with diminished inflammation response ...
  • 1990] Embryofetal effects of pentamidine isethionate administered to pregnant Sprague-Dawley rats. (cdc.gov)
  • not available for OECD SIDS 2006) 25 pregnant Sprague-Dawley rats per dose were gavaged once daily with 0, 430, 1290, 3870 mg/kg bw at gestation day (GD) 5 -19. (europa.eu)
  • In the first, male rats { Rattus nonvgicus , Sprague Dawley strain) with enriched (EC) or impoverished ( IC) experience ( leading to differences in exploratory behavior documented previously) were given an opportunity to explore an arena with a hidden escape route on two consecutive days. (escholarship.org)
  • Laboratory rats or lab rats are strains of the subspecies Rattus norvegicus domestica which are bred and kept for scientific research. (wikipedia.org)
  • In 18th-century Europe, wild brown rats (Rattus norvegicus) ran rampant and this infestation fueled the industry of rat-catching. (wikipedia.org)
  • Over time, breeding the rats for these contests may have produced variations in color, notably the albino and hooded varieties. (wikipedia.org)
  • Genetic analysis of 117 albino rat strains collected from all parts of the world carried out by a team led by Takashi Kuramoto at Kyoto University in 2012 showed that the albinos descended from hooded rats and all the albinos descended from a single ancestor. (wikipedia.org)
  • As there is evidence that the hooded rat was known as the "Japanese rat" in the early 20th century, Kuramoto concluded that one or more Japanese hooded rats might have been brought to Europe or the Americas and an albino rat that emerged as a product of the breeding of these hooded rats was the common ancestor of all the albino laboratory rats in use today. (wikipedia.org)
  • Most are derived from the albino Wistar rat, which is still widely used. (wikipedia.org)
  • Other common strains are the Sprague Dawley, Fischer 344, Holtzman albino strains, Long-Evans, and Lister black hooded rats. (wikipedia.org)
  • 1992. Effect of tricresyl phosphate on humoral and cell-mediated immune responses in albino rats. (cdc.gov)
  • meats, biological trials were conducted on Albino rats of the Sprague-Dawley albino rats. (who.int)
  • Effects of endocrine disruptor furan on reproductive physiology of Sprague Dawley rats: An F1 Extended One-Generation Reproductive Toxicity Study (EOGRTS). (bvsalud.org)
  • The present study investigated the reproductive toxicity of furan in an Extended One-Generation Reproductive Toxicity Study in rats . (bvsalud.org)
  • In a prenatal developmental toxicity study conducted in accordance with OECD guideline 414 (adopted 1981) pregnant Wistar rats (n = 24 per group) received, in a limit test, a dose of 0 or 1000 mg/kg bw/day by gavage on gestation days 6 to 15. (europa.eu)
  • In this developmental toxicity study pregnant Wistar rats (n = 25 per group) received 0, 100, 400, or 1000 mg/kg bw/day by gavage also on gestation days (GD) 6 to 15 and dams were sacrificed on GD 20. (europa.eu)
  • The reproductive function of rats was studied at the Institute for Experimental Biology at the University of California, Berkeley by Herbert McLean Evans and Joseph A. Long. (wikipedia.org)
  • Effect of astragaloside IV on the general and peripartum reproductive toxicity in Sprague-Dawley rats. (bvsalud.org)
  • Conclusion for both studies on Wistar rats: The NOAEL for maternal toxicity and developmental toxicity is 400 mg/kg bw/day, the LOAEL is 1000 mg/kg bw/day (reduced body weight in dams and increased skeletal variations in offspring). (europa.eu)
  • In two gavage studies (OECD guideline 414) on the prenatal developmental toxicity in Wistar rats, the NOAEL for maternal and developmental toxicity was 400 mg/kg bw/day. (europa.eu)
  • METHODS Animals Man Sprague-Dawley rats weighing 300-330 g had been found in all tests. (immune-source.com)
  • Methods: An acute rat liver injury model induced by D-galactosamine was used. (bvsalud.org)
  • Clinically severe and moderate hospitalized cases in Seoul City where only urban rats were found. (cdc.gov)
  • We have isolated a genetically similar by eating undercooked meat from domestic pigs, wild boar, HEV from urban rats in Los Angeles, California, USA, and several species of wild deer has been documented ( 6 , 7 ). (cdc.gov)
  • It has not been established that the bandicoot rat isolate is identical to other rat isolates or to Hantaan virus. (cdc.gov)
  • Sixty one plants reputed to have anti-fertility activity were tested on female Sprague-Dawley rats, in order to isolate active compounds with a potential for use in human fertility regulation. (who.int)
  • A 1972 study compared neoplasms in Sprague Dawleys from six different commercial suppliers and found highly significant differences in the incidences of endocrine and mammary tumors. (wikipedia.org)
  • There were even significant variations in the incidences of adrenal medulla tumors among rats from the same source raised in different laboratories. (wikipedia.org)
  • All but one of the testicular tumors occurred in the rats from a single supplier. (wikipedia.org)
  • 2006. Tumors from rats given 1,2-dimethylhydrazine plus chlorophyllin or indole-3-carbinol contain transcriptional changes in beta-catenin that are independent of beta-catenin mutation status. . (oregonstate.edu)
  • Conclusion: In Sprague-Dawley rats maternal toxicity (reduced food consumption and reduced body weight gain) and a decrease in fetal weights were found at a dose level of 3870 mg/kg bw/day, the NOAEL for maternal and developmental toxicity was 1290 mg/kg bw/day. (europa.eu)
  • While less commonly used for research than laboratory mice, rats have served as an important animal model for research in psychology and biomedical science. (wikipedia.org)
  • Over the next 30 years, rats were used for several more experiments and eventually the laboratory rat became the first animal domesticated for purely scientific reasons. (wikipedia.org)
  • Laboratory rats are frequently subject to dissection or microdialysis to study internal effects on organs and the brain, such as for cancer or pharmacological research. (wikipedia.org)
  • Laboratory rats not sacrificed may be euthanized or, in some cases, become pets. (wikipedia.org)
  • In October 2003, researchers succeeded in cloning two laboratory rats by nuclear transfer. (wikipedia.org)
  • and characterized its ability to infect laboratory rats and However, many, if not most, persons who have unexplained nonhuman primates. (cdc.gov)
  • HEV in Rats, Los Angeles, California, USA genomic sequence or to transmit an agent to laboratory Table 1. (cdc.gov)
  • We analysed LCN2 expression in livers of rats subjected to bile duct ligation or repeated doses of carbon tetrachloride and tested the impact of various pro-inflammatory cytokines in cultured primary liver cells. (nih.gov)
  • Then the rats were anesthetized by pentobarbital sodium (40 mg/kg.bw) to obtain blood samples for biochemical analysis and organs (heart, liver, spleen, lungs, kidneys, brain, testis) to be conducted for biopsy and organ coefficients. (cdc.gov)
  • Absorption, distribution, excretion, and metabolism of a single oral dose of [`"Cl tri-ortho-cresyl phosphate (TOCP) in the male rat. (cdc.gov)
  • No effects on female gonads were observed in the 90 day gavage study on rats at doses up to 5000 mg/kg bw/day (see section repeated dose toxicity). (europa.eu)
  • However, the body weight of male rats was significantly reduced in this dose group. (europa.eu)
  • It was demonstrated, using immunoblotting, that intrathecal ML221 downregulated phosphorylated extracellular signal‑related kinase (ERK) in the rat spinal cord dorsal horn, suggesting that the effect of apelin on neuropathic pain may be mediated via ERK signaling. (spandidos-publications.com)
  • The MC-PαLA-MP NPs exhibited high biocompatibility and released 81% MC and 54% MP within 24 h under TSCI-like conditions, effectively reducing 40% of pro-inflammatory cytokine release both in cultures and injured rat spinal cord tissues. (dovepress.com)
  • EC rats escaped significantly more quickly than IC rats, and a composite .score derived from pre-challenge behavior in the arena was correlated significantly with escape time under challenge. (escholarship.org)
  • Many investigators who wish to trace observations on behavior and physiology to underlying genes regard aspects of these in rats as more relevant to humans and easier to observe than in mice, giving impetus to the development of genetic research techniques applicable to rats. (wikipedia.org)
  • Because these veterans were exposed to a combination of chemicals including pyridostigmine bromide (PB), DEET, and permethrin, we investigated the effects of these agents, alone and in combination, on the sensorimotor behavior and central cholinergic system of rats. (duke.edu)
  • This study aimed to use PET mapping for BCI-based stimulation in a rat model with electrodes implanted in the ventroposterior medial (VPM) nucleus of the thalamus. (snmjournals.org)
  • A descriptive, prospective, experimental and comparative study of some 20 white Sprague-Dawley rats was performed from may to october 2007. (isciii.es)
  • They were divided into 2 groups: study, 10 rats with autologous cartilage wrapped with fascia, and control, 10 rats with cartilage only. (isciii.es)
  • The purpose of this study was to explore the effect of autologous bone marrow stem cell mobilization induced by intranasal administration of granulocyte-macrophage colony stimulating factor (GM-CSF) for TBI in rats. (uwi.edu)
  • The genetics of rats was studied by William Ernest Castle at the Bussey Institute of Harvard University until it closed in 1994. (wikipedia.org)
  • At postnatal day (PND) 70, a significant (p = 0.03) decrease in testosterone levels of male rats and estrogen levels of female rats (p = 0.05) was observed in 10 mg kg-1 furan-treated group in F1 generation. (bvsalud.org)
  • To explore the joint toxicity and bio-accumulation of multi-heavy metals and potential chemoprevention strategies, Male Sprague Dawley (SD) rats (n = 30) were treated orally once a week for six months with 500mg/kg.bw of eight heavy metals which were commonly identified in aquatic products in the Ningbo area including chromium, manganese , nickel, copper, zinc, cadmium, mercury, and lead. (cdc.gov)
  • Male Sprague-Dawley rats (200-250 gm) were treated with DEET (40 mg/kg, dermal) or permethrin (0.13 mg/kg, dermal), alone and in combination with PB (1.3 mg/kg, oral, last 15 days only), for 45 days. (duke.edu)
  • Adult Sprague-Dawley (SD) rats were assigned to three groups: control group (TBI only), TBI+GM-CSF subcutaneous injection and TBI+GM-CSF intranasally. (uwi.edu)
  • After sacrifice, compared with the control, rats treated with GM-CSF subcutaneous injection and GM-CSF intranasally, significantly increased expressions of Brdu/GFAP, BDNF, Nestin, Factor VIII, and reduced expression of apoptotis cells around the lesion site. (uwi.edu)
  • As a control, OVX rats (no ovarian E2 and no replacement) were injected with SAL or CFA. (tamu.edu)
  • 2.1-kb hGFAP promoter or a 1.5-kb rat neuron-speci®c enolase (rNSE) promoter (control vector) has been described elsewhere (Jakobsson et al. (lu.se)
  • A total of 72 female rats 50 days old were divided in three groups and hold in constant conditions temperature, light and humidity. (scialert.net)
  • By using primary cultures of hepatic stellate cells and hepatocytes isolated from normal and injured rat livers, we found a significant LCN2 expression in early hepatic stellate cell cultures, a lower expression in fully transdifferentiated myofibroblasts and no expression in freshly isolated hepatocytes. (nih.gov)
  • When monolayer cultures of rat hepatocytes are incubated with the ethanolamine/choline analogue, monomethylethanolamine, the secretion of apolipoproteins B100 and B48, as well as the lipid constituents, of very low density lipoprotein (VLDL) is inhibited by approximately 50% (Vance, J. E. (1991) J. Lipid Res. (strath.ac.uk)
  • We divided Sprague-Dawley (SD) rats into three groups: the sham group, IR group and IR + HFMSCs group. (researchsquare.com)
  • neutralizing antibody titrations indicated that infections were caused by a rat-associated virus(30). (cdc.gov)
  • Thus, it is important to understand how this rat virus is diagnosed with increasing frequency as a cause of sporadic related to human infections. (cdc.gov)
  • A genetically distinct HEV have been isolated from humans with hepatitis E, regularly was recently isolated from rats in Germany, and its genome infect pigs worldwide ( 6 ), and infection in humans caused was sequenced. (cdc.gov)
  • In Japan, there was a widespread practice of keeping rats as a domesticated pet during the Edo period and in the 18th century guidebooks on keeping domestic rats were published by Youso Tamanokakehashi (1775) and Chingan Sodategusa (1787). (wikipedia.org)
  • Domestic rats differ from wild rats (various spp. (wikipedia.org)
  • The rats were then put on stock diet for 7 from the local market and dried in a hot days prior to the experiment. (who.int)
  • We retrogradely labeled CVLM-projecting NTS neurons through the injection of FluoSpheres into the CVLM in a fructose-fed rat model to determine the cellular mechanism involved in increased sympathetic outflow. (frontiersin.org)
  • An animal model is the fructose-induced hypertensive rat with hyperglycemia, hypertriglyceridemia, insulin resistance, and moderate hypertension as a result of being fed a fructose-rich diet. (frontiersin.org)
  • Biosafety was examined using the MTT assay, cell penetration efficiency using confocal microscopy, and flow cytometry using Cyanine5 (Cy5)-labeled MC-PαLA-MP NPs, effects on injury-induced pro-inflammatory cytokine release using enzyme-linked immunosorbent assays and immunofluorescence, and treatment efficacy by measuring motor recovery in a rat model of TSCI. (dovepress.com)
  • A small intestinal IR injury rat model was established by clamping of the superior mesenteric artery (SMA) for 30 minutes and reperfusion for 2 hours. (researchsquare.com)
  • The first rat colony in America used for nutrition research was started in January 1908 by Elmer McCollum and then, nutritive requirements of rats were used by Thomas Burr Osborne and Lafayette Mendel to determine the details of protein nutrition. (wikipedia.org)
  • Results of testing for transmission of human and swine rats. (cdc.gov)
  • Rat-baiting was a popular sport, which involved filling a pit with rats and timing how long it took for a terrier to kill them all. (wikipedia.org)
  • exposed Sprague-Dawley rats by munity long before cohort-based NHL and other lymphoprolifera- gavage. (who.int)
  • The Morris water maze test was used to evaluate spatial learning and memory in the treated rats. (cdc.gov)
  • Sprague Dawley F0 weaning rats (30 per sex per group) were exposed to furan orally at 0, 1, 2.5, 5, and 10 mg kg-1 for 10 weeks ( males ) and 2 weeks ( females ) and then mated. (bvsalud.org)
  • Rat-catchers would not only make money by trapping the rodents, but also by selling them for food or, more commonly, for rat-baiting. (wikipedia.org)
  • Based on the above results, it is suggested that exposure to food -based contaminant furan induced remarkable changes in the F0 (parental stage) and F1 (offspring, pubertal, and adult stage) generations of Sprague Dawley rats . (bvsalud.org)
  • During the training, rats learn to interpret remote brain stimulation as instructions directing their trajectory of locomotion. (snmjournals.org)
  • At the end of 10 days trial, all the rats were to each diet. (who.int)
  • The rats were fed the allotted killed with an overdose of chloroform and diet ad libitum for a period of 10 days. (who.int)
  • Systemic injection increased the Basso, Beattie, Bresnahan score of TSCI rats from 2.33 ± 0.52 to 8.83 ± 1.83 in 8 weeks, providing effective neuroprotection and enhanced exercise recovery in the TSCI rats. (dovepress.com)
  • This was the first in a series of developments that have begun to make rats tractable as genetic research subjects, although they still lag behind mice, which lend themselves better to the embryonic stem cell techniques typically used for genetic manipulation. (wikipedia.org)
  • Virus was transmissible venison, raising the possibility that other animals or modes to seronegative Sprague-Dawley rats, but transmission was of zoonotic transmission exist. (cdc.gov)
  • Furthermore, fructose feeding reduces the L-arginine-induced increase in presynaptic spontaneous glutamatergic synaptic inputs to NTS neurons, while NO donor DEA/NO produces an increase in glutamatergic synaptic inputs in fructose-fed rats similar to that in vehicle-treated rats. (frontiersin.org)
  • The results suggest that the cyclic estrous cycle concentrations of E2 and P4 can influence CFA-induced TMJ nociception in the rat. (tamu.edu)