Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.DNA Methylation: Addition of methyl groups to DNA. DNA methyltransferases (DNA methylases) perform this reaction using S-ADENOSYLMETHIONINE as the methyl group donor.Genes, Reporter: Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Sp1 Transcription Factor: Promoter-specific RNA polymerase II transcription factor that binds to the GC box, one of the upstream promoter elements, in mammalian cells. The binding of Sp1 is necessary for the initiation of transcription in the promoters of a variety of cellular and viral GENES.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Transcriptional Activation: Processes that stimulate the GENETIC TRANSCRIPTION of a gene or set of genes.Transcription Initiation Site: The first nucleotide of a transcribed DNA sequence where RNA polymerase (DNA-DIRECTED RNA POLYMERASE) begins synthesizing the RNA transcript.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Regulatory Sequences, Nucleic Acid: Nucleic acid sequences involved in regulating the expression of genes.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Electrophoretic Mobility Shift Assay: An electrophoretic technique for assaying the binding of one compound to another. Typically one compound is labeled to follow its mobility during electrophoresis. If the labeled compound is bound by the other compound, then the mobility of the labeled compound through the electrophoretic medium will be retarded.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Operon: In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.Cell Line: Established cell cultures that have the potential to propagate indefinitely.DNA Footprinting: A method for determining the sequence specificity of DNA-binding proteins. DNA footprinting utilizes a DNA damaging agent (either a chemical reagent or a nuclease) which cleaves DNA at every base pair. DNA cleavage is inhibited where the ligand binds to DNA. (from Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Response Elements: Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Luciferases: Enzymes that oxidize certain LUMINESCENT AGENTS to emit light (PHYSICAL LUMINESCENCE). The luciferases from different organisms have evolved differently so have different structures and substrates.Chloramphenicol O-Acetyltransferase: An enzyme that catalyzes the acetylation of chloramphenicol to yield chloramphenicol 3-acetate. Since chloramphenicol 3-acetate does not bind to bacterial ribosomes and is not an inhibitor of peptidyltransferase, the enzyme is responsible for the naturally occurring chloramphenicol resistance in bacteria. The enzyme, for which variants are known, is found in both gram-negative and gram-positive bacteria. EC 2.3.1.28.Bacterial Proteins: Proteins found in any species of bacterium.Repressor Proteins: Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.TATA Box: A conserved A-T rich sequence which is contained in promoters for RNA polymerase II. The segment is seven base pairs long and the nucleotides most commonly found are TATAAAA.CpG Islands: Areas of increased density of the dinucleotide sequence cytosine--phosphate diester--guanine. They form stretches of DNA several hundred to several thousand base pairs long. In humans there are about 45,000 CpG islands, mostly found at the 5' ends of genes. They are unmethylated except for those on the inactive X chromosome and some associated with imprinted genes.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.5' Flanking Region: The region of DNA which borders the 5' end of a transcription unit and where a variety of regulatory sequences are located.Trans-Activators: Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.Chromatin Immunoprecipitation: A technique for identifying specific DNA sequences that are bound, in vivo, to proteins of interest. It involves formaldehyde fixation of CHROMATIN to crosslink the DNA-BINDING PROTEINS to the DNA. After shearing the DNA into small fragments, specific DNA-protein complexes are isolated by immunoprecipitation with protein-specific ANTIBODIES. Then, the DNA isolated from the complex can be identified by PCR amplification and sequencing.Deoxyribonuclease I: An enzyme capable of hydrolyzing highly polymerized DNA by splitting phosphodiester linkages, preferentially adjacent to a pyrimidine nucleotide. This catalyzes endonucleolytic cleavage of DNA yielding 5'-phosphodi- and oligonucleotide end-products. The enzyme has a preference for double-stranded DNA.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Enhancer Elements, Genetic: Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter.Genes, Bacterial: The functional hereditary units of BACTERIA.Gene Expression Regulation, Enzymologic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Sequence Deletion: Deletion of sequences of nucleic acids from the genetic material of an individual.Consensus Sequence: A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Introns: Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.Tumor Cells, Cultured: Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Genes, Regulator: Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Reverse Transcriptase Polymerase Chain Reaction: A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.Polymorphism, Genetic: The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.DNA-Directed RNA Polymerases: Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).Cell Line, Tumor: A cell line derived from cultured tumor cells.Gene Silencing: Interruption or suppression of the expression of a gene at transcriptional or translational levels.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.beta-Galactosidase: A group of enzymes that catalyzes the hydrolysis of terminal, non-reducing beta-D-galactose residues in beta-galactosides. Deficiency of beta-Galactosidase A1 may cause GANGLIOSIDOSIS, GM1.Histones: Small chromosomal proteins (approx 12-20 kD) possessing an open, unfolded structure and attached to the DNA in cell nuclei by ionic linkages. Classification into the various types (designated histone I, histone II, etc.) is based on the relative amounts of arginine and lysine in each.Chromatin: The material of CHROMOSOMES. It is a complex of DNA; HISTONES; and nonhistone proteins (CHROMOSOMAL PROTEINS, NON-HISTONE) found within the nucleus of a cell.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Epigenesis, Genetic: A genetic process by which the adult organism is realized via mechanisms that lead to the restriction in the possible fates of cells, eventually leading to their differentiated state. Mechanisms involved cause heritable changes to cells without changes to DNA sequence such as DNA METHYLATION; HISTONE modification; DNA REPLICATION TIMING; NUCLEOSOME positioning; and heterochromatization which result in selective gene expression or repression.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.Gene Expression Regulation, Neoplastic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Gene Expression Regulation, Viral: Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.Lac Operon: The genetic unit consisting of three structural genes, an operator and a regulatory gene. The regulatory gene controls the synthesis of the three structural genes: BETA-GALACTOSIDASE and beta-galactoside permease (involved with the metabolism of lactose), and beta-thiogalactoside acetyltransferase.Azacitidine: A pyrimidine analogue that inhibits DNA methyltransferase, impairing DNA methylation. It is also an antimetabolite of cytidine, incorporated primarily into RNA. Azacytidine has been used as an antineoplastic agent.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Sp3 Transcription Factor: A specificity protein transcription factor that regulates expression of a variety of genes including VASCULAR ENDOTHELIAL GROWTH FACTOR and CYCLIN-DEPENDENT KINASE INHIBITOR P27.Artificial Gene Fusion: The in vitro fusion of GENES by RECOMBINANT DNA techniques to analyze protein behavior or GENE EXPRESSION REGULATION, or to merge protein functions for specific medical or industrial uses.Models, Genetic: Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.Polymorphism, Single Nucleotide: A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.Genetic Vectors: DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.5' Untranslated Regions: The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.Single-Strand Specific DNA and RNA Endonucleases: Enzymes that catalyze the endonucleolytic cleavage of single-stranded regions of DNA or RNA molecules while leaving the double-stranded regions intact. They are particularly useful in the laboratory for producing "blunt-ended" DNA molecules from DNA with single-stranded ends and for sensitive GENETIC TECHNIQUES such as NUCLEASE PROTECTION ASSAYS that involve the detection of single-stranded DNA and RNA.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Gene Deletion: A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Cell Nucleus: Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Sigma Factor: A protein which is a subunit of RNA polymerase. It effects initiation of specific RNA chains from DNA.Organ Specificity: Characteristic restricted to a particular organ of the body, such as a cell type, metabolic response or expression of a particular protein or antigen.Acetylation: Formation of an acetyl derivative. (Stedman, 25th ed)Down-Regulation: A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.Oligodeoxyribonucleotides: A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).Methylation: Addition of methyl groups. In histo-chemistry methylation is used to esterify carboxyl groups and remove sulfate groups by treating tissue sections with hot methanol in the presence of hydrochloric acid. (From Stedman, 25th ed)Blotting, Northern: Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.CCAAT-Enhancer-Binding Proteins: A class of proteins that were originally identified by their ability to bind the DNA sequence CCAAT. The typical CCAAT-enhancer binding protein forms dimers and consists of an activation domain, a DNA-binding basic region, and a leucine-rich dimerization domain (LEUCINE ZIPPERS). CCAAT-BINDING FACTOR is structurally distinct type of CCAAT-enhancer binding protein consisting of a trimer of three different subunits.Homeodomain Proteins: Proteins encoded by homeobox genes (GENES, HOMEOBOX) that exhibit structural similarity to certain prokaryotic and eukaryotic DNA-binding proteins. Homeodomain proteins are involved in the control of gene expression during morphogenesis and development (GENE EXPRESSION REGULATION, DEVELOPMENTAL).Genomic Library: A form of GENE LIBRARY containing the complete DNA sequences present in the genome of a given organism. It contrasts with a cDNA library which contains only sequences utilized in protein coding (lacking introns).DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Transgenes: Genes that are introduced into an organism using GENE TRANSFER TECHNIQUES.Multigene Family: A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Gene Expression Regulation, Plant: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in plants.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Up-Regulation: A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.Gene Expression Regulation, Developmental: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.Gene Frequency: The proportion of one particular in the total of all ALLELES for one genetic locus in a breeding POPULATION.Genetic Predisposition to Disease: A latent susceptibility to disease at the genetic level, which may be activated under certain conditions.RNA Polymerase II: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.Gene Expression Regulation, Fungal: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in fungi.Nucleotide Mapping: Two-dimensional separation and analysis of nucleotides.Upstream Stimulatory Factors: Ubiquitously expressed basic HELIX-LOOP-HELIX MOTIF transcription factors. They bind CANNTG sequences in the promoters of a variety of GENES involved in carbohydrate and lipid metabolism.Plants, Genetically Modified: PLANTS, or their progeny, whose GENOME has been altered by GENETIC ENGINEERING.Haplotypes: The genetic constitution of individuals with respect to one member of a pair of allelic genes, or sets of genes that are closely linked and tend to be inherited together such as those of the MAJOR HISTOCOMPATIBILITY COMPLEX.Transcription Factor AP-1: A multiprotein complex composed of the products of c-jun and c-fos proto-oncogenes. These proteins must dimerize in order to bind to the AP-1 recognition site, also known as the TPA-responsive element (TRE). AP-1 controls both basal and inducible transcription of several genes.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.Cyclic AMP Response Element-Binding Protein: A protein that has been shown to function as a calcium-regulated transcription factor as well as a substrate for depolarization-activated CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASES. This protein functions to integrate both calcium and cAMP signals.Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.CCAAT-Binding Factor: A heterotrimeric DNA-binding protein that binds to CCAAT motifs in the promoters of eukaryotic genes. It is composed of three subunits: A, B and C.Oligonucleotide Probes: Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.Gene Expression Profiling: The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.Nucleic Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.GlucuronidaseDNA Restriction Enzymes: Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.Regulon: In eukaryotes, a genetic unit consisting of a noncontiguous group of genes under the control of a single regulator gene. In bacteria, regulons are global regulatory systems involved in the interplay of pleiotropic regulatory domains and consist of several OPERONS.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Cell Differentiation: Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.DNA, Recombinant: Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.3T3 Cells: Cell lines whose original growing procedure consisted being transferred (T) every 3 days and plated at 300,000 cells per plate (J Cell Biol 17:299-313, 1963). Lines have been developed using several different strains of mice. Tissues are usually fibroblasts derived from mouse embryos but other types and sources have been developed as well. The 3T3 lines are valuable in vitro host systems for oncogenic virus transformation studies, since 3T3 cells possess a high sensitivity to CONTACT INHIBITION.Green Fluorescent Proteins: Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.NF-kappa B: Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.Nucleosomes: The repeating structural units of chromatin, each consisting of approximately 200 base pairs of DNA wound around a protein core. This core is composed of the histones H2A, H2B, H3, and H4.YY1 Transcription Factor: A ubiquitously expressed zinc finger-containing protein that acts both as a repressor and activator of transcription. It interacts with key regulatory proteins such as TATA-BINDING PROTEIN; TFIIB; and ADENOVIRUS E1A PROTEINS.Mutagenesis, Insertional: Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.Oligonucleotides: Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.Regulatory Elements, Transcriptional: Nucleotide sequences of a gene that are involved in the regulation of GENETIC TRANSCRIPTION.NFI Transcription Factors: Transcription factors that were originally identified as site-specific DNA-binding proteins essential for DNA REPLICATION by ADENOVIRUSES. They play important roles in MAMMARY GLAND function and development.Bacillus subtilis: A species of gram-positive bacteria that is a common soil and water saprophyte.Immediate-Early Proteins: Proteins that are coded by immediate-early genes, in the absence of de novo protein synthesis. The term was originally used exclusively for viral regulatory proteins that were synthesized just after viral integration into the host cell. It is also used to describe cellular proteins which are synthesized immediately after the resting cell is stimulated by extracellular signals.Proto-Oncogene Proteins: Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.Proto-Oncogene Proteins c-jun: Cellular DNA-binding proteins encoded by the c-jun genes (GENES, JUN). They are involved in growth-related transcriptional control. There appear to be three distinct functions: dimerization (with c-fos), DNA-binding, and transcriptional activation. Oncogenic transformation can take place by constitutive expression of c-jun.Chromosome Deletion: Actual loss of portion of a chromosome.Transcription Factor AP-2: A family of DNA binding proteins that regulate expression of a variety of GENES during CELL DIFFERENTIATION and APOPTOSIS. Family members contain a highly conserved carboxy-terminal basic HELIX-TURN-HELIX MOTIF involved in dimerization and sequence-specific DNA binding.Sulfites: Inorganic salts of sulfurous acid.Zinc Fingers: Motifs in DNA- and RNA-binding proteins whose amino acids are folded into a single structural unit around a zinc atom. In the classic zinc finger, one zinc atom is bound to two cysteines and two histidines. In between the cysteines and histidines are 12 residues which form a DNA binding fingertip. By variations in the composition of the sequences in the fingertip and the number and spacing of tandem repeats of the motif, zinc fingers can form a large number of different sequence specific binding sites.Histone Deacetylases: Deacetylases that remove N-acetyl groups from amino side chains of the amino acids of HISTONES. The enzyme family can be divided into at least three structurally-defined subclasses. Class I and class II deacetylases utilize a zinc-dependent mechanism. The sirtuin histone deacetylases belong to class III and are NAD-dependent enzymes.DNA Modification Methylases: Enzymes that are part of the restriction-modification systems. They are responsible for producing a species-characteristic methylation pattern, on either adenine or cytosine residues, in a specific short base sequence in the host cell's own DNA. This methylated sequence will occur many times in the host-cell DNA and remain intact for the lifetime of the cell. Any DNA from another species which gains entry into a living cell and lacks the characteristic methylation pattern will be recognized by the restriction endonucleases of similar specificity and destroyed by cleavage. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms.Open Reading Frames: A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).RNA, Bacterial: Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Hydroxamic Acids: A class of weak acids with the general formula R-CONHOH.Operator Regions, Genetic: The regulatory elements of an OPERON to which activators or repressors bind thereby effecting the transcription of GENES in the operon.DNA Transposable Elements: Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.Genes, Viral: The functional hereditary units of VIRUSES.Oligonucleotide Array Sequence Analysis: Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.Plant Proteins: Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Erythroid-Specific DNA-Binding Factors: A group of transcription factors that were originally described as being specific to ERYTHROID CELLS.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Genes, Plant: The functional hereditary units of PLANTS.Tumor Suppressor Proteins: Proteins that are normally involved in holding cellular growth in check. Deficiencies or abnormalities in these proteins may lead to unregulated cell growth and tumor development.RNA, Small Interfering: Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.Neoplasm Proteins: Proteins whose abnormal expression (gain or loss) are associated with the development, growth, or progression of NEOPLASMS. Some neoplasm proteins are tumor antigens (ANTIGENS, NEOPLASM), i.e. they induce an immune reaction to their tumor. Many neoplasm proteins have been characterized and are used as tumor markers (BIOMARKERS, TUMOR) when they are detectable in cells and body fluids as monitors for the presence or growth of tumors. Abnormal expression of ONCOGENE PROTEINS is involved in neoplastic transformation, whereas the loss of expression of TUMOR SUPPRESSOR PROTEINS is involved with the loss of growth control and progression of the neoplasm.Viral Proteins: Proteins found in any species of virus.Transformation, Genetic: Change brought about to an organisms genetic composition by unidirectional transfer (TRANSFECTION; TRANSDUCTION, GENETIC; CONJUGATION, GENETIC, etc.) and incorporation of foreign DNA into prokaryotic or eukaryotic cells by recombination of part or all of that DNA into the cell's genome.Kruppel-Like Transcription Factors: A family of zinc finger transcription factors that share homology with Kruppel protein, Drosophila. They contain a highly conserved seven amino acid spacer sequence in between their ZINC FINGER MOTIFS.Acetyltransferases: Enzymes catalyzing the transfer of an acetyl group, usually from acetyl coenzyme A, to another compound. EC 2.3.1.Genetic Variation: Genotypic differences observed among individuals in a population.Potassium Permanganate: Permanganic acid (HMnO4), potassium salt. A highly oxidative, water-soluble compound with purple crystals, and a sweet taste. (From McGraw-Hill Dictionary of Scientific and Technical Information, 4th ed)Proto-Oncogene Proteins c-ets: A family of transcription factors that share a unique DNA-binding domain. The name derives from viral oncogene-derived protein oncogene protein v-ets of the AVIAN ERYTHROBLASTOSIS VIRUS.Octamer Transcription Factor-1: A ubiquitously expressed octamer transcription factor that regulates GENETIC TRANSCRIPTION of SMALL NUCLEAR RNA; IMMUNOGLOBULIN GENES; and HISTONE H2B genes.Hepatocyte Nuclear Factor 4: A subfamily of nuclear receptors that regulate GENETIC TRANSCRIPTION of a diverse group of GENES involved in the synthesis of BLOOD COAGULATION FACTORS; and in GLUCOSE; CHOLESTEROL; and FATTY ACIDS metabolism.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.Genes, Fungal: The functional hereditary units of FUNGI.Saccharomyces cerevisiae Proteins: Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.Mice, Inbred C57BLDinucleoside Phosphates: A group of compounds which consist of a nucleotide molecule to which an additional nucleoside is attached through the phosphate molecule(s). The nucleotide can contain any number of phosphates.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Proto-Oncogene Protein c-ets-1: An ets proto-oncogene expressed primarily in adult LYMPHOID TISSUE; BRAIN; and VASCULAR ENDOTHELIAL CELLS.Arabidopsis: A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.Globins: A superfamily of proteins containing the globin fold which is composed of 6-8 alpha helices arranged in a characterstic HEME enclosing structure.Y-Box-Binding Protein 1: Y-box-binding protein 1 was originally identified as a DNA-binding protein that interacts with Y-box PROMOTER REGIONS of MHC CLASS II GENES. It is a highly conserved transcription factor that regulates expression of a wide variety of GENES.Tetradecanoylphorbol Acetate: A phorbol ester found in CROTON OIL with very effective tumor promoting activity. It stimulates the synthesis of both DNA and RNA.Basic Helix-Loop-Helix Leucine Zipper Transcription Factors: A family of transcription factors that contain regions rich in basic residues, LEUCINE ZIPPER domains, and HELIX-LOOP-HELIX MOTIFS.TATA-Box Binding Protein: A general transcription factor that plays a major role in the activation of eukaryotic genes transcribed by RNA POLYMERASES. It binds specifically to the TATA BOX promoter element, which lies close to the position of transcription initiation in RNA transcribed by RNA POLYMERASE II. Although considered a principal component of TRANSCRIPTION FACTOR TFIID it also takes part in general transcription factor complexes involved in RNA POLYMERASE I and RNA POLYMERASE III transcription.Hepatocyte Nuclear Factor 1: A transcription factor that regulates the expression of a large set of hepatic proteins including SERUM ALBUMIN; beta-fibrinogen; and ALPHA 1-ANTITRYPSIN. It is composed of hetero- or homo-dimers of HEPATOCYTE NUCLEAR FACTOR 1-ALPHA and HEPATOCYTE NUCLEAR FACTOR 1-BETA.DNA (Cytosine-5-)-Methyltransferase: An enzyme that catalyzes the transfer of a methyl group from S-ADENOSYLMETHIONINE to the 5-position of CYTOSINE residues in DNA.Nucleotide Motifs: Commonly observed BASE SEQUENCE or nucleotide structural components which can be represented by a CONSENSUS SEQUENCE or a SEQUENCE LOGO.Case-Control Studies: Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.Cyclic AMP Receptor Protein: A transcriptional regulator in prokaryotes which, when activated by binding cyclic AMP, acts at several promoters. Cyclic AMP receptor protein was originally identified as a catabolite gene activator protein. It was subsequently shown to regulate several functions unrelated to catabolism, and to be both a negative and a positive regulator of transcription. Cell surface cyclic AMP receptors are not included (CYCLIC AMP RECEPTORS), nor are the eukaryotic cytoplasmic cyclic AMP receptor proteins, which are the regulatory subunits of CYCLIC AMP-DEPENDENT PROTEIN KINASES.Serotonin Plasma Membrane Transport Proteins: Sodium chloride-dependent neurotransmitter symporters located primarily on the PLASMA MEMBRANE of serotonergic neurons. They are different than SEROTONIN RECEPTORS, which signal cellular responses to SEROTONIN. They remove SEROTONIN from the EXTRACELLULAR SPACE by high affinity reuptake into PRESYNAPTIC TERMINALS. Regulates signal amplitude and duration at serotonergic synapses and is the site of action of the SEROTONIN UPTAKE INHIBITORS.DNA, Neoplasm: DNA present in neoplastic tissue.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.

Transcriptional repression by the Drosophila giant protein: cis element positioning provides an alternative means of interpreting an effector gradient. (1/58449)

Early developmental patterning of the Drosophila embryo is driven by the activities of a diverse set of maternally and zygotically derived transcription factors, including repressors encoded by gap genes such as Kruppel, knirps, giant and the mesoderm-specific snail. The mechanism of repression by gap transcription factors is not well understood at a molecular level. Initial characterization of these transcription factors suggests that they act as short-range repressors, interfering with the activity of enhancer or promoter elements 50 to 100 bp away. To better understand the molecular mechanism of short-range repression, we have investigated the properties of the Giant gap protein. We tested the ability of endogenous Giant to repress when bound close to the transcriptional initiation site and found that Giant effectively represses a heterologous promoter when binding sites are located at -55 bp with respect to the start of transcription. Consistent with its role as a short-range repressor, as the binding sites are moved to more distal locations, repression is diminished. Rather than exhibiting a sharp 'step-function' drop-off in activity, however, repression is progressively restricted to areas of highest Giant concentration. Less than a two-fold difference in Giant protein concentration is sufficient to determine a change in transcriptional status of a target gene. This effect demonstrates that Giant protein gradients can be differentially interpreted by target promoters, depending on the exact location of the Giant binding sites within the gene. Thus, in addition to binding site affinity and number, cis element positioning within a promoter can affect the response of a gene to a repressor gradient. We also demonstrate that a chimeric Gal4-Giant protein lacking the basic/zipper domain can specifically repress reporter genes, suggesting that the Giant effector domain is an autonomous repression domain.  (+info)

Association of snRNA genes with coiled bodies is mediated by nascent snRNA transcripts. (2/58449)

BACKGROUND: Coiled bodies are nuclear organelles that are highly enriched in small nuclear ribonucleoproteins (snRNPs) and certain basal transcription factors. Surprisingly, coiled bodies not only contain mature U snRNPs but also associate with specific chromosomal loci, including gene clusters that encode U snRNAs and histone messenger RNAs. The mechanism(s) by which coiled bodies associate with these genes is completely unknown. RESULTS: Using stable cell lines, we show that artificial tandem arrays of human U1 and U2 snRNA genes colocalize with coiled bodies and that the frequency of the colocalization depends directly on the transcriptional activity of the array. Association of the genes with coiled bodies was abolished when the artificial U2 arrays contained promoter mutations that prevent transcription or when RNA polymerase II transcription was globally inhibited by alpha-amanitin. Remarkably, the association was also abolished when the U2 snRNA coding regions were replaced by heterologous sequences. CONCLUSIONS: The requirement for the U2 snRNA coding region indicates that association of snRNA genes with coiled bodies is mediated by the nascent U2 RNA itself, not by DNA or DNA-bound proteins. Our data provide the first evidence that association of genes with a nuclear organelle can be directed by an RNA and suggest an autogenous feedback regulation model.  (+info)

Telomerase reverse transcriptase gene is a direct target of c-Myc but is not functionally equivalent in cellular transformation. (3/58449)

The telomerase reverse transcriptase component (TERT) is not expressed in most primary somatic human cells and tissues, but is upregulated in the majority of immortalized cell lines and tumors. Here, we identify the c-Myc transcription factor as a direct mediator of telomerase activation in primary human fibroblasts through its ability to specifically induce TERT gene expression. Through the use of a hormone inducible form of c-Myc (c-Myc-ER), we demonstrate that Myc-induced activation of the hTERT promoter requires an evolutionarily conserved E-box and that c-Myc-ER-induced accumulation of hTERT mRNA takes place in the absence of de novo protein synthesis. These findings demonstrate that the TERT gene is a direct transcriptional target of c-Myc. Since telomerase activation frequently correlates with immortalization and telomerase functions to stabilize telomers in cycling cells, we tested whether Myc-induced activation of TERT gene expression represents an important mechanism through which c-Myc acts to immortalize cells. Employing the rat embryo fibroblast cooperation assay, we show that TERT is unable to substitute for c-Myc in the transformation of primary rodent fibroblasts, suggesting that the transforming activities of Myc extend beyond its ability to activate TERT gene expression and hence telomerase activity.  (+info)

Detailed methylation analysis of the glutathione S-transferase pi (GSTP1) gene in prostate cancer. (4/58449)

Glutathione-S-Transferases (GSTs) comprise a family of isoenzymes that provide protection to mammalian cells against electrophilic metabolites of carcinogens and reactive oxygen species. Previous studies have shown that the CpG-rich promoter region of the pi-class gene GSTP1 is methylated at single restriction sites in the majority of prostate cancers. In order to understand the nature of abnormal methylation of the GSTP1 gene in prostate cancer we undertook a detailed analysis of methylation at 131 CpG sites spanning the promoter and body of the gene. Our results show that DNA methylation is not confined to specific CpG sites in the promoter region of the GSTP1 gene but is extensive throughout the CpG island in prostate cancer cells. Furthermore we found that both alleles are abnormally methylated in this region. In normal prostate tissue, the entire CpG island was unmethylated, but extensive methylation was found outside the island in the body of the gene. Loss of GSTP1 expression correlated with DNA methylation of the CpG island in both prostate cancer cell lines and cancer tissues whereas methylation outside the CpG island in normal prostate tissue appeared to have no effect on gene expression.  (+info)

B-MYB transactivates its own promoter through SP1-binding sites. (5/58449)

B-MYB is an ubiquitous protein required for mammalian cell growth. In this report we show that B-MYB transactivates its own promoter through a 120 bp segment proximal to the transcription start site. The B-MYB-responsive element does not contain myb-binding sites and gel-shift analysis shows that SP1, but not B-MYB, protein contained in SAOS2 cell extracts binds to the 120 bp B-myb promoter fragment. B-MYB-dependent transactivation is cooperatively increased in the presence of SP1, but not SP3 overexpression. When the SP1 elements of the B-myb promoter are transferred in front of a heterologous promoter, an increased response to B-MYB results. In contrast, c-MYB, the prototype member of the Myb family, is not able to activate the luciferase construct containing the SP1 elements. With the use of an SP1-GAL4 fusion protein, we have determined that the cooperative activation occurs through the domain A of SP1. These observations suggest that B-MYB functions as a coactivator of SP1, and that diverse combinations of myb and SP1 sites may dictate the responsiveness of myb-target genes to the various members of the myb family.  (+info)

Differential stability of the DNA-activated protein kinase catalytic subunit mRNA in human glioma cells. (6/58449)

DNA-dependent protein kinase (DNA-PK) functions in double-strand break repair and immunoglobulin [V(D)J] recombination. We previously established a radiation-sensitive human cell line, M059J, derived from a malignant glioma, which lacks the catalytic subunit (DNA-PKcs) of the DNA-PK multiprotein complex. Although previous Northern blot analysis failed to detect the DNA-PKcs transcript in these cells, we show here through quantitative studies that the transcript is present, albeit at greatly reduced (approximately 20x) levels. Sequencing revealed no genetic alteration in either the promoter region, the kinase domain, or the 3' untranslated region of the DNA-PKcs gene to account for the reduced transcript levels. Nuclear run-on transcription assays indicated that the rate of DNA-PKcs transcription in M059J and DNA-PKcs proficient cell lines was similar, but the stability of the DNA-PKcs message in the M059J cell line was drastically (approximately 20x) reduced. Furthermore, M059J cells lack an alternately spliced DNA-PKcs transcript that accounts for a minor (5-20%) proportion of the DNA-PKcs message in all other cell lines tested. Thus, alterations in DNA-PKcs mRNA stability and/or the lack of the alternate mRNA may result in the loss of DNA-PKcs activity. This finding has important implications as DNA-PKcs activity is essential to cells repairing damage induced by radiation or radiomimetric agents.  (+info)

Id helix-loop-helix proteins inhibit nucleoprotein complex formation by the TCF ETS-domain transcription factors. (7/58449)

The Id subfamily of helix-loop-helix (HLH) proteins plays a fundamental role in the regulation of cellular proliferation and differentiation. Id proteins are thought to inhibit differentiation mainly through interaction with other HLH proteins and by blocking their DNA-binding activity. Members of the ternary complex factor (TCF) subfamily of ETS-domain proteins have key functions in regulating immediate-early gene expression in response to mitogenic stimulation. TCFs form DNA-bound complexes with the serum response factor (SRF) and are direct targets of MAP kinase (MAPK) signal transduction cascades. In this study we demonstrate functional interactions between Id proteins and TCFs. Ids bind to the ETS DNA-binding domain and disrupt the formation of DNA-bound complexes between TCFs and SRF on the c-fos serum response element (SRE). Inhibition occurs by disrupting protein-DNA interactions with the TCF component of this complex. In vivo, the Id proteins cause down-regulation of the transcriptional activity mediated by the TCFs and thereby block MAPK signalling to SREs. Therefore, our results demonstrate a novel facet of Id function in the coordination of mitogenic signalling and cell cycle entry.  (+info)

Cooperative binding of heat shock factor to the yeast HSP82 promoter in vivo and in vitro. (8/58449)

Previous work has shown that heat shock factor (HSF) plays a central role in remodeling the chromatin structure of the yeast HSP82 promoter via constitutive interactions with its high-affinity binding site, heat shock element 1 (HSE1). The HSF-HSE1 interaction is also critical for stimulating both basal (noninduced) and induced transcription. By contrast, the function of the adjacent, inducibly occupied HSE2 and -3 is unknown. In this study, we examined the consequences of mutations in HSE1, HSE2, and HSE3 on HSF binding and transactivation. We provide evidence that in vivo, HSF binds to these three sites cooperatively. This cooperativity is seen both before and after heat shock, is required for full inducibility, and can be recapitulated in vitro on both linear and supercoiled templates. Quantitative in vitro footprinting reveals that occupancy of HSE2 and -3 by Saccharomyces cerevisiae HSF (ScHSF) is enhanced approximately 100-fold through cooperative interactions with the HSF-HSE1 complex. HSE1 point mutants, whose basal transcription is virtually abolished, are functionally compensated by cooperative interactions with HSE2 and -3 following heat shock, resulting in robust inducibility. Using a competition binding assay, we show that the affinity of recombinant HSF for the full-length HSP82 promoter is reduced nearly an order of magnitude by a single-point mutation within HSE1, paralleling the effect of these mutations on noninduced transcript levels. We propose that the remodeled chromatin phenotype previously shown for HSE1 point mutants (and lost in HSE1 deletion mutants) stems from the retention of productive, cooperative interactions between HSF and its target binding sites.  (+info)

Results Significant hypomethylation of two CpG sites within IFI44L promoter, Site1 (Chr1: 79 085 222) and Site2 (Chr1: 79 085 250; cg06872964), was identified in patients with SLE compared with HCs, patients with RA and patients with pSS. In a comparison between patients with SLE and HCs included in the first validation cohort, Site1 methylation had a sensitivity of 93.6% and a specificity of 96.8% at a cut-off methylation level of 75.5% and Site2 methylation had a sensitivity of 94.1% and a specificity of 98.2% at a cut-off methylation level of 25.5%. The IFI44L promoter methylation marker was also validated in an European-derived cohort. In addition, the methylation levels of Site1 and Site2 within IFI44L promoter were significantly lower in patients with SLE with renal damage than those without renal damage. Patients with SLE showed significantly increased methylation levels of Site1 and Site2 during remission compared with active stage. ...
Gao, L., Smit, M. A., van den Oord, J. J., Goeman, J. J., Verdegaal, E. M. E., van der Burg, S. H., Stas, M., Beck, S., Gruis, N. A., Tensen, C. P., Willemze, R., Peeper, D. S. and van Doorn, R. (2013), Genome-wide promoter methylation analysis identifies epigenetic silencing of MAPK13 in primary cutaneous melanoma. Pigment Cell & Melanoma Research, 26: 542-554. doi: 10.1111/pcmr.12096 ...
We have characterized the 5′ region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of housekeeping and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5′ sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained ...
Our products have been quoted by publications of Association of CnB 5I/5D promoter gene polymorphism and serum calcineurin levels in early onset of coronary artery disease of south Indian cohort from Gene .
Our results establish that the extent of stable DNA wrapping in RPo depends on the sequence of the promoter and, in particular, on sequence determinants in the upstream region of the promoter (UP elements). The presence of αCTD and an intact α‐linker is required to maintain extensive stable DNA wrapping. Our results further indicate that the sequence of the upstream region of the promoter can affect DNA wrapping even in the absence of αCTD and thus even in the absence of αCTD-DNA interactions. For example, RPo prepared using ΔαCTDI/ΔαCTDII RNAP shows an apparent DNA compaction of 13±0.6 nm at lacUV5(UPfull) but only 4±0.8 nm at lacUV5(ICAP) (Fig 3E,F). We infer that the sequence of the upstream region of the promoter can affect compaction not only through effects on αCTD-DNA interaction but also through other effects. We suggest that these other effects involve intrinsic DNA curvature, noting that UP‐element subsites and UP elements are A/T‐rich sequences (Fig 1A; Ross et al, ...
Dual Luciferase Assay - posted in Molecular Cloning: I am planning to do a dual luciferase assay using the firefly and renilla luciferase vectors. Can someone suggest me a ratio for the co-reporter vectors to be added to the transfection mix. Regards Sankella
The present study describes a novel cell type-specific mechanism of transcriptional regulation of TSP-1 in vascular cells in response to glucose. We report here that unlike our recently identified short promoter region (−280/+66) responsible for the increased THBS1 transcription in ECs, a longer promoter fragment (−1270/+66) is required for THBS1 regulation in HASMCs, as was described for specialized pericytes and mesangial cells.27 Interestingly, glucose responsiveness in ECs was in fact inhibited by the distal fragment of the promoter,10 suggesting the presence of an inhibitory element in this region, which is not active in either VSMCs or mesangial cells.27 The longer promoter region, −1270/+66, responsible for the increased THBS1 transcription in HASMCs contained distinctly different binding elements, as identified by MatInspector, located in the distal end of the promoter. These binding elements had no similarity to those in the EC-specific THBS1 promoter fragment, −280/+66, ...
In this article, we review some of the expression systems that are available for Metabolic Control Analysis and Metabolic Engineering, and examine their advantages and disadvantages in different contexts. In a recent approach, artificial promoters for modulating gene expression in micro-organisms were constructed using synthetic degenerated oligonucleotides. From this work, a promoter library was obtained for Lactococcus lactis, containing numerous individual promoters and covering a wide range of promoter activities. Importantly, the range of promoter activities was covered in small steps of activity change. Promoter libraries generated by this approach allow for optimization of gene expression and for experimental control analysis in a wide range of biological systems by choosing from the promoter library promoters giving, e.g., 25%, 50%, 200%, and 400% of the normal expression level of the gene in question. If the relevant variable (e.g., the flux or yield) is then measured with each of these ...
No. The Promoter Selection Plate is not meant to be used to establish fundamental lentiviral transduction conditions, such as optimal cell density, in your cells of interest. The purpose of the Promoter Selection Plate is to visually assess relative promoter activity. Basic experimental conditions (such as cell density, with or without serum, Polybrene concentration) should be established prior to transduction of viral particles using the SMARTchoice Promoter Selection Plate. The Promoter Selection Plate contains duplicate wells of serially diluted lentiviral particles representing each promoter so that two separate conditions can be tested simultaneously. After identification of the optimal promoter for your cells of interest, additional transduction optimization should be performed to identify appropriate MOIs for optimal shRNA performance ...
An accurate identification of gene promoters remains an important challenge. Computational approaches for this problem rely on promoter sequence attributes that are believed to be critical for transcription initiation. Here we report a probabilistic model that captures two important properties of promoters, not used by previous methods, viz., the location preference and co-occurrence of promoter elements. Additionally, we found that many of the position-specific DNA elements are strongly linked with the function of the gene product. For instance, a highly conserved motif CCTTT at -1 position is strongly associated with protein synthesis, cellular and tissue development. Our comparative analysis of promoter classes reveals that the promoters devoid of CpG islands are more conserved and have fewer alternative transcription start sites. The discovered links between promoter elements and gene function allows us to infer genetic networks from promoter elements. The web server for the PSPA promoter ...
The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5 LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the
Fibulin-1 is a multifunctional extracellular protein involved in diverse biological processes including cardiovascular development, haemostasis and cancer. To investigate the transcriptional regulation of the gene encoding fibulin-1 we cloned and analysed about 4.0kb of the 5′-flanking regions of both the human and mouse fibulin-1 genes. The human and mouse fibulin-1 promoters share little sequence similarity except for a short region of approx. 150-170bp immediately upstream of the translation start site. The conserved region contains a TATA-like sequence (ATAATT) and multiple consensus binding sites for Sp1 and activator protein 2 (AP-2). That the short conserved region in each gene confers basal promoter activity is demonstrated by transient transfections of promoter deletion constructs for both the human and mouse genes into cells that express fibulin-1 constitutively. Co-transfections of promoter constructs with expression plasmids for Sp1, Sp3 and Sp4 into Drosophila SL2 cells indicate ...
The mdm2 gene is a target for transcriptional activation by the p53 tumor suppressor gene product. Previous work has revealed that the mouse mdm2 gene contains two promoters: one is located upstream to the gene and is active in the absence of p53, the other resides within the first intron and requires p53 for transcriptional activity. To determine whether this unique promoter activation pattern is biologically important, we investigated the structure and function of the corresponding region of the human mdm2 (hmdm2) gene. We report here that the hmdm2 gene also contains an intronic, p53-dependent promoter. The structural features of this promoter are highly conserved between mouse and man, as opposed to the lack of conservation of the first exon. This promoter is triggered in vivo in the presence of activated wild type p53, leading to the production of novel mRNA species. The intronic hmdm2 promoter contains two tandem p53 binding elements. Deletion analysis suggests that optimal promoter
IL-6 induces PAI-1 mRNA and protein accumulation.13,19 Although several transcription factor binding sites were identified in PAI-1 promoter, no classic inflammatory response element was found. Because promoter activity was increased by IL-6, the IL-6-responsive region was explored. The deletion and site mutation of the region from −239 to −210 bp decreased ,80% of the IL-6-inducible promoter activity, indicating that the region is critical for response. A computer-based database analysis indicated there is a putative C/EBP binding site (−226 to −212 bp). The promoters of most IL-6-inducible acute-phase protein genes have been characterized with C/EBP binding motifs.11 Using competition experiments, EMSA supershift analysis, and DNase I footprinting analysis, a C/EBP motif on PAI-1 promoter was verified, and 3 members of C/EBP family including α, β, and δ were involved in the DNA-protein complex formation. C/EBPβ was involved in the formation of 3 complexes because single-copy ...
Core promoter element analysis is performed in order to investigate the quality of the promoter collection. It exploits the fact that certain DNA motifs preferentially occur at characteristic distances from a TSS. For instance, the TATA-box occurs in a narrow region centered about 28 bp upstream of the TSS whereas the CCAAT-box occurs in a much wider area with a peak frequency at position −80. Based on these observations, we would expect a high-quality promoter collection to show high peaks for both sequence motifs. In addition, a narrow TATA-box peak at −28 would indicate precise TSS mapping. This analysis has been performed using OProf. Readers are encouraged to repeat this anlysis and perform others in order to check for the quality of the promoter list. TATA-box: this core promoter element is normally found 28 bp upstream the transcription start site. The following plot shows that EPDnew promoter collection has a more focused TATA-box distribution compared to Gramene annotation ...
Several mutants derived from transformed human B cell lines are defective in expressing major histocompatibility complex (MHC) class II genes. The failure to express a class II gene in at least one such mutant line has been mapped to the MHC class II X box, a conserved transcriptional element in the promoter region. A complementary DNA encoding a DNA-binding protein (human X box binding protein, hXBP-1) whose target is the human DR alpha X box and the 3 flanking region has now been cloned. This complementary DNA encoded a protein with structural similarities to the c-jun proto-oncogene product, and its target sequence was closely related to the palindromic target sequence of c-jun. Mutation of the hXBP-1 DNA target sequence decreased DR alpha promoter activity in vivo. These studies suggest that the hXBP-1 protein acts as a transcription factor in B cells. ...
REHOVOT, Israel and CUIABÁ, Brazil, Oct. 19, 2016-- Evogene Ltd., a leading biotechnology company for the improvement of crop productivity, and Instituto Mato-grossense do Algodão, a leading developer and marketer of cotton seeds, announced today a collaboration for the discovery and validation of novel genomic promoters to support IMAmts product...
Binding of transcriptional activators to a promoter is a prerequisite process in transcriptional activation. It is well established that the efficiency of activator binding to a promoter is determined by the affinity of direct interactions between the DNA-binding domain of an activator and its specific target sequences. However, I describe here that activator binding to a promoter is augmented in vivo by the effects of two other determinants that have not been generally appreciated: (i) the number of activator binding sites present in a promoter and (ii) the potency of activation domains of activators. Multiple sites within a promoter can cooperatively recruit cognate factors regardless of whether they contain an effective activation domain. This cooperativity can result in the synergistic activation of transcription. The second effect is the enhancement of activator binding to a promoter by the presence of activation domains. In this case, activation domains are not simply tethered to the ...
Fig. 4. Analysis of the 5′ region of FEZ1 gene. A, primer extension analysis of the transcriptional start site of human FEZ1 gene. Poly(A)+ RNAs from human brain (Lane 1) and breast (Lane 2) were reverse-transcribed with a 5′-radiolabeled, gene-specific primer corresponding with the 1524-1499-bp upstream region from the first translatable methionine. Arrow, TSS, which is 69 bp upstream from the 3′-end of the primer. B, analysis of the human FEZ1 gene 5′ region. Bold bar at the top of the figure indicates the FEZ1 gene locus, in which exons are depicted in boxes. Cross-hatched boxes, deletion mutants used for the luciferase reporter assay. The 5′-end positions of the deleted promoter are indicated as nucleotide numbers from the TSS. C, luciferase reporter assay of the deleted FEZ1 promoter regions. Luciferase reporter plasmids were transfected into Fez1-positive 293 cells to identify the positive regulatory region for FEZ1 transcription. Left, 5′-end positions of the deleted promoter ...
A promoter is a region of DNA that facilitates the transcription of a particular gene. "Promoters can be about 100-1000 [nucleotides] long.[1]. A promoter is on the template strand for the gene and near the gene in numbers of nucleotides (nts) along the DNA template strand. Usually, the promoter lies within the string of nucleotides between genes. Some promoters are called constitutive as they are active in all circumstances in the cell, while others are regulated becoming active in response to specific stimuli. These specific stimuli for a gene find a receptive portion within that genes promoter. In the case of genes that are used to produce proteins, the RNA polymerase II holoenzyme that actually performs the transcription from the template strand needs to find chemical cues for attachment to the DNA and where to begin transcription. Preceding this are chemical cues for which DNA strand is the template strand and in what direction transcription is to be performed. A promoter contains cues for ...
A promoter is a region of DNA that facilitates the transcription of a particular gene. "Promoters can be about 100-1000 [nucleotides] long.[1]. A promoter is on the template strand for the gene and near the gene in numbers of nucleotides (nts) along the DNA template strand. Usually, the promoter lies within the string of nucleotides between genes. Some promoters are called constitutive as they are active in all circumstances in the cell, while others are regulated becoming active in response to specific stimuli. These specific stimuli for a gene find a receptive portion within that genes promoter. In the case of genes that are used to produce proteins, the RNA polymerase II holoenzyme that actually performs the transcription from the template strand needs to find chemical cues for attachment to the DNA and where to begin transcription. Preceding this are chemical cues for which DNA strand is the template strand and in what direction transcription is to be performed. A promoter contains cues for ...
This invention provides novel chimeric promoter/enhancers. The chimeric promoter/enhancers are particularly suitable for directing gene expression in mammalian cells.
The functionality of a 3422-base pair promoter fragment from the mouse α1B-adrenergic receptor (α1BAR) gene was examined. This fragment, cloned from a mouse genomic library, was found to have significant sequence homology to the known human and rat α1BAR promoters. However, the consensus motif of several key cis-acting elements is not conserved among the rat, human, and mouse genes, suggesting species specificity. Confirming fidelity of the murine promoter, robust in vitro expression of a chloramphenicol acetyltransferase (CAT) reporter was detected in known α1BAR-expressing BC3H1, NB41A3, and DDT1MF-2 cells transiently transfected with a promoter-CAT construct. Conversely, minimal CAT expression was detected in known α1BAR-negative RAT-1 and R3T3 cells. These findings were extended by transfecting the same promoter-CAT construct into various primary cell types. In support of the hypothesis that α1ARs are differentially expressed in the smooth muscle of the vasculature, primary cultures of ...
Transcription initiation is an important step in the process of gene regulation in prokaryotes. Promoters are stretches of DNA sequence that are present in the upstream region of transcription start sites (TSSs), where RNA polymerase and other transcription factors bind to initiate transcription. Recent advancement in sequencing technologies has resulted in huge amount of raw data in the form of whole genome sequences. This sequence data has to be annotated, in order to identify coding, non-coding and regulatory regions. Computational tools are useful for a quick and fairly reliable annotation of many genome sequences. Promoter prediction is an important step in genome annotation process which is needed, not only for the validation of predicted genes, but also for the identification of novel genes, especially those coding for non-coding RNA, which are missed by gene prediction programs. DNA sequence dependent structural properties such as DNA duplex stability, bendability and intrinsic ...
... software free downloads. Promoter Gene shareware, freeware, demos: Gene Inspector by Textco BioSoftware Inc, Page Promoter by NetPromoter, Meta Tag Promoter by NetPromoter etc...
I am currently studying the regulation of several mammalian (mouse and human) promoters. Of obvious interest are known transcription factor binding sites. Since I wouldnt know an AP-1 site from an EcoRI site, I was hoping there might be a computer program on the net that would analyze a submitted sequence for consensus recognition sites. Does anyone out there have any advice? At this point, even a simple list of known consensus sites would be better than nothing. Thanks in advance, Benjamin S. Braun UCLA ...
RESULTS: A percentage of 36.17% controls and 38.6% patients were heterozygosis, considering Amplification-refractory mutation system (ARMS)-PCR assay while 23% and 22.85% were heterozygosis using Mismatch Amplification Mutation Assay (MAMA)-PCR. On the contrary, 1.3% and 1.4% were homozygosis A, while 75.7% and 75.75% presented homozygosis G, taking into account the MAMA-PCR results. The two assays were significantly different (P=0.0004 at χ2 Test), but MAMA-PCR showed a better performance for TNF-α -308 G/A gene polymorphism investigation ...
Potential binding sites of transcription factors are an example of biological event sequences where co-occurrence patterns and burstiness occur. We applied our techniques on 10 Mbp regions from human chromosomes 1-10 [11] (NCBI 36 assembly), where we identified potential binding sites as matches to known transcription factor binding motifs. The regions 30 - 40 Mbp were used for chromosomes 1-9, and 20 - 30 Mbp for chromosome 10, to avoid the centromere region. This dataset contains genome regions with different characteristics (e.g., C+G and gene densities), while being compact enough to be efficiently studied with several null models and window sizes. The motifs we consider are from the Jaspar collection [12] (Jaspar Core), all 138 motifs in the 2008 build. In these sequences we identified all matches for each Jaspar transcription factor (TF) matrix by the PoSSuMsearch program [13]. The threshold for a match was set with p ≤ 10-5, yielding approximately 30000 matches for each 10 Mbp sequence. ...
In article ,310FF66A.A0A at ulam.generes.ca,, kalch ,kalch at ulam.generes.ca, wrote: , Hi, , we are trying to map promoter elements from known DNA sequence. , However, we find that the DNA analysis programs we have in the lab , (MacVector and GeneWorks) are not suitable for this analysis. Could , someone please post (or respond to me directly) where I can send (or , download) a program that will search for promoter elements (e.g. , Sp1, ERE, AP1, AP2, etc)? , , Thanks, , , Michael MacVector does do this (Im not saying that it does it well, but it has the ability). I think that the newer versions ship with a transcription factor subsequence file that has over 600 sites bound by proteins in promoter regions. You just have to do a nucleic acid subsequence search. I ran a test against the junD promoter and it found all the sites that had been mapped by Shaul etal when they cloned it (except the TATA box. Im not sure why it didnt find that as one of the subsequences is exactly the same sequence ...
Generation of mutant mice. In the strategy of IMCT (Kobayashi et al., 1995), transgenic (Tg) mice are generated that express the human interleukin-2 receptor α-subunit (IL-2Rα) under the control of a cell type-specific promoter. These mice are then treated with a recombinant immunotoxin (IT), which is composed of the variable regions of the anti-IL-2Rα monoclonal antibody and a bacterial exotoxin fragment. The transgene construct contained a 10 kb DNA fragment encoding the 5′-flanking region of the mouse neuropsin (NP) gene (Hirata et al., 2001), the second intron of the rabbit β-globin gene (Kobayashi et al., 1992), the gene cassette encoding IL-2Rα fused to green fluorescent protein (IL-2Rα/GFP) (Watanabe et al., 1998), and the polyadenylation signals of the rabbit β-globin gene and simian virus 40 early gene (Kobayashi et al., 1992). The construct was microinjected into fertilized mouse eggs, which were then implanted into pseudopregnant females. Tg mice were identified by Southern ...
Promoters. Oriane Broustal BIO 535. Promoters. About promoters ( structure, function,…) Two types of human promoters based on CG content Bidirectional promoters in human genome. Questions:. What are the differences between eukaryotic and prokaryotic promoters? Slideshow 5386988 by ivana
Promoter elements play important roles in isoform and cell type-specific expression. We surveyed the epigenomic promoter landscape of gastric adenocarcinoma, analyzing 110 chromatin profiles (H3K4me3, H3K4me1, H3K27ac) of primary gastric cancers, gastric cancer lines, and nonmalignant gastric tissues. We identified nearly 2,000 promoter alterations (somatic promoters), many deregulated in various epithelial malignancies and mapping frequently to alternative promoters within the same gene, generating potential pro-oncogenic isoforms (RASA3). Somatic promoter-associated N-terminal peptides displaying relative depletion in tumors exhibited high-affinity MHC binding predictions and elicited potent T-cell responses in vitro, suggesting a mechanism for reducing tumor antigenicity. In multiple patient cohorts, gastric cancers with high somatic promoter usage also displayed reduced T-cell cytolytic marker expression. Somatic promoters are enriched in PRC2 occupancy, display sensitivity to EZH2 ...
Use this page to investigate EPDnew promoters for their chromatin status or motifs enrichment/distribution with our tools. If you want to restrict the analysis to a subset of promoters please use the promoter selection tool page. ...
The double truncation constructs, P3 and P4, are both lacking 449 nts immediately upstream the ATG translation start codon. The absence of this region does not seem to be critical for promoter functionality, since the activity was comparable to the full-length construct (Sps1) and other mutants (Sps2-Sps6) all of which include these initial 449 upstream nts at their 3 end. As concluded from P3, the removal of nts upstream 1167 from the 5 end did not reduce activity. Therefore a series of 5-truncations were made to narrow the critical promoter region. Up to construct Sps6 which includes nts 1-763 no significant reduction was observed whereas a dramatic loss near almost background levels was noticed for the shorter constructs Sps7 to Sps11. Since construct Sps5, containing 910 nts, exhibits full activity, this 5 end was considered critical and additional constructs were designed by successively truncating 3 nts (ds13-ds17). The four long constructs dS13 - dS16 showed fairly high promoter ...
I want to do a ChIP assay with an antibody against acetylated histone h3. I did a cDNA microarray before and now I want to check if the genes I found there are really regulated by histone acetylation. Thats why I want to do quantitative realtime PCR after the ChIP. The problem is (correct me if I am wrong) that I now have to design primer in the promoter region. And I have no idea how I can do this. Actually I do not even know how to search for the promoter region ...
PR is a classical estrogen-regulated gene (1, 2) and is frequently used as a surrogate marker for functional ERα activity. PR exists in 2 isoforms, PRA and PRB, which are the result of transcription from 2 alternative promoters, and initiation of translation at 2 different AUG codons (3). Structurally, PRB differs from PRA only in that the B receptor contains an additional 164 amino acids at the N-terminus of the protein (4). Despite structural similarities, PRA and PRB possess different functional activities. PRB has been found to be a stronger transcriptional activator than PRA, due in part to a third activation domain (AF-3) within the N-terminal 164 amino acids (5). On the other hand, PRA has been shown to act as a repressor which can inhibit other receptors, including ER and PRB (6). PRA and PRB regulate different sets of genes-of 94 progesterone-regulated genes, 65 were uniquely regulated by PRB, 4 uniquely by PRA, and only 25 by both (7). Moreover, the unliganded PR can regulate gene ...
As an anti-inflammatory mediator IL10 is beneficial in certain contexts and deleterious in others. As increased production of IL10 favours protection against inflammatory disease, whereas low production promotes elimination of foreign pathogens by the host, we investigated the possible influence of balancing selection at this locus. We began by resequencing 48 European and 48 African chromosomes across 2.2 kb of the IL10 promoter region, and compared this with four neighbouring gene regions: MK2, IL19, IL20 and IL24. Analysis of nucleotide diversity showed a positive Tajimas D-test for IL10 in Europeans, of borderline statistical significance (1.89, P=0.05). Analysis of F(st) values showed significant population divergence at MK2, IL19, IL20 and IL24 (P,0.01) but not at IL10. Taken together, these findings are consistent with the hypothesis that balancing selection has played a role in the evolution of polymorphisms in the IL10 promoter region.. ...
All fusion proteins for the two types of a light-switchable promoter system has been finished (BBa_K801039, BBa_K801040 and BBa_K801041), also pTEF1 driven gene expression batteries coding for all components of each type of our light-switchable promoter system has been done (BBa_K801042 and BBa_K801043). GAL4 based light-switchable promoter system is working fine! LexA based light-switchable promoter system even works more efficient but reporter construct (BBa_K165031, iGEM08_BrownTwo) is extremly leaky due to suboptimal LexA binding elements, which contains the TATATAA sequence of the typical yeast TATA-Box. The solution to prevent high basal gene expression is to create a minimal promoter preceded by DNA motifs which are recognized by LexA but do not contain the TATA sequence (e. g.: BBa_K079039 or BBa_K079040). A general improvement to lower the basal activity and to get an higher S/N-ratio in both systems is to use low-copy yeast plasmids instead of high-copy plasmids. ...
Delezione 13q14.3 Subclinical chronic lymphocytic leukaemia associated with a 13q deletion presenting initially in the skin: apropos of a case. 2006. Human RFP2 gene promoter: unique structure and unusual strength.. Human gene RFP2 is a candidate tumor suppressor located at 13q14.3 and deleted in multiple tumor types. To explore regulation of RFP2, we determined structure of the 5-untranslated region of RFP2 gene and its promoter. RFP2 promoter area is TATA-less, highly enriched in G and C nucleotides, and contains multiple quadruplex forming GGGGA-repeats. Deletion analysis of 5-flanking sequences demonstrated that repeat containing fragment possesses activity seven times exceeding that of the combined SV40 promoter/enhancer. Other unusual features of the RFP2 promoter include anomalously high electrostatic fields induced by sequence-dependent dipoles and very low nucleosome forming potential. A "minimized" version of the RFP2 promoter could be used for overexpression of the various ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Stable expression of a defense-related gene in wheat epidermis under transcriptional control of a novel promoter confers pathogen ...
Expression vectors usually contain a promoter that is recognized by the host organism and is operably linked to the gene of interest. Promoters are untranslated sequences located upstream (5) to the start codon of a structural gene (generally within about 100 to 1000 bp) that control the transcription and translation of a particular nucleic acid sequence to which they are operably linked. Such promoters typically fall into two classes, inducible and constitutive. Inducible promoters are promoters that initiate increased levels of transcription from DNA under their control in response to some change in culture conditions, e.g., the presence or absence of a nutrient or a change in temperature. At this time a large number of promoters recognized by a variety of potential host cells are well known in the art. These promoters are operably linked to the gene of interest by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the ...
Sigma-Aldrich offers abstracts and full-text articles by [George E Liu, Matthew T Weirauch, Curtis P Van Tassell, Robert W Li, Tad S Sonstegard, Lakshmi K Matukumalli, Erin E Connor, Richard W Hanson, Jianqi Yang].
The human telomerase reverse transcriptase (T) is highly expressed in a majority of cancer types but not in normal cells, which allows it to be used as a tumor biomarker (15, 17, 18). Previously, we identified and validated the specificity of the T promoter in ovarian cancer and showed that its activity was enhanced by the VISA amplification system (15). In this study, our results further showed that the T promoter is specifically activated in breast cancer cells but had much weaker activity than the CMV promoter. Using the VISA system that was initially developed for pancreatic cancer (13), we have since then showed that this system is highly active in ovarian (15), lung (16), and liver (30) cancers. With the goal of further developing a robust and breast tumor-specific vector, we incorporated the T promoter into our VISA system and constructed T-VISA expression carrier. Our engineered T-VISA is a composite that contains 3three basic elements: the T promoter, the TSTA system, and the WPRE ...
The systematic prediction and categorisation of promoters, repressors, enhancers, etc., is not only essential to unravel the inner workings of biochemical networks, but also to engineer novel synthetic ones. Each putative regulatory region, however, has to be validated experimentally in order to be categorized as a fully defined functional element, which constitutes a significant bottleneck. In most studies, the promoter activity is illustrated as the amount of fluorescence divided by the optical density. These values are obtained from a coupled time-series experiment. With relatively simple mathematical reasoning, a tool that describes promoter activity in each time point has been implemented. The protein expression and the protein maturation process are modelled as a first order differential equations taking into account the degradation and the maturation rates which are to be known in advance. The promoter activity is then expressed based on the measured quantities of optical density and ...
I am trying to clone a promoter controlling the expression of a reporter gene. The promoter has never been cloned before so there arent plasmids aviable to perform a subcloning. I planned to amplify the promoter from genomic DNA. In order to know the secuence of the promoter I search my gene in the web site of the ensembl project (ensembl.org) and I designed degenerated primers (only 1 mismatch) to amplify 1200 pb from the first exon of the gene to the upstream sequence. I finaly got the amplificate of the exact size I expected, and I cut it with restriction enzimes to be sure that it was the promoter. However the cuts didnt appear where they were supposed to be. So I would like to ask ...
The availability of high-density genotype data for mice has made it possible to quantify the relationship between haplotype structure and differential gene expression. A relationship between SNP in the 1 kb upstream region and differential expression was only observable when using a stringent test of differential expression (absolute log2 fold change , 0.5; pplr , 0.005). This was interpreted as evidence that the variance of expression of cis regulated genes is much lower than that of trans regulated genes. Although the 1 kb upstream region may contain the highest density of regulatory elements it does not contain all of them, they can be spread throughout the gene and its 3 region as well as going tens to hundreds of kilobases upstream. Therefore we are likely to have underestimated the numbers of cis regulated genes using this strategy. However SNP in the upstream region will frequently be markers for larger haplotypes that extend into or through the whole gene region so these regions will ...
Thread... Lets say that a highly-profitable, listed business is un-leveraged but its promoters are highly leveraged in their personal balance sheets. Lets also say that loans taken by the promoters are secured by the collateral of the promoters shares in the listed company. Lets further assume that the mistakes were made by the promoters with…
το κείμενο με τίτλο Automatic discovery of regulatory patterns in promoter regions ... σχετίζετε με Βιοτεχνολογία
We present experimental evidence for the existence of multiple activator-binding sites in the upstream sequence of the ompC promoter, the expression of which is activated by the positive regulator OmpR in response to the osmolarity of the medium. We also found that a single OmpR-binding site can activate the ompC promoter, providing that the binding site is close and placed stereospecifically with respect to the canonical-35 and -10 regions. ...
Promoter activities of genes in the FliA-FlgM module.The promoter activities of fliA (green), flgM (red), and tar (blue) measured by means of fluorescent report
View Test Prep - BMB400Test_2 from BMB 400 at University of Maine Orono. BMB 400 Dr. Keith Hutchison 12/18/07 Exam 2 1) Here is my sequence and the binding sites within it: My promoter region was
This gene encodes a protein that is conserved across metazoans. In vertebrates, this gene is linked in a head-to-head arrangement with the adjacent parkin gene, which is associated with autosomal recessive juvenile Parkinsons disease. These genes are co-regulated in various tissues and they share a bi-directional promoter. Both genes are associated with susceptibility to leprosy. The parkin co-regulated gene protein forms a large molecular complex with chaperones, including heat shock proteins 70 and 90, and chaperonin components. This protein is also a component of Lewy bodies in Parkinsons disease patients, and it suppresses unfolded Pael receptor-induced neuronal cell death. Multiple transcript variants encoding different isoforms have been found for this gene.
Our comprehensive collection contains more than 18,000 endogenous human promoter reporter GoClone® constructs that are transfection-ready with no DNA preparation required. Our reporters contain a novel luciferase gene for industry-leading sensitivity ...
Our comprehensive collection contains more than 18,000 endogenous human promoter reporter GoClone® constructs that are transfection-ready with no DNA preparation required. Our reporters contain a novel luciferase gene for industry-leading sensitivity ...
Inactivation of TSGs can occur at many levels. Most often, they occur genetically and epigenetically by affecting transcriptional, translational, and post-translational regulation. This governs the amount and activity of tumor suppressor proteins.. Genetic Mechanisms. At the molecular level, multiple mechanisms exist whereby a TSG may be inactivated (3).. 1. Mutations in the DNA can result in inactive/dysfunctional forms of TSGs.. Mutations in TSGs can result in decreased or non-fuctional proteins or can interfere with other functioning proteins, resulting in a cell that is more likely to escape control mechanisms in place and become cancerous. These mutations can occur within the coding regions of the gene or at splice sites. Mutations at the latter may cause splicing errors that render the protein functionally null.. 2. Mutations in cis-/trans-acting elements or in the promoter region of a TSG.. Cis/trans-acting elements and the promotor region of a TSG play critical roles in driving and ...
The present invention provides methods and systems for regulating delivery of therapeutic proteins and nucleic acids. Specifically, this involves using a genetically engineered electrically responsive promoter operably linked to a therapeutic gene sequence, wherein expression of said sequence is controlled by an electrical pulse generator
Assume we have a set of sequences upstream of genes that are involved in a pathway with a common function. Since these genes are to be regulated more or less simultaneously, common regulatory factors or CIS-acting elements are likely to be involved. We want to investigate if, among the set of sequences, certain motifs are responsible for the regulation. An indication for this would be if we can find motifs that are present very frequently.
Col10a1 promoter activity is up-regulated via RUNX2 binding elements in vitro. (A) Transactivation of Col10a1 via RUNX2-binding A and B elements. The RUNX2 expr
Plasmid HB401: pMVP (L1-L4) CMV promoter from Dr. Christopher Newgards lab contains the insert CMV promoter and is published in Nucleic Acids Res. 2018 Dec 27. pii: 5264291. doi: 10.1093/nar/gky1286. This plasmid is available through Addgene.
Promoters play a central role in transcription initiation and gene regulation, so it is necessary for these DNA regions to be differentiated from non-promoter sequences. Sequence motif based computational methods have not been able to identify these regio
Choose the promoter option that has been demonstrated, either by your own experimental observations or through references in the published literature, to actively express a transgene in your cells of choice. For optimal experimental confidence or if such information is not available, consider using multiple lentiviral promoter-Cas9 constructs or selecting the best promoter empirically using the Dharmacon SMARTchoice Promoter Selection Plate Cat #SP-001000-01 ...
Lentivirus with CMV promoter-driven expression of chromosome 17 open reading frame 76 (C17orf76), transcript variant 1 in pLenti vector with puromycin selection and C-terminal Myc and FLAG tags.
Lentivirus with CMV promoter-driven expression of potassium channel, subfamily K, member 17 (KCNK17), transcript variant 1 in pLenti vector with puromycin selection and C-terminal Myc and FLAG tags.
To me, distance between two genes would be the distance between the two transcriptional start sites. So I would just take the two TSS and get the absolute differences between them. This makes sense if you are looking into transcriptional regulation as its about promoters ( even if its about enhancers, they usually loop to the gene promoters).. If you are looking for something else, I am not sure what would be the best to consider as ...
Customers can choose from the varied promoter types and fusion tags; and get their target genes cloned into these engineered vectors (refer the schematic representation image). These clones are ideal for protein over-expression studies in E. coli. ...
Cancer therapy that specifically targets malignant cells with minimal or no toxicity to normal tissue has been a long-standing goal of cancer research. Rad51 expression is elevated in a wide range of cancers and Rad51 promoter has been used to transcriptionally target tumor cells, however, a large s …
Table 1 Primer sequences used: A Homeobox-specific PCR: 1 #2606 HOX-A 5GT(GC)AA(GA)AT(CT)TGGTT(CT)CA(GA)AA3 2 #2607 HOX-B 5AA(GA)AT(CT)TGGTT(CT)CA(GA)AA(CT)CG3 3 #4661 T7-promoter sequence 5AATACGACTCACTATAGGG3 B Distal-less-specific: Set# 1 1. #3779 Sense 5AGCCCCAACAACAGCGATT3 2. #5731 4534 + T7 promoter 5AATACGACTCACTATAGGGTATTGACAGAGGTGTGGGC3 Set# 2 1. #4534 Antisense 5TATTGACAGAGGTGTGGGC3 2. #4416 3779 + T3 promoter 5AATTAACCCTCACTAAAGGGAGCCCCAACAACAGCGATT3 C Anterior neural fold-specific: Set#3 1. #3780 Sense 5TAATTCCACCTCCAGCCTG3 2. #5732 4659 + T7 promoter 5AATACGACTCACTATAGGGCCTCTCCCAGCAAATTAAG3 Set#4 1. #4659 Antisense 5CCTCTCCCAGCAAATTAAG3 2. #4657 3780 + T3 promoter 5AATTAACCCTCACTAAAGGGTAATTCCACCTCCAGCCTG3 ...
In silico cis -analysis. promoter analysis Promoters and cis -elements Searching for patterns Searching redundant patterns. What is a promoter?. and why care about it?. AAAAAAAA. CDS. A little about these. cis-elements - Transcription Factors (TF) often bind to them Slideshow 6988126...
JASPAR motifsSummary:Association of JASPAR motif to the promoter expression in this sample. Pearsons correlation between the number of TFBSs estimated by using the position-weight matrix for each promoter and its expression is expressed as Z-score by taking the ones based on random position-weight matrix, and the tail probability of the normal distribution corresponding to the Z-score is taken as the resulting P-value. Lower P-value indicates more (non-random) association of the motif to promoter ...
JASPAR motifsSummary:Association of JASPAR motif to the promoter expression in this sample. Pearsons correlation between the number of TFBSs estimated by using the position-weight matrix for each promoter and its expression is expressed as Z-score by taking the ones based on random position-weight matrix, and the tail probability of the normal distribution corresponding to the Z-score is taken as the resulting P-value. Lower P-value indicates more (non-random) association of the motif to promoter ...
NFAM1, 0.1 ml. . The protein encoded by this gene is a type I membrane receptor that activates cytokine gene promoters such as the IL-13 and TNF-alpha promoters.
To reap the greatest benefits from a tool, a company must embed it in its operations and ways of working, rather than bolting it on as a separate project or through a separate team. Embedding it is the only way to change behavior in the organization. For instance, embedding AI throughout a call center, which changes how agents work, will yield far greater results than piloting AI to automate sorting in the mail room.. Consider how sportswear giant Adidas has concentrated its resources on a few tools crucial to its business. The Net Promoter System®, for instance, has proven valuable on several fronts, such as aligning the senior team and the entire organization around the consumers priorities. In fact, Adidas ties part of all employee bonuses to the brands Net Promoter Score® relative to competitors. The company tracks its customer experience Net Promoter Score across the world to quickly identify topics of detraction, teasing out the business impact of the topic, strategic relevance and ...
Gentaur molecular products has all kinds of products like :search , Gene Link \ SP6 Promoter primer 24mer \ 26-3000-07 for more molecular products just contact us
The new AutoRegulatoryNetwork plugin keeps track of how the genetic parts, such as promoters, coding sequence, etc. are moved. Whenever coding parts are placed downstream of a promoter, the coding parts will receive an Assignment rule that sets the coding parts value equal to the promoter parts value. Remember that value refers to the the activity numerical attribute for genetic parts such as promoter, rbs, coding, etc ...
499 GTAGCCGTCA AGATTGTGTT GGGTCGTTGC TTTCTTGTTG TTTTAAATCA CGGTCATGTG -439 TTTGGCAAGG GTGCTGGTTA ACCGAAAATG TTGGTTCTAG AGCTAGAAGT ACTGGCATTC -379 AAATAAACAT ATTTGGGGGT TGGGGGTTGA TGAGCAAGGC TGGGAGGAGA CAAAAGAAGT -319 ATCTCGGCTC AGTCGTCAGA GACGCGCAAG GTGTAACGGA GAGAGCAATC TAGGTTGTGA -259 GAGTGGCTCC AAACATTGAG ACATGGAGCC AGGACCTTTG CTCCTGGGGG ATGGCCCTAG -199 TACTGATGCG CAGGACCTGG TCCTTGAAGG AGCTGACAAA ACTGCCGTTC ACCCGCGCGA -139 CCACCGGCAA AGCAGCTCCA CAGCCTGCCC CTCCCCTTGG CTGCTCCCCC ACCCATTTCC -79 CGCCTTGTCT TTCCTCTCTT CTCTCTCTCC CTCCTCCCTG CGCGAAGCGG AAGTGACGCG -19 AGGCGTAGCG GAAGTTACTG CAGCCGCGGT GTTGTGCTGT GGGGAAGGGA GAAGGATTTG , TSS 41 TAAACCCCGG AGCGAGGTTC TGCTTACCCG AGGCCGCTGC TGTGCGGAGA CCCCCGGGTG ...
Karpova T.S, Kim M.J, Spriet C, Nalley K, Stasevich T, Kherrouche Z, Heliot L, McNally J.G Concurrent Fast and Slow Cycling of a Transcriptional Activator at an Endogenous Promoter. Sciences (2008 ...
Using AngularJS within the Iconic Framework, you can build a quality mobile app by using special form elements. This online video will show you how to add two specific elements: ranges and select popups. You will learn how to code a range that has icons and colors, as well as how to create a popup list, from which you can pick elements to enrich your application.
We found that 7133 promoter we have been used has a sequence of 7113 promoter. Please read all g7133 h in this manual as g7113 h ...
TY - JOUR. T1 - ApoE -491A/T promoter polymorphism is not an independent risk factor, but associated with the ε4 allele in Hungarian Alzheimers dementia population. AU - Juhász, Anna. AU - Palotás, András. AU - Janka, Zoltán. AU - Rimanóczy, Ágnes. AU - Palotás, Miklós. AU - Bódi, Nikoletta. AU - Boda, Krisztina. AU - Zana, Marianna. AU - Vincze, Gábor. AU - Kálmán, János. PY - 2005/5/1. Y1 - 2005/5/1. N2 - Apolipoprotein E gene (Apoε) has three common alleles (ε2, ε3, and ε4), of which ε4 has been shown to be associated with an increased risk for Alzheimers disease (AD). Possible additional genetic factors, like the -491A variant of ApoE promoter may modify the development of AD, independently of the ApoE allele status. The objective of this study was to investigate whether A/T allelic polymorphism at site-491 of the ApoE promoter is associated with AD in a Hungarian population. The genomic DNA isolated from peripheral blood lymphocytes of 52 late-onset AD and 53 control ...
TY - JOUR. T1 - Exendin-4 as a stimulator of rat insulin I gene promoter activity via bZIP/CRE interactions sensitive to serine/threonine protein kinase inhibitor Ro 31-8220. AU - Chepurny, Oleg G.. AU - Hussain, Mehboob. AU - Holz, George G.. PY - 2002. Y1 - 2002. N2 - Signal transduction properties of exendin-4 (Ex-4) underlying its ability to stimulate rat insulin I gene promoter (RIP1) activity were assessed in the pancreatic β-cell line INS-1. Ex-4 acted via glucagon-like peptide-1 receptors to stimulate RIP1 in a glucose-dependent manner, as measured in cells transfected with a -410-bp RIP1-luciferase construct (RIP1-Luc). The action of Ex-4 was independent of cAMP and PKA because it was not blocked by cotransfection with dominant-negative Gαs, was unaffected by pretreatment with the membrane-permeant cAMP antagonist 8-Br-Rp-cAMPS, and remained apparent after treatment with PKA inhibitors H-89 or KT 5720. Similarly, cotransfection with a dominant-negative isoform of the type-2 ...
The physiological role of TFIIA was investigated by analyzing transcription in a yeast strain that contains a TATA-binding protein (TBP) mutant (N2-1) defective for interacting with TFIIA. In cells containing N2-1, transcription from a set of artificial his3 promoters dependent on different activators is generally reduced by a similar extent, indicating that TFIIA function is largely nonselective for activators. In addition, TATA element utilization, a core promoter function, is altered at his3 promoters dependent on weak activators. Genomic expression analysis reveals that 3% of the genes are preferentially affected by a factor of 4 or more. Chimeras of affected promoters indicate that the sensitivity to the TFIIA-TBP interaction can map either to the upstream or core promoter region. Unlike wild-type TBP or TFIIA, the N2-1 derivative does not activate transcription when artificially recruited to the promoter via a heterologous DNA binding domain, indicating that TFIIA is important for transcription
Succinoglycan (EPS I), the main acidic exopolysaccharide of Sinorhizobium meliloti, is required for the initiation and elongation of infection threads during nodulation of the host plant alfalfa. The gene products of the exoYFQ operon are involved in the first step of succinoglycan biosynthesis as well as in the polymerisation of subunits to the high-molecular-mass form of this exopolysaccharide. One promoter region that directs transcription of exoX and two promoter regions that drive transcription of exoY were mapped in the exoX-exoY intergenic region. The distal exoY promoter region containing three putative -10 promoter elements was active under standard growth conditions and was subject to ExoR-dependent regulation. Although this promoter region was stimulated in a phoB mutant, no PHO box-like sequences were found, suggesting an indirect regulatory effect of PhoB. The proximal promoter contains a PHO box-like sequence in the putative - 35 region and was affected by low and high phosphate ...
cytosol, nucleus, centromeric DNA binding, chromatin binding, DNA replication origin binding, RNA polymerase II core promoter proximal region sequence-specific DNA binding, sequence-specific DNA binding, transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding, transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding, anatomical structure morphogenesis
Tumor‑specific promoter hypermethylation of large tumor suppressor, homolog 2 (LATS2), a tumor suppressor gene, has been investigated using methylation‑specific polymerase chain reaction (MSP) assays in different types of human cancer producing conflicting results. The aim of the present study was to evaluate the methylation status of the LATS2 promoter region using bisulfite sequencing with a next generation sequencer for breast cancer. In the 11 patients enrolled in the present study, the LATS2 promoter methylation index (MI) was uniformly high in tumor and normal tissues of the breast (median, 84.0 and 87.4%, respectively). The presence of LATS2 promoter hypermethylation was confirmed in isolated tumor cells and normal epithelial cells using the magnetic‑activated cell sorting method. In situ hybridization for LATS2 messenger RNA (mRNA) revealed that the mRNA expression of LATS2 was higher in normal epithelial cells, compared with tumor cells, however, it was not significantly ...
Transgenic techniques offer a valuable tool for determining gene functions. Although various promoters are available for use in gene overexpression, gene knockdown, and identification of transgenic individuals, there is nevertheless a lack of versatile promoters for such studies, and this dearth acts as a bottleneck, especially with regard to nonmodel organisms. Here, we succeeded in identifying a novel strong and ubiquitous promoter/enhancer in the silkworm. We identified a unique silkworm strain whose reporter gene showed strong and ubiquitous expression during the establishment of enhancer trap strains. In this strain, the transposon was inserted into the 5′UTR of hsp90, a housekeeping gene that is abundantly expressed in a range of tissues. To determine whether the promoter/enhancer of hsp90 could be used to induce strong gene expression, a 2.9-kb upstream genomic fragment of hsp90 was isolated (hsp90P2.9k), and its transcriptional activation activity was examined. Strikingly, hsp90P2.9k ...
In plant genetic engineering, the identification of gene promoters leading to particular expression patterns is crucial for the development of new genetically modified plant generations. This research was conducted in order to isolate and characterize several new promoters from cassava (Manihot esculenta Crantz) elongation factor 1 alpha (EF1A) gene family. Three promoters MeEF1A3, MeEF1A4 and MeEF1A5 were successfully isolated. Sequence analyses showed that all of the promoters contain three conserved putative cis-acting elements which are located upstream of the transcription start site. These elements are included a TEF1, a TELO and TATA boxes. In addition, all of the promoters also have the 5′UTR intron but with a different lengths. These promoters were constructed translationally with gusAreporter gene (promoter::gusA fusion) in pBI-121 binary vector to build a new binary vector using Overlap Extension PCR Cloning (OEPC) technique. Transient expression assay that was done by using ...
The tRNA(m5U54)methyltransferase, whose structural gene is designated trmA, catalyzes the formation of 5-methyluridine in position 54 of all tRNA species in Escherichia coli. The synthesis of this enzyme has previously been shown to be both growth rate dependent and stringently regulated, suggesting regulatory features similar to those of rRNA. We have determined the complete nucleotide sequence of the trmA operon in E. coli and the sequence of the trmA promoter region in Salmonella typhimurium and also analyzed the transcriptional regulation of the gene. The trmA and the btuB (encoding the vitamin B12 outer membrane receptor protein) promoters are divergent promoters separated by 102 bp between the transcriptional start sites. The trmA promoters of both E. coli and S. typhimurium share promoter elements with the rRNA P1 promoter. The sequence downstream from the -10 region of the trmA promoter is homologous to the discriminatory region found in stringently regulated promoters. Next to and ...
OBJECTIVE: Inactivating mutations in glucokinase (GCK) cause mild fasting hyperglycemia. Identification of a GCK mutation has implications for treatment and prognosis; therefore, it is important to identify these individuals. A significant number of patients have a phenotype suggesting a defect in glucokinase but no abnormality of GCK. We hypothesized that the GCK beta-cell promoter region, which currently is not routinely screened, could contain pathogenic mutations; therefore, we sequenced this region in 60 such probands. RESEARCH DESIGN AND METHODS: The beta-cell GCK promoter was sequenced in patient DNA. The effect of the identified novel mutation on GCK promoter activity was assessed using a luciferase reporter gene expression system. Electrophoretic mobility shift assays (EMSAs) were used to determine the impact of the mutation on Sp1 binding. RESULTS: A novel -71G|C mutation was identified in a nonconserved region of the human promoter sequence in six apparently unrelated probands. Family testing
Incubation of 3T3-L1 preadipocytes with isobutylmethylxanthine (IBMX), dexamethasone, and insulin, alone or in combination, demonstrated that IBMX, which increased cAMP-response element-binding protein (CREB) phosphorylation, was the predominant regulator of Pde3b expression. Real time PCR and immunoblotting indicated that in 3T3-L1 preadipocytes, IBMX-stimulated induction of Pde3b mRNA and protein was markedly inhibited by dominant-negative CREB proteins. By transfecting preadipocytes, differentiating preadipocytes, and HEK293A cells with luciferase reporter vectors containing different fragments of the 5- flanking region of the Pde3b gene, we identified a distal promoter that contained canonical cis-acting cAMP-response elements (CRE) and a proximal, GC-rich promoter region, which contained atypical CRE. Mutation of the CRE sequences dramatically reduced distal promoter activity; H89 inhibited IBMX-stimulated CREB phosphorylation and proximal and distal promoter activities. Distal promoter ...
Conventional wisdom holds that, owing to the dominance of features such as chromatin level control, the expression of a gene cannot be readily predicted from knowledge of promoter architecture. This is reflected, for example, in a weak or absent correlation between promoter divergence and expression divergence between paralogs. However, an inability to predict may reflect an inability to accurately measure or employment of the wrong parameters. Here we address this issue through integration of two exceptional resources: ENCODE data on transcription factor binding and the FANTOM5 high-resolution expression atlas. Consistent with the notion that in eukaryotes most transcription factors are activating, the number of transcription factors binding a promoter is a strong predictor of expression breadth. In addition, evolutionarily young duplicates have fewer transcription factor binders and narrower expression. Nonetheless, we find several binders and cooperative sets that are disproportionately associated
Background: Conventional wisdom holds that, owing to the dominance of features such as chromatin level control, the expression of a gene cannot be readily predicted from knowledge of promoter architecture. This is reflected, for example, in a weak or absent correlation between promoter divergence and expression divergence between paralogs. However, an inability to predict may reflect an inability to accurately measure or employment of the wrong parameters. Here we address this issue through integration of two exceptional resources: ENCODE data on transcription factor binding and the FANTOM5 high-resolution expression atlas. Results: Consistent with the notion that in eukaryotes most transcription factors are activating, the number of transcription factors binding a promoter is a strong predictor of expression breadth. In addition, evolutionarily young duplicates have fewer transcription factor binders and narrower expression. Nonetheless, we find several binders and cooperative sets that are ...
The family of repeats (FR) is a major upstream enhancer of the Epstein-Barr virus (EBV) latent C promoter (Cp) that controls transcription of six different latent nuclear proteins following interaction with the EBV nuclear protein EBNA1. Here, it was shown that Cp could also be activated by octamer-binding factor (Oct) proteins. Physical binding to the FR by the cellular transcription factors Oct-1 and Oct-2 was demonstrated by using an electrophoretic mobility-shift assay. Furthermore, Oct-1 in combination with co-regulator Bob.1, or Oct-2 alone, could drive transcription of a heterologous thymidine kinase promoter linked to the FR in both B cells and epithelial cells. Cp controlled by the FR was also activated by binding of Oct-2 to the FR. This may have direct implications for B cell-specific regulation of Cp.
The "upstream regions of the human CYP11A and bovine CYP11B genes [have] a distal promoter in each gene. The distal promoters are located at −1.8 to −1.5 kb in the upstream region of the CYP11A gene and −1.5 to −1.1 kb in the upstream region of the CYP11B gene."[11] "Using cloned chicken βA-globin genes, either individually or within the natural chromosomal locus, enhancer-dependent transcription is achieved in vitro at a distance of 2 kb with developmentally staged erythroid extracts. This occurs by promoter derepression and is critically dependent upon DNA topology. In the presence of the enhancer, genes must exist in a supercoiled conformation to be actively transcribed, whereas relaxed or linear templates are inactive. Distal protein-protein interactions in vitro may be favored on supercoiled DNA because of topological constraints."[12] Distal promoter regions may be a relatively small number of nucleotides, fairly close to the TSS such as (-253 to -54)[13] or several regions of ...
The Pem gene encodes an atypical homeodomain protein, distantly related to Prd/Pax family members, that we demonstrate is regulated in a complex transcriptional and post-transcriptional manner. We show that the rat Pem genomic structure includes three 5-untranslated (5-UT) exons and four coding exons, three of which encode the homeodomain. Several alternatively spliced transcripts were identified, including one that skips an internal coding exon, enabling this mRNA to express a novel form of the Pem protein. Other alternatively spliced mRNAs were characterized that possess different 5-UT regions, including a muscle-specific transcript. The different 5-UT termini present in Pem transcripts conferred different levels of translatability in vitro. Two promoters containing multiple transcription initiation sites were identified: a distal promoter (Pd) in the first 5-UT exon and a proximal promoter (Pp) located in the intron upstream of the first coding exon. The Pd was active in placenta, ovary, tumor
ERα and ERβ exert differential effects on the transcriptional activity of the human PAI-1 promoter in transient transfection studies using cultured endothelial cells. Our experiments demonstrate that ERα increases the promoter activity of PAI-1 promoter fragments in response to estrogen. ERα interacts with at least 1 ERE located at position −422 in the proximal PAI-1 promoter to elicit this estrogen-dependent activation of the PAI-1 promoter. In contrast, ERβ fails to induce, and in fact may suppress, the activity of PAI-1 promoter constructs tested in BAECs through an estrogen-independent mechanism. Furthermore, ERβ exerts a dominant-negative effect on ERα to blunt the estrogen-dependent activation of the PAI-1 promoter in BAECs. Based on these findings, we speculate that the balance of ERα and ERβ in vascular tissue modulates vascular PAI-1 production via estrogen-dependent and estrogen-independent mechanisms.. The observations reported here are consistent with recent studies that ...
We have isolated the 5 region of the ecto-5-nucleotidase (low K(m) 5-NT) gene and established that a 969-base pair (bp) fragment confers cell-specific expression of a CAT reporter gene that correlates with the expression of endogenous ecto-5-NT mRNA and enzymatic activity. A 768-bp upstream negative regulatory region has been identified that conferred lymphocyte-specific negative regulation in a heterologous system with a 244-bp deoxycytidine kinase core promoter. DNase I footprinting identified several protected areas including Sp1, Sp1/AP-2, and cAMP response element (CRE) binding sites within the 201-bp core promoter region and Sp1, NRE-2a, TCF-1/LEF-1, and Sp1/NF-AT binding sites in the upstream regulatory region. Whereas the CRE site was essential in mediating the negative activity of the upstream regulatory region in Jurkat but not in HeLa cells, mutation of the Sp1/AP-2 site decreased promoter activity in both cell lines. Electrophoretic mobility shift assay analysis of proteins ...
The human tumor necrosis factor alpha (TNF-alpha) gene is one of the earliest genes transcribed after the stimulation of a B cell through its antigen receptor or via the CD-40 pathway. In both cases, induction of TNF-alpha gene transcription can be blocked by the immunosuppressants cyclosporin A and FK506, which suggested a role for the NFAT family of proteins in the regulation of the gene in B cells. Furthermore, in T cells, two molecules of NFATp bind to the TNF-alpha promoter element kappa 3 in association with ATF-2 and Jun proteins bound to an immediately adjacent cyclic AMP response element (CRE) site. Here, using the murine B-cell lymphoma cell line A20, we show that the TNF-alpha gene is regulated in a cell-type-specific manner. In A20 B cells, the TNF-alpha gene is not regulated by NFATp bound to the kappa 3 element. Instead, ATF-2 and Jun proteins bind to the composite kappa 3/CRE site and NFATp binds to a newly identified second NFAT site centered at -76 nucleotides relative to the ...
Divergence of transcription factor binding sites is considered to be an important source of regulatory evolution. The associations between transcription factor binding sites and phenotypic diversity have been investigated in many model organisms. However, the understanding of other factors that contribute to it is still limited. Recent studies have elucidated the effect of chromatin structure on molecular evolution of genomic DNA. Though the profound impact of nucleosome positions on gene regulation has been reported, their influence on transcriptional evolution is still less explored. With the availability of genome-wide nucleosome map in yeast species, it is thus desirable to investigate their impact on transcription factor binding site evolution. Here, we present a comprehensive analysis of the role of nucleosome positioning in the evolution of transcription factor binding sites. We compared the transcription factor binding site frequency in nucleosome occupied regions and nucleosome depleted regions
GO Terms Descrition:, periodic partitioning by pair rule gene, central nervous system development, RNA polymerase II distal enhancer sequence-specific DNA binding, positive regulation of transcription from RNA polymerase II promoter, trunk segmentation, cell fate specification, RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity, RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription, regulation of transcription from RNA polymerase II promoter, blastoderm segmentation, negative regulation of transcription from RNA polymerase II promoter, regulation of transcription, DNA-templated, sequence-specific DNA binding transcription factor activity, nucleus, sequence-specific DNA binding, gonadal mesoderm development, segmentation, posterior head segmentation, germ cell migration ...
Merkel cell carcinoma (MCC) is one of the most aggressive cancers of the skin. RASSFs are a family of tumor suppressors that are frequently inactivated by promoter hypermethylation in various cancers. We studied CpG island promoter hypermethylation in MCC of RASSF2, RASSF5A, RASSF5C and RASSF10 by combined bisulfite restriction analysis (COBRA) in MCC samples and control tissue. We found RASSF2 to be methylated in three out of 43 (7%), RASSF5A in 17 out of 39 (44%, but also 43% in normal tissue), RASSF5C in two out of 26 (8%) and RASSF10 in 19 out of 84 (23%) of the cancer samples. No correlation between the methylation status of the analyzed RASSFs or between RASSF methylation and MCC characteristics (primary versus metastatic, Merkel cell polyoma virus infection, age, sex) was found. Our results show that RASSF2, RASSF5C and RASSF10 are aberrantly hypermethylated in MCC to a varying degree and this might contribute to Merkel cell carcinogenesis.
The chicken ovalbumin upstream promoter transcription factors (COUP-TFs) are members from the steroid/thyroid hormone receptor superfamily and function in transcriptional regulation of a multitude of genes. of the ovalbumin gene (Bagchi et al., 1987; Pastorcic et al., 1986; Wang et Procyanidin B3 inhibitor Mouse monoclonal to Human Albumin al., 1987). It was found to bind an element (COUP) between C90 and C70 within the ovalbumin promoter that is much like thyroid and estrogen response elements (Pastorcic et al., 1986). The COUP-TF has also been shown to bind cis-elements involved in positive transcription rules in the rat insulin II (Hwung et al., 1988; Hwung et al., 1988b), chicken VLDL II (Wijnholds et Procyanidin B3 inhibitor al., 1988), and human being apolipoprotein AI and CIII genes (Ladias and Karathanasis, 1991). It was also reported to bind to bad regulatory elements in the proopiomelanocortin (Drouin et al., 1989a; Drouin et al., 1989b) and HIV-1 (Cooney et al., 1991) promoters. The ...
TY - CHAP. T1 - Osteonectin promoter-mediated suicide gene therapy of prostate cancer. AU - Hsiao, Wan Chi. AU - Sung, Shian Ying. AU - Chung, Leland W.K.. AU - Hsieh, Chia Ling. PY - 2019/1/1. Y1 - 2019/1/1. N2 - Suicide gene therapy using the herpes simplex virus thymidine kinase (HSV-tk) gene, combined with the prodrug ganciclovir (GCV) medication, is a promising approach for the treatment of malignant tumors, including prostate cancer. The success of this therapeutic strategy requires tissue- or tumor-specific gene expression and efficient gene delivery. In this chapter, we describe the experimental protocols of key methodologies, including promoter construction, reporter assay, adenoviral vector construction and preparation, HSV-tk enzymatic assay and cytotoxicity assay to evaluate the specificity and efficacy of osteonectin promoter-mediated HSV-tk/GCV suicide gene therapy of prostate cancer.. AB - Suicide gene therapy using the herpes simplex virus thymidine kinase (HSV-tk) gene, combined ...
The endogenous opioid enkephalin neuropeptides are mediators of pain perception and have been implicated in human addictions. The preproenkephalin gene and its mRNA have also provided many examples of tissue- and species-specific variations in mRNA structure produced through a variety of transcriptional and post-transcriptional mechanisms. Resultant differences in mRNA structure, in several cases, have impact on translation of enkephalin prepropeptide. The reports and discussion presented herein describe studies of the preproenkephalin gene and mRNA structure in the guinea pig, an animal that may have specific advantages for modeling the human endogenous opioid system. A guinea pig brain cDNA library was constructed and screened for clones of preproenkephalin and preprodynorphin, which were then sequenced. These studies confirmed the predicted mRNA structure that had been previously proposed based on homology with gene sequences and other methods. Multiple transcription initiation sites for each ...
Although no functional studies to assess the role of the described HAMP polymorphism on hepcidin expression have been performed, our findings suggest that the presence of this polymorphic variant might play a role in iron metabolism of poly-transfused thalassemic patients,11-14 perhaps changing the response to the transcriptional activation by both upstream stimulatory factors 1 and 2 (USF1/USF2) and cMyc/Max heterodimers that occur through E-boxes within the promoter, as shown by Bayele.5 Alterations of these elements might render the promoter less responsive to USF1/USF2 or c-Myc/Max, modifying regulation of the hepcidin transcription factors and its function in iron metabolism.5. The c.-582 A,G HAMP-P variant did not show an impact on the level of iron loading in the regular chelated patients, while it influenced the LIC values and the serum ferritin among the patients receiving an irregular chelation treatment. These observations suggest that this HAMP-P polymorphism may be associated with ...
The promoter region in higher eukaryotes. ISBN 0-7167-3520-2. Diakses tanggal 2010-08-17.. Pemeliharaan CS1: Banyak nama: ... An Introduction to Genetic Analysis. University of British Columbia, University of California, Harvard University (edisi ke-7 ... Glossary - Promoter. ISBN 0-7167-3520-2. Diakses tanggal 2010-08-17.. Pemeliharaan CS1: Banyak nama: authors list (link) ... Rangsangan akan mengaktifkan bagian promoter inti,[2] segmen gen yang berfungsi sebagai pencerap RNA polimerase[3] yang ...
UGT1A1 is associated with a TATA box promoter region; this region most commonly contains the genetic sequence A(TA6)TAA; this ... the most common of which results from adding another dinucleotide repeat TA to the promoter region, resulting in A(TA7)TAA, ... most commonly due to a polymorphism in the promoter region of the UGT1A1 gene". Journal of Hepatology. 33 (3): 348-351. doi: ... "Genetic variation in bilirubin UPD-glucuronosyltransferase gene promoter and Gilbert's syndrome". Lancet. 347 (9001): 578-81. ...
Promoters are relatively short sequences of DNA which include the site where transcription is initiated and the region ... The most efficient way for an organism to regulate genetic expression is at the transcriptional level. CREs function to control ... The most well characterized types of CREs are enhancers and promoters. Both of these sequence elements are structural regions ... must bind sequentially to this region. Only once this region has been bound with the appropriate set of TFs, and in the proper ...
The 3' coding region of mir-433 is also the promoter of the neighbouring miRNA gene: mir-127. The two genes overlap and are ... This is a method by which genetic information can be stored in a compact and efficient way. Mir-433, along with the other ... No such association was found between mir-433 variation and Parkinson's disease despite the fact that variation in the region ... A single nucleotide polymorphism (SNP) in the 3' untranslated region (UTR) of HDAC6 was found to segregate with the ...
A genetic variation in the Kv1.3 promoter region is associated with low insulin sensitivity and impaired glucose tolerance. ... "Topology of the pore-region of a K+ channel revealed by the NMR-derived structures of scorpion toxins". Neuron. 15 (5): 1169-81 ... "A family of three mouse potassium channel genes with intronless coding regions". Science. 247 (4945): 973-5. doi:10.1126/ ...
Therefore, genetic markers that are close to the region of interest in chromosome 6q24 can be selected. Chromosome duplication ... It was discovered that a differentially methylated region (DMR) is present within the shared promoter of these genes. Generally ... Different genetic inheritance or genetic mutations can lead to different diagnosis of NDM (Permanent or Transient Neonatal ... The prognosis can be confirmed with genetic analysis to find the genetic cause of the disease. WIth proper management, the ...
In addition, the Isoelectric Point of FAM149A is 9.891999 The following is an analysis of the promoter region for FAM149A. It ... shows a number of transcription factor binding sites that may have strong contribution to regulating the genetic expression. ... Here is the promoter for the FAM149A gene provided by ElDorado and the sequence extracted from the information. The following ... Only the dog contains what is considered as an Evolutionary Conserved Region (ECR). Based on the graphs on the right, the ...
The complex binds to the promoter region to activate transcription, enhancing the creation of sucrose phosphorylase (Nelson and ... "Sucrose utilization in bacteria: genetic organization and regulation." Journal of Applied Microbiology & Biotechnology 67.3 ( ... Cox 2005). Genetic regulation of sucrose phosphorylase is also performed by metabolites. Through experimentation it is known ...
... such as the 2R and 3R alleles of the promoter region, have associations with aggressive behavior in men.[27][28] The ... Genetic[edit]. Research into genetic associations in antisocial personality disorder is suggestive that ASPD has some or even a ... Twin studies, which are designed to discern between genetic and environmental effects, have reported significant genetic ... Genetic associations studies have suggested that the short "S" allele is associated with impulsive antisocial behavior and ASPD ...
Stress can also result in inheritable changes DNA methylation in the promoter regions of the estrogen receptor alpha (ERα), ... Small non-coding RNAs may serve as a potential mechanism for stress-related genetic changes in offspring. Mouse models of ... These heritable epigenetic modifications include DNA methylation of the promoter regions of genes that affect sensitivity to ... Evidence of decreased complexity in the CA1 and CA3 region of the hippocampus in terms of dendritic length and spine density ...
A promoter is a region of DNA that facilitates transcription of a particular gene when a transcription factor binds to it. ... Promoters are typically located near the genes they regulate and upstream of them. A genetic insulator is a boundary element ... Ultimately genetic, evolutionary, and biochemical approaches can all be used in a complementary way to identify regions that ... Promoters facilitate the transcription of a particular gene and are typically upstream of the coding region. Enhancer sequences ...
At the ends of the linear chromosomes are specialized regions of DNA called telomeres. The main function of these regions is to ... Genetic engineering. Further information: Molecular biology, Nucleic acid methods, and Genetic engineering ... Genes contain an open reading frame that can be transcribed, and regulatory sequences such as promoters and enhancers, which ... known collectively as the genetic code. The genetic code consists of three-letter 'words' called codons formed from a sequence ...
The SV40 promoter was conventionally used until research showed that vectors driven by the Rous Sarcoma Virus (RSV) promoter ... These "genetic adjuvants" can be administered as a: mixture of 2 plasmids, one encoding the immunogen and the other encoding ... Accessory regions pertaining to the plasmid backbone may engage in a wide range of structural instability phenomena. Well-known ... The advantages of genetic adjuvants are their low cost and simple administration, as well as avoidance of unstable recombinant ...
To date all regulatory regions (promoters) and genes, that have been examined in detail at the molecular level, have TRAM ... According to Dover, TRAM is a genetic system that has features of Non-mendelian inheritance Turnover, copy number and ... Molecular drive is a term coined by Gabriel Dover in 1982 to describe evolutionary processes that change the genetic ... Molecular drive operates independently of natural selection and genetic drift. The best-known such process is the concerted ...
Cytogenetic studies localized the region to the long arm of chromosome 13, and molecular genetic studies demonstrated that ... while in most cases the loss is due to methylation of its promoter region.[50] Similarly, when loss of expression of the DNA ... Genetic heterogeneity in neoplasms[edit]. There are multiple levels of genetic heterogeneity associated with cancer, including ... This theory predicts a unique genetic composition in each neoplasm due to the random process of mutations, genetic ...
Genetic determination. See also: Human genetic clustering. Eye color is an inherited trait influenced by more than one gene.[13 ... The same DNA sequence in the region of the OCA2 gene among blue-eyed people suggests they may have a single common ancestor.[44 ... which is hypothesized to interact with the OCA2 gene promoter, reduced expression of OCA2 with subsequent reduction in melanin ... 2007). "Genetic determinants of hair, eye and skin pigmentation in Europeans". Nat. Genet. 39 (12): 1443-52. doi:10.1038/ng. ...
Specifically, the SLC18A2 promoter region for the VMAT2 gene has been identified as an area where several polymorphisms form ... Studies using a genetic rodent model to understand clinical depression in humans suggest that VMAT2 genetic or functional ... Genetic research models have shown that polymorphisms in SLC18A1 and SLC18A2, the genes that encode for VMAT1 and 2 proteins ... VMAT gene sequence analysis demonstrates that 4 aspartic acid residues in the middle region of TMD I, VI, X, and XI and one ...
Wikimedia Commons has media related to Genetic promoter regions.. *ORegAnno - Open Regulatory Annotation Database ... A promoter region is located before the -35 and -10 Consensus sequences. The closer the promoter region is to the consensus ... In genetics, a promoter is a region of DNA that initiates transcription of a particular gene. Promoters are located near the ... Although the term "bidirectional promoter" refers specifically to promoter regions of mRNA-encoding genes, luciferase assays ...
"Transforming p21ras mutants and c-Ets-2 activate the cyclin D1 promoter through distinguishable regions". J Biol Chem. 270: ... Jares P, Colomer D, Campo E (Oct 2007). "Genetic and molecular pathogenesis of mantle cell lymphoma: perspectives for new ... Matsuoka S, Yamaguchi M, Matsukage A (April 1994). "D-type cyclin-binding regions of proliferating cell nuclear antigen". J. ... In mantle cell lymphoma, cyclin D1 is translocated to the IgH promoter leading to cyclin D1 overexpression. Chromosomal ...
Type I promoters consists of a consensus -35 and -10 region (Pribnow box) upstream of the gene start site. Heidorn et al. 2011 ... The iGem Registry hosts these promoter sequences as part of the BioBrick initiative to create interchangeable genetic parts. ... Several popular inducible promoters in E. coli are the pBad, pTet, and pLac promoters, all of which repress gene expression by ... Several such promoters were evaluated in Synechocystis sp. PCC6803 by Peca 2007. These promoters are not ideal, as metal ions ...
2008). "Functional characterization of a -100_-102delAAG deletion-insertion polymorphism in the promoter region of the HTR3B ... 2008). "Genetic susceptibility to heroin addiction; a candidate-gene association study". Genes, Brain and Behavior. 7 (7): 720- ... 2008). "Genetic polymorphisms in the 5-hydroxytryptamine type 3B receptor gene and paroxetine-induced nausea". Int. J. ... 2008). "Genetic evaluation of the serotonergic system in chronic fatigue syndrome". Psychoneuroendocrinology. 33 (2): 188-97. ...
TFG-TEC binds to the proximal promoter region of the ENO3 gene. Click on genes, proteins and metabolites below to link to ... Advances in genetic testing, such as exome sequencing and specific gene panels, can provide greater access to diagnoses for ... The ENO3 gene spans 6 kb and contains 12 exons, though the first exon is an untranslated region and, thus, non-coding. This ... Upstream of the first exon lies a TATA-like box and CpG-rich region, which contains recognition motifs for binding ...
Level 0 modules are the base for MoClo system, where they contain genetic elements like a promoter, a 5' untranslated region ( ... First-tier Golden Gate assembly constructs the single-gene construct by adding in genetic elements such as promoter, open ... In this process, one needs to make sure that the introduced mutation will not affect the genetic function encoded by the ... An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules". PLOS ONE. 6 (7): e21622. doi:10.1371/ ...
... end of the EpCAM gene causes epigenetic inactivation of the MSH2 gene by hypermethylating the promoter region of the MSH2 gene ... A problem in EpCAM can indirectly cause Lynch syndrome, a genetic disorder that leads to increased risk of cancer. Deletion of ... Tomita, N; Yamano T; Matsubara N; Tamura K (2013). "[A Novel Genetic Disorder of Lynch Syndrome-EPCAM Gene Deletion]". Gan to ...
Several genetic links to shyness are current areas of research. One is the serotonin transporter promoter region polymorphism ( ... Scientists believe that they have located genetic data supporting the hypothesis that shyness is, at least, partially genetic. ... "Relation of shyness in grade school children to the genotype for the long form of the serotonin transporter promoter region ... The long version of the 5-HTT gene-linked polymorphic region (5-HTTLPR) is now postulated to be correlated with shyness, but in ...
This modulation in gene expression may be due to oxidative DNA damage at promoter regions in the genome. Genes that are down- ... The search for genetic factors has always been an important aspect in trying to understand neuro-pathological processes. ... By contrast, all brain regions and brain cells appear to have roughly the same epigenetic age in subjects who are younger than ... Regional volume reduction is not uniform; some brain regions shrink at a rate of up to 1% per year, whereas others remain ...
"Mobile Genetic Elements. 3 (4): e25845. doi:10.4161/mge.25845. PMC 3812789. PMID 24195014.. ... The inverted repeat regions are highly conserved among land plants, and accumulate few mutations.[8][11] Similar inverted ... The two RNA polymerases may recognize and bind to different kinds of promoters within the chloroplast genome.[35] The ribosomes ... It further contends that only a minority of the genetic material is kept in circular chromosomes while the rest is in branched ...
... so that certain molecules will migrate from the region of higher osmotic pressure to the region of lower osmotic pressure, ... Tournamille C, Colin Y, Cartron JP, Le Van Kim C (1995). "Disruption of a GATA motif in the Duffy gene promoter abolishes ... Human genetic resistance to malaria refers to inherited changes in the DNA of humans which increase resistance to malaria and ... 2009). "Genetic control of resistance to human malaria". Current Opinion in Immunology. 21 (5): 499-505. doi:10.1016/j.coi. ...
The overall extent of maintenance in DNA methylation changes was comparable to that of genetic copy number alterations. Regions ... Whereas some regions showed intraindividual metastatic tumor heterogeneity in promoter methylation, such methylation ... Additionally, regions exhibiting high consistency of hypermethylation across metastases within individuals, even if variably ... This was despite a general tendency for promoter methylation patterns to be strongly correlated with gene expression, ...
Genetic polymorphisms in promoter and intronic regions of CYP1A2 gene in Roma and Hungarian population samples.. Szalai R1, ...
... we investigated the effect of variation in the common functional rs2268498 T/C polymorphism in the promoter region of OXTR on ... These results indicate the impact of this OXTR genetic variant on individual differences in social affective neural processing. ... "Association of Genetic Variation in the Promoter Region of OXTR with Differences in Social Affective Neural Processing," ... we investigated the effect of variation in the common functional rs2268498 T/C polymorphism in the promoter region of OXTR on ...
... and genetic variation in OXTR [46] on emotion processing in the amygdala and connected social brain regions . ... we investigated the effect of variation in the common functional rs2268498 T/C polymorphism in the promoter region of OXTR on ... parietal cortex and occipital regions (Pcorr < 0.01). For fear versus neutral activated regions were restricted to the right ... Effect of OXTR genetic variation at SNP rs- 2268498 during the emotion processing task. The T/T group (n = 14) had bilaterally ...
Genetic Polymorphism in the Serotonin Transporter Promoter Region and Ecological Success in Macaques. Publication Type:. ... Home » Publication » Genetic Polymorphism in the Serotonin Transporter Promoter Region and Ecological Success in Macaques ... A well-characterised sequence length polymorphism in the serotonin transporter promoter region (5-HTTLPR) influences individual ...
"Promoter Regions, Genetic" by people in this website by year, and whether "Promoter Regions, Genetic" was a major or minor ... "Promoter Regions, Genetic" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical ... Promoter Regions, Genetic*Promoter Regions, Genetic. *Genetic Promoter Region. *Genetic Promoter Regions ... Below are the most recent publications written about "Promoter Regions, Genetic" by people in Profiles. ...
The aim of this study was to determine the genetic association of polymorphisms in the APOAI promoter region with plasma lipid ... A 435 bp region of the APOAI promoter was analyzed by re-sequencing in 549 Kuwaiti samples. DNA was extracted from blood taken ... The target sequence included a partial segment of the promoter region, 5UTR and exon 1 located between nucleotides −141 to + ... This study is the first to report sequence analysis of the APOAI promoter in an Arab population. The unexpected positive ...
... into the genetic foundation of aggression in Papio and the evolution of two length-polymorphisms in the promoter regions of ... Insights into the genetic foundation of aggression in Papio and the evolution of two length-polymorphisms in the promoter ... Insights into the genetic foundation of aggression in Papio and the evolution of two length-polymorphisms in the promoter ... into the genetic foundation of aggression in Papio and the evolution of two length-polymorphisms in the promoter regions of ...
The c.-1973T , C polymorphism located in the SERPINA1 promoter region is found more frequent in A1AT deficiency patients with ... Kok, K.F., te Morsche, R.H., van Oijen, M.G. et al. Prevalence of genetic polymorphisms in the promoter region of the alpha-1 ... Prevalence of genetic polymorphisms in the promoter region of the alpha-1 antitrypsin (SERPINA1) gene in chronic liver disease ... The c.-1973T , C polymorphism located in the SERPINA1 promoter region is found more frequent in A1AT deficiency patients with ...
Genetic analysis of the TBX20 gene promoter region in patients with ventricular septal defects.. Qiao Y1, Wanyan H, Xing Q, Xie ... However, the promoter region of TBX20 gene has not been genetically analyzed in CHD patients. As TBX20 functions as a dosage- ... Within the promoter region of the TBX20 gene, one single-nucleotide polymorphism (SNP), rs336284 (g.4740T,C), and one novel ... In this study, we bi-directionally sequenced the promoter region of the TBX20 gene in 265 patients with ventricular septal ...
genetic message a. protein-coding segment ______ promoter b. .... Biology: The Unity and Diversity of Life (MindTap Course List ... What negative soil effects can result when irrigated agriculture is practiced in regions that experience great .... ...
Wikimedia Commons has media related to Genetic promoter regions.. *ORegAnno - Open Regulatory Annotation Database ... A promoter region is located before the -35 and -10 Consensus sequences. The closer the promoter region is to the consensus ... In genetics, a promoter is a region of DNA that initiates transcription of a particular gene. Promoters are located near the ... Although the term "bidirectional promoter" refers specifically to promoter regions of mRNA-encoding genes, luciferase assays ...
Genetic analysis of the promoter region of the GATA4 gene in patients with ventricular septal defects.. Wu G1, Shan J, Pang S, ... we hypothesized that the promoter region variants of the GATA4 gene may be genetic causes of VSD. In this study, we analyzed ... within the promoter region of the GATA gene were identified in 5 VSD patients, but in none of controls. One heterozygous ... our data suggest that these sequence variants within the promoter region of the GATA4 gene may contribute to the VSD etiology ...
... important role in ensuring proper development in higher eukaryotes by controlling accessibility of cis-regulatory DNA regions ... Promoter Regions, Genetic/genetics. *Reverse Transcriptase Polymerase Chain Reaction. *Sequence Analysis, DNA ... Using genetic and molecular analyses we have identified WUSCHEL (WUS) as a biologically important target of the SNF2-class ... We present evidence that SYD is recruited to the WUS promoter and that it is involved in regulation of the stem cell pool ...
Systematic reverse genetic analysis of this novel LRR family has therefore identified gametophytically active genes that ... otherwise would likely be missed by forward genetic screens. ... Promoter region (-272). a Mutant isolated from Wisconsin T-DNA ... Analysis of junction sites confirmed the position of the insertions in the first exon and the presumed promoter region, ... Forward genetic approaches have proven effective for identifying loci with gametophytic functions [1,2,3,4,5]. One strategy for ...
Association of genetic variants in the promoter region of genes encoding p22phox (CYBA) and glutamate cysteine ligase catalytic ... at the promoter region of the CYBA and GCLC genes modulate the risk for decreased GFR in type 1 diabetes patients even after ... in the promoter region of three genes related to cellular redox balance: (1) -675 T → A in CYBA (unregistered), where the T ... Biochemical and genetic characterization of Italian subpopulation. Am Heart J. 2007, 154: 1123-1129. 10.1016/j.ahj.2007.07.029. ...
Promoter Regions, Genetic*. Proto-Oncogene Proteins c-jun / genetics, metabolism*. Transcriptional Activation. ... Furthermore, chromatin immunoprecipitation indicated the presence of cJun at the proximal region of the native PII promoter. ... The Jun-mediated repression was specific to the aromatase promoter, as Jun proteins stimulated known AP1-responsive promoters ... in the PII promoter-proximal region. Alteration of the CRE-like site impaired both the cAMP-responsive transcriptional ...
The c-myb promoter contains multiple GGA repeats beginning 17 bp downstream of the transcription initiation site. GGA repeats ... Promoter Regions, Genetic*. Repressor Proteins / metabolism*. Transcription Factors / metabolism*. Trinucleotide Repeats. Grant ... Several G-quadruplex regions have been identified in promoters and shown to be critical for regulation of promoter activity. ... Deletion of GGA repeat region 1 or both regions 1 and 2 in the c-myb promoter increased relative luciferase activities by 3- to ...
Promoter Regions, Genetic* * Saccharomyces cerevisiae / metabolism * Saccharomyces cerevisiae Proteins / chemistry * ... Competitive Promoter Occupancy by Two Yeast Paralogous Transcription Factors Controlling the Multidrug Resistance Phenomenon J ... Chromatin immunoprecipitation experiments confirmed that Yrm1 binds to the promoters of the up-regulated genes only in yeast ...
Genetic Predisposition. *Promoter Regions. *Linkage Disequilibrium. *Cytokines. *Case-Control Studies. *Receptors, ... BACKGROUND: Malignant B-cell clones are affected by both acquired genetic alterations and by inherited genetic variations ... Genetic determinants of UV-susceptibility in non-melanoma skin cancer.. PLoS One. 2011; 6(7):e20019 [PubMed] Free Access to ... Genetic variants in immunoregulatory genes and risk for childhood lymphomas.. Eur J Haematol. 2009; 83(4):334-42 [PubMed] ...
Hypermethylation at gene promoter regions is often associated with transcriptional silencing; however, expression of only 245 ... This pilot study was aimed to identify the genetic alteration in 100 bp upstream and downstream flanking regions in addition to ... Aberrant DNA methylation in the promoter regions of gene, which leads to inactivation of tumor suppressor and other cancer- ... PURPOSE: EBV-associated gastric carcinoma shows global CpG island methylation of the promoter region of various cancer-related ...
Promoter Regions, Genetic * Shivering * Thermogenesis* / drug effects * Time Factors * Uncoupling Protein 1 ...
A functional genetic variant, rs1690789, affects susceptibility to emphysema by altering TGFB2 expression in human lung ... Using the TGFB2 promoter region as the anchor region, we detected interaction between the rs1690789-containing region and the ... Using chromatin conformation capture, we confirmed that the region spanning this SNP interacts with the TGFB2 promoter region. ... the region containing rs1690789 has multiple interactions with other DNA regions, including the TGFB2 promoter and other ...
2.2.6 Genetic transfer and plasmids in Thermus.- 2.2.7 A repetitive sequence in Thermus thermophilus.- 2.2.8 Promoter regions ... 4.5 Molecular genetic studies of acidophiles.- 4.5.1 The development of genetic systems for acidophiles.- 4.5.2 Gene transfer ... 2.2.12 Other genes and genetic systems in Bacillus stearothermophilus.- 2.3 Anaerobic eubacteria.- 2.3.1 Cloning of genes ...
Genetic analysis of transgenic tobacco. Sterile T1 seeds were plated on MS medium supplemented with 200 μg/mL kanamycin. Two ... Identification of two promoter regions responsible for heavy metals. A, The sequence of the two promoter regions. Region I (− ... Two HMREs Lie in the −222/−147 Promoter Region. To test this, the 76-bp promoter fragment was subdivided into two pieces, one ... The wild-type region I, mutated region I, and region II were in the context of 35SΔ64 fused to GUS gene to construct pBMRE, ...
  • Human Genome Epidemiology:A Scientific Foundation for Using Genetic Information To Improve Health and Prevent Disease. (epa.gov)
  • They performed whole-exome sequencing, which examines the protein-coding regions of the genome, on an unprecedented 316 tumors. (nih.gov)
  • The whole genome sequence database in the public domain (www.ensembl.org) provides an opportunity to look for the genetic architecture of this gene. (thefreelibrary.com)
  • Using a starter line selected for detailed analysis, the efficiency of tagging over a 50-kb region in the genome was examined. (plantphysiol.org)
  • Next, it scans the horizon for emerging genetic-engineering technologies, including synthetic biology and genome editing, and speculates about how they might shape the future of crops. (nap.edu)
  • We collect DNA from every child in preparation for a genome-wide association study (GWAS) to identify genetic markers informative in understudied populations in the U.S. and Canada. (yale.edu)
  • Methods We analysed the MLH1 promoter sequence in five different patient groups with colorectal cancer (CRC) (n=480) composed of patients with i) CEM (n=16), ii) unsolved loss of MLH1 expression in CRC (n=37), iii) CpG-island methylator-phenotype CRC (n=102), iv) patients with LS (n=83) and v) MLH1-proficient CRC (n=242) as controls. (bmj.com)
  • A phenotype (e.g., a biological function or genetic disease) is identified and then tracked back to the responsible gene, based on its genetic map position. (google.com)
  • Unlike traditionally animal and plant breeding, which involves doing multiple crosses and then selecting for the organism with the desired phenotype, genetic engineering takes the gene directly from one organism and inserts it in the other. (wikipedia.org)
  • Our preliminary data suggest that imaging is a sensitive phenotype for dyslexia and will identify new functional-genetic units for reading not previously appreciated. (yale.edu)
  • Using genetic and molecular analyses we have identified WUSCHEL (WUS) as a biologically important target of the SNF2-class ATPase SPLAYED (SYD) in the shoot apical meristem of Arabidopsis. (mendeley.com)
  • Additional studies in experimental animals will deepen our understanding of the genetic basis of VSD and shed light on designing novel molecular therapies for adult VSD patients carrying these variants. (cdc.gov)
  • 4.5 Molecular genetic studies of acidophiles. (barnesandnoble.com)
  • The main reasons why molecular genetic information can result in greater genetic gain than phenotypic information are: a) Assuming no genotyping errors, molecular genetic information is not affected by environmental effects and, therefore, has heritability equal to 1. (intechopen.com)
  • b)-Molecular genetic information can be available at an early age, in principle at the embryo stage, thereby allowing early selection and reduction of generation intervals. (intechopen.com)
  • C) Molecular genetic information can be obtained on all selection candidates, which is especially beneficial for sex-limited traits, traits that are expensive or difficult to record, or traits that require slaughter of the animal (carcass traits) ( Dekkers, 2004 ). (intechopen.com)
  • Abstract -Genetic approaches have succeeded in defining the molecular basis of an increasing array of heart diseases, such as hypertrophic cardiomyopathy and the long-QT syndromes, associated with serious arrhythmias. (ahajournals.org)
  • The current state of the art of the molecular and genetic basis of inherited arrhythmias is first reviewed, followed by practical advice on the role of genetic testing in these and other syndromes and the way in which new findings have influenced current understanding of the molecular and biophysical basis of arrhythmogenesis. (ahajournals.org)
  • The Molecular Cell study focused on a gene called hunchback ( hb ), which makes cells in the head region of the fly embryo that are different from cells in the abdomen. (nyu.edu)
  • We and others ( 11 - 16 ) have reported that genetic predisposition involved in several molecular pathways, such as carcinogen metabolism, DNA repair, and cell cycle control, is associated with the risk for SPM after primary SCCHN. (aacrjournals.org)
  • This relies on recombinant nucleic acid techniques to form new combinations of heritable genetic material followed by the incorporation of that material either indirectly through a vector system or directly through micro-injection, macro-injection or micro-encapsulation. (wikipedia.org)
  • deletion) within the promoter region of the GATA gene were identified in 5 VSD patients, but in none of controls. (cdc.gov)
  • deletion) were increased significantly compared with the wild-type GATA4 gene promoter. (cdc.gov)
  • Deletion of one or two (GGA)(4) motifs destabilizes this secondary structure and increases c-myb promoter activity, indicating that the G-quadruplexes formed in the c-myb GGA repeat region may act as a negative regulator of the c-myb promoter. (biomedsearch.com)
  • Using chromatin conformation capture, we confirmed that the region containing rs1690789 contacts the TGFB2 promoter in fibroblasts, and CRISPR/Cas-9 targeted deletion of a ~ 100 bp region containing rs1690789 resulted in decreased TGFB2 expression in primary human lung fibroblasts. (elifesciences.org)
  • Through genetic studies of families and children with reading disability we identified a major contributor, called doublecortin-domain- containing-2 (DCDC2) We found that a deletion in a putative regulatory sequence in DCDC2 is present in ~20% of dyslexics. (yale.edu)
  • These results indicate the impact of this OXTR genetic variant on individual differences in social affective neural processing. (scirp.org)
  • Conclusion We report the second promoter variant stably inducing a hereditary CEM. (bmj.com)
  • This view rests on biased gene conversion, in which the broken chromosome copies genetic information from its uncut homolog and may generate an extra copy of a genetic variant ( Fig. 1A ). (sciencemag.org)
  • One of the approaches based on next-generation sequencing (NGS) is targeted enrichment of genomic DNA (TEDNA-seq) sequencing, which allows the identification of a directly selected genomic region by using hybridization probes during DNA library preparation. (springer.com)
  • The induction of the transposase results in transposition of Ds elements from the T-DNA into adjacent genomic regions, generating new transposon lines that will be stable. (plantphysiol.org)
  • INFRAVEC addresses the need of the scientific community to share facilities and integrate cuttingedge knowledge and technologies that are not readily accessible but nevertheless critical to exploit genetic and genomic information in the effort to control mosquito-borne diseases. (europa.eu)
  • The potential genetic markers for pig productive traits were identified by using targeted enrichment DNA sequencing of chromosome 15 region that is QTL-rich. (springer.com)
  • However, until recently most comparative studies were coarse and based on genetic maps and various kinds of markers. (genetics.org)
  • Identification of genetic disease markers in at-risk persons could play an important role in preventive health care. (plos.org)
  • Genetic Alteration of p16INKA4A Promoter Region in Endometrial Carcinoma. (koreamed.org)
  • Therefore, the FAS/FASLG pathway plays an important role in regulation of apoptosis and maintenance of cellular homeostasis, and genetic alteration of the FAS/FASLG signaling pathway may result in immune escape and, thus, tumorigenesis, including SPM. (aacrjournals.org)
  • DNA double-strand breaks (DSBs) generated by the Spo11 protein initiate meiotic recombination, which alters genetic linkage and promotes pairing and accurate chromosome segregation ( 1 ). (sciencemag.org)
  • In pigs, chromosome 15 contains a region between the microsatellites SW1683 and SW906 (79.3-89.3 cM, 127-135 Mbp) which is highly rich in QTLs associated with meat quality, fat content and growth traits. (springer.com)
  • Meiotic recombination rates are highly non-uniform along the chromosome, being very low around centromeres and variable in distal chromosomal regions. (weizmann.ac.il)
  • We selected for this study the A. thaliana ABI1-Rps2-Ck1 segment on chromosome 4, which, according to previous comparative genetic mapping, is structurally conserved in Brassica species ( S adowski and Q uiros 1998 ). (genetics.org)
  • Fluorescence in situ hybridization with PAC DNA clones localized ATP1B3 to the q22 → 23 region of Chromosome (Chr) 3, and the β3 pseudogene to the p13 → 15 region of Chr 2. (elsevier.com)
  • In the present study, we demonstrated that 17β-estradiol (E2) repressed human GnRHR promoter via an activator protein 1-like motif and estrogen receptor-α, of which the DNA-binding domain and the ligand-binding domain were indispensable for the repression. (hku.hk)
  • An organism that is generated through genetic engineering is considered to be genetically modified (GM) and the resulting entity is a genetically modified organism (GMO). (wikipedia.org)
  • Genetic engineering does not normally include traditional breeding, in vitro fertilisation, induction of polyploidy, mutagenesis and cell fusion techniques that do not use recombinant nucleic acids or a genetically modified organism in the process. (wikipedia.org)
  • As TBX20 functions as a dosage-dependent regulator during the heart development, we hypothesized that the sequence variants within the promoter region of the TBX20 gene may contribute to CHD. (cdc.gov)
  • As the GATA4 factor is a dosage-sensitive regulator, we hypothesized that the promoter region variants of the GATA4 gene may be genetic causes of VSD. (cdc.gov)
  • As GATA4 is a dosage-sensitive regulator during development, our data suggest that these sequence variants within the promoter region of the GATA4 gene may contribute to the VSD etiology by altering its gene expression. (cdc.gov)
  • A novel G-quadruplex-forming GGA repeat region in the c-myb promoter is a critical regulator of promoter activity. (biomedsearch.com)
  • Structure and dynamics of polymyxin-resistance-associated response regulator PmrA in complex with promoter DNA. (nih.gov)
  • Phosphorylation of OmpR/PhoB response regulator induces the formation of a symmetric dimer in the N-terminal receiver domain (REC), promoting two C-terminal DNA-binding domains (DBDs) to recognize promoter DNA to elicit adaptive responses. (nih.gov)
  • Furthermore, we demonstrated that Myc-associated zinc finger protein (MAZ) represses c-myb promoter activity and binds to the c-myb T:H:H:T G-quadruplexes. (biomedsearch.com)
  • Our findings show that the T:H:H:T G-quadruplex-forming region in the c-myb promoter is a critical cis-acting element and may repress c-myb promoter activity through MAZ interaction with G-quadruplexes in the c-myb promoter. (biomedsearch.com)
  • Transformed tobacco ( Nicotiana tabacum ) seedlings expressing β -glucuronidase under control of the PvSR2 promoter region (−687/+48) showed heavy metal-specific responsive activity that depended on the type and concentration of the heavy metal and the type of organ. (plantphysiol.org)
  • GUS activity was detected only in seeds, except in those having integrated the 124 bp promoter. (deepdyve.com)
  • Mor then binds and activates transcription from the WT or mutant Pm promoter cloned in pIA12, leading to synthesis of β-galactosidase at levels proportional to Pm activity. (nih.gov)
  • Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. (hindawi.com)
  • SOCS1 and SOCS3 possess a kinase-inhibitory region (KIR) domain that is critical for inhibition of kinase activity [ 1 ]. (hindawi.com)
  • en] Glucocorticoids have been shown to inhibit the activity of the human prolactin (hPRL) promoter. (ac.be)
  • Twenty-one promoters were evaluated for activity using reporter assays. (mendeley.com)
  • Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. (mendeley.com)
  • A team of biologists has discovered how cells become different from each other during embryogenesis, a finding that offers new insights into genetic activity and has implications for better understanding the onset of disease and birth defects. (nyu.edu)
  • Interestingly, the same cis-acting motif was also found to be important for both the basal activity and phorbol 12-myristate 13-acetate responsiveness of the GnRHR promoter. (hku.hk)
  • Loci associated with IBD were strongly and specifically (relative to rheumatoid arthritis and unrelated traits) enriched for promoters that were regulated in monocyte differentiation or activation. (nih.gov)
  • In this region, the abundance of QTLs related to meat quality traits, in particular meat texture, is the highest in comparison to other pig chromosomes. (springer.com)
  • However, genetic progress may be further enhanced if we could gain insight into the black box of quantitative traits. (intechopen.com)
  • We associated polymorphisms in the promoter exonic regions of the SERT gene with parental risk-taking-related behaviour and fitness traits. (biologists.org)
  • Although the gene-behaviour associations are environment and condition dependent ( Adriaenssens and Johnsson, 2010 ), behavioural traits consistently differ between individuals of the same population (for a review, see Carere and Maestripieri, 2013 ) and have a significant genetic basis (for a review, see Laine and van Oers, 2017 ). (biologists.org)
  • Our results support the view that circulating IGF-I levels and IGFBP-3 levels are complex traits and are influenced by a number of interacting genetic and nongenetic factors. (aacrjournals.org)
  • Region I (−222/−188) contains a motif (metal-regulatory element-like sequence) similar to the consensus metal-regulatory element of the animal metallothionein gene, and mutation of this motif eliminated the heavy metal-inducible function of region I. Region II (−187/−147) had no similarity to previously identified cis-acting elements involved in heavy metal induction, suggesting the presence of a novel heavy metal-responsive element. (plantphysiol.org)
  • Meiotic recombination occurs in the context of chromatin, therefore we investigated both genetic and epigenetic factors that affect this process. (weizmann.ac.il)
  • In order to understand what are the genetic and epigenetic features that characterize a crossover event. (weizmann.ac.il)
  • Dr. Park and his laboratory team are interested in genetic and epigenetic variations associated with prostate cancer recurrence. (moffitt.org)
  • MacAlpine and colleagues used a technique known as Repli-seq to characterize newly replicated regions of DNA with next generation sequencing. (eurekalert.org)
  • Plasmid pKM78 contains a WT mor gene under the control of the PlacUV5 promoter. (nih.gov)
  • The chromosomal regions flanking the T-DNA were cloned by plasmid rescue. (deepdyve.com)
  • The low-Ca 2+ -response (LCR) plasmid pCD1 of the plague agent Yersinia pestis KIM5 was sequenced and analyzed for its genetic structure. (asm.org)
  • Genetic organization of the LCR plasmid, pCD1, of Y. pestis KIM5. (asm.org)
  • Because the 5-HTT-linked polymorphic region (5′-HTTLPR) within the promoter region of the 5-HTT gene leads to differential expression of the 5-HTT, we examined, for the first time, whether there is a differential association between the long (L) and short (S) alleles of the 5′-HTTLPR and the age of first methamphetamine use (AMU). (frontiersin.org)
  • Treatment of naive T cells under the Treg-cell-polarizing conditions with butyrate enhanced histone H3 acetylation in the promoter and conserved non-coding sequence regions of the Foxp3 locus, suggesting a possible mechanism for how microbial-derived butyrate regulates the differentiation of Treg cells. (nih.gov)
  • Late replicating segments have an absence of active histone marks, are enriched in repressive histone modifications, and are in gene poor regions. (eurekalert.org)
  • The morbidity and mortality of CHD patients are significantly higher than normal population even after surgical correction of cardiac defects, which is likely caused by genetic defects. (cdc.gov)
  • Digestion products of the 836 bp fragment in the 5'UTR region of growth hormone receptor gene with enzyme AluI, loaded on 8% acrilamid gel. (intechopen.com)
  • Genetic differences mean that certain people are more likely to develop emphysema than others. (elifesciences.org)
  • They identified 113 significant DNA copy number aberrations - differences in the number of copies of specific DNA regions. (nih.gov)
  • Individual differences in coping with potentially dangerous situations are affected by a combination of genetic and environmental factors. (biologists.org)