Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.
The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
A technique for identifying individuals of a species that is based on the uniqueness of their DNA sequence. Uniqueness is determined by identifying which combination of allelic variations occur in the individual at a statistically relevant number of different loci. In forensic studies, RESTRICTION FRAGMENT LENGTH POLYMORPHISM of multiple, highly polymorphic VNTR LOCI or MICROSATELLITE REPEAT loci are analyzed. The number of loci used for the profile depends on the ALLELE FREQUENCY in the population.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.
The detection of RESTRICTION FRAGMENT LENGTH POLYMORPHISMS by selective PCR amplification of restriction fragments derived from genomic DNA followed by electrophoretic analysis of the amplified restriction fragments.
Enzyme systems containing a single subunit and requiring only magnesium for endonucleolytic activity. The corresponding modification methylases are separate enzymes. The systems recognize specific short DNA sequences and cleave either within, or at a short specific distance from, the recognition sequence to give specific double-stranded fragments with terminal 5'-phosphates. Enzymes from different microorganisms with the same specificity are called isoschizomers. EC 3.1.21.4.
The proportion of one particular in the total of all ALLELES for one genetic locus in a breeding POPULATION.
Procedures for identifying types and strains of bacteria. The most frequently employed typing systems are BACTERIOPHAGE TYPING and SEROTYPING as well as bacteriocin typing and biotyping.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.
Any method used for determining the location of and relative distances between genes on a chromosome.
Genotypic differences observed among individuals in a population.
The relationships of groups of organisms as reflected by their genetic makeup.
A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
A latent susceptibility to disease at the genetic level, which may be activated under certain conditions.
A phenotypically recognizable genetic trait which can be used to identify a genetic locus, a linkage group, or a recombination event.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
The co-inheritance of two or more non-allelic GENES due to their being located more or less closely on the same CHROMOSOME.
Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
The genetic constitution of individuals with respect to one member of a pair of allelic genes, or sets of genes that are closely linked and tend to be inherited together such as those of the MAJOR HISTOCOMPATIBILITY COMPLEX.
One of the Type II site-specific deoxyribonucleases (EC 3.1.21.4). It recognizes and cleaves the sequence A/AGCTT at the slash. HindIII is from Haemophilus influenzae R(d). Numerous isoschizomers have been identified. EC 3.1.21.-.
The application of molecular biology to the answering of epidemiological questions. The examination of patterns of changes in DNA to implicate particular carcinogens and the use of molecular markers to predict which individuals are at highest risk for a disease are common examples.
The functional hereditary units of BACTERIA.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
One of the Type II site-specific deoxyribonucleases (EC 3.1.21.4). It recognizes and cleaves the sequence G/AATTC at the slash. EcoRI is from E coliRY13. Several isoschizomers have been identified. EC 3.1.21.-.
The intergenic DNA segments that are between the ribosomal RNA genes (internal transcribed spacers) and between the tandemly repeated units of rDNA (external transcribed spacers and nontranscribed spacers).
Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.
One of the Type II site-specific deoxyribonucleases (EC 3.1.21.4). It recognizes and cleaves the sequences C/CGG and GGC/C at the slash. HpaII is from Haemophilus parainfluenzae. Several isoschizomers have been identified. EC 3.1.21.-.
Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Tandem arrays of moderately repetitive, short (10-60 bases) DNA sequences which are found dispersed throughout the GENOME, at the ends of chromosomes (TELOMERES), and clustered near telomeres. Their degree of repetition is two to several hundred at each locus. Loci number in the thousands but each locus shows a distinctive repeat unit.
A species of gram-positive, aerobic bacteria that produces TUBERCULOSIS in humans, other primates, CATTLE; DOGS; and some other animals which have contact with humans. Growth tends to be in serpentine, cordlike masses in which the bacilli show a parallel orientation.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
Gel electrophoresis in which the direction of the electric field is changed periodically. This technique is similar to other electrophoretic methods normally used to separate double-stranded DNA molecules ranging in size up to tens of thousands of base-pairs. However, by alternating the electric field direction one is able to separate DNA molecules up to several million base-pairs in length.
One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.
Individuals whose ancestral origins are in the southeastern and eastern areas of the Asian continent.
Electrophoresis in which agar or agarose gel is used as the diffusion medium.
Reduction in caloric intake without reduction in adequate nutrition. In experimental animals, caloric restriction has been shown to extend lifespan and enhance other physiological variables.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.
Deoxyribonucleic acid that makes up the genetic material of fungi.
The presence of bacteria, viruses, and fungi in the soil. This term is not restricted to pathogenic organisms.
An individual having different alleles at one or more loci regarding a specific character.
Process of determining and distinguishing species of bacteria or viruses based on antigens they share.
Identification of genetic carriers for a given trait.
A set of statistical methods used to group variables or observations into strongly inter-related subgroups. In epidemiology, it may be used to analyze a closely grouped series of events or cases of disease or other health-related phenomenon with well-defined distribution patterns in relation to time or place or both.
Variation in a population's DNA sequence that is detected by determining alterations in the conformation of denatured DNA fragments. Denatured DNA fragments are allowed to renature under conditions that prevent the formation of double-stranded DNA and allow secondary structure to form in single stranded fragments. These fragments are then run through polyacrylamide gels to detect variations in the secondary structure that is manifested as an alteration in migration through the gels.
The analysis of a sequence such as a region of a chromosome, a haplotype, a gene, or an allele for its involvement in controlling the phenotype of a specific trait, metabolic pathway, or disease.
A country spanning from central Asia to the Pacific Ocean.
Deoxyribonucleic acid that makes up the genetic material of viruses.
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
An individual in which both alleles at a given locus are identical.
The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)
One of the Type II site-specific deoxyribonucleases (EC 3.1.21.4). It recognizes and cleaves the sequence G/GATCC at the slash. BamHI is from Bacillus amyloliquefaciens N. Numerous isoschizomers have been identified. EC 3.1.21.-.
Genes, found in both prokaryotes and eukaryotes, which are transcribed to produce the RNA which is incorporated into RIBOSOMES. Prokaryotic rRNA genes are usually found in OPERONS dispersed throughout the GENOME, whereas eukaryotic rRNA genes are clustered, multicistronic transcriptional units.
Deoxyribonucleic acid that makes up the genetic material of protozoa.
Technique that utilizes low-stringency polymerase chain reaction (PCR) amplification with single primers of arbitrary sequence to generate strain-specific arrays of anonymous DNA fragments. RAPD technique may be used to determine taxonomic identity, assess kinship relationships, analyze mixed genome samples, and create specific probes.
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
Procedures for identifying types and strains of fungi.
A functional system which includes the organisms of a natural community together with their environment. (McGraw Hill Dictionary of Scientific and Technical Terms, 4th ed)
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Proteins found in any species of bacterium.
Nonrandom association of linked genes. This is the tendency of the alleles of two separate but already linked loci to be found together more frequently than would be expected by chance alone.
Actual loss of portion of a chromosome.
Constituent of 50S subunit of prokaryotic ribosomes containing about 3200 nucleotides. 23S rRNA is involved in the initiation of polypeptide synthesis.
Biochemical identification of mutational changes in a nucleotide sequence.
Any of the infectious diseases of man and other animals caused by species of MYCOBACTERIUM.
Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.
Sudden increase in the incidence of a disease. The concept includes EPIDEMICS and PANDEMICS.
Double-stranded DNA of MITOCHONDRIA. In eukaryotes, the mitochondrial GENOME is circular and codes for ribosomal RNAs, transfer RNAs, and about 10 proteins.
A set of three nucleotides in a protein coding sequence that specifies individual amino acids or a termination signal (CODON, TERMINATOR). Most codons are universal, but some organisms do not produce the transfer RNAs (RNA, TRANSFER) complementary to all codons. These codons are referred to as unassigned codons (CODONS, NONSENSE).
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
An aspect of personal behavior or lifestyle, environmental exposure, or inborn or inherited characteristic, which, on the basis of epidemiologic evidence, is known to be associated with a health-related condition considered important to prevent.
The female sex chromosome, being the differential sex chromosome carried by half the male gametes and all female gametes in human and other male-heterogametic species.
Copies of transposable elements interspersed throughout the genome, some of which are still active and often referred to as "jumping genes". There are two classes of interspersed repetitive elements. Class I elements (or RETROELEMENTS - such as retrotransposons, retroviruses, LONG INTERSPERSED NUCLEOTIDE ELEMENTS and SHORT INTERSPERSED NUCLEOTIDE ELEMENTS) transpose via reverse transcription of an RNA intermediate. Class II elements (or DNA TRANSPOSABLE ELEMENTS - such as transposons, Tn elements, insertion sequence elements and mobile gene cassettes of bacterial integrons) transpose directly from one site in the DNA to another.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
Deliberate breeding of two different individuals that results in offspring that carry part of the genetic material of each parent. The parent organisms must be genetically compatible and may be from different varieties or closely related species.
Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.
Using MOLECULAR BIOLOGY techniques, such as DNA SEQUENCE ANALYSIS; PULSED-FIELD GEL ELECTROPHORESIS; and DNA FINGERPRINTING, to identify, classify, and compare organisms and their subtypes.
A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
A flavoprotein amine oxidoreductase that catalyzes the reversible conversion of 5-methyltetrahydrofolate to 5,10-methylenetetrahydrofolate. This enzyme was formerly classified as EC 1.1.1.171.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.
Former kingdom, located on Korea Peninsula between Sea of Japan and Yellow Sea on east coast of Asia. In 1948, the kingdom ceased and two independent countries were formed, divided by the 38th parallel.
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.
Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
Plasmids containing at least one cos (cohesive-end site) of PHAGE LAMBDA. They are used as cloning vehicles.
The study of microorganisms living in a variety of environments (air, soil, water, etc.) and their pathogenic relationship to other organisms including man.
Deoxyribonucleic acid that makes up the genetic material of plants.
The variety of all native living organisms and their various forms and interrelationships.
A variety of simple repeat sequences that are distributed throughout the GENOME. They are characterized by a short repeat unit of 2-8 basepairs that is repeated up to 100 times. They are also known as short tandem repeats (STRs).
Individuals whose ancestral origins are in the continent of Europe.
Any cell, other than a ZYGOTE, that contains elements (such as NUCLEI and CYTOPLASM) from two or more different cells, usually produced by artificial CELL FUSION.
Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)
MYCOBACTERIUM infections of the lung.
DNA present in neoplastic tissue.
Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
A species of bacteria that resemble small tightly coiled spirals. Its organisms are known to cause abortion in sheep and fever and enteritis in man and may be associated with enteric diseases of calves, lambs, and other animals.
A genus of gram-positive, aerobic bacteria. Most species are free-living in soil and water, but the major habitat for some is the diseased tissue of warm-blooded hosts.
Infections with bacteria of the genus CAMPYLOBACTER.
The unconsolidated mineral or organic matter on the surface of the earth that serves as a natural medium for the growth of land plants.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
The period of confinement of a patient to a hospital or other health facility.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
The presence of bacteria, viruses, and fungi in water. This term is not restricted to pathogenic organisms.
RESTRICTION FRAGMENT LENGTH POLYMORPHISM analysis of rRNA genes that is used for differentiating between species or strains.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
A selective increase in the number of copies of a gene coding for a specific protein without a proportional increase in other genes. It occurs naturally via the excision of a copy of the repeating sequence from the chromosome and its extrachromosomal replication in a plasmid, or via the production of an RNA transcript of the entire repeating sequence of ribosomal RNA followed by the reverse transcription of the molecule to produce an additional copy of the original DNA sequence. Laboratory techniques have been introduced for inducing disproportional replication by unequal crossing over, uptake of DNA from lysed cells, or generation of extrachromosomal sequences from rolling circle replication.
Diseases of plants.
Univalent antigen-binding fragments composed of one entire IMMUNOGLOBULIN LIGHT CHAIN and the amino terminal end of one of the IMMUNOGLOBULIN HEAVY CHAINS from the hinge region, linked to each other by disulfide bonds. Fab contains the IMMUNOGLOBULIN VARIABLE REGIONS, which are part of the antigen-binding site, and the first IMMUNOGLOBULIN CONSTANT REGIONS. This fragment can be obtained by digestion of immunoglobulins with the proteolytic enzyme PAPAIN.
The discipline studying genetic composition of populations and effects of factors such as GENETIC SELECTION, population size, MUTATION, migration, and GENETIC DRIFT on the frequencies of various GENOTYPES and PHENOTYPES using a variety of GENETIC TECHNIQUES.
A mass of organic or inorganic solid fragmented material, or the solid fragment itself, that comes from the weathering of rock and is carried by, suspended in, or dropped by air, water, or ice. It refers also to a mass that is accumulated by any other natural agent and that forms in layers on the earth's surface, such as sand, gravel, silt, mud, fill, or loess. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed, p1689)
The functional hereditary units of VIRUSES.
Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).
Established cell cultures that have the potential to propagate indefinitely.
A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.
The functional hereditary units of PLANTS.
A protein with a molecular weight of 40,000 isolated from bacterial flagella. At appropriate pH and salt concentration, three flagellin monomers can spontaneously reaggregate to form structures which appear identical to intact flagella.
Studies determining the effectiveness or value of processes, personnel, and equipment, or the material on conducting such studies. For drugs and devices, CLINICAL TRIALS AS TOPIC; DRUG EVALUATION; and DRUG EVALUATION, PRECLINICAL are available.
The presence of bacteria, viruses, and fungi in food and food products. This term is not restricted to pathogenic organisms: the presence of various non-pathogenic bacteria and fungi in cheeses and wines, for example, is included in this concept.
The ability of microorganisms, especially bacteria, to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
A genus of gram-negative, aerobic, rod-shaped bacteria often surrounded by a protein microcapsular layer and slime layer. The natural cycle of its organisms generally involves a vertebrate and an invertebrate host. Species of the genus are the etiological agents of human diseases, such as typhus.
The sum of the weight of all the atoms in a molecule.
The spectrum of different living organisms inhabiting a particular region, habitat, or biotope.
One of the three domains of life (the others being BACTERIA and Eukarya), formerly called Archaebacteria under the taxon Bacteria, but now considered separate and distinct. They are characterized by: (1) the presence of characteristic tRNAs and ribosomal RNAs; (2) the absence of peptidoglycan cell walls; (3) the presence of ether-linked lipids built from branched-chain subunits; and (4) their occurrence in unusual habitats. While archaea resemble bacteria in morphology and genomic organization, they resemble eukarya in their method of genomic replication. The domain contains at least four kingdoms: CRENARCHAEOTA; EURYARCHAEOTA; NANOARCHAEOTA; and KORARCHAEOTA.
The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.
Water containing no significant amounts of salts, such as water from RIVERS and LAKES.
Any of the DNA in between gene-coding DNA, including untranslated regions, 5' and 3' flanking regions, INTRONS, non-functional pseudogenes, and non-functional repetitive sequences. This DNA may or may not encode regulatory functions.
A country in northern Africa between ALGERIA and LIBYA. Its capital is Tunis.
Annual cereal grass of the family POACEAE and its edible starchy grain, rice, which is the staple food of roughly one-half of the world's population.
A terminal section of a chromosome which has a specialized structure and which is involved in chromosomal replication and stability. Its length is believed to be a few hundred base pairs.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
A transferase that catalyzes the addition of aliphatic, aromatic, or heterocyclic FREE RADICALS as well as EPOXIDES and arene oxides to GLUTATHIONE. Addition takes place at the SULFUR. It also catalyzes the reduction of polyol nitrate by glutathione to polyol and nitrite.
The medium-sized, acrocentric human chromosomes, called group D in the human chromosome classification. This group consists of chromosome pairs 13, 14, and 15.
Copies of DNA sequences which lie adjacent to each other in the same orientation (direct tandem repeats) or in the opposite direction to each other (INVERTED TANDEM REPEATS).
Staining of bands, or chromosome segments, allowing the precise identification of individual chromosomes or parts of chromosomes. Applications include the determination of chromosome rearrangements in malformation syndromes and cancer, the chemistry of chromosome segments, chromosome changes during evolution, and, in conjunction with cell hybridization studies, chromosome mapping.
The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.
Mapping of the KARYOTYPE of a cell.
A specific pair of GROUP E CHROMOSOMES of the human chromosome classification.
Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.
The ratio of two odds. The exposure-odds ratio for case control data is the ratio of the odds in favor of exposure among cases to the odds in favor of exposure among noncases. The disease-odds ratio for a cohort or cross section is the ratio of the odds in favor of disease among the exposed to the odds in favor of disease among the unexposed. The prevalence-odds ratio refers to an odds ratio derived cross-sectionally from studies of prevalent cases.
Excrement from the INTESTINES, containing unabsorbed solids, waste products, secretions, and BACTERIA of the DIGESTIVE SYSTEM.
A subspecies of gram-positive, aerobic bacteria. It is the etiologic agent of Johne's disease (PARATUBERCULOSIS), a chronic GASTROENTERITIS in RUMINANTS.
A bacterium causing tuberculosis in domestic fowl and other birds. In pigs, it may cause localized and sometimes disseminated disease. The organism occurs occasionally in sheep and cattle. It should be distinguished from the M. avium complex, which infects primarily humans.
The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.
A constitution or condition of the body which makes the tissues react in special ways to certain extrinsic stimuli and thus tends to make the individual more than usually susceptible to certain diseases.
The statistical reproducibility of measurements (often in a clinical context), including the testing of instrumentation or techniques to obtain reproducible results. The concept includes reproducibility of physiological measurements, which may be used to develop rules to assess probability or prognosis, or response to a stimulus; reproducibility of occurrence of a condition; and reproducibility of experimental results.
The genetic complement of a BACTERIA as represented in its DNA.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
Family of retrovirus-associated DNA sequences (ras) originally isolated from Harvey (H-ras, Ha-ras, rasH) and Kirsten (K-ras, Ki-ras, rasK) murine sarcoma viruses. Ras genes are widely conserved among animal species and sequences corresponding to both H-ras and K-ras genes have been detected in human, avian, murine, and non-vertebrate genomes. The closely related N-ras gene has been detected in human neuroblastoma and sarcoma cell lines. All genes of the family have a similar exon-intron structure and each encodes a p21 protein.
A form of GENE LIBRARY containing the complete DNA sequences present in the genome of a given organism. It contrasts with a cDNA library which contains only sequences utilized in protein coding (lacking introns).
The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.
A complex that includes several strains of M. avium. M. intracellulare is not easily distinguished from M. avium and therefore is included in the complex. These organisms are most frequently found in pulmonary secretions from persons with a tuberculous-like mycobacteriosis. Strains of this complex have also been associated with childhood lymphadenitis and AIDS; M. avium alone causes tuberculosis in a variety of birds and other animals, including pigs.
Elements of limited time intervals, contributing to particular results or situations.
The salinated water of OCEANS AND SEAS that provides habitat for marine organisms.
Partial immunoglobulin molecules resulting from selective cleavage by proteolytic enzymes or generated through PROTEIN ENGINEERING techniques.
Proteins isolated from the outer membrane of Gram-negative bacteria.
A free-living soil amoeba pathogenic to humans and animals. It occurs also in water and sewage. The most commonly found species in man is NAEGLERIA FOWLERI which is the pathogen for primary amebic meningoencephalitis in primates.
Deoxyribonucleic acid that makes up the genetic material of archaea.
Gram-negative helical bacteria, in the genus BORRELIA, that are the etiologic agents of LYME DISEASE. The group comprises many specific species including Borrelia afzelii, Borellia garinii, and BORRELIA BURGDORFERI proper. These spirochetes are generally transmitted by several species of ixodid ticks.
A family of the order Rodentia containing 250 genera including the two genera Mus (MICE) and Rattus (RATS), from which the laboratory inbred strains are developed. The fifteen subfamilies are SIGMODONTINAE (New World mice and rats), CRICETINAE, Spalacinae, Myospalacinae, Lophiomyinae, ARVICOLINAE, Platacanthomyinae, Nesomyinae, Otomyinae, Rhizomyinae, GERBILLINAE, Dendromurinae, Cricetomyinae, MURINAE (Old World mice and rats), and Hydromyinae.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
A species of gram-negative, rod-shaped bacteria isolated from the intestinal tract of swine, poultry, and man. It may be pathogenic.
A plant genus of the family ERICACEAE.
Inflammation, often mild, of the conjunctiva caused by a variety of viral agents. Conjunctival involvement may be part of a systemic infection.
A group of the D-related HLA antigens found to differ from the DR antigens in genetic locus and therefore inheritance. These antigens are polymorphic glycoproteins comprising alpha and beta chains and are found on lymphoid and other cells, often associated with certain diseases.
The simplest saturated hydrocarbon. It is a colorless, flammable gas, slightly soluble in water. It is one of the chief constituents of natural gas and is formed in the decomposition of organic matter. (Grant & Hackh's Chemical Dictionary, 5th ed)
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Any tests that demonstrate the relative efficacy of different chemotherapeutic agents against specific microorganisms (i.e., bacteria, fungi, viruses).
A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.
An electrochemical process in which macromolecules or colloidal particles with a net electric charge migrate in a solution under the influence of an electric current.
A glutathione transferase that catalyzes the conjugation of electrophilic substrates to GLUTATHIONE. This enzyme has been shown to provide cellular protection against redox-mediated damage by FREE RADICALS.
RNA, usually prepared by transcription from cloned DNA, which complements a specific mRNA or DNA and is generally used for studies of virus genes, distribution of specific RNA in tissues and cells, integration of viral DNA into genomes, transcription, etc. Whereas DNA PROBES are preferred for use at a more macroscopic level for detection of the presence of DNA/RNA from specific species or subspecies, RNA probes are preferred for genetic studies. Conventional labels for the RNA probe include radioisotope labels 32P and 125I and the chemical label biotin. RNA probes may be further divided by category into plus-sense RNA probes, minus-sense RNA probes, and antisense RNA probes.
Proteins, usually found in the cytoplasm, that specifically bind calcitriol, migrate to the nucleus, and regulate transcription of specific segments of DNA with the participation of D receptor interacting proteins (called DRIP). Vitamin D is converted in the liver and kidney to calcitriol and ultimately acts through these receptors.
The science dealing with the earth and its life, especially the description of land, sea, and air and the distribution of plant and animal life, including humanity and human industries with reference to the mutual relations of these elements. (From Webster, 3d ed)

Identification of DNA polymorphisms associated with the V type alpha1-antitrypsin gene. (1/8395)

alpha1-Antitrypsin (alpha1-AT) is a highly polymorphic protein. The V allele of alpha1-AT has been shown to be associated with focal glomerulosclerosis (FGS) in Negroid and mixed race South African patients. To identify mutations and polymorphisms in the gene for the V allele of alpha1-AT in five South African patients with FGS nephrotic syndrome DNA sequence analysis and restriction fragment length polymorphisms of the coding exons were carried out. Four of the patients were heterozygous for the BstEII RFLP in exon III [M1(Val213)(Ala213)] and one patient was a M1(Ala213) homozygote. The mutation for the V allele was identified in exon II as Gly-148 (GGG)-->Arg (AGG) and in all patients was associated with a silent mutation at position 158 (AAC-->AAT). The patient who was homozygous for (Ala213) also had a silent mutation at position 256 in exon III (GAT-->GAC) which was not present in any of the other four patients. Although the V allele of alpha1-AT is not associated with severe plasma deficiency, it may be in linkage disequilibrium with other genes on chromosome 14 that predispose to FGS. Furthermore, the associated silent mutation at position 158 and the Ala213 polymorphism are of interest, as these could represent an evolutionary intermediate between the M1(Ala213) and M1(Val213) subtypes.  (+info)

Identification of a cytolethal distending toxin gene locus and features of a virulence-associated region in Actinobacillus actinomycetemcomitans. (2/8395)

A genetic locus for a cytolethal distending toxin (CDT) was identified in a polymorphic region of the chromosome of Actinobacillus actinomycetemcomitans, a predominant oral pathogen. The locus was comprised of three open reading frames (ORFs) that had significant amino acid sequence similarity and more than 90% sequence identity to the cdtABC genes of some pathogenic Escherichia coli strains and Haemophilus ducreyi, respectively. Sonic extracts from recombinant E. coli, containing the A. actinomycetemcomitans ORFs, caused the distension and killing of Chinese hamster ovary cells characteristic of a CDT. Monoclonal antibodies made reactive with the CdtA, CdtB, and CdtC proteins of H. ducreyi recognized the corresponding gene products from the recombinant strain. CDT-like activities were no longer expressed by the recombinant strain when an OmegaKan-2 interposon was inserted into the cdtA and cdtB genes. Expression of the CDT-like activities in A. actinomycetemcomitans was strain specific. Naturally occurring expression-negative strains had large deletions within the region of the cdt locus. The cdtABC genes were flanked by an ORF (virulence plasmid protein), a partial ORF (integrase), and DNA sequences (bacteriophage integration site) characteristic of virulence-associated regions. These results provide evidence for a functional CDT in a human oral pathogen.  (+info)

Role of the angiotensin type 2 receptor gene in congenital anomalies of the kidney and urinary tract, CAKUT, of mice and men. (3/8395)

Angiotensin type 2 receptor gene null mutant mice display congenital anomalies of the kidney and urinary tract (CAKUT). Various features of mouse CAKUT impressively mimic human CAKUT. Studies of the human type 2 receptor (AGTR2) gene in two independent cohorts found that a significant association exists between CAKUT and a nucleotide transition within the lariat branchpoint motif of intron 1, which perturbs AGTR2 mRNA splicing efficiency. AGTR2, therefore, has a significant ontogenic role for the kidney and urinary tract system. Studies revealed that the establishment of CAKUT is preceded by delayed apoptosis of undifferentiated mesenchymal cells surrounding the urinary tract during key ontogenic events, from the ureteral budding to the expansive growth of the kidney and ureter.  (+info)

Diversity of rhizobia associated with Amorpha fruticosa isolated from Chinese soils and description of Mesorhizobium amorphae sp. nov. (4/8395)

Fifty-five Chinese isolates from nodules of Amorpha fruticosa were characterized and compared with the type strains of the species and genera of bacteria which form nitrogen-fixing symbioses with leguminous host plants. A polyphasic approach, which included RFLP of PCR-amplified 16S rRNA genes, multilocus enzyme electrophoresis (MLEE), DNA-DNA hybridization, 16S rRNA gene sequencing, electrophoretic plasmid profiles, cross-nodulation and a phenotypic study, was used in the comparative analysis. The isolates originated from several different sites in China and they varied in their phenotypic and genetic characteristics. The majority of the isolates had moderate to slow growth rates, produced acid on YMA and harboured a 930 kb symbiotic plasmid (pSym). Five different RFLP patterns were identified among the 16S rRNA genes of all the isolates. Isolates grouped by PCR-RFLP of the 16S rRNA genes were also separated into groups by variation in MLEE profiles and by DNA-DNA hybridization. A representative isolate from each of these DNA homology groups had a separate position in a phylogenetic tree as determined from sequencing analysis of the 16S rRNA genes. A new species, Mesorhizobium amorphae, is proposed for the majority of the isolates, which belonged to a moderately slow- to slow-growing, acid-producing group based upon their distinct phylogenetic position, their unique electrophoretic type, their low DNA homology with reference strains representing the species within the genus Mesorhizobium and their distinct phenotypic features. Strain ACCC 19665 was chosen as the type strain for M. amorphae sp. nov.  (+info)

RFLP of rRNA genes and sequencing of the 16S-23S rDNA intergenic spacer region of ammonia-oxidizing bacteria: a phylogenetic approach. (5/8395)

It has been established that 16S rRNA gene-based phylogeny gives a low resolution between members of the chemoautotrophic ammonia-oxidizing bacteria (AOB) belonging to the beta-subclass of the Proteobacteria. In this study, 12 isolates of AOB were ribotyped, and the sequences of the 16S-23S rDNA intergenic spacer region (ISR) were determined and used in a phylogenetic study. 16S and 23S rDNA ribotyping revealed that the AOB studied contain only one rrn operon per genome, in contrast to most bacteria, which have 5-10 copies of the rRNA genes per genome. It is likely that the presence of only one set of rRNA genes is related to the slow growth of the AOB. The 16S and 23S rRNA genes of the AOB were shown to be arranged in the classical way: a 16S rRNA gene, an ISR and a 23S rRNA gene. Despite the close phylogenetic relationship among the AOB, the relative location of the rRNA genes in the genome appears to vary considerably. The size of the ISR was approximately 400 bp in the Nitrosomonas isolates and 645-694 bp in the Nitrosospira isolates, suggesting a species-specific size difference in the ISR. The ISR contained two potential tRNA genes in the 5' end in all isolates studied. The similarity values between the ISR sequences of the AOB are low (42.9-96.2%) compared with the 16S rDNA sequence similarity values, and therefore the ISR sequences are valuable as a complementary phylogenetic tool in combination with 16S rRNA gene sequences. The phylogenetic analysis of the AOB based on ISR sequences confirms the 16S rRNA gene-based phylogeny but has the benefit of giving a higher resolution.  (+info)

Identification of yeasts by RFLP analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers. (6/8395)

The identification and classification of yeasts have traditionally been based on morphological, physiological and biochemical traits. Various kits have been developed as rapid systems for yeast identification, but mostly for clinical diagnosis. In recent years, different molecular biology techniques have been developed for yeast identification, but there is no available database to identify a large number of species. In the present study, the restriction patterns generated from the region spanning the internal transcribed spacers (ITS1 and ITS2) and the 5.8S rRNA gene were used to identify a total of 132 yeast species belonging to 25 different genera, including teleomorphic and anamorphic ascomycetous and basidiomycetous yeasts. In many cases, the size of the PCR products and the restriction patterns obtained with endonucleases CfoI, HaeIII and HinfI yielded a unique profile for each species. Accordingly, the use of this molecular approach is proposed as a new rapid and easy method of routine yeast identification.  (+info)

Epidemiological characterization of methicillin-resistant Staphylococcus aureus isolated in the North West of England by protein A (spa) and coagulase (coa) gene polymorphisms. (7/8395)

In a comparative study, isolates of methicillin-resistant Staphylococcus aureus (MRSA) with known pulsed-field gel electrophoresis (PFGE) and bacteriophage type were analysed by polymerase chain reaction (PCR) and restriction fragment length polymorphisms (RFLP) for additional discriminatory subtyping information. PFGE was previously performed using standardized, commercially available kits and pre-programmed software. Isolates were examined for coagulase (coa) and protein A (spa) gene polymorphisms following PCR amplification of the coa hypervariable and spa repeat regions. Coa gene RFLPs produced a total of 38 distinct combined patterns after digestion with HaeIII and AluI and identified the predominant epidemic (EMRSA) types 15 and 16. A unique HaeIII restriction site was identified by RFLP and sequence analysis in the coa gene for EMRSA 15 but not EMRSA 16. The spa gene PCR yielded a total of 14 different profiles ranging from 3-18 repeats with the 2 predominant EMRSA types falling into 2 distinct groups. PCR detection of coa and spa polymorphisms offer a rapid preliminary strain identification and discriminatory subtyping information for surveillance of MRSA.  (+info)

Molecular cloning and characterization of three cDNAs encoding putative mitogen-activated protein kinase kinases (MAPKKs) in Arabidopsis thaliana. (8/8395)

We isolated three Arabidopsis thaliana cDNA clones (ATMKK3, ATMKK4 and ATMKK5) encoding protein kinases with extensive homology to the mitogen-activated protein kinase kinases (MAPKKs) of various organisms in the catalytic domain. ATMKK3 shows high homology (85% identity) to NPK2, a tobacco MAPKK homologue. ATMKK4 and 5 are closely related to each other (84% identity). Phylogenetic analysis showed that the plant MAPKKs constitute at least three subgroups. The recombinant ATMKK3 and ATMKK4 were expressed as a fusion protein with glutathione S-transferase (GST) in Escherichia coli. Affinity purified GST-ATMKK3 and GST-ATMKK4 proteins contained phosphorylation activity, which shows that both the ATMKK3 and ATMKK4 genes encode functional protein kinases. Northern blot analysis revealed that the ATMKK3 gene expressed in all the organs. The levels of ATMKK4 and 5 mRNAs were relatively higher in steins and leaves than in flowers and roots. We determined the map positions of the ATMKK3, 4 and 5 genes on Arabidopsis chromosomes by RFLP mapping using P1 genomic clones.  (+info)

TY - JOUR. T1 - Cryptosporidium parvum mixed genotypes detected by PCR-restriction fragment length polymorphism analysis. AU - Reed, C.. AU - Sturbaum, G. D.. AU - Hoover, P. J.. AU - Sterling, Charles R. PY - 2002. Y1 - 2002. N2 - Combinations of 10 Cryptosporidium parvum oocysts, with various ratios of genotype I to genotype II, were isolated and subjected to PCR-restriction fragment length polymorphism analysis. Amplification of both genotypes in these samples ranged from 31 to 74% and yielded no information about the genotype proportions. In addition, since both genotypes were not always detected, amplification of a single genotype is not conclusive evidence that the sample contains only a single genotype.. AB - Combinations of 10 Cryptosporidium parvum oocysts, with various ratios of genotype I to genotype II, were isolated and subjected to PCR-restriction fragment length polymorphism analysis. Amplification of both genotypes in these samples ranged from 31 to 74% and yielded no information ...
Background: Onychomycosis is a fungal infection of one or more units of the nail caused by dermatophytes, or mold and nondermatophytes yeast. Investigations are needed to establish the diagnosis of onychomycosis before starting treatment. Several investigations methods for diagnosing onychomycosis such as microscopic examination with 20% KOH, fungal culture, histopathology examination with PAS staining (Periodic acid Schiff) and PCR (Polymerase Chain Reaction), for culture methods require a long time about 4 weeks to identify fungal that cause onychomycosis. A molecular technology such as PCR is a sensitive and specific test for the diagnosis of a variety of microorganisms including fungal pathogens. Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) is a method with the addition of the enzyme after PCR amplification allowing more specific results. Objective: To determine the diagnostic value of Polymerase Chain Reaction-Restriction Fragment Length Polymorphism ...
The present investigation was undertaken to study the genetic polymorphism of the DRB3 exon 2 in 75 crossbred cattle by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. Five genotypes i.e. HaeIII-a, HaeIII-b, HaeIII-e, HaeIII-ab and HaeIII-ae were observed when the 284 bp PCR products were digested with HaeIII restriction enzyme. The corresponding frequencies of these patterns were 0.53, 0.04, 0.01, 0.38 and 0.04, respectively. Digestion with RsaI restriction enzyme resolved 24 different restriction patterns. The frequencies of these patterns ranged from 0.013 (RsaI-f, RsaI-k and RsaI-c/n) to 0.120 (RsaI-n). The results revealed that the crossbred cows belonged to the RsaI patterns namely b, k, l, a/l, d/s, l/n, l/o and m/n, whose corresponding frequencies were 0.027, 0.013, 0.040, 0.027, 0.040, 0.067, 0.027 and 0.067, respectively. Digestion of the 284 bp PCR product of DRB3.2 gene with PstI in the crossbred cattle did not reveal any restriction site. ...
Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis of Three Lipooligosaccharide-Associated Genes of Campylobacter jejuni and Campylobacter coli Isolated From Animal Samples ...
Several high frequency restriction fragment length polymorphisms (RFLPs) associated with the human gene for apolipoprotein B have been previously reported by Priestly et al. The EcoRI RFLP here was shown to be very strongly associated with the Ag(t/z) immunochemical polymorphism of human low density lipoproteins, allowing correct Ag(t/z) phenotyping of 17 (out of 17 tested) unrelated individuals. The Xbal RFLP was associated with the Ag(g/c) immunochemical polymorphism, permitting correct phenotyping of 14 (out of 17 tested) unrelated individuals. Its close association with an RFLP permitted localization of the Ag(t/z) polymorphism to the C-terminal end of the apolipoprotein B peptide, and allowed detailed discussion of its probable molecular basis. ...
Terminal restriction fragment length polymorphism (TRFLP or sometimes T-RFLP) is a molecular biology technique for profiling of microbial communities based on the position of a restriction site closest to a labelled end of an amplified gene. The method is based on digesting a mixture of PCR amplified variants of a single gene using one or more restriction enzymes and detecting the size of each of the individual resulting terminal fragments using a DNA sequencer. The result is a graph image where the x-axis represents the sizes of the fragment and the y-axis represents their fluorescence intensity. TRFLP is one of several molecular methods aimed to generate a fingerprint of an unknown microbial community. Other similar methods include DGGE, TGGE, ARISA, ARDRA, PLFA, etc. These relatively high throughput methods were developed in order to reduce the cost and effort in analyzing microbial communities using a clone library. The method was first described by Liu and colleagues in 1997 which employed ...
TY - JOUR. T1 - Quantitative real-time polymerase chain reaction (qRT-PCR) restriction fragment length polymorphism (RFLP) method for monitoring highly conserved transgene expression during gene therapy. AU - Bruzzone, Carol M.. AU - Belcher, John D.. AU - Schuld, Nathan J.. AU - Newman, Kristal A.. AU - Vineyard, Julie. AU - Nguyen, Julia. AU - Chen, Chunsheng. AU - Beckman, Joan D.. AU - Steer, Clifford J.. AU - Vercellotti, Gregory M.. PY - 2008/12. Y1 - 2008/12. N2 - Evaluation of the transfer efficiency of a rat heme oxygenase-1 (HO-1) transgene into mice requires differentiation of rat and mouse HO-1. However, rat and mouse HO-1 have 94% homology; antibodies and enzyme activity cannot adequately distinguish HO-1. We designed a quantitative real-time polymerase chain reaction (qRT-PCR) method to monitor HO-1 transcription relative to a housekeeping gene, GAPDH. The ratio of rat and mouse HO-1 mRNA could be estimated through restriction fragment length polymorphism (RFLP) analysis of the PCR ...
Synonyms for restriction fragment length polymorphism at Thesaurus.com with free online thesaurus, antonyms, and definitions. Dictionary and Word of the Day.
A typing method was developed for Neisseria meningitidis serogroup A by analysis of restriction fragment length polymorphisms (RFLP) of the class 1 outer membrane protein gene (porA). By using appropriate primers, an approximately 1,116-bp fragment of the porA gene was amplified by PCR and then was digested with the restriction endonuclease MspI. The digestion products were separated on 10% polyacrylamide gels and were stained with silver. One hundred three clinical isolates of group A N. meningitidis from 17 provinces of China collected over a 26-year period were analyzed. Results of MspI-generated RFLP profiles of PCR-amplified porA genes were compared with those obtained by conventional serosubtyping. There was a band of about 400 bp common to all strains examined, and the 103 strains of serogroup A resulted in 22 unique RFLP patterns. The differences in bands could be observed mainly in the range of 120 to 280 bp. The smaller fragments were useful in distinguishing meningococci with the same ...
RFLP (Restriction Fragment Length Polymorphism) RFLP RFLP was developed at the late 70 s due to the discovery of restriction enzymes (REs; or called as restriction ... – A free PowerPoint PPT presentation (displayed as a Flash slide show) on PowerShow.com - id: 425ce8-OTc2N
TY - JOUR. T1 - Restriction maps and restriction fragment length polymorphisms of the human 21-hydroxylase genes. AU - Donohoue, Patricia A.. AU - Jospe, Nicholas. AU - Migeon, Claude J.. AU - McLean, Robert H.. AU - Bias, Wilma B.. AU - White, Perrin C.. AU - Van Dop, Cornelis. N1 - Funding Information: ACKNOWLEDGEMENTS: We thank Dr. M. C. Carroll of Harvard pK4 clone, Ms. S. F. Klupt for assistance in preparation Ms. C. Schaefer for C4 phenotyping, Drs. E. Fleischnick, Crigler, Jr., for aid in obtaining blood samples from Bw47-linked CAH, and Ms. D. Qgorzalek for preparation work was supported in part by NIH grants AM-00180 AM-31920 (R.H.M.), AM-36085 (C.V.D.) and CA-22507 University for the of restriction blots, L. Key, and J. F. two patients with HLA-of this manuscript. This (C.J.M.), AM-07116 (C.J.M.), (P.C.W.).. PY - 1986/4/29. Y1 - 1986/4/29. N2 - Restriction maps were constructed for the two human 21-hydroxylase genes (21-OHA and 21-OHB) by using DNA from subjects homozygous for a ...
OBJECTIVE: The relationship between response to dietary fat and cholesterol, and the EcoRI restriction fragment length polymorphism (RFLP) of the apolipoprotein B(apoB) gene was examined. DESIGN: Forty-nine free-living subjects took part in a prospective double-blind crossover dietary intervention study. The apoB EcoRI cutting site was present in five women and 18 men (E+) and absent in 15 women and 11 men (E-). INTERVENTION: Subjects consumed a low fat (25% energy), low cholesterol (less than 200 mg/day) diet. After two weeks on this background diet (baseline) subjects were randomly assigned to consume a liquid supplement for three weeks which was either fat and cholesterol free or which contained fat (30 to 36 g) and cholesterol (650 to 780 mg). After the first three-week period subjects switched to the other supplement. Blood samples were collected for plasma lipid analysis after an overnight fast on two consecutive days at the end of baseline and on three consecutive days after each ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The Hallman et al. [8] definition of endophytic bacteria requires surface-disinfested plant tissue or extraction from the plant. Disinfestation by killing all the epiphytic bacteria may be effective when culture-dependent protocols are used, but is not appropriate in culture-independent protocols, such as the present one, since the DNA or RNA of dead epiphytes, if not removed, would still be amplified by bacteria-specific PCR. For those organs, like tubers, whose outer layers can be easily peeled off, endophytic bacteria can be isolated from inside of the plants unambiguously. However, peeling the epidermis off leaves, while possible, is not practical for a study like the present one. Therefore, to study leaf endophytic bacterial communities, it is critical to dislodge epiphytic bacteria from the leaf surfaces as far as possible. We have dislodged epiphytes using methods similar to those reported by others [13, 26-28]. Since we did not test the rinse water for rDNA amplicons, we cannot be ...
Cnr (Colourless non-ripening) is a dominant pleiotropic ripening mutation of tomato (Lycopersicon esculentum) which has previously been mapped to the proximal region of tomato chromosome 2. We describe the fine mapping of the Cnr locus using both linkage analysis and fluorescence in situ hybridisation (FISH). Restriction fragment length polymorphism (RFLP)-, amplified restriction fragment polymorphism (AFLP)-, and cleaved amplified polymorphic sequence (CAPS)- based markers, linked to the Cnr locus were mapped onto the long arm of chromosome 2. Detailed linkage analysis indicated that the Cnr locus was likely to lie further away from the top of the long arm than previously thought. This was confirmed by FISH, which was applied to tomato pachytene chromosomes in order to gain an insight into the organisation of hetero- and euchromatin and its relationship to the physical and genetic distances in the Cnr region. Three molecular markers linked to Cnr were unambiguously located by FISH to the long arm of
Peripheral blood (2 ml) was taken from all subjects and genomic DNA was extracted from peripheral blood using the TIANamp Blood DNA kit (Tiangen Biotech, Beijing, China) according to manufacturers instructions. The quality and concentration of extracted DNA was measured in two OD wavelength 260 and 280 nm using NanoDrop (Thermo Scientific, U.S.A.). SNP genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism method. The primers used for the nucleotide extension reaction were AACAAGTAAGAATGAAAAGAGGACATGGT (forward) and CCCCCAATGAGGTCATAGAAGAATC (reverse) for rs2275913 and ACCAAGGCTGCTCTGTTTCT (forward) and GGTAAGGAGTGGCATTTCTA (reverse) for rs763780 polymorphism. For PCR, 25 μl reaction mixture contained as follows: 2.5 μl of 10× reaction buffer (with 1.5 mM MgCl2), 2 μl of deoxynucleotide triphosphate (dNTP; 2.5 mM), 2 μl of each pair primer, 50 ng DNA template, 1 μl of 0.4U Taq polymerase (Applied Biosystems, Evry, France) and 14.5 μl ddH2O. The ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Infertility affects 1 in 6 couples and approximately 1 in 25 men. Male factor infertility is a major cause of spermatogenic anomalies, the causes of which are largely unknown. Impaired repro-ductive functions in men might result from physiological, genetic, and/or environmental factors such as xenobiotics. The multi-drug re-sistance1 (MDR1) gene encodes a P-glycoprotein which has a role in the active transport of various substrates providing protection of somatic cells from potentially toxic substances, including xenobi-otics. MDR1 is highly expressed at the luminal surface of capillary endothelial cells, and is expressed in Leydig cells, testicular mac-rophages, and Sertoli cells. We performed genotype and haplotype analyses of MDR1 in 192 infertile and 102 fertile Turkish men for the genetic markers C1236T and C3435T, using polymerase chain reaction-restriction fragment length polymorphism analysis. In the overall population, correlations were analyzed in all genotype mod-els. We found that ...
An evaluation of the utility of rep PCR typing compared to the 15 loci discriminatory set of MIRU-VNTR was undertaken. Twenty-nine isolates of Mycobacterium tuberculosis from patients were examined. Genomic DNA was extracted from the isolates by standard method. The number of copies of tandem repeats of the 15 MIRU-VNTR loci was determined by PCR amplification and agarose gel electrophoresis of the amplicons. M. tuberculosis outbreak-related strains were distinguished from other isolates. MIRU-VNTR typing identified 4 major clusters of strains. The same isolates clustered together after RFLP typing, but rep-PCR identified only 3 of them. The concordance between RFLP and MIRU-VNTR typing was complete, with the exception of two isolates with identical RFLP patterns that differed in the number of tandem repeat copies at two MIRU-VNTR alleles. A further isolate, even sharing the same RFLP pattern, differed by one repeat from the rest of its cluster. We also tested the use of an automated rep-PCR for ...
Aims: Several studies indicated that CYP2C19 loss-of-function polymorphisms have a higher risk of stent thrombosis (ST) after percutaneous coronary interventions (PCIs). However, this association has not been investigated thoroughly in Chinese population. In this study, we aimed to determine the effect of CYP2C19 loss-of-function polymorphisms on the occurrence of ST and other adverse clinical events in Chinese population.. Methods: The study population included 1 068 consecutive patients undergoing intracoronary stent implantation after pre-loading with 600mg of clopidogrel. CYP2C19*2 and CYP2C19*3 were genotyped by use of polymerase chain reaction-restriction fragment length polymorphism analysis. The adverse clinical events recorded were ST, death, myocardial infarction, and bleeding events. The primary end point of the study was the incidence of cumulative ST within 1 year following PCI. The secondary end point was other adverse clinical outcomes 1 year after the procedure.. Results: The ...
Proliferative diabetic retinopathy is an important cause of visual impairment. We investigated whether the polymorphism of the β3-adrenoreceptor (β3-AR) gene, which is associated with insulin resistance and an earlier onset of NIDDM, was associated with proliferative diabetic retinopathy (PDR) in 215 Japanese NIDDM patients with a duration of diabetes of ,10 years. The polymorphism of the β3-AR gene was determined by polymerase chain reaction-restriction fragment length polymorphism analysis. The Trp64Arg allele of the β3-AR gene was significantly more frequent in the NIDDM patients with PDR (P = 0.002), but not in those with non-PDR (P = 0.151), than in NIDDM patients without diabetic retinopathy. Those with the mutation had an earlier onset of diabetes, a longer duration of diabetes, and higher current and maximal BMI values, compared with those without the mutation. Moreover, this mutation was also associated with higher serum triglyceride and decreased HDL-cholesterol levels. When ...
Molecular identification of larval stages of Otiorhynchus (Coleoptera: Curculionidae) species based on polymerase chain reaction-restriction fragment length polymorphism analysis Journal of Applied Entomology (2008) 132, 230-238 ...
Salmonella spp. is the major bacterial pathogen in poultry and is responsible for significant economic losses of the poultry industry in many parts of the world. Among Salmonella spp., Salmonellagallinarum and S.pullorum are the most common causative agents of chicken salmonellosis resulting in high mortality and morbidity.The aim of this study was to identify S. gallinarum and S. pullorum by using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method.In this study, 13 samples of Salmonella, isolated from local poultry, were obtained from Razi Type Culture Collection (RTCC). For the PCR-RFLP method based on the fliC gene, extracted DNA was used as a template for amplifying of the fliC gene (197bp) using specific primers. PCR products were subjected to digestion using Hinp1I restriction endonuclease.For the PCR, 197 bp fliC fragment was amplified from all 13 isolates. Ten out of 13 were S.gallinarum and the other three were S. pullorum. As part of the PCR-RFLP, two
A quantitative molecular technique was developed for rapid analysis of microbial community diversity in various environments. The technique employed PCR in which one of the two primers used was fluorescently labeled at the 5 end and was used to amplify a selected region of bacterial genes encoding 16S rRNA from total community DNA. The PCR product was digested with restriction enzymes, and the fluorescently labeled terminal restriction fragment was precisely measured by using an automated DNA sequencer. Computer-simulated analysis of terminal restriction fragment length polymorphisms (T-RFLP) for 1,002 eubacterial sequences showed that with proper selection of PCR primers and restriction enzymes, 686 sequences could be PCR amplified and classified into 233 unique terminal restriction fragment lengths or ribotypes. Using T-RFLP, we were able to distinguish all bacterial strains in a model bacterial community, and the pattern was consistent with the predicted outcome. Analysis of complex ...
The technique for RFLP analysis is, however, slow and cumbersome. It requires a large amount of sample DNA, and the combined process of probe labeling, DNA fragmentation, electrophoresis, blotting, hybridization, washing, and autoradiography can take up to a month to complete. A limited version of the RFLP method that used oligonucleotide probes was reported in 1985.[1] The results of the Human Genome Project have largely replaced the need for RFLP mapping, and the identification of many single-nucleotide polymorphisms (SNPs) in that project (as well as the direct identification of many disease genes and mutations) has replaced the need for RFLP disease linkage analysis (see SNP genotyping). The analysis of VNTR alleles continues, but is now usually performed by polymerase chain reaction (PCR) methods. For example, the standard protocols for DNA fingerprinting involve PCR analysis of panels of more than a dozen VNTRs. RFLP is still used in marker-assisted selection. Terminal restriction fragment ...
|i |Aim.|/i| The aim of this study was to evaluate the role of the Lys751Gln (rs13181) |i |ERCC2|/i| gene polymorphism in clinical parameters and the risk for development of ovarian cancer. |i |Material and Methods.|/i| The study consisted of 430 patients with ovarian cancer (mean age: 53.2 ± 10.11) and 430 healthy subjects (mean age: 50.31 ± 18.21). Analysis of the gene polymorphisms was performed using the PCR-based restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) and 95% confidence intervals (CIs) for each genotype and allele were calculated. |i |Results.|/i| The results obtained indicate that the genotype Gln/Gln is associated with an increased risk of ovarian cancer (OR 5.01; 95% CI 3.37–7.43; |svg xmlns:xlink=http://www.w3.org/1999/xlink xmlns=http://www.w3.org/2000/svg style=vertical-align:-3.42938pt id=M1 height=11.7782pt version=1.1 viewBox=-0.0498162 -8.34882 57.0529 11.7782 width=57.0529pt||g transform=matrix(.013,0
Angiotensin converting enzyme (ACE) is a membrane-bound dipeptidyl carboxy-peptidase that generates vasoconstricting angiotensin II and inactivates vasodilating bradykinin. The ACE gene encodes two isozymes: the somatic isozyme (sACE) is found in many tissues including vascular endothelial cells, whereas the testis-specific isozyme (tACE) is expressed exclusively in developing spermatids and mature sperm. Thus, ACE might have physiological functions in addition to blood pressure regulation. Male mice lacking tACE activity show reduced fertility, indicating its importance in male fertility. In this study, we screened five recently defined tACE gene polymorphisms in 90 Singapore Chinese men with infertility and 84 fertile controls using PCR-based restriction fragment length polymorphism and DNA sequencing. However, only one of these polymorphisms was identified in both patient and control groups, the frequency of which was not significantly different in patients and controls. Thus, these ACE gene ...
Widespread use of DNA restriction fragment length polymorphism (RFLP) to differentiate strains of Mycobacterium tuberculosis to monitor the transmission of tuberculosis has been hampered by the need to culture this slow-growing organism and by the level of technical sophistication needed for RFLP typing. We have developed a simple method which allows simultaneous detection and typing of M. tuberculosis in clinical specimens and reduces the time between suspicion of the disease and typing from 1 or several months to 1 or 3 days. The method is based on polymorphism of the chromosomal DR locus, which contains a variable number of short direct repeats interspersed with nonrepetitive spacers. The method is referred to as spacer oligotyping or spoligotyping because it is based on strain-dependent hybridization patterns of in vitro-amplified DNA with multiple spacer oligonucleotides. Most of the clinical isolates tested showed unique hybridization patterns, whereas outbreak strains shared the same ...
TY - JOUR. T1 - Loss of Heterozygosity for Loci on the Long Arm of Chromosome 6 in Human Malignant Melanoma. AU - Millikin, D.. AU - Trent, J.. PY - 1991/10/15. Y1 - 1991/10/15. N2 - Malignant melanoma has been documented to display recurring abnormalities of chromosome 6, particularly the long arm (6q). Restriction fragment length polymorphism analysis was used as a molecular genetic approach to examine loci on chromosome 6q for loss of constitutional heterozygosity (LOH). Five DNA markers that recognize restriction fragment length polymorphisms along 6q and one polymorphic DNA marker for 6p were used to screen 20 autologous pairs of tumor DNA and normal DNA to determine the tumor and constitutional genotypes of each patient. LOH on chromosome 6q was identified at 21 of S3 inform ative loci (40%). Five patients with more than one informative locus had allele losses consistent with the loss of the entire long arm (or of an entire copy) of chromosome 6, while four other patients demonstrated ...
Background: Peroxisome proliferator-activated receptor gamma (PPAR gamma) is a ligand dependent transcription factor involved in various processes, including carcinogenesis. We aimed to investigate any possible association of the PPAR gamma Pro12Ala (rs1801282) polymorphism with risk of developing gastric cancer (GC). Patients and Methods: A hospital based case control study was designed covering 50 patients with GC and 120 healthy controls. The frequencies of PPAR gamma Pro12Ala (rs1801282) were determined using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. Results: The Ala12 allele of the PPAR gamma Pro12Ala G gene was associated with a 1.95 fold increased risk of GC development (p: 0.022; 95% CI: 1.58-2.40). Subgroup analyses showed that the same allele was also associated with metastasis (p: 0.000; OR: 4.09; 95% CI: 2.273-7.368) and differentiation (p: 0.004; OR: 1.95; 95% CI: 1.335-2.875) in patients with GC. Conclusion: This study suggests that the ...
Aims: IL-1b-3953 C,T and MMP-9-1562C,T variants have been shown to be linked to the development of myocardial infarction (MI), although previous studies have reported inconsistent results. The aim of the present study was to determine whether these genetic variations are associated with MI susceptibility in an Iranian population. Methods: In the current study, 117 patients with MI and 120 control group members were selected as participants. Peripheral blood samples were taken from all the subjects for genomic DNA extraction. Single nucleotide polymorphism (SNP) genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays. Results: Multiple logistic regression analysis revealed that the TT genotype of the IL-1b-3953 C,T polymorphism is associated with a significant MI protective effect in: the homozygote model after adjustment for MI risk factors (odds ratio OR]: 0.18, confidence interval 95% CI] = 0.04-0.72; p = 0.01); and also in the recessive ...
Despite the rapid development of pharmacogenetic testing and the frequencies of medication related emergencies increasing, pharmacogentic testing is not yet implemented extensively in clinical practice. Several studies document that polymorphic Cytochrome P450 isoenzymes CYP2C9, CYP2C19 and CYP2D6 are responsible for the metabolism of many clinically important drugs and xenobiotics. These polymorphisms contribute to inter-individual and interethnic variation in drug metabolism which may lead to differences in drug response, suggesting that common dose regimen will not always equivocate to efficacious dosing. The CYP2D6*2, CYP2D6*4 and CYP2D6*10 variants were studied in four Indian populations (Gujarati, Punjabi, Bengali and Koya tribe). Genotypes at individual alleles were identified using Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP) method. Differences in frequencies of CYP2D6 genotypes/ alleles were compared at regional and global level. CYP2D6*2 variant ...
Background: Polymorphism of NFKB1 and NFKB1A are highly associated with cancer. We have assessed polymorphism in the promoter region of NFKB1 -94 del/ins ATTG (rs28362491) and NFKB1A -826 C/T (rs2233406) with the risk of HNSCC in Indian population. Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used for the genotyping NFKB1 -94 del/ins ATTG and NFKB1A -826 C/T. Sequencing was done to validate the results of PCR-RFLP. Statistical analysis of data was done by Stata/SE-14.0 software. Results: ins/ins genotype was observed to be a risk factor of HNSCC as compared del/del genotype of NFKB1 -94 ATTG. Interactive effects of smoking and chewing on ins/ins genotype showed 13.96 and 10.92 fold increased risk of HNSCC. NFKB1A -826 C/T polymorphism, TT genotype showed no association with the risk of HNSCC as compared to wild type CC genotype. Conclusion: Our results showed NFKB1 -94 del/ins ATTG with smoking and tobacco chewing may increase the risk of HNSCC
After immunoflurescent microscopy DNA mutational analysis is the final step in elucidating the underlying molecular defect, and in most cases, it reduces the number of genes to be screened. DNA is extracted from blood of the patient and family members. Initial mutation screening is performed by restriction fragment-length polymorphism analysis, hotspot analysis, and finally, direct DNA sequencing ...
INTRODUCTION: Asthma is a common respiratory childhood disease that results from an interaction between genetic, environmental and immunologic factors. The implication of nucleotide-binding and oligomerization domain 1 and 2 (NOD1/CARD4, NOD2/CARD15) was highlighted in many inflammatory diseases.. METHODS: In this case-control study, we analyzed the association of three NOD2 polymorphisms and one NOD1 variant, in 338 Tunisian asthmatic children and 425 healthy Controls, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. We also assessed NOD1 and NOD2 mRNA and protein levels by qRT-PCR and ELISA techniques.. RESULTS: The homozygous AA genotype of rs2075820 was a risk factor for asthma (OR 2.39). The influence of the E266K variant in the presence of the heterozygous AG genotype was higher in male than female groups. The homozygous AA genotype was a risk factor associated with asthma, for patients aged between 6 and 18 years OR 2.39, IC95% (1.04-5.49) p , ...
The vitamin D receptor (VDR) was the first candidate gene to be studied in relation to osteoporosis, and most attention has focused on polymorphisms situated near the 3 flank of VDR. The aim of this study was to investigate the association about VDR gene Apa I polymorphism with bone mineral density (BMD) in postmenopausal women with osteoporosis. We studied a total of 136 postmenopausal women with a mean age of 56.36 +/- 10.29 years. Among them, a total of 75 had osteoporosis, 37 had osteopenia, and 24 had normal BMD. Venous blood samples were obtained for evaluation of bone metabolism and genotyping. The VDR Apa I genotype was determined by polymerase chain reaction-restriction fragment length polymorphism. BMDs at the lumbar spine and hip were measured by dual-energy X-ray absorptiometry. Postmenopausal women with aa genotype had significantly lower BMD values (grams per centimeter square) at lumbar spines compared to persons with AA genotype. Also, postmenopausal women with AA genotype had ...
Molecular analysis of the CYP21A2 gene was performed for the detection of the six most common point mutations (p.P30L, p.I172N, p.V281L, p.Q318X, the splice site mutation Int2 [IVS2-13A/C,G], and the cluster of three mutations [p.I236N, p.V237E, and p.M239K] designed as CL6). Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was performed on 47 unrelated Egyptian 21α-OH deficiency patients and their available parents to detect the presence of the six most common point mutations. ...
Genome-wide association studies (GWAS) have proved the association of IKZF1 polymorphisms with childhood acute lymphoblastic leukemia (ALL). In the present study, we aimed to inspect the impact of IKZF1 gene polymorphisms and childhood ALL in a sample of Iranian population who live in south east of Iran. This case-control study was done on 110 children diagnosed with ALL and 120 healthy children. The IKZF1 (rs4132601 T > G, rs11978267 A > G, rs11980379 T > C, and rs10272724 T > C) polymorphisms were determined using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP). The results showed that rs4132601 T > G polymorphism increased the risk of ALL in the codominant (OR = 2.96, 95 % CI = 1.58-5.54, p = 0.0008, TG vs TT; and OR = 2.75, 95 % CI = 1.31-5.76, p = 0.0094, GG vs TT) and dominant (OR = 2.89, 95 % CI = 1.61-5.19, p = 0.0004, TG + GG vs TT) inheritance models. On the other hand, the rs4132601 G allele increased the risk of ALL (OR = 1.86, 95 % CI = 1.28-2.96; p = ...
Penelitian ini bertujuan untuk membandingkan konsentrasi, tingkat kemurnian, visualisasi elektroforesis, dan penggunaan DNA hasil isolasi untuk polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) dari delapan spesies ikan laut. Sampel DNA yang diperoleh dari daging dan sirip ikan baronang (Siganus javus), kerapu (Epinephelus sp), ekor kuning (Caesionidae sp), kakap merah (Lutjanus campechanus), kurisi (Nemipterus nematophorus), kue (Caranx melampygus), bawal hitam (Parastromateus niger), dan selar (Selaroides leptolepis) diisolasi menggunakan metode presipitasi amonium asetat. Primer universal sitokrom b digunakan untuk mengamplifikasi mtDNA menggunakan PCR. Amplikon dipotong menggunakan enzim restriksi Hinf I. Hasil menunjukkan bahwa konsentrasi dan kemurnian DNA sampel daging dan sirip tidak berbeda nyata (P,0.05) yaitu berturut-turut 22.01±20.29 dan 1.44±0.27 untuk konsentrasi dan kemurnian DNA sampel daging, serta 52.86±41.37 dan 1.54±0.23 untuk konsentrasi dan ...
Background Assess the relation between the presence of PVUII and XBAI polymorphisms in the estrogen receptor alpha gene and mammographic density in postmenopausal women.. Methods For the present analysis, 189 postmenopausal women who had never used hormonal therapy and who did not have clinical or mammographic features were selected. Based on the ACR-BIRADSâ 2003 classification, the mammographic density was determined by three independent readers (two subjective ratings and one computerized - Adobe Photoshop â 7.0 software). Blood samples were available to extract DNA according to KIT GFX â protocol. PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism) was then used to identify the polymorphisms.. Results There was a high degree of agreement among the three readers to determine the mammographic density (Kappa,0.75). Sixty women (32%) had dense breasts and 129 (68%) had non-dense breasts. The PVUII polymorphism was found in 132 (69.8%) of 189 women, while the XBAI ...
OBJECTIVE: To determine whether transforming growth factor beta1 (TGFbeta1) gene DNA polymorphism is associated with pathogenesis in the fibrosis of patients with systemic sclerosis (SSc). METHODS: Eighty-seven Japanese patients with SSc including 30 with diffuse type and 57 with limited type together with 110 unrelated controls were investigated. Pulmonary fibrosis was determined in 34 SSc patients using high-resolution chest computed tomography. TGFbeta1 genetic polymorphisms were analyzed in 2 loci; T869C (Leu10Pro) in codon 10 at exon 1, and C-509T in the promoter region using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). RESULTS: Neither the genotype of T/C polymorphism in T869C nor C/T polymorphism in C-509T revealed any difference in distribution between SSc and controls. In the group of SSc patients with pulmonary fibrosis, a weak but significantly high frequency (p = 0.05) of TC+CC (the presence of C allele) in T869C, and CT+TT (the presence of T allele) ...
Gly1057Asp polymorphism in insulin receptor substrate (IRS)-2 is related to insulin resistance and diabetes mellitus (DM), which both contribute to the pathogenesis of coronary artery disease (CAD). Hence, we hypothesize that Gly1057Asp polymorphism in IRS-2 is associated with CAD. Patients receiving elective coronary angiography were enrolled. Significant stenosis is defined as a luminal diameter stenosis greater than 50%. Patients without significant stenosis were defined as group A, and those with significant stenosis in at least one major coronary artery were defined as group B. Genotypes were determined by polymerase chain reaction/restriction fragment length polymorphism. Chi-square test and multivariate logistic regression were used to evaluate the relationship between Gly1057Asp polymorphism in IRS-2 and CAD. The homeostasis model assessment of insulin resistance (HOMA-IR) index was calculated as a representative of insulin resistance. Multiple linear regression was used to analyze the
P53 can bind to the promoter of miR-34a/b/c, inducing their expression at the transcriptional level. Previous reports have shown that TP-53 and miR-34b/c may play crucial roles in carcinogenesis. We conducted a case-control study to investigate the association between miR-34b/c rs4938723 and TP-53 Arg72Pro polymorphisms and the risk of breast cancer (BC) in Chinese women. We genotyped the two polymorphisms in 228 BC patients and 307 healthy controls using polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing assay. We found that the miR-34b/c rs4938723 CT genotype and C allele were associated with significantly increased risks of BC compared with the TT genotype and T allele (CT vs. TT: OR = 1.81, 95 % CI, 1.24 - 2.65, P = 0.002; C vs. T: OR = 1.36, 95 % CI, 1.06 - 1.74, P = 0.016, respectively). Moreover, a significant association between the cases and controls was also observed in a dominant model (OR = 1.75; 95 % CI, 1.22 - 2.51, P = 0.002). Stratified analysis ...
Background: Interleukin (IL)-23 has an important role in tumor immune regulation. Objective: To investigate the possible association of interleukin-23 receptor (IL23R) gene variants rs1884444, rs10889677 and rs11209026 with development of acute lymphoblastic leukemia (ALL). Methods: The IL23R variants were studied in 164 ALL patients and compared to 175 healthy controls by polymerase chain reaction-restriction fragment length polymorphism. The relationship between these variants and clinical and laboratory features of the patients and response to therapy were evaluated. Results: No significant differences in genotype and allele frequencies existed between patients and controls. The rs1884444TG genotype was significantly lower in patients who relapsed (24.2%) compared to those without relapse (55.9%, p=0.006). Fewer patients who relapsed had evidence of the G allele (P=0.034). The TG genotype was associated with a longer complete remission at1804±116 days compared to other genotypes (|1217 days, p=0.028
CALLAS, Ney et al. Genetic polymorphism of the E apolipoprotein in school age children: comparison with levels of plasma lipids and apolipoproteins. Biomédica [online]. 2007, vol.27, n.4, pp.526-536. ISSN 0120-4157.. Introduction. Research in laboratories around the world has documented the contribution of the E apolipoprotein alleles to structural variations of lipids and apolipoproteins. Objective. The gene frequencies of the E apolipoprotein alleles were compared with the lipid and apolipoprotein levels in school age children. Materials and methods. Six hundred and ninety one 5 to 15 years old school age children from the Colombian departments of Cundinamarca, Boyacá, Meta, Santander and Norte de Santander, were evaluated.The genotypes of the E apolipoprotein were identified by polymerase chain reaction-restriction fragment length polymorphism. Plasma levels for the following 5 lipids and lipoproteins were assayed: total cholesterol, HDL (high density lipoprotein) cholesterol, LDL (low ...
In a group of 50 randomly selected case-matched patients from 1999, the positive blood cultures were concomitant with fever in 98%, intravenous phlebitis in 44%, and recurrent bacteremia in 20%. Fever disappeared approximately 6 hours after intravenous catheter removal. Polymerase chain reaction-restriction fragment length polymorphism revealed strain homogeneity in patient, water, and alcohol isolates. Contaminated tap water had been used to dilute alcohol for skin antisepsis and for decontamination of the caps of heparin vials. Only sporadic cases directly attributable to breach of protocol were reported after single-use alcohol swabs were substituted ...
The knowledge about microorganisms-activity and diversity under hop production is still limited. We assumed that, different systems of hop production (within the same soil and climatic conditions) significantly influence on the composition of soil microbial populations and its functional activity (metabolic potential). Therefore, we compared a set of soil microbial properties in the field experiment of two hop production systems (a) ecological based on the use of probiotic preparations and organic fertilization (b) conventional-with the use of chemical pesticides and mineral fertilizers. Soil analyses included following microbial properties: The total number microorganisms, a bunch of soil enzyme activities, the catabolic potential was also assessed following Biolog EcoPlates®. Moreover, the abundance of ammonia-oxidizing archaea (AOA) was characterized by terminal restriction fragment length polymorphism analysis (T-RFLP) of PCR ammonia monooxygenase α-subunit (amoA) gene products. Conventional and
This study aimed at investigating the genetic diversity of a panel of Candida africana strains recovered from vaginal samples in different countries. All fungal strains were heterozygous at the mating type-like locus and belonged to the genotype A of Candida albicans. Moreover, all examined C. africana strains lack N-acetylglucosamine assimilation and sequence analysis of the HXK1 gene showed a distinctive polymorphism that impair the utilization of this aminosugar in this yeast.Multilocus sequencing of seven housekeeping genes revealed a substantial genetic homogeneity among the strains, except for the CaMPIb and VPS13 loci which contributed significantly to the classification of our set of C. africana strains into 6 existing diploid sequence types. Amplified fragment length polymorphism (AFLP) fingerprint analysis yielded greater genotypic heterogeneity among the C. africana strains. Overall the data reported here show that in C. africana genetic diversity occurs and the existence of this intriguing
This dataset contains the 5 TRFLP fragment data.. T4-like myovirus communities were analyzed by terminal restriction fragment length polymorphism (TRFLP) of g23, which encodes the major capsid protein (Chow and Fuhrman, 2012). Viral fingerprints were obtained from both terminal fragments (5 and 3). g23-TRFLP products were run in duplicate on non-adjacent lanes on an ABI377 by slab gel electrophoresis with internal size standards (Bioventures, Murfreesboro, TN, USA) every 25 bp (50-900 bp) or 50 bp (900-1400 bp). Peaks were identified in DAx (van Mierlo, Inc, Eindhoven, The Netherlands). Fragments (50-500 bp) were rounded to the nearest 0.1 bp and dynamically binned (Ruan, et al., 2006b; Chow and Fuhrman, 2012). The resulting bins were manually curated to merge bins ,0.1 bp wide with the nearest neighbor. Terminal fragments from in silico analysis of publicly available T4-like viral genomes were used to assign identities to environmental g23-TRFLP OTUs. Unique fragment lengths were considered ...
RFLP Lets generate a restriction map for a region of human X-chromosome 5kb 3kb The restriction map in the same region of the X chromosome of a second individual may appear as 8kb Normal GAATTC Mutant GAGTTC
... or Restriction fragment length polymorphism). *SSLP (or Simple sequence length polymorphism). *AFLP (or Amplified fragment ... Some of the methods used to study the genome or phylogenetics are RFLP, Amplified fragment length polymorphism (AFLP), RAPD, ... RAD markers (or Restriction site associated DNA markers). Molecular genetic markers can be divided into two classes a) ... single nucleotide polymorphism, SNP), or a long one, like minisatellites. ...
Intra-individual tissue-specific restriction fragment length polymorphism". FEBS Lett. 221 (1): 129-33. doi:10.1016/0014-5793( ... Suzuki Y, Yoshitomo-Nakagawa K, Maruyama K, Suyama A, Sugano S (1997). "Construction and characterization of a full length- ...
Intra-individual tissue-specific restriction fragment length polymorphism". FEBS Lett. 221 (1): 129-33. doi:10.1016/0014-5793( ... Ruiz A, Bhat SP, Bok D (1995). "Characterization and quantification of full-length and truncated Na,K-ATPase alpha 1 and beta 1 ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)". Genome ...
Intra-individual tissue-specific restriction fragment length polymorphism". FEBS Lett. 221 (1): 129-33. doi:10.1016/0014-5793( ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)". Genome ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ...
The markers were mostly PCR-based restriction fragment length polymorphisms. Zygospores are the sexual structures of P. ...
Xu DQ, Guilhot S, Galibert F (May 1985). "Restriction fragment length polymorphism of the human c-fms gene". Proc. Natl. Acad. ... It is 60.002 kilobases in length. The encoded protein has 972 amino acids and a predicted molecular weight of 107.984 ...
The work relied on locating restriction fragment length polymorphisms (RFLP). The first RFLP that Page found was from a site of ...
Terminal restriction fragment length polymorphism (T-RFLP) is a method that uses fluorescently-labeled DNA fragments to produce ... Marsh, T.L. (2005). "Culture-independent microbial community analysis with terminal restriction fragment length polymorphism". ... terminal restriction fragment length polymorphism and automated ribosomal intergenic spacer analysis, for determination of ... "An evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis for the study of microbial community ...
Restriction fragment length polymorphism analysis demonstrated this classification scheme needed revision. This genus is ... "Phylogeny of the genus Agaricus inferred from restriction analysis of enzymatically amplified ribosomal DNA". Fungal Genet Biol ...
Palsdottir A, Cross SJ, Edwards JH, Carroll MC (1984). "Correlation between a DNA restriction fragment length polymorphism and ... Hessing M, van 't Veer C, Hackeng TM, Bouma BN, Iwanaga S (Oct 1990). "Importance of the alpha 3-fragment of complement C4 for ... DNA sequences, polymorphism, and linkage to the 21-hydroxylase gene". Journal of Immunology. 146 (3): 1057-66. PMID 1988494. ... Jenhani F, Bardi R, Gorgi Y, Ayed K, Jeddi M (Apr 1992). "C4 polymorphism in multiplex families with insulin dependent diabetes ...
... chromosomal localization and associated restriction fragment length polymorphisms". Proc Natl Acad Sci U S A. 83 (15): 5592-6. ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ...
RFLP Restriction fragment length polymorphism is a technique used to detect variations in homologous DNA. Specific restriction ... AFLP Amplified fragment length polymorphism is a PCR-based DNA fingerprinting technique. DNA is first digested with ... The restriction fragments are then ligated together. A molecular marker is then generated when specific fragments are selected ... The DNA marker allows for the size of the restriction fragments to be estimated. Minisatellites Similar to RFLP, this technique ...
Santillano, D.; Boetius, A.; Ramette, A. (2010). "Improved dsrA-based Terminal Restriction Fragment Length Polymorphism ...
Cross SJ, Tonks S, Trowsdale J, Campbell RD (1992). "Novel detection of restriction fragment length polymorphisms in the human ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)". Genome ...
"Lactobacillus hilgardii and Lactobacillus brevis DNA analysis by restriction fragment length polymorphism (RFLP)". Food ...
The first true method of DNA profiling was restriction fragment length polymorphism analysis. The first use of RFLP analysis in ... By 1995, scientists attempted to return to a VNTR based analysis combined with PCR technology called amplified fragment length ... Smaller fragments would travel farther through the gel than larger fragments separating them out. These differences were used ... The process of RFLP analysis was extremely time consuming and due to the length of the repeats used, between 9 and 100 base ...
"Random Amplified Polymorphic DNA and Restriction Fragment Length Polymorphism analyses of Cannabis sativa". "99 Percent of All ...
... and Ray White developed the method for constructing a genetic linkage map using restriction fragment length polymorphisms that ... "Construction of a genetic linkage map in man using restriction fragment length polymorphisms". American Journal of Human ... With Janet E. Mertz, Davis was the first to demonstrate the use of restriction endonucleases for joining DNA fragments. Davis ... "Cleavage of DNA by RI restriction endonuclease generates cohesive ends". Proceedings of the National Academy of Sciences. 69 ( ...
"Genetic relationship of wood and plains bison based on restriction fragment length polymorphisms" (PDF). Canadian Journal of ...
Vogelstein B, Fearon ER, Hamilton SR, Feinberg AP (1985). "Use of restriction fragment length polymorphisms to determine the ...
as identified by 16S rDNA restriction fragment length polymorphism analysis in a trout farm". Journal of Applied Microbiology. ...
Suzuki H, Yamashiro K (2002). "L-myc restriction fragment length polymorphism and histological pattern of invasion in lung ... "Ethnic differences in frequencies of gene polymorphisms in the MYCL1 region and modulation of lung cancer patients' survival" ( ...
DNA can be analyzed through restriction fragment length polymorphism (RFLP) and Polymerase chain reactions (PCR). The RFLP ... There are multiple methods for testing and analyzing genetic information including restriction fragment length polymorphism ( ... These fragments are sorted through gel electrophoresis. The gel demonstrates the length of the fragments allowing specialists ... Restriction enzymes digest portions of the DNA, leaving short fragments. ...
Strains were characterized by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. ... "Construction of an infectious horsepox virus vaccine from chemically synthesized DNA fragments". PLOS ONE. 13 (1): e0188453. ...
... revealed by restriction fragment length polymorphism (RFLP) markers". Euphytica. 101: 103-108. doi:10.1023/a:1018323721803. ... Niu vai endocarp fragments have been recovered in archaeological sites in the St. Matthias Islands of the Bismarck Archipelago ... The fragments are dated to approximately 1000 BCE, suggesting that cultivation and artificial selection of coconuts were ... enabling farmers and real estate developers to clear land with fewer restrictions. With this, it will no more be considered as ...
In addition they used RFLP technology (Restriction fragment length polymorphism) to examine differences between DNA. Using ... Given that the mitogenome is about 16553 base pairs in length (each base-pair which can be aligned with known references is ... Cann, Stoneking & Wilson (1987) did not rely on a predicted TCHLCA to estimate single-nucleotide polymorphism (SNP) rates. ... Consequently, this study used transversions, which evolve at a slower rate than the more common transition polymorphisms. ...
Followed by restriction fragment length polymorphism (RFLP) digestion or gene sequencing to obtain the results. The highly ... Further testing with amplified fragment length polymorphism (AFLP) found 3 clusters in Sudan, in contrast to the 2 clusters ... Restriction endonuclease assay (REA) and random amplification of polymorphic DNA (RAPD) helped characterize the different ... When following these methods for M. mycetomatis, alternative suspensions of hyphal fragments are required, as conidial forms ...
"HpaII polymerase chain reaction restriction fragment length polymorphism in the human CD19 gene on 16p11". Human Heredity. 48 ( ... CD21, complement receptor 2, can bind fragments of C3 that have covalently attached to glycoconjugates by complement activation ...
"HLA class II antigens and DNA restriction fragment length polymorphism in myasthenia gravis in Japan". Ann. Neurol. 29 (2): 168 ... 1991). "Immunogenetics of rheumatoid arthritis and primary Sjögren's syndrome: DNA polymorphism of HLA class II genes". Dis. ...
... revealed by restriction fragment length polymorphism (RFLP) markers". Euphytica. 101: 103-108.. ... enabling farmers and real estate developers to clear land with fewer restrictions.[57] With this, it will no more be considered ...
... microorganisms associated with the seagrass Halophila stipulacea estimated by restriction fragment length polymorphism analysis ... "A method for high precision sequencing of near full-length 16S rRNA genes on an Illumina MiSeq". PeerJ 4: e2492. PMC 5036073 ... "Identification of species by multiplex analysis of variable-length sequences". Nucleic Acids Research 38 (22): e203. PMC ...
... and restriction fragment length polymorphism (RFLP). Paternity testing can now also be performed while the woman is still ... In the United Kingdom, there were no restrictions on paternity tests until the Human Tissue Act 2004 came into force in ... Genetic parental testing technology advanced further with the isolation of the first restriction enzyme in 1970. Highly ...
A recent molecular study using restriction fragment length polymorphism analysis suggests that the three subspecies are ... The adults are relatively large flies, with lengths of 0.5-1.5 cm,[9] and have a recognizable shape or bauplan which makes them ... Feasibility studies indicated that the fly population was confined to very fragmented habitats and a population genetics study ...
Instead, the adapters are added after the DNA is treated and fragmented with bisulfite, allowing all fragments to be amplified ... Other methods to detect DNA methylation include methylation-sensitive restriction enzymes. Restriction enzymes also enable the ... MDA products result in a length of about 12 kb and ranges up to around 100 kb, enabling its use in DNA sequencing.[10] In 2017 ... Single-nucleotide polymorphisms (SNPs), which are a big part of genetic variation in the human genome, and copy number ...
As the body length of the mammals' ancestors fell below 50 mm (2 inches), advances in thermal insulation and temperature ... In an influential 1988 paper, Timothy Rowe advocated this restriction, arguing that "ancestry... provides the only means of ... are represented only by teeth and jaw fragments, which is not very helpful. ...
... fucosyltransferase gene and two H locus-related DNA restriction fragments. Isolation of a candidate for the human Secretor ... 1998). "Extensive polymorphism of the FUT2 gene in an African (Xhosa) population of South Africa". Hum. Genet. 103 (2): 204-10 ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2002). "The cytoplasmic tail of alpha 1,3-galactosyltransferase inhibits Golgi localization of the full-length enzyme". J. Biol ...
... or assumed noncoding DNA sequences such as microsatellites or those generating restriction fragment length polymorphisms (RFLPs ...
... large DNA fragments into shorter DNA fragments. The fragmented DNA may then be cloned into a DNA vector and amplified in a ... Read length. Accuracy (single read not consensus). Reads per run. Time per run. Cost per 1 million bases (in US$). Advantages. ... Even so, a recent study did use the short sequence reads and mass spectroscopy to compare single-nucleotide polymorphisms in ... For longer targets such as chromosomes, common approaches consist of cutting (with restriction enzymes) or shearing (with ...
Insert the fragments of DNA into vectors that were cut with the same restriction enzyme. Use the enzyme DNA ligase to seal the ... Plasmids are generally 2 to 4 kilobase-pairs (kb) in length and are capable of carrying inserts up to 15kb. Plasmids contain an ... Teams are now able to catalog polymorphisms in genomes and investigate those candidate genes contributing to maladies such as ... In either case, the fragments are ligated into a vector that has been digested with the same restriction enzyme. The vector ...
A single domestication for potato based on multilocus amplified fragment length polymorphism genotyping. PNAS. 2005, s. 14694- ... How Do Agricultural Policy Restrictions to Global Trade and Welfare Differ across Commodities? [online]. The World Bank, March ...
Restriction fragment length polymorphism in mitochondrial DNA stocks of Coregonus in Finland. Pol. Arch. Hydrobiol. 39(3-4):541 ... Study of the populations of Coregonus autumnalis migratorius in Lake Baikal by the restriction analysis of mitochondrial DNA. J ...
... the ds-cDNA is digested by restriction enzymes (at location 'X' and 'X'+11) to produce 11-nucleotide 'tag' fragments. These ... In 1995, the idea of reducing the tag length from 100 to 800 bp down to tag length of 10 to 22 bp helped reduce the cost of ... In addition, the longer contigs can be screened for polymorphisms. As UTRs show a large number of polymorphisms between ... Following this, the linkers, containing internal restriction sites, are digested with the appropriate restriction enzyme and ...
In general, these particular peptides are small polymers, about 9 amino acids in length.[citation needed] Foreign antigens ... For example, if the cell is infected by a virus, the HLA system brings fragments of the virus to the surface of the cell so ... Variant types for each sequence feature are defined based upon all known polymorphisms in the HLA locus being described. SFVT ... T cells require presentation via MHC molecules to recognize foreign antigens - a requirement known as MHC restriction. These ...
1998). "Why restriction fragment length polymorphism analysis of mitochondrial DNA failed to resolve sardine (Sardinops) ... length Typ. length Max. mass Max. age. years Trophic. level Fish. Base FAO ITIS IUCN. status ... One criterion suggests fish shorter in length than 15 cm (6 in) are sardines, and larger fish are pilchards.[6] ...
A restriction fragment length polymorphism is said to occur when the length of a detected fragment varies between individuals, ... In molecular biology, restriction fragment length polymorphism (RFLP) is a technique that exploits variations in homologous DNA ... Terminal restriction fragment length polymorphism (TRFLP or sometimes T-RFLP) is a technique initially developed for ... a DNA sample is digested into fragments by one or more restriction enzymes, and the resulting restriction fragments are then ...
"A single domestication for potato based on multilocus amplified fragment length polymorphism genotyping". PNAS. 102 (41): 14694 ... Numerous countries have placed restrictions on the production, import or use of GMO foods and crops.[141] Currently a global ... a combination of trade restrictions, exchange rate policies and subsidies have affected farmers in both the developing and the ... "How Do Agricultural Policy Restrictions to Global Trade and Welfare Differ across Commodities?" (PDF). Policy Research Working ...
Groenen PM, Bunschoten AE, van Soolingen D, van Embden JD (December 1993). "Nature of DNA polymorphism in the direct repeat ... the spacers are fragments of DNA gathered from viruses that previously tried to attack the cell. The source of the spacers was ... as the short read lengths prevent more than two or three repeat units appearing in a single read. CRISPR identification in raw ... overhangs left by Cpf1 can be used for DNA assembly that is much more target-specific than traditional Restriction Enzyme ...
Citrus as Inferred from Internal Transcribed Spacer and Chloroplast DNA Sequence and Amplified Fragment Length Polymorphism ... Market Classification, Maturity Standards And Processing Or Packing Restrictions For Hybrids, D20. Departmental, 20. Department ...
As a result, it is both the percentage of GC base pairs and the overall length of a DNA double helix that determines the ... The restriction enzyme EcoRV (green) in a complex with its substrate DNA[118] ... Leslie AG, Arnott S, Chandrasekaran R, Ratliff RL (October 1980). "Polymorphism of DNA double helices". Journal of Molecular ... This enzyme makes discontinuous segments (called Okazaki fragments) before DNA ligase joins them together. ...
"On Understanding Types, Data Abstraction, and Polymorphism". Manuscript (1985). Archived from the original on 19 June 2006. ... The static semantics defines restrictions on the structure of valid texts that are hard or impossible to express in standard ... The following C language fragment is syntactically correct, but performs operations that are not semantically defined (the ... generally sequences of bits of various lengths.[47] High-level untyped languages include BCPL, Tcl, and some varieties of Forth ...
This can result in a stable polymorphism, with an equilibrium frequency that depends on the drive strength and direct fitness ... Östergren G (1945). "Parasitic nature of extra fragment chromosomes". Botaniska Notiser. 2: 157-163.. ... when Austin Burt and Robert Trivers published the first book-length treatment of the topic, the tide was changing.[11] While ... does not always have organismal fitness as the sole driver is when selfish genetic elements have their way without restriction ...
The gel also shows a positive control, and a DNA ladder containing DNA fragments of defined length for sizing the bands in the ... Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR (1989). "Engineering hybrid genes without the use of restriction enzymes: gene ... "RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable ... in length, although some techniques allow for amplification of fragments up to 40 kbp.[8] The amount of amplified product is ...
... terminal restriction fragment length polymorphism (t-RFLP),[4] amplified fragment length polymorphism (AFLP),[5] and multiplex ... Several common genotyping techniques include restriction fragment length polymorphism (RFLP), ... Software for Terminal-Restriction Fragment Length Polymorphism (T-RFLP) Data Analysis" (PDF). SoftGenetics. Archived from the ... DNA fragment analysis can also be used to determine such disease causing genetics aberrations as microsatellite instability ( ...
... restriction fragment length polymorphism (RFLP), random amplification of polymorphic DNA (RAPD), amplified fragment length ... polymorphism (AFLP), and single nucleotide polymorphisms (SNPs).[9]. Positive and negative selectable markers[edit]. The ... The term 'perfect marker' is sometimes used when tests are performed to detect a SNP or other DNA polymorphism in the gene of ... be it another gene or a polymorphism that is easier to detect, such as a short tandem repeat) may present as the most realistic ...
... and restriction fragment length polymorphism (RFLP). For the most part, however, genetic fingerprinting has all but taken over ...
Restriction landmark genomic scanning, a complicated and now rarely used assay based upon restriction enzymes' differential ... DNA methylation polymorphisms may be used as an early biomarker of atherosclerosis since they are present before lesions are ... a length greater than 200bp, 2) a G+C content greater than 50%, 3) a ratio of observed to expected CpG greater than 0.6, ... immunoprecipitation is used to isolate methylated DNA fragments for input into DNA detection methods such as DNA microarrays ( ...
Kõige esimene kasutatav meetod oli RFLP (ingl restriction fragment length polymorphism) analüüs, mille käigus kasutati ...
E.g. we know that calorie restriction to about 1500 Kcal per day or less is very likely able to lower the risk of getting ... Buyru, N; Tezol, A; Yosunkaya-Fenerci, E; Dalay, N (2003). "Vitamin D receptor gene polymorphisms in breast cancer". Exp Mol ... I don't see how Heaney and Hollick were misrepresented in the fragment of discussion you picked up on. The article certainly ... Borges, CR; Rehder, DS; Jarvis, JW; Schaab, MR; Oran, PE; Nelson, RW (2010). "Full-length characterization of proteins in human ...
A restriction fragment length polymorphism is said to occur when the length of a detected fragment varies between individuals, ... In molecular biology, restriction fragment length polymorphism (RFLP) is a technique that exploits variations in homologous DNA ... Terminal restriction fragment length polymorphism (TRFLP or sometimes T-RFLP) is a technique initially developed for ... a DNA sample is digested into fragments by one or more restriction enzymes, and the resulting restriction fragments are then ...
I know a Restriction Fragment Length Polymorphism sounds like something that must be impossibly complicated to understand, but ... RFLP is an acronym that stands for "Restriction Fragment Length Polymorphism." Thats quite a mouthful and once youve said ... My guess is that for many of you, that word is "length." When we talk about length in this context, we are talking about the ...
Restriction Fragment Length Polymorphism Paper Towel Nick Translation Bromphenol Blue Restriction Fragment Length Poly These ... Bernatzky R. (1989) Restriction fragment length polymorphism. In: Gelvin S.B., Schilperoort R.A., Verma D.P.S. (eds) Plant ... Burr B, Evola SV, Burr FA, Beckmann JS (1983) The application of restriction fragment length polymorphisms to plant breeding. ... Evola SV, Burr FA, Burr B (1986) The suitability of restriction fragment length polymorphisms as genetic markers in maize. ...
... is a type of polymorphism that results from variation in the DNA sequence ... So a single base difference between two people could result in either the presence or absence of that restriction site. So then ... And that results in a polymorphism, or difference between those two people. We typically see these, or we monitor these, by ... So these differences in nucleic acid sequences and restriction enzyme binding sites just mean that theres a difference in the ...
Terminal restriction fragment length polymorphism (TRFLP or sometimes T-RFLP) is a molecular biology technique for profiling of ... "Formation of Pseudo-Terminal Restriction Fragments, a PCR-Related Bias Affecting Terminal Restriction Fragment Length ... a tool for optimal resolution of terminal restriction fragment length polymorphism analysis based on user defined primer-enzyme ... "Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16S ...
Terminal restriction fragment length polymorphism (T-RFLP) is an increasingly widely used technique in mycorrhizal ecology. In ... Terminal restriction fragment length polymorphism (T-RFLP) is an increasingly widely used technique in mycorrhizal ecology. In ... Using terminal restriction fragment length polymorphism (T-RFLP) to identify mycorrhizal fungi: a methods review. ... Blackwood CB, Marsh T, Kim S-H, Paul EA (2003) Terminal restriction fragment length polymorphism data analysis for quantitative ...
The natural genomic variability of poliovirus analyzed by a restriction fragment length polymorphism assay.. Balanant J1, ... Our results indicate that the assay we developed for the analysis of the restriction fragment length polymorphism of the ... The genomic variability of poliovirus was examined by analyzing the restriction fragment length polymorphism of a reverse- ... the restriction profiles of the amplified genomic fragment of a total of 72 strains of various geographic and temporal origins ...
... characterise TEM-derived extended-spectrum beta-lactamases a fast and easy method using polymerase chain reaction-restriction ... fragment length polymorphism was developed. This method was validated with ten reference TEM-type extended-spectrum beta- ... Molecular characterisation by PCR-restriction fragment length polymorphism of TEM beta-lactamases FEMS Microbiol Lett. 1995 Dec ... Finally, the combination of polymerase chain reaction-restriction fragment length polymorphism and plasmid analysis allowed us ...
Terminal Restriction Fragment Length Polymorphism for Identification of Cryptosporidium Species in Human Feces L. S. Waldron, B ... Strain CBDB1 by Using Terminal Restriction Fragment Length Polymorphism and Quantitative PCR Anke Wagner, Lorenz Adrian, Sabine ... Tilting at Windmills: a Response to a Recent Critique of Terminal Restriction Fragment Length Polymorphism Data Noah Fierer ... Improved dsrA-Based Terminal Restriction Fragment Length Polymorphism Analysis of Sulfate-Reducing Bacteria Daniel Santillano, ...
Terminal restriction fragment length polymorphism (tRFLP) is a potentially high-throughput method for the analysis of complex ... T-Align, a web-based tool for comparison of multiple terminal restriction fragment length polymorphism profiles.. Smith CJ1, ... replicate profiles are compared and used to generate a single consensus profile containing only terminal restriction fragments ... profiles representing different communities are compared to produce a list showing whether a terminal restriction fragment (TRF ...
... () ... DNA fingerprinting of Bacillus cereus from diverse sources by restriction fragment length polymorphism analysis. Advances in ... Field, D. and Wills, C. (1998) Abundant micro satellite polymorphism in Saccharomyces cerevisiae, and the different ...
Synonyms for restriction fragment length polymorphism at Thesaurus.com with free online thesaurus, antonyms, and definitions. ... More words related to restriction fragment length polymorphism. DNA fingerprinting noun. method of identification of ... restriction fragment length polymorphism. star. see definition of restriction fragment length polymorphism show all. noun. ... Synonyms for restriction fragment length polymorphism noun method of identification of individuals by comparing dna ...
Cytologically Integrated Physical Restriction Fragment Length Polymorphism Maps for the Barley Genome Based on Translocation ... Cytologically Integrated Physical Restriction Fragment Length Polymorphism Maps for the Barley Genome Based on Translocation ... Cytologically Integrated Physical Restriction Fragment Length Polymorphism Maps for the Barley Genome Based on Translocation ... Cytologically Integrated Physical Restriction Fragment Length Polymorphism Maps for the Barley Genome Based on Translocation ...
A cloned EcoRI fragment from a Neisseria meningitidis Group B serotype 15P1.16 sulphonamide-resistant strain was used to probe ... Southern blots of total chromosomal DNA restriction fragments (enzy … ... A restriction fragment length polymorphism (RFLP) typing method was developed for Neisseria meningitidis. ... A restriction fragment length polymorphism (RFLP) typing method was developed for Neisseria meningitidis. A cloned EcoRI ...
Application of Amplified Restriction Fragment Length Polymorphism for Genetic Characterization of Colletotrichum Pathogens of ... Amplified restriction fragment length polymorphism (AFLP) was used to assess the levels of genomic variations among species and ... Application of Amplified Restriction Fragment Length Polymorphism for Genetic Characterization of Colletotrichum Pathogens of ... isolates within complex genera such as Colletotrichum because of its ability to generate large numbers of polymorphisms and the ...
Restriction fragment length polymorphism among Ae. speltoides DNAs (top) and monomorphism among Ae. tauschii DNAs (bottom) at ... Restriction Fragment Length Polymorphism and Divergence in the Genomic Regions of High and Low Recombination in Self- ... Restriction Fragment Length Polymorphism and Divergence in the Genomic Regions of High and Low Recombination in Self- ... Restriction Fragment Length Polymorphism and Divergence in the Genomic Regions of High and Low Recombination in Self- ...
Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism ( ... Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism ( ... Community analysis of preservative-treated southern pine (Pinus spp ) using terminal restriction fragment length polymorphism ( ... Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism ( ...
A Restriction Fragment Length Polymorphism (RFLP) of Apo AII in Hyperlipidaemia and Atherosclerosis. G.A.A. Ferns, S. Shelley, ... A Restriction Fragment Length Polymorphism (RFLP) of Apo AII in Hyperlipidaemia and Atherosclerosis ... A Restriction Fragment Length Polymorphism (RFLP) of Apo AII in Hyperlipidaemia and Atherosclerosis ... A Restriction Fragment Length Polymorphism (RFLP) of Apo AII in Hyperlipidaemia and Atherosclerosis ...
... study aimed at improving two identification methods based on polymerase chain reaction-restriction fragment length polymorphism ... The ITS2 fragment digested by Bsi ZI showed the highest diagnostic power. This assay allowed the discrimination of at least 13 ... f RESTRICTION FRAGMENT LENGTH POLYMORPHISM METHOD FOR THE IDENTIFICATION OF MAJOR AFRICAN AND ASIAN MALARIA VECTORS WITHIN THE ... RESTRICTION FRAGMENT LENGTH POLYMORPHISM METHOD FOR THE IDENTIFICATION OF MAJOR AFRICAN AND ASIAN MALARIA VECTORS WITHIN THE ...
... were clarified by comparing their restriction fragment length polymorphism patterns and sequence similarities of the polymerase ... Differential fragment patterns in relation to different genospecies of Lyme disease spirochetes were observed among tested ... Based on the differential fragment patterns and sequence similarity among these Taiwan isolates, the genetic identity of these ... isolated in Taiwan by restriction fragment length polymorphism analysis of 5S(rrf)-23S(rrl) intergenic spacer amplicons. * Li- ...
Restriction fragment length polymorphism (RFLP) analysis of amplified 16S ribosomal DNA (rDNA), previously proven to be ... Differentiation of Burkholderia Species by PCR-Restriction Fragment Length Polymorphism Analysis of the 16S rRNA Gene and ... Differentiation of Burkholderia Species by PCR-Restriction Fragment Length Polymorphism Analysis of the 16S rRNA Gene and ... Differentiation of Burkholderia Species by PCR-Restriction Fragment Length Polymorphism Analysis of the 16S rRNA Gene and ...
Restriction fragment length polymorphism analysis of Cryptococcus neoformans isolates from environmental (pigeon excreta) and ... Restriction fragment length polymorphism analysis of environmental (pigeon excreta) and clinical Cryptococcus neoformans var. ... Restriction fragment length polymorphism analysis of Cryptococcus neoformans isolates from environmental (pigeon excreta) and ... Restriction fragment length polymorphism analysis of Cryptococcus neoformans isolates from environmental (pigeon excreta) and ...
PubMed journal article The BsmI vitamin D receptor restriction fragment length polymorphism (bb) influences the effect of ... The BsmI vitamin D receptor restriction fragment length polymorphism (bb) influences the effect of calcium intake on bone ... "The BsmI Vitamin D Receptor Restriction Fragment Length Polymorphism (bb) Influences the Effect of Calcium Intake On Bone ... The BsmI vitamin D receptor restriction fragment length polymorphism (bb) influences the effect of calcium intake on bone ...
... View the animation below, then complete the quiz to test your knowledge of the ... The population is said to be ________ for restriction enzyme fragment patterns.. A). polygenic. ... Restriction Endonuclea... Early Genetic Engineer... cDNA. Steps in Cloning a Gene. Steps in Cloning a Gen... Steps in Cloning a ... Restriction Endonuclea... Early Genetic Engineer... cDNA. Steps in Cloning a Gene. Steps in Cloning a Gen... Steps in Cloning a ...
Characterization of Bois Noir Isolates by Restriction Fragment Length Polymorphism of a Stolbur-Specific Putative Membrane ... Characterization of Bois Noir Isolates by Restriction Fragment Length Polymorphism of a Stolbur-Specific Putative Membrane ... and restriction fragment length polymorphism analysis divided these amplicons further into 12 profiles (V1 to V12). French BNp ... Amplification of stol-1H10 from infected grapevines, weeds, and Hyalesthes obsoletus produced fragments of three sizes, ...
Diers, Brian William, "Restriction fragment length polymorphism mapping of quantitative and qualitative traits in soybean " ( ... Restriction fragment length polymorphism mapping of quantitative and qualitative traits in soybean ...
... Restriction enzymes cut DNA at precise points producing *a collection of DNA ... with the smaller fragments migrating farther than the larger fragments. *One or more of the fragments can be visualized with a ... complementary to a run of nucleotides in one or more of the restriction fragments and is *radioactive (or fluorescent). If ... a set of DNA fragments of known and decreasing length (MARKER). They provide a built-in ruler for measuring the exact distance ...
IS1245 restriction fragment length polymorphism typing of Mycobacterium avium from patients admitted to a reference hospital in ... IS1245 restriction fragment length polymorphism (RFLP) was determined according to an internationally standardized protocol (14 ... Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism ... 1998). IS1245 restriction fragment length polymorphism typing of Mycobacterium avium isolates: proposal for standardization. ...
RFLP RFLP was developed at the late 70 s due to the discovery of restriction enzymes (REs; or called as restriction ... - A ... RFLP: Restriction Fragment Length Polymorphism - RFLP: Restriction Fragment Length Polymorphism A restriction enzyme cuts the ... RFLP (Restriction Fragment Length Polymorphism). Description:. RFLP (Restriction Fragment Length Polymorphism) RFLP RFLP was ... RFLP (Restriction Fragment Length Polymorphism). 1. RFLP(Restriction Fragment Length Polymorphism) 2. RFLP* RFLP was developed ...
  • In RFLP analysis , a DNA sample is digested into fragments by one or more restriction enzymes , and the resulting restriction fragments are then separated by gel electrophoresis according to their size. (wikipedia.org)
  • RFLP is an acronym that stands for "Restriction Fragment Length Polymorphism. (scienceblogs.com)
  • Restriction fragment length polymorphism (RFLP) is a type of polymorphism that results from variation in the DNA sequence recognized by restriction enzymes. (genome.gov)
  • Terminal restriction fragment length polymorphism (TRFLP or sometimes T-RFLP) is a molecular biology technique for profiling of microbial communities based on the position of a restriction site closest to a labelled end of an amplified gene. (wikipedia.org)
  • Thus, T-RFLP is different from ARDRA and RFLP in which all restriction fragments are visualized. (wikipedia.org)
  • Terminal restriction fragment length polymorphism (T-RFLP) is an increasingly widely used technique in mycorrhizal ecology. (springer.com)
  • using terminal restriction fragment length polymorphism (T-RFLP) analysis. (usda.gov)
  • The effects of chlorothalonil (CTN), butylated hydroxytoluene (BHT), and ammoniacal copper quat (ACQ-C) on the fungal community on southern yellow pine (SYP) were assessed using terminal restriction fragment length polymorphism (T-RFLP) analysis over 15 months. (usda.gov)
  • Community analysis of preservative-treated southern pine (Pinus spp ) using terminal restriction fragment length polymorphism (T-RFLP) analysis Part 1: Fungal field study. (usda.gov)
  • A restriction fragment length polymorphism (RFLP) typing method was developed for Neisseria meningitidis. (nih.gov)
  • A group of 75 apparently unrelated organisms gave rise to 26 different restriction fragment length patterns and two different groups of epidemiologically related strains had RFLP patterns that were distinct for each group. (nih.gov)
  • This study aimed at improving two identification methods based on polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) already developed for either group. (ajtmh.org)
  • is also involved, though rarely, in CF. Since standard laboratory procedures fail to provide an accurate identification of these organisms, we assessed the ability of restriction fragment length polymorphism (RFLP) analysis of amplified 16S ribosomal DNA (rDNA), with the combination of the patterns obtained with six endonucleases, to differentiate Burkholderia species. (asm.org)
  • IS 1245 restriction fragment length polymorphism (RFLP) was determined according to an internationally standardized protocol (14). (scielo.br)
  • RFLP was developed at the late 70s due to the discovery of restriction enzymes (REs or called as restriction endonucleases) from bacteria. (powershow.com)
  • Southern blot analysis of the genomic DNA from 17 individuals showed perfect correspondence between a Bsp 12861 restriction fragment length polymorphism (RFLP) and the Ag(c/g) locus on human apolipoprotein (apo) B. The RFLP polymorphism is caused by a C--------T transition at nucleotide 421 on the cDNA, resulting in a threonine-to-isoleucine conversion. (ahajournals.org)
  • Methods] Sixty RA patients and 102 ethnically matched unrelated healthy subjects were typed for LMP, TAP, and disease associated HLA-DRB1 alleles by using a new strategy based on polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) with amplification created restriction sites. (csic.es)
  • This study used terminal restriction fragment length polymorphism (T-RFLP) and next-generation sequencing (NGS) to analyze and compare gut microbiota of Japanese control subjects and Japanese patients with carcinoma in adenoma. (spandidos-publications.com)
  • OBJECTIVES--To employ polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis for the rapid differentiation of Neisseria gonorrhoeae protein IB (PIB) isolates and to compare its usefulness with the widely accepted auxotype/serovar classification scheme. (bmj.com)
  • The EcoRI RFLP here was shown to be very strongly associated with the Ag(t/z) immunochemical polymorphism of human low density lipoproteins, allowing correct Ag(t/z) phenotyping of 17 (out of 17 tested) unrelated individuals. (ahajournals.org)
  • The Xbal RFLP was associated with the Ag(g/c) immunochemical polymorphism, permitting correct phenotyping of 14 (out of 17 tested) unrelated individuals. (ahajournals.org)
  • Its close association with an RFLP permitted localization of the Ag(t/z) polymorphism to the C-terminal end of the apolipoprotein B peptide, and allowed detailed discussion of its probable molecular basis. (ahajournals.org)
  • Polymorphism, PCR- RFLP, GDF9 gene. (ajol.info)
  • Terminal restriction fragment length polymorphism (T- RFLP ) is a culture-independent method of obtaining a genetic fingerprint of the composition of a microbial community. (msu.edu)
  • Unique restriction fragment length polymorphism (RFLP) patterns were observed in 84.3% of the strains, showing their epidemiological independence, and 15.7% were grouped into 22 clusters. (up.ac.za)
  • A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. (rupress.org)
  • RFLP, as a molecular marker, is specific to a single clone/restriction enzyme combination. (waterpathogens.org)
  • Restriction fragment length polymorphism (RFLP) analysis and GISH (genomic in situ hybridization) were performed on euploid plants derived from crosses between Oryza sativa (2n = 24, AA) and two brown planthopper-resistant accessions of O. eichingeri (2n = 24, CC). After screening with 164 RFLP markers, 60 of the 67 euploid plants were identified as introgression lines, each carrying 1-6 small O. eichingeri segments integrated on chromosomes 1, 2, 6, or 10. (elsevier.com)
  • The present investigation was undertaken to study the genetic polymorphism of the DRB3 exon 2 in 75 crossbred cattle by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. (koreascience.or.kr)
  • 1999. Genetic polymorphism of BoLA DRB3 gene in Jersey crossbred and Ongole cattle revealed by PCR-RFLP. (koreascience.or.kr)
  • 3. Since elements regulating gene expression are known to exist in the first intron of other genes, this new restriction fragment length polymorphism (RFLP) might play a role in the reported overexpression of the SHR renin gene independent of changes in the length of the tandem repeat element. (edu.au)
  • The ratio of rat and mouse HO-1 mRNA could be estimated through restriction fragment length polymorphism (RFLP) analysis of the PCR products. (umn.edu)
  • The common methods used to identify and describe the DNA profile includes - Restriction fragment length polymorphism (RFLP) and Short tandem repeat profiling (STR). (news-medical.net)
  • In RFLP, the DNA is cut into segments of varying lengths by an enzyme, then the segments are separated out on the basis of size using a technique called electrophoresis. (news-medical.net)
  • In this study, we developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to differentiate usp gene types. (ums.edu.my)
  • This technique is based on Polymerase Chain Reaction-Restriction Fragment length Polymorphism (PCR-RFLP) of a conserved region in the mitochondrial (mt)cytochrome b (cyt b) gene for meat identification and authentication. (ums.edu.my)
  • The mutation was confirmed by restriction fragment length polymorphism (RFLP) analysis and found that the transition resulted in the absence of a BslI restriction site in the affected members of the pedigree. (plos.org)
  • We have optimized a duplex polymerase chain reaction-restriction fragment length polymorphism assay (PCR-RFLP) for the simultaneous detection of both variants in acute leukemia patients, from Tunisia. (cdc.gov)
  • Restriction Fragment Length Polymorphism (RFLP) was performed in two separate tubes followed by agarose gel electrophoresis. (cdc.gov)
  • Three restriction enzymes were used in Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) using the mitochondrial cytochrome b region to establish a differential diagnosis which detect and discriminate between three meat species: pork, cow and chicken. (upm.edu.my)
  • The amplified 359 base pairs (bp) portion of the mitochondrial cyt b gene from pure or mixed samples in different ratios was cut using three different restriction enzymes resulting in species specific restriction fragment length polymorphism (RFLP). (upm.edu.my)
  • Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) merupakan metode PCR dengan penambahan enzim setelah amplifikasi sehingga memungkinkan hasil yang lebih spesifik. (usu.ac.id)
  • Tujuan : Mengetahui nilai diagnostik Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) dalam menegakkan diagnosis onikomikosis dengan menggunakan kultur jamur sebagai baku emas dan mengetahui spesies jamur yang paling banyak menyebabkan onikomikosis. (usu.ac.id)
  • Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) is a method with the addition of the enzyme after PCR amplification allowing more specific results. (usu.ac.id)
  • Objective: To determine the diagnostic value of Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) in the diagnosis of onychomycosis using fungal culture as the gold standard and to find out the majority fungal species that cause onychomycosis. (usu.ac.id)
  • This HBV genotyping system using restriction fragment length polymorphism (RFLP) was confirmed to be correct when the PCR products of the S gene in 23 isolates collected from various countries were digested with this method. (fujita-hu.ac.jp)
  • Mutations were screened by DNA sequencing and verified by restriction fragment length polymorphism (RFLP) analysis. (molvis.org)
  • Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. (scielo.br)
  • Let's take a look at RFLP (Restriction Fragment Length Polymorphism) analysis - the original "DNA fingerprinting" - 1st in it's wider use, then how we use a form of it in molecular cloning confirmation. (thebumblingbiochemist.com)
  • Restriction fragment length polymorphism (RFLP) maps have been constructed for cultivated sunflower (Helianthus annuus L.) using three independent sets of RFLP probes. (usda.gov)
  • The aim of this research was to integrate RFLP markers from two sets with RFLP markers for resistance gene candidate (RGC) and amplified fragment length polymorphism (AFLP) markers. (usda.gov)
  • Genotypes of the MTHFR C677T and A1298C polymorphisms were detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). (molvis.org)
  • The products were compared by performing restriction fragment length polymorphism (RFLP) analysis with restriction endonucleases Alu I, Hap II, Hha I, and Hae III. (elsevier.com)
  • The 16S rDNA sequence of T. ferrooxidans NASF-1 possessed an additional restriction site for Hha I. These results show that iron-oxidizing bacteria isolated from natural environments were rapidly identified as T. ferrooxidans by the method combining RFLP analysis with physiological analysis. (elsevier.com)
  • We assessed RET G691S (rs1799939), L769L (rs1800861) and S904S (rs1800863) polymorphisms by restriction fragment length polymorphism (RFLP) in order to explain their potential role in the diagnosis and prognosis of Papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC). (intechopen.com)
  • Some of the methods used to study the genome or phylogenetics are RFLP, Amplified fragment length polymorphism (AFLP), RAPD, SSR. (wikipedia.org)
  • A restriction fragment length polymorphism (RFLP) analysis of the 16S rDNAs was performed with Smal and MluI. (kribb.re.kr)
  • A mutation in the coding exon 1 of UGT1A1 gene was determined by restriction fragment length polymorphism (RFLP) method. (cdc.gov)
  • These enzymes, known as restriction enzymes [19], have proved very valuable in modern manipulations of DNA. (springer.com)
  • Type II restriction enzymes are therefore capable of reducing complex DNA, such as plant nuclear DNA, into a population of fragments with discrete sizes. (springer.com)
  • The method is based on digesting a mixture of PCR amplified variants of a single gene using one or more restriction enzymes and detecting the size of each of the individual resulting terminal fragments using a DNA sequencer. (wikipedia.org)
  • By using the restriction enzymes HaeIII, DdeI, and HpaII, strain-specific restriction profiles could be generated for the amplified genomic fragment of each of the six reference poliovirus strains tested: one representative wild poliovirus of each of the three serotypes (P1/Mahoney, P2/Lansing, and P3/Finland/23127/84) and the three Sabin vaccine strains. (nih.gov)
  • Most restriction enzymes are used at 37?C. (powershow.com)
  • abolishes a sequence (CTGAGG, which spans codons 5, 6, and 7) recognized and cut by one of the restriction enzymes. (biology-pages.info)
  • The approximately 1 kb DNA products were then digested separately with restriction enzymes CfoI and MspA1I, and electrophoresed on agarose gels. (bmj.com)
  • During the RRFLP procedure, DNA is digested with restriction enzymes targeting an informative polymorphic site and then used as template in a real-time polymerase chain reaction (PCR) with primers flanking the informative region. (eurekamag.com)
  • You can use restriction enzymes as DNA detectives to collect and analyze "DNA fingerprints in an ANALYTICAL DIGEST- and speaking of detectives, actual detectives have historically used similar techniques to ID criminals, prove paternity, and chase down genetic mutations causing disease. (thebumblingbiochemist.com)
  • Bacteria have DNA-specific "scissors" called RESTRICTION ENZYMES (aka restriction endonucleases, or REases) that recognize & cut specific "code words" (RESTRICTION SITES aka recognition sequences) written in DNA that act as "dotted lines. (thebumblingbiochemist.com)
  • So if you break open cells from a person, extract out the DNA, add restriction enzymes to cut it up into pieces and then look at the SIZE of the pieces that encompass those regions, you can get get a "DNA fingerprint. (thebumblingbiochemist.com)
  • Based on the divergent sequence of Cyt b and cutting restriction enzymes, these populations were classified into three distinct phylogroups. (springeropen.com)
  • The genomic variability of poliovirus was examined by analyzing the restriction fragment length polymorphism of a reverse-transcribed genomic fragment amplified by the polymerase chain reaction. (nih.gov)
  • To rapidly characterise TEM-derived extended-spectrum beta-lactamases a fast and easy method using polymerase chain reaction-restriction fragment length polymorphism was developed. (nih.gov)
  • Finally, the combination of polymerase chain reaction-restriction fragment length polymorphism and plasmid analysis allowed us to investigate nosocomial outbreaks due to clinical isolates of multi-resistant Klebsiella pneumoniae in three hospitals. (nih.gov)
  • Our conclusion is that the AFLP technique will be useful for identification of individual isolates within complex genera such as Colletotrichum because of its ability to generate large numbers of polymorphisms and the consistency of polymerase chain reaction amplification. (apsnet.org)
  • The genetic identities of these Taiwan isolates (TWKM1-7) were clarified by comparing their restriction fragment length polymorphism patterns and sequence similarities of the polymerase chain reaction-amplified intergenic spacer amplicon genes with 3 major genospecies of Lyme disease spirochetes. (ajtmh.org)
  • Subjects from the Framingham Study (ages 69-90 years) included those who underwent BMD testing and who had genotyping for the VDR alleles (n = 328) using polymerase chain reaction methods and restriction fragment length polymorphisms with BsmI (B absence, b presence of cut site). (unboundmedicine.com)
  • Polymerase chain reaction-restriction fragment length polymorphism analysis shows divergence among mer determinants from gram-negative soil bacteria indistinguishable by DNA-DNA hybridization. (asm.org)
  • The mer sequences of 10 Tn501-homologous Hgr determinants from each site were amplified by the polymerase chain reaction, with primers designed to consensus sequences of the mer determinants of Tn501, Tn21, and pMJ100, and were classified on the basis of the size of the amplified product and the restriction fragment length polymorphism pattern. (asm.org)
  • Differentiation of Neisseria gonorrhoeae strains by polymerase chain reaction and restriction fragment length polymorphism of outer membrane protein IB genes. (bmj.com)
  • 2009). 'Identification of beef using restriction fragment length polymorphism-polymerase chain reaction', Iraqi Journal of Veterinary Sciences , 23(1), pp. 43-46. (vetmedmosul.com)
  • Polymerase chain reaction (PCR) amplification of the ITS, followed by digestion with some restriction endonucleases (but not others), produced restriction fragments diagnostic of the giant race. (flvc.org)
  • Uji Diagnostik Polymerase Chain Reaction -Restriction Fragment Length Polymorphism Dalam Menegakkan Diagnosis Onikomikosis. (usu.ac.id)
  • Methods: The distribution of L-myc polymorphism in 61 patients with gastric cancer was determined by polymerase chain reaction-based restriction fragment length polymorphism and compared with that of 107 healthy control subjects. (elsevier.com)
  • In view of the importance of venereal transmission of bovine leptospirosis, the objective of the present study was to apply the polymerase chain reaction (PCR) to 26 serovars of Leptospira interrogans, L. borgpetersenii, L. santarosai, L. noguchii and L. biflexa, to determine the detection threshold in semen samples and to evaluate the possibility of differentiation among serovars using 19 restriction endonucleases. (unesp.br)
  • At least 475 restriction endonucleases have been described to date [24]. (springer.com)
  • Hudson RR (1982) Estimating genetic variability with restriction endonucleases. (springer.com)
  • Prize in Medicine (1978) for the discovery of restriction endonucleases, leading to the development of recombinant DNA technology. (powershow.com)
  • A difference in homologous DNA sequences that can be detected by the presence of fragments of different lengths after digestion of the samples with specific restriction endonucleases. (waterpathogens.org)
  • The 600-bp amplicons of the rpo B gene were digested with the restriction endonucleases Taq I, Tru 1I, Sau 3AI and Msl I, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. (scielo.br)
  • The hybridization patterns of the DNA samples from rats belonging to the different inbred strains showed interstrain variation in the length of restriction fragments with four restriction endonucleases. (hokudai.ac.jp)
  • The identification of a pair of generic primers flanking this fragment allowed its amplification in practically all the poliovirus strains tested so far (more than 150). (nih.gov)
  • To compare the distribution of poliovirus genotypes in nature before and after the introduction of poliovirus vaccines, the restriction profiles of the amplified genomic fragment of a total of 72 strains of various geographic and temporal origins were determined. (nih.gov)
  • In contrast, wild (Sabin unrelated) strains isolated after vaccine introduction, during a single epidemic in a particular geographic area, showed identical or very similar restriction profiles, indicating the circulation of predominant regional genotypes. (nih.gov)
  • Strains were genotyped using IS 1245 restriction fragment length polymorphism typing. (scielo.br)
  • The present study was designed to identify and characterize the genetic polymorphism of M. avium strains recovered from clinical specimens between 1996 and 1998. (scielo.br)
  • Restriction fragment length polymorphisms of the 16S rRNA genes of Erysipelothrix strains were studied by cleavage of the chromosomal DNA with restriction endonuclease EcoRI, followed by hybridization to a 420-bp internal fragment of the 16S rRNA gene. (microbiologyresearch.org)
  • The Igh-V locus of MRL mice: restriction fragment length polymorphism in eleven strains of mice as determined with VH and D gene probes. (semanticscholar.org)
  • The DNA sequence data of the P1 gene provided information for restriction fragment length polymorphism analyses among strains of H. influenzae biogroup aegyptius. (elsevier.com)
  • Using PCR for amplification of the P1 gene, we found that AlwI restriction of this gene allowed for a highly accurate segregation of virulent strains of H. influenzae biogroup aegyptius associated with BPF. (elsevier.com)
  • The strong association of virulent phenotypes with specific AlwI restriction patterns of the P1 gene provides a basis for the convenient and accurate identification of strains of H. influenzae biogroup aegyptius which cause BPF. (elsevier.com)
  • Since the DNA samples prepared from several rats of one inbred strain gave an identical hybridization pattern, the restriction fragment patterns for the Yc gene could be used as markers for genetic monitoring of inbred rat strains. (hokudai.ac.jp)
  • The strains of 'S. caesia' gave a restriction pattern identical to that of S. azurea K161(T) (T = type strain). (kribb.re.kr)
  • So these differences in nucleic acid sequences and restriction enzyme binding sites just mean that there's a difference in the sequence between those two people. (genome.gov)
  • These advances result in many complex datasets associated with in depth knowledge, e.g., genome sequences of many species, microarray expression profiles of different cell lines, single nucleotide polymorphisms (SNPs) or mutations in the human genome, etc. (news-medical.net)
  • One source of polymorphisms is different #s of repeating sequences called tandem-repeats. (thebumblingbiochemist.com)
  • This new gene probe detected all exon sequences containing restriction fragments, and enabled us to demonstrate all described polymorphisms, which might be useful for genetic linkage studies. (uni-bielefeld.de)
  • Mutations in cytokine polymorphism sequences may alter transcription factor sites, which could alter transcription itself and subsequent cytokine production. (bmj.com)
  • Amplification of stol-1H10 from infected grapevines, weeds, and Hyalesthes obsoletus produced fragments of three sizes, and restriction fragment length polymorphism analysis divided these amplicons further into 12 profiles (V1 to V12). (apsnet.org)
  • Several methods based on amplification, hybridization or restriction can be applied to trace the mechanisms of disease. (scielo.br)
  • Restriction fragment length polymorphism analysis revealed that each amplification product size group could be further subdivided into five subgroups. (asm.org)
  • Objective] The aim of this study was to investigate the relation between the polymorphism of large molecular weight proteasome (LMP) (LMP2-LMP7) and transporter associated with antigen processing (TAP) (TAP1-TAP2) genes and rheumatoid arthritis (RA). (csic.es)
  • Results] The polymorphism of LMP (LMP2-LMP7) and TAP (TAP1-TAP2) genes was examined in shared epitope positive and negative RA patients and controls. (csic.es)
  • Conclusion] The data suggest that the polymorphisms of LMP and TAP genes do not have an important influence in the pathogenesis of RA, although larger studies will be needed to provide more conclusive evidence on the role of these genes in RA. (csic.es)
  • 1986. Genomic hybridization of bovine class II Major histocompatibility gene, extensive polymorphism of DQa and DQb genes. (koreascience.or.kr)
  • Both genes exhibit various genetic polymorphisms. (nature.com)
  • To determine whether polymorphisms of the genes encoding donor or recipient interleukin 1α (IL-1α), tumour necrosis factor α (TNFα), or IL-4 have any impact on the incidence of acute rejection after renal transplantation. (bmj.com)
  • All donors and recipients were genotyped for three polymorphisms in the three cytokine genes: IL1A −889, TNFA −308, and IL4 -590. (bmj.com)
  • Differential fragment patterns in relation to different genospecies of Lyme disease spirochetes were observed among tested Borrelia isolates, and all of these Taiwan isolates were closely related to the genospecies of B. burgdorferi sensu stricto. (ajtmh.org)
  • Based on the differential fragment patterns and sequence similarity among these Taiwan isolates, the genetic identity of these Taiwan isolates should be classified into the genospecies of B. burgdorferi sensu stricto. (ajtmh.org)
  • The population is said to be ________ for restriction enzyme fragment patterns. (mhhe.com)
  • Digestion with RsaI restriction enzyme resolved 24 different restriction patterns. (koreascience.or.kr)
  • Terminal restriction fragment length polymorphism (TRFLP) patterns of narG and nosZ were similar before and after experimental drought or experimental flooding, indicating a stable nitrate reducer and denitrifier community in the fen. (frontiersin.org)
  • The four validly described Saccharomonospora species could be differentiated on the basis of their characteristic 16S rDNA restriction patterns. (kribb.re.kr)
  • In addition to these steps the TRFLP protocol often includes a cleanup of the PCR products prior to the restriction and in case a capillary electrophoresis is used a desalting stage is also performed prior to running the sample. (wikipedia.org)
  • Burke DJ, Martin KJ, Rygiewicz PT, Topa MA (2005) Ectomycorrhizal fungi identification in single and pooled root samples: terminal restriction fragment length polymorphism (TRFLP) and morphotyping compared. (springer.com)
  • Terminal restriction fragment length polymorphism (tRFLP) is a potentially high-throughput method for the analysis of complex microbial communities. (nih.gov)
  • Here we describe a low-cost terminal restriction fragment length polymorphism (TRFLP) procedure to distinguish between the common infant-associated bifidobacterial species. (elsevier.com)
  • Exon 1 from GDF9 gene was amplified to produce a 462 bp and exon 2 from GDF9 gene was amplified to produce a 139 bp fragment. (ajol.info)
  • The amplified fragment of Exon 1 was digested with Hin6I restriction enzyme and the amplified fragment of exon 2 was digested with DdeI restriction enzyme. (ajol.info)
  • There was a significant correlation of the C3435T polymorphism in exon 26 of the ABCB1 gene with lower intestinal P-gp expression levels and elevated oral bioavailability of digoxin. (nature.com)
  • Restriction fragment length polymorphism effectively identifies exon 1 mutation of UGT1A1 gene in patients with Gilbert's Syndrome. (cdc.gov)
  • Molecular characterization of Lyme disease spirochetes (Borrelia burgdorferi sensu lato) isolated in Taiwan by restriction fragment length polymorphism analysis of 5S(rrf)-23S(rrl) intergenic spacer amplicons. (ajtmh.org)
  • M. avium reference strain IWGMT49 with fragments of known molecular weights was analyzed together with unknown samples. (scielo.br)
  • The basic technique for the detection of RFLPs involves fragmenting a sample of DNA with the application of a restriction enzyme , which can selectively cleave a DNA molecule wherever a short, specific sequence is recognized in a process known as a restriction digest . (wikipedia.org)
  • This is a very common cause of RFLPs and now such polymorphisms are often referred to as single nucleotide polymorphisms or SNPs . (biology-pages.info)
  • Several high frequency restriction fragment length polymorphisms (RFLPs) associated with the human gene for apolipoprotein B have been previously reported by Priestly et al. (ahajournals.org)
  • The three species showed restriction fragment length polymorphisms (RFLPs) in the ribosomal cistron, the 18S rDNA gene, and the ribosomal internal transcribed spacer (ITS). (flvc.org)
  • Thyroid cancer is influenced in a polygenic and low-penetrance manner by RET gene polymorphisms and this part of the world (North India) has not recorded any study regarding RET alterations in this very cancer. (intechopen.com)
  • Statistical analysis of the data obtained revealed no association between the cytokine gene polymorphisms tested and the incidence of post-transplant acute rejection. (bmj.com)
  • However, the exact role of cytokine gene polymorphisms in transplant outcome remains controversial, with some groups showing a correlation, 1- 3 but others not. (bmj.com)
  • Amplified restriction fragment length polymorphism (AFLP) was used to assess the levels of genomic variations among species and isolates of the genus Colletotrichum . (apsnet.org)
  • A cloned EcoRI fragment from a Neisseria meningitidis Group B serotype 15P1.16 sulphonamide-resistant strain was used to probe Southern blots of total chromosomal DNA restriction fragments (enzyme AvaI). (nih.gov)
  • DNA genome of pine tree restricted by EcoRI can generate 5 million different restricted fragments. (powershow.com)
  • Each fragment length is considered an allele , whether it actually contains a coding region or not, and can be used in subsequent genetic analysis. (wikipedia.org)
  • Artursson V, Finlay RD, Jansson JK (2005) Combined bromodeoxyuridine immunocapture and terminal-restriction fragment length polymorphism analysis highlights differences in the active soil bacterial metagenome due to Glomus mosseae inoculation or plant species. (springer.com)
  • Blackwood CB, Marsh T, Kim S-H, Paul EA (2003) Terminal restriction fragment length polymorphism data analysis for quantitative comparison of microbial communities. (springer.com)
  • Our results indicate that the assay we developed for the analysis of the restriction fragment length polymorphism of the poliovirus genome may be used to identify and characterize poliovirus genotypes circulating in nature. (nih.gov)
  • Restriction fragment length polymorphism analysis of Cryptococcus neoformans isolates from environmental (pigeon excreta) and clinical sources in New York City. (asm.org)
  • Restriction fragment length polymorphism analysis of environmental (pigeon excreta) and clinical Cryptococcus neoformans var. (asm.org)
  • Is the Subject Area "Restriction fragment length polymorphism analysis" applicable to this article? (plos.org)
  • Cloning of a functional human adenine phosphoribosyltransferase (APRT) gene: identification of a restriction fragment length polymorphism and preliminary analysis of DNAs from APRT-deficient families and cell mutants. (semanticscholar.org)
  • 2003. Terminal restriction fragment length polymorphism data analysis for quantitative comparison of microbial communities. (msu.edu)
  • Analysis of Jaccard distance between profiles, which considers only the presence or absence of a terminal restriction fragment, was the most sensitive in redundancy analysis, and was equally sensitive in cluster analysis, if all profiles had cumulative peak heights greater than 10,000 fluorescence units. (msu.edu)
  • Lesse, Alan J. / DNA sequence analysis and restriction fragment length polymorphisms of the P1 gene of Haemophilus influenzae biogroup aegyptius associated with Brazilian purpuric fever . (elsevier.com)
  • Combinations of 10 Cryptosporidium parvum oocysts, with various ratios of genotype I to genotype II, were isolated and subjected to PCR-restriction fragment length polymorphism analysis. (elsevier.com)
  • Hybridization of the membrane to a labeled DNA probe then determines the length of the fragments which are complementary to the probe. (wikipedia.org)
  • DNA fragment restriction and subsequent hybridization with IS 1245 probes have been shown to be suitable for typing M. avium infections (13,14). (scielo.br)
  • In allele A , the genome is cleaved by a restriction enzyme at three nearby sites (triangles), but only the rightmost fragment will be detected by the probe. (wikipedia.org)
  • In the third schematic, the probe and restriction enzyme are chosen to detect a region of the genome that includes a variable number tandem repeat (VNTR) segment (boxes in schematic diagram). (wikipedia.org)
  • The fragment was a 480-nucleotide sequence of the poliovirus genome coding for the N-terminal half of the capsid protein VP1, including antigenic site 1. (nih.gov)
  • A novel technique, the reverse restriction fragment length polymorphism (RRFLP) assay, was developed as a means of detecting specific informative polymorphic sites in the infectious laryngotracheitis virus (ILTV) genome. (eurekamag.com)
  • Following contig assembly into genome-length cDNA, transfected full-length transcripts recovered several recombinant viruses (rMERS-CoV) that contained the expected marker mutations inserted into the component clones. (pnas.org)
  • A restriction site for EarI in genotype B was absent in spite of its presence in all the other genotypes and genotype C has no restriction site for AlwI. (fujita-hu.ac.jp)
  • Only genotype E is digested with NciI, while only genotype F has a restriction site for HphI. (fujita-hu.ac.jp)
  • Genotype A can be distinguished by a single restriction enzyme site for NlaIV, while genotype D digestion with this enzyme results in two products that migrates at 265 and 186 bp. (fujita-hu.ac.jp)
  • The TT and AC genotypes of MTHFR C677T and A1298C polymorphisms and the combined genotype TTAC were associated with PCAG in Punjabi subjects of Pakistani origin and correlated with the high serum tHcy levels seen in these patients. (molvis.org)
  • Use of Restriction Fragment Length Polymorphism to Rapidly Identify Dermatophyte Species Related to Dermatophytosis. (mysciencework.com)
  • The DNA fragments produced by the digest are then separated by length through a process known as agarose gel electrophoresis and transferred to a membrane via the Southern blot procedure. (wikipedia.org)
  • We typically see these, or we monitor these, by isolating the DNA, cutting it with that bacterial restriction enzyme, and running it on a gel using electrophoresis. (genome.gov)
  • Following the restriction reaction, the mixture of fragments is separated using either capillary or polyacrylamide electrophoresis in a DNA sequencer and the sizes of the different terminal fragments are determined by the fluorescence detector. (wikipedia.org)
  • These can be separated by electrophoresis , with the smaller fragments migrating farther than the larger fragments. (biology-pages.info)
  • When the normal gene (beta A ) is digested with the enzyme and the fragments separated by electrophoresis, the probe binds to a short fragment (between the red arrows). (biology-pages.info)
  • Previous studies of the vitamin D receptor (VDR) polymorphisms and bone mineral density (BMD) have suggested that there may be differences in calcium absorption among groups of women with different VDR genotypes, and that the association may be stronger in younger women. (unboundmedicine.com)
  • A genetic marker may be a short DNA sequence, such as a sequence surrounding a single base-pair change ( single nucleotide polymorphism , SNP), or a long one, like minisatellites . (wikipedia.org)
  • Also to the left of each locus is the coefficient of exchange (centimorgans per percentage of metaphase chromosome length) of the chromosome region in which a locus resides. (genetics.org)
  • In the somatic chromosome preparations of F 1 hybrid, O. eichingeri chromosomes, fluorescing greenish-yellow in the sequential GISH, appeared to be longer and to contain more heterochromatin than O. sativa ones, and this karyotypic polymorphism can be used to detect some introgressed O. eichingeri segments in euploid plants. (elsevier.com)
  • In addition, GISH identification presented direct evidence for the transfer of small segments from O. eichingeri to O. sativa chromosome(s) which were subsequently recognized according to their condensation pattern, arm ratio, and chromosome length. (elsevier.com)
  • The polymorphism in the aldosterone synthase gene may interact with the Y chromosome to increase the odds of an individual's developing higher BP. (ahajournals.org)
  • 9 Recently, Ellis et al 10 reported an association between an increased risk of elevated diastolic blood pressure (DBP) and a biallelic polymorphism on the NRY region of the Y chromosome in 409 subjects recruited from the general population in Victoria, Australia. (ahajournals.org)
  • In the present study, we tested the hypothesis that the Y chromosome polymorphism was associated with elevated BP in 2 European populations. (ahajournals.org)
  • We also tested for interactions between the Y chromosome and a polymorphism in the steroidogenic factor (SF1) binding site of CYP11B2 gene. (ahajournals.org)
  • Genetic polymorphisms in the MTHFR gene are well established, the most extensively studied of which are C677T and A1298C single-nucleotide polymorphisms (SNPs). (molvis.org)
  • However, the plasma level of these markers should be independent of genetic polymorphisms in order to be reliable biomarkers. (biomedcentral.com)
  • The present study investigates whether plasma suPAR levels measured by the suPARnostic ® assay are prognostic for HIV-1 disease progression and whether suPAR levels and survival are influenced by common genetic polymorphisms in the uPAR promoter region. (biomedcentral.com)
  • The natural genomic variability of poliovirus analyzed by a restriction fragment length polymorphism assay. (nih.gov)
  • DNA polymorphisms are playing a decisive role in unscrambling the genomic basis of tumor formation and development in cancer. (intechopen.com)
  • The aim of this study was to: 1) Evaluate the prognostic value of the new suPARnostic ® assay and 2) Determine whether polymorphisms in the active promoter of uPAR influences survival and/or suPAR values in HIV-1 patients who are antiretroviral therapy (ART) naive. (biomedcentral.com)
  • Digestion of lambda Huap15 DNA with BamH1 generated a 2.2-kb fragment that is the only fragment of eight produced to hybridize with the mouse APRT gene. (semanticscholar.org)
  • Digestion of the 284 bp PCR product of DRB3.2 gene with PstI in the crossbred cattle did not reveal any restriction site. (koreascience.or.kr)
  • T-Align, a web-based tool for comparison of multiple terminal restriction fragment length polymorphism profiles. (nih.gov)
  • Subsequently consensus profiles representing different communities are compared to produce a list showing whether a terminal restriction fragment (TRF) is present in a particular sample and its relative fluorescence intensity. (nih.gov)
  • Draft sequence data are mostly in the form of 10,000 base pair-sized fragments whose approximate chromosomal locations are known. (google.com)
  • DNAs were digested with Dra I restriction endonuclease. (genetics.org)
  • When 21 poliovirus field isolates previously identified as Sabin vaccine-related were tested, they showed restriction profiles identical to those of the originating homotypic Sabin virus, demonstrating the conservation of these profiles during virus replication in humans. (nih.gov)
  • To study whether heterozygosity for the Arg753Gln variant of TLR-2 influenced susceptibility for LD, we analyzed 155 patients for this polymorphism. (jimmunol.org)
  • Background: L-myc polymorphism has been documented to be a representative genetic trait which is related an individual's susceptibility to several cancers. (elsevier.com)
  • However, there have been no reports concerning any significant association between susceptibility to gastric cancer and L-myc polymorphism. (elsevier.com)
  • Conclusion: L-myc polymorphism may be significant in an individual's susceptibility to gastric cancer in Japan, and may be a useful marker for identifying patients at high risk of developing gastric cancer. (elsevier.com)
  • different mutations that alter the length of their mRNA. (mhhe.com)
  • But if there are mutations in between cut sites that change the length of the in-between part, you'll get different sized pieces. (thebumblingbiochemist.com)
  • And although I say "mutations" it's important to remember that mutations aren't all bad - and instead of calling them mutations (sounds scary) we can call them "polymorphisms" (less scary-sounding and conveys the accurate impression that these genetic differences are just ways we're unique not things to make you freak! (thebumblingbiochemist.com)
  • So ~1/2 the polymporphic fragments will come from the biological father and any fragments that aren't present in the mother should* be present in the father (since the kid had to get it from somewhere I say "should" not "must" because random spontaneous mutations can arise leaving the kid to have a polymorphism not present in either parent. (thebumblingbiochemist.com)
  • It is also used in identification of recombination rate in the loci between restriction sites. (wikipedia.org)
  • I. Identification of a restriction fragment length polymorphism closely linked to the gld mutation within a conserved linkage group. (rupress.org)
  • Helentjaris T, King G, Slocum M, Siedenstrang C, Wegman S (1985) Restriction fragment polymorphisms as probes for plant diversity and their development as tools for applied plant breeding. (springer.com)
  • Unique AvaI and AlwI restriction enzyme sites were identified in the tissue culture origin and chicken embryo origin attenuated vaccines, respectively. (eurekamag.com)
  • Length ranks your synonyms based on character count. (thesaurus.com)
  • Bsp 12861 restriction fragment length polymorphism detects Ag(c/g) locus of human apolipoprotein B in all 17 persons studied. (ahajournals.org)
  • Two DNA restriction fragment length polymorphisms associated with Ag(t/z) and Ag(g/c) antigenic sites of human apolipoprotein B. (ahajournals.org)
  • The second diagram shows how this fragment size variation would look on a Southern blot, and how each allele (two per individual) might be inherited in members of a family. (wikipedia.org)
  • Blood from individuals heterozygous for the TLR-2 polymorphism Arg753Gln was tested for cytokine release upon stimulation with Borrelia lysate, and induction of TNF-α and IFN-γ was significantly lower as compared with individuals not exhibiting this variation. (jimmunol.org)
  • Single nucleotide polymorphisms (SNP) are the most common type of genetic variation. (bionity.com)
  • Bhattacharya SS, Wright AF, Clayton JF, Price WH, Phillips CI, McKeown CME, Jay M, Bird AC, Pearson J (1984) Close genetic linkage between X-linked Retinitis pigmentosa and a restriction fragment length polymorphism identified by recombinant DNA probe L1.28. (springer.com)
  • This new method has proved to be a rapid, simple, and reliable method that should facilitate high throughput genotyping of MTHFR polymorphisms in acute leukemia. (cdc.gov)
  • To date there are conflicting results regarding the association of MTHFR polymorphisms with glaucoma. (molvis.org)
  • In allele a , restriction site 2 has been lost by a mutation , so the probe now detects the larger fused fragment running from sites 1 to 3. (wikipedia.org)
  • In allele c , there are five repeats in the VNTR, and the probe detects a longer fragment between the two restriction sites. (wikipedia.org)
  • In allele d , there are only two repeats in the VNTR, so the probe detects a shorter fragment between the same two restriction sites. (wikipedia.org)
  • The mixture of amplicons is then subjected to a restriction reaction, normally using a four-cutter restriction enzyme. (wikipedia.org)
  • Because the excised mixture of amplicons is analyzed in a sequencer, only the terminal fragments (i.e. the labeled end or ends of the amplicon) are read while all other fragments are ignored. (wikipedia.org)
  • Nei M, Tajima F (1985) Evolutionary change of restriction cleavage sites and phylogenetic inference in man and apes. (springer.com)
  • Avise JC, Lansman RA (1983) Polymorphism of mitochondrial DNA in populations of higher animals. (springer.com)
  • ITS fragments differentiated between D. dipsaci and Aphelenchoides rhyntium in mixed populations. (flvc.org)
  • Engels WR (1981) Estimating genetic divergence and genetic variability with restriction endo-nucleases. (springer.com)
  • There are two common mechanisms by which the size of a particular restriction fragment can vary. (wikipedia.org)
  • Often, several different bacteria in a population might give a single peak on the electropherogram due to the presence of a restriction site for the particular restriction enzyme used in the experiment at the same position. (wikipedia.org)
  • However, the enzyme cannot cut the sickle-cell gene at this site, so the probe attaches to a much larger fragment (between the blue arrows). (biology-pages.info)
  • The mutation resulting in the allele for sickle‑cell anemia removes a restriction site from the β‑globin gene such that a specific probe hybridizes to one 1.3‑kb fragment instead of two fragments of 1.1 kb and 0.2 kb. (answermenu.com)
  • With the simplified gene probe, pLDLR delta, we also studied other polymorphisms. (uni-bielefeld.de)
  • Because of the length of the probe sequence, the hairpin segment of the probe will denatured in favour of forming a longer, more stable probe-target hybrid. (bionity.com)
  • Evola SV, Burr FA, Burr B (1986) The suitability of restriction fragment length polymorphisms as genetic markers in maize. (springer.com)
  • A), abolishing a BstSF I restriction site in one allele of all the affected individuals. (molvis.org)
  • Boyer HW (1971) DNA restriction and modification mechanisms in bacteria. (springer.com)
  • So basically, if you follow the sequence of DNA, particular sites, a series of four to eight nucleic acids, results in a restriction site where an enzyme from bacteria can actually bind and cleave that DNA. (genome.gov)
  • So a single base difference between two people could result in either the presence or absence of that restriction site. (genome.gov)
  • Well, we can take advantage of this fact to actually look for differences between people if they have that restriction enzyme site or not. (genome.gov)
  • We identified two common uPAR promoter polymorphisms: a G to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. (biomedcentral.com)
  • A restriction fragment length polymorphism is said to occur when the length of a detected fragment varies between individuals, indicating non-identical sequence homologies. (wikipedia.org)
  • They are matched up with radioactively labelled fragments of DNA in such a way that only fragments that are identical stick together. (news-medical.net)
  • Furthermore, restriction fragment length polymorphisms indicate that the two arms are identical, which is compatible with the hypothesis of an isochromosome 12p. (wiley.com)
  • DNA sequence differences in the pattern of restriction sites. (mhhe.com)
  • Polymorphisms are inherited differences found among the individuals in a population. (biology-pages.info)