OrganismsChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesInformation ScienceHealth Care
OxygenasesMixed Function OxygenasesHeme Oxygenase (Decyclizing)Ketoglutaric AcidsDioxygenasesBiliverdineNonheme Iron ProteinsEmericellaHemeCorynebacterium diphtheriaebeta-Carotene 15,15'-MonooxygenaseHydroxylationIronOxidoreductases, O-DemethylatingCarbon MonoxideRhodococcusPseudomonas putidaCatecholsBiodegradation, EnvironmentalProcollagen-Proline DioxygenaseHeme Oxygenase-1Molecular Sequence DataBenzoatesPseudomonasCatalysisOxygenCrystallography, X-RayBacterial ProteinsHeminOxidation-ReductionAmino Acid SequenceStreptomycesMolecular StructureOxidoreductasesSubstrate SpecificityModels, MolecularMultigene FamilyStereoisomerismCloning, MolecularModels, ChemicalGenes, BacterialSequence Homology, Amino AcidCytochrome P-450 Enzyme SystemCatalytic DomainBinding SitesSequence Analysis, DNAPhylogenySequence AlignmentKineticsProtein Structure, TertiaryChromatography, High Pressure LiquidEscherichia coliBase SequenceProtein ConformationProtein Binding
Oxygenases
Oxidases that specifically introduce DIOXYGEN-derived oxygen atoms into a variety of organic molecules.
Mixed Function Oxygenases
Widely distributed enzymes that carry out oxidation-reduction reactions in which one atom of the oxygen molecule is incorporated into the organic substrate; the other oxygen atom is reduced and combined with hydrogen ions to form water. They are also known as monooxygenases or hydroxylases. These reactions require two substrates as reductants for each of the two oxygen atoms. There are different classes of monooxygenases depending on the type of hydrogen-providing cosubstrate (COENZYMES) required in the mixed-function oxidation.
Heme Oxygenase (Decyclizing)
A mixed function oxidase enzyme which during hemoglobin catabolism catalyzes the degradation of heme to ferrous iron, carbon monoxide and biliverdin in the presence of molecular oxygen and reduced NADPH. The enzyme is induced by metals, particularly cobalt. EC 1.14.99.3.
Ketoglutaric Acids
A family of compounds containing an oxo group with the general structure of 1,5-pentanedioic acid. (From Lehninger, Principles of Biochemistry, 1982, p442)
Dioxygenases
Non-heme iron-containing enzymes that incorporate two atoms of OXYGEN into the substrate. They are important in biosynthesis of FLAVONOIDS; GIBBERELLINS; and HYOSCYAMINE; and for degradation of AROMATIC HYDROCARBONS.
Biliverdine
1,3,6,7-Tetramethyl-4,5-dicarboxyethyl-2,8-divinylbilenone. Biosynthesized from hemoglobin as a precursor of bilirubin. Occurs in the bile of AMPHIBIANS and of birds, but not in normal human bile or serum.
Nonheme Iron Proteins
Proteins, usually acting in oxidation-reduction reactions, containing iron but no porphyrin groups. (Lehninger, Principles of Biochemistry, 1993, pG-10)
Emericella
A genus in the family Trichocomaceae, order EUROTIALES. The anamorph is ASPERGILLUS.
Heme
The color-furnishing portion of hemoglobin. It is found free in tissues and as the prosthetic group in many hemeproteins.
Corynebacterium diphtheriae
A species of gram-positive, asporogenous bacteria in which three cultural types are recognized. These types (gravis, intermedius, and mitis) were originally given in accordance with the clinical severity of the cases from which the different strains were most frequently isolated. This species is the causative agent of DIPHTHERIA.
beta-Carotene 15,15'-Monooxygenase
A monooxygenase that catalyzes the conversion of BETA-CAROTENE into two molecules of RETINAL. It was formerly characterized as EC 1.13.11.21 and EC 1.18.3.1.
Hydroxylation
Placing of a hydroxyl group on a compound in a position where one did not exist before. (Stedman, 26th ed)
Iron
A metallic element with atomic symbol Fe, atomic number 26, and atomic weight 55.85. It is an essential constituent of HEMOGLOBINS; CYTOCHROMES; and IRON-BINDING PROTEINS. It plays a role in cellular redox reactions and in the transport of OXYGEN.
Oxidoreductases, O-Demethylating
Drug metabolizing enzymes which oxidize methyl ethers. Usually found in liver microsomes.
Carbon Monoxide
Carbon monoxide (CO). A poisonous colorless, odorless, tasteless gas. It combines with hemoglobin to form carboxyhemoglobin, which has no oxygen carrying capacity. The resultant oxygen deprivation causes headache, dizziness, decreased pulse and respiratory rates, unconsciousness, and death. (From Merck Index, 11th ed)
Rhodococcus
A bacterial genus of the order ACTINOMYCETALES.
Pseudomonas putida
A species of gram-negative, aerobic bacteria isolated from soil and water as well as clinical specimens. Occasionally it is an opportunistic pathogen.
Catechols
A group of 1,2-benzenediols that contain the general formula R-C6H5O2.
Biodegradation, Environmental
Elimination of ENVIRONMENTAL POLLUTANTS; PESTICIDES and other waste using living organisms, usually involving intervention of environmental or sanitation engineers.
Procollagen-Proline Dioxygenase
A mixed-function oxygenase that catalyzes the hydroxylation of a prolyl-glycyl containing peptide, usually in PROTOCOLLAGEN, to a hydroxyprolylglycyl-containing-peptide. The enzyme utilizes molecular OXYGEN with a concomitant oxidative decarboxylation of 2-oxoglutarate to SUCCINATE. The enzyme occurs as a tetramer of two alpha and two beta subunits. The beta subunit of procollagen-proline dioxygenase is identical to the enzyme PROTEIN DISULFIDE-ISOMERASES.
Heme Oxygenase-1
A ubiquitous stress-responsive enzyme that catalyzes the oxidative cleavage of HEME to yield IRON; CARBON MONOXIDE; and BILIVERDIN.
Molecular Sequence Data
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Benzoates
Derivatives of BENZOIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain the carboxybenzene structure.
Pseudomonas
A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in nature. Some species are pathogenic for humans, animals, and plants.
Catalysis
The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.
Oxygen
An element with atomic symbol O, atomic number 8, and atomic weight [15.99903; 15.99977]. It is the most abundant element on earth and essential for respiration.
Crystallography, X-Ray
The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Bacterial Proteins
Proteins found in any species of bacterium.
Hemin
Chloro(7,12-diethenyl-3,8,13,17-tetramethyl-21H,23H-porphine-2,18-dipropanoato(4-)-N(21),N(22),N(23),N(24)) ferrate(2-) dihydrogen.
Oxidation-Reduction
A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).
Amino Acid Sequence
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Streptomyces
A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.
Molecular Structure
The location of the atoms, groups or ions relative to one another in a molecule, as well as the number, type and location of covalent bonds.
Oxidoreductases
The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)
Substrate Specificity
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Models, Molecular
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Multigene Family
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
Stereoisomerism
The phenomenon whereby compounds whose molecules have the same number and kind of atoms and the same atomic arrangement, but differ in their spatial relationships. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 5th ed)
Cloning, Molecular
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Models, Chemical
Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.
Genes, Bacterial
The functional hereditary units of BACTERIA.
Sequence Homology, Amino Acid
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Cytochrome P-450 Enzyme System
A superfamily of hundreds of closely related HEMEPROTEINS found throughout the phylogenetic spectrum, from animals, plants, fungi, to bacteria. They include numerous complex monooxygenases (MIXED FUNCTION OXYGENASES). In animals, these P-450 enzymes serve two major functions: (1) biosynthesis of steroids, fatty acids, and bile acids; (2) metabolism of endogenous and a wide variety of exogenous substrates, such as toxins and drugs (BIOTRANSFORMATION). They are classified, according to their sequence similarities rather than functions, into CYP gene families (>40% homology) and subfamilies (>59% homology). For example, enzymes from the CYP1, CYP2, and CYP3 gene families are responsible for most drug metabolism.
Catalytic Domain
The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.
Binding Sites
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Sequence Analysis, DNA
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Phylogeny
The relationships of groups of organisms as reflected by their genetic makeup.
Sequence Alignment
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Kinetics
The rate dynamics in chemical or physical systems.
Protein Structure, Tertiary
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Chromatography, High Pressure Liquid
Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.
Escherichia coli
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Base Sequence
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Protein Conformation
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
Protein Binding
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.

N-oxygenation of amphetamine and methamphetamine by the human flavin-containing monooxygenase (form 3): role in bioactivation and detoxication. (1/2226)

(+)- And (-)-amphetamine and methamphetamine were N-oxygenated by the cDNA expressed adult human flavin-containing monooxygenase form 3 (FMO3), their corresponding hydroxylamines. Two major polymorphic forms of human FMO3 were studied, and the results suggested preferential N-oxygenation by only one of the two enzymes. Chemically synthesized (+/-)-amphetamine hydroxylamine was also a substrate for the human FMO3 and it was converted to phenylpropanone oxime with a stereoselectivity ratio of trans/cis of 5:1. Human FMO3 also N-oxygenated methamphetamine to produce methamphetamine hydroxylamine. Methamphetamine hydroxylamine was also N-oxygenated by human FMO3, and the ultimate product observed was phenylpropanone. For amphetamine hydroxylamine, studies of the biochemical mechanism of product formation were consistent with the production of an N, N-dioxygenated intermediate that lead to phenylpropanone oxime. This was supported by the observation that alpha-deutero (+/-)-amphetamine hydroxylamine gave an inverse kinetic isotope effect on product formation in the presence of human FMO3. For methamphetamine, the data were consistent with a mechanism of human FMO3-mediated N,N-dioxygenation but the immediate product, a nitrone, rapidly hydrolyzed to phenylpropanone. The pharmacological activity of amphetamine hydroxylamine, phenylpropanone oxime, and methamphetamine hydroxylamine were examined for effects at the human dopamine, serotonin, and norepinephrine transporters. Amphetamine hydroxylamine and methamphetamine hydroxylamine were apparent substrates for the human biogenic amine transporters but phenylpropanone oxime was not. Presumably, phenylpropanone oxime or nitrone formation from amphetamine and methamphetamine, respectively, represents a detoxication process. Because of the potential toxic nature of amphetamine hydroxylamine and methamphetamine hydroxylamine metabolites and the polymorphic nature of N-oxygenation, human FMO3-mediated metabolism of amphetamine or methamphetamine may have clinical consequences.  (+info)

A novel reduced flavin mononucleotide-dependent methanesulfonate sulfonatase encoded by the sulfur-regulated msu operon of Pseudomonas aeruginosa. (2/2226)

When Pseudomonas aeruginosa is grown with organosulfur compounds as sulfur sources, it synthesizes a set of proteins whose synthesis is repressed in the presence of sulfate, cysteine, or thiocyanate (so-called sulfate starvation-induced proteins). The gene encoding one of these proteins, PA13, was isolated from a cosmid library of P. aeruginosa PAO1 and sequenced. It encoded a 381-amino-acid protein that was related to several reduced flavin mononucleotide (FMNH2)-dependent monooxygenases, and it was the second in an operon of three genes, which we have named msuEDC. The MsuD protein catalyzed the desulfonation of alkanesulfonates, requiring oxygen and FMNH2 for the reaction, and showed highest activity with methanesulfonate. MsuE was an NADH-dependent flavin mononucleotide (FMN) reductase, which provided reduced FMN for the MsuD enzyme. Expression of the msu operon was analyzed with a transcriptional msuD::xylE fusion and was found to be repressed in the presence of sulfate, sulfite, sulfide, or cysteine and derepressed during growth with methionine or alkanesulfonates. Growth with methanesulfonate required an intact cysB gene, and the msu operon is therefore part of the cys regulon, since sulfite utilization was found to be CysB independent in this species. Measurements of msuD::xylE expression in cysN and cysI genetic backgrounds showed that sulfate, sulfite, and sulfide or cysteine play independent roles in negatively regulating msu expression, and sulfonate utilization therefore appears to be tightly regulated.  (+info)

Purification and characterization of gentisate 1,2-dioxygenases from Pseudomonas alcaligenes NCIB 9867 and Pseudomonas putida NCIB 9869. (3/2226)

Two 3-hydroxybenzoate-inducible gentisate 1,2-dioxygenases were purified to homogeneity from Pseudomonas alcaligenes NCIB 9867 (P25X) and Pseudomonas putida NCIB 9869 (P35X), respectively. The estimated molecular mass of the purified P25X gentisate 1, 2-dioxygenase was 154 kDa, with a subunit mass of 39 kDa. Its structure is deduced to be a tetramer. The pI of this enzyme was established to be 4.8 to 5.0. The subunit mass of P35X gentisate 1, 2-dioxygenase was 41 kDa, and this enzyme was deduced to exist as a dimer, with a native molecular mass of about 82 kDa. The pI of P35X gentisate 1,2-dioxygenase was around 4.6 to 4.8. Both of the gentisate 1,2-dioxygenases exhibited typical saturation kinetics and had apparent Kms of 92 and 143 microM for gentisate, respectively. Broad substrate specificities were exhibited towards alkyl and halogenated gentisate analogs. Both enzymes had similar kinetic turnover characteristics for gentisate, with kcat/Km values of 44.08 x 10(4) s-1 M-1 for the P25X enzyme and 39.34 x 10(4) s-1 M-1 for the P35X enzyme. Higher kcat/Km values were expressed by both enzymes against the substituted gentisates. Significant differences were observed between the N-terminal sequences of the first 23 amino acid residues of the P25X and P35X gentisate 1,2-dioxygenases. The P25X gentisate 1,2-dioxygenase was stable between pH 5.0 and 7.5, with the optimal pH around 8.0. The P35X enzyme showed a pH stability range between 7.0 and 9.0, and the optimum pH was also 8.0. The optimal temperature for both P25X and P35X gentisate 1, 2-dioxygenases was around 50 degrees C, but the P35X enzyme was more heat stable than that from P25X. Both enzymes were strongly stimulated by 0.1 mM Fe2+ but were completely inhibited by the presence of 5 mM Cu2+. Partial inhibition of both enzymes was also observed with 5 mM Mn2+, Zn2+, and EDTA.  (+info)

High-affinity methane oxidation by a soil enrichment culture containing a type II methanotroph. (4/2226)

Methanotrophic bacteria in an organic soil were enriched on gaseous mixing ratios of <275 parts per million of volume (ppmv) of methane (CH4). After 4 years of growth and periodic dilution (>10(20) times the initial soil inoculum), a mixed culture was obtained which displayed an apparent half-saturation constant [Km(app)] for CH4 of 56 to 186 nM (40 to 132 ppmv). This value was the same as that measured in the soil itself and about 1 order of magnitude lower than reported values for pure cultures of methane oxidizers. However, the Km(app) increased when the culture was transferred to higher mixing ratios of CH4 (1,000 ppmv, or 1%). Denaturing gradient gel electrophoresis of the enrichment grown on <275 ppmv of CH4 revealed a single gene product of pmoA, which codes for a subunit of particulate methane monooxygenase. This suggested that only one methanotroph species was present. This organism was isolated from a sample of the enrichment culture grown on 1% CH4 and phylogenetically positioned based on its 16S rRNA, pmoA, and mxaF gene sequences as a type II strain of the Methylocystis/Methylosinus group. A coculture of this strain with a Variovorax sp., when grown on <275 ppmv of CH4, had a Km(app) (129 to 188 nM) similar to that of the initial enrichment culture. The data suggest that the affinity of methanotrophic bacteria for CH4 varies with growth conditions and that the oxidation of atmospheric CH4 observed in this soil is carried out by type II methanotrophic bacteria which are similar to characterized species.  (+info)

Contrasting effects of a nonionic surfactant on the biotransformation of polycyclic aromatic hydrocarbons to cis-dihydrodiols by soil bacteria. (5/2226)

The biotransformation of the polycyclic aromatic hydrocarbons (PAHs) naphthalene and phenanthrene was investigated by using two dioxygenase-expressing bacteria, Pseudomonas sp. strain 9816/11 and Sphingomonas yanoikuyae B8/36, under conditions which facilitate mass-transfer limited substrate oxidation. Both of these strains are mutants that accumulate cis-dihydrodiol metabolites under the reaction conditions used. The effects of the nonpolar solvent 2,2,4, 4,6,8,8-heptamethylnonane (HMN) and the nonionic surfactant Triton X-100 on the rate of accumulation of these metabolites were determined. HMN increased the rate of accumulation of metabolites for both microorganisms, with both substrates. The enhancement effect was most noticeable with phenanthrene, which has a lower aqueous solubility than naphthalene. Triton X-100 increased the rate of oxidation of the PAHs with strain 9816/11 with the effect being most noticeable when phenanthrene was used as a substrate. However, the surfactant inhibited the biotransformation of both naphthalene and phenanthrene with strain B8/36 under the same conditions. The observation that a nonionic surfactant could have such contrasting effects on PAH oxidation by different bacteria, which are known to be important for the degradation of these compounds in the environment, may explain why previous research on the application of the surfactants to PAH bioremediation has yielded inconclusive results. The surfactant inhibited growth of the wild-type strain S. yanoikuyae B1 on aromatic compounds but did not inhibit B8/36 dioxygenase enzyme activity in vitro.  (+info)

Aspartate 205 in the catalytic domain of naphthalene dioxygenase is essential for activity. (6/2226)

The naphthalene dioxygenase enzyme system carries out the first step in the aerobic degradation of naphthalene by Pseudomonas sp. strain NCIB 9816-4. The crystal structure of naphthalene dioxygenase (B. Kauppi, K. Lee, E. Carredano, R. E. Parales, D. T. Gibson, H. Eklund, and S. Ramaswamy, Structure 6:571-586, 1998) indicates that aspartate 205 may provide the most direct route of electron transfer between the Rieske [2Fe-2S] center of one alpha subunit and mononuclear iron in the adjacent alpha subunit. In this study, we constructed four site-directed mutations that changed aspartate 205 to alanine, glutamate, asparagine, or glutamine to test whether this residue is essential for naphthalene dioxygenase activity. The mutant proteins were very inefficient in oxidizing naphthalene to cis-naphthalene dihydrodiol, and oxygen uptake in the presence of naphthalene was below detectable levels. The purified mutant protein with glutamine in place of aspartate 205 had identical spectral properties to wild-type naphthalene dioxygenase and was reduced by NADH in the presence of catalytic amounts of ferredoxinNAP and reductaseNAP. Benzene, an effective uncoupler of oxygen consumption in purified naphthalene dioxygenase, did not elicit oxygen uptake by the mutant protein. These results indicate that electron transfer from NADH to the Rieske center in the mutant oxygenase is intact, a finding consistent with the proposal that aspartate 205 is a necessary residue in the major pathway of electron transfer to mononuclear iron at the active site.  (+info)

Homologous expression of soluble methane monooxygenase genes in Methylosinus trichosporium OB3b. (7/2226)

An homologous expression system has been developed for soluble methane monooxygenase (sMMO) genes from Methylosinus trichosporium OB3b. sMMO-minus mutants were previously obtained after marker-exchange mutagenesis, by the insertion of a kanamycin-resistance cassette into the mmoX gene of the sMMO operon. Complementation of the sMMO-minus genotype was achieved by conjugation with broad-host-range plasmids containing the native promoter and sMMO operon from Ms. trichosporium OB3b (pVK100Sc and pHM2). In wild-type methanotrophs, copper ions present in the growth medium at concentrations greater than 0.25 microM inhibit transcription of sMMO genes. The stable maintenance of pVK100Sc resulted in transconjugant methanotrophs with a decreased sensitivity to copper, since expression of sMMO occurred at copper sulphate concentrations of 7.5 microM. sMMO activity was only detected in soluble extracts after the addition of purified sMMO reductase component, which is inhibited by copper ions in vitro. This phenomenon could have arisen due to the increased number of sMMO gene copies (derived from pVK100Sc) in the cell. Transconjugants obtained from conjugations with pHM2 expressed sMMO at copper concentrations of 0-2.5 microM only and sMMO activity was not restored by the addition of purified reductase component at copper concentrations higher than 2.5 microM. Southern hybridization showed that the plasmid had integrated into the chromosome, probably by a single homologous recombination event. This is the first report of homologous sMMO expression in a methanotroph with enzyme activities that are comparable to the activity reported in wild-type strains. This expression system will be useful for site-directed mutagenesis of active-site residues of sMMO from Ms. trichosporium OB3b.  (+info)

Yeast flavin-containing monooxygenase generates oxidizing equivalents that control protein folding in the endoplasmic reticulum. (8/2226)

The flavin-containing monooxygenase from yeast (yFMO) catalyzes the O2- and NADPH-dependent oxidations of biological thiols, including oxidation of glutathione to glutathione disulfide (GSSG). Glutathione and GSSG form the principle redox buffering system in the cell, with the endoplasmic reticulum (ER) being more oxidizing than the cytoplasm. Proper folding of disulfide-bonded proteins in the ER depends on an optimum redox buffer ratio. Here we show that yFMO is localized to the cytoplasmic side of the ER membrane. We used a gene knockout strain and expression vectors to show that yFMO has a major effect on the generation of GSSG transported into the ER. The enzyme is required for the proper folding, in the ER, of test proteins with disulfide bonds, whereas those without disulfide bonds are properly folded independently of yFMO in the ER or in the cytoplasm.  (+info)

arachidonic acid epoxygenase activity Antibodies | Invitrogen ...arachidonic acid epoxygenase activity Antibodies | Invitrogen ...
Antibodies for proteins involved in arachidonic acid epoxygenase activity pathways, according to their Panther/Gene Ontology Classification
https://www.thermofisher.com/antibody/primary/panther/arachidonic%20acid%20epoxygenase%20activity
Flavin-containing monooxygenase 3 - WikipediaFlavin-containing monooxygenase 3 - Wikipedia
Flavin-containing monooxygenase 3 (FMO3), also known as dimethylaniline monooxygenase [N-oxide-forming] 3 and trimethylamine monooxygenase, is a flavoprotein enzyme (EC 1.14.13.148) that in humans is encoded by the FMO3 gene. This enzyme catalyzes the following chemical reaction: N,N,N-trimethylamine + NADPH + H+ + O2 ⇌ {\displaystyle \rightleftharpoons } N,N,N-trimethylamine N-oxide + NADP+ + H2O FMO3 is the main flavin-containing monooxygenase isoenzyme that is expressed in the liver of adult humans. The human FMO3 enzyme catalyzes several types of reactions, including: the N-oxygenation of primary, secondary, and tertiary amines; the S-oxygenation of nucleophilic sulfur-containing compounds; and the 6-methylhydroxylation of DMXAA. FMO3 is the primary enzyme in humans which catalyzes the N-oxidation of trimethylamine into trimethylamine N-oxide; FMO1 also N-oxygenates trimethylamine, but to a much lesser extent than FMO3. Genetic deficiencies of the FMO3 enzyme cause primary ...
https://en.wikipedia.org/wiki/Flavin-containing_monooxygenase_3
Sequence Similarity - 1FYZ: METHANE MONOOXYGENASE HYDROXYLASE, FORM II REDUCED BY SOAKING Sequence Similarity Report...Sequence Similarity - 1FYZ: METHANE MONOOXYGENASE HYDROXYLASE, FORM II REDUCED BY SOAKING Sequence Similarity Report...
1FYZ: Crystal structures of the soluble methane monooxygenase hydroxylase from Methylococcus capsulatus (Bath) demonstrating geometrical variability at the dinuclear iron active site.
http://www.rcsb.org/pdb/explore/sequenceCluster.do?structureId=1FYZ
Sequence Similarity - 1FZ2: METHANE MONOOXYGENASE HYDROXYLASE, FORM II MIXED-VALENT GENERATED BY CRYSTAL SOAKING...Sequence Similarity - 1FZ2: METHANE MONOOXYGENASE HYDROXYLASE, FORM II MIXED-VALENT GENERATED BY CRYSTAL SOAKING...
1FZ2: Crystal structures of the soluble methane monooxygenase hydroxylase from Methylococcus capsulatus (Bath) demonstrating geometrical variability at the dinuclear iron active site.
http://www.rcsb.org/pdb/explore/sequenceCluster.do?structureId=1FZ2
Flavin-containing monooxygenase - WikipediaFlavin-containing monooxygenase - Wikipedia
The flavin-containing monooxygenase (FMO) protein family specializes in the oxidation of xeno-substrates in order to facilitate the excretion of these compounds from living organisms. These enzymes can oxidize a wide array of heteroatoms, particularly soft nucleophiles, such as amines, sulfides, and phosphites. This reaction requires an oxygen, an NADPH cofactor, and an FAD prosthetic group. FMOs share several structural features, such as a NADPH binding domain, FAD binding domain, and a conserved arginine residue present in the active site. Recently, FMO enzymes have received a great deal of attention from the pharmaceutical industry both as a drug target for various diseases and as a means to metabolize pro-drug compounds into active pharmaceuticals. These monooxygenases are often misclassified because they share activity profiles similar to those of cytochrome P450 (CYP450), which is the major contributor to oxidative xenobiotic metabolism. However, a key difference between the two enzymes ...
https://en.wikipedia.org/wiki/Flavin-containing_monooxygenase
Role of P-450 Arachidonic Acid Epoxygenase in the Response of Cerebral Blood Flow to Glutamate in Rats | StrokeRole of P-450 Arachidonic Acid Epoxygenase in the Response of Cerebral Blood Flow to Glutamate in Rats | Stroke
The purpose of the present study was to gain further insight into the hypothesis that the metabolites of P-450 AA epoxygenase function in the regulation of CBF. We found that glutamate enhanced the formation and release of EETs from rat brain astrocytes. We also found that the expression of a recently identified P-450 2C11 enzyme is upregulated after prolonged exposure to glutamate. Finally, the present study demonstrated that inhibition of P-450 enzyme activity markedly blunts the increase in laser-Doppler-measured CBF in response to glutamate in anesthetized rats.. Previous work from our laboratory demonstrated that cultured astrocytes metabolize AA by the P-450 pathway to EETs and that they express P-450 2C11 cDNA.10 P-450 2C11 enzymes catalyze formation of 5,6-, 8,9-, 11,12-, and 14,15-EETs from AA.10 A physiological role for EETs in the regulation of CBF is emerging. Ellis and coworkers15 found that mouse brain tissue and cultured rat astrocytes metabolize AA to EETs, which dilate cerebral ...
http://stroke.ahajournals.org/content/28/5/1066
Metabolism of Ketoconazole and Deacetylated Ketoconazole by Rat Hepatic Microsomes and Flavin-Containing Monooxygenases | Drug...Metabolism of Ketoconazole and Deacetylated Ketoconazole by Rat Hepatic Microsomes and Flavin-Containing Monooxygenases | Drug...
Thank you for sharing this Drug Metabolism & Disposition article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
https://dmd.aspetjournals.org/content/25/6/772/tab-article-info
Metabolism of Ketoconazole and Deacetylated Ketoconazole by Rat Hepatic Microsomes and Flavin-Containing Monooxygenases | Drug...Metabolism of Ketoconazole and Deacetylated Ketoconazole by Rat Hepatic Microsomes and Flavin-Containing Monooxygenases | Drug...
Thank you for sharing this Drug Metabolism & Disposition article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
https://dmd.aspetjournals.org/content/25/6/772/tab-figures-data
Quantification and cellular localization of expression in human skin of genes encoding flavin-containing monooxygenases and...Quantification and cellular localization of expression in human skin of genes encoding flavin-containing monooxygenases and...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
https://www.ncbi.nlm.nih.gov/pubmed/11551524?dopt=Abstract
Iris View Profile
Research is focussed on the so-called drug metabolizing enzyme (DME) families, flavin-containing monooxygenases (FMOs) and cytochromes P-450 (CYPs). DMEs make it possible for an organism to be exposed to foreign chemicals e.g. therapeutic drugs, environmental pollutants, dietary components and plant products and to respond by metabolising such compounds to allow their clearance from the body. Using knockout models we have identified key roles for FMOs not only in drug and foreign chemical metabolism but also in energy metabolism. FMOs therefore have a dual role both in xenobiotic and endogenous metabolism. The biochemical consequences of genetic variation within these DME gene families for drug therapy and human health are of particular interest. Our research includes also studies of the perceptions of the clinical profession and the public in the use of medical therapies based on personalised genetic profiles (pharmacogenetics).. Of special interest is the genetic disorder primary ...
http://iris.ucl.ac.uk/iris/browse/profile?upi=EASHE43
Recombinant Human FMO5 protein (ab57977) ReferencesRecombinant Human FMO5 protein (ab57977) References
References for Abcams Recombinant Human FMO5 protein (ab57977). Please let us know if you have used this product in your publication
http://www.abcam.com/recombinant-human-fmo5-protein-ab57977-references.html
Aryl acetylenes as mechanism-based inhibitors of cytochrome P450-dependent monooxygenase enzymes. - PubMed - NCBIAryl acetylenes as mechanism-based inhibitors of cytochrome P450-dependent monooxygenase enzymes. - PubMed - NCBI
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
https://www.ncbi.nlm.nih.gov/pubmed/9074808?dopt=Abstract
Selected publicationsSelected publications
AUX/LAX genes encode a family of auxin influx transporters that perform distinct functions during Arabidopsis development. Péret B, Swarup K, Ferguson A, Seth M, Yang Y, Dhondt S, James N, Casimiro I, Perry P, Syed A, Yang H, Reemmer J, Venison E, Howells C, Perez-Amador MA, Yun J, Alonso J, Beemster GT, Laplaze L, Murphy A, Bennett MJ, Nielsen E, Swarup R. Plant Cell. 2012 24:2874-85 (2012). -. The Arabidopsis YUCCA1 flavin monooxygenase functions in the indole-3-pyruvic acid branch of auxin biosynthesis. Stepanova AN, Yun J, Robles LM, Novak O, He W, Guo H, Ljung K, Alonso JM. Plant Cell. 23:3961-3973 (2011). -. A Small-Molecule Screen Identifies L-Kynurenine That Competitively Inhibits TAA1/TAR Activity in Ethylene-Directed Auxin Biosynthesis and Root Growth. He W, Brumos J, Li H, Ji Y, Ke M, Gong X, Zeng Q, Li W, Zhang X, An F, Wen X, Li P, Xie D, Stepanova A, Alonso J, and Guo H. Plant Cell. 23: 3944-3960 (2011). -. Bypassing transcription: a shortcut in cytokinin-auxin interactions. ...
https://alonsostepanova.wordpress.ncsu.edu/welcome/publications/pubklications/
Fidelta :: Metabolic Stability Microsomes
Drugs are eliminated from the body either as unchanged parent or as metabolite. Metabolic stability plays a major role in drug clearance, with the liver being the primary site for drug biotransformation via two major enzymatic reactions: Phase I (modifications to the molecular structure itself) and Phase II reactions (conjugation reactions). A common system for measuring hepatic metabolism in early drug discovery, restricted to Phase I reactions, uses liver microsomes, a subcellular fraction containing major drug-metabolizing enzymes, including the cytochrome P450 (CYP) family and flavin monooxygenase (FMO). ...
http://www.fidelta.eu/resources/data-sheets/adme-pk/metabolic-stability-microsomes/
Cidofovir: An overview | Herpes Advice
Additionally, target-based therapies, such as inhibition of angiogenesis, metalloproteinases, and cytokine signaling, may be an effective strategy to treat patients with KS that progresses despite chemotherapy and/or HAART [22]. ^ NADAC as of 2016-11-30 , Data.Medicaid.gov. Antisense aims for a renaissance. Human fibroblasts (HF) were cultivated in Dulbeccos modified Eagles medium (DMEM; Gibco) containing 10% fetal bovine serum (FBS) and 100 units per mL penicillin G and 100 μg per mL streptomycin (Pen-Strep) and maintained at 37°C in a humidified 5% CO2 atmosphere, as previously described [9]. The metabolism of artemisinin in human liver microsomes is primarily mediated by cytochrome P-450 monooxygenase enzyme (CYP) 2B6, with a secondary contribution by CYP3A4 in individuals with low CYP2B6 expression. International Drug Price Indicator Guide. There is a need to identify alternative antiviral therapies with different modes of action to improve the treatment and control of HSV ...
http://www.wdmac.com/cidofovir-an-overview/
Novel variants of the human flavin-containing monooxygenase 3 (FMO3) gene associated with trimethylaminuriaNovel variants of the human flavin-containing monooxygenase 3 (FMO3) gene associated with trimethylaminuria
The disorder trimethylaminuria (TMAu) often manifests itself in a body odor for individuals affected. TMAu is due to decreased metabolism of dietary-derived trimethylamine (TMA). In a healthy individual, 95% or more of TMA is converted by the flavin-containing monooxygenase 3 (FMO3, EC 1.14.13.8) to …
https://pubmed.ncbi.nlm.nih.gov/19321370/?dopt=Abstract
Phenol hydroxylase and toluene/o-xylene monooxygenase from Pseudomonas stutzeri OX1: interplay between two enzymes. | IRIS...
Degradation of aromatic hydrocarbons by aerobic bacteria is generally divided into an upper pathway, which produces dihydroxylated aromatic intermediates by the action of monooxygenases, and a lower pathway, which processes these intermediates down to molecules that enter the citric acid cycle. Bacterial multicomponent monooxygenases (BMMs) are a family of enzymes divided into six distinct groups. Most bacterial genomes code for only one BMM, but a few cases (3 out of 31) of genomes coding for more than a single monooxygenase have been found. One such case is the genome of Pseudomonas stutzeri OX1, in which two different monooxygenases have been found, phenol hydroxylase (PH) and toluene/o-xylene monooxygenase (ToMO). We have already demonstrated that ToMO is an oligomeric protein whose subunits transfer electrons from NADH to oxygen, which is eventually incorporated into the aromatic substrate. However, no molecular data are available on the structure and on the mechanism of action of PH. To ...
https://www.iris.unina.it/handle/11588/201952
Frontiers | Two Novel Flavin-Containing Monooxygenases Involved in Biosynthesis of Aliphatic Glucosinolates | Plant ScienceFrontiers | Two Novel Flavin-Containing Monooxygenases Involved in Biosynthesis of Aliphatic Glucosinolates | Plant Science
Glucosinolates (GSLs), a class of secondary metabolites from cruciferous plants, are derived from amino acids and have diverse biological activities, such as in biotic defense, depending on their side chain modification. The first structural modification step in the synthesis of aliphatic (methionine-derived) GSLs-S-oxygenation of methylthioalkyl GSLs to methylsulfinylalkyl GSLs-was found to be catalyzed by five flavin-containing monooxygenases (FMOs), FMOGS-OX1-5. Here, we report two additional FMOGS-OX enzymes, FMOGS-OX6 and FMOGS-OX7, encoded by At1g12130 and At1g12160, respectively. The overexpression of both FMOGS-OX6 and FMOGS-OX7 decreased the ratio of MT GSL to the sum of MT and MS GSL, suggesting that the introduction of the two genes converted MT GSL into MS GSL. Analysis of expression pattern revealed that the spatial expression of the two genes is quite similar and partially overlapped with the other FMOGS-OX genes, which are primarily expressed in vascular tissue. We further analyzed the
https://www.frontiersin.org/articles/10.3389/fpls.2016.01292/full
Archives for May 2020 | www.hyphadiscovery.co.ukArchives for May 2020 | www.hyphadiscovery.co.uk
Metabolites derived from any human flavin-containing monooxygenase (FMO) subtype can now be produced as a service offering at Hypha. Recombinant… read more →. ...
https://www.hyphadiscovery.co.uk/2020/05/
Absence of metabolism of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) by flavin-containing monooxygenase (FMO). :...
The N-nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) is a potent lung carcinogen present in tobacco and tobacco smoke. Carbonyl reduction, alpha-carbon hydroxylation (activation) and N-oxidation of the pyridyl ring (detoxification) are the three main pathways of metabolism of NNK. In this study, metabolism of NNK was studied with lung and liver microsomes from F344 rats, Syrian golden hamsters and pigs and cloned flavin-containing monooxygenases (FMOs) from human and rabbit liver. Thermal inactivation at 45 degrees C for 2 min reduced FMO S-oxygenating activity but did not affect N-oxidation of NNK, leading to the conclusion that FMOs are not implicated in the detoxification of NNK. Detoxification of NNK was not increased by n-octylamine or by incubation at pH 8.4, supporting the conclusion that FMOs are not involved in the metabolism of NNK. SKF-525A (1 mM) significantly reduced N-oxidation and alpha-carbon hydroxylation, suggesting that these two pathways were catalyzed by ...
http://oxfordindex.oup.com/view/10.1093/carcin/18.10.1979
Alkene monooxygenase from Mycobacterium: a multicomponent enzyme.<...
TY - JOUR. T1 - Alkene monooxygenase from Mycobacterium: a multicomponent enzyme.. AU - Hartmans, S.. AU - Weber, F.J.. AU - Somhorst, D.P.M.. AU - de Bont, J.A.M.. PY - 1991. Y1 - 1991. U2 - 10.1099/00221287-137-11-2555. DO - 10.1099/00221287-137-11-2555. M3 - Article. VL - 137. SP - 2555. EP - 2560. JO - Journal of general microbiology. JF - Journal of general microbiology. SN - 0022-1287. ER - ...
https://research.wur.nl/en/publications/alkene-monooxygenase-from-mycobacterium-a-multicomponent-enzyme
Auxin biosynthesis by the YUCCA flavin monooxygenases controls...Auxin biosynthesis by the YUCCA flavin monooxygenases controls...
Auxin biosynthesis by the YUCCA flavin monooxygenases controls the formation of floral organs and vascular tissues in Arabidopsis: Auxin biosynthesis in plants
https://www.mysciencework.com/publication/show/auxin-biosynthesis-by-the-yucca-flavin-monooxygenases-controls-the-formation-of-floral-organs-and-vascular-tissues-in-arabidopsis
Toluene 1,2-dioxygenase system ferredoxin elisa and antibodyToluene 1,2-dioxygenase system ferredoxin elisa and antibody
Shop Toluene 1,2-dioxygenase system ferredoxin ELISA Kit, Recombinant Protein and Toluene 1,2-dioxygenase system ferredoxin Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
https://www.mybiosource.com/protein_family.php?root=toluene-1-2-dioxygenase-system-ferredoxin
paaB - 1,2-phenylacetyl-CoA epoxidase, subunit B - Escherichia coli (strain K12) - paaB gene & proteinpaaB - 1,2-phenylacetyl-CoA epoxidase, subunit B - Escherichia coli (strain K12) - paaB gene & protein
Component of 1,2-phenylacetyl-CoA epoxidase multicomponent enzyme system which catalyzes the reduction of phenylacetyl-CoA (PA-CoA) to form 1,2-epoxyphenylacetyl-CoA. The subunit B may play a regulatory role or be directly involved in electron transport.
https://www.uniprot.org/uniprot/P76078
ScienceAsia - Journal of The Science Society of ThailandScienceAsia - Journal of The Science Society of Thailand
ABSTRACT: Flavin monooxygenase (FMO) is one of the most important enzymes involved in glucosinolate biosynthesis. In this study, the full length of FMO gene (RsFMOgs-ox1) encoding a putative FMO protein composed of 450 amino acids was successfully cloned using the RACE-PCR method. The amino acid sequence of RsFMOgs-ox1 has high similarities of 92% and 83% with BrFMOgs-ox1 and AtFMOgs-ox1,2,3, respectively, and the gene structure of FMOgs-ox1 is similar to its plant homologues. Quantitative (qPCR) analysis revealed that RsFMOgs-ox1 was highly expressed during early seedling development. In mature radish, the highest expression was observed in the leaves, while the lowest transcript was evident in the root. The expression of RsFMOgs-ox1 was also regulated by wounding, notably 1 day after treatment. Subcellular localization in Arabidopsis showed that RsFMOgs-ox1 was localized in the cytoplasm and nuclei. This study allows us to understand something about RsFMOgs-ox1 function in glucosinolate ...
http://www.scienceasia.org/content/viewabstract.php?ms=4993&v=31&abst=1
Download Advances in Catalytic Activation of Dioxygen by Metal by László I. Simándi PDF - Kur nuomotis BooksDownload Advances in Catalytic Activation of Dioxygen by Metal by László I. Simándi PDF - Kur nuomotis Books
the topic of dioxygen activation and homogeneous catalytic oxidation by way of steel complexes has been within the concentration of recognition during the last two decades. The common curiosity is illustrated through its routine presence one of the periods and topic components of significant overseas meetings on quite a few facets of bioinorganic and coordination chemistry in addition to catalysis. the main admired examples are ICCC, ICBIC, EUROBIC, ISHC, and naturally the ADHOC sequence of conferences targeting the topic itself. equally, the variety of unique and overview papers dedicated to a variety of features of dioxygen activation are at the upward push. This pattern is due evidently to the relevance of catalytic oxidation to organic strategies similar to dioxygen shipping, and the motion of oxygenase and oxidase enzymes relating to metabolism. The structural and useful modeling of metalloenzymes, quite of these containing iron and copper, by way of low-molecular complexes of iron, copper, ...
http://kurnuomotispastolius.lt/download/advances-in-catalytic-activation-of-dioxygen-by-metal-complexes-catalysis-by
UniSysCat: Publications
Stoichiometric Formation of an Oxoiron(IV) Complex by a Soluble Methane Monooxygenase Type Activation of O at an Iron(II)-Cyclam Center, D. Kass, T. Corona, K. Warm, B. Braun-Cula, U. Kuhlmann, E. Bill, S. Mebs, M. Swart, H. Dau, M. Haumann, P. Hildebrandt, K. Ray, Journal of the American Chemical Society 2020, 142, 5924-5928, 10.1021/jacs.9b13756 ...
https://www.unisyscat.de/de/arbeitsgruppen/ray-kallol/publications.html
Amine oxidase [flavin-containing] B (human) | Protein Target - PubChemAmine oxidase [flavin-containing] B (human) | Protein Target - PubChem
Protein target information for Amine oxidase [flavin-containing] B (human). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
https://pubchem.ncbi.nlm.nih.gov/protein/P27338
From a trans to cis olefin and oxidations « Naturalproductmans BlogFrom a trans to cis olefin and oxidations « Naturalproductmans Blog
Kenji Watanabe and co-workers from the University of Shizuoka have reported in ACIE on an enzyme system (PsoE (glutathione S-transferase) and PsoF (flavin-containing monooxygenase)) that involves glutathione conjugation of a polyolefinic natural product (presynerazol) to form a glutathione adduct intermediate, which in turn is oxidized to the sulfoxide (by flavin hydroperoxide) and eliminates to form…
https://naturalproductman.wordpress.com/2016/04/14/from-a-trans-to-cis-olefin-and-oxidations/
Is Fasted Cardio Better then Fed Cardo?Is Fasted Cardio Better then Fed Cardo?
I see this question crop up fairly frequently. There seems to be the belief that doing cardio exercise after fasting is more beneficial than doing cardio
http://nutribody.com/is-fasted-cardio-better-then-fed-cardo/
Cardo | The Jewish Press - JewishPress.comCardo | The Jewish Press - JewishPress.com
Printed from: http://www.jewishpress.com/news/breaking-news/jerusalem-district-border-police-block-jewish-march-to-temple-mount/2014/05/06/. Scan this QR code to visit this page online ...
http://www.jewishpress.com/tag/cardo/
Confessions - Page 122Confessions - Page 122
Originally Posted by Qlip Nahh, I know what a tan is, I was born with one. I think its that thing where you dont get a lot of sun, because its alwa
https://www.typologycentral.com/forums/the-bonfire/68434-confessions-122.html
A Genome-Scale Metabolic Model for <i>Methylococcus capsulatus </i>(Bath) Suggests Reduced Efficiency Electron Transfer to the...A Genome-Scale Metabolic Model for <i>Methylococcus capsulatus </i>(Bath) Suggests Reduced Efficiency Electron Transfer to the...
TY - JOUR. T1 - A Genome-Scale Metabolic Model for Methylococcus capsulatus (Bath) Suggests Reduced Efficiency Electron Transfer to the Particulate Methane Monooxygenase. AU - Lieven, Christian. AU - Petersen, Leander A. H.. AU - Jørgensen, Sten Bay. AU - Gernaey, Krist V.. AU - Herrgard, Markus J.. AU - Sonnenschein, Nikolaus. PY - 2018. Y1 - 2018. N2 - Genome-scale metabolic models allow researchers to calculate yields, to predict consumption and production rates, and to study the effect of genetic modifications in silico, without running resource-intensive experiments. While these models have become an invaluable tool for optimizing industrial production hosts like E. coli and S. cerevisiae, few such models exist for one-carbon (C1) metabolizers. Here we present a genome-scale metabolic model for Methylococcus capsulatus (Bath), a well-studied obligate methanotroph, which has been used as a production strain of single cell protein (SCP). The model was manually curated, and spans a total of ...
https://orbit.dtu.dk/en/publications/a-genome-scale-metabolic-model-for-imethylococcus-capsulatus-ibat
Partial purification and substrate specificity of flavin-containing monooxygenase from rat brain microsomesPartial purification and substrate specificity of flavin-containing monooxygenase from rat brain microsomes
Flavin-containing monooxygenase (FMO) was partially purified from rat brain microsomes through two successive chromatographies on columns of DEAE Sepharose and 2,5-ADP Sepharose. The specific activity, benzydamine N-oxidation of partially purified brain FMO, was 122-fold higher than that of micros …
https://pubmed.ncbi.nlm.nih.gov/8787783/?dopt=Abstract
Diamond Publications - Search Results
Abstract: Soluble methane monooxygenase (sMMO) is a multicomponent metalloenzyme that catalyzes the conversion of methane to methanol at ambient temperature using a nonheme, oxygen-bridged dinuclear iron cluster in the active site. Structural changes in the hydroxylase component (sMMOH) containing the diiron cluster caused by complex formation with a regulatory component (MMOB) and by iron reduction are important for the regulation of O2 activation and substrate hydroxylation. Structural studies of metalloenzymes using traditional synchrotron-based X-ray crystallography are often complicated by partial X-ray-induced photoreduction of the metal center, thereby obviating determination of the structure of pure oxidation states. Here microcrystals of the sMMOH:MMOB complex from Methylosinus trichosporium OB3b were serially exposed to X-ray free electron laser (XFEL) pulses, where the ≦35 fs duration of exposure of an individual crystal yields diffraction data before photoreduction-induced ...
https://publications.diamond.ac.uk/pubman/searchpublicationsadvanced?advancedsearch=1&authorId=98283&publicationStates%5B4%5D.selected=true
Amine oxidase flavin-containing | definition of amine oxidase flavin-containing by Medical dictionaryAmine oxidase flavin-containing | definition of amine oxidase flavin-containing by Medical dictionary
Looking for online definition of amine oxidase flavin-containing in the Medical Dictionary? amine oxidase flavin-containing explanation free. What is amine oxidase flavin-containing? Meaning of amine oxidase flavin-containing medical term. What does amine oxidase flavin-containing mean?
https://medical-dictionary.thefreedictionary.com/amine+oxidase+flavin-containing
ENZYME: 1.14.11.ENZYME: 1.14.11.
1.14.11.1 Gamma-butyrobetaine dioxygenase 1.14.11.2 Procollagen-proline 4-dioxygenase 1.14.11.3 Pyrimidine-deoxynucleoside 2-dioxygenase 1.14.11.4 Procollagen-lysine 5-dioxygenase 1.14.11.5 Transferred entry: 1.14.11.6 1.14.11.6 Thymine dioxygenase 1.14.11.7 Procollagen-proline 3-dioxygenase 1.14.11.8 Trimethyllysine dioxygenase 1.14.11.9 Flavanone 3-dioxygenase 1.14.11.10 Pyrimidine-deoxynucleoside 1-dioxygenase 1.14.11.11 Hyoscyamine (6S)-dioxygenase 1.14.11.12 Gibberellin-44 dioxygenase 1.14.11.13 Gibberellin 2-beta-dioxygenase 1.14.11.14 6-beta-hydroxyhyoscyamine epoxidase 1.14.11.15 Gibberellin 3-beta-dioxygenase 1.14.11.16 Peptide-aspartate beta-dioxygenase 1.14.11.17 Taurine dioxygenase 1.14.11.18 Phytanoyl-CoA dioxygenase 1.14.11.19 Anthocyanidin synthase 1.14.11.20 Deacetoxyvindoline 4-hydroxylase 1.14.11.21 Clavaminate synthase 1.14.11.22 Flavone synthase 1.14.11.23 Flavonol synthase 1.14.11.24 2-deoxymugineic-acid 2-dioxygenase 1.14.11.25 Mugineic-acid 3-dioxygenase 1.14.11.26 ...
https://enzyme.expasy.org/EC/1.14.11.-
UniSysCat: Soluble Methane Monooxygenase Type Oxygen Activation at an Iron(II)-Cyclam Center
Three UniSysCat research groups investigated in an interdisciplinary approach oxygen activation of a non-heme iron(II) Cyclam Center relevant for understanding the chemistry of dinuclear non-heme iron enzymes.
https://www.unisyscat.de/news-events/soluble-methane-monooxygenase-type-oxygen-activation-at-an-ironii-cyclam-center.html
Tetrachlorobenzene | Article about tetrachlorobenzene by The Free DictionaryTetrachlorobenzene | Article about tetrachlorobenzene by The Free Dictionary
Looking for tetrachlorobenzene? Find out information about tetrachlorobenzene. C6H2Cl4 Water-insoluble, combustible white crystals that appear in two forms: 1,2,3,4-tetrachlorobenzene which melts at 47°C and is used in chemical... Explanation of tetrachlorobenzene
https://encyclopedia2.thefreedictionary.com/tetrachlorobenzene
Dioxygen Activation on Cu-MOR Zeolite: Theoretical Insights into the Formation of Cu<sub>2</sub>O and Cu<sub>3</sub>O<sub...
TY - JOUR. T1 - Dioxygen Activation on Cu-MOR Zeolite. T2 - Theoretical Insights into the Formation of Cu2O and Cu3O3 Active Species. AU - Mahyuddin, M. Haris. AU - Tanaka, Takahiro. AU - Staykov, Aleksandar. AU - Shiota, Yoshihito. AU - Yoshizawa, Kazunari. PY - 2018/8/20. Y1 - 2018/8/20. N2 - The utilization of low-cost and abundant oxygen (O2) as an oxidant in the activation of copper-exchanged zeolites is highly important for the direct, selective oxidation of methane to methanol at low temperatures. While two motifs of active sites, i.e., the [Cu2(μ-O)]2+ and [Cu3(μ-O)3]2+, have been experimentally observed in mordenite (MOR) zeolite, the mechanisms of their formation from the reaction of Cu-MOR with O2 are still unclear. In this study, we performed density functional theory (DFT) calculations for O2 activation over 2[Cu2]2+-MOR and [Cu3O]2+-MOR zeolites. For the reaction on the dicopper species, we found two possible reaction routes: O-O bond cleavage leading to (1) formation of a ...
https://kyushu-u.pure.elsevier.com/en/publications/dioxygen-activation-on-cu-mor-zeolite-theoretical-insights-into-t
ASMscience | Diversity, Function, and
This chapter focuses on the aerobic degradation of hydrocarbons, with an emphasis on alkanes, and the applications of enzymes involved in these processes for biocatalysis. Yeasts and fungi are often mentioned as alkane degraders, for example in connection with the production of single-cell proteins or organic acids and amino acids from hydrocarbons. Soluble and particulate mono-oxygenases are known to oxidize the same compounds, and some of the gene diversity detected with primers that amplify membrane-bound methane mono-oxygenase (pMMO) and soluble MMO (sMMO) genes may well be due to short-chain alkane-degrading bacteria instead of methanotrophs. The application of oxygenases in biocatalytic processes is more complicated than that of enzymes such as hydrolases, because of cofactor and oxygen requirements, the sensitive nature of many oxygenases, the toxicity of substrates and products to the biocatalyst, and the uptake of the lipophilic substrates. The best strain in this study was a hexane-degrading
https://www.asmscience.org/content/book/10.1128/9781555817589.chap13
IJMS | Free Full-Text | Flavin-Dependent Enzymes in Cancer PreventionIJMS | Free Full-Text | Flavin-Dependent Enzymes in Cancer Prevention
Statistical studies have demonstrated that various agents may reduce the risk of cancers development. One of them is activity of flavin-dependent enzymes such as flavin-containing monooxygenase (FMO)GS-OX1, FAD-dependent 5,10-methylenetetrahydrofolate reductase and flavin-dependent monoamine oxidase. In the last decade, many papers concerning their structure, reaction mechanism and role in the cancer prevention were published. In our work, we provide a more in-depth analysis of flavin-dependent enzymes and their contribution to the cancer prevention. We present the actual knowledge about the glucosinolate synthesized by flavin-containing monooxygenase (FMO)GS-OX1 and its role in cancer prevention, discuss the influence of mutations in FAD-dependent 5,10-methylenetetrahydrofolate reductase on the cancer risk, and describe FAD as an important cofactor for the demethylation of histons. We also present our views on the role of riboflavin supplements in the prevention against cancer.
http://mdpi.com/1422-0067/13/12/16751/xml
Trimethylaminuria Prevention and TreatmentTrimethylaminuria Prevention and Treatment
Trimethylaminuria Prevention and Treatment: treatment - General: There is currently no cure for trimethylaminuria (TMAU), and treatment options are limited. However, with proper treatment or precautions, individuals with TMAU may be able to live normal, healthy lives. Generally, treatment is based on symptom management, although widely varying degrees of effectiveness have been reported. Depending on the type and cause of TMAU, an individual...
http://www.wellness.com/reference/conditions/trimethylaminuria/prevention-and-treatment
Therapeutic EnzymesTherapeutic Enzymes
Rat liver microsomes act on 1,1-dichloro-cis -diphenylcyclopropane to form several products such as 2-chloro-3-oxo-1,3-diphenyl-1-propene. This involves an unusual type of ring fission which is considered to form 2,3-dichloro-1,3-diphenyl-1-propene as the initial product F573 . Methylococcus capsulatus soluble methane monooxygenase (E.C. 1.14.13.25) converts cyclopropylbenzene into benzyl alcohol. 3-Phenylprop-2-en-1-ol is also formed, and this may be an intermediate F278 . 1.6 Reactions.... ...
https://www.ormedmedical.us/therapeutic-enzymes/
Mtarc2 - Mitochondrial amidoxime reducing component 2 precursor - Rattus norvegicus (Rat) - Mtarc2 gene & proteinMtarc2 - Mitochondrial amidoxime reducing component 2 precursor - Rattus norvegicus (Rat) - Mtarc2 gene & protein
Catalyzes the reduction of N-oxygenated molecules, acting as a counterpart of cytochrome P450 and flavin-containing monooxygenases in metabolic cycles. As a component of prodrug-converting system, reduces a multitude of N-hydroxylated prodrugs particularly amidoximes, leading to increased drug bioavailability. May be involved in mitochondrial N(omega)-hydroxy-L-arginine (NOHA) reduction, regulating endogenous nitric oxide levels and biosynthesis. Postulated to cleave the N-OH bond of N-hydroxylated substrates in concert with electron transfer from NADH to cytochrome b5 reductase then to cytochrome b5, the ultimate electron donor that primes the active site for substrate reduction.
https://www.uniprot.org/uniprot/O88994
Squalene epoxidase elisa and antibodySqualene epoxidase elisa and antibody
Shop Squalene epoxidase ELISA Kit, Recombinant Protein and Squalene epoxidase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
https://www.mybiosource.com/protein_family.php?root=squalene-epoxidase
EC 1.13.11EC 1.13.11
EC 1.13.11.63. Accepted name: β-carotene 15,15-dioxygenase. Reaction: β-carotene + O2 = 2 all-trans-retinal. For diagram of reaction click here.. Other name(s): blh (gene name); BCO1 (gene name); BCDO (gene name); carotene dioxygenase; carotene 15,15-dioxygenase; BCMO1 (misleading); β-carotene 15,15-monooxygenase (incorrect). Systematic name: β-carotene:oxygen 15,15-dioxygenase (bond-cleaving). Comments: Requires Fe2+. The enzyme cleaves β-carotene symmetrically, producing two molecules of all-trans-retinal. Both atoms of the oxygen molecule are incorporated into the products [8]. The enzyme can also process β-cryptoxanthin, 8-apo-β-carotenal, 4-apo-β-carotenal, α-carotene and γ-carotene in decreasing order. The presence of at least one unsubstituted β-ionone ring in a substrate greater than C30 is mandatory [5]. A prokaryotic enzyme has been reported from the uncultured marine bacterium 66A03, where it is involved in the proteorhodopsin system, which uses retinal as its ...
http://www.sbcs.qmul.ac.uk/iubmb/enzyme/EC1/1311.html
DMOZ - Health: Conditions and Diseases: Nutritional and Metabolic Disorders: Inherited: Trimethylaminuria
Trimethylaminuria (TMAU), also known as fish odor syndrome or fish malodor syndrome, is a rare metabolic disorder that causes a defect in the normal production of the enzyme Flavin containing monooxygenase 3 (FMO3).When FMO3 is not working correctly, the body loses the ability to properly breakdown trimethylamine.
http://dmoztools.net/Health/Conditions_and_Diseases/Nutritional_and_Metabolic_Disorders/Inherited/Trimethylaminuria/
British Library EThOS: Near infrared spectroscopic monitoring and control of a whole-cell biocatalytic processBritish Library EThOS: Near infrared spectroscopic monitoring and control of a whole-cell biocatalytic process
Accurate and robust monitoring of product and reactants in a complex bioconversion stream is essential for the development of effective process control strategies. To monitor a microbially-catalysed Baeyer-Villiger bioconversion of a cyclic ketone to an optically pure lactone, a near infrared (NIR) spectroscopic method has been developed. The reaction, catalysed by cyclohexanone monooxygenase from Acinetobacter calcoaceticus (expressed in Escherichia coli) is characterised by substrate (ketone) and product (lactone) inhibition at relatively low concentrations. Quantitative multivariate calibration of a NIR spectrophotometer for ketone and lactone resulted in a standard error of prediction (SEP) at-line of 0.088 and 0.110 g/l-1 and on-line of 0.130 and 0.180 g/l-1 , respectively. The directed modification of quantitative models, by the inclusion of spiked process samples improved the SEP for lactone prediction where bioprocess development meant existing NIR models were not relevant. The ...
http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.415563
Synthetic anticonvulsants, antihypoxics, and liver monooxygenase system inducers based on amides and urea. XI. Synthesis of...
TY - JOUR. T1 - Synthetic anticonvulsants, antihypoxics, and liver monooxygenase system inducers based on amides and urea. XI. Synthesis of alkyl- and arylalkylureas and their effects on the liver monooxygenase system. AU - Bakibaev, S. S.. AU - Akhmedzhanov, R. R.. AU - Filimonov, V. D.. AU - Novocheeva, T. P.. AU - Saratikov, A. S.. AU - Tignibidina, L. G.. AU - Pustovoitov, A. V.. PY - 1993/9. Y1 - 1993/9. UR - http://www.scopus.com/inward/record.url?scp=14744281917&partnerID=8YFLogxK. UR - http://www.scopus.com/inward/citedby.url?scp=14744281917&partnerID=8YFLogxK. U2 - 10.1007/BF00780583. DO - 10.1007/BF00780583. M3 - Article. AN - SCOPUS:14744281917. VL - 27. SP - 631. EP - 634. JO - Pharmaceutical Chemistry Journal. JF - Pharmaceutical Chemistry Journal. SN - 0091-150X. IS - 9. ER - ...
https://tpu.pure.elsevier.com/en/publications/synthetic-anticonvulsants-antihypoxics-and-liver-monooxygenase-sy-2
Squalene Epoxidase抗体|Abcam中国|Anti-Squalene Epoxidase抗体Squalene Epoxidase抗体|Abcam中国|Anti-Squalene Epoxidase抗体
Squalene Epoxidase 兔多克隆抗体(ab112960)可与人样本反应并经WB实验严格验证。中国75%以上现货，所有产品均提供质保服务，可通过电话、电邮或微信获得本地专属技术支持。
http://www.abcam.cn/squalene-epoxidase-antibody-ab112960.html
Monooxygenases | definition of monooxygenases by Medical dictionaryMonooxygenases | definition of monooxygenases by Medical dictionary
Looking for online definition of monooxygenases in the Medical Dictionary? monooxygenases explanation free. What is monooxygenases? Meaning of monooxygenases medical term. What does monooxygenases mean?
https://medical-dictionary.thefreedictionary.com/monooxygenases
Inducible monooxygenase activities and 3-methylcholanthrene- -initiate by S A. Atlas, B A. Diwan et al.Inducible monooxygenase activities and 3-methylcholanthrene- -initiate by S A. Atlas, B A. Diwan et al.
Atlas, S A.; Diwan, B A.; and Nebert, D W., Inducible monooxygenase activities and 3-methylcholanthrene- -initiated tumorigenesis in mouse recombinant inbred sublines. (1976). Subject Strain Bibliography 1976. 2211 ...
https://mouseion.jax.org/ssbb1976/2211/
PROSITEPROSITE
Dioxygenases catalyze the incorporation of both atoms of molecular oxygen into substrates. Cleavage of aromatic rings is one of the most important function of dioxygenases. The substrates of ring-cleavage dioxygenases can be classified into two groups according to the mode of scission of the aromatic ring. Intradiol enzymes cleave the aromatic ring between two hydroxyl groups, whereas extradiol enzymes cleave the aromatic ring between a hydroxylated carbon and another adjacent nonhydroxylated carbon [1]. Intradiol dioxygenases require a nonheme ferric ion as a cofactor. The enzymes that belong to this family are: ...
https://prosite.expasy.org/doc/PS00083
Hydroxyacetophenone (HAP, CAS 99-93-4) Market by Product (2-Hydroxyacetophenone, 4-Hydroxyacetophenone), by Application ...Hydroxyacetophenone (HAP, CAS 99-93-4) Market by Product (2-Hydroxyacetophenone, 4-Hydroxyacetophenone), by Application ...
Hydroxyacetophenone (HAP, CAS 99-93-4) Market by Product (2-Hydroxyacetophenone, 4-Hydroxyacetophenone), by Application (Pharmaceuticals, Chemical Intermediates, Cosmetics) and by Region, Trend, Forecast, Competitive Analysis, and Growth Opportunity 2019-2024 - Radiant Insights
https://www.radiantinsights.com/research/hydroxyacetophenone-hap-cas-99-93-4-market?utm_source=Abnewswire&utm_medium=Referral&utm_campaign=ABN_ManishaS_06feb20_rd1
Record details
Dihydroflavonols are substrates for the biosynthesis of the coloured anthocyanin pigments, which are produced in three steps: firstly a reduction, catalysed by the enzyme dihydroflavonol 4-reductase (DFR); secondly the production of colourless anthocyanidin through the action of anthocyanidin synthase and thirdly addition of a glucose residue to produce a coloured anthocyanin molecule ...
http://bch.cbd.int/database/record.shtml?documentid=105424
Structural studies of the flavoprotein reductase component of the P450 mono-oxygenase system | Biochemical Society TransactionsStructural studies of the flavoprotein reductase component of the P450 mono-oxygenase system | Biochemical Society Transactions
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
http://www.biochemsoctrans.org/content/27/1/A29.3
Alkane 1-monooxygenase: Definition with Alkane 1-monooxygenase Pictures and PhotosAlkane 1-monooxygenase: Definition with Alkane 1-monooxygenase Pictures and Photos
Definition of Alkane 1-monooxygenase with photos and pictures, translations, sample usage, and additional links for more information.
http://www.lexic.us/definition-of/alkane_1-monooxygenase
The 9 Best MMO Mice 2021 Reviews & Buying Guide
As per the name, an MMO gaming mouse is primarily designed for playing MMO games. This is primarily due to the reason that these MMO mice offer multiple
https://indiarightnow.com/index.php/2021/03/03/the-9-best-mmo-mice-2021-reviews-buying-guide/
CYCLOHEXANONE ... - Brenntag product information pageCYCLOHEXANONE ... - Brenntag product information page
CYCLOHEXANONE ... - Brenntag product information page Brenntag is Beneluxs leading distributor and exporter of industrial chemicals and specialties, located in Belgium (Deerlijk, Antwerpen & Mouscron) and the Netherlands (Dordrecht, Loosdrecht, Zwijndrecht, Moerdijk, Rotterdam, Enschede).
http://brenntag.be/prd/product/cyclohexanonecyclohexanonecyclohexanonen.php
China Cyclohexanone-Qingdao Hisea Chem Co., Ltd - China Cyclohexanone, CycChina Cyclohexanone-Qingdao Hisea Chem Co., Ltd - China Cyclohexanone, Cyc
China Cyclohexanone-Qingdao Hisea Chem Co., Ltd, Find details about China Cyclohexanone, Cyc from Cyclohexanone-Qingdao Hisea Chem Co., Ltd - Qingdao Hisea Chem Co., Ltd.
http://hiseachem.en.made-in-china.com/product/XsjJvwnPLfcS/China-Cyclohexanone-Qingdao-Hisea-Chem-Co-Ltd.html
phenylacetone monooxygenase - Creative Enzymesphenylacetone monooxygenase - Creative Enzymes
A flavoprotein (FAD). NADH cannot replace NADPH as coenzyme. In addition to phenylacetone, which is the best substrate found to date, this Baeyer-Villiger monooxygenase c
https://www.creative-enzymes.com/product/Phenylacetone-Monooxygenase_11071.html
Onderon Collector - MMO BitsOnderon Collector - MMO Bits
MMO Bits is an MMO Gaming focused website featuring content primarily for Star Wars The Old Republic, Elder Scrolls Online and New World. The site features a mix of news, reviews, opinions and guides. ...
https://mmobits.com/tag/onderon-collector/?amp
Forex deposit mmo
forex deposit mmo Fredholm - forex deposit mmo, free realtime forex charts, forex ecn brokers usa, forex gold rate pk, kiyosaki forex
http://retzepti.ru/forex-deposit-mmo-1.html
KEGG T01835: LL3 01464
GenBank) Acireductone dioxygenase; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase; DHK-MTPene dioxygenase; Acireductone ...
http://www.genome.jp/dbget-bin/www_bget?bql:LL3_01464
The MMO Report: Baby names editionThe MMO Report: Baby names edition
This week on The MMO Report, Casey discusses the un-disbanding of the Multiverse project and associated Firefly/Buffy IPs, Wakfus bright and bizarre charact...
https://www.engadget.com/2012/01/12/the-mmo-report-baby-names-edition/
鎂營養 - 维基百科，自由的百科全书鎂營養 - 维基百科，自由的百科全书
鎂是人體內重要元素之一，是體內礦物質含量第四豐富的陽離子，僅次於鈣、鉀、鈉，在體液中主要以二價陽離子形式存在。成年人體內鎂總量約21-28克，鎂主要存在於細胞內，它在細胞內液的含量僅次於鉀，是細胞內的重要陽離子。其中骨骼肌佔27%，其他細胞佔6%-7%（以肝臟為最高）中，細胞外液（extracellular fluid，ECF）約佔1%，其餘60%-65%集中在骨骼，占骨頭總灰分的0.5%~0.7%。骨骼的鎂約三分之一與磷酸根緊密結合，其餘三分之二吸附於骨骼表面，可用來維持血液和組織的正常濃度。軟組織的鎂含量約為每公斤2.5-9毫莫耳，與代謝活性成正比。紅細胞內濃度2.5mmo1/L，血清 0.75-1.25 mmo1/L。血漿中鎂濃度平均約為0.85 mM (0.7-1.0 mM)，其中60%為離子態，30%與白蛋白（albumin）結合，10%為小分子複合物。細胞內鎂約90 ...
https://zh.wikipedia.org/wiki/%E9%8E%82%E7%87%9F%E9%A4%8A
3-phenylpropanoate dioxygenase(EC 1.14.12.19) - Creative Enzymes3-phenylpropanoate dioxygenase(EC 1.14.12.19) - Creative Enzymes
This enzyme catalyses a step in the pathway of phenylpropanoid compounds degradation. It catalyses the insertion of both atoms of molecular oxygen into positions 2 and 3
https://www.creative-enzymes.com/product/3phenylpropanoate-Dioxygenase_10858.html
TSAR, Vol.1, No.10TSAR, Vol.1, No.10
TSAR is a free, digitally delivered art information utility. Every entry is carefully checked with the presenting institutions. Nevertheless, inaccuracies occur. Always try to call the sponsoring institution to check the facts. In our effort to be an increasingly more valuable product, we ask for your comments and suggestions to be emailed to [email protected] ...
http://www.eyewithwings.net/VanishingPoints/TSAR.htm
Vanco 00340 : CDS information --- DoBISCUIT
putative 3,5-dihydroxyphenylacetyl-CoA 1,2-dioxygenase [hydroxyacyl-dehydrogenase] GTGACCACGGATTCCCCGACGCTGTCGCTTTCGCCGGGGCTCGACCATCGAGCCCTGGCG AAGGCGGCACAGCGTGTCGACGAGCTGCTCGACGGGTTGCCGTCGCCCTCGGCCAGGACG CCCGCGCAGCGTGAGGCCGCGTCCTCGGCGCTGGACGAGATCAGGGCGGCGCGGACGGAG TACGTGGAAGCGCACGCCGAGGAGATCTACGACCGGCTCACCGACGGCCGCACCCGCTAT CTACGCCTCGACGAACTCGTCCGGGCCGCCGCGTCGGCCTATCCCGGCCTGGTGCCCACG GAGGCGCAGATGGCGGCCGAGCGGTCCCGACGGCAGGCGGAGAAGGAAGGCCGTGAGATC GATCAGGGCATTTTCCTGCGCGGGATCCTGAGCGCGCCGAAAGCCGGGCCGCATCTGCTC GACGCCATGCTCAGGCCCACCGCCAGGGCGCTGGAGCTGCTGCCGGAGTTCGTCGAGACC GGTGTGGTGCGGATGGAGGCCGCCTCCCTGGAGCGCCGTGACGGCGTCGCGTACCTGACC CTGTGCCGGGACGACTGCCTGAACGCCGAGGACGCCCAGCAGGTCGACGACATGGAGACC GCGGTCGATCTGGCGCTGCTCGACCCGGCCGTCCGGGTGGGGATGCTGCGGGGCGGCGTG ATGAGCCATCCCCGGTACGCGGGGCGCCGGGTGTTCTGCGCGGGGATCAACCTCAAGAAG CTGAGTTCGGGCGACATCCCGCTCGTCGATTTCCTCCTGCGGCGGGAATTGGGCTATATC CACAAGATCGTGCGCGGGGTGGCCACGGACGGTTCGTGGCGAGCACGGGTGATCGACAAG CCCTGGCTGGCGGCCGTCGATTCCTTCGCCATCGGGGGCGGGGCCCAGCTCCTGCTGGTC ...
http://www.bio.nite.go.jp/pks/feature/view/Vanco_00340
SACOL RS01985 - AureoWikiSACOL RS01985 - AureoWiki
Unknown functionEnzymes of unknown specificityputative FMN-dependent luciferase-like monooxygenase, KPN_01858 family (TIGR04027; EC 1.-.-.-; HMM-score: 48.7) ...
http://aureowiki.med.uni-greifswald.de/SACOL_RS01985
OxygenaseOxygenase
The oxygenases form a class of oxidoreductases; their EC number is EC 1.13 or EC 1.14. Oxygenases were discovered in 1955 ... An oxygenase is any enzyme that oxidizes a substrate by transferring the oxygen from molecular oxygen O2 (as in air) to it. ... Hayaishi was awarded the 1986 Wolf Prize in Medicine "for the discovery of the oxygenase enzymes and elucidation of their ... SW, Ryter; J, Alam (April 2006). "Heme oxygenase-1/carbon monoxide: from basic science to therapeutic applications". Physiol ...
https://en.wikipedia.org/wiki/Oxygenase
Pyrimidine oxygenasePyrimidine oxygenase
Pyrimidine+oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology (EC 1.14.99). ... Pyrimidine oxygenase (EC 1.14.99.46, RutA) is an enzyme with systematic name uracil,FMNH2:oxygen oxidoreductase (uracil ...
https://en.wikipedia.org/wiki/Pyrimidine_oxygenase
Premnaspirodiene oxygenasePremnaspirodiene oxygenase
... (EC 1.14.13.121, HPO, Hyoscymus muticus premnaspirodiene oxygenase) is an enzyme with systematic ... Premnaspirodiene+oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology (Articles ... 2 H2O Premnaspirodiene oxygenase heme-thiolate protein (P-450). Takahashi S, Yeo YS, Zhao Y, O'Maille PE, Greenhagen BT, Noel ... JP, Coates RM, Chappell J (October 2007). "Functional characterization of premnaspirodiene oxygenase, a cytochrome P450 ...
https://en.wikipedia.org/wiki/Premnaspirodiene_oxygenase
Pentalenene oxygenasePentalenene oxygenase
... (EC 1.14.15.32, Formerly EC 1.14.13.133, PtlI) is an enzyme with systematic name pentalenene,NADPH:oxygen ... Pentalenene+oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology (EC 1.14.15). ... 2 H2O Pentalenene oxygenase is a heme-thiolate protein (P-450). Quaderer R, Omura S, Ikeda H, Cane DE (October 2006). " ...
https://en.wikipedia.org/wiki/Pentalenene_oxygenase
Sulfur oxygenaseSulfur oxygenase
... may refer to: Sulfur dioxygenase, an enzyme Sulfur oxygenase/reductase, an enzyme This set index page lists ...
https://en.wikipedia.org/wiki/Sulfur_oxygenase
Leucocyanidin oxygenaseLeucocyanidin oxygenase
In enzymology, a leucocyanidin oxygenase (EC 1.14.11.19) is an enzyme that catalyzes the chemical reaction leucocyanidin + 2- ... In a broader way, leucocyanidin oxygenase uses flavan-3,4-diols (leucoanthocyanidins) to produce 3-hydroxyanthocyanidins. The ... "Direct evidence for anthocyanidin synthase as a 2-oxoglutarate-dependent oxygenase: molecular cloning and functional expression ... "Mechanistic studies on three 2-oxoglutarate-dependent oxygenases of flavonoid biosynthesis: anthocyanidin synthase, flavonol ...
https://en.wikipedia.org/wiki/Leucocyanidin_oxygenase
Carotenoid oxygenaseCarotenoid oxygenase
... information More Carotenoid Oxygenase information This article incorporates text from the public domain ... Carotenoid oxygenases are a family of enzymes involved in the cleavage of carotenoids to produce, for example, retinol, ... Examples of carotenoid oxygenases include: Beta-carotene 15,15'-monooxygenase (BCO1; EC 1.14.99.36) from animals, which cleaves ... Carotenoid oxygenases cleave a variety of carotenoids into a range of biologically important products, including apocarotenoids ...
https://en.wikipedia.org/wiki/Carotenoid_oxygenase
Inositol oxygenaseInositol oxygenase
... , also commonly referred to as myo-inositol oxygenase (MIOX), is a non-heme di-iron enzyme that oxidizes myo- ... Inositol Glucuronic acid Oxygenases Bollinger JM, Diao Y, Matthews ML, Xing G, Krebs C (February 2009). "myo-Inositol oxygenase ... I. Purification and characterization of the oxygenase and of an enzyme complex containing the oxygenase and D-glucuronate ... "Crystal structure of a substrate complex of myo-inositol oxygenase, a di-iron oxygenase with a key role in inositol metabolism ...
https://en.wikipedia.org/wiki/Inositol_oxygenase
Heme oxygenaseHeme oxygenase
... , or haem oxygenase, (HMOX, commonly abbreviated as HO) is an enzyme that catalyzes the degradation of heme to ... Heme+Oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) EC 1.14.99.3 Portal: Biology (CS1: long ... Heme oxygenase 2 (HMOX2 or HO-2) is a constitutive isoform that is expressed under homeostatic conditions in the testes, ... CO is formed at a rate of 16.4 μmol/hour in the human body, ~86% originating from heme via heme oxygenase and ~14% from non- ...
https://en.wikipedia.org/wiki/Heme_oxygenase
Diapolycopene oxygenaseDiapolycopene oxygenase
Diapolycopene+oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology v t e (EC 1.14. ... Diapolycopene oxygenase (EC 1.14.99.44, crtP) is an enzyme with systematic name 4,4'-diapolycopene,AH2:oxygen oxidoreductase (4 ... Mijts BN, Lee PC, Schmidt-Dannert C (April 2005). "Identification of a carotenoid oxygenase synthesizing acyclic xanthophylls: ... 6 H2O Diapolycopene oxygenase is involved in the biosynthesis of C30 carotenoids such as staphyloxanthin. ...
https://en.wikipedia.org/wiki/Diapolycopene_oxygenase
Senecionine N-oxygenaseSenecionine N-oxygenase
In enzymology, a senecionine N-oxygenase (EC 1.14.13.101) is an enzyme that catalyzes the chemical reaction senecionine + NADPH ...
https://en.wikipedia.org/wiki/Senecionine_N-oxygenase
Chlorophyllide-a oxygenaseChlorophyllide-a oxygenase
... (EC 1.14.13.122), chlorophyllide a oxygenase, chlorophyll-b synthase, CAO) is an enzyme with ... Chlorophyllide-a+oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology (Articles ... encoding chlorophyll a oxygenase, is required for chlorophyll b synthesis in Arabidopsis thaliana". Proceedings of the National ... localization of chlorophyllide a oxygenase and discovery of a stable radical in the catalytic subunit". BMC Plant Biology. 4: 5 ...
https://en.wikipedia.org/wiki/Chlorophyllide-a_oxygenase
Aldehyde deformylating oxygenaseAldehyde deformylating oxygenase
Cyanobacterial aldehyde deformylating oxygenases are cytosolic nonheme di-iron oxygenases, but are much smaller (29 kDa) than ... Aldehyde deformylating oxygenases (ADO) (EC 4.1.99.5) are a family of enzymes which catalyze the oxygenation of medium and long ... n-aldehyde + O2 + 2 NADPH + H+ → (n-1)-alkane + formate + H2O + 2 NADP+ Aldehyde deformylating oxygenases are found in ... Cryptic Redox by an Unusual Dimetal Oxygenase". J. Am. Chem. Soc. 133 (16): 6158-6161. doi:10.1021/ja2013517. PMC 3113487. PMID ...
https://en.wikipedia.org/wiki/Aldehyde_deformylating_oxygenase
Pheophorbide a oxygenasePheophorbide a oxygenase
... (EC 1.14.15.17, pheide a monooxygenase, pheide a oxygenase, PAO) is an enzyme with systematic name ... Pheophorbide+a+oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology (EC 1.14.15). ... Chung DW, Pruzinská A, Hörtensteiner S, Ort DR (September 2006). "The role of pheophorbide a oxygenase expression and activity ... Pruzinská A, Tanner G, Anders I, Roca M, Hörtensteiner S (December 2003). "Chlorophyll breakdown: pheophorbide a oxygenase is a ...
https://en.wikipedia.org/wiki/Pheophorbide_a_oxygenase
Pyrogallol 1,2-oxygenasePyrogallol 1,2-oxygenase
In enzymology, a pyrogallol 1,2-oxygenase (EC 1.13.11.35) is an enzyme that catalyzes the chemical reaction 1,2,3- ... oxygenases). The oxygen incorporated need not be derived from O2. The systematic name of this enzyme class is 1,2,3- ...
https://en.wikipedia.org/wiki/Pyrogallol_1,2-oxygenase
Beta-apo-4-carotenal oxygenaseBeta-apo-4'-carotenal oxygenase
... (EC 1.2.1.82, beta-apo-4'-carotenal dehydrogenase, YLO-1, carD (gene)) is an enzyme with ... Beta-apo-4'-carotenal+oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology (EC 1.2. ...
https://en.wikipedia.org/wiki/Beta-apo-4'-carotenal_oxygenase
All-trans-8-apo-beta-carotenal 15,15-oxygenaseAll-trans-8'-apo-beta-carotenal 15,15'-oxygenase
... (EC 1.14.99.41, Diox1, ACO, 8'-apo-beta-carotenal 15,15'-oxygenase) is an ... Kloer DP, Ruch S, Al-Babili S, Beyer P, Schulz GE (April 2005). "The structure of a retinal-forming carotenoid oxygenase". ... All-trans-8'-apo-beta-carotenal+15,15'-oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal ... oxygenase contains an Fe2+-4His arrangement. Ruch S, Beyer P, Ernst H, Al-Babili S (February 2005). "Retinal biosynthesis in ...
https://en.wikipedia.org/wiki/All-trans-8'-apo-beta-carotenal_15,15'-oxygenase
Catechol 1,2-dioxygenaseCatechol 1,2-dioxygenase
Hayaishi O, Lardy H, Myrbäck K (1963). "Direct oxygenation by O2, oxygenases". In Boyer PD (ed.). The Enzymes. Vol. 8 (2nd ed ... Hayaishi S, Katagiri M, Rothberg S (1957). "Pioneering the Field of Oxygenases through the Study of Tryptophan Metabolism: the ... Itoh, M (1981). "Characteristics of a new catechol-1,2-oxygenase from Trichosporon cutaneum WY2-2". Agric. Biol. Chem. 45 (1): ... Nakazawa H, Inoue H, Takeda Y (1963). "Characteristics of Catechol Oxygenase from Brevibacterium fuscum". J. Biochem. 54 (1): ...
https://en.wikipedia.org/wiki/Catechol_1,2-dioxygenase
DioxygenaseDioxygenase
Abu-Omar MM, Loaiza A, Hontzeas N (June 2005). "Reaction mechanisms of mononuclear non-heme iron oxygenases". Chemical Reviews ... Sono M, Roach MP, Coulter ED, Dawson JH (November 1996). "Heme-Containing Oxygenases". Chemical Reviews. 96 (7): 2841-2888. doi ... Fetzner S (November 2002). "Oxygenases without requirement for cofactors or metal ions". Applied Microbiology and Biotechnology ... and an α3β3 oxygenase with each α-subunit containing a mononuclear iron center and a [2Fe-2S] Rieske cluster. Within each α- ...
https://en.wikipedia.org/wiki/Dioxygenase
Tryptophan 2,3-dioxygenaseTryptophan 2,3-dioxygenase
... oxygenases). This family includes tryptophan 2,3-dioxygenase (TDO, also sometimes referred to as tryptophan oxygenase and L- ... Sono M, Roach MP, Coulter ED, Dawson JH (November 1996). "Heme-Containing Oxygenases". Chemical Reviews. 96 (7): 2841-2888. doi ... Comings DE, Muhleman D, Dietz GW, Donlon T (February 1991). "Human tryptophan oxygenase localized to 4q31: possible ...
https://en.wikipedia.org/wiki/Tryptophan_2,3-dioxygenase
Kynurenine 3-monooxygenaseKynurenine 3-monooxygenase
Saito Y, Hayaishi O, Rothberg S (1957). "Studies on oxygenases; enzymatic formation of 3-hydroxy-L-kynurenine from L-kynurenine ...
https://en.wikipedia.org/wiki/Kynurenine_3-monooxygenase
KynurenineKynurenine
Kynureninase, European Bioinformatics Institute Saito Y, Hayaishi O, Rothberg S (1957-12-01). "Studies on Oxygenases". The ...
https://en.wikipedia.org/wiki/Kynurenine
Copper proteinCopper protein
Solomon EI, Sundaram UM, Machonkin TE (November 1996). "Multicopper Oxidases and Oxygenases". Chemical Reviews. 96 (7): 2563- ...
https://en.wikipedia.org/wiki/Copper_protein
Alpha-ketoglutarate-dependent hydroxylasesAlpha-ketoglutarate-dependent hydroxylases
Cheng AX, Han XJ, Wu YF, Lou HX (January 2014). "The function and catalysis of 2-oxoglutarate-dependent oxygenases involved in ... Hewitson KS, Granatino N, Welford RW, McDonough MA, Schofield CJ (April 2005). "Oxidation by 2-oxoglutarate oxygenases: non- ... Rose NR, McDonough MA, King ON, Kawamura A, Schofield CJ (August 2011). "Inhibition of 2-oxoglutarate dependent oxygenases". ... Proshlyakov DA, McCracken J, Hausinger RP (April 2016). "Spectroscopic analyses of 2-oxoglutarate-dependent oxygenases: TauD as ...
https://en.wikipedia.org/wiki/Alpha-ketoglutarate-dependent_hydroxylases
Streptomyces luridusStreptomyces luridus
2-Oxoglutarate-Dependent Oxygenases. Royal Society of Chemistry. ISBN 1-84973-950-1. Kukhar, Valery P.; Hudson, Harry R. (2000 ...
https://en.wikipedia.org/wiki/Streptomyces_luridus
Lesser PolandLesser Poland
Heme Oxygenases 2007 Conference. Jagiellonian University. Archived from the original on 15 July 2007. Retrieved 14 August 2007 ...
https://en.wikipedia.org/wiki/Lesser_Poland
Phytanoyl-CoA dioxygenasePhytanoyl-CoA dioxygenase
This enzyme belongs to the family of iron(II)-dependent oxygenases, which typically incorporate one atom of dioxygen into the ... Iron(II) and 2OG-dependent oxygenases are common in microorganisms, plants, and animals; the human genome is predicted to ... Martinez S, Hausinger RP (Aug 2015). "Catalytic Mechanisms of Fe(II)- and 2-Oxoglutarate-dependent Oxygenases". The Journal of ... Hausinger, Robert P. (2015). "CHAPTER 1. Biochemical Diversity of 2-Oxoglutarate-Dependent Oxygenases". 2-Oxoglutarate- ...
https://en.wikipedia.org/wiki/Phytanoyl-CoA_dioxygenase
LaccaseLaccase
Biology portal Solomon EI, Sundaram UM, Machonkin TE (November 1996). "Multicopper Oxidases and Oxygenases". Chemical Reviews. ...
https://en.wikipedia.org/wiki/Laccase
Coproporphyrinogen dehydrogenaseCoproporphyrinogen dehydrogenase
Fetzner, Susanne; Steiner, Roberto A. (2010-02-16). "Cofactor-independent oxidases and oxygenases". Applied Microbiology and ...
https://en.wikipedia.org/wiki/Coproporphyrinogen_dehydrogenase
Catechol 2,3-dioxygenaseCatechol 2,3-dioxygenase
... (EC 1.13.11.2, 2,3-pyrocatechase, catechol 2,3-oxygenase, catechol oxygenase, metapyrocatechase, ... Hayaishi O, Lardy H, Myrbäck K (1963). "Direct oxygenation by O2, oxygenases". In Boyer PD (ed.). The Enzymes. Vol. 8 (2nd ed ...
https://en.wikipedia.org/wiki/Catechol_2,3-dioxygenase
Heme Oxygenase-1 Promotes Delayed Wound Healing in Diabetic RatsHeme Oxygenase-1 Promotes Delayed Wound Healing in Diabetic Rats
The aim of the study was to explore the effect of heme oxygenase-1 on wound closure in diabetic rats. Diabetic wound model was ... Effects of Heme Oxygenase-1 on CSE and CBS Protein Expression. To explore the beneficial effect of heme oxygenase-1 on wound ... Heme Oxygenase-1 Promotes Delayed Wound Healing in Diabetic Rats. Qing-Ying Chen. ,1Guo-Guang Wang. ,2Wei Li. ,2Yu-Xin Jiang. , ... Compared with DTV rats, heme oxygenase-1 significantly accelerated the wound closure rates from DTH rats after 5 days (. ) ( ...
https://www.hindawi.com/journals/jdr/2016/9726503/
JCI - Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiencyJCI - Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency
The first known human case of heme oxygenase-1 (HO-1) deficiency is presented in this report. The patient is a six-year-old boy ... Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. ... Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. ...
https://www.jci.org/articles/view/4165/figure/8
Acromioclavicular Joint Injury Medication: Nonsteroidal Anti-inflammatory Drugs (NSAIDs), Cyclo-oxygenase 2 Inhibitors,...Acromioclavicular Joint Injury Medication: Nonsteroidal Anti-inflammatory Drugs (NSAIDs), Cyclo-oxygenase 2 Inhibitors,...
Cyclo-oxygenase 2 Inhibitors. Class Summary. COX-2 inhibitors are used to control pain and inflammation, especially in cases of ...
https://emedicine.medscape.com/article/92337-medication
Comparative study for oxygenases produced by Aspergillus niger, ATCC 9642, in solid-state and submerged fermentationComparative study for oxygenases produced by Aspergillus niger, ATCC 9642, in solid-state and submerged fermentation
3.4 Production of oxygenase(s). Culture media c and f were selected to produce oxygenase(s) by SmF and SSF respectively. The ... 2.4 Oxygenase(s) production. Once the hexadecane degradation was studied in both types of systems, culture media c and f (Table ... 3.5.3 The effect of temperature on oxygenase(s) activity. There are two optimum temperatures for the oxidation of decane as ... 3.5.2 Oxygenase(s) substrate specificity. Crude extracts from SSF oxidized aliphatic and cyclic substrates (Fig. 6A). There was ...
https://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S1665-27382011000200005&lng=pt&nrm=iso&tlng=en
Mechanisms of 2-oxoglutarate-dependent oxygenases: The hydroxylation paradigm and beyond<...
Mechanisms of 2-oxoglutarate-dependent oxygenases : The hydroxylation paradigm and beyond. 2-Oxoglutarate-Dependent Oxygenases ... Mechanisms of 2-oxoglutarate-dependent oxygenases: The hydroxylation paradigm and beyond. J. Martin Bollinger, Wei Chen Chang, ... 2-Oxoglutarate-Dependent Oxygenases. ed. / Robert P. Hausinger; Christopher J. Schofield. 3. ed. Royal Society of Chemistry, ... Mechanisms of 2-oxoglutarate-dependent oxygenases : The hydroxylation paradigm and beyond. / Bollinger, J. Martin; Chang, Wei ...
https://pennstate.pure.elsevier.com/en/publications/mechanisms-of-2-oxoglutarate-dependent-oxygenases-the-hydroxylati
British Library EThOS: The structure and expression of genes encoding the small subunit of ribulose 1,5-bisphosphate...British Library EThOS: The structure and expression of genes encoding the small subunit of ribulose 1,5-bisphosphate...
The multigene family encoding the small subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase [EC 4.1.1.39] in Phaseolus ... The structure and expression of genes encoding the small subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase in ...
https://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.796168
Intermediates in O2 Activation by Oxygenases at Non-heme - Fingerprint - Experts@MinnesotaIntermediates in O2 Activation by Oxygenases at Non-heme - Fingerprint - [email protected]
Intermediates in O2 Activation by Oxygenases at Non-heme. *Lipscomb, John D (PI) ...
https://experts.umn.edu/en/projects/intermediates-in-o2-activation-by-oxygenases-at-non-heme/fingerprints/
Heme oxygenase-1 derived carbon monoxide suppresses Aβ1-42 toxicity in astrocytes - CentAURHeme oxygenase-1 derived carbon monoxide suppresses Aβ1-42 toxicity in astrocytes - CentAUR
Hettiarachchi, N. T., Boyle, J. P., Dallas, M., Al-Owais, M. M., Scragg, J. L. and Peers, C. (2017) Heme oxygenase-1 derived ... Induction of heme oxygenase-1 (HO-1) protected astrocytes from Aβ(1-42) toxicity, and this protective effect was mimicked by ... Heme oxygenase-1 derived carbon monoxide suppresses Aβ1-42 toxicity in astrocytes ...
https://centaur.reading.ac.uk/70612/
Nitric oxide synthase (neuronal) (oxygenase domain) (human), (recombinant) (purified) - ALX-201-264 - Enzo Life SciencesNitric oxide synthase (neuronal) (oxygenase domain) (human), (recombinant) (purified) - ALX-201-264 - Enzo Life Sciences
Design and properties of nitric-oxide synthase oxygenase/FMN domain constructs: D.K. Ghosh, et al.; J. Biol. Chem. 281, 14173 ( ...
https://www.enzolifesciences.com/ALX-201-264/nitric-oxide-synthase-neuronal-oxygenase-domain-human-recombinant-purified/
The Heme synthesis and degradation pathways: role in oxidant sensitivity - Heme oxygenase has both pro- and antioxidant...
The heme oxygenases (HOs) provide this function and participate in cellular defense. This hypothesis emerges from the ... The heme oxygenases (HOs) provide this function and participate in cellular defense. This hypothesis emerges from the ... The heme oxygenases (HOs) provide this function and participate in cellular defense. This hypothesis emerges from the ... The heme oxygenases (HOs) provide this function and participate in cellular defense. This hypothesis emerges from the ...
https://researchportal.bath.ac.uk/en/publications/the-heme-synthesis-and-degradation-pathways-role-in-oxidant-sensi
Genotyping of flavin-containing mono-oxygenase 3 (FMO3) gene by polymerase chain reaction-restriction fragment length...Genotyping of flavin-containing mono-oxygenase 3 (FMO3) gene by polymerase chain reaction-restriction fragment length...
Fishy smelling off-flavour of chicken meat is caused by a mutation (FMO3 c.985A,T) in exon 7 of flavincontaining mono-oxygenase ... Genotyping of flavin-containing mono-oxygenase 3 (FMO3) gene by polymerase chain reaction-restriction fragment length ...
https://www.ajol.info/index.php/ajb/article/view/100352
Natural heme oxygenase-1 inducers in hepatobiliary function
... LI VOLTI, Giovanni;SACERDOTI D;DI GIACOMO, Claudia;BARCELLONA ML; ...
https://www.iris.unict.it/handle/20.500.11769/6490
Mixed Function Oxygenases | Profiles RNS
"Mixed Function Oxygenases" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical ... This graph shows the total number of publications written about "Mixed Function Oxygenases" by people in this website by year, ... Below are the most recent publications written about "Mixed Function Oxygenases" by people in Profiles. ... Below are MeSH descriptors whose meaning is more general than "Mixed Function Oxygenases". ...
https://profiles.ouhsc.edu/display/30341
Translational Significance of Heme Oxygenase in Obesity and Metabolic by Nader G. Abraham, Joshua Junge et al."Translational Significance of Heme Oxygenase in Obesity and Metabolic " by Nader G. Abraham, Joshua Junge et al.
This review reflects the dramatic increase in research on the role of increased expression of heme oxygenase (HO)-1/HO-2, ... This review reflects the dramatic increase in research on the role of increased expression of heme oxygenase (HO)-1/HO-2, ... Translational Significance of Heme Oxygenase in Obesity and Metabolic Syndrome. Trends Pharmacol Sci. 2016;37(1):17-36. doi: ...
https://mds.marshall.edu/sm_bm/250/
View 2 Oxoglutarate Dependent Oxygenases 2015
... by Henry 4.1 ... If your view 2 oxoglutarate dependent oxygenases is to be another individuation to connect at works in the CRE they will get to ... Org ID and the view 2 oxoglutarate dependent oxygenases Grazers substance, issuer truth and care force. *Sitemap ... You can present the sisters in this individual view 2 oxoglutarate dependent oxygenases breathing the philosophy praxis, and ...
http://schusters-rappenschinder.de/bilder/library.php?q=view-2-oxoglutarate-dependent-oxygenases-2015/
Increased risk of venous thromboembolism is associated with genetic variation in heme oxygenase-1 in BlacksIncreased risk of venous thromboembolism is associated with genetic variation in heme oxygenase-1 in Blacks
Heme Oxygenase-1 Humans Logistic Models Male Microsatellite Repeats Middle Aged Risk Factors Venous Thromboembolism Whites ... The inducible heme oxygenase-1 (HMOX1) gene encodes a key cytoprotective enzyme with anti-inflammatory, antioxidant and ... Our results support a key role for the heme oxygenase system in protecting patients at increased risk for thrombosis and ... Increased risk of venous thromboembolism is associated with genetic variation in heme oxygenase-1 in Blacks. ...
https://stacks.cdc.gov/view/cdc/33733
Potential candidate for oral pericoital contraception: evaluating ulipristal acetate plus cyclo-oxygenase-2 inhibitor for...Potential candidate for oral pericoital contraception: evaluating ulipristal acetate plus cyclo-oxygenase-2 inhibitor for...
Potential candidate for oral pericoital contraception: evaluating ulipristal acetate plus cyclo-oxygenase-2 inhibitor for ... Potential candidate for oral pericoital contraception: evaluating ulipristal acetate plus cyclo-oxygenase-2 inhibitor for ... Potential candidate for oral pericoital contraception: evaluating ulipristal acetate plus cyclo-oxygenase-2 inhibitor for ...
https://srh.bmj.com/content/48/3/217.citation-tools
Cumulative Effect of Mesenchymal Stem Cells and Heme Oxygenase-1 Inducer in Ameliorating Induced Liver Toxicity in Rats. |...Cumulative Effect of Mesenchymal Stem Cells and Heme Oxygenase-1 Inducer in Ameliorating Induced Liver Toxicity in Rats. |...
Cumulative Effect of Mesenchymal Stem Cells and Heme Oxygenase-1 Inducer in Ameliorating Induced Liver Toxicity in Rats.. *View ... Cumulative Effect of Mesenchymal Stem Cells and Heme Oxygenase-1 Inducer in Ameliorating Induced Liver Toxicity in Rats. ... Cumulative Effect of Mesenchymal Stem Cells and Heme Oxygenase-1 Inducer in Ameliorating Induced Liver Toxicity in Rats., ...
https://scholar.cu.edu.eg/?q=ahmedmohamedtalaat/publications/cumulative-effect-mesenchymal-stem-cells-and-heme-oxygenase-1-induce
Heat shock proteins and hormesis in the diagnosis and treatment of neurodegenerative diseases | SpringerLinkHeat shock proteins and hormesis in the diagnosis and treatment of neurodegenerative diseases | SpringerLink
Two main isoforms of heme oxygenase were identified so far and named HO-1 and HO-2 [61, 62]. Heme oxygenase-1 is the inducible ... The heme oxygenase family. The heme oxygenase (HO) isoforms have been recognized as dynamic sensors of cellular oxidative ... such as heme oxygenase-1 (HO-1), Hsp72, sirtuins and thioredoxin/thioredoxin reductase (Fig. 1) [7, 26, 27]. Heme oxygenase-1, ... A Heme oxygenase: A master vitagene involved in cellular stress response. In: AM Eleuteri, editor. Enzymes and the Cellular ...
https://link.springer.com/article/10.1186/s12979-015-0046-8
Disease Relevance - Heme Oxygenase | Heme OxygenaseDisease Relevance - Heme Oxygenase | Heme Oxygenase
Heme Oxygenase: Disease Relevance. HO-1 in Cancer. Heme oxygenase 1 (HO-1) has generally been considered as being a ...
http://hemeoxygenase.com/disease-relevance/
Tag: Heme oxygenase - cannabinoid.data-1.science
IMSEAR at SEARO: Immunolocalization of heme oxygenase-1 in periodontal diseases.
One such system is heme oxygenase enzymes. Heme oxygenase is the key enzyme involved in catabolism of heme. It cleaves the heme ... Immunolocalization of heme oxygenase-1 in periodontal diseases.. Autor : Gayathri, G. Muthukumar, S. Joseph, Leena Dennis. ... Increased heme oxygenase expression has been identified in inflammatory condition, such as pancreatitis, diabetes, nephritis, ... Aims: The aim of this study is to compare the expression of heme oxygenase-1 in patients with healthy periodontium, ...
https://imsear.searo.who.int/handle/123456789/154654?locale=es
Frontiers | Differential Retinal Ganglion Cell Vulnerability, A Critical Clue for the Identification of Neuroprotective Genes...Frontiers | Differential Retinal Ganglion Cell Vulnerability, A Critical Clue for the Identification of Neuroprotective Genes...
Hmox1 (Heme Oxygenase-1). Hmox1 is upregulated in neurodegeneration in [3] (59) and [4] (60) (Figure 1B). Heme oxygenase (HO) ... Heme oxygenase-1 (HO-1, encoded by Hmox1) exerts neuronal and non-neuronal cell protection after visceral organ injury (81) and ... As described above, the heme oxygenase-1 (HO-1, encoded by Hmox1) is commonly identified in [3] (59) and [4] (60), and it ... Functional Human Heme Oxygenase has a Neuroprotective Effect on Adult Rat Ganglion Cells After Pressure-Induced Ischemia. ...
https://www.frontiersin.org/articles/10.3389/fopht.2022.905352/full
COX 2 (Cyclo-Oxygenase) Inhibitors - London Pain ClinicCOX 2 (Cyclo-Oxygenase) Inhibitors - London Pain Clinic
The cyclo-oxygenase 2 (COX-2) inhibitors are a new form of non-steroidal anti-inflammatory drugs (NSAIDs) that are considered ...
https://www.londonpainclinic.com/anti-inflammatories/cox-2-cyclo-oxygenase-inhibitors/
Recombinant Mouse Heme oxygenase 1 Protein - enQuire BioReagentsRecombinant Mouse Heme oxygenase 1 Protein - enQuire BioReagents
Recombinant Mouse Heme oxygenase 1 Protein. Synthesized inYeast. Protein Tag: His. Purity: Greater than 90% as determined by ... General Description of Recombinant Mouse Heme oxygenase 1 Protein.. He oxygenase cleaves the he ring at the alpha methene ... Recombinant Mouse Heme oxygenase 1 Protein. $ 578.00 - $ 1,588.00. Please Select Product Options Below To View The Catalog ... Be the first to review "Recombinant Mouse Heme oxygenase 1 Protein" Cancel reply. Your email address will not be published. ...
https://enquirebio.com/proteins/QP9180-Heme-oxygenase-1
Other Oxygenases/OxidasesOther Oxygenases/Oxidases
Supplementary MaterialsAdditional document 1 1. Proteins/Soluble Receptors. 9. Note 1. Further Evidence for any Receptor for TCC. Note 2 Problems with Cross-linking Experiments. 10. Evidence for Binary Receptors aside from the IGF System. 11. Evidence for Two Receptors for a Particular Trefone, outside the IGF System. 12. Note 1 Mechanisms of Nuclear Localization. Take note 2 NL of IGFBPs. Take note 3 NL of Potential Trefones apart from the IGF Program. 13. Proof Helping the Life of i-Cells and a-Cells. 14. Applicants with a-Cell-Type or i-Cell-Type Features mainly. 15. Interacting Trefones and Cells not from the IGF Program. 16. Heterogeneity/Variability of Cells in Lifestyle. 17. Cell lines arent Typical of Regular Cells. 18. Cell Receptors and Cell Markers. 19. Described Couplet Cells for Glucagon and Insulin; Histamine and Gastrin. 20. Potential Couplet Trefones. 21. Further Types of Potential Cell and Trefone Couplets. 22. Examples of Cellular Rules by Complexes. 23. Proteolytic enzymes ...
http://www.insulin-receptor.info/category/other-oxygenasesoxidases/
Recombinant Human Heme oxygenase 1(HMOX1),partial - GeneBio SystemsRecombinant Human Heme oxygenase 1(HMOX1),partial - GeneBio Systems
Recombinant Human Heme oxygenase 1(HMOX1),partial. CSB-EP010583HU Regular price $709.00 CAD ... Relevance: He oxygenase cleaves the he ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently ... Under physiological conditions, the activity of he oxygenase is highest in the spleen, where senescent erythrocytes are ...
https://www.genebiosystems.com/products/recombinant-human-heme-oxygenase-1hmox1-partial
Lumbar Facet Arthropathy Medication: Nonsteroidal anti-inflammatory drugs, Cyclo-oxygenase-2 Inhibitors, Analgesics
Cyclo-oxygenase-2 Inhibitors. Class Summary. Although increased cost can be a negative factor, the incidence of costly and ... Their mechanism of action is not known, but they may inhibit cyclo-oxygenase (COX) activity and prostaglandin synthesis. Other ...
https://www.staging.medscape.com/answers/310069-106072/which-drugs-are-used-in-the-treatment-of-lumbar-facet-arthropathy
Lumbar Facet Arthropathy Medication: Nonsteroidal anti-inflammatory drugs, Cyclo-oxygenase-2 Inhibitors, AnalgesicsLumbar Facet Arthropathy Medication: Nonsteroidal anti-inflammatory drugs, Cyclo-oxygenase-2 Inhibitors, Analgesics
Cyclo-oxygenase-2 Inhibitors. Class Summary. Although increased cost can be a negative factor, the incidence of costly and ... Their mechanism of action is not known, but they may inhibit cyclo-oxygenase (COX) activity and prostaglandin synthesis. Other ...
https://emedicine.staging.medscape.com/article/310069-medication
Heme oxygenaseMono-oxygenaseCyclo-oxygenaseProteinCytochromeBiliverdinBiodegradationInhibitionCarbonSubstrateDescriptorFoldsHydroxylationCellularRegulationGlucoseSubstancePhysiologyMetabolismActivityExpressionFunctionKnowledgeGroupCyclo-Oxygenase-2 InhibitorsNitric oxide syHMOX1Signaling proteinCarboxylaseReductaseCatalyzed by heme oxygenaseInhibitorsPolymorphismGeneInductionDegradationNonheme ironMacrophagesEnzymeProstaglandinEnzymesMRNADependentCatalyzesGenesEndothelialProteinsRieskeSpeciesCadmiumCatalyticInhibitorCellsInflammationBiphenylEquimolarPseudomonasUpregulationPromoter
Heme oxygenase39
  • The aim of the study was to explore the effect of heme oxygenase-1 on wound closure in diabetic rats. (hindawi.com)
  • The first known human case of heme oxygenase-1 (HO-1) deficiency is presented in this report. (jci.org)
  • Up‐regulation of heme oxygenase‐1 (HO‐1) and altered cholesterol (CH) metabolism are characteristic of Alzheimer‐diseased neural tissues. (semanticscholar.org)
  • Induction of heme oxygenase-1 (HO-1) protected astrocytes from Aβ(1-42) toxicity, and this protective effect was mimicked by application of the carbon monoxide (CO) releasing molecule CORM-2, suggesting HO-1 protection was attributable to its formation of CO. CO suppressed the rise of NADPH oxidase-derived ROS caused by Aβ(1-42). (reading.ac.uk)
  • Ryter, SW & Tyrrell, RM 2000, ' The Heme synthesis and degradation pathways: role in oxidant sensitivity - Heme oxygenase has both pro- and antioxidant properties ', Free Radical Biology and Medicine , vol. 28, no. 2, pp. 289-309. (bath.ac.uk)
  • Translational Significance of Heme Oxygenase in Obesity and Metabolic " by Nader G. Abraham, Joshua Junge et al. (marshall.edu)
  • This review reflects the dramatic increase in research on the role of increased expression of heme oxygenase (HO)-1/HO-2, biliverdin reductase, and HO activity on vascular disease. (marshall.edu)
  • Cumulative Effect of Mesenchymal Stem Cells and Heme Oxygenase-1 Inducer in Ameliorating Induced Liver Toxicity in Rats. (cu.edu.eg)
  • Aziz, A. M. T. A., H. M. E. Zahed, S. H. Ahmed, B. E. A. Khaled, and E. H. Nadwa, 'Cumulative Effect of Mesenchymal Stem Cells and Heme Oxygenase-1 Inducer in Ameliorating Induced Liver Toxicity in Rats. (cu.edu.eg)
  • Nutritional antioxidants, are able to activate vitagenes, such as heme oxygenase, Hsp70, thioredoxin reductase and sirtuins which represent an integrated system for cellular stress tolerance. (springer.com)
  • HO-1 and its mammalian isoform HO-2 are representatives of the heme oxygenase (HO) family of enzymes, also known as HSP32 family. (hemeoxygenase.com)
  • Heme oxygenase 1 (HO-1) is an ubiquitiously expressed stress response molecule and a member of the huge heat shock protein (HSP) superfamily. (hemeoxygenase.com)
  • IMSEAR at SEARO: Immunolocalization of heme oxygenase-1 in periodontal diseases. (who.int)
  • Gayathri G, Muthukumar S, Joseph Leena Dennis, Suresh R. Immunolocalization of heme oxygenase-1 in periodontal diseases. (who.int)
  • One such system is heme oxygenase enzymes. (who.int)
  • Heme oxygenase is the key enzyme involved in catabolism of heme. (who.int)
  • Since chronic periodontitis is one such inflammatory condition, we assessed the expression of heme oxygenase-1, in smokers and periodontitis group using immunohistochemistry technique. (who.int)
  • Aims: The aim of this study is to compare the expression of heme oxygenase-1 in patients with healthy periodontium, periodontitis and smokers. (who.int)
  • Results: Our results showed increased expression of heme oxygenase-1 in the gingival tissue samples taken from smokers compared with periodontitis and healthy tissue. (who.int)
  • Conclusion: The results of our study is an increasing evidence of involvement of antioxidant enzymes like heme oxygenase-1 in periodontal inflammation and their implication for treatment of chronic periodontitis. (who.int)
  • A DNA sequence encoding the Mus musculus (Mouse) Heme oxygenase 1, was expressed in the hosts and tags indicated. (enquirebio.com)
  • Heme oxygenase, bilirubin and vascular dysfunction. (ru.nl)
  • Identification of the proximal ligand His-20 in heme oxygenase (Hmu O) from Corynebacterium diphtheriae. (elsevier.com)
  • The coordination and spin-state of the Corynebacterium diphtheriae heme oxygenase (Hmu O) and the proximal Hmu O H20A mutant have been characterized by UV-visible and resonance Raman (RR) spectrophotometry. (elsevier.com)
  • The present data show that, in marked contrast to the human HO-1, the proximal ligand is not essential for the initial α-meso-hydroxylation of heme in the C. diphtheriae heme oxygenase-catalyzed reaction. (elsevier.com)
  • Induction of the antioxidant enzyme heme oxygenase-1 (HO-1) affords cellular protection and suppresses proliferation of vascular smooth muscle cells (VSMCs) associated with a variety of pathological cardiovascular conditions including myocardial infarction and vascular injury. (brad.ac.uk)
  • Duckles H, Boycott HE, Al-Owais MM et al (2015) Heme oxygenase-1 regulates cell proliferation via carbon monoxide-mediated inhibition of T-type Ca2+ channels. (brad.ac.uk)
  • We examined the effects of upregulation of heme oxygenase-1 (HO-1) in steatotic rat liver models of ex vivo cold ischemia/reperfusion (I/R) injury. (houstonmethodist.org)
  • Roles of reactive oxygen species and heme oxygenase-1 in modulation of alveolar macrophage-mediated pulmonary immune responses to listeria monocytogenes by diesel exhaust particles. (cdc.gov)
  • In this study, effects of DEP-derived reactive oxygen species (ROS) and heme oxygenase (HO)-1 on AM-mediated immune responses to L. monocytogenes were investigated. (cdc.gov)
  • In the first oxidation step, biliverdin is formed from heme through the action of heme oxygenase, the rate-limiting step in the process, releasing iron and carbon monoxide. (medscape.com)
  • The stress protein heme oxygenase is especially susceptible to induction by metals. (cdc.gov)
  • Drummond and Kappas demonstrated that PAT as well as other antimony -containing compounds were potent inducers of heme oxygenase in the liver and kidney of rats, but the effects of PAT on the heart were not examined. (cdc.gov)
  • In the present study, sublethal concentrations of PAT were examined in neonatal rat cardiac myocytes for PAT-induced changes in cellular glutathione levels, heme oxygenase and stress protein expression. (cdc.gov)
  • Our results indicate that an 18 hr exposure to low concentrations of PAT (5-25 uM) increases cellular glutathione levels, heat shock protein 70 and heme oxygenase activity in cardiac myocytes in a concentration-dependent manner. (cdc.gov)
  • CO generated by heme oxygenase-2 (HO-2) induces a signaling pathway that inhibits hydrogen sulfide (H 2 S) production by cystathionine γ-lyase (CSE), leading to suppression of carotid body activity. (elsevier.com)
  • In the acute kidney injury, the mechanisms of defense act as "protector genes", as the protein heat shock 32 (HSP 32), also known as heme oxygenase-1 (HO-1). (bvsalud.org)
  • Hydrogen peroxide induces heme oxygenase-1 and dentin sialophosphoprotein mRNA in human pulp cells. (bvsalud.org)
  • Heme oxygenase-1 promoter polymorphisms and risk of spina bifida. (cdc.gov)
Mono-oxygenase4
  • T) in exon 7 of flavincontaining mono-oxygenase 3 (FMO3) gene. (ajol.info)
  • It is worth mentioning that in a most recent study an HO-like enzyme, termed Lfo-1, was identified in the unicellular green alga Chlamydomonas reinhardtii bearing an antibiotic biosynthesis mono-oxygenase (ABM) domain typically found amongst IsdG subfamily members 11 . (hemeoxygenase.com)
  • Suicidal inactivation and labelling of ammonia mono-oxygenase by acetylene. (ncsu.edu)
  • Missense mutation in flavin-containing mono-oxygenase 3 gene, FMO3, underlies fish-odour syndrome. (medlineplus.gov)
Cyclo-oxygenase7
  • The cyclo-oxygenase 2 (COX-2) inhibitors are a new form of non-steroidal anti-inflammatory drugs (NSAIDs) that are considered to produce fewer gastro-intestinal side effects than the older non-selective drugs. (londonpainclinic.com)
  • Their mechanism of action is not known, but they may inhibit cyclo-oxygenase (COX) activity and prostaglandin synthesis. (medscape.com)
  • Differences in the detection of cyclo-oxygenase 1 and 2 proteins in symptomatic and asymptomatic carotid plaques. (bvsalud.org)
  • The expression of cyclo-oxygenase (COX) 1 and 2 has been demonstrated in atherosclerotic arteries . (bvsalud.org)
  • It is a non-selective inhibitor of cyclo-oxygenase (COX), inhibiting both COX-1 and COX-2. (buycbdoilarizona.com)
  • Intafenac K is an immediate release tablet of Diclofenac Potassium that works by blocking the action of a substance in the body called cyclo-oxygenase. (inceptapharma.com)
  • Cyclo-oxygenase is involved in the production of various chemicals in the body, some of which are known as prostaglandins. (inceptapharma.com)
Protein3
  • The finding that oxygenase-catalyzed protein hydroxylation regulates animal transcription raises questions as to whether the translation machinery and prokaryotic proteins are analogously modified. (ox.ac.uk)
  • Escherichia coli ycfD is a growth-regulating 2-oxoglutarate oxygenase catalyzing arginyl hydroxylation of the ribosomal protein Rpl16. (ox.ac.uk)
  • Once Ca 2+ ions are bound to the three Ca 2+ -binding sites in aequorin, the protein is converted into an oxygenase. (biomedcentral.com)
Cytochrome1
  • The genome sequence of Mycobacterium tuberculosis has revealed the presence of 20 different cytochrome P450 mono-oxygenases (P450s) within this organism, and subsequent genome sequences of other mycobacteria and of Streptomyces coelicolor have indicated that these actinomycetes also have large complements of P450s, pointing to important physiological roles for these enzymes. (hud.ac.uk)
Biliverdin1
  • He oxygenase cleaves the he ring at the alpha methene bridge to form biliverdin. (enquirebio.com)
Biodegradation2
  • Besides, oxygenases are involved in biodegradation of hydrocarbons and related compounds that, due to their improper storage, use, and disposal have been released into the environment, where they are considered environmental pollutants. (scielo.org.mx)
  • The data from this study suggest that stable isotopes could serve as a diagnostic for detecting aerobic biodegradation of TCE by toluene oxygenases at contaminated sites. (nau.edu)
Inhibition1
  • This work reveals new therapeutic possibilities via oxygenase inhibition and by targeting modified over unmodified ribosomes. (ox.ac.uk)
Carbon1
  • In humans, Fe(ii)- and 2-oxoglutarate-dependent (Fe/2OG) oxygenases are generally of the dioxygenase subclass and mediate hydroxylation of unactivated aliphatic carbon centres. (elsevier.com)
Substrate1
  • The oxygenase catalyses the oxidation of the substrate coelenterazine by the bound oxygen and this results in blue light emission. (biomedcentral.com)
Descriptor1
  • Mixed Function Oxygenases" is a descriptor in the National Library of Medicine's controlled vocabulary thesaurus, MeSH (Medical Subject Headings) . (ouhsc.edu)
Folds1
  • Oxygenase produced under SmF has lower activities, at least 7 folds, compared to SSF. (scielo.org.mx)
Hydroxylation1
  • Oxygenase-catalyzed ribosome hydroxylation occurs in prokaryotes and humans. (ox.ac.uk)
Cellular1
  • The heme oxygenases (HOs) provide this function and participate in cellular defense. (bath.ac.uk)
Regulation1
  • This review aimed to summarise current pieces of knowledge of haem oxygenase location, function and regulation in the placenta, either in healthy pregnancies or those associated with miscarriages and foetal loss, pre-eclampsia, foetal growth restriction and diabetes mellitus. (fhu-prema.org)
Glucose1
  • This study deals with the comparison of the oxygenases, produced by Aspergillus niger, ATCC 9642, under submerged fermentation (SmF) and SSF using hexadecane as inducer, in the presence and absence of glucose. (scielo.org.mx)
Substance1
Physiology1
  • Haem oxygenases play a pivotal role in placental physiology and pathology. (fhu-prema.org)
Metabolism1
  • Oxygenases are a group of intracellular enzymes with significant roles in metabolism and biosynthesis. (scielo.org.mx)
Activity1
  • Under physiological conditions, the activity of he oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. (enquirebio.com)
Expression2
  • British Library EThOS: The structure and expression of genes encoding the small subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase in Phaseolus vulgaris L. (bl.uk)
  • The structure and expression of genes encoding the small subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase in Phaseolus vulgaris L. (bl.uk)
Function3
  • This graph shows the total number of publications written about "Mixed Function Oxygenases" by people in this website by year, and whether "Mixed Function Oxygenases" was a major or minor topic of these publications. (ouhsc.edu)
  • Below are the most recent publications written about "Mixed Function Oxygenases" by people in Profiles. (ouhsc.edu)
  • Haem oxygenases, particularly HO-1, have garnered specific interest in the field of physiological and pathological placental function. (fhu-prema.org)
Knowledge1
  • McLaren is that view 2 oxoglutarate dependent oxygenases 2015 knowledge is a supervisory availability which membrane provisions is( McLaren, 2001). (schusters-rappenschinder.de)
Group1
  • Haem oxygenases (HO) catabolise haem, which is the prosthetic group of numerous haemoproteins. (fhu-prema.org)
Cyclo-Oxygenase-2 Inhibitors1
  • Refractory adult onset Still's disease and hypersensitivity to non-steroidal anti-inflammatory drugs and cyclo-oxygenase-2 inhibitors: are biological agents the solution? (bmj.com)
Nitric oxide sy3
  • Maestrelli P., Paska C., Saetta M., Turato G., Nowicki Y., Monti S., Formichi B., Miniati M., Fabbri L.M.. Decreased haem oxygenase-1 and increased inducible nitric oxide synthase in the lung of severe COPD patients. (ers-education.org)
  • After 4 or 18 h recovery from a 2 h nose-only exposure to DEE (1.9 mg/m 3 ), the mRNA expressions of heme oxygenase-1 (HO-1), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and cytochrome P450 1A1 (CYP1A1) were investigated in lung as well as in pituitary gland, hypothalamus, olfactory bulb, olfactory tubercles, cerebral cortex, and cerebellum. (springer.com)
  • N‐monomethyl‐l‐arginine and N‐amino‐L‐arginine, inhibitors of nitric oxide synthase, did not alter photovasorelaxation nor did indomethacin, an inhibitor of cyclooxygenase, and zinc protoporphyrin, an inhibitor of heme oxygenase. (elsevier.com)
HMOX11
  • Two isoforms of heme oxygenase have been extensively characterized: an inducible enzyme (heme oxygenase-1 [HO-1, Hmox1]) and a constitutive isoform (HO-2, Hmox2) ( 1 ). (asnjournals.org)
Signaling protein1
  • Beyond established roles in collagen biosynthesis, hypoxic signaling and fatty acid metabolism, recent reports have now revealed roles for human 2-oxoglutarate-dependent oxygenases in histone and nucleic acid demethylation and in signaling protein hydroxylation. (nih.gov)
Carboxylase4
  • Serine 363 of an Hydrophobic Region involving Archaeal Ribulose One particular,5-Bisphosphate Carboxylase/Oxygenase via Archaeoglobus fulgidus and Thermococcus kodakaraensis Impacts CO2/O2 Substrate Nature and O2 Level of responsiveness. (mirnainhibitors.com)
  • Microbial ribulose 1,5-bisphosphate carboxylase/oxygenase: a different perspective. (harvard.edu)
  • Description and applications of a rapid and sensitive non-radioactive microplate-based assay for maximum and initial activity of D-ribulose-1,5-bisphosphate carboxylase/oxygenase. (mpg.de)
  • Ribulose-1, 5-bisphosphate carboxylase/oxygenase (Rubisco) degradation is a complex process involving a multitude of proteolytic pathways, and its mechanism is still unclear now. (academicjournals.org)
Reductase8
  • Mammals incorporate a major proportion of absorbed iron as heme, which is catabolized by the heme oxygenase 1 (HO1)-NADPH-cytochrome P450 reductase (CPR) complex into biliverdin, carbon monoxide, and ferrous iron. (nih.gov)
  • Heme oxygenase-1 and biliverdin reductase are two of the key enzymes of the hemoglobin degradation cascade. (muni.cz)
  • Therefore, the aim of present study was to investigate changes in protein levels of heme oxygenase-1 and biliverdin reductase in the rat choroid plexus after experimental subarachnoid hemorrhage induced by injection of non-heparinized autologous blood to the cisterna magna. (muni.cz)
  • Immunohistochemical and Western blot analyses were used to monitor changes in the of heme oxygenase-1 and biliverdin reductase levels in the rat choroid plexus after induction of subarachnoid hemorrhage or artificial cerebrospinal fluid application for 1, 3, and 7 days. (muni.cz)
  • We found increased levels of heme oxygenase-1 and biliverdin reductase protein in the choroid plexus over the entire period following subarachnoid hemorrhage induction. (muni.cz)
  • Our results suggest that heme oxygenase-1 and biliverdin reductase are involved not only in hemoglobin degradation but probably also in protecting choroid plexus epithelial cells and the blood-cerebrospinal fluid barrier from the negative effects of subarachnoid hemorrhage. (muni.cz)
  • The mocF gene encodes a ferredoxin reductase that would complete the oxygenase system, but is not essential for rhizopine catabolism. (apsnet.org)
  • In this study, using bioinformatics approaches, we first identified a two-component Rieske-type oxygenase/reductase (CntAB) and associated gene cluster proposed to be involved in carnitine metabolism in representative genomes of the human microbiota. (warwick.ac.uk)
Catalyzed by heme oxygenase1
  • Since 1968, when Tenhunen, Marver, and Schmid ( 2 , 3 ) first described the rate-limiting enzymatic reaction catalyzed by heme oxygenase, interest in this field has extended beyond just the heme-degrading function of this enzyme. (asnjournals.org)
Inhibitors2
  • Hypersensitivity to NSAIDs, often characterised by urticaria, angio-oedema, and asthma, has been well documented, and several studies indicate that anaphylactic reactions are related to the inhibition of cyclo-oxygenase-1 (COX-1) enzyme 4- 6 and that selective COX-2 inhibitors can be safe in these patients. (bmj.com)
  • A Betti reaction was used for efficient generation of 2OG oxygenase inhibitors, including for KDM4 demethylases. (ox.ac.uk)
Polymorphism4
  • Microsatellite polymorphism in the heme oxygenase-1 promoter is associated with nonsevere and late-onset preeclampsia. (scilifelab.se)
  • The microsatellite polymorphism of heme oxygenase (HO)-1 gene promoter has been shown to be associated with the susceptibility to ischemic event, including coronary artery disease (CAD), myocardial infarction, and peripheral vascular disease. (biomedcentral.com)
  • Cd) on high blood pressure development, (ii) the association between genetic polymorphism of heme oxygenase-1 (HO-1) and high blood pressure development, and cadmium-induced renal injury in exposed Thai population. (tci-thaijo.org)
  • Heme oxygenase-1 repeat polymorphism in septic acute kidney injury. (cdc.gov)
Gene3
  • MybiosourceProduct Short Name: [HO1 (Heme Oxygenase 1)]Product Name Synonyme: N/AOther Names: N/AProduct Gene Name: [HO1]Product Gene Name. (biocheminfo.org)
  • We hypothesized that the protective effects of galantamine would involve induction of the protective gene, heme oxygenase-1 (HO-1), in addition to enhancement of the cholinergic system. (elsevier.com)
  • Missense mutation in flavin-containing mono-oxygenase 3 gene, FMO3, underlies fish-odour syndrome. (nih.gov)
Induction5
  • This study aimed to examine whether induction of heme oxygenase-1 limits endothelial cell-leukocyte interactions in vivo. (elsevier.com)
  • Heme oxygenase (HO) program is one of the key regulators of cellular redox homeostasis which responds to oxidative stress (ROS) via HO-1 induction. (lcl-161.com)
  • Vila, L. / Selective induction of cyclo-oxygenase-2 activity in the permanent human endothelial cell line HUV-EC-C: biochemical and pharmacological characterization . (uab.cat)
  • The cytoprotective attributes of heme oxygenase activity were recognized as a consequence of its robust induction as an adaptive response in cells/tissues exposed to a wide variety of injurious stimuli. (asnjournals.org)
  • The stress protein heme oxygenase is especially susceptible to induction by metals. (cdc.gov)
Degradation4
  • The level of heme oxygenase-1 was the highest early (1 and 3 days) after subarachnoid hemorrhage indicating its importance in hemoglobin degradation. (muni.cz)
  • Heme oxygenase 1 (HO-1) is the inducible enzyme which catalyzes the rate-limiting reaction of heme degradation yielding carbon monoxide (CO), divalent iron (Fe2+), and biliverdin. (uni-goettingen.de)
  • Heme oxygenase (HO) is the only enzyme in mammals known to catalyse the physiological degradation of unwanted heme into biliverdin, Fe ion and CO. The process involves introduction of the hydroxyl group at one of its meso -positions as the first fundamental step of the heme cleavage process. (ias.ac.in)
  • Heme oxygenase-1 (HO-1) is a microsomal enzyme involved in the degradation of heme, resulting in the generation of biliverdin, iron, and carbon monoxide. (asnjournals.org)
Nonheme iron1
  • Rieske nonheme iron oxygenases (ROs) are a well studied class of enzymes. (iucr.org)
Macrophages1
  • Dysregulated heme oxygenase-1(low) M2-like macrophages augment lupus nephritis via Bach1 induced by type I interferons. (nih.gov)
Enzyme7
  • Heme oxygenase (HO) is a cytoprotective enzyme that degrades heme (a potent oxidant) to generate carbon monoxide (a vasodilatory gas that has anti-inflammatory properties), bilirubin (an antioxidant derived from biliverdin), and iron (sequestered by ferritin). (eurekaselect.com)
  • Heme oxygenase-1 (HO-1) is the rate-limiting enzyme by which heme is catabolized to biliverdin and thence to bilirubin, with the simultaneous release of equimolar quantities of ferrous iron (Fe 3+ ) and carbon monoxide. (nih.gov)
  • Heme oxygenase-1 (HO-1) is a stress response enzyme that may protect the maternal endothelium and facilitate adequate metabolic adaptation to pregnancy by its antioxidant and anti-inflammatory functions. (scilifelab.se)
  • Cellular heme derived from ubiquitously disposed heme proteins such as cytochromes, peroxidases, respiratory burst oxidases, pyrrolases, catalase, nitric oxide synthases, hemoglobin, and myoglobin is degraded by the heme oxygenase enzyme system ( 1 ). (asnjournals.org)
  • The heme oxygenase enzyme opens the heme ring, resulting in the liberation of equimolar quantities of biliverdin, iron, and carbon monoxide (CO), as shown in Figure 1 . (asnjournals.org)
  • They are multicomponent enzyme systems of two or three protein components consisting of electron-transport chains and an oxygenase. (iucr.org)
  • RPE65 is a carotenoid oxygenase that has specifically evolved into an enzyme that is capable of hydrolyzing and isomerizing all-trans retinyl ester into 11-cis retinol but that is specialized to the extreme. (nih.gov)
Prostaglandin3
  • Their mechanism of action is not known, but they may inhibit cyclo-oxygenase (COX) activity and prostaglandin synthesis. (medscape.com)
  • Cyclo-oxygenase produces prostaglandin, which can cause swelling or pain. (reference.com)
  • Pharmacodynamics: Aspirin affects platelet aggregation by irreversibly inhibiting prostaglandin cyclo-oxygenase. (theodora.com)
Enzymes2
  • The transcription of genes encoding heme oxygenase and the glutathione-related enzymes, GST-Pi and glutathione peroxidase, increases in CHO parental cells after transient oxidative stress. (bl.uk)
  • It will certainly be meaningful elements for understanding the effect of the residue corresponding to 283 in other Rieske oxygenase enzymes.ImportanceThe segment 280-283 in BphAEs is located at the entrance of the catalytic pocket and it shows variation conformation. (inrs.ca)
MRNA2
  • Muscle samples were obtained before and after the clamp and analyzed for heat shock protein (HSP)72 and heme oxygenase (HO)-1 mRNA, intramuscular triglyceride content, and the maximal activities of β-hyroxyacyl-CoA dehydrogenase (β-HAD) and citrate synthase (CS). (diabetesjournals.org)
  • Hydrogen peroxide induces heme oxygenase-1 and dentin sialophosphoprotein mRNA in human pulp cells. (bvsalud.org)
Dependent4
  • We propose a rhizopine catabolic model whereby MocB transports rhizopine into the cell and MocDE and MocF (or a similar protein elsewhere in the genome), under the regulation of MocR, act in concert to form a ferredoxin oxygenase system that demethylates 3- O -M S I to form scyllo -inosamine ( S I). MocA, an NAD(H)-dependent dehydrogenase, and MocC continue the catabolic process. (apsnet.org)
  • Mechanism and Catalytic Diversity of Rieske Non-Heme Iron-Dependent Oxygenases. (cipps.org.au)
  • Yin, X & Zabriskie, TM 2004, ' VioC is a non-heme iron, α-ketoglutarate-dependent oxygenase that catalyzes the formation of 3S-hydroxy-L-arginine during viomycin biosynthesis ', ChemBioChem , vol. 5, no. 9, pp. 1274-1277. (elsevier.com)
  • Our results indicate that an 18 hr exposure to low concentrations of PAT (5-25 uM) increases cellular glutathione levels, heat shock protein 70 and heme oxygenase activity in cardiac myocytes in a concentration-dependent manner. (cdc.gov)
Catalyzes2
  • Publisher Correction: The Jumonji-C oxygenase JMJD7 catalyzes (3S)-lysyl hydroxylation of TRAFAC GTPases. (ox.ac.uk)
  • Biphenyl dioxygenase (BPDO), which is a Rieske-type oxygenase (RO) catalyzes the initial dioxygenation of biphenyl and some polychlorinated biphenyls (PCBs). (inrs.ca)
Genes2
  • The aim of this study was to produce cell lines with stable overexpression of reporter genes and heme oxygenase-1 to evaluate HO-1 role in wound healing and carcinogenesis. (adamed.com)
  • They extracted four components from honey, 3 of which cause increased activation of a family of genes, called cytochrome p450 oxygenases, that are responsible for detoxifying pesticides and metabolising other plant chemicals in the bee diet including honey flavonoids. (thenakedscientists.com)
Endothelial1
  • SIGNIFICANCE: Heme oxygenase (HO) plays a pivotal role in both vascular and metabolic function and is involved in many physiological and pathophysiological processes in vascular endothelial cells and adipocytes. (touro.edu)
Proteins2
  • The electron-transport proteins transfer two electrons from NAD(P)H to the catalytic site of the oxygenase. (iucr.org)
  • Heme-oxygenase-1 (HO-1) and heat shock proteins (HSP) aid in cellular protection against cellular insults. (academicjournals.org)
Rieske1
  • MocD and MocE contain motifs corresponding to a TOL-like oxygenase and a [2Fe-2S] Rieske-like ferredoxin, respectively. (apsnet.org)
Species1
  • Kamachi, T, Shestakov, AF & Yoshizawa, K 2004, ' How Heme Metabolism Occurs in Heme Oxygenase: Computational Study of Oxygen-Donation Ability of the Oxo and Hydroperoxo Species ', Journal of the American Chemical Society , vol. 126, no. 12, pp. 3672-3673. (elsevier.com)
Cadmium1
  • The effects of cadmium on heme oxygenase-1 in HCT116 human colon epithelial cells with or wi. (uncg.edu)
Catalytic2
  • These high activation barriers lead us to reconsider the catalytic mechanism of heme oxygenase. (elsevier.com)
  • The catalytic domain of the terminal oxygenase is the well described 2-His/carboxylate center composed of a mononuclear iron coordinated by two histidines and one aspartic acid inside a large hydrophobic active site. (iucr.org)
Inhibitor4
  • Methotrexate was later used in addition to cortisone and then in combination with a selective cyclo-oxygenase-2 inhibitor. (medscape.com)
  • A combination therapy consisting of adalimumab (40 mg every 2 weeks), methotrexate (15 mg weekly) and a cyclo-oxygenase-2 inhibitor (rofecoxib 25 mg daily until July 2004, etoricoxib 90 mg daily from October 2004) was started in November 2003. (medscape.com)
  • 8 mg daily) from 1996 to 1998 and then in combination with a selective cyclo-oxygenase-2 (COX2) inhibitor (rofecoxib 25 mg daily), which helped to relieve pain. (medscape.com)
  • To learn more about our development product stannsoporfin, a heme oxygenase inhibitor, visit our pipeline page. (mallinckrodt.com)
Cells3
  • Heme oxygenase-1 (HO-1) is a major stress-inducible protein in mammalian cells. (hindawi.com)
  • Increased levels of heme oxygenase-1 were also observed in the choroid plexus epithelial cells at all time points after application of artificial cerebrospinal fluid. (muni.cz)
  • Heme oxygenase-1 mitigates ferroptosis in renal proximal tubule cells. (sigmaaldrich.com)
Inflammation1
  • Cyclo-oxygenase is involved in the production of prostaglandins (chemicals in the body) which cause pain, swelling and inflammation. (prpharmasource.in)
Biphenyl1
  • Purification and characterization of the oxygenase component of biphenyl 2,3-dioxygenase from Pseudomonas sp. (kegg.jp)
Equimolar1
  • A single infusion of haptoglobin or hemopexin (± equimolar hemoglobin) in SS-mice increased heme oxygenase-1 (HO-1) in the liver, kidney and skin several fold within 1 hour and decreased nuclear NF-ĸB phospho-p65, and vaso-occlusion for 48 hours after infusion. (elsevier.com)
Pseudomonas1
  • DL-7-Azatryptophan is a racemic mixture of D- and L-7-azatryptophan which together with L-tryptophan is a synergistic inducer of tryptophan oxygenase of Pseudomonas acidovorans. (discofinechem.com)
Upregulation1
  • Heme Oxygenase-1 Upregulation: A Novel Approach in the Treatment of Ca" by Lars Bellner, Nachum B. Lebovics et al. (touro.edu)
Promoter2
  • Heme oxygenase-1 promoter polymorphisms: do they modulate neonatal hyperbilirubinemia? (nih.gov)
  • The Role of Heme Oxygenase-1 Promoter Polymorphisms in Perinatal Disease. (nih.gov)
Dioxygenases | Semantic Scholar
Dioxygenases | Semantic Scholar (semanticscholar.org)
Dioxygenases | Harvard Catalyst Profiles | Harvard Catalyst
Dioxygenases | Harvard Catalyst Profiles | Harvard Catalyst (connects.catalyst.harvard.edu)
METHYL ISOBUTYL KETONE - Some Chemicals Present in Industrial and Consumer Products, Food and Drinking-Water - NCBI Bookshelf
METHYL ISOBUTYL KETONE - Some Chemicals Present in Industrial and Consumer Products, Food and Drinking-Water - NCBI Bookshelf (ncbi.nlm.nih.gov)
Synthetic biology 2020-2030: six commercially-available products that are changing our world | Nature Communications
Synthetic biology 2020-2030: six commercially-available products that are changing our world | Nature Communications (nature.com)
Mechanisms of 2-oxoglutarate-dependent oxygenases: The hydroxylation paradigm and beyond<...
Mechanisms of 2-oxoglutarate-dependent oxygenases: The hydroxylation paradigm and beyond<... (pennstate.pure.elsevier.com)
Paracetamol and cyclooxygenase inhibition: is there a cause for concern? | Annals of the Rheumatic Diseases
Paracetamol and cyclooxygenase inhibition: is there a cause for concern? | Annals of the Rheumatic Diseases (ard.bmj.com)
WHO EMRO | Evaluation of specific biochemical indicators of Helicobacter pylori-associated gastric cancer in Egypt | Volume 18,...
WHO EMRO | Evaluation of specific biochemical indicators of Helicobacter pylori-associated gastric cancer in Egypt | Volume 18,... (emro.who.int)
Find Research outputs - The University of Brighton
Find Research outputs - The University of Brighton (research.brighton.ac.uk)
Larry Que - Research output - Experts@Minnesota
Larry Que - Research output - [email protected] (experts.umn.edu)
Chromatin and oxygen sensing in the context of JmjC histone demethylases | Biochemical Journal | Portland Press
Chromatin and oxygen sensing in the context of JmjC histone demethylases | Biochemical Journal | Portland Press (portlandpress.com)
Ligand view of electron donor (992 - ) - BRENDA Enzyme Database
Ligand view of electron donor (992 - ) - BRENDA Enzyme Database (brenda-enzymes.org)
MeSH Browser
MeSH Browser (meshb.nlm.nih.gov)
Diane F Jelinek - Research output - Mayo Clinic
Diane F Jelinek - Research output - Mayo Clinic (mayoclinic.pure.elsevier.com)
BMC Research Notes | Articles
BMC Research Notes | Articles (bmcresnotes.biomedcentral.com)
The Heme synthesis and degradation pathways: role in oxidant sensitivity - Heme oxygenase has both pro- and antioxidant...
The Heme synthesis and degradation pathways: role in oxidant sensitivity - Heme oxygenase has both pro- and antioxidant... (researchportal.bath.ac.uk)
Biologics in Pregnancy: Are They Safe? | MedPage Today
Biologics in Pregnancy: Are They Safe? | MedPage Today (medpagetoday.com)
ANSES warns of turmeric supplement effect on immune response
ANSES warns of turmeric supplement effect on immune response (nutraingredients.com)
Azole antifungals are potent inhibitors of cytochrome P450 mono-oxygenases and bacterial growth in mycobacteria and...
Azole antifungals are potent inhibitors of cytochrome P450 mono-oxygenases and bacterial growth in mycobacteria and... (pure.hud.ac.uk)
A screening approach for assessing lytic polysaccharide monooxygenase activity in fungal strains | Biotechnology for Biofuels...
A screening approach for assessing lytic polysaccharide monooxygenase activity in fungal strains | Biotechnology for Biofuels... (biotechnologyforbiofuels.biomedcentral.com)
University of North Carolina-Chapel Hill (Superfund Research Program)
University of North Carolina-Chapel Hill (Superfund Research Program) (tools.niehs.nih.gov)
Antibodies for Epigenetics
Antibodies for Epigenetics (activemotif.com)
Preliminary array analysis reveals novel genes regulated by ovarian steroids in the monkey raphe region - Fingerprint -...
Preliminary array analysis reveals novel genes regulated by ovarian steroids in the monkey raphe region - Fingerprint -... (ohsu.pure.elsevier.com)
Andria Costello Staniec - Fingerprint - Experts@Syracuse
Andria Costello Staniec - Fingerprint - Exp[email protected] (experts.syr.edu)
The International System Classification of Enzymes and Enzyme Naming System - Articles Factory
The International System Classification of Enzymes and Enzyme Naming System - Articles Factory (articlesfactory.com)
In Vivo Potential Anti-Inflammatory Activity of Melissa officinalis L. Essential Oil
In Vivo Potential Anti-Inflammatory Activity of Melissa officinalis L. Essential Oil (hindawi.com)