Oxidases that specifically introduce DIOXYGEN-derived oxygen atoms into a variety of organic molecules.
Widely distributed enzymes that carry out oxidation-reduction reactions in which one atom of the oxygen molecule is incorporated into the organic substrate; the other oxygen atom is reduced and combined with hydrogen ions to form water. They are also known as monooxygenases or hydroxylases. These reactions require two substrates as reductants for each of the two oxygen atoms. There are different classes of monooxygenases depending on the type of hydrogen-providing cosubstrate (COENZYMES) required in the mixed-function oxidation.
A mixed function oxidase enzyme which during hemoglobin catabolism catalyzes the degradation of heme to ferrous iron, carbon monoxide and biliverdin in the presence of molecular oxygen and reduced NADPH. The enzyme is induced by metals, particularly cobalt. EC 1.14.99.3.
A family of compounds containing an oxo group with the general structure of 1,5-pentanedioic acid. (From Lehninger, Principles of Biochemistry, 1982, p442)
Non-heme iron-containing enzymes that incorporate two atoms of OXYGEN into the substrate. They are important in biosynthesis of FLAVONOIDS; GIBBERELLINS; and HYOSCYAMINE; and for degradation of AROMATIC HYDROCARBONS.
1,3,6,7-Tetramethyl-4,5-dicarboxyethyl-2,8-divinylbilenone. Biosynthesized from hemoglobin as a precursor of bilirubin. Occurs in the bile of AMPHIBIANS and of birds, but not in normal human bile or serum.
Proteins, usually acting in oxidation-reduction reactions, containing iron but no porphyrin groups. (Lehninger, Principles of Biochemistry, 1993, pG-10)
A genus in the family Trichocomaceae, order EUROTIALES. The anamorph is ASPERGILLUS.
The color-furnishing portion of hemoglobin. It is found free in tissues and as the prosthetic group in many hemeproteins.
A species of gram-positive, asporogenous bacteria in which three cultural types are recognized. These types (gravis, intermedius, and mitis) were originally given in accordance with the clinical severity of the cases from which the different strains were most frequently isolated. This species is the causative agent of DIPHTHERIA.
A monooxygenase that catalyzes the conversion of BETA-CAROTENE into two molecules of RETINAL. It was formerly characterized as EC 1.13.11.21 and EC 1.18.3.1.
Placing of a hydroxyl group on a compound in a position where one did not exist before. (Stedman, 26th ed)
A metallic element with atomic symbol Fe, atomic number 26, and atomic weight 55.85. It is an essential constituent of HEMOGLOBINS; CYTOCHROMES; and IRON-BINDING PROTEINS. It plays a role in cellular redox reactions and in the transport of OXYGEN.
Drug metabolizing enzymes which oxidize methyl ethers. Usually found in liver microsomes.
Carbon monoxide (CO). A poisonous colorless, odorless, tasteless gas. It combines with hemoglobin to form carboxyhemoglobin, which has no oxygen carrying capacity. The resultant oxygen deprivation causes headache, dizziness, decreased pulse and respiratory rates, unconsciousness, and death. (From Merck Index, 11th ed)
A bacterial genus of the order ACTINOMYCETALES.
A species of gram-negative, aerobic bacteria isolated from soil and water as well as clinical specimens. Occasionally it is an opportunistic pathogen.
A group of 1,2-benzenediols that contain the general formula R-C6H5O2.
Elimination of ENVIRONMENTAL POLLUTANTS; PESTICIDES and other waste using living organisms, usually involving intervention of environmental or sanitation engineers.
A mixed-function oxygenase that catalyzes the hydroxylation of a prolyl-glycyl containing peptide, usually in PROTOCOLLAGEN, to a hydroxyprolylglycyl-containing-peptide. The enzyme utilizes molecular OXYGEN with a concomitant oxidative decarboxylation of 2-oxoglutarate to SUCCINATE. The enzyme occurs as a tetramer of two alpha and two beta subunits. The beta subunit of procollagen-proline dioxygenase is identical to the enzyme PROTEIN DISULFIDE-ISOMERASES.
A ubiquitous stress-responsive enzyme that catalyzes the oxidative cleavage of HEME to yield IRON; CARBON MONOXIDE; and BILIVERDIN.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Derivatives of BENZOIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain the carboxybenzene structure.
A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in nature. Some species are pathogenic for humans, animals, and plants.
The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.
An element with atomic symbol O, atomic number 8, and atomic weight [15.99903; 15.99977]. It is the most abundant element on earth and essential for respiration.
The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Proteins found in any species of bacterium.
Chloro(7,12-diethenyl-3,8,13,17-tetramethyl-21H,23H-porphine-2,18-dipropanoato(4-)-N(21),N(22),N(23),N(24)) ferrate(2-) dihydrogen.
A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.
The location of the atoms, groups or ions relative to one another in a molecule, as well as the number, type and location of covalent bonds.
The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
The phenomenon whereby compounds whose molecules have the same number and kind of atoms and the same atomic arrangement, but differ in their spatial relationships. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 5th ed)
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.
The functional hereditary units of BACTERIA.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
A superfamily of hundreds of closely related HEMEPROTEINS found throughout the phylogenetic spectrum, from animals, plants, fungi, to bacteria. They include numerous complex monooxygenases (MIXED FUNCTION OXYGENASES). In animals, these P-450 enzymes serve two major functions: (1) biosynthesis of steroids, fatty acids, and bile acids; (2) metabolism of endogenous and a wide variety of exogenous substrates, such as toxins and drugs (BIOTRANSFORMATION). They are classified, according to their sequence similarities rather than functions, into CYP gene families (>40% homology) and subfamilies (>59% homology). For example, enzymes from the CYP1, CYP2, and CYP3 gene families are responsible for most drug metabolism.
The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
The relationships of groups of organisms as reflected by their genetic makeup.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
The rate dynamics in chemical or physical systems.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.

N-oxygenation of amphetamine and methamphetamine by the human flavin-containing monooxygenase (form 3): role in bioactivation and detoxication. (1/2226)

(+)- And (-)-amphetamine and methamphetamine were N-oxygenated by the cDNA expressed adult human flavin-containing monooxygenase form 3 (FMO3), their corresponding hydroxylamines. Two major polymorphic forms of human FMO3 were studied, and the results suggested preferential N-oxygenation by only one of the two enzymes. Chemically synthesized (+/-)-amphetamine hydroxylamine was also a substrate for the human FMO3 and it was converted to phenylpropanone oxime with a stereoselectivity ratio of trans/cis of 5:1. Human FMO3 also N-oxygenated methamphetamine to produce methamphetamine hydroxylamine. Methamphetamine hydroxylamine was also N-oxygenated by human FMO3, and the ultimate product observed was phenylpropanone. For amphetamine hydroxylamine, studies of the biochemical mechanism of product formation were consistent with the production of an N, N-dioxygenated intermediate that lead to phenylpropanone oxime. This was supported by the observation that alpha-deutero (+/-)-amphetamine hydroxylamine gave an inverse kinetic isotope effect on product formation in the presence of human FMO3. For methamphetamine, the data were consistent with a mechanism of human FMO3-mediated N,N-dioxygenation but the immediate product, a nitrone, rapidly hydrolyzed to phenylpropanone. The pharmacological activity of amphetamine hydroxylamine, phenylpropanone oxime, and methamphetamine hydroxylamine were examined for effects at the human dopamine, serotonin, and norepinephrine transporters. Amphetamine hydroxylamine and methamphetamine hydroxylamine were apparent substrates for the human biogenic amine transporters but phenylpropanone oxime was not. Presumably, phenylpropanone oxime or nitrone formation from amphetamine and methamphetamine, respectively, represents a detoxication process. Because of the potential toxic nature of amphetamine hydroxylamine and methamphetamine hydroxylamine metabolites and the polymorphic nature of N-oxygenation, human FMO3-mediated metabolism of amphetamine or methamphetamine may have clinical consequences.  (+info)

A novel reduced flavin mononucleotide-dependent methanesulfonate sulfonatase encoded by the sulfur-regulated msu operon of Pseudomonas aeruginosa. (2/2226)

When Pseudomonas aeruginosa is grown with organosulfur compounds as sulfur sources, it synthesizes a set of proteins whose synthesis is repressed in the presence of sulfate, cysteine, or thiocyanate (so-called sulfate starvation-induced proteins). The gene encoding one of these proteins, PA13, was isolated from a cosmid library of P. aeruginosa PAO1 and sequenced. It encoded a 381-amino-acid protein that was related to several reduced flavin mononucleotide (FMNH2)-dependent monooxygenases, and it was the second in an operon of three genes, which we have named msuEDC. The MsuD protein catalyzed the desulfonation of alkanesulfonates, requiring oxygen and FMNH2 for the reaction, and showed highest activity with methanesulfonate. MsuE was an NADH-dependent flavin mononucleotide (FMN) reductase, which provided reduced FMN for the MsuD enzyme. Expression of the msu operon was analyzed with a transcriptional msuD::xylE fusion and was found to be repressed in the presence of sulfate, sulfite, sulfide, or cysteine and derepressed during growth with methionine or alkanesulfonates. Growth with methanesulfonate required an intact cysB gene, and the msu operon is therefore part of the cys regulon, since sulfite utilization was found to be CysB independent in this species. Measurements of msuD::xylE expression in cysN and cysI genetic backgrounds showed that sulfate, sulfite, and sulfide or cysteine play independent roles in negatively regulating msu expression, and sulfonate utilization therefore appears to be tightly regulated.  (+info)

Purification and characterization of gentisate 1,2-dioxygenases from Pseudomonas alcaligenes NCIB 9867 and Pseudomonas putida NCIB 9869. (3/2226)

Two 3-hydroxybenzoate-inducible gentisate 1,2-dioxygenases were purified to homogeneity from Pseudomonas alcaligenes NCIB 9867 (P25X) and Pseudomonas putida NCIB 9869 (P35X), respectively. The estimated molecular mass of the purified P25X gentisate 1, 2-dioxygenase was 154 kDa, with a subunit mass of 39 kDa. Its structure is deduced to be a tetramer. The pI of this enzyme was established to be 4.8 to 5.0. The subunit mass of P35X gentisate 1, 2-dioxygenase was 41 kDa, and this enzyme was deduced to exist as a dimer, with a native molecular mass of about 82 kDa. The pI of P35X gentisate 1,2-dioxygenase was around 4.6 to 4.8. Both of the gentisate 1,2-dioxygenases exhibited typical saturation kinetics and had apparent Kms of 92 and 143 microM for gentisate, respectively. Broad substrate specificities were exhibited towards alkyl and halogenated gentisate analogs. Both enzymes had similar kinetic turnover characteristics for gentisate, with kcat/Km values of 44.08 x 10(4) s-1 M-1 for the P25X enzyme and 39.34 x 10(4) s-1 M-1 for the P35X enzyme. Higher kcat/Km values were expressed by both enzymes against the substituted gentisates. Significant differences were observed between the N-terminal sequences of the first 23 amino acid residues of the P25X and P35X gentisate 1,2-dioxygenases. The P25X gentisate 1,2-dioxygenase was stable between pH 5.0 and 7.5, with the optimal pH around 8.0. The P35X enzyme showed a pH stability range between 7.0 and 9.0, and the optimum pH was also 8.0. The optimal temperature for both P25X and P35X gentisate 1, 2-dioxygenases was around 50 degrees C, but the P35X enzyme was more heat stable than that from P25X. Both enzymes were strongly stimulated by 0.1 mM Fe2+ but were completely inhibited by the presence of 5 mM Cu2+. Partial inhibition of both enzymes was also observed with 5 mM Mn2+, Zn2+, and EDTA.  (+info)

High-affinity methane oxidation by a soil enrichment culture containing a type II methanotroph. (4/2226)

Methanotrophic bacteria in an organic soil were enriched on gaseous mixing ratios of <275 parts per million of volume (ppmv) of methane (CH4). After 4 years of growth and periodic dilution (>10(20) times the initial soil inoculum), a mixed culture was obtained which displayed an apparent half-saturation constant [Km(app)] for CH4 of 56 to 186 nM (40 to 132 ppmv). This value was the same as that measured in the soil itself and about 1 order of magnitude lower than reported values for pure cultures of methane oxidizers. However, the Km(app) increased when the culture was transferred to higher mixing ratios of CH4 (1,000 ppmv, or 1%). Denaturing gradient gel electrophoresis of the enrichment grown on <275 ppmv of CH4 revealed a single gene product of pmoA, which codes for a subunit of particulate methane monooxygenase. This suggested that only one methanotroph species was present. This organism was isolated from a sample of the enrichment culture grown on 1% CH4 and phylogenetically positioned based on its 16S rRNA, pmoA, and mxaF gene sequences as a type II strain of the Methylocystis/Methylosinus group. A coculture of this strain with a Variovorax sp., when grown on <275 ppmv of CH4, had a Km(app) (129 to 188 nM) similar to that of the initial enrichment culture. The data suggest that the affinity of methanotrophic bacteria for CH4 varies with growth conditions and that the oxidation of atmospheric CH4 observed in this soil is carried out by type II methanotrophic bacteria which are similar to characterized species.  (+info)

Contrasting effects of a nonionic surfactant on the biotransformation of polycyclic aromatic hydrocarbons to cis-dihydrodiols by soil bacteria. (5/2226)

The biotransformation of the polycyclic aromatic hydrocarbons (PAHs) naphthalene and phenanthrene was investigated by using two dioxygenase-expressing bacteria, Pseudomonas sp. strain 9816/11 and Sphingomonas yanoikuyae B8/36, under conditions which facilitate mass-transfer limited substrate oxidation. Both of these strains are mutants that accumulate cis-dihydrodiol metabolites under the reaction conditions used. The effects of the nonpolar solvent 2,2,4, 4,6,8,8-heptamethylnonane (HMN) and the nonionic surfactant Triton X-100 on the rate of accumulation of these metabolites were determined. HMN increased the rate of accumulation of metabolites for both microorganisms, with both substrates. The enhancement effect was most noticeable with phenanthrene, which has a lower aqueous solubility than naphthalene. Triton X-100 increased the rate of oxidation of the PAHs with strain 9816/11 with the effect being most noticeable when phenanthrene was used as a substrate. However, the surfactant inhibited the biotransformation of both naphthalene and phenanthrene with strain B8/36 under the same conditions. The observation that a nonionic surfactant could have such contrasting effects on PAH oxidation by different bacteria, which are known to be important for the degradation of these compounds in the environment, may explain why previous research on the application of the surfactants to PAH bioremediation has yielded inconclusive results. The surfactant inhibited growth of the wild-type strain S. yanoikuyae B1 on aromatic compounds but did not inhibit B8/36 dioxygenase enzyme activity in vitro.  (+info)

Aspartate 205 in the catalytic domain of naphthalene dioxygenase is essential for activity. (6/2226)

The naphthalene dioxygenase enzyme system carries out the first step in the aerobic degradation of naphthalene by Pseudomonas sp. strain NCIB 9816-4. The crystal structure of naphthalene dioxygenase (B. Kauppi, K. Lee, E. Carredano, R. E. Parales, D. T. Gibson, H. Eklund, and S. Ramaswamy, Structure 6:571-586, 1998) indicates that aspartate 205 may provide the most direct route of electron transfer between the Rieske [2Fe-2S] center of one alpha subunit and mononuclear iron in the adjacent alpha subunit. In this study, we constructed four site-directed mutations that changed aspartate 205 to alanine, glutamate, asparagine, or glutamine to test whether this residue is essential for naphthalene dioxygenase activity. The mutant proteins were very inefficient in oxidizing naphthalene to cis-naphthalene dihydrodiol, and oxygen uptake in the presence of naphthalene was below detectable levels. The purified mutant protein with glutamine in place of aspartate 205 had identical spectral properties to wild-type naphthalene dioxygenase and was reduced by NADH in the presence of catalytic amounts of ferredoxinNAP and reductaseNAP. Benzene, an effective uncoupler of oxygen consumption in purified naphthalene dioxygenase, did not elicit oxygen uptake by the mutant protein. These results indicate that electron transfer from NADH to the Rieske center in the mutant oxygenase is intact, a finding consistent with the proposal that aspartate 205 is a necessary residue in the major pathway of electron transfer to mononuclear iron at the active site.  (+info)

Homologous expression of soluble methane monooxygenase genes in Methylosinus trichosporium OB3b. (7/2226)

An homologous expression system has been developed for soluble methane monooxygenase (sMMO) genes from Methylosinus trichosporium OB3b. sMMO-minus mutants were previously obtained after marker-exchange mutagenesis, by the insertion of a kanamycin-resistance cassette into the mmoX gene of the sMMO operon. Complementation of the sMMO-minus genotype was achieved by conjugation with broad-host-range plasmids containing the native promoter and sMMO operon from Ms. trichosporium OB3b (pVK100Sc and pHM2). In wild-type methanotrophs, copper ions present in the growth medium at concentrations greater than 0.25 microM inhibit transcription of sMMO genes. The stable maintenance of pVK100Sc resulted in transconjugant methanotrophs with a decreased sensitivity to copper, since expression of sMMO occurred at copper sulphate concentrations of 7.5 microM. sMMO activity was only detected in soluble extracts after the addition of purified sMMO reductase component, which is inhibited by copper ions in vitro. This phenomenon could have arisen due to the increased number of sMMO gene copies (derived from pVK100Sc) in the cell. Transconjugants obtained from conjugations with pHM2 expressed sMMO at copper concentrations of 0-2.5 microM only and sMMO activity was not restored by the addition of purified reductase component at copper concentrations higher than 2.5 microM. Southern hybridization showed that the plasmid had integrated into the chromosome, probably by a single homologous recombination event. This is the first report of homologous sMMO expression in a methanotroph with enzyme activities that are comparable to the activity reported in wild-type strains. This expression system will be useful for site-directed mutagenesis of active-site residues of sMMO from Ms. trichosporium OB3b.  (+info)

Yeast flavin-containing monooxygenase generates oxidizing equivalents that control protein folding in the endoplasmic reticulum. (8/2226)

The flavin-containing monooxygenase from yeast (yFMO) catalyzes the O2- and NADPH-dependent oxidations of biological thiols, including oxidation of glutathione to glutathione disulfide (GSSG). Glutathione and GSSG form the principle redox buffering system in the cell, with the endoplasmic reticulum (ER) being more oxidizing than the cytoplasm. Proper folding of disulfide-bonded proteins in the ER depends on an optimum redox buffer ratio. Here we show that yFMO is localized to the cytoplasmic side of the ER membrane. We used a gene knockout strain and expression vectors to show that yFMO has a major effect on the generation of GSSG transported into the ER. The enzyme is required for the proper folding, in the ER, of test proteins with disulfide bonds, whereas those without disulfide bonds are properly folded independently of yFMO in the ER or in the cytoplasm.  (+info)

Antibodies for proteins involved in arachidonic acid epoxygenase activity pathways, according to their Panther/Gene Ontology Classification
Flavin-containing monooxygenase 3 (FMO3), also known as dimethylaniline monooxygenase [N-oxide-forming] 3 and trimethylamine monooxygenase, is a flavoprotein enzyme (EC 1.14.13.148) that in humans is encoded by the FMO3 gene. This enzyme catalyzes the following chemical reaction: N,N,N-trimethylamine + NADPH + H+ + O2 ⇌ {\displaystyle \rightleftharpoons } N,N,N-trimethylamine N-oxide + NADP+ + H2O FMO3 is the main flavin-containing monooxygenase isoenzyme that is expressed in the liver of adult humans. The human FMO3 enzyme catalyzes several types of reactions, including: the N-oxygenation of primary, secondary, and tertiary amines; the S-oxygenation of nucleophilic sulfur-containing compounds; and the 6-methylhydroxylation of DMXAA. FMO3 is the primary enzyme in humans which catalyzes the N-oxidation of trimethylamine into trimethylamine N-oxide; FMO1 also N-oxygenates trimethylamine, but to a much lesser extent than FMO3. Genetic deficiencies of the FMO3 enzyme cause primary ...
1FYZ: Crystal structures of the soluble methane monooxygenase hydroxylase from Methylococcus capsulatus (Bath) demonstrating geometrical variability at the dinuclear iron active site.
1FZ2: Crystal structures of the soluble methane monooxygenase hydroxylase from Methylococcus capsulatus (Bath) demonstrating geometrical variability at the dinuclear iron active site.
The flavin-containing monooxygenase (FMO) protein family specializes in the oxidation of xeno-substrates in order to facilitate the excretion of these compounds from living organisms. These enzymes can oxidize a wide array of heteroatoms, particularly soft nucleophiles, such as amines, sulfides, and phosphites. This reaction requires an oxygen, an NADPH cofactor, and an FAD prosthetic group. FMOs share several structural features, such as a NADPH binding domain, FAD binding domain, and a conserved arginine residue present in the active site. Recently, FMO enzymes have received a great deal of attention from the pharmaceutical industry both as a drug target for various diseases and as a means to metabolize pro-drug compounds into active pharmaceuticals. These monooxygenases are often misclassified because they share activity profiles similar to those of cytochrome P450 (CYP450), which is the major contributor to oxidative xenobiotic metabolism. However, a key difference between the two enzymes ...
The purpose of the present study was to gain further insight into the hypothesis that the metabolites of P-450 AA epoxygenase function in the regulation of CBF. We found that glutamate enhanced the formation and release of EETs from rat brain astrocytes. We also found that the expression of a recently identified P-450 2C11 enzyme is upregulated after prolonged exposure to glutamate. Finally, the present study demonstrated that inhibition of P-450 enzyme activity markedly blunts the increase in laser-Doppler-measured CBF in response to glutamate in anesthetized rats.. Previous work from our laboratory demonstrated that cultured astrocytes metabolize AA by the P-450 pathway to EETs and that they express P-450 2C11 cDNA.10 P-450 2C11 enzymes catalyze formation of 5,6-, 8,9-, 11,12-, and 14,15-EETs from AA.10 A physiological role for EETs in the regulation of CBF is emerging. Ellis and coworkers15 found that mouse brain tissue and cultured rat astrocytes metabolize AA to EETs, which dilate cerebral ...
Thank you for sharing this Drug Metabolism & Disposition article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
Thank you for sharing this Drug Metabolism & Disposition article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Research is focussed on the so-called drug metabolizing enzyme (DME) families, flavin-containing monooxygenases (FMOs) and cytochromes P-450 (CYPs). DMEs make it possible for an organism to be exposed to foreign chemicals e.g. therapeutic drugs, environmental pollutants, dietary components and plant products and to respond by metabolising such compounds to allow their clearance from the body. Using knockout models we have identified key roles for FMOs not only in drug and foreign chemical metabolism but also in energy metabolism. FMOs therefore have a dual role both in xenobiotic and endogenous metabolism. The biochemical consequences of genetic variation within these DME gene families for drug therapy and human health are of particular interest. Our research includes also studies of the perceptions of the clinical profession and the public in the use of medical therapies based on personalised genetic profiles (pharmacogenetics).. Of special interest is the genetic disorder primary ...
References for Abcams Recombinant Human FMO5 protein (ab57977). Please let us know if you have used this product in your publication
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
AUX/LAX genes encode a family of auxin influx transporters that perform distinct functions during Arabidopsis development. Péret B, Swarup K, Ferguson A, Seth M, Yang Y, Dhondt S, James N, Casimiro I, Perry P, Syed A, Yang H, Reemmer J, Venison E, Howells C, Perez-Amador MA, Yun J, Alonso J, Beemster GT, Laplaze L, Murphy A, Bennett MJ, Nielsen E, Swarup R. Plant Cell. 2012 24:2874-85 (2012). -. The Arabidopsis YUCCA1 flavin monooxygenase functions in the indole-3-pyruvic acid branch of auxin biosynthesis. Stepanova AN, Yun J, Robles LM, Novak O, He W, Guo H, Ljung K, Alonso JM. Plant Cell. 23:3961-3973 (2011). -. A Small-Molecule Screen Identifies L-Kynurenine That Competitively Inhibits TAA1/TAR Activity in Ethylene-Directed Auxin Biosynthesis and Root Growth. He W, Brumos J, Li H, Ji Y, Ke M, Gong X, Zeng Q, Li W, Zhang X, An F, Wen X, Li P, Xie D, Stepanova A, Alonso J, and Guo H. Plant Cell. 23: 3944-3960 (2011). -. Bypassing transcription: a shortcut in cytokinin-auxin interactions. ...
Drugs are eliminated from the body either as unchanged parent or as metabolite. Metabolic stability plays a major role in drug clearance, with the liver being the primary site for drug biotransformation via two major enzymatic reactions: Phase I (modifications to the molecular structure itself) and Phase II reactions (conjugation reactions). A common system for measuring hepatic metabolism in early drug discovery, restricted to Phase I reactions, uses liver microsomes, a subcellular fraction containing major drug-metabolizing enzymes, including the cytochrome P450 (CYP) family and flavin monooxygenase (FMO). ...
Additionally, target-based therapies, such as inhibition of angiogenesis, metalloproteinases, and cytokine signaling, may be an effective strategy to treat patients with KS that progresses despite chemotherapy and/or HAART [22]. ^ NADAC as of 2016-11-30 , Data.Medicaid.gov. Antisense aims for a renaissance. Human fibroblasts (HF) were cultivated in Dulbeccos modified Eagles medium (DMEM; Gibco) containing 10% fetal bovine serum (FBS) and 100 units per mL penicillin G and 100 μg per mL streptomycin (Pen-Strep) and maintained at 37°C in a humidified 5% CO2 atmosphere, as previously described [9]. The metabolism of artemisinin in human liver microsomes is primarily mediated by cytochrome P-450 monooxygenase enzyme (CYP) 2B6, with a secondary contribution by CYP3A4 in individuals with low CYP2B6 expression. International Drug Price Indicator Guide. There is a need to identify alternative antiviral therapies with different modes of action to improve the treatment and control of HSV ...
The disorder trimethylaminuria (TMAu) often manifests itself in a body odor for individuals affected. TMAu is due to decreased metabolism of dietary-derived trimethylamine (TMA). In a healthy individual, 95% or more of TMA is converted by the flavin-containing monooxygenase 3 (FMO3, EC 1.14.13.8) to …
Degradation of aromatic hydrocarbons by aerobic bacteria is generally divided into an upper pathway, which produces dihydroxylated aromatic intermediates by the action of monooxygenases, and a lower pathway, which processes these intermediates down to molecules that enter the citric acid cycle. Bacterial multicomponent monooxygenases (BMMs) are a family of enzymes divided into six distinct groups. Most bacterial genomes code for only one BMM, but a few cases (3 out of 31) of genomes coding for more than a single monooxygenase have been found. One such case is the genome of Pseudomonas stutzeri OX1, in which two different monooxygenases have been found, phenol hydroxylase (PH) and toluene/o-xylene monooxygenase (ToMO). We have already demonstrated that ToMO is an oligomeric protein whose subunits transfer electrons from NADH to oxygen, which is eventually incorporated into the aromatic substrate. However, no molecular data are available on the structure and on the mechanism of action of PH. To ...
Glucosinolates (GSLs), a class of secondary metabolites from cruciferous plants, are derived from amino acids and have diverse biological activities, such as in biotic defense, depending on their side chain modification. The first structural modification step in the synthesis of aliphatic (methionine-derived) GSLs-S-oxygenation of methylthioalkyl GSLs to methylsulfinylalkyl GSLs-was found to be catalyzed by five flavin-containing monooxygenases (FMOs), FMOGS-OX1-5. Here, we report two additional FMOGS-OX enzymes, FMOGS-OX6 and FMOGS-OX7, encoded by At1g12130 and At1g12160, respectively. The overexpression of both FMOGS-OX6 and FMOGS-OX7 decreased the ratio of MT GSL to the sum of MT and MS GSL, suggesting that the introduction of the two genes converted MT GSL into MS GSL. Analysis of expression pattern revealed that the spatial expression of the two genes is quite similar and partially overlapped with the other FMOGS-OX genes, which are primarily expressed in vascular tissue. We further analyzed the
Metabolites derived from any human flavin-containing monooxygenase (FMO) subtype can now be produced as a service offering at Hypha. Recombinant… read more →. ...
The N-nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) is a potent lung carcinogen present in tobacco and tobacco smoke. Carbonyl reduction, alpha-carbon hydroxylation (activation) and N-oxidation of the pyridyl ring (detoxification) are the three main pathways of metabolism of NNK. In this study, metabolism of NNK was studied with lung and liver microsomes from F344 rats, Syrian golden hamsters and pigs and cloned flavin-containing monooxygenases (FMOs) from human and rabbit liver. Thermal inactivation at 45 degrees C for 2 min reduced FMO S-oxygenating activity but did not affect N-oxidation of NNK, leading to the conclusion that FMOs are not implicated in the detoxification of NNK. Detoxification of NNK was not increased by n-octylamine or by incubation at pH 8.4, supporting the conclusion that FMOs are not involved in the metabolism of NNK. SKF-525A (1 mM) significantly reduced N-oxidation and alpha-carbon hydroxylation, suggesting that these two pathways were catalyzed by ...
TY - JOUR. T1 - Alkene monooxygenase from Mycobacterium: a multicomponent enzyme.. AU - Hartmans, S.. AU - Weber, F.J.. AU - Somhorst, D.P.M.. AU - de Bont, J.A.M.. PY - 1991. Y1 - 1991. U2 - 10.1099/00221287-137-11-2555. DO - 10.1099/00221287-137-11-2555. M3 - Article. VL - 137. SP - 2555. EP - 2560. JO - Journal of general microbiology. JF - Journal of general microbiology. SN - 0022-1287. ER - ...
Auxin biosynthesis by the YUCCA flavin monooxygenases controls the formation of floral organs and vascular tissues in Arabidopsis: Auxin biosynthesis in plants
Shop Toluene 1,2-dioxygenase system ferredoxin ELISA Kit, Recombinant Protein and Toluene 1,2-dioxygenase system ferredoxin Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Component of 1,2-phenylacetyl-CoA epoxidase multicomponent enzyme system which catalyzes the reduction of phenylacetyl-CoA (PA-CoA) to form 1,2-epoxyphenylacetyl-CoA. The subunit B may play a regulatory role or be directly involved in electron transport.
ABSTRACT: Flavin monooxygenase (FMO) is one of the most important enzymes involved in glucosinolate biosynthesis. In this study, the full length of FMO gene (RsFMOgs-ox1) encoding a putative FMO protein composed of 450 amino acids was successfully cloned using the RACE-PCR method. The amino acid sequence of RsFMOgs-ox1 has high similarities of 92% and 83% with BrFMOgs-ox1 and AtFMOgs-ox1,2,3, respectively, and the gene structure of FMOgs-ox1 is similar to its plant homologues. Quantitative (qPCR) analysis revealed that RsFMOgs-ox1 was highly expressed during early seedling development. In mature radish, the highest expression was observed in the leaves, while the lowest transcript was evident in the root. The expression of RsFMOgs-ox1 was also regulated by wounding, notably 1 day after treatment. Subcellular localization in Arabidopsis showed that RsFMOgs-ox1 was localized in the cytoplasm and nuclei. This study allows us to understand something about RsFMOgs-ox1 function in glucosinolate ...
the topic of dioxygen activation and homogeneous catalytic oxidation by way of steel complexes has been within the concentration of recognition during the last two decades. The common curiosity is illustrated through its routine presence one of the periods and topic components of significant overseas meetings on quite a few facets of bioinorganic and coordination chemistry in addition to catalysis. the main admired examples are ICCC, ICBIC, EUROBIC, ISHC, and naturally the ADHOC sequence of conferences targeting the topic itself. equally, the variety of unique and overview papers dedicated to a variety of features of dioxygen activation are at the upward push. This pattern is due evidently to the relevance of catalytic oxidation to organic strategies similar to dioxygen shipping, and the motion of oxygenase and oxidase enzymes relating to metabolism. The structural and useful modeling of metalloenzymes, quite of these containing iron and copper, by way of low-molecular complexes of iron, copper, ...
Stoichiometric Formation of an Oxoiron(IV) Complex by a Soluble Methane Monooxygenase Type Activation of O at an Iron(II)-Cyclam Center, D. Kass, T. Corona, K. Warm, B. Braun-Cula, U. Kuhlmann, E. Bill, S. Mebs, M. Swart, H. Dau, M. Haumann, P. Hildebrandt, K. Ray, Journal of the American Chemical Society 2020, 142, 5924-5928, 10.1021/jacs.9b13756 ...
Protein target information for Amine oxidase [flavin-containing] B (human). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
Kenji Watanabe and co-workers from the University of Shizuoka have reported in ACIE on an enzyme system (PsoE (glutathione S-transferase) and PsoF (flavin-containing monooxygenase)) that involves glutathione conjugation of a polyolefinic natural product (presynerazol) to form a glutathione adduct intermediate, which in turn is oxidized to the sulfoxide (by flavin hydroperoxide) and eliminates to form…
I see this question crop up fairly frequently. There seems to be the belief that doing cardio exercise after fasting is more beneficial than doing cardio
Printed from: http://www.jewishpress.com/news/breaking-news/jerusalem-district-border-police-block-jewish-march-to-temple-mount/2014/05/06/. Scan this QR code to visit this page online ...
Originally Posted by Qlip Nahh, I know what a tan is, I was born with one. I think its that thing where you dont get a lot of sun, because its alwa
TY - JOUR. T1 - A Genome-Scale Metabolic Model for Methylococcus capsulatus (Bath) Suggests Reduced Efficiency Electron Transfer to the Particulate Methane Monooxygenase. AU - Lieven, Christian. AU - Petersen, Leander A. H.. AU - Jørgensen, Sten Bay. AU - Gernaey, Krist V.. AU - Herrgard, Markus J.. AU - Sonnenschein, Nikolaus. PY - 2018. Y1 - 2018. N2 - Genome-scale metabolic models allow researchers to calculate yields, to predict consumption and production rates, and to study the effect of genetic modifications in silico, without running resource-intensive experiments. While these models have become an invaluable tool for optimizing industrial production hosts like E. coli and S. cerevisiae, few such models exist for one-carbon (C1) metabolizers. Here we present a genome-scale metabolic model for Methylococcus capsulatus (Bath), a well-studied obligate methanotroph, which has been used as a production strain of single cell protein (SCP). The model was manually curated, and spans a total of ...
Abstract: Soluble methane monooxygenase (sMMO) is a multicomponent metalloenzyme that catalyzes the conversion of methane to methanol at ambient temperature using a nonheme, oxygen-bridged dinuclear iron cluster in the active site. Structural changes in the hydroxylase component (sMMOH) containing the diiron cluster caused by complex formation with a regulatory component (MMOB) and by iron reduction are important for the regulation of O2 activation and substrate hydroxylation. Structural studies of metalloenzymes using traditional synchrotron-based X-ray crystallography are often complicated by partial X-ray-induced photoreduction of the metal center, thereby obviating determination of the structure of pure oxidation states. Here microcrystals of the sMMOH:MMOB complex from Methylosinus trichosporium OB3b were serially exposed to X-ray free electron laser (XFEL) pulses, where the ≦35 fs duration of exposure of an individual crystal yields diffraction data before photoreduction-induced ...
Looking for online definition of amine oxidase flavin-containing in the Medical Dictionary? amine oxidase flavin-containing explanation free. What is amine oxidase flavin-containing? Meaning of amine oxidase flavin-containing medical term. What does amine oxidase flavin-containing mean?
1.14.11.1 Gamma-butyrobetaine dioxygenase 1.14.11.2 Procollagen-proline 4-dioxygenase 1.14.11.3 Pyrimidine-deoxynucleoside 2-dioxygenase 1.14.11.4 Procollagen-lysine 5-dioxygenase 1.14.11.5 Transferred entry: 1.14.11.6 1.14.11.6 Thymine dioxygenase 1.14.11.7 Procollagen-proline 3-dioxygenase 1.14.11.8 Trimethyllysine dioxygenase 1.14.11.9 Flavanone 3-dioxygenase 1.14.11.10 Pyrimidine-deoxynucleoside 1-dioxygenase 1.14.11.11 Hyoscyamine (6S)-dioxygenase 1.14.11.12 Gibberellin-44 dioxygenase 1.14.11.13 Gibberellin 2-beta-dioxygenase 1.14.11.14 6-beta-hydroxyhyoscyamine epoxidase 1.14.11.15 Gibberellin 3-beta-dioxygenase 1.14.11.16 Peptide-aspartate beta-dioxygenase 1.14.11.17 Taurine dioxygenase 1.14.11.18 Phytanoyl-CoA dioxygenase 1.14.11.19 Anthocyanidin synthase 1.14.11.20 Deacetoxyvindoline 4-hydroxylase 1.14.11.21 Clavaminate synthase 1.14.11.22 Flavone synthase 1.14.11.23 Flavonol synthase 1.14.11.24 2-deoxymugineic-acid 2-dioxygenase 1.14.11.25 Mugineic-acid 3-dioxygenase 1.14.11.26 ...
Three UniSysCat research groups investigated in an interdisciplinary approach oxygen activation of a non-heme iron(II) Cyclam Center relevant for understanding the chemistry of dinuclear non-heme iron enzymes.
Looking for tetrachlorobenzene? Find out information about tetrachlorobenzene. C6H2Cl4 Water-insoluble, combustible white crystals that appear in two forms: 1,2,3,4-tetrachlorobenzene which melts at 47°C and is used in chemical... Explanation of tetrachlorobenzene
TY - JOUR. T1 - Dioxygen Activation on Cu-MOR Zeolite. T2 - Theoretical Insights into the Formation of Cu2O and Cu3O3 Active Species. AU - Mahyuddin, M. Haris. AU - Tanaka, Takahiro. AU - Staykov, Aleksandar. AU - Shiota, Yoshihito. AU - Yoshizawa, Kazunari. PY - 2018/8/20. Y1 - 2018/8/20. N2 - The utilization of low-cost and abundant oxygen (O2) as an oxidant in the activation of copper-exchanged zeolites is highly important for the direct, selective oxidation of methane to methanol at low temperatures. While two motifs of active sites, i.e., the [Cu2(μ-O)]2+ and [Cu3(μ-O)3]2+, have been experimentally observed in mordenite (MOR) zeolite, the mechanisms of their formation from the reaction of Cu-MOR with O2 are still unclear. In this study, we performed density functional theory (DFT) calculations for O2 activation over 2[Cu2]2+-MOR and [Cu3O]2+-MOR zeolites. For the reaction on the dicopper species, we found two possible reaction routes: O-O bond cleavage leading to (1) formation of a ...
This chapter focuses on the aerobic degradation of hydrocarbons, with an emphasis on alkanes, and the applications of enzymes involved in these processes for biocatalysis. Yeasts and fungi are often mentioned as alkane degraders, for example in connection with the production of single-cell proteins or organic acids and amino acids from hydrocarbons. Soluble and particulate mono-oxygenases are known to oxidize the same compounds, and some of the gene diversity detected with primers that amplify membrane-bound methane mono-oxygenase (pMMO) and soluble MMO (sMMO) genes may well be due to short-chain alkane-degrading bacteria instead of methanotrophs. The application of oxygenases in biocatalytic processes is more complicated than that of enzymes such as hydrolases, because of cofactor and oxygen requirements, the sensitive nature of many oxygenases, the toxicity of substrates and products to the biocatalyst, and the uptake of the lipophilic substrates. The best strain in this study was a hexane-degrading
Statistical studies have demonstrated that various agents may reduce the risk of cancers development. One of them is activity of flavin-dependent enzymes such as flavin-containing monooxygenase (FMO)GS-OX1, FAD-dependent 5,10-methylenetetrahydrofolate reductase and flavin-dependent monoamine oxidase. In the last decade, many papers concerning their structure, reaction mechanism and role in the cancer prevention were published. In our work, we provide a more in-depth analysis of flavin-dependent enzymes and their contribution to the cancer prevention. We present the actual knowledge about the glucosinolate synthesized by flavin-containing monooxygenase (FMO)GS-OX1 and its role in cancer prevention, discuss the influence of mutations in FAD-dependent 5,10-methylenetetrahydrofolate reductase on the cancer risk, and describe FAD as an important cofactor for the demethylation of histons. We also present our views on the role of riboflavin supplements in the prevention against cancer.
Trimethylaminuria Prevention and Treatment: treatment - General: There is currently no cure for trimethylaminuria (TMAU), and treatment options are limited. However, with proper treatment or precautions, individuals with TMAU may be able to live normal, healthy lives. Generally, treatment is based on symptom management, although widely varying degrees of effectiveness have been reported. Depending on the type and cause of TMAU, an individual...
Rat liver microsomes act on 1,1-dichloro-cis -diphenylcyclopropane to form several products such as 2-chloro-3-oxo-1,3-diphenyl-1-propene. This involves an unusual type of ring fission which is considered to form 2,3-dichloro-1,3-diphenyl-1-propene as the initial product F573 . Methylococcus capsulatus soluble methane monooxygenase (E.C. 1.14.13.25) converts cyclopropylbenzene into benzyl alcohol. 3-Phenylprop-2-en-1-ol is also formed, and this may be an intermediate F278 . 1.6 Reactions.... ...
Catalyzes the reduction of N-oxygenated molecules, acting as a counterpart of cytochrome P450 and flavin-containing monooxygenases in metabolic cycles. As a component of prodrug-converting system, reduces a multitude of N-hydroxylated prodrugs particularly amidoximes, leading to increased drug bioavailability. May be involved in mitochondrial N(omega)-hydroxy-L-arginine (NOHA) reduction, regulating endogenous nitric oxide levels and biosynthesis. Postulated to cleave the N-OH bond of N-hydroxylated substrates in concert with electron transfer from NADH to cytochrome b5 reductase then to cytochrome b5, the ultimate electron donor that primes the active site for substrate reduction.
Shop Squalene epoxidase ELISA Kit, Recombinant Protein and Squalene epoxidase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
EC 1.13.11.63. Accepted name: β-carotene 15,15-dioxygenase. Reaction: β-carotene + O2 = 2 all-trans-retinal. For diagram of reaction click here.. Other name(s): blh (gene name); BCO1 (gene name); BCDO (gene name); carotene dioxygenase; carotene 15,15-dioxygenase; BCMO1 (misleading); β-carotene 15,15-monooxygenase (incorrect). Systematic name: β-carotene:oxygen 15,15-dioxygenase (bond-cleaving). Comments: Requires Fe2+. The enzyme cleaves β-carotene symmetrically, producing two molecules of all-trans-retinal. Both atoms of the oxygen molecule are incorporated into the products [8]. The enzyme can also process β-cryptoxanthin, 8-apo-β-carotenal, 4-apo-β-carotenal, α-carotene and γ-carotene in decreasing order. The presence of at least one unsubstituted β-ionone ring in a substrate greater than C30 is mandatory [5]. A prokaryotic enzyme has been reported from the uncultured marine bacterium 66A03, where it is involved in the proteorhodopsin system, which uses retinal as its ...
Trimethylaminuria (TMAU), also known as fish odor syndrome or fish malodor syndrome, is a rare metabolic disorder that causes a defect in the normal production of the enzyme Flavin containing monooxygenase 3 (FMO3).When FMO3 is not working correctly, the body loses the ability to properly breakdown trimethylamine.
Accurate and robust monitoring of product and reactants in a complex bioconversion stream is essential for the development of effective process control strategies. To monitor a microbially-catalysed Baeyer-Villiger bioconversion of a cyclic ketone to an optically pure lactone, a near infrared (NIR) spectroscopic method has been developed. The reaction, catalysed by cyclohexanone monooxygenase from Acinetobacter calcoaceticus (expressed in Escherichia coli) is characterised by substrate (ketone) and product (lactone) inhibition at relatively low concentrations. Quantitative multivariate calibration of a NIR spectrophotometer for ketone and lactone resulted in a standard error of prediction (SEP) at-line of 0.088 and 0.110 g/l-1 and on-line of 0.130 and 0.180 g/l-1 , respectively. The directed modification of quantitative models, by the inclusion of spiked process samples improved the SEP for lactone prediction where bioprocess development meant existing NIR models were not relevant. The ...
TY - JOUR. T1 - Synthetic anticonvulsants, antihypoxics, and liver monooxygenase system inducers based on amides and urea. XI. Synthesis of alkyl- and arylalkylureas and their effects on the liver monooxygenase system. AU - Bakibaev, S. S.. AU - Akhmedzhanov, R. R.. AU - Filimonov, V. D.. AU - Novocheeva, T. P.. AU - Saratikov, A. S.. AU - Tignibidina, L. G.. AU - Pustovoitov, A. V.. PY - 1993/9. Y1 - 1993/9. UR - http://www.scopus.com/inward/record.url?scp=14744281917&partnerID=8YFLogxK. UR - http://www.scopus.com/inward/citedby.url?scp=14744281917&partnerID=8YFLogxK. U2 - 10.1007/BF00780583. DO - 10.1007/BF00780583. M3 - Article. AN - SCOPUS:14744281917. VL - 27. SP - 631. EP - 634. JO - Pharmaceutical Chemistry Journal. JF - Pharmaceutical Chemistry Journal. SN - 0091-150X. IS - 9. ER - ...
Our data suggest that DHETs regulate cAMP production via PDE4 and Gαi protein. Moreover, they provide novel evidence as to how EET-mediated signaling may alter G-protein coupling in HEK293 cells.
Squalene Epoxidase 兔多克隆抗体(ab112960)可与人样本反应并经WB实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
Looking for online definition of monooxygenases in the Medical Dictionary? monooxygenases explanation free. What is monooxygenases? Meaning of monooxygenases medical term. What does monooxygenases mean?
Atlas, S A.; Diwan, B A.; and Nebert, D W., Inducible monooxygenase activities and 3-methylcholanthrene- -initiated tumorigenesis in mouse recombinant inbred sublines. (1976). Subject Strain Bibliography 1976. 2211 ...
Dioxygenases catalyze the incorporation of both atoms of molecular oxygen into substrates. Cleavage of aromatic rings is one of the most important function of dioxygenases. The substrates of ring-cleavage dioxygenases can be classified into two groups according to the mode of scission of the aromatic ring. Intradiol enzymes cleave the aromatic ring between two hydroxyl groups, whereas extradiol enzymes cleave the aromatic ring between a hydroxylated carbon and another adjacent nonhydroxylated carbon [1]. Intradiol dioxygenases require a nonheme ferric ion as a cofactor. The enzymes that belong to this family are: ...
Hydroxyacetophenone (HAP, CAS 99-93-4) Market by Product (2-Hydroxyacetophenone, 4-Hydroxyacetophenone), by Application (Pharmaceuticals, Chemical Intermediates, Cosmetics) and by Region, Trend, Forecast, Competitive Analysis, and Growth Opportunity 2019-2024 - Radiant Insights
Dihydroflavonols are substrates for the biosynthesis of the coloured anthocyanin pigments, which are produced in three steps: firstly a reduction, catalysed by the enzyme dihydroflavonol 4-reductase (DFR); secondly the production of colourless anthocyanidin through the action of anthocyanidin synthase and thirdly addition of a glucose residue to produce a coloured anthocyanin molecule ...
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
Definition of Alkane 1-monooxygenase with photos and pictures, translations, sample usage, and additional links for more information.
CYCLOHEXANONE ... - Brenntag product information page Brenntag is Beneluxs leading distributor and exporter of industrial chemicals and specialties, located in Belgium (Deerlijk, Antwerpen & Mouscron) and the Netherlands (Dordrecht, Loosdrecht, Zwijndrecht, Moerdijk, Rotterdam, Enschede).
China Cyclohexanone-Qingdao Hisea Chem Co., Ltd, Find details about China Cyclohexanone, Cyc from Cyclohexanone-Qingdao Hisea Chem Co., Ltd - Qingdao Hisea Chem Co., Ltd.
A flavoprotein (FAD). NADH cannot replace NADPH as coenzyme. In addition to phenylacetone, which is the best substrate found to date, this Baeyer-Villiger monooxygenase c
forex deposit mmo Fredholm - forex deposit mmo, free realtime forex charts, forex ecn brokers usa, forex gold rate pk, kiyosaki forex
GenBank) Acireductone dioxygenase; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase; DHK-MTPene dioxygenase; Acireductone ...
This week on The MMO Report, Casey discusses the un-disbanding of the Multiverse project and associated Firefly/Buffy IPs, Wakfus bright and bizarre charact...
鎂是人體內重要元素之一,是體內礦物質含量第四豐富的陽離子,僅次於鈣、鉀、鈉,在體液中主要以二價陽離子形式存在。成年人體內鎂總量約21-28克,鎂主要存在於細胞內,它在細胞內液的含量僅次於鉀,是細胞內的重要陽離子。其中骨骼肌佔27%,其他細胞佔6%-7%(以肝臟為最高)中,細胞外液(extracellular fluid,ECF)約佔1%,其餘60%-65%集中在骨骼,占骨頭總灰分的0.5%~0.7%。骨骼的鎂約三分之一與磷酸根緊密結合,其餘三分之二吸附於骨骼表面,可用來維持血液和組織的正常濃度。軟組織的鎂含量約為每公斤2.5-9毫莫耳,與代謝活性成正比。紅細胞內濃度2.5mmo1/L,血清 0.75-1.25 mmo1/L。血漿中鎂濃度平均約為0.85 mM (0.7-1.0 mM),其中60%為離子態,30%與白蛋白(albumin)結合,10%為小分子複合物。細胞內鎂約90 ...
This enzyme catalyses a step in the pathway of phenylpropanoid compounds degradation. It catalyses the insertion of both atoms of molecular oxygen into positions 2 and 3
TSAR is a free, digitally delivered art information utility. Every entry is carefully checked with the presenting institutions. Nevertheless, inaccuracies occur. Always try to call the sponsoring institution to check the facts. In our effort to be an increasingly more valuable product, we ask for your comments and suggestions to be emailed to [email protected] ...
putative 3,5-dihydroxyphenylacetyl-CoA 1,2-dioxygenase [hydroxyacyl-dehydrogenase] GTGACCACGGATTCCCCGACGCTGTCGCTTTCGCCGGGGCTCGACCATCGAGCCCTGGCG AAGGCGGCACAGCGTGTCGACGAGCTGCTCGACGGGTTGCCGTCGCCCTCGGCCAGGACG CCCGCGCAGCGTGAGGCCGCGTCCTCGGCGCTGGACGAGATCAGGGCGGCGCGGACGGAG TACGTGGAAGCGCACGCCGAGGAGATCTACGACCGGCTCACCGACGGCCGCACCCGCTAT CTACGCCTCGACGAACTCGTCCGGGCCGCCGCGTCGGCCTATCCCGGCCTGGTGCCCACG GAGGCGCAGATGGCGGCCGAGCGGTCCCGACGGCAGGCGGAGAAGGAAGGCCGTGAGATC GATCAGGGCATTTTCCTGCGCGGGATCCTGAGCGCGCCGAAAGCCGGGCCGCATCTGCTC GACGCCATGCTCAGGCCCACCGCCAGGGCGCTGGAGCTGCTGCCGGAGTTCGTCGAGACC GGTGTGGTGCGGATGGAGGCCGCCTCCCTGGAGCGCCGTGACGGCGTCGCGTACCTGACC CTGTGCCGGGACGACTGCCTGAACGCCGAGGACGCCCAGCAGGTCGACGACATGGAGACC GCGGTCGATCTGGCGCTGCTCGACCCGGCCGTCCGGGTGGGGATGCTGCGGGGCGGCGTG ATGAGCCATCCCCGGTACGCGGGGCGCCGGGTGTTCTGCGCGGGGATCAACCTCAAGAAG CTGAGTTCGGGCGACATCCCGCTCGTCGATTTCCTCCTGCGGCGGGAATTGGGCTATATC CACAAGATCGTGCGCGGGGTGGCCACGGACGGTTCGTGGCGAGCACGGGTGATCGACAAG CCCTGGCTGGCGGCCGTCGATTCCTTCGCCATCGGGGGCGGGGCCCAGCTCCTGCTGGTC ...
Unknown functionEnzymes of unknown specificityputative FMN-dependent luciferase-like monooxygenase, KPN_01858 family (TIGR04027; EC 1.-.-.-; HMM-score: 48.7) ...
Hayaishi O, Lardy H, Myrbäck K (1963). "Direct oxygenation by O2, oxygenases". In Boyer PD (ed.). The Enzymes. 8 (2nd ed.). New ... Hayaishi S, Katagiri M, Rothberg S (1957). "Pioneering the Field of Oxygenases through the Study of Tryptophan Metabolism: the ... Itoh, M (1981). "Characteristics of a new catechol-1,2-oxygenase from Trichosporon cutaneum WY2-2". Agric. Biol. Chem. 45 (1): ... Nakazawa H, Inoue H, Takeda Y (1963). "Characteristics of Catechol Oxygenase from Brevibacterium fuscum". J. Biochem. 54 (1): ...
Abu-Omar MM, Loaiza A, Hontzeas N (June 2005). "Reaction mechanisms of mononuclear non-heme iron oxygenases". Chemical Reviews ... Sono M, Roach MP, Coulter ED, Dawson JH (November 1996). "Heme-Containing Oxygenases". Chemical Reviews. 96 (7): 2841-2888. doi ... Fetzner S (November 2002). "Oxygenases without requirement for cofactors or metal ions". Applied Microbiology and Biotechnology ... and an α3β3 oxygenase with each α-subunit containing a mononuclear iron center and a [2Fe-2S] Rieske cluster. Within each α- ...
... oxygenases). This family includes tryptophan 2,3-dioxygenase (TDO, also sometimes referred to as tryptophan oxygenase and L- ... Sono M, Roach MP, Coulter ED, Dawson JH (November 1996). "Heme-Containing Oxygenases". Chemical Reviews. 96 (7): 2841-2888. doi ... Comings DE, Muhleman D, Dietz GW, Donlon T (February 1991). "Human tryptophan oxygenase localized to 4q31: possible ...
Saito Y, Hayaishi O, Rothberg S (1957). "Studies on oxygenases; enzymatic formation of 3-hydroxy-L-kynurenine from L-kynurenine ...
Kynureninase, European Bioinformatics Institute Saito Y, Hayaishi O, Rothberg S (1957-12-01). "Studies on Oxygenases". The ...
2-Oxoglutarate-Dependent Oxygenases. Royal Society of Chemistry. ISBN 1-84973-950-1. Kukhar, Valery P.; Hudson, Harry R. (2000 ...
Heme Oxygenases 2007 Conference. Jagiellonian University. Archived from the original on 15 July 2007. Retrieved 14 August 2007 ...
Biology portal Solomon EI, Sundaram UM, Machonkin TE (November 1996). "Multicopper Oxidases and Oxygenases". Chemical Reviews. ...
Fetzner, Susanne; Steiner, Roberto A. (2010-02-16). "Cofactor-independent oxidases and oxygenases". Applied Microbiology and ...
... (EC 1.13.11.2, 2,3-pyrocatechase, catechol 2,3-oxygenase, catechol oxygenase, metapyrocatechase, ... Hayaishi O, Lardy H, Myrbäck K (1963). "Direct oxygenation by O2, oxygenases". In Boyer PD (ed.). The Enzymes. 8 (2nd ed.). New ...
More specifically, CDO is part of the group of non-heme iron oxygenases that employ oxygen as an electron acceptor. Cysteine ... Lombardini JB, Singer TP, Boyer PD (March 1969). "Cystein oxygenase. II. Studies on the mechanism of the reaction with 18oxygen ...
Rose NR, McDonough MA, King ON, Kawamura A, Schofield CJ (2011). "Inhibition of 2-Oxoglutarate Dependent Oxygenases". Chemical ...
Cheng AX, Han XJ, Wu YF, Lou HX (January 2014). "The function and catalysis of 2-oxoglutarate-dependent oxygenases involved in ... Hewitson KS, Granatino N, Welford RW, McDonough MA, Schofield CJ (April 2005). "Oxidation by 2-oxoglutarate oxygenases: non- ... Rose NR, McDonough MA, King ON, Kawamura A, Schofield CJ (August 2011). "Inhibition of 2-oxoglutarate dependent oxygenases". ... Proshlyakov DA, McCracken J, Hausinger RP (April 2016). "Spectroscopic analyses of 2-oxoglutarate-dependent oxygenases: TauD as ...
A Database of Biodegradative Oxygenases. 6 December 2017. Retrieved 6 December 2017. "Welcome to IMTECH". www.imtech.res.in. 6 ...
The 2-oxoglutarate (2OG)-dependent oxygenases are a superfamily of non-haem iron dependent oxygenases, most of which use the ... After work on plant and microbial oxygenases, he studied uncharacterised human oxygenases. His research has identified ... A current focus of the group is modification of histones, in particular oxygenase catalysed N-demethylation of histone ... Loenarz, Christoph; Schofield, Christopher J. (1 March 2008). "Expanding chemical biology of 2-oxoglutarate oxygenases". Nature ...
Similar to many other 2OG oxygenases, the activity of gamma-butyrobetaine dioxygenase can be stimulated by reducing agents such ... Similar to other 2OG oxygenases, gamma-butyrobetaine dioxygenase can be inhibited by 2OG mimics and aromatic inhibitors such as ... Gamma-butyrobetaine dioxygenase is unique among other human 2OG oxygenases that it catalyses both hydroxylation (e.g.: L- ... Loenarz C, Schofield CJ (Mar 2008). "Expanding chemical biology of 2-oxoglutarate oxygenases". Nature Chemical Biology. 4 (3): ...
Olomucki A, Pho DB, Lebar R, Delcambe L, Thoai NV (1968). "[Arginine oxygenase (decarboxylating). V. Purification and flavin ... oxygenases). The oxygen incorporated need not be derived from O with incorporation of one atom of oxygen (internal ... arginine oxygenase (decarboxylating), and arginine decarboxy-oxidase. This enzyme participates in urea cycle and metabolism of ...
Heme oxygenase (HO) is a heme-containing member of the heat shock protein (HSP) family identified as HSP32. Three isoforms of ... CO is formed at a rate of 16.4 μmol/hour in the human body, ~86% originating from heme via heme oxygenase and ~14% from non- ... The majority of CO produced in mammals originates from the degradation of heme by the three isoforms of heme oxygenase, whereby ... Some PPIX analogs such as tin PPIX, tin mesoporphyrin, and zinc PPIX, are heme oxygenase inhibitors. In the late 1960s Tenhunen ...
"Expanding chemical biology of 2-oxoglutarate oxygenases". Nature Chemical Biology. 4 (3): 152-6. doi:10.1038/nchembio0308-152. ...
A large family of multicomponent mononuclear (non-heme) iron oxygenases has been identified. Components of bacterial aromatic- ... Harayama, S.; Kok, M. & Neidle, E.L. (1992). "Functional and evolutionary relationships among diverse oxygenases". Annu. Rev. ...
Harayama S, Kok M, Neidle EL (1992). "Functional and evolutionary relationships among diverse oxygenases". Annu. Rev. Microbiol ...
The omega oxygenases metabolize fatty acids (RH) by adding a hydroxyl (OH) to their terminal (i.e. furthest from the fatty ... While once regarded as functioning mainly in the catabolism of dietary fatty acids, the omega oxygenases are now considered ... Harayama S, Kok M, Neidle EL (1992). "Functional and evolutionary relationships among diverse oxygenases". Annu. Rev. Microbiol ...
PHF8: PHD finger protein 8 belongs to the family of ferrous iron and 2-oxoglutarate dependent oxygenases, and is a histone ... Loenarz, C.; Schofield, C. J. (2008). "Expanding chemical biology of 2-oxoglutarate oxygenases". Nat. Chem. Biol. 4 (3): 152- ...
Takeda H, Hayaishi O (1966). "Crystalline L-lysine oxygenase". J. Biol. Chem. 241 (11): 2733-6. PMID 5911646. Takeda H, ... oxygenases). The oxygen incorporated need not be derived from O with incorporation of one atom of oxygen (internal ... Other names in common use include lysine oxygenase, lysine monooxygenase, and L-lysine-2-monooxygenase. This enzyme ...
Abu-Omar, Mahdi M.; Loaiza, Aristobulo; Hontzeas, Nikos (2005). "Reaction Mechanisms of Mononuclear Non-Heme Iron Oxygenases". ...
Dnr G, a C-12 oxygenase (see (5) for numbering) introduces a keto group using molecular oxygen. It is an "anthrone type ... Fetzner S (2002). "Oxygenases without requirement for cofactors or metal ions". Appl. Microbiol. Biotechnol. 60 (3): 243-57. ... oxygenase", also called a quinone-forming monooxygenase, many of which are important 'tailoring enzymes' in the biosynthesis of ...
ISBN 0-935702-73-3. Kikuchi, G.; Yoshida, T.; Noguchi, M. (2005). "Heme oxygenase and heme degradation". Biochemical and ...
Kikuchi G, Yoshida T, Noguchi M (December 2005). "Heme oxygenase and heme degradation". Biochem Biophys Res Commun. 338 (1): ... where an enzyme called heme oxygenase instead breaks excess heme into biliverdin, iron, and carbon monoxide. Several mechanisms ...
NRF2 increases heme oxygenase 1 leading to an increase in phase II enzymes in vitro. NRF2 also inhibits the NLRP3 inflammasome ... Heme oxygenase-1 (HMOX1, HO-1) is an enzyme that catalyzes the breakdown of heme into the antioxidant biliverdin, the anti- ... Heme oxygenase Carbon monoxide-releasing molecules GRCh38: Ensembl release 89: ENSG00000116044 - Ensembl, May 2017 GRCm38: ... Wang J, Doré S (June 2007). "Heme oxygenase-1 exacerbates early brain injury after intracerebral haemorrhage". Brain. 130 (Pt 6 ...
Kikuchi, G.; Yoshida, T.; Noguchi, M. (2005). "Heme oxygenase and heme degradation". Biochemical and Biophysical Research ...
The oxygenases form a class of oxidoreductases; their EC number is EC 1.13 or EC 1.14. Oxygenases were discovered in 1955 ... An oxygenase is any enzyme that oxidizes a substrate by transferring the oxygen from molecular oxygen O2 (as in air) to it. ... Hayaishi was awarded the 1986 Wolf Prize in Medicine "for the discovery of the oxygenase enzymes and elucidation of their ... SW, Ryter; J, Alam (April 2006). "Heme oxygenase-1/carbon monoxide: from basic science to therapeutic applications". Physiol ...
Pyrimidine oxygenase (EC 1.14.99.46, RutA) is an enzyme with systematic name uracil,FMNH2:oxygen oxidoreductase (uracil ... Pyrimidine+oxygenase at the US National Library of Medicine Medical Subject Headings (MeSH) Biology portal. ...
HEME_OXYGENASE (PS00593). Accession PS00593 Integration. Haem oxygenase conserved site (IPR018207) Member database. PROSITE ...
Inhibition of 2-oxoglutarate dependent oxygenases.. Rose NR1, McDonough MA, King ON, Kawamura A, Schofield CJ. ... Several 2OG oxygenases are now being targeted for therapeutic intervention for diseases including anaemia, inflammation and ... In this critical review, we describe studies on the inhibition of 2OG oxygenases, focusing on small molecules, and discuss the ... Commercial applications of 2OG oxygenase inhibitors began with plant growth retardants, and now extend to a clinically used ...
If you know of any papers that use this antibody, please contact us at antibodies [at] alzforum [dot] org for consideration in the References section.. ...
Haem oxygenase HugZ-like superfamily (IPR037119). Short name: Haem_oxidase_HugZ-like_sf ... Crystal structure of Campylobacter jejuni ChuZ: A split-barrel family heme oxygenase with a novel heme-binding mode.. Biochem. ... Crystal structure of HugZ, a novel heme oxygenase from Helicobacter pylori.. J. Biol. Chem. 286 1537-44 2011 ... a class of heme oxygenase that belongs to the PPOX family and lacks homology to the HmuO family. This enzyme releases iron ...
The Heme Oxygenase System in Hematological Malignancies.. Li Volti G1,2, Tibullo D3, Vanella L4, Giallongo C3, Di Raimondo F3, ... Among these pathways, the heme oxygenase-1 (HO-1) pathway is likely to play a major role. HO catalyzes the enzymatic ...
Crystal Structure of the Dioxygen-bound Heme Oxygenase from Corynebacterium diphtheriae: IMPLICATIONS FOR HEME OXYGENASE ... Mammalian heme oxygenase (Hmox, also known as HO; EC 1.14.99.3), which catabolizes cellular heme to biliverdin, carbon monoxide ... Heme Oxygenase-1 Gene Activation by the NAD(P)H Oxidase Inhibitor 4-(2-Aminoethyl) Benzenesulfonyl Fluoride via a Protein ... Heme oxygenase 1 is required for mammalian iron reutilization. Kenneth D. Poss and Susumu Tonegawa ...
RoxB Is a Novel Type of Rubber Oxygenase That Combines Properties of Rubber Oxygenase RoxA and Latex Clearing Protein (Lcp) ... Rubber oxygenase A (RoxA) is one of only two known enzymes able to catalyze the oxidative cleavage of latex for biodegradation ... Structure of the processive rubber oxygenase RoxA from Xanthomonas sp Message Subject (Your Name) has sent you a message from ... Structure of the processive rubber oxygenase RoxA from Xanthomonas sp. Julian Seidel, Georg Schmitt, Maren Hoffmann, Dieter ...
... Anikó Pósa,1 Renáta Szabó,1 Anett Csonka,1 ... A. M. K. Choi, "Heme oxygenase-1 protects the heart," Circulation Research, vol. 89, no. 2, pp. 105-107, 2001. View at Google ... T. M. Chen, J. Li, L. Liu et al., "Effects of heme oxygenase-1 upregulation on blood pressure and cardiac function in an animal ... Y. M. Lee, P. Y. Cheng, S. F. Hong et al., "Oxidative stress induces vascular heme oxygenase-1 expression in ovariectomized ...
Porphobilinogen oxygenase and horseradish peroxidase show dual oxygenase and peroxidase activities. By treating porphobilinogen ... oxygenase with phenylhydrazine in the presence of H2O2both activities... ... The dual oxygenase and peroxidase activities of porphobilinogen oxygenase and horseradish peroxidase: a study using the ... The oxygenase and peroxidase activities of porphobilinogen oxygenase were entirely recovered in the reconstituted enzyme, while ...
RoxB Is a Novel Type of Rubber Oxygenase That Combines Properties of Rubber Oxygenase RoxA and Latex Clearing Protein (Lcp) ...
5-bisphosphate carboxylase/oxygenase, Rubisco, plays an important role in photosynthesis as well as in photorespiration. In ... Miziorko, H. M., and Lorimer, G., 1983, Ribulose-1,5-bisphosphate carboxylase-oxygenase, Annu. Rev. Biochem., 52: 507.CrossRef ... Andersson, I., and Branden, C.-I., 1984, Large single crystals of spinach 1,5-bisphosphate carboxylase/oxygenase suitable for X ... Knight S., Andersson I., Branden CI., Lorimer G. (1989) Structural Studies of Ribulose-1, 5-Bisphosphate Carboxylase/Oxygenase ...
Heme oxygenase 1. A, B. 288. Homo sapiens. Mutation(s): 0 Gene Names: HMOX1, HO, HO1. EC: 1.14.14.18. ... Heme oxygenase-1 (HO-1, HMOX1) degrades pro-oxidant heme into carbon monoxide (CO), ferrous ions (Fe 2+ ) and biliverdin. The ... Heme oxygenase-1 (HO-1, HMOX1) degrades pro-oxidant heme into carbon monoxide (CO), ferrous ions (Fe 2+ ) and biliverdin. The ... Development and characterization of a new inhibitor of heme oxygenase activity for cancer treatment.. Mucha, O., Podkalicka, P. ...
Heme oxygenase-1 (HO-1, encoded by HMOX1) dampens inflammatory reactions via the catabolism of heme into CO, Fe, and biliverdin ...
Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to ... Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are ...
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
X. N. Nguyen and P. A. Dennery, "Nuclear translocation of heme oxygenase-1 and heme oxygenase-2 proteins: a novel signaling ... Heme-oxygenase enzymes were inhibited by tin protoporphyrine IX (SnPP; 30.0 mg/kg, s.c., pH 7.4, 24 hours and one hour before ... heme oxygenase 1; HO-2: heme oxygenase 2; AVP: Arginine vasopressin. ... Panel (a): heme-oxygenase 2 (HO-2) (expressed as %) in the aortic tissue of male (the black square) and female (the grey square ...
... inositol oxygenase activity, oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, inositol ... Inositol oxygenaseAdd BLAST. 285. Amino acid modifications. Feature key. Position(s). DescriptionActions. Graphical view. ... Inositol oxygenase (MIOX). This subpathway is part of the pathway myo-inositol degradation into D-glucuronate, which is itself ... "Structural and biophysical characterization of human myo-inositol oxygenase.". Thorsell A.G., Persson C., Voevodskaya N., Busam ...
... is one of the three isoforms of the heme oxygenase enzyme that catabolyzes the degradation of heme into biliverdin with the ... Heme oxygenase-1 (HO-1) is one of the three isoforms of the heme oxygenase enzyme that catabolyzes the degradation of heme into ... Heme oxygenase Carbon monoxide Inflammation Autoimmunity Allergy Infection Transplantation Dendritic cell Lymphocyte Macrophage ... Blancou P and Anegon I (2010) Heme oxygenase-1 and dendritic cells: what else? J Leuckoc Biol 87: 185-187.CrossRefGoogle ...
Buy our Recombinant Human Heme Oxygenase 1 protein. Ab86919 is a protein fragment produced in Escherichia coli and has been ... Recombinant Human Heme Oxygenase 1 protein. See all Heme Oxygenase 1 proteins and peptides. ... Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to ... Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are ...
Carotenoid Cleavage Oxygenases from Microbes and Photosynthetic Organisms: Features and Functions Oussama Ahrazem 1. , Lourdes ... "Carotenoid Cleavage Oxygenases from Microbes and Photosynthetic Organisms: Features and Functions." Int. J. Mol. Sci. 17, no. ... Carotenoid Cleavage Oxygenases from Microbes and Photosynthetic Organisms: Features and Functions. International Journal of ... Ahrazem, O.; Gómez-Gómez, L.; Rodrigo, M.J.; Avalos, J.; Limón, M.C. Carotenoid Cleavage Oxygenases from Microbes and ...
The Structure of Nitric Oxide Synthase Oxygenase Domain and Inhibitor Complexes. By Brian R. Crane, Andrew S. Arvai, Ratan ... The Structure of Nitric Oxide Synthase Oxygenase Domain and Inhibitor Complexes. By Brian R. Crane, Andrew S. Arvai, Ratan ... The Structure of Nitric Oxide Synthase Oxygenase Domain and Inhibitor Complexes Message Subject. (Your Name) has forwarded a ... The nitric oxide synthase oxygenase domain (NOSox) oxidizes arginine to synthesize the cellular signal and defensive cytotoxin ...
Oxygenase that can act as both a histone lysine demethylase and a ribosomal histidine hydroxylase. Is involved in the ... "Oxygenase-catalyzed ribosome hydroxylation occurs in prokaryotes and humans.". Ge W., Wolf A., Feng T., Ho C.H., Sekirnik R., ... "Oxygenase-catalyzed ribosome hydroxylation occurs in prokaryotes and humans.". Ge W., Wolf A., Feng T., Ho C.H., Sekirnik R., ... Ribosomal oxygenase 2Add BLAST. 465. Amino acid modifications. Feature key. Position(s). DescriptionActions. Graphical view. ...
View mouse Riox1 Chr12:83950608-83952951 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled- ... Ribulose-1,5-bisphosphate carboxylase oxygenase Is the Subject Area "Ribulose-1,5-bisphosphate carboxylase oxygenase" ...
Oxygenase · Oxygenases · Pcr primers · Primer sets · Short rods · Benzene · bacterial enzyme · benzene · benzene oxygenase · ... Biology · cholesterol 7alpha monooxygenase · insulin · oxygenase · sterol 27 hydroxylase · unclassified drug · animal cell · ... Oxidative stress was apparent from strong upregulation of heme oxygenase, peroxiredoxin 1 and other genes. Bromobenzene-induced ... Chemicals/CAS: cholesterol 7alpha monooxygenase, 9037-53-0; insulin, 9004-10-8; oxygenase, 9037-29-0, 9046-59-7; sterol 27 ...
Cyclo-oxygenase (COX) inhibitors for treating preterm labour. Not enough evidence on whether COX inhibitors administered to ... Cyclo-oxygenase (COX) inhibitors inhibit uterine contractions, are easily administered and appear to have few maternal side ... Reinebrant HE, Pileggi-Castro C, Romero CLT, dos Santos RAN, Kumar S, Souza J, Flenady V. Cyclo-oxygenase (COX) inhibitors for ...
Mixed Function Oxygenases: Widely distributed enzymes that carry out oxidation-reduction reactions in which one atom of the ... Oxygenases: 89*Mixed Function Oxygenases: 449*Prostaglandin-Endoperoxide Synthases: 5248. *Cytochrome P-450 Enzyme System: 3623 ... Mixed Function Oxygenases (Monooxygenases). Subscribe to New Research on Mixed Function Oxygenases ...
Heme oxygenase exists in at least two isozyme forms: heme oxygenase-1 and heme oxygenase-2, each of which differs in tissue ... Antibodies for Heme Oxygenase-1 Detection. Anti-Heme Oxygenase-1 Antibody, Monoclonal (Clone GTS-1) and Anti-Heme Oxygenase-1 ... Heme oxygenase‑1. M174. IHC. WB. Heme oxygenase‑1 inhibition assay. Rat. (GTS-1). Mouse IgG1 MoAb. Cross-reacts with human and ... Heme oxygenase‑1. M175. IHC. WB. Heme oxygenase‑1 inhibition assay. Rat. (GTS-3). Mouse IgG1 MoAb. Cross-reacts with human HO‑1 ...
  • Commercial applications of 2OG oxygenase inhibitors began with plant growth retardants, and now extend to a clinically used pharmaceutical compound for cardioprotection. (nih.gov)
  • Cyclo-oxygenase (COX) inhibitors inhibit uterine contractions, are easily administered and appear to have few maternal side effects. (cochrane.org)
  • We conclude that the pressor response to heme oxygenase inhibitors results from withdrawal of the inhibitory influence of endogenous carbon monoxide on a pressor mechanism mediated by the autonomic nervous system. (ahajournals.org)
  • Do selective cyclo-oxygenase-2 inhibitors and traditional non-steroidal anti-inflammatory drugs increase the risk of atherothrombosis? (bmj.com)
  • Objective To assess the effects of selective cyclo-oxygenase-2 (COX 2) inhibitors and traditional non-steroidal anti-inflammatory drugs (NSAIDs) on the risk of vascular events. (bmj.com)
  • Whereas NSAIDs inhibit the two recognised forms of prostaglandin G/H synthase (also referred to as cyclo-oxygenase), selective cyclo-oxygenase-2 (COX 2) inhibitors are selective inhibitors of the COX 2 isozyme. (bmj.com)
  • The present study assessed the effectiveness of a novel class of selective heme oxygenase (HO) inhibitors in models of inflammatory and neuropathic pain in rats. (queensu.ca)
  • 2006) Risk of upper gastrointestinal ulcer bleeding associated with selective cyclo-oxygenase-2 inhibitors, traditional non-aspirin non-steroidal anti-inflammatory drugs, aspirin and combinations. (scirp.org)
  • Jones, P. and Lamdin, R. (2010) Oral Cyclo-Oxygenase 2 Inhibitors versus Other Oral Analgesics for Acute Soft Tissue Injury Systematic Review and Meta-Analysis. (scirp.org)
  • Use of cyclo-oxygenase 2 inhibitors (COX-2) and prescription non-steroidal anti-inflammatory drugs (NSAIDS) in UK and USA populations. (rti.org)
  • Effectiveness of novel imidazole-dioxolane heme oxygenase inhibitors in renal proximal tubule epithelial cells. (semanticscholar.org)
  • Abstract Heme oxygenase is a mammalian enzyme that converts heme to biliverdin and carbon monoxide. (ahajournals.org)
  • Sexual dimorphism of cardiovascular ischemia susceptibility is mediated by heme oxygenase," Oxidative Medicine and Cellular Longevity , vol. 2013, Article ID 521563, 11 pages, 2013. (hindawi.com)
  • 3 The enzyme activity of the cyclo-oxygenase/prostaglandin E (PGE) isomerase was measured in cell membranes from control cells and dexamethasone-treated cells. (wiley.com)
  • The combined efficacy of selective and non-selective cyclo-oxygenase-2 (COX-2) inhibition on the axial manifestations of ankylosing spondylitis (AS) in the presence or absence of chronic peripheral arthritis was evaluated. (bmj.com)
  • Non-steroidal anti-inflammatory drugs (NSAIDs) acting via inhibition of cyclo-oxygenase-2 (COX-2) have been the cornerstone of treatment for patients with AS since the introduction of phenylbutazone. (bmj.com)
  • Hayaishi was awarded the 1986 Wolf Prize in Medicine "for the discovery of the oxygenase enzymes and elucidation of their structure and biological importance. (wikipedia.org)
  • 2-Oxoglutarate (2OG) dependent oxygenases are ubiquitous iron enzymes that couple substrate oxidation to the conversion of 2OG to succinate and carbon dioxide. (nih.gov)
  • Rubber oxygenase A (RoxA) is one of only two known enzymes able to catalyze the oxidative cleavage of latex for biodegradation. (pnas.org)
  • The enzyme β-carotene 15,15'-oxygenase (BCO1) is a member of a large and diverse family of non-heme iron-dependent carotenoid cleavage enzymes. (plos.org)
  • The oxygenase belongs to the class of general drug-metabolizing enzymes and it may act on different compounds which can undergo sulphoxidation. (biochemj.org)
  • Heme oxygenases are enzymes that are involved in the degradation of heme. (perkinelmer.com)
  • IMPORTANCE Sulfur oxygenase reductases (SORs) are the only enzymes catalyzing an oxygen-dependent disproportionation of elemental sulfur and/or polysulfides to sulfite, thiosulfate, and hydrogen sulfide. (uni-muenchen.de)
  • Heme oxygenase (HO) is a family of microsomal enzymes with high conservatism in evolution. (scielo.br)
  • Heme oxygenase-1 (HO-1, HMOX1) degrades pro-oxidant heme into carbon monoxide (CO), ferrous ions (Fe 2+ ) and biliverdin. (rcsb.org)
  • Heme oxygenase-1 (HO-1, encoded by HMOX1) dampens inflammatory reactions via the catabolism of heme into CO, Fe, and biliverdin. (jci.org)
  • Auf www.antikoerper-online.de finden Sie aktuell 63 Heme Oxygenase (Decycling) 1 (HMOX1) ELISA Kits von 15 unterschiedlichen Herstellern. (antikoerper-online.de)
  • This entry represents a domain superfamily that can be found in a group of putative haem-iron utilisation proteins, such as HugZ, a class of heme oxygenase that belongs to the PPOX family and lacks homology to the HmuO family. (ebi.ac.uk)
  • Ren H, Leib S L, Ferriero D M, et al (2007) Induction of haem oxygenase-1 causes cortical non-haem iron increase in experimental pneumococcal meningitis: evidence that concomitant ferritin up-regulation prevents iron-induced oxidative damage. (springer.com)
  • Induction or ectopic overexpression of HO-1 (haem oxygenase 1) protects against a wide variety of disorders. (portlandpress.com)
  • Inhibition of 2-oxoglutarate dependent oxygenases. (nih.gov)
  • In this critical review, we describe studies on the inhibition of 2OG oxygenases, focusing on small molecules, and discuss the potential of 2OG oxygenases as therapeutic targets (295 references). (nih.gov)
  • Anti-Heme Oxygenase-1 Antibody, Monoclonal (Clone GTS-1) and Anti-Heme Oxygenase-1 Antibody, Monoclonal (Clone GTS-3) are sodium azide-free and can be used directly form heme oxygenase-1 inhibition assays. (clontech.com)
  • Zinc deuteroporphyrin 2,4-bis glycol (ZnDPBG) inhibits heme oxygenase in rats and thus permits assessment of the hemodynamic response to inhibition of endogenous carbon monoxide synthesis. (ahajournals.org)
  • Gong X, Marisiddaiah R, Rubin LP (2017) Inhibition of pulmonary β-carotene 15, 15'-oxygenase expression by glucocorticoid involves PPARα. (plos.org)
  • Inhibition of heme oxygenase activity in newborn mice by azalanstat. (semanticscholar.org)
  • Inhibition of heme oxygenase after oral vs intraperitoneal administration of chromium porphyrins. (semanticscholar.org)
  • View detailed Heme Oxygenase 1 antibody specifications by linking to the specific product blocks. (scbt.com)
  • In this study, we investigated whether expression of the metabolic gene, heme oxygenase-1 (HO-1) in tumor microenvironment imparts significant effects on prostate cancer progression. (harvard.edu)
  • Heme oxygenase 1 (HO-1) serves as a protective gene. (clinicaltrials.gov)
  • Basal and inducer‐dependent transcription activity of the heme oxygenase‐1 gene promoter can be measured using the luciferase reporter gene in transfection assays. (currentprotocols.com)
  • A MI oxygenase (MIOX) gene was identified in chromosome 4 ( miox4 ) of Arabidopsis ecotype Columbia, and its enzymatic activity was confirmed in bacterially expressed recombinant protein. (plantphysiol.org)
  • Complementation analysis and regulation of CO2 fixation gene expression in a ribulose 1,5-bisphosphate carboxylase-oxygenase deletion strain of Rhodospirillum rubrum. (asm.org)
  • Thus, we investigated the effect of Hcy on the gene expression of heme oxygenase-1 (HO-1), the primary rate-limiting enzyme in heme catabolism and a key anti-oxidant detoxification enzyme in maintaining cellular redox homeostasis. (biomedcentral.com)
  • 9 10 11 ZnDPBG has been shown to inhibit endogenous carbon monoxide production in rats 12 and thus permits the physiological actions of heme oxygenase activity to be studied in vivo. (ahajournals.org)
  • 3-Hydroxyanthranilic acid oxygenase (3HAO) is the biosynthetic enzyme for quinolinic acid, an endogenous agonist of the NMDA glutamate receptor subtype and a potent neurotoxin. (jneurosci.org)
  • Sequence comparisons showed that the sulfur oxygenase reductase (SOR) of the haloalkaliphilic bacterium Thioalkalivibrio paradoxus Arh 1 (TpSOR) is branching deeply within dendrograms of these proteins (29 to 34% identity). (uni-muenchen.de)
  • Yachie A, Niida Y, Wada T, et al (1999) Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. (springer.com)
  • The AlphaLISA ® immunoassay kit for human heme oxygenase 2 (HO-2) enables the quantitative determination of human HO-2 in serum, buffered solution, and cell culture supernatants using a homogeneous AlphaLISA assay (no wash steps). (perkinelmer.com)
  • Vareille M, Rannou F, Thelier N, et al (2008) Heme oxygenase-1 is a critical regulator of nitric oxide production in enterohemorrhagic Escherichia coli -infected human enterocytes. (springer.com)
  • The nitric oxide synthase oxygenase domain (NOS ox ) oxidizes arginine to synthesize the cellular signal and defensive cytotoxin nitric oxide (NO). Crystal structures determined for cytokine-inducible NOS ox reveal an unusual fold and heme environment for stabilization of activated oxygen intermediates key for catalysis. (sciencemag.org)
  • Computer model showing the dimeric structure of murine nitric oxide synthase oxygenase (yellow, pink-red). (sciencephoto.com)
  • Inflammation and stress result in the induction of "protective genes" such as the inducible forms of heme oxygenase 1 (HO-1) and nitric oxide (NO) synthase II (inducible NO synthase [iNOS]) that generate the gaseous molecules carbon monoxide (CO) and NO, respectively. (rupress.org)
  • Oxidative stress induces vascular heme oxygenase-1 expression in ovariectomized rats," Free Radical Biology and Medicine , vol. 39, no. 1, pp. 108-117, 2005. (hindawi.com)
  • Heme oxygenase-1 (HO-1) is one of the three isoforms of the heme oxygenase enzyme that catabolyzes the degradation of heme into biliverdin with the production of free iron and CO. HO-1 is induced by its substrate and by other stimuli, including agents involved in oxidative stress and proinflammatory cytokines as well as several anti-inflammatory stimuli. (springer.com)
  • Heme oxygenase 1 (HO-1) and its metabolites have been implicated in the cytoprotective defense against oxidative injury in atherogenesis. (ahajournals.org)
  • Activation of heme oxygenase-1 (HO-1), a heme-degrading enzyme responsive to a wide range of cellular stress, is traditionally considered to convey adaptive responses to oxidative stress, inflammation and vasoconstriction. (biomedsearch.com)
  • These may be atheroprotective in view of raised heme oxygenase 1 (HO-1), CD163, and interleukin-10 expression and suppressed oxidative stress. (ahajournals.org)
  • Heme oxygenases have been characterized as markers for oxidative stress, metabolic disorders and inflammation. (perkinelmer.com)
  • Heme oxygenase (HO) is a microsomal enzyme involved in cellular response to oxidative stress. (acris-antibodies.com)
  • In cellular anti-oxidant systems, heme oxygenase-1 (HO-1) is an oxidative-sensor protein induced by ROS generation or carbon monoxide (CO) release. (frontiersin.org)
  • Heme oxygenase-1 (HO-1) is a highly inducible, detoxifying enzyme critical for limiting oxidative stress, inflammation, and cellular injury within the central nervous system (CNS) and other tissues. (upenn.edu)
  • Nath K A, Vercellotti G M, Grande J P, et al (2001) Heme protein-induced chronic renal inflammation: suppressive effect of induced heme oxygenase-1. (springer.com)
  • Heme oxygenase-1 (HO-1) is a microsomal enzyme that degrades heme, a prosthetic group of the heme protein family (e.g., hemoglobin), into the bile pigment biliverdin. (clontech.com)
  • Zusätzlich bieten wir Ihnen Heme Oxygenase (Decycling) 1 Antikörper (375) und Heme Oxygenase (Decycling) 1 Proteine (36) und viele weitere Produktgruppen zu diesem Protein an. (antikoerper-online.de)
  • Heme oxygenase-1 (HO-1), a stress-inducible protein, also regulates IL-10 and TNF-α production. (jimmunol.org)
  • Recently, the involvement of the heme oxygenase (HO) pathway in antidegenerative mechanisms has received considerable attention, as it has been demonstrated that the expression of HO is closely related to that of amyloid precursor protein. (unboundmedicine.com)
  • Among these pathways, the heme oxygenase-1 (HO-1) pathway is likely to play a major role. (nih.gov)
  • Bijjem, Padi, lal Sharma: Pharmacological activation of heme oxygenase (HO)-1/carbon monoxide pathway prevents the development of peripheral neuropathic pain in Wistar rats. (antikoerper-online.de)
  • We previously demonstrated that a prominent component of cigarette smoke, CO, suppresses Th17-mediated experimental colitis in IL-10 −/− mice through a heme oxygenase (HO)-1-dependent pathway. (jimmunol.org)
  • The Rat Heme Oxygenase-1 EIA Kit (Precoated) is a solid phase sandwich ELISA that utilizes two mouse monoclonal heme oxygenase-1 antibodies, one of which is coated on the plate and the other of which is peroxidase-labeled. (clontech.com)
  • These antibodies can also be used for detection of heme oxygenase-1 by Western blot (WB) and immunohistochemistry (IHC) in frozen and paraffin-embedded tissues. (clontech.com)
  • Santa Cruz Biotechnology, Inc. offers a broad range of Heme Oxygenase 1 antibodies. (scbt.com)
  • Select Heme Oxygenase 1 antibodies from monoclonal antibodies listed below. (scbt.com)
  • Select appropriate Heme Oxygenase 1 antibodies for your research by isotype, epitope, applications and species reactivity. (scbt.com)
  • Heme oxygenase-1 (HO-1), the rate-limiting enzyme in the heme metabolism, has been implicated in a various cellular processes, such as inflammatory injury and anti-oxidant/oxidant homeostasis. (eurekamag.com)
  • Conceivably, upregulation of myo -inositol oxygenase (MIOX) is associated with altered cellular redox. (diabetesjournals.org)
  • The primary function of heme oxygenase-1 (HO1) is to catalyze the degradation of heme into biliverdin, ferrous iron, and carbon monoxide. (diabetesjournals.org)
  • The degradation of heme is catalyzed by heme oxygenase (HO) isozymes, producing equimolar quantities of carbon monoxide (CO), ferrous iron (Fe 2+ ), and biliverdin, which is converted rapidly to bilirubin ( Maines, 1997 ). (jneurosci.org)
  • Heme oxygenase (HO) is the first and rate-limiting step in degradation of heme, and in the presence of NADPH-cytochrome P-450 reductase it produces equimolar amounts of biliverdin and CO. CO produced in a closed system can be quantified as described in this unit by gas chromatography as a measure of HO activity in tissue slices, tissue homogenates, and tissue fractions. (semanticscholar.org)
  • George J F, Braun A, Brusko T M, et al (2008) Suppression by CD4+CD25+ regulatory T cells is dependent on expression of heme oxygenase-1 in antigen-presenting cells. (springer.com)
  • Heme oxygenase exists in at least two isozyme forms: heme oxygenase-1 and heme oxygenase-2, each of which differs in tissue expression and inducibility. (clontech.com)
  • Heme oxygenase (HO)-1 expression was investigated in rat isolated pancreatic islets. (nih.gov)
  • Robaczewska, Kędziora-Kornatowska, Kucharski, Nowak, Muszalik, Kornatowski, Kędziora: Decreased expression of heme oxygenase is associated with depressive symptoms and may contribute to depressive and hypertensive comorbidity. (antikoerper-online.de)
  • Although it is known that CO can induce production of NO and that NO can induce expression of the cytoprotective enzyme heme oxygenase 1 (HO-1), there is no information whether the protective effect of CO ever requires NO production or whether either gas must induce expression of HO-1 to exert its functional effects. (rupress.org)
  • AKI induces upregulation of heme oxygenase 1 (HO-1), which exerts cytoprotective effects and modulates the renal response to injury, suggesting that a biomarker of intrarenal HO-1 activity may be useful. (asnjournals.org)
  • Oxygenases consist of both constitutive and inducible isozymes (HO-1, HO-2). (wikipedia.org)
  • Heme oxygenase (HO) isozymes are thought to detoxify the pro-oxidant heme to the potent antioxidant, bilirubin. (jneurosci.org)
  • HO-1 and HO-2 are the two principal isozymes of heme oxygenase. (jneurosci.org)
  • Two heme oxygenase isozymes, termed HO 1 and HO 2, have been identified so far. (acris-antibodies.com)
  • 7 There has been speculation that heme oxygenase-generated carbon monoxide production might play a physiological role in blood pressure (BP) regulation, 3 8 but no such role has been established. (ahajournals.org)
  • Heme oxygenase activity as measured by carbon monoxide production. (semanticscholar.org)
  • The organic nitrate pentaerythritol tetranitrate is devoid of nitrate tolerance, which has been attributed to the induction of the antioxidant enzyme heme oxygenase (HO)-1. (ahajournals.org)
  • Heme oxygenase 1 (HO-1), the inducible isoform of the family of heme oxygenases, degrades heme into the metabolites carbon monoxide, biliverdin, and ferrous iron. (ahajournals.org)
  • For example, heme oxygenase-1 (HO-1), an enzyme that degrades heme, inhibits dendritic cell maturation. (bloodjournal.org)
  • Several 2OG oxygenases are now being targeted for therapeutic intervention for diseases including anaemia, inflammation and cancer. (nih.gov)
  • Heme oxygenase (HO)-2 deficiency impairs wound healing and exacerbates inflammation following injury. (sigmaaldrich.com)
  • The importance of HO-1 in physiological and pathological states is underlined by the versatility of HO-1 inducers and the cytoprotective effects attributed to heme oxygenase products in conditions that are associated with moderate or severe cellular stress, such as inflammation, endotoxemia, ischemia, and radiation ( 8 ). (jimmunol.org)
  • Relevance of Nrf2 and heme oxygenase-1 in articular diseases. (medworm.com)
  • Activation of Nrf2 results in the synthesis of heme oxygenase-1 (HO-1) leading to the formation of a number of bioactive metabolites, mainly CO, biliverdin and bilirubin. (medworm.com)
  • Astrocyte overexpression of heme oxygenase-1 improves outcome after intracerebral hemorrhage. (sigmaaldrich.com)
  • To investigate the role of heme oxygenase-1 (HO-1) in the regulation of inflammatory reaction, neuronal cell proliferation and apoptosis in rats after intracerebral hemorrhage (ICH). (dovepress.com)
  • The effect of heme oxygenase on ganglioside redistribution within hepatocytes in experimental estrogen-induced cholestasis. (semanticscholar.org)
  • Effects of heme oxygenase-1 upregulation on blood pressure and cardiac function in an animal model of hypertensive myocardial infarction," International Journal of Molecular Sciences , vol. 14, no. 2, pp. 2684-2706, 2013. (hindawi.com)
  • The role of 2-oxoglutarate oxygenases in the hypoxic and other signalling pathways is discussed. (portlandpress.com)
  • It is established that the cytoprotective enzyme heme oxygenase-1 (HO-1) is over-expressed in several cancers, and may play a significant role in the growth and metastasis of tumors by inducing cell survival pathways. (aacrjournals.org)
  • Oxygenase that can act as both a histone lysine demethylase and a ribosomal histidine hydroxylase. (uniprot.org)
  • Ribulose-1, 5-bisphosphate carboxylase/oxygenase, Rubisco, plays an important role in photosynthesis as well as in photorespiration. (springer.com)
  • The possibility to increase the carboxylase/oxygenase ratio has therefore attracted substantial interest. (springer.com)
  • Is the Subject Area "Ribulose-1,5-bisphosphate carboxylase oxygenase" applicable to this article? (plos.org)
  • Various studies indicate that ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is present in the pyrenoid, although the fraction of Rubisco localized there remains controversial. (plantphysiol.org)
  • A ribulose 1,5-bisphosphate carboxylase-oxygenase (RubisCO) deletion strain of Rhodospirillum rubrum that was incapable of photolithoautotrophic growth was constructed. (asm.org)
  • Kinetics and equilibrium binding of the dyes TNS and RH421 to ribulose 1,5 bisphosphate carboxylase/oxygenase (rubisco). (wur.nl)
  • Chung S W, Liu X, Macias A A, et al (2008) Heme oxygenase-1-derived carbon monoxide enhances the host defense response to microbial sepsis in mice. (springer.com)
  • Yet S F, Perrella M A, Layne M D, et al (1999) Hypoxia induces severe right ventricular dilatation and infarction in heme oxygenase-1 null mice. (springer.com)
  • Lee T S and Chau L Y (2002) Heme oxygenase-1 mediates the anti-inflammatory effect of interleukin-10 in mice. (springer.com)
  • Heme oxygenase-1 (HO-1) catalyzes the rate-limiting reaction of heme breakdown and may have both antioxidant and pro-oxidant effects. (sigmaaldrich.com)
  • Heme oxygenase -1 (HO-1) play a protective antioxidant role in the lung. (ersjournals.com)
  • Heme oxygenase-1 (HO-1) is a key cytoprotective, antioxidant, and antiinflammatory molecule. (rupress.org)
  • Heme oxygenase (HO)-1 has potent antioxidant and anti-inflammatory functions. (go.jp)
  • Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. (rcsb.org)
  • Heme oxygenase is a widely distributed enzyme that daily converts almost 1% of the heme in blood to biliverdin and carbon monoxide. (ahajournals.org)
  • Heme oxygenase (HO) is the enzyme that breaks down heme to form carbon monoxide, free iron, and biliverdin. (queensu.ca)
  • Heme oxygenase (HO) is the rate-limiting enzyme in heme catabolism, leading to the generation of biliverdin, free iron, and carbon monoxide (CO) ( 5 , 6 , 7 ). (jimmunol.org)
  • Poss KD and Tonegawa S (1997) Heme oxygenase 1 is required for mammalian iron reutilization. (springer.com)
  • To investigate the relations of neuropeptide Y (NPY) and heme oxygenase-1 (HO-1) expressions with fetal brain injury in rats with intrahepatic cholestasis of pregnancy (ICP). (scielo.br)
  • Kapturczak M H, Wasserfall C, Brusko T, et al (2004) Heme oxygenase-1 modulates early inflammatory responses: evidence from the heme oxygenase-1-deficient mouse. (springer.com)
  • made the seminal observation that heme oxygenase-1 (HO-1), the enzyme that is responsible for heme degradation, is upregulated in proximal tubule cells in response to oxidant stress, 1 and once induced, it confers dramatic cytoprotective and anti-inflammatory effects. (asnjournals.org)
  • In addition to gluconeogenic genes, Foxo1 also regulates other target genes ( 8 - 10 ), one of which, heme oxygenase-1 (HO1), has attracted attention in recent years ( 11 ). (diabetesjournals.org)
  • In addition, Rubisco has an oxygenase activity whereby oxygen is added to ribulose 1, 5-bisphosphate to yield 3-D-phosphoglycerate and 2-phosphoglycolate, the major substrate for photorespiration. (springer.com)
  • 2-Oxoglutarate-Dependent Oxygenases 1st Edition by Christopher Schofield and Publisher Royal Society of Chemistry. (vitalsource.com)
  • These constitute a major intracellular source of iron and carbon monoxide There are two types of oxygenases: Monooxygenases, or mixed function oxidase, transfer one oxygen atom to the substrate, and reduce the other oxygen atom to water. (wikipedia.org)
  • 6 A recent study has provided evidence that a subset of glutamate receptors, involved in the function of the afferent arm of the baroreceptor reflex, may be coupled with heme oxygenase-mediated production of carbon monoxide. (ahajournals.org)
  • Ryter S W, Alam J, and Choi A M (2006) Heme oxygenase-1/carbon monoxide: from basic science to therapeutic applications. (springer.com)
  • Heme oxygenase-1: an emerging therapeutic target to curb cardiac pathology. (biomedsearch.com)
  • Belongs to the heme oxygenase family. (abcam.com)
  • Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. (rcsb.org)
  • therefore, heme oxygenase-1 monitoring may prove useful for the identification of physiological stress inducers. (clontech.com)