An serine-threonine protein kinase that requires the presence of physiological concentrations of CALCIUM and membrane PHOSPHOLIPIDS. The additional presence of DIACYLGLYCEROLS markedly increases its sensitivity to both calcium and phospholipids. The sensitivity of the enzyme can also be increased by PHORBOL ESTERS and it is believed that protein kinase C is the receptor protein of tumor-promoting phorbol esters.
A family of enzymes that catalyze the conversion of ATP and a protein to ADP and a phosphoprotein.
A group of enzymes that are dependent on CYCLIC AMP and catalyze the phosphorylation of SERINE or THREONINE residues on proteins. Included under this category are two cyclic-AMP-dependent protein kinase subtypes, each of which is defined by its subunit composition.
A CALMODULIN-dependent enzyme that catalyzes the phosphorylation of proteins. This enzyme is also sometimes dependent on CALCIUM. A wide range of proteins can act as acceptor, including VIMENTIN; SYNAPSINS; GLYCOGEN SYNTHASE; MYOSIN LIGHT CHAINS; and the MICROTUBULE-ASSOCIATED PROTEINS. (From Enzyme Nomenclature, 1992, p277)
A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.
A superfamily of PROTEIN-SERINE-THREONINE KINASES that are activated by diverse stimuli via protein kinase cascades. They are the final components of the cascades, activated by phosphorylation by MITOGEN-ACTIVATED PROTEIN KINASE KINASES, which in turn are activated by mitogen-activated protein kinase kinase kinases (MAP KINASE KINASE KINASES).
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
An intracellular signaling system involving the MAP kinase cascades (three-membered protein kinase cascades). Various upstream activators, which act in response to extracellular stimuli, trigger the cascades by activating the first member of a cascade, MAP KINASE KINASE KINASES; (MAPKKKs). Activated MAPKKKs phosphorylate MITOGEN-ACTIVATED PROTEIN KINASE KINASES which in turn phosphorylate the MITOGEN-ACTIVATED PROTEIN KINASES; (MAPKs). The MAPKs then act on various downstream targets to affect gene expression. In mammals, there are several distinct MAP kinase pathways including the ERK (extracellular signal-regulated kinase) pathway, the SAPK/JNK (stress-activated protein kinase/c-jun kinase) pathway, and the p38 kinase pathway. There is some sharing of components among the pathways depending on which stimulus originates activation of the cascade.
Agents that inhibit PROTEIN KINASES.
A mitogen-activated protein kinase subfamily that regulates a variety of cellular processes including CELL GROWTH PROCESSES; CELL DIFFERENTIATION; APOPTOSIS; and cellular responses to INFLAMMATION. The P38 MAP kinases are regulated by CYTOKINE RECEPTORS and can be activated in response to bacterial pathogens.
Phosphotransferases that catalyzes the conversion of 1-phosphatidylinositol to 1-phosphatidylinositol 3-phosphate. Many members of this enzyme class are involved in RECEPTOR MEDIATED SIGNAL TRANSDUCTION and regulation of vesicular transport with the cell. Phosphatidylinositol 3-Kinases have been classified both according to their substrate specificity and their mode of action within the cell.
A proline-directed serine/threonine protein kinase which mediates signal transduction from the cell surface to the nucleus. Activation of the enzyme by phosphorylation leads to its translocation into the nucleus where it acts upon specific transcription factors. p40 MAPK and p41 MAPK are isoforms.
Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.
A serine-threonine protein kinase family whose members are components in protein kinase cascades activated by diverse stimuli. These MAPK kinases phosphorylate MITOGEN-ACTIVATED PROTEIN KINASES and are themselves phosphorylated by MAP KINASE KINASE KINASES. JNK kinases (also known as SAPK kinases) are a subfamily.
A cytoplasmic serine threonine kinase involved in regulating CELL DIFFERENTIATION and CELLULAR PROLIFERATION. Overexpression of this enzyme has been shown to promote PHOSPHORYLATION of BCL-2 PROTO-ONCOGENE PROTEINS and chemoresistance in human acute leukemia cells.
A 44-kDa extracellular signal-regulated MAP kinase that may play a role the initiation and regulation of MEIOSIS; MITOSIS; and postmitotic functions in differentiated cells. It phosphorylates a number of TRANSCRIPTION FACTORS; and MICROTUBULE-ASSOCIATED PROTEINS.
A ubiquitously expressed protein kinase that is involved in a variety of cellular SIGNAL PATHWAYS. Its activity is regulated by a variety of signaling protein tyrosine kinase.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
A subgroup of mitogen-activated protein kinases that activate TRANSCRIPTION FACTOR AP-1 via the phosphorylation of C-JUN PROTEINS. They are components of intracellular signaling pathways that regulate CELL PROLIFERATION; APOPTOSIS; and CELL DIFFERENTIATION.
Intracellular signaling protein kinases that play a signaling role in the regulation of cellular energy metabolism. Their activity largely depends upon the concentration of cellular AMP which is increased under conditions of low energy or metabolic stress. AMP-activated protein kinases modify enzymes involved in LIPID METABOLISM, which in turn provide substrates needed to convert AMP into ATP.
Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.
A protein kinase C subtype that was originally characterized as a CALCIUM-independent, serine-threonine kinase that is activated by PHORBOL ESTERS and DIACYLGLYCEROLS. It is targeted to specific cellular compartments in response to extracellular signals that activate G-PROTEIN-COUPLED RECEPTORS; TYROSINE KINASE RECEPTORS; and intracellular protein tyrosine kinase.
A phorbol ester found in CROTON OIL with very effective tumor promoting activity. It stimulates the synthesis of both DNA and RNA.
PKC beta encodes two proteins (PKCB1 and PKCBII) generated by alternative splicing of C-terminal exons. It is widely distributed with wide-ranging roles in processes such as B-cell receptor regulation, oxidative stress-induced apoptosis, androgen receptor-dependent transcriptional regulation, insulin signaling, and endothelial cell proliferation.
A PROTEIN-TYROSINE KINASE family that was originally identified by homology to the Rous sarcoma virus ONCOGENE PROTEIN PP60(V-SRC). They interact with a variety of cell-surface receptors and participate in intracellular signal transduction pathways. Oncogenic forms of src-family kinases can occur through altered regulation or expression of the endogenous protein and by virally encoded src (v-src) genes.
Substances that stimulate mitosis and lymphocyte transformation. They include not only substances associated with LECTINS, but also substances from streptococci (associated with streptolysin S) and from strains of alpha-toxin-producing staphylococci. (Stedman, 25th ed)
A group of cyclic GMP-dependent enzymes that catalyze the phosphorylation of SERINE or THREONINE residues of proteins.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Protein kinases that catalyze the PHOSPHORYLATION of TYROSINE residues in proteins with ATP or other nucleotides as phosphate donors.
Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Established cell cultures that have the potential to propagate indefinitely.
Phosphoprotein with protein kinase activity that functions in the G2/M phase transition of the CELL CYCLE. It is the catalytic subunit of the MATURATION-PROMOTING FACTOR and complexes with both CYCLIN A and CYCLIN B in mammalian cells. The maximal activity of cyclin-dependent kinase 1 is achieved when it is fully dephosphorylated.
An adenine nucleotide containing one phosphate group which is esterified to both the 3'- and 5'-positions of the sugar moiety. It is a second messenger and a key intracellular regulator, functioning as a mediator of activity for a number of hormones, including epinephrine, glucagon, and ACTH.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
The rate dynamics in chemical or physical systems.
A ubiquitous casein kinase that is comprised of two distinct catalytic subunits and dimeric regulatory subunit. Casein kinase II has been shown to phosphorylate a large number of substrates, many of which are proteins involved in the regulation of gene expression.
Mitogen-activated protein kinase kinase kinases (MAPKKKs) are serine-threonine protein kinases that initiate protein kinase signaling cascades. They phosphorylate MITOGEN-ACTIVATED PROTEIN KINASE KINASES; (MAPKKs) which in turn phosphorylate MITOGEN-ACTIVATED PROTEIN KINASES; (MAPKs).
A multifunctional calcium-calmodulin-dependent protein kinase subtype that occurs as an oligomeric protein comprised of twelve subunits. It differs from other enzyme subtypes in that it lacks a phosphorylatable activation domain that can respond to CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE KINASE.
A dsRNA-activated cAMP-independent protein serine/threonine kinase that is induced by interferon. In the presence of dsRNA and ATP, the kinase autophosphorylates on several serine and threonine residues. The phosphorylated enzyme catalyzes the phosphorylation of the alpha subunit of EUKARYOTIC INITIATION FACTOR-2, leading to the inhibition of protein synthesis.
An abundant 43-kDa mitogen-activated protein kinase kinase subtype with specificity for MITOGEN-ACTIVATED PROTEIN KINASE 1 and MITOGEN-ACTIVATED PROTEIN KINASE 3.
A mitogen-activated protein kinase subfamily that is widely expressed and plays a role in regulation of MEIOSIS; MITOSIS; and post mitotic functions in differentiated cells. The extracellular signal regulated MAP kinases are regulated by a broad variety of CELL SURFACE RECEPTORS and can be activated by certain CARCINOGENS.
A family of serine-threonine kinases that bind to and are activated by MONOMERIC GTP-BINDING PROTEINS such as RAC GTP-BINDING PROTEINS and CDC42 GTP-BINDING PROTEIN. They are intracellular signaling kinases that play a role the regulation of cytoskeletal organization.
A family of protein serine/threonine kinases which act as intracellular signalling intermediates. Ribosomal protein S6 kinases are activated through phosphorylation in response to a variety of HORMONES and INTERCELLULAR SIGNALING PEPTIDES AND PROTEINS. Phosphorylation of RIBOSOMAL PROTEIN S6 by enzymes in this class results in increased expression of 5' top MRNAs. Although specific for RIBOSOMAL PROTEIN S6 members of this class of kinases can act on a number of substrates within the cell. The immunosuppressant SIROLIMUS inhibits the activation of ribosomal protein S6 kinases.
A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
A protein-serine-threonine kinase that is activated by PHOSPHORYLATION in response to GROWTH FACTORS or INSULIN. It plays a major role in cell metabolism, growth, and survival as a core component of SIGNAL TRANSDUCTION. Three isoforms have been described in mammalian cells.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
A non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE. It is involved in the biosynthesis of PURINES; PYRIMIDINES; and other amino acids.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.
A mitogen-activated protein kinase kinase with specificity for JNK MITOGEN-ACTIVATED PROTEIN KINASES; P38 MITOGEN-ACTIVATED PROTEIN KINASES and the RETINOID X RECEPTORS. It takes part in a SIGNAL TRANSDUCTION pathway that is activated in response to cellular stress.
Protein kinases that control cell cycle progression in all eukaryotes and require physical association with CYCLINS to achieve full enzymatic activity. Cyclin-dependent kinases are regulated by phosphorylation and dephosphorylation events.
A group of protein-serine-threonine kinases that was originally identified as being responsible for the PHOSPHORYLATION of CASEINS. They are ubiquitous enzymes that have a preference for acidic proteins. Casein kinases play a role in SIGNAL TRANSDUCTION by phosphorylating a variety of regulatory cytoplasmic and regulatory nuclear proteins.
A phorbol ester found in CROTON OIL which, in addition to being a potent skin tumor promoter, is also an effective activator of calcium-activated, phospholipid-dependent protein kinase (protein kinase C). Due to its activation of this enzyme, phorbol 12,13-dibutyrate profoundly affects many different biological systems.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Proteins isolated from the roots of the pokeweed, Phytolacca americana, that agglutinate some erythrocytes, stimulate mitosis and antibody synthesis in lymphocytes, and induce activation of plasma cells.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
A group of compounds with the heterocyclic ring structure of benzo(c)pyridine. The ring structure is characteristic of the group of opium alkaloids such as papaverine. (From Stedman, 25th ed)
Proteins and peptides that are involved in SIGNAL TRANSDUCTION within the cell. Included here are peptides and proteins that regulate the activity of TRANSCRIPTION FACTORS and cellular processes in response to signals from CELL SURFACE RECEPTORS. Intracellular signaling peptide and proteins may be part of an enzymatic signaling cascade or act through binding to and modifying the action of other signaling factors.
Tumor-promoting compounds obtained from CROTON OIL (Croton tiglium). Some of these are used in cell biological experiments as activators of protein kinase C.
Proteins prepared by recombinant DNA technology.
An indolocarbazole that is a potent PROTEIN KINASE C inhibitor which enhances cAMP-mediated responses in human neuroblastoma cells. (Biochem Biophys Res Commun 1995;214(3):1114-20)
A specific protein kinase C inhibitor, which inhibits superoxide release from human neutrophils (PMN) stimulated with phorbol myristate acetate or synthetic diacylglycerol.
A group of phenyl benzopyrans named for having structures like FLAVONES.
A transferase that catalyzes formation of PHOSPHOCREATINE from ATP + CREATINE. The reaction stores ATP energy as phosphocreatine. Three cytoplasmic ISOENZYMES have been identified in human tissues: the MM type from SKELETAL MUSCLE, the MB type from myocardial tissue and the BB type from nervous tissue as well as a mitochondrial isoenzyme. Macro-creatine kinase refers to creatine kinase complexed with other serum proteins.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
Benzopyrroles with the nitrogen at the number one carbon adjacent to the benzyl portion, in contrast to ISOINDOLES which have the nitrogen away from the six-membered ring.
A glycogen synthase kinase that was originally described as a key enzyme involved in glycogen metabolism. It regulates a diverse array of functions such as CELL DIVISION, microtubule function and APOPTOSIS.
A serine-threonine protein kinase that, when activated by DNA, phosphorylates several DNA-binding protein substrates including the TUMOR SUPPRESSOR PROTEIN P53 and a variety of TRANSCRIPTION FACTORS.
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
A group of enzymes that transfers a phosphate group onto an alcohol group acceptor. EC 2.7.1.
A cyclic AMP-dependent protein kinase subtype primarily found in particulate subcellular fractions. They are tetrameric proteins that contain two catalytic subunits and two type II-specific regulatory subunits.
The relationship between the dose of an administered drug and the response of the organism to the drug.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Highly conserved protein-serine threonine kinases that phosphorylate and activate a group of AGC protein kinases, especially in response to the production of the SECOND MESSENGERS, phosphatidylinositol 3,4,-biphosphate (PtdIns(3,4)P2) and phosphatidylinositol 3,4,5-triphosphate (PtdIns(3,4,5)P3).
ATP:pyruvate 2-O-phosphotransferase. A phosphotransferase that catalyzes reversibly the phosphorylation of pyruvate to phosphoenolpyruvate in the presence of ATP. It has four isozymes (L, R, M1, and M2). Deficiency of the enzyme results in hemolytic anemia. EC 2.7.1.40.
A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.
A class of cellular receptors that have an intrinsic PROTEIN-TYROSINE KINASE activity.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Derivatives of the steroid androstane having two double bonds at any site in any of the rings.
Cell lines whose original growing procedure consisted being transferred (T) every 3 days and plated at 300,000 cells per plate (J Cell Biol 17:299-313, 1963). Lines have been developed using several different strains of mice. Tissues are usually fibroblasts derived from mouse embryos but other types and sources have been developed as well. The 3T3 lines are valuable in vitro host systems for oncogenic virus transformation studies, since 3T3 cells possess a high sensitivity to CONTACT INHIBITION.
Elements of limited time intervals, contributing to particular results or situations.
A group of intracellular-signaling serine threonine kinases that bind to RHO GTP-BINDING PROTEINS. They were originally found to mediate the effects of rhoA GTP-BINDING PROTEIN on the formation of STRESS FIBERS and FOCAL ADHESIONS. Rho-associated kinases have specificity for a variety of substrates including MYOSIN-LIGHT-CHAIN PHOSPHATASE and LIM KINASES.
A c-jun amino-terminal kinase that is activated by environmental stress and pro-inflammatory cytokines. Several isoforms of the protein with molecular sizes of 43 and 48 KD exist due to multiple ALTERNATIVE SPLICING.
A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.
A family of ribosomal protein S6 kinases that are structurally distinguished from RIBOSOMAL PROTEIN S6 KINASES, 70-KDA by their apparent molecular size and the fact they contain two functional kinase domains. Although considered RIBOSOMAL PROTEIN S6 KINASES, members of this family are activated via the MAP KINASE SIGNALING SYSTEM and have been shown to act on a diverse array of substrates that are involved in cellular regulation such as RIBOSOMAL PROTEIN S6 and CAMP RESPONSE ELEMENT-BINDING PROTEIN.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
A cell line derived from cultured tumor cells.
An essential amino acid occurring naturally in the L-form, which is the active form. It is found in eggs, milk, gelatin, and other proteins.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
A group of enzymes removing the SERINE- or THREONINE-bound phosphate groups from a wide range of phosphoproteins, including a number of enzymes which have been phosphorylated under the action of a kinase. (Enzyme Nomenclature, 1992)
Compounds with a six membered aromatic ring containing NITROGEN. The saturated version is PIPERIDINES.
Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
A protein serine-threonine kinase that catalyzes the PHOSPHORYLATION of I KAPPA B PROTEINS. This enzyme also activates the transcription factor NF-KAPPA B and is composed of alpha and beta catalytic subunits, which are protein kinases and gamma, a regulatory subunit.
A 195-kDa MAP kinase kinase kinase with broad specificity for MAP KINASE KINASES. It is found localized in the CYTOSKELETON and can activate a variety of MAP kinase-dependent pathways.
An enzyme that catalyzes the conversion of ATP and thymidine to ADP and thymidine 5'-phosphate. Deoxyuridine can also act as an acceptor and dGTP as a donor. (From Enzyme Nomenclature, 1992) EC 2.7.1.21.
Benzo-indoles similar to CARBOLINES which are pyrido-indoles. In plants, carbazoles are derived from indole and form some of the INDOLE ALKALOIDS.
The phosphoric acid ester of serine.
A 44 kDa mitogen-activated protein kinase kinase with specificity for MITOGEN-ACTIVATED PROTEIN KINASE 1 and MITOGEN-ACTIVATED PROTEIN KINASE 3.
Compounds containing 1,3-diazole, a five membered aromatic ring containing two nitrogen atoms separated by one of the carbons. Chemically reduced ones include IMIDAZOLINES and IMIDAZOLIDINES. Distinguish from 1,2-diazole (PYRAZOLES).
Transport proteins that carry specific substances in the blood or across cell membranes.
An enzyme that catalyzes the conversion of phosphatidylinositol (PHOSPHATIDYLINOSITOLS) to phosphatidylinositol 4-phosphate, the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate.
Organic nitrogenous bases. Many alkaloids of medical importance occur in the animal and vegetable kingdoms, and some have been synthesized. (Grant & Hackh's Chemical Dictionary, 5th ed)
A family of cell cycle-dependent kinases that are related in structure to CDC28 PROTEIN KINASE; S CEREVISIAE; and the CDC2 PROTEIN KINASE found in mammalian species.
Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
An enzyme of the transferase class that uses ATP to catalyze the phosphorylation of diacylglycerol to a phosphatidate. EC 2.7.1.107.
A family of highly conserved serine-threonine kinases that are involved in the regulation of MITOSIS. They are involved in many aspects of cell division, including centrosome duplication, SPINDLE APPARATUS formation, chromosome alignment, attachment to the spindle, checkpoint activation, and CYTOKINESIS.
An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.
Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
Morphologic alteration of small B LYMPHOCYTES or T LYMPHOCYTES in culture into large blast-like cells able to synthesize DNA and RNA and to divide mitotically. It is induced by INTERLEUKINS; MITOGENS such as PHYTOHEMAGGLUTININS, and by specific ANTIGENS. It may also occur in vivo as in GRAFT REJECTION.
Intracellular fluid from the cytoplasm after removal of ORGANELLES and other insoluble cytoplasmic components.
A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
A 6-kDa polypeptide growth factor initially discovered in mouse submaxillary glands. Human epidermal growth factor was originally isolated from urine based on its ability to inhibit gastric secretion and called urogastrone. Epidermal growth factor exerts a wide variety of biological effects including the promotion of proliferation and differentiation of mesenchymal and EPITHELIAL CELLS. It is synthesized as a transmembrane protein which can be cleaved to release a soluble active form.
Four carbon unsaturated hydrocarbons containing two double bonds.
The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.
Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.
An enzyme that phosphorylates myosin light chains in the presence of ATP to yield myosin-light chain phosphate and ADP, and requires calcium and CALMODULIN. The 20-kDa light chain is phosphorylated more rapidly than any other acceptor, but light chains from other myosins and myosin itself can act as acceptors. The enzyme plays a central role in the regulation of smooth muscle contraction.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A non-receptor protein tyrosine kinase that is localized to FOCAL ADHESIONS and is a central component of integrin-mediated SIGNAL TRANSDUCTION PATHWAYS. Focal adhesion kinase 1 interacts with PAXILLIN and undergoes PHOSPHORYLATION in response to adhesion of cell surface integrins to the EXTRACELLULAR MATRIX. Phosphorylated p125FAK protein binds to a variety of SH2 DOMAIN and SH3 DOMAIN containing proteins and helps regulate CELL ADHESION and CELL MIGRATION.
A family of calcium/calmodulin-dependent PROETIN-SERINE-THREONINE KINASES. They are ubiquitously expressed in adult and embryonic mammalian tissues, and their functions are tightly related to the early stages of eukaryotic programmed cell death.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
A cyclic GMP-dependent protein kinase subtype that is expressed in SMOOTH MUSCLE tissues and plays a role in regulation of smooth muscle contraction. Two isoforms, PKGIalpha and PKGIbeta, of the type I protein kinase exist due to alternative splicing of its mRNA.
Compounds of four rings containing a nitrogen. They are biosynthesized from reticuline via rearrangement of scoulerine. They are similar to BENZYLISOQUINOLINES. Members include chelerythrine and sanguinarine.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
A regulatory calcium-calmodulin-dependent protein kinase that specifically phosphorylates CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE TYPE 1; CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE TYPE 2; CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE TYPE 4; and PROTEIN KINASE B. It is a monomeric enzyme that is encoded by at least two different genes.
Mucoproteins isolated from the kidney bean (Phaseolus vulgaris); some of them are mitogenic to lymphocytes, others agglutinate all or certain types of erythrocytes or lymphocytes. They are used mainly in the study of immune mechanisms and in cell culture.
A mitogen-activated protein kinase kinase with specificity for P38 MITOGEN-ACTIVATED PROTEIN KINASES.
The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.
Analysis of PEPTIDES that are generated from the digestion or fragmentation of a protein or mixture of PROTEINS, by ELECTROPHORESIS; CHROMATOGRAPHY; or MASS SPECTROMETRY. The resulting peptide fingerprints are analyzed for a variety of purposes including the identification of the proteins in a sample, GENETIC POLYMORPHISMS, patterns of gene expression, and patterns diagnostic for diseases.
A structurally-diverse family of intracellular-signaling adaptor proteins that selectively tether specific protein kinase A subtypes to distinct subcellular sites. They play a role in focusing the PROTEIN KINASE A activity toward relevant substrates. Over fifty members of this family exist, most of which bind specifically to regulatory subunits of CYCLIC AMP-DEPENDENT PROTEIN KINASE TYPE II such as CAMP PROTEIN KINASE RIIALPHA or CAMP PROTEIN KINASE RIIBETA.
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
A mitogen-activated protein kinase kinase with specificity for a subset of P38 MITOGEN-ACTIVATED PROTEIN KINASES that includes MITOGEN-ACTIVATED PROTEIN KINASE 12; MITOGEN-ACTIVATED PROTEIN KINASE 13; and MITOGEN-ACTIVATED PROTEIN KINASE 14.
A MANNOSE/GLUCOSE binding lectin isolated from the jack bean (Canavalia ensiformis). It is a potent mitogen used to stimulate cell proliferation in lymphocytes, primarily T-lymphocyte, cultures.
A family of non-receptor, PROLINE-rich protein-tyrosine kinases.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
The sum of the weight of all the atoms in a molecule.
A c-jun amino-terminal kinase that is activated by environmental stress and pro-inflammatory cytokines. Several isoforms of the protein with molecular sizes of 48 and 54 KD exist due to multiple ALTERNATIVE SPLICING.
A serine threonine kinase that controls a wide range of growth-related cellular processes. The protein is referred to as the target of RAPAMYCIN due to the discovery that SIROLIMUS (commonly known as rapamycin) forms an inhibitory complex with TACROLIMUS BINDING PROTEIN 1A that blocks the action of its enzymatic activity.
A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymes
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.
Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.
A 110-kDa extracellular signal-regulated MAP kinase that is activated in response to cellular stress and by GROWTH FACTOR RECEPTORS-mediated pathways.
A 38-kDa mitogen-activated protein kinase that is abundantly expressed in a broad variety of cell types. It is involved in the regulation of cellular stress responses as well as the control of proliferation and survival of many cell types. The kinase activity of the enzyme is inhibited by the pyridinyl-imidazole compound SB 203580.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A heat-stable, low-molecular-weight activator protein found mainly in the brain and heart. The binding of calcium ions to this protein allows this protein to bind to cyclic nucleotide phosphodiesterases and to adenyl cyclase with subsequent activation. Thereby this protein modulates cyclic AMP and cyclic GMP levels.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
A subclass of phospholipases that hydrolyze the phosphoester bond found in the third position of GLYCEROPHOSPHOLIPIDS. Although the singular term phospholipase C specifically refers to an enzyme that catalyzes the hydrolysis of PHOSPHATIDYLCHOLINE (EC 3.1.4.3), it is commonly used in the literature to refer to broad variety of enzymes that specifically catalyze the hydrolysis of PHOSPHATIDYLINOSITOLS.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.
A monomeric calcium-calmodulin-dependent protein kinase subtype that is expressed in a broad variety of mammalian cell types. Its expression is regulated by the action of CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE KINASE. Several isoforms of this enzyme subtype are encoded by distinct genes.
Systems of enzymes which function sequentially by catalyzing consecutive reactions linked by common metabolic intermediates. They may involve simply a transfer of water molecules or hydrogen atoms and may be associated with large supramolecular structures such as MITOCHONDRIA or RIBOSOMES.
A long-acting derivative of cyclic AMP. It is an activator of cyclic AMP-dependent protein kinase, but resistant to degradation by cyclic AMP phosphodiesterase.
Compounds or factors that act on a specific enzyme to increase its activity.
A monomeric calcium-calmodulin-dependent protein kinase subtype that is primarily expressed in neuronal tissues; T-LYMPHOCYTES and TESTIS. The activity of this enzyme is regulated by its phosphorylation by CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE KINASE.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Organic compounds containing the -CN radical. The concept is distinguished from CYANIDES, which denotes inorganic salts of HYDROGEN CYANIDE.
A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
A type I cAMP-dependent protein kinase regulatory subunit that plays a role in confering CYCLIC AMP activation of protein kinase activity. It has a lower affinity for cAMP than the CYCLIC-AMP-DEPENDENT PROTEIN KINASE RIBETA SUBUNIT.
A Janus kinase subtype that is involved in signaling from GROWTH HORMONE RECEPTORS; PROLACTIN RECEPTORS; and a variety of CYTOKINE RECEPTORS such as ERYTHROPOIETIN RECEPTORS and INTERLEUKIN RECEPTORS. Dysregulation of Janus kinase 2 due to GENETIC TRANSLOCATIONS have been associated with a variety of MYELOPROLIFERATIVE DISORDERS.
The phosphoric acid ester of threonine. Used as an identifier in the analysis of peptides, proteins, and enzymes.
Mitogenic peptide growth hormone carried in the alpha-granules of platelets. It is released when platelets adhere to traumatized tissues. Connective tissue cells near the traumatized region respond by initiating the process of replication.
Guanosine cyclic 3',5'-(hydrogen phosphate). A guanine nucleotide containing one phosphate group which is esterified to the sugar moiety in both the 3'- and 5'-positions. It is a cellular regulatory agent and has been described as a second messenger. Its levels increase in response to a variety of hormones, including acetylcholine, insulin, and oxytocin and it has been found to activate specific protein kinases. (From Merck Index, 11th ed)
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
A eukayrotic protein serine-threonine phosphatase subtype that dephosphorylates a wide variety of cellular proteins. The enzyme is comprised of a catalytic subunit and regulatory subunit. Several isoforms of the protein phosphatase catalytic subunit exist due to the presence of multiple genes and the alternative splicing of their mRNAs. A large number of proteins have been shown to act as regulatory subunits for this enzyme. Many of the regulatory subunits have additional cellular functions.
An amino acid that occurs in endogenous proteins. Tyrosine phosphorylation and dephosphorylation plays a role in cellular signal transduction and possibly in cell growth control and carcinogenesis.
A 51-amino acid pancreatic hormone that plays a major role in the regulation of glucose metabolism, directly by suppressing endogenous glucose production (GLYCOGENOLYSIS; GLUCONEOGENESIS) and indirectly by suppressing GLUCAGON secretion and LIPOLYSIS. Native insulin is a globular protein comprised of a zinc-coordinated hexamer. Each insulin monomer containing two chains, A (21 residues) and B (30 residues), linked by two disulfide bonds. Insulin is used as a drug to control insulin-dependent diabetes mellitus (DIABETES MELLITUS, TYPE 1).
An imidazole derivative which is a metabolite of the antineoplastic agents BIC and DIC. By itself, or as the ribonucleotide, it is used as a condensation agent in the preparation of nucleosides and nucleotides. Compounded with orotic acid, it is used to treat liver diseases.
An enzyme that catalyzes the conversion of ATP and PHOSPHORYLASE B to ADP and PHOSPHORYLASE A.
The muscle tissue of the HEART. It is composed of striated, involuntary muscle cells (MYOCYTES, CARDIAC) connected to form the contractile pump to generate blood flow.
A key regulator of CELL CYCLE progression. It partners with CYCLIN E to regulate entry into S PHASE and also interacts with CYCLIN A to phosphorylate RETINOBLASTOMA PROTEIN. Its activity is inhibited by CYCLIN-DEPENDENT KINASE INHIBITOR P27 and CYCLIN-DEPENDENT KINASE INHIBITOR P21.
A casein kinase that was originally described as a monomeric enzyme with a molecular weight of 30-40 kDa. Several ISOENZYMES of casein kinase I have been found which are encoded by separate genes. Many of the casein kinase I isoenzymes have been shown to play distinctive roles in intracellular SIGNAL TRANSDUCTION.
The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.
A specific inhibitor of phosphoserine/threonine protein phosphatase 1 and 2a. It is also a potent tumor promoter. (Thromb Res 1992;67(4):345-54 & Cancer Res 1993;53(2):239-41)
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.

Nitric oxide stimulates the stress-activated protein kinase p38 in rat renal mesangial cells. (1/13310)

Nitric oxide (NO) has gained increased attention as a diffusible universal messenger that plays a crucial role in the pathogenesis of inflammatory and autoimmune diseases. Recently, we reported that exogenous NO is able to activate the stress-activated protein kinase (SAPK) cascade in mesangial cells. Here, we demonstrate that exposure of glomerular mesangial cells to compounds releasing NO, including spermine-NO and (Z)-1- (N-methyl-N-[6-(N-methylammoniohexyl)amino]diazen)-1-ium-1,2-diolate (MAHMA-NO), results in an activation of the stress-activated p38-mitogen-activated protein kinase (p38-MAPK) cascade as measured by the phosphorylation of the activator of transcription factor-2 (ATF2) in an immunocomplex kinase assay. Activation of the p38-MAPK cascade by a short stimulation (10 min) with the NO donor MAHMA-NO causes a large increase in ATF2 phosphorylation that is several times greater than that observed after stimulation with interleukin-1beta, a well-known activator of the p38-MAPK pathway. Time course studies reveal that MAHMA-NO causes rapid and maximal activation of p38-MAPK after 10 min of stimulation and that activation declines to basal levels within 60 min. The longer-lived NO donor spermine-NO causes a comparable rapid activation of the p38-MAPK pathway; however, the increased activation state of p38-MAPK was maintained for several hours before control values were reattained after 24 h of stimulation. Furthermore, the NO donors also activated the classical extracellular signal-regulated kinase (ERK) p44-MAPK cascade as shown by phosphorylation of the specific substrate cytosolic phospholipase A2 in an immunocomplex kinase reaction. Both MAHMA-NO and spermine-NO cause a rapid activation of p44-MAPK after 10 min of stimulation. Interestingly, there is a second delayed peak of p44-MAPK activation after 4-24 h of stimulation with NO donors. These results suggest that there is a differential activation pattern for stress-activated and mitogen-activated protein kinases by NO and that the integration of these signals may lead to specific cell responses.  (+info)

A Drosophila TNF-receptor-associated factor (TRAF) binds the ste20 kinase Misshapen and activates Jun kinase. (2/13310)

Two families of protein kinases that are closely related to Ste20 in their kinase domain have been identified - the p21-activated protein kinase (Pak) and SPS1 families [1-3]. In contrast to Pak family members, SPS1 family members do not bind and are not activated by GTP-bound p21Rac and Cdc42. We recently placed a member of the SPS1 family, called Misshapen (Msn), genetically upstream of the c-Jun amino-terminal (JNK) mitogen-activated protein (MAP) kinase module in Drosophila [4]. The failure to activate JNK in Drosophila leads to embryonic lethality due to the failure of these embryos to stimulate dorsal closure [5-8]. Msn probably functions as a MAP kinase kinase kinase kinase in Drosophila, activating the JNK pathway via an, as yet, undefined MAP kinase kinase kinase. We have identified a Drosophila TNF-receptor-associated factor, DTRAF1, by screening for Msn-interacting proteins using the yeast two-hybrid system. In contrast to the mammalian TRAFs that have been shown to activate JNK, DTRAF1 lacks an amino-terminal 'Ring-finger' domain, and overexpression of a truncated DTRAF1, consisting of only its TRAF domain, activates JNK. We also identified another DTRAF, DTRAF2, that contains an amino-terminal Ring-finger domain. Msn specifically binds the TRAF domain of DTRAF1 but not that of DTRAF2. In Drosophila, DTRAF1 is thus a good candidate for an upstream molecule that regulates the JNK pathway by interacting with, and activating, Msn. Consistent with this idea, expression of a dominant-negative Msn mutant protein blocks the activation of JNK by DTRAF1. Furthermore, coexpression of Msn with DTRAF1 leads to the synergistic activation of JNK. We have extended some of these observations to the mammalian homolog of Msn, Nck-interacting kinase (NIK), suggesting that TRAFs also play a critical role in regulating Ste20 kinases in mammals.  (+info)

JNK2 is required for efficient T-cell activation and apoptosis but not for normal lymphocyte development. (3/13310)

BACKGROUND: The Jun N-terminal kinase (JNK) signaling pathway has been implicated in cell proliferation and apoptosis, but its function seems to depend on the cell type and inducing signal. In T cells, JNK has been implicated in both antigen-induced activation and apoptosis. RESULTS: We generated mice lacking the JNK2 isozymes. The mutant mice were healthy and fertile but defective in peripheral T-cell activation induced by antibody to the CD3 component of the T-cell receptor (TCR) complex - proliferation and production of interleukin-2 (IL-2), IL-4 and interferon-gamma (IFN-gamma) were reduced. The proliferation defect was restored by exogenous IL-2. B-cell activation was normal in the absence of JNK2. Activation-induced peripheral T-cell apoptosis was comparable between mutant and wild-type mice, but immature (CD4(+) CD8(+)) thymocytes lacking JNK2 were resistant to apoptosis induced by administration of anti-CD3 antibody in vivo. The lack of JNK2 also resulted in partial resistance of thymocytes to anti-CD3 antibody in vitro, but had little or no effect on apoptosis induced by anti-Fas antibody, dexamethasone or ultraviolet-C (UVC) radiation. CONCLUSIONS: JNK2 is essential for efficient activation of peripheral T cells but not B cells. Peripheral T-cell activation is probably required indirectly for induction of thymocyte apoptosis resulting from administration of anti-CD3 antibody in vivo. JNK2 functions in a cell-type-specific and stimulus-dependent manner, being required for apoptosis of immature thymocytes induced by anti-CD3 antibody but not for apoptosis induced by anti-Fas antibody, UVC or dexamethasone. JNK2 is not required for activation-induced cell death of mature T cells.  (+info)

Activation of c-Abl tyrosine kinase requires caspase activation and is not involved in JNK/SAPK activation during apoptosis of human monocytic leukemia U937 cells. (4/13310)

Genotoxic stress triggers the activation of several sensor molecules, such as p53, JNK1/SAPK and c-Abl, and occasionally promotes the cells to apoptosis. We previously reported that JNK1/SAPK regulates genotoxic stress-induced apoptosis in p53-negative U937 cells by activating caspases. c-Abl is expected to act upstream of JNK1/SAPK activation upon treatment with genotoxic stressors, but its involvement in apoptosis development is still unclear. We herein investigated the kinase activities of c-Abl and JNK1/SAPK during apoptosis elicited by genotoxic anticancer drugs and tumor necrosis factor (TNF) in U937 cells and their apoptosis-resistant variant UK711 cells. We found that the activation of JNK1/SAPK and c-Abl correlated well with apoptosis development in these cell lines. Unexpectedly, however, the JNK1/SAPK activation preceded the c-Abl activation. Moreover, the caspase inhibitor Z-Asp suppressed c-Abl activation and the onset of apoptosis but not the JNK1/SAPK activation. Interestingly, c-Abl tyrosine kinase inhibition by CGP 57148 reduced apoptosis without interfering with JNK1/SAPK activation. These results indicate that c-Abl acts not upstream of JNK1/ SAPK but downstream of caspases during the development of p53-independent apoptosis and is possibly involved in accelerating execution of the cell death pathway.  (+info)

Activation of c-Jun N-terminal kinase 1 by UV irradiation is inhibited by wortmannin without affecting c-iun expression. (5/13310)

Activation of c-Jun N-terminal kinases (JNKs)/stress-activated protein kinases is an early response of cells upon exposure to DNA-damaging agents. JNK-mediated phosphorylation of c-Jun is currently understood to stimulate the transactivating potency of AP-1 (e.g., c-Jun/c-Fos; c-Jun/ATF-2), thereby increasing the expression of AP-1 target genes. Here we show that stimulation of JNK1 activity is not a general early response of cells exposed to genotoxic agents. Treatment of NIH 3T3 cells with UV light (UV-C) as well as with methyl methanesulfonate (MMS) caused activation of JNK1 and an increase in c-Jun protein and AP-1 binding activity, whereas antineoplastic drugs such as mafosfamide, mitomycin C, N-hydroxyethyl-N-chloroethylnitrosourea, and treosulfan did not elicit this response. The phosphatidylinositol 3-kinase inhibitor wortmannin specifically blocked the UV-stimulated activation of JNK1 but did not affect UV-driven activation of extracellular regulated kinase 2 (ERK2). To investigate the significance of JNK1 for transactivation of c-jun, we analyzed the effect of UV irradiation on c-jun expression under conditions of wortmannin-mediated inhibition of UV-induced stimulation of JNK1. Neither the UV-induced increase in c-jun mRNA, c-Jun protein, and AP-1 binding nor the activation of the collagenase and c-jun promoters was affected by wortmannin. In contrast, the mitogen-activated protein kinase/ERK kinase inhibitor PD98056, which blocked ERK2 but not JNK1 activation by UV irradiation, impaired UV-driven c-Jun protein induction and AP-1 binding. Based on the data, we suggest that JNK1 stimulation is not essential for transactivation of c-jun after UV exposure, whereas activation of ERK2 is required for UV-induced signaling leading to elevated c-jun expression.  (+info)

A low-affinity serum response element allows other transcription factors to activate inducible gene expression in cardiac myocytes. (6/13310)

Hypertrophic growth of cardiac muscle cells is induced by a variety of physiological and pathological stimuli and is associated with a number of changes, including activation of genes such as atrial natriuretic factor. We found that two serum response element (SRE)-like DNA elements, one of which does not meet the consensus sequence and binds serum response factor (SRF) with low affinity, regulate the activity of this promoter. Surprisingly, the ability to induce the promoter by two different physiologic stimuli, as well as various activated transcription factors, including SRF-VP16, was primarily dependent upon the nonconsensus rather than the consensus SRE. This SRE controls the induction of gene expression via an unusual mechanism in that it is required to allow some, but not all, active transcription factors at unrelated sites on the promoter to stimulate gene expression. Thus, in addition to regulation of SRF activity by growth stimuli, regulation of a low-affinity SRE element controls inducible gene expression by modulating the ability of other transcription factors to stimulate the transcription machinery.  (+info)

The Jun kinase 2 isoform is preferentially required for epidermal growth factor-induced transformation of human A549 lung carcinoma cells. (7/13310)

We have previously found that epidermal growth factor (EGF) mediates growth through the Jun N-terminal kinase/stress-activated kinase (JNK/SAPK) pathway in A549 human lung carcinoma cells. As observed here, EGF treatment also greatly enhances the tumorigenicity of A549 cells, suggesting an important role for JNK in cancer cell growth (F. Bost, R. McKay, N. Dean, and D. Mercola, J. Biol. Chem. 272:33422-33429, 1997). Several isoforms families of JNK, JNK1, JNK2, and JNK3, have been isolated; they arise from alternative splicing of three different genes and have distinct substrate binding properties. Here we have used specific phosphorothioate oligonucleotides targeted against the two major isoforms, JNK1 and JNK2, to discriminate their roles in EGF-induced transformation. Multiple antisense sequences have been screened, and two high-affinity and specific candidates have been identified. Antisense JNK1 eliminated steady-state mRNA and JNK1 protein expression with a 50% effective concentration (EC50) of <0.1 microM but did not alter JNK2 mRNA or protein levels. Conversely, antisense JNK2 specifically eliminated JNK2 steady-state mRNA and protein expression with an EC50 of 0.1 microM. Antisense JNK1 and antisense JNK2 inhibited by 40 and 70%, respectively, EGF-induced total JNK activity, whereas sense and scrambled-sequence control oligonucleotides had no effect. The elimination of mRNA, protein, and JNK activities lasted 48 and 72 h following a single Lipofectin treatment with antisense JNK1 and JNK2, respectively, indicating sufficient duration for examining the impact of specific elimination on the phenotype. Direct proliferation assays demonstrated that antisense JNK2 inhibited EGF-induced doubling of growth as well as the combination of active antisense oligonucleotides did. EGF treatment also induced colony formation in soft agar. This effect was completely inhibited by antisense JNK2 and combined-antisense treatment but not altered by antisense JNK1 alone. These results show that EGF doubles the proliferation (growth in soft agar as well as tumorigenicity in athymic mice) of A549 lung carcinoma cells and that the JNK2 isoform but not JNK1 is utilized for mediating the effects of EGF. This study represents the first demonstration of a cellular phenotype regulated by a JNK isoform family, JNK2.  (+info)

All-trans-retinoic acid inhibits Jun N-terminal kinase by increasing dual-specificity phosphatase activity. (8/13310)

Jun N-terminal kinases (JNKs) are serine-threonine kinases that play a critical role in the regulation of cell growth and differentiation. We previously observed that JNK activity is suppressed by all-trans-retinoic acid (t-RA), a ligand for retinoic acid nuclear receptors (RARs), in normal human bronchial epithelial cells, which are growth inhibited by t-RA. In this study, we investigated the mechanism by which t-RA inhibits JNK and the possibility that this signaling event is blocked in non-small cell lung cancer (NSCLC) cells. Virtually all NSCLC cell lines are resistant to the growth-inhibitory effects of t-RA, and a subset of them have a transcriptional defect specific to retinoid nuclear receptors. We found that in NSCLC cells expressing functional retinoid receptors, serum-induced JNK phosphorylation and activity were inhibited by t-RA in a bimodal pattern, transiently within 30 min and in a sustained fashion beginning at 12 h. Retinoid receptor transcriptional activation was required for the late, but not the early, suppression of JNK activity. t-RA inhibited serum-induced JNK activity by blocking mitogen-activated protein (MAP) kinase kinase 4-induced signaling events. This effect of t-RA was phosphatase dependent and involved an increase in the expression of the dual-specificity MAP kinase phosphatase 1 (MKP-1). t-RA did not activate MKP-1 expression or inhibit JNK activity in a NSCLC cell line with retinoid receptors that are refractory to ligand-induced transcriptional activation. These findings provide the first evidence that t-RA suppresses JNK activity by inhibiting JNK phosphorylation. Retinoid receptor transcriptional activation was necessary for the sustained inhibition of JNK activity by t-RA, and this signaling event was disrupted in NSCLC cells with retinoid receptors that are refractory to ligand-induced transcriptional activation.  (+info)

MAP (mitogen-activated protein) kinases are a family of serine/threonine kinases that have a pivotal role in signal transduction. Here we report the cloning and characterization of a mouse homologue of extracellular-signal-regulated protein kinase (ERK)3. The mouse Erk3 cDNA encodes a predicted protein of 720 residues, which displays 94% identity with human ERK3. Transcription and translation of this cDNA in vitro generates a 100 kDa protein similar to the human gene product ERK3. Immunoblot analysis with an antibody raised against a unique sequence of ERK3 also recognizes a 100 kDa protein in mouse tissues. A single transcript of Erk3 was detected in every adult mouse tissue examined, with the highest expression being found in the brain. Interestingly, expression of Erk3 mRNA is acutely regulated during mouse development, with a peak of expression observed at embryonic day 11. The mouse Erk3 gene was mapped to a single locus on central mouse chromosome 9, adjacent to the dilute mutation locus ...
The p38 mitogen-activated protein (MAP) kinase signal transduction pathway is activated by proinflammatory cytokines and environmental stress. The detection of p38 MAP kinase in the nucleus of activated cells suggests that p38 MAP kinase can mediate signaling to the nucleus. To test this hypothesis, we constructed expression vectors for activated MKK3 and MKK6, two MAP kinase kinases that phosphorylate and activate p38 MAP kinase. Expression of activated MKK3 and MKK6 in cultured cells caused a selective increase in p38 MAP kinase activity. Cotransfection experiments demonstrated that p38 MAP kinase activation causes increased reporter gene expression mediated by the transcription factors ATF2 and Elk-1. These data demonstrate that the nucleus is one target of the p38 MAP kinase signal transduction pathway. ...
Raingeaud J., Whitmarsh A.J., Barrett T., Derijard B., Davis R.J.. The p38 mitogen-activated protein (MAP) kinase signal transduction pathway is activated by proinflammatory cytokines and environmental stress. The detection of p38 MAP kinase in the nucleus of activated cells suggests that p38 MAP kinase can mediate signaling to the nucleus. To test this hypothesis, we constructed expression vectors for activated MKK3 and MKK6, two MAP kinase kinases that phosphorylate and activate p38 MAP kinase. Expression of activated MKK3 and MKK6 in cultured cells caused a selective increase in p38 MAP kinase activity. Cotransfection experiments demonstrated that p38 MAP kinase activation causes increased reporter gene expression mediated by the transcription factors ATF2 and Elk-1. These data demonstrate that the nucleus is one target of the p38 MAP kinase signal transduction pathway.. Mol. Cell. Biol. 16:1247-1255(1996) [PubMed] [Europe PMC] ...
Mitogen-activated protein kinase (MAPK)-triggered protein kinase 2 (MAPKAPK2) mediates multiple p38 MAPK-dependent inflammatory responses. at Ser-58. Computational modeling and calculation of theoretical binding energies predicted that both phosphorylation at Ser-58 and mutation of Ser-58 to Asp (S58D) jeopardized the ability of 14-3-3 to dimerize. Experimentally, S58D mutation significantly impaired both 14-3-3 dimerization and binding to Raf-1. These data suggest that MAPKAPK2-mediated phosphorylation regulates 14-3-3 functions, and this MAPKAPK2 activity may symbolize a novel pathway mediating p38 MAPK-dependent swelling. A diverse group of cellular responses are elicited by activation of a highly conserved family of mitogen-activated protein kinase (MAPK) signaling pathways, which includes extracellular signal-regulated kinases (ERKs), c-jun N-terminal kinases (JNKs), ERK5, and p38 MAPKs. A large body of evidence shows that p38 MAPK activity is critical to immune and inflammatory responses. ...
TY - JOUR. T1 - Mitogen-activated protein kinase (MAP kinase), MAP kinase kinase and c-Mos stimulate glucose transport in Xenopus oocytes. AU - Merrall, N. W.. AU - Plevin, R. J.. AU - Stokoe, D.. AU - Cohen, P.. AU - Nebreda, A. R.. AU - Gould, G. W.. PY - 1993/10/15. Y1 - 1993/10/15. N2 - Mitogens and growth factors acutely stimulate glucose transport in all cells to supply energy for their growth and division, but little is known about the signalling mechanism by which these agonists promote sugar uptake. Here we show that the transport of deoxyglucose and 3-O-methylglucose into Xenopus laevis oocytes is stimulated about 2.5-fold when mitogen-activated protein kinase (MAP kinase) is microinjected into these oocytes. We also demonstrate that microinjection of the proto-oncogene product c-Mos (an activator of MAP kinase kinase, which activates MAP kinase in Xenopus oocytes), and purified MAP kinase kinase produce similar increases in deoxyglucose transport. Since the activation of MAP kinase is ...
Sun QY.,Wu GM.,Lai LX.,Bonk A.,Cabot R.,...&Schatten H.(2002).Regulation of mitogen-activated protein kinase phosphorylation, microtubule organization, chromatin behavior, and cell cycle progression by protein phosphatases during pig oocyte maturation and fertilization in vitro.Biology of Reproduction,66(3),580-588 ...
TY - JOUR. T1 - bHLH-zip transcription factor Spz1 mediates mitogen-activated protein kinase cell proliferation, transformation, and tumorigenesis. AU - Hsu, Shih Hsien. AU - Hsieh-Li, Hsiu Mei. AU - Huang, Hsin Yi. AU - Huang, Pei Hsin. AU - Li, Hung. PY - 2005/5/15. Y1 - 2005/5/15. N2 - BHLH-zip proteins usually play important regulatory roles in cell growth and differentiation. In this study, we show that Spz1, a bHLH-zip transcription factor, acts downstream of mitogen-activated protein kinase (MAPK, extracellular signal-regulated kinase 1/2) to up-regulate cell proliferation and tumorigenesis. In addition, through an interaction with proliferating cell nuclear antigen (PCNA) promoter, Spz1 induced cell proliferation concomitant with an increase in PCNA gene expression. Spz1-transfected cells formed colony foci on soft agar and developed fibrosarcoma tumors in nude mice. MAPK directly interacted and phosphorylated Spz1 protein, which increased PCNA transcription and cell tumorigenic ...
PGC-1α-dependent irisin, a novel myokine, is derived from cleaving Fndc5 protein. Irisin promotes brown fat-like development and thermogenesis in WAT both in vitro and in vivo. The discovery of irisin has created an opportunity to further understand the role of adipocytes in obesity, diabetes, and other associated metabolic disorders (12,13,26,27). However, the molecular mechanisms and cellular signaling pathways responsible for the browning effect of irisin have not been elucidated.. In this study, we successfully constructed the yeast expression plasmid containing a synthesized optimal codon usage, human irisin-coding sequence and generated pure human recombinant irisin protein in P. pastoris with high yield that is fully biologically functional. The P. pastoris system is widely used for heterogenic protein expression, with the capacity to generate posttranslational modified proteins (28). The human recombinant irisin protein expressed in yeast showed a predominant band of ∼22 kDa, which is ...
Stimulation of hemopoietic cells with IL-3, IL-4, IL-5, granulocyte-macrophage-CSF and Steel factor-(SLF) induced tyrosine phosphorylation of a number of protein substrates. Two of these proteins, designated p42 and p44, were tyrosine phosphorylated rapidly in response to treatment with IL-3, IL-5, granulocyte-macrophage-CSF and SLF, but not IL-4. We demonstrate that these common substrates are members of the mitogen-activated protein kinase (MAP kinase) family of protein serine/threonine kinases. Ion-exchange chromatography yielded a peak of MAP kinase activity eluting at 0.3 to 0.32 M NaCl. Immunoblotting of column fractions with antiphosphotyrosine antibodies showed coelution of the peak of MAP kinase enzyme activity with the p42 and p44 tyrosine phosphorylated species, and with two proteins of 42 and 44 kDa which were immunoreactive with anti-MAP kinase antibodies. Moreover, a characteristic shift in mobility of the p42 and p44 species was observed after factor treatment. Time-course ...
Stress-activated protein kinases (SAPKs) are stimulated by cell damaging agents as well as by physiological receptor agonists. In this study we show that human platelets contain the isoforms SAPK2a, SAPK2b, SAPK3 and SAPK4 as determined by immunoblotting with specific antibodies. All four kinases were activated in thrombin-stimulated platelets whereas only SAPK2a and SAPK2b were significantly stimulated by collagen. All four isoforms were able to phosphorylate wild-type human cPLA2in vitro, although to different extents, but not cPLA2 mutants that had Ser505 replaced by alanine. Phosphorylation at Ser505 was confirmed by phosphopeptide mapping using microbore HPLC. SAPK2a and 42-kDa mitogen-activated protein kinase incorporated similar levels of phosphate into cPLA2 relative to the ability of each kinase to stimulate phosphorylation of myelin basic protein. SAPK2b and SAPK4 incorporated less phosphate, and cPLA2 was a poor substrate for SAPK3. The inhibitor of SAPK2a and SAPK2b, SB 202190, ...
Delayed cytoprotection (preconditioning) occurs 24h after sublethal simulated ischaemia and reperfusion (SI/R) in neonatal rat ventricular cardiomyocytes. SI/R was used to investigate the role of activation of mitogen-activated protein kinases (MAPKs), stress-activated protein kinases (SAPKs) and phosphoinositide 3-kinase-dependent protein kinase B (PKB)/Akt in cytoprotection. SI resulted in transient dual (Thr/Tyr) phosphorylation of p42/p44-MAPK and p38-MAPK, weak phosphorylation of p46/p54-SAPK, but no phosphorylation of PKB. Reperfusion caused further transient phosphorylation of p38-MAPK, but sustained phosphorylation of p42/p44-MAPK (lasting 4h) and of Ser473 of PKB (lasting 2h). Furthermore, SI/R (24h) induced delayed protection against lethal SI, as determined by an increase in cell viability {bioreduction of MTT [3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide]} and a decrease in cell injury (release of creatine kinase). Both protection and phosphorylation of ...
TY - JOUR. T1 - The p38 mitogen-activated protein kinase pathway and its role in interferon signaling. AU - Platanias, Leonidas C.. PY - 2003/5/1. Y1 - 2003/5/1. N2 - Interferons (IFNs) are pleiotropic cytokines that exhibit multiple biological effects on cells and tissues. IFN receptors are expressed widely in mammalian cells and virtually all different cell types express them on their surface. The Type I IFN receptor has a multichain structure, composed of at least two distinct receptor subunits, IFNαR1 and IFNαR2. Two Jak-kinases, Tyk-2 and Jak-1, associate with the different receptor subunits and are activated in response to IFNα or IFNβ to regulate engagement of multiple downstream signaling cascades. These include the Stat-pathway, whose function is essential for transcriptional activation of IFN-sensitive genes, and the insulin receptor substrate pathway, which regulates downstream activation of the phosphatidyl-inositol-3′ kinase. Members of the Map family of kinases are also ...
Mitogen-activated protein kinase involved in a signal transduction pathway that is activated by changes in the osmolarity of the extracellular environment. Controls osmotic regulation of transcription via the stress response element (STRE) in promoters of target genes. Upon osmotic shock, associates with the SKO1-SSN6-TUP1 complex, phosphorylates SKO1, and converts it into an activator that subsequently recruits Swi/Snf and SAGA complexes. Activates the SMP1 transcription factor and the RCK2 kinase, both also involved in the regulation of the expression of a subset of osmotic stress-related genes. Phosphorylation of HSL1 by HOG1 leads to a G2 arrest essential for cell survival at high osmolarity. Mediates also cell-cycle arrest in G1 phase by the dual targeting of SIC1. Regulates MFA2 ARE-mediated translation in response to carbon source. Targets RDP3 histone deacetylase to osmoresponsive promoters to induce gene expression on stress. Plays an essential role in maintaining water homeostasis, arsenite
Mutational activation of Ras (H-Ras, K-Ras, and N-Ras) is associated with a diverse spectrum of human cancers (1). For example, 50% of colorectal carcinomas harbor mutated K-RAS, and 25% of melanomas contain mutated N-RAS alleles. Consequently, there is considerable interest and effort in the development of anti-Ras strategies for cancer treatment (2, 3). One approach involves the inhibition of Ras-mediated signal transduction. Of these efforts, inhibitors of signaling mediated by the Ras effectors, the Raf serine/threonine kinases (c-Raf-1, A-Raf, and B-Raf), have attracted the most interest. Ras promotes Raf activation, which in turn, activates the mitogen-activated protein kinase/extracellular signal-regulated kinase (ERK) kinase (MEK) 1 and MEK2 dual-specificity protein kinases. MEK1/2 kinases then activate the ERK1 and ERK2 mitogen-activated protein kinases and inhibitors of this cascade have been developed and are currently under evaluation in clinical trials (4). These include kinase ...
All cells use stress responses to identify and mitigate toxic threats. Hog1 is an evolutionarily conserved stress-activated protein kinase in Saccharomyces cerevisiae and is best known for its role in the osmotic stress response, wherein it orchestrates a complex program of cellular remodeling (1). Hog1 controls the transcription of ~600 genes, and this is achieved in large part through Hog1-dependent phosphorylation of transcription factors. Hog1 also has important nontranscriptional functions, including regulation of key membrane proteins (2). Hog1 is related to a family of mammalian mitogen-activated protein kinases (MAPKs) and is generally considered to be the yeast ortholog of the p38 family of MAPKs, which function in a wide variety of cellular processes.. In addition to osmotic stress, Hog1 is also activated by various mechanistically distinct environmental stressors including heat shock, hypoxia, tunicamycin, and arsenic, suggesting a broad role for Hog1 in cellular stress responses (3). ...
Investigation of T-helper type 2 cytokines and the mitogen-activated protein kinase pathway in the modulation of bronchial hyperresponsiveness, airway inflammation and remodelling ...
Background Mitogen-activated protein kinases (MAPKs) are signalling transduction molecules that have different functions and diverse behaviour in cancer. phosphorylated protein except p-ERK1/2 which showed both nuclear and cytoplasmic expression. The total/unphosphorylated forms showed cytoplasmic expression. All MAPKs PIK-293 proteins showed an equivocal expression in normal breast tissue, DCIS and BC tissue included within the TMA cores at varying degrees ranging from unfavorable to strong positivity (Online Resource). Cut-off of positivity was chosen for each marker to assess its association with other variables. There were positive correlations between different members of MAPKs using continuous data as well as dichotomised variables (Online Resource). The association between MAPKs and clinicopathological variables Expression of MAPK proteins showed positive correlations with clinicopathological features characteristic of good prognosis including lower grade, early stage, smaller tumour ...
Purification and characterization of two isoenzymes of DL-glycerol-3-phosphatase from Saccharomyces cerevisiae. Identification of the corresponding GPP1 and GPP2 genes and evidence for osmotic regulation of Gpp2p expression by the osmosensing mitogen-activated protein kinase signal transduction pathway ...
Mitogen-Activated Protein Kinases (MAPKs): Activation, Functions and Regulation opens with a summary of the present knowledge about MAPK, with special emphasis on p38 and c-Jun N-terminal kinase. The authors focus on how these signaling pathways are engaged during some infections with intracellular parasites.. The authors also describe selected regulatory aspects of circadian clocks in vertebrates, exploring an intriguing link to MAPK. Circadian clocks are time-tracking systems that provide organisms with a survival advantage.. Cadmium, one of the toxic metals, is an important occupational and environmental pollutant that damages various organs, especially the kidney. The concluding study proposes that the type of kidney cell and severity of cadmium-induced cellular stress appear to determine the effect of MAPK on cell fate ...
The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008 ...
Growth factors and various cellular stresses are known to activate mitogen-activated protein (MAP) kinase, which plays a role in conveying signals from the cytosol to the nucleus. The phosphorylation of MAP kinase is thought to be a prerequisite for translocation. Here, we investigate the translocation and activation of MAP kinase during ischaemia and reperfusion in perfused rat heart. Ischaemia (0-40 min) induces the translocation of MAP kinase from the cytosol fraction to the nuclear fraction. Immunohistochemical observation shows that MAP kinase staining in the nucleus is enhanced after ischaemia for 40 min. Unexpectedly, tyrosine phosphorylation of MAP kinase is unchanged in the nuclear fraction during ischaemia, indicating that unphosphorylated MAP kinase translocates from the cytosol to the nucleus. During reperfusion (0-30 min), after ischaemia for 20 min, tyrosine phosphorylation of MAP kinase in the nuclear fraction is increased with a peak at 10 min of reperfusion. The activation is ...
Mitogen-Activated Protein Kinases (MAPKs): ERKs, JNKs, and p38s - CHEMICAL BIOLOGY - reflects the multidimensional character of chemical biology, focusing in particular on the fundamental science of biological structures and systems, the use of chemical and biological techniques to elucidate
Constitutive activation of the mitogen-activated protein kinase (MAPK) pathway is implicated in the development and progression of many human cancers, including
Low temperature is one of the most common environmental stresses affecting plant growth and agricultural production. The mitogen-activated protein kinase (MAPK) cascade plays a pivotal role in...
Fingerprint Dive into the research topics of Dopamine D2 receptor stimulation of mitogen-activated protein kinases mediated by cell type-dependent transactivation of receptor tyrosine kinases. Together they form a unique fingerprint. ...
Recombinant Mitogen-Activated Protein Kinase 8 (MAPK8) Protéine. Origine: Humain. Source: Baculovirus infected Insect Cells. Commandez ABIN593493.
Recombinant Mitogen-Activated Protein Kinase 8 (MAPK8) Protein (GST tag). Spezies: Human. Quelle: Wheat germ. Jetzt Produkt ABIN1310303 bestellen.
Kinase suppressor of Ras-1 (KSR-1) is an essential scaffolding protein that coordinates the assembly of the mitogen-activated protein kinase (MAPK) module, consisting of the MAPK kinase kinase Raf, the MAPK kinase MEK (mitogen-activated or extracellular signal-regulated protein kinase kinase), and the MAPK ERK (extracellular signal-regulated kinase) to facilitate activation of MEK and thus ERK. Although KSR-1 is targeted to the cell membrane in part by its atypical C1 domain, which binds to phospholipids, other domains may be involved. We identified another domain in KSR-1 that we termed CC-SAM, which is composed of a coiled coil (CC) and a sterile α motif (SAM). The CC-SAM domain targeted KSR-1 to specific signaling sites at the plasma membrane in growth factor-treated cells, and it bound directly to various micelles and bicelles in vitro, indicating that the CC-SAM functioned as a membrane-binding module. By combining nuclear magnetic resonance spectroscopy and experiments in cultured cells, ...
Fingerprint Dive into the research topics of Activin A stimulates mitogenesis in Swiss 3T3 fibroblasts without activation of mitogen-activated protein kinases. Together they form a unique fingerprint. ...
Direct evidence that Gi-coupled receptor stimulation of mitogen-activated protein kinase is mediated by G beta gamma activation of p21ras.
TY - JOUR. T1 - NHP6A and NHP6B, which encode HMG1-like proteins, are candidates for downstream components of the yeast SLT2 mitogen-activated protein kinase pathway. AU - Costigan, Christine. AU - Kolodrubetz, David J. AU - Snyder, Michael. PY - 1994/4. Y1 - 1994/4. N2 - The yeast SLK1 (BCK1) gene encodes a mitogen-activated protein kinase (MAPK) activator protein which functions upstream in a protein kinase cascade that converges on the MAPK Slt2p (Mpk1p). Dominant alleles of SLK1 have been shown to bypass the conditional lethality of a protein kinase C mutation, pkc1-Δ, suggesting that Pkc1p may regulate Slk1p function. Slk1p has an important role in morphogenesis and growth control, and deletions of the SLK1 gene are lethal in a spa2-Δ mutant background. To search for genes that interact with the SLK1-SLT2 pathway, a synthetic lethal suppression screen was carried out. Genes which in multiple copies suppress the synthetic lethality of slk1-1 spa2-Δ were identified, and one, the NHP6A ...
TY - JOUR. T1 - Chromatin-tethered MAPKs. AU - Klein, Aileen M.. AU - Zaganjor, Elma. AU - Cobb, Melanie H.. PY - 2013. Y1 - 2013. N2 - Mitogen-activated protein kinases (MAPKs) are a family of protein kinases that are essential nodes in many cellular regulatory circuits including those that take place on DNA. Most members of the four MAPK subgroups that exist in canonical three kinase cascades - extracellular signalregulated kinases 1 and 2 (ERK1/2), ERK5, c-Jun N-terminal kinases (JNK1-3), and p38 (α, β, γ, and δ) families - have been shown to perform regulatory functions on chromatin. This review offers a brief update on the variety of processes that involve MAPKs and available mechanisms garnered in the last two years.. AB - Mitogen-activated protein kinases (MAPKs) are a family of protein kinases that are essential nodes in many cellular regulatory circuits including those that take place on DNA. Most members of the four MAPK subgroups that exist in canonical three kinase cascades - ...
The mitogen-activated protein kinase (MAPK) pathway is the canonical signaling pathway for many receptor tyrosine kinases, such as the Epidermal Growth Factor Receptor. Downstream of the receptors, this pathway involves the activation of a kinase cascade that culminates in a transcriptional response and affects processes, such as cell migration and adhesion. In addition, the strength and duration of the upstream signal also influence the mode of the cellular response that is switched on. Thus, the same components can in principle coordinate opposite responses, such as proliferation and differentiation. In recent years, it has become evident that MAPK signaling is regulated and fine-tuned by proteins that can bind to several MAPK signaling proteins simultaneously and, thereby, affect their function. These so-called MAPK scaffolding proteins are, thus, important coordinators of the signaling response in cells. In this review, we summarize the recent advances in the research on MAPK/extracellular signal
The mitogen-activated protein kinase (MAPK) pathway is the canonical signaling pathway for many receptor tyrosine kinases, such as the Epidermal Growth Factor Receptor. Downstream of the receptors, this pathway involves the activation of a kinase cascade that culminates in a transcriptional response and affects processes, such as cell migration and adhesion. In addition, the strength and duration of the upstream signal also influence the mode of the cellular response that is switched on. Thus, the same components can in principle coordinate opposite responses, such as proliferation and differentiation. In recent years, it has become evident that MAPK signaling is regulated and fine-tuned by proteins that can bind to several MAPK signaling proteins simultaneously and, thereby, affect their function. These so-called MAPK scaffolding proteins are, thus, important coordinators of the signaling response in cells. In this review, we summarize the recent advances in the research on MAPK/extracellular signal
Activation of Ras-MAPK signalling pathway is predominantly essential for promoting neuronal cell growth and differentiation. [24]Several pathways derive from Trk receptors for activation of Ras molecules, which begin by formation of ligand-bound mitogen (BDNF or NGF) at an extracellular domain of the trk, causing receptor dimerization. This subsequently will lead to phosphorylation of the intracellular parts of the receptors, which activates Guanine Exchange factors (GEFs), such as sos, Grb2 and Shc. GEFs trigger the exchange of GDP bound to inactive Ras to GTP, resulting Ras to activate. The presence of activated Ras molecules, stimulate signaling via a major downstream pathway known as MAP kinase (mitogen-activated protein kinase)-although activated Ras, would be also capable of triggering several other downstream pathways such as PLC-y1 and PI3-kinases (Figure..). [24] Mitogen-activated protein kinase (MAPK) pathway involves a series of signalling cascade. Raf is the first component of MAPK, ...
Activation of Ras-MAPK signalling pathway is predominantly essential for promoting neuronal cell growth and differentiation. [24]Several pathways derive from Trk receptors for activation of Ras molecules, which begin by formation of ligand-bound mitogen (BDNF or NGF) at an extracellular domain of the trk, causing receptor dimerization. This subsequently will lead to phosphorylation of the intracellular parts of the receptors, which activates Guanine Exchange factors (GEFs), such as sos, Grb2 and Shc. GEFs trigger the exchange of GDP bound to inactive Ras to GTP, resulting Ras to activate. The presence of activated Ras molecules, stimulate signaling via a major downstream pathway known as MAP kinase (mitogen-activated protein kinase)-although activated Ras, would be also capable of triggering several other downstream pathways such as PLC-y1 and PI3-kinases (Figure..). [24] Mitogen-activated protein kinase (MAPK) pathway involves a series of signalling cascade. Raf is the first component of MAPK, ...
The protein encoded by this gene is a member of the mitogen-activated protein kinase (MAP kinase) family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described.[3] ...
What cellular and molecular properties of neurons in the T-SWR support a 45 min spacing interval for two-trial LTM? Studies of the patterning requirements for the induction of long-term facilitation (LTF) of the tail SN-motor neuron (MN) synapse parallel those for sensitization memory in the T-SWR (Mauelshagen et al., 1996, 1998). For example, four spaced (ISI of 15 min) pulses of exogenous 5-HT are required to induce LTF at tail SN-MN synapses (Mauelshagen et al., 1996). If 5-HT release within the CNS is a critical signaling event initiated by TS, an important experimental question is whether two spaced 5-HT pulses (ISI of 45 min) can induce LTF or whether additional 5-HT signaling (provided by additional pulses) is required.. The analysis of repeated trial learning in Aplysia has identified several critical molecular requirements for LTM induction downstream of 5-HT. These include the signaling kinases protein kinase A (PKA), MAPK, the transcription factor CREB1, and CRE-mediated transcription ...
Molecular Plant-Microbe Interactions 25:471-480...Gerit Bethke,1,2 Pascal Pecher,1 Lennart Eschen-Lippold,1 Kenichi Tsuda,2 Fumiaki Katagiri,2 Jane Glazebrook,2 Dierk Scheel,1 and Justin Lee1...© 2012 The American Phytopathological Society...
Platelet-derived growth factor (PDGF) is a family of signaling molecules that stimulates cell growth, survival and migration. PDGF is recognized by specific transmembrane proteins, the PDGF receptors, which relay the signals to the cell activating the Mitogen-activated protein (MAP) kinases and other signaling pathways. Aberrant activation of these pathways is frequently detected in cancer. Hence, the study of these processes is essential for identifying potential drug targets or diagnostic markers.. In paper I, we identified Receptor Subfamily 4 Group A Member 1 NR4A1 to be regulated by PDGF via MAP kinases, clarifying the role of Extracellular signal-regulated kinases (Erk) 1/2, Erk5 and Nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB) in its regulation. NR4A1 was found to be important for the tumorigenic potential, measured as anchorage-independent growth, of glioblastoma cells.. Since the cellular responses elicited by PDGF result from the balance between phosphorylation ...
Extracellular signal-regulated protein kinase (ERK) is a mitogen-activated protein kinase (MAPK) that mediates intracellular signal transduction in response to a variety of stimuli. ERK is involved in cell proliferation and differentiation and in neuronal plasticity, including long-term potentiation …
arabidopsis, polyclonal, antibody, mpk6, mapk6, map kinase 6, mitogen activated protein kinase 6, MAP kinase induced by pathogens, ethylene biosynthesis, oxidative stress and osmotic stress
FUNCTION: The protein encoded by this gene is a serine/threonine-protein kinase, which is targeted by both the extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways. This enzyme targets several substrates including eukaryotic translation initiation factor 4E and mammalian target of rapamycin, which are negatively regulated by its phosphorylation. Null mutant mice do not exhibit developmental or reproductive defects. However, mice null for both this protein and mitogen-activated protein kinase-interacting serine/threonine protein kinase 1 have delayed tumor development in phosphatase and tensin homolog mutant mice, indicating an oncogenic function for this gene in tumor development. [provided by RefSeq, Oct 2014 ...
TY - JOUR. T1 - Systematic review of p38 mitogen-activated kinase and its functional role in reproductive tissues. AU - Sheller-Miller, Samantha. AU - Richardson, Lauren. AU - Martin, Laura. AU - Jin, Jin. AU - Menon, Ramkumar. PY - 2018/1/1. Y1 - 2018/1/1. N2 - Oxidative stress (OS) plays a role in uterine tissue remodeling during pregnancy and parturition. While p38 MAPK is an OS-response kinase, a precise functional role is unknown. Therefore, we conducted a systematic review of literature on p38 MAPK expression, activation, and function in reproductive tissues throughout pregnancy and parturition, published between January 1980 and August 2017, using four electronic databases (Web of Science, PubMed, Medline, and CoCHRANE). We identified 418 reports; 108 were selected for full-text evaluation and 74 were included in final review. p38 MAPK was investigated using feto-maternal primary or immortalized cells, tissue explants, and animal models. Western blot was most commonly used to report ...
Preconditioning, the phenomenon whereby brief episodes of ischemia or pharmacological agents protect the myocardium against subsequent ischemic injury, consists of an early and a late phase.1 The early phase develops immediately and disappears within 1 to 2 hours of ischemic preconditioning stimulus, whereas the late phase, also known as the second window of protection, becomes manifest after 12 to 24 hours and lasts for 3 to 4 days. An understanding of the signaling mechanisms that trigger and mediate this cardioprotective phenomenon would have vast physiological and pathological implications. Accordingly, many recent studies have focused on the characterization and delineation of the signal transduction pathways (molecules) underlying the development and manifestation of both the early and late phases of preconditioning. The general hypothesis is that the preconditioning stimulus will induce the activation of a cascade of stress-responsive kinases, which in turn transduce the stress signal ...
Fingerprint Dive into the research topics of Saw palmetto extract suppresses insulin-like growth factor-I signaling and induces stress-activated protein kinase/c-Jun N-terminal kinase phosphorylation in human prostate epithelial cells. Together they form a unique fingerprint. ...
Therefore, a rational therapy for NF1 may be to inhibit Ras signaling. A direct approach to inhibit Ras would be to block its required post-translational processing, e.g., by inhibition of farnesyltransferase. In preclinical studies, for example, FTI have been shown to block proliferation of a human neurofibrosarcoma cell line (Yan et al., 1995) and of Schwann cells derived from a neurofibromin-deficient mouse (Kim et al., 1997). FTI administration also reversed learning deficits in the heterozygous NF1+/- mouse (Costa et al., 2002). There is a currently accruing phase 2 clinical trial of an FTI for progressing plexiform neurofibromas in NF1 (protocol 01-C-0222). It has previously been noted that FTI treatment is not very effective at inhibiting proliferation of hematopoietic cells from neurofibromin-deficient mice, which the authors attributed to the lack of ability of the FTI to inhibit the processing of K- and N-Ras (Mahgoub et al., 1999). Functional connections between neurofibromin ...
TY - JOUR. T1 - Activation of mitogen-activated protein kinases by lysophosphatidylcholine- induced mitochondrial reactive oxygen species generation in endothelial cells. AU - Watanabe, Nobuo. AU - Zmijewski, Jaroslaw W.. AU - Takabe, Wakako. AU - Umezu-Goto, Makiko. AU - Le Goffe, Claire. AU - Sekine, Azusa. AU - Landar, Aimee. AU - Watanabe, Akira. AU - Aoki, Junken. AU - Arai, Hiroyuki. AU - Kodama, Tatsuhiko. AU - Murphy, Michael P.. AU - Kalyanaraman, Raman. AU - Darley-Usmar, Victor M.. AU - Noguchi, Noriko. PY - 2006/5. Y1 - 2006/5. N2 - Lysophosphatidylcholine (lysoPC) evokes diverse biological responses in vascular cells including Ca2+ mobilization, production of reactive oxygen species, and activation of the mitogen-activated protein kinases, but the mechanisms linking these events remain unclear. Here, we provide evidence that the response of mitochondria to the lysoPC-dependent increase in cytosolic Ca2+ leads to activation of the extracellular signal-regulated kinase (ERK) ...
TY - JOUR. T1 - The Mechanism of Heat Shock Activation of ERK Mitogen-activated Protein Kinases in the Interleukin 3-dependent ProB Cell Line BaF3. AU - Ng, D.C.H.. AU - Bogoyevitch, M.A.. PY - 2000. Y1 - 2000. M3 - Article. VL - 275. SP - 40856. EP - 40866. JO - The Journal of Biological Chemistry. JF - The Journal of Biological Chemistry. SN - 0021-9258. IS - 52. ER - ...
We have previously reported the in vitro pharmacological properties of E6201, including the following: 1) E6201 suppressed the activation of AP-1 via inhibitory effects on mitogen-activated protein kinase/extracellular signal-regulated kinase kinase-1 and mitogen-activated protein kinase/extracellular signal-regulated kinase kinase kinase-; 2) E6201 decreased activation of NF-κB; 3) E6201 suppressed the production of various proinflammatory cytokines in human monocytes and leukocytes; and 4) E6201 attenuated hyperproliferation and IL-8 production in human keratinocytes in vitro (Goto et al., 2009). These pharmacological properties of E6201 indicate that this compound represents a promising strategy for the treatment of psoriasis, because psoriasis is a chronic inflammatory skin disease characterized by severe hyperplasia in the epidermis and marked infiltration of leukocytes into dermis and epidermis. In this article, we investigated the therapeutic effects of topically administered E6201 in ...
As well as providing a structural framework, the actin cytoskeleton plays integral roles in cell death, survival, and proliferation. The disruption of the actin cytoskeleton results in the activation of the c-Jun N-terminal kinase (JNK) stress-activated protein kinase (SAPK) pathway; however, the
Background: Alzheimers Disease (AD) is a neuron related brain disorder leading to reasoning and memory loss. There is no specific cure identified for AD. JNK3 (c-Jun N-terminal kinase /stress-activated protein kinase) are highly revealed within the central nervous system, particularly neurons, playing vital role in functioning of brain. JNK3 hyper phosphorylation is a very common conclusion in neurodegenerative diseases. JNK3 in turn hyper phosphorylates Amyloid Precursor Protein (APP) which leads to the formation of Amyloid β peptides (an inductive agent of Alzheimers disease). Methods: Protein JNK-3 (PDB ID: 3KVX) was retrieved from protein data bank and later we docked a library of compounds against it. These were further validated by ADMET studies. Results: Thus, docking inhibitors of JNK3 may provide a promising sanitive approach. Based on best docking score and glide score a potential lead is identified against JNK3. Conclusion: Inhibiting JNK-3 may lead to less production of amyloidβ ...
TY - JOUR. T1 - Signal transduction pathways regulated by mitogen-activated/extracellular response kinase kinase kinase induce cell death. AU - Johnson, Nancy Lassignal. AU - Gardner, Anne M.. AU - Diener, Katrina M.. AU - Lange-Carter, Carol A.. AU - Gleavy, Janice. AU - Jarpe, Matthew B.. AU - Minden, Audrey. AU - Karin, Michael. AU - Zon, Leonard I.. AU - Johnson, Gary L.. PY - 1996/2/9. Y1 - 1996/2/9. N2 - Mitogen-activated/extracellular response kinase kinase (MEK) kinase (MEKK) is a serine-threonine kinase that regulates sequential protein phosphorylation pathways, leading to the activation of mitogen-activated protein kinases (MAPK), including members of the Jun kinase (JNK)/stress- activated protein kinase (SAPK) family. In Swiss 3T3 and REF52 fibroblasts, activated MEKK induces cell death involving cytoplasmic shrinkage, nuclear condensation, and DNA fragmentation characteristic of apoptosis. Expression of activated MEKK enhanced the apoptotic response to ultraviolet irradiation, ...
A tetracycline-regulated reporter system was used to investigate the regulation of cyclooxygenase 2 (Cox-2) mRNA stability by the mitogen-activated protein kinase (MAPK) p38 signaling cascade. The stable beta-globin mRNA was rendered unstable by insertion of the 2, 500-nucleotide Cox-2 3 untranslated region (3 UTR). The chimeric transcript was stabilized by a constitutively active form of MAPK kinase 6, an activator of p38. This stabilization was blocked by SB203580, an inhibitor of p38, and by two different dominant negative forms of MAPK-activated protein kinase 2 (MAPKAPK-2), a kinase lying downstream of p38. Constitutively active MAPKAPK-2 was also able to stabilize chimeric beta-globin-Cox-2 transcripts. The MAPKAPK-2 substrate hsp27 may be involved in stabilization, as beta-globin-Cox-2 transcripts were partially stabilized by phosphomimetic mutant forms of hsp27. A short (123-nucleotide) fragment of the Cox-2 3 UTR was necessary and sufficient for the regulation of mRNA stability by the p38
MAPK8 [ENSP00000378974]. Stress-activated protein kinase JNK1; Serine/threonine-protein kinase involved in various processes such as cell proliferation, differentiation, migration, transformation and programmed cell death. Extracellular stimuli such as proinflammatory cytokines or physical stress stimulate the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway. In this cascade, two dual specificity kinases MAP2K4/MKK4 and MAP2K7/MKK7 phosphorylate and activate MAPK8/JNK1. In turn, MAPK8/JNK1 phosphorylates a number of transcription factors, primarily components of AP-1 such as JUN, JDP2 and ATF2 and thus regulates AP-1 transcriptional activity. Phosphorylates the replication licensing factor CDT1, inhibiting the interaction between CDT1 and the histone H4 acetylase HBO1 to replication origins. Loss of this interaction abrogates the acetylation required for replication initiation. Promotes stressed cell apoptosis by phosphorylating key regulatory factors including ...
This gene product is a 626-amino acid polypeptide that is 96.5% identical to mouse Mekk3. Its catalytic domain is closely related to those of several other kinases, including mouse Mekk2, tobacco NPK, and yeast Ste11. Northern blot analysis revealed a 4.6-kb transcript that appears to be ubiquitously expressed. This protein directly regulates the stress-activated protein kinase (SAPK) and extracellular signal-regulated protein kinase (ERK) pathways by activating SEK and MEK1/2 respectively; it does not regulate the p38 pathway. In cotransfection assays, it enhanced transcription from a nuclear factor kappa-B (NFKB)-dependent reporter gene, consistent with a role in the SAPK pathway. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008 ...
Looking for the definition of p38 mitogen-activated protein kinases? Find out what is the full meaning of p38 mitogen-activated protein kinases on Abbreviations.com! Protein Kinase C is one option -- get in to view more @ The Webs largest and most authoritative acronyms and abbreviations resource.
MAPK (mitogen-activated proteins kinase) pathways constitute major regulators of cellular transcriptional programmes. multiple ErbB ligands, vascular endothelial growth element and PHRP (parathyroid hormone-related protein). PHRP is the main mediator of humoral hypercalcaemia of malignancy, and has been implicated in metastasis to bone. We demonstrate that PHRP is definitely secreted by MEK1EE-expressing cells. This secretion is definitely inhibited by PD184352, but not by ErbB inhibitors. Our results suggest that, in addition to anti-proliferative properties, MEK1,2 inhibitors may be anti-angiogenic Tyrosine kinase inhibitor manufacture and possess restorative energy in the treatment of PHRP-positive tumours. transcription reagents (Enzo Diagnostics; Affymetrix, #900182), resulting in approx.?100-fold amplification of RNA. The biotin-labelled cRNA probes were purified and fragmented in fragmentation buffer (Affymetrix, #900371) by incubation at 95?C for 35?min. Hybridization to Affymetrix U95A ...
Phosphorylation of the C terminus of c-Fos has been implicated in serum response element-mediated repression of c-fos transcription after its induction by serum growth factors. The growth-regulated enzymes responsible for this phosphorylation in early G1 phase of the cell cycle and the sites of phosphorylation have not been identified. We now provide evidence that two growth-regulated, nucleus- and cytoplasm-localized protein kinases, 90-kDa ribosomal S6 kinase (RSK) and mitogen-activated protein kinase (MAP kinase), contribute to the serum-induced phosphorylation of c-Fos. The major phosphopeptides derived from biosynthetically labeled c-Fos correspond to phosphopeptides generated after phosphorylation of c-Fos in vitro with both RSK and MAP kinase. The phosphorylation sites identified for RSK (Ser-362) and MAP kinase (Ser-374) are in the transrepression domain. Cooperative phosphorylation at these sites by both enzymes was observed in vitro and reflected in vivo by the predominance of the ...
BACKGROUND: Mitogen-activated protein kinase 14 (MAPK14) acts as an integration point for multiple biochemical signal pathways. High expressions of MAPK14 have been found in a variety of tumors. Runt‑related transcription factor 2 (RUNX2) is related to many tumors, especially in tumor invasion and metastasis. However, the mechanism of these two genes in bladder cancer remains unclear.. METHODS: TCGA database and Western blot were used to analyze the mRNA and protein levels of the target gene in bladder cancer tissues and adjacent tissues. The proliferation ability of bladder cancer cells was tested by colony forming and EdU assay. The migration ability of cells was detected by transwell assay. Immunoprecipitation was utilized to detect protein-protein interaction. Cycloheximide chase assay was used to measure the half-life of RUNX2 protein.. RESULTS: Phosphorylated mitogen-activated protein kinase 14 (P-MAPK14, Thr180/Tyr182) was highly expressed in bladder cancer tissues and bladder cancer ...
LOC100996792 (dual specificity mitogen-activated protein kinase kinase 3), Authors: Dessen P. Published in: Atlas Genet Cytogenet Oncol Haematol.
TY - JOUR. T1 - Attenuation of CHOP-mediated myocardial apoptosis in pressure-overloaded dominant negative p38α mitogen-activated protein kinase mice. AU - Sari, Flori R.. AU - Widyantoro, Bambang. AU - Thandavarayan, Rajarajan A.. AU - Harima, Meilei. AU - Lakshmanan, Arun. AU - Zhang, Shaosong. AU - Muslin, Anthony J.. AU - Suzuki, Kenji. AU - Kodama, Makoto. AU - Watanabe, Kenichi. PY - 2011/6/27. Y1 - 2011/6/27. N2 - Background/Aims: Pressure overload stimulation is known to elicit disturbances in the endoplasmic reticulum (ER), which leads to ER stress (ERS). p38 mitogen-activated protein kinase (MAPK) plays an important role in mediating apoptotic processes, however, the roles of this kinase in activating ERS-initiated apoptosis in pressure-overloaded hearts are largely unknown. Methods: We clarified the role of p38α MAPK in ERS-associated apoptosis by subjecting transgenic mice displaying cardiac specific dominant negative (DN) mutant p38α MAPK over-expression to seven day pressure ...
Vascular smooth muscle contraction is mediated by activation of extracellular signal-regulated kinase (ERK) 1/2, an isoform of mitogen-activated protein kinase (MAPK). However, the role of stress-activated protein kinase/,i,c-Jun,/i, N-terminal kinase (JNK) in vascular smooth muscle contraction has not been defined. We investigated the role of JNK in the contractile response to norepinephrine (NE) in rat aortic smooth muscle. NE evoked contraction in a dose-dependent manner, and this effect was inhibited by the JNK inhibitor SP600125. NE increased the phosphorylation of JNK, which was greater in aortic smooth muscle from hypertensive rats than from normotensive rats. NE-induced JNK phosphorylation was significantly inhibited by SP600125 and the conventional-type PKC (cPKC) inhibitor Gö6976, but not by the Rho kinase inhibitor Y27632 or the phosphatidylinositol 3-kinase inhibitor LY294002. Thymeleatoxin, a selective activator of cPKC, increased JNK phosphorylation, which was inhibited by ...
The phosphorylation of the human estrogen receptor (ER) serine residue at position 118 is required for full activity of the ER activation function 1 (AF-1). This Ser118 is phosphorylated by mitogen-activated protein kinase (MAPK) in vitro and in cells treated with epidermal growth factor (EGF) and insulin-like growth factor (IGF) in vivo. Overexpression of MAPK kinase (MAPKK) or of the guanine nucleotide binding protein Ras, both of which activate MAPK, enhanced estrogen-induced and antiestrogen (tamoxifen)-induced transcriptional activity of wild-type ER, but not that of a mutant ER with an alanine in place of Ser118. Thus, the activity of the amino-terminal AF-1 of the ER is modulated by the phosphorylation of Ser118 through the Ras-MAPK cascade of the growth factor signaling pathways.. ...
MK08_HUMAN] Serine/threonine-protein kinase involved in various processes such as cell proliferation, differentiation, migration, transformation and programmed cell death. Extracellular stimuli such as proinflammatory cytokines or physical stress stimulate the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway. In this cascade, two dual specificity kinases MAP2K4/MKK4 and MAP2K7/MKK7 phosphorylate and activate MAPK8/JNK1. In turn, MAPK8/JNK1 phosphorylates a number of transcription factors, primarily components of AP-1 such as JUN, JDP2 and ATF2 and thus regulates AP-1 transcriptional activity. Phosphorylates the replication licensing factor CDT1, inhibiting the interaction between CDT1 and the histone H4 acetylase HBO1 to replication origins. Loss of this interaction abrogates the acetylation required for replication initiation. Promotes stressed cell apoptosis by phosphorylating key regulatory factors including p53/TP53 and Yes-associates protein YAP1. In ...
The data reported herein show the capacity of NSC 651016 to act as an inhibitor of CXCL12-mediated angiogenesis in a variety of in vitro and in vivo angiogenesis assays. Furthermore, these data suggest the potential application of NSC 651016 as an antiangiogenic therapy because it blocked endothelial cell migration, capillary-like tube formation, and angiogenesis. Furthermore, NSC 651016 may have wider applications in cancer therapy. CXCL12 has been implicated in the proliferation of astrocytes (14) by activating extracellular signal-regulated kinase 1/2 but not p38 or stress-activated protein kinase/c-Jun NH2-terminal kinase pathways (14) , therefore, CXCL12 may have a direct role in pathological glial cell proliferation such as reactive gliosis and brain tumor formation. Thus, blockade of CXCL12 function by NSC 651016 may have direct therapeutic benefits for certain brain cancers, one of the most refractory tumor types known. Additionally, CXCL12 participates in cancer cell metastasis by ...
Cytokines may contribute to beta-cell apoptosis in the early stages of type 1 diabetes mellitus. It has been reported recently that interleukin-1 beta (IL-1 beta) induces activation of the mitogen-activated protein kinases (MAPK) p38 and ERK1/2 in neonatal rat islets. Since these kinases may partici …
The p38 mitogen-activated protein kinase (MAPK) pathway plays an important role in the post-transcriptional regulation of inflammatory genes. p38 has been found to regulate both the translation and the stability of inflammatory mRNAs. The mRNAs regulated by p38 share common AU-rich elements (ARE) present in their 3-untranslated regions. AREs act as mRNA instability determinants but also confer stabilisation of the mRNA by the p38 pathway. In recent years, AREs have shown to be binding sites for numerous proteins including HuR, TTP, AUF1, AUF2, FBP1, FBP2 (KSRP), TIA-1, and TIAR. However, it is unclear which protein is responsible for mRNA stabilisation by p38. This review gives an overview of the major ARE-binding proteins and discusses reasons for and against their involvement in p38-mediated mRNA stabilisation.
The Raf-1 protein, encoded by the c-raf-1 gene, is a 75 kDa serine-threonine kinase that functions as a key regulator of cell growth, proliferation, and survival (1) . Raf-1 is a critical component of multiple signal transduction pathways, integrating signals from cell membrane-bound growth factor receptors and apoptotic regulators (2) . Activated Raf-1 in turn interfaces with a many downstream targets controlling proliferation and survival, including activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase kinases MEK1 and MEK2, activation of the nuclear factor κB survival and proliferation pathway, and inhibition of the proapoptotic factor Bad (3) .. Deregulated Raf-1 activity has been implicated in oncogenic transformation (4 , 5) . Constitutive Raf-1 activation leads to morphological changes consistent with a malignant phenotype, to growth factor-independent proliferation, and to increased resistance to cytotoxic agents (6) . Raf-1 promotes full malignant ...
Catalytic domain of the Serine/Threonine Kinase, p38alpha Mitogen-Activated Protein Kinase. Serine/Threonine Kinases (STKs), p38alpha subfamily, catalytic (c) domain. STKs catalyze the transfer of the gamma-phosphoryl group from ATP to serine/threonine residues on protein substrates. The p38alpha subfamily is part of a larger superfamily that includes the catalytic domains of other protein STKs, protein tyrosine kinases, RIO kinases, aminoglycoside phosphotransferase, choline kinase, and phosphoinositide 3-kinase. p38 kinases are mitogen-activated protein kinases (MAPKs), serving as important mediators of cellular responses to extracellular signals. They are activated by the MAPK kinases MKK3 and MKK6, which in turn are activated by upstream MAPK kinase kinases including TAK1, ASK1, and MLK3, in response to cellular stresses or inflammatory cytokines. Vertebrates contain four isoforms of p38, named alpha, beta, gamma, and delta. p38alpha, also called MAPK14, is expressed in most tissues and is ...
Cerebral ischemia is associated with the activation of glial cells, infiltration of leukocytes and an increase in inflammatory mediators in the ischemic brain and systemic circulation. How this inflammatory response influences lesion size and neurological outcome remains unclear. D-JNKI1, an inhibitor of the c-Jun N-terminal kinase pathway, is strongly neuroprotective in animal models of stroke. Intriguingly, the protection mediated by D-JNKI1 is high even with intravenous administration at very low doses with undetectable drug levels in the brain, pointing to a systemic mode of action, perhaps on inflammation. We evaluated whether D-JNKI1, administered intravenously 3 h after the onset of middle cerebral artery occlusion (MCAO), modulates secretion of the inflammatory mediators interleukin-6 and keratinocyte-derived chemokine in the plasma and from the spleen and brain at several time points after MCAO. We found an early release of both mediators in the systemic circulation followed by an increase in
Fingerprint Dive into the research topics of Involvement of mitogen-activated protein kinase in hippocampal long-term potentiation. Together they form a unique fingerprint. ...
Mitogen-activated protein kinase (MAPK)-triggered protein kinase 2 (MAPKAPK2) mediates multiple p38 MAPK-dependent inflammatory responses. at Ser-58. Computational modeling and calculation of theoretical binding energies predicted that both phosphorylation at Ser-58 and mutation of Ser-58 to Asp (S58D) jeopardized the ability of 14-3-3 to dimerize. Experimentally, S58D mutation significantly impaired both 14-3-3 dimerization and binding to Raf-1. These data suggest that MAPKAPK2-mediated phosphorylation regulates 14-3-3 functions, and this MAPKAPK2 activity may symbolize a novel pathway mediating p38 MAPK-dependent swelling. A diverse group of cellular responses are elicited by activation of a highly conserved family of mitogen-activated protein kinase (MAPK) signaling pathways, which includes extracellular signal-regulated kinases (ERKs), c-jun N-terminal kinases (JNKs), ERK5, and p38 MAPKs. A large body of evidence shows that p38 MAPK activity is critical to immune and inflammatory responses. ...
Mitogen-activated protein kinase 13 (MAPK 13), also known as stress-activated protein kinase 4 (SAPK4), is an enzyme that in humans is encoded by the MAPK13 gene. The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is closely related to p38 MAP kinase, both of which can be activated by proinflammatory cytokines and cellular stress. MAP kinase kinases 3, and 6 can phosphorylate and activate this kinase. Transcription factor ATF2, and microtubule dynamics regulator stathmin have been shown to be the substrates of this kinase. GRCh38: Ensembl release 89: ENSG00000156711 - Ensembl, May 2017 GRCm38: Ensembl release 89: ENSMUSG00000004864 - Ensembl, May 2017 Human PubMed Reference:. Mouse PubMed Reference:. Entrez Gene: mitogen-activated protein kinase 13. ...
Mitogen-activated protein kinases (MAPKs) are proline-directed serine and threonine protein kinases that regulate numerous physiological cell responses including: embryogenesis, cell differentiation, proliferation, migration, apoptosis and death. Extracellular signal-regulated kinases (ERKs) 1 and 2 (ERK1/2), also known as p44 MAPK and p42 MAPK respectively, belong to one of the five major groups of MAPKs. Closely-related ERK1/2 isoforms are uniquely activated by several extracellular signals including growth factors, cytokines, hormones, and neuro-transmitters. Activation of ERK1/2 by the upstream kinases MEK1 and MEK2 occurs via dual phosphorylation on specific threonine (Thr202) and tyrosine (Tyr204) residues on the T*EY* motif. MEK1 and MEK2 are activated through receptors (tyrosine kinases or integrins) via pathways involving adaptor proteins, guanine nucleotide exchange factors, small GTP binding proteins, and MAPKKs. Activated ERK1/2 phosphorylates both, cytosolic (SOS, MNK1/2, RSKs) and ...
p42 MAP Kinase (Mitogen-Activated Protein Kinase, MAPK), also known as Erk2 (Extracellular signal-regulated kinase 2) is one of two isoforms of MAP kinase family. It is a serine/threonine protein kinase
Catalytic domain of the Serine/Threonine Kinase, p38 Mitogen-Activated Protein Kinase. Serine/Threonine Kinases (STKs), p38 subfamily, catalytic (c) domain. STKs catalyze the transfer of the gamma-phosphoryl group from ATP to serine/threonine residues on protein substrates. The p38 subfamily is part of a larger superfamily that includes the catalytic domains of other protein STKs, protein tyrosine kinases, RIO kinases, aminoglycoside phosphotransferase, choline kinase, and phosphoinositide 3-kinase. p38 kinases are mitogen-activated protein kinases (MAPKs), serving as important mediators of cellular responses to extracellular signals. They function in the regulation of the cell cycle, cell development, cell differentiation, senescence, tumorigenesis, apoptosis, pain development and pain progression, and immune responses. p38 kinases are activated by the MAPK kinases MKK3 and MKK6, which in turn are activated by upstream MAPK kinase kinases including TAK1, ASK1, and MLK3, in response to cellular ...
The mitogen-activated protein kinase (MAPK) pathway is intimately implicated in the molecular pathogenesis of non-small-cell lung cancer (NSCLC). Aberrant MAPK signaling resulting from the upstream activating mutations converges on mitogen-activated protein kinase kinase 1/2 (MEK1/2), making MEK inhibition an attractive strategy for the treatment of NSCLC. Several MEK inhibitors have demonstrated anticancer activity in patients with NSCLC. Areas covered: In this article, we discuss the biological rationale for the use of MEK inhibitors and summarize the clinical experience with MEK1/2 inhibitors for the treatment of NSCLC, from initial phase I studies to phase II/III studies, both as monotherapy or in combination with other anticancer agents ...
Expression of integrin αvβ3 is increased on endothelial cells after exposure to bFGF in vitro (Cheng and Kramer, 1989; Senger et al., 1996; Boudreau et al., 1997) and angiogenic blood vessels in vivo (Brooks et al., 1994a,b, 1995). In addition, integrin αvβ3 expression on chick CAM angiogenic blood vessels has been linked to the ability of bFGF to promote expression of the Hox D3 homeobox gene in these tissues (Boudreau et al., 1997). While αvβ3 was detectable on preexisting blood vessels in 10-d-old chick CAMs, αvβ3 levels were not significantly increased above this baseline level for at least 12 h after bFGF treatment. This suggests that the preexisting levels of αvβ3 are sufficient to initiate this sustained phase of MAP kinase activity in these blood vessels and that the requirement of αvβ3 ligation for the sustained MAP kinase activity in blood vessels within 4 h was independent of an increase in the total expression of αvβ3 protein. To support the model that integrin-mediated ...
FIGURE 4. LPS and T. gondii trigger distinct MKK3/6 activation kinetics. A, Mφ were stimulated with either LPS or T. gondii (Tg), and at the indicated time points cell lysates were prepared for immunoblot analysis using phospho-specific MKK3/6 Ab (phospho). In parallel, a gel was stained with Coomassie Blue to assure equivalent protein loading (total). The region shown (37-50 kDa) brackets the molecular mass of MKK3/6 (40 and 41 kDa). Densitometric analysis of phospho-MKK3/6 and phospho-p38 MAPK within each sample was performed on cells stimulated with LPS and Toxoplasma (B). C, Phospho-MKK3/6 was examined in whole cell lysates of Mφ that were subjected to 6-h pretreatment with medium alone, Toxoplasma (Tg; 1:6 ratio of cells to parasites), or LPS (100 ng/ml), followed by secondary LPS stimulation (100 ng/ml) for the indicated times. The experiments were repeated three times with the same result.. ...
The mitogen-activated protein kinase (MAPK) cascade is a highly conserved module that is involved in various cellular functions, including cell proliferation, differentiation and migration. Mammals express at least four distinctly regulated groups of MAPKs, extracellular signal-related kinases (ERK)-1/2, Jun amino-terminal kinases (JNK1/2/3), p38 proteins (p38alpha/beta/gamma/delta) and ERK5, that are activated by specific MAPKKs: MEK1/2 for ERK1/2, MKK3/6 for the p38, MKK4/7 (JNKK1/2) for the JNKs, and MEK5 for ERK5. Each MAPKK, however, can be activated by more than one MAPKKK, increasing the complexity and diversity of MAPK signalling. Presumably each MAPKKK confers responsiveness to distinct stimuli. For example, activation of ERK1/2 by growth factors depends on the MAPKKK c-Raf, but other MAPKKKs may activate ERK1/2 in response to pro-inflammatory stimuli. Source: KEGG http://www.genome.jp/dbget-bin/www_bget?pathway:map04010 ...
The mitogen-activated protein kinase (MAPK) cascade is a highly conserved module that is involved in various cellular functions, including cell proliferation, differentiation and migration. Mammals express at least four distinctly regulated groups of MAPKs, extracellular signal-related kinases (ERK)-1/2, Jun amino-terminal kinases (JNK1/2/3), p38 proteins (p38alpha/beta/gamma/delta) and ERK5, that are activated by specific MAPKKs: MEK1/2 for ERK1/2, MKK3/6 for the p38, MKK4/7 (JNKK1/2) for the JNKs, and MEK5 for ERK5. Each MAPKK, however, can be activated by more than one MAPKKK, increasing the complexity and diversity of MAPK signalling. Presumably each MAPKKK confers responsiveness to distinct stimuli. For example, activation of ERK1/2 by growth factors depends on the MAPKKK c-Raf, but other MAPKKKs may activate ERK1/2 in response to pro-inflammatory stimuli ...
ERKs (Extracellular-signal-regulated kinases) are widely expressed protein kinase intracellular signalling molecules that are involved in functions including the regulation of meiosis, mitosis, and postmitotic functions in differentiated cells. Many different stimuli, including growth factors, cytokines, virus infection, ligands for heterotrimeric G protein-coupled receptors, transforming agents, and carcinogens, activate the ERK pathway. In the MAPK/ERK pathway, Ras activates c-Raf, followed by mitogen-activated protein kinase kinase (abbreviated as MKK, MEK, or MAP2K) and then MAPK1/2 (below). Ras is typically activated by growth hormones through receptor tyrosine kinases and GRB2/SOS, but may also receive other signals. ERKs are known to activate many transcription factors, such as ELK1, and some downstream protein kinases. Disruption of the ERK pathway is common in cancers, especially Ras, c-Raf and receptors such as HER2.
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Söderström T.S., Poukkula M., Holmström T.H., et al. Mitogen-activated protein kinase/extracellular signal-regulated kinase signaling in activated T cells abrogates TRAIL-induced apoptosis upstream of the mitochondrial amplification loop and caspase-8. (англ.) // J. Immunol. (англ.)русск. : journal. - 2002. - Vol. 169, no. 6. - P. 2851-2860. - PMID 12218097. ...
Background Multi-drug proneness and level of resistance to metastasize are main clinical complications in cancers treatment. on cell migration and in cell protein-protein association Neurog1 had been researched by wound-healing and closeness ligation assays, respectively. Outcomes We present right here, that N11 treatment network 336113-53-2 marketing leads to i) significant caspase-mediated apoptotic cell loss of […]. Read More ». ...
This trial aims to evaluate the efficacy of fulvestrant +/- selumetinib [AZD6244] in patients with advanced stage breast cancer progressing after aromatase
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
"Fluid shear stress activation of focal adhesion kinase. Linking to mitogen-activated protein kinases". J. Biol. Chem. 272 (48 ... Corbalan-Garcia S, Yang SS, Degenhardt KR, Bar-Sagi D (1996). "Identification of the mitogen-activated protein kinase ... "Transgenic MUC1 interacts with epidermal growth factor receptor and correlates with mitogen-activated protein kinase activation ... nucleotide exchange protein Sos and a 75-kDa protein that is a substrate for T cell antigen receptor-activated tyrosine kinases ...
... to activate the Rho family of GTPases signaling proteins and Gi-Gβγ G proteins to activateRaf/MEK/mitogen-activated kinase ... RAF/MEK/Mitogen-activated protein kinases; PKC/Ca2+/Calcineurin/Nuclear factor of activated T-cells; and the EGF cellular ... regulation of proliferation by activation of the epidermal growth factor receptor and mitogen-activated protein kinase ... phospholipase C/IP3/cell Ca2+ mobilization/diacylglycerol/protein kinase Cs; calmodulin-modulated myosin light chain kinase; ...
Mitogen-activated protein kinase 4 is a member of the mitogen-activated protein kinase family. Tyrosine kinase growth factor ... "Genomic loci of human mitogen-activated protein kinases". Oncogene. 9 (2): 647-9. PMID 8290275. "Entrez Gene: MAPK4 mitogen- ... Mitogen-activated protein kinase 4 is an enzyme that in humans is encoded by the MAPK4 gene. ... Robinson MJ, Cobb MH (April 1997). "Mitogen-activated protein kinase pathways". Current Opinion in Cell Biology. 9 (2): 180-6. ...
Yang TT, Xiong Q, Enslen H, Davis RJ, Chow CW (Jun 2002). "Phosphorylation of NFATc4 by p38 mitogen-activated protein kinases ... Nuclear factor of activated T-cells, cytoplasmic 4 is a protein that in humans is encoded by the NFATC4 gene. The product of ... NFATC4+protein,+human at the US National Library of Medicine Medical Subject Headings (MeSH) This article incorporates text ... Other members of this family of nuclear factors of activated T cells also participate in the formation of this complex. The ...
But MyD88 also activates mitogenactivated protein kinases (MAPKs). However, several strains of lactic acid bacteria have been ... Toll-like receptor 6 is a protein that in humans is encoded by the TLR6 gene. TLR6 is a transmembrane protein, member of toll- ... It is also known that TLR2/6 binds some viral products, among them hepatitis C core and NS3 protein from the hepatitis C virus ... TLR6 has also been designated as CD286 (cluster of differentiation 286). The protein encoded by this gene is a member of the ...
"Regulation of lymphoid enhancer factor 1/T-cell factor by mitogen-activated protein kinase-related Nemo-like kinase-dependent ... 2003). "The TAK1-NLK mitogen-activated protein kinase cascade functions in the Wnt-5a/Ca(2+) pathway to antagonize Wnt/beta- ... This enzyme is a member of the Mitogen-activated protein kinase (MAPK) family, although not explicitly designated as such (it ... Coulombe P, Meloche S (August 2007). "Atypical mitogen-activated protein kinases: structure, regulation and functions". Biochim ...
It is a p38 mitogen-activated protein kinase inhibitor. A phase II trial for treatment of ovarian cancer has completed. Patnaik ...
Roy M, Li Z, Sacks DB (September 2005). "IQGAP1 is a scaffold for mitogen-activated protein kinase signaling". Mol. Cell. Biol ... Ras GTPase-activating-like protein IQGAP1 (IQGAP1) also known as p195 is a ubiquitously expressed protein that in humans is ... or poly-proline protein-protein domain, so named because of two functionally conserved tryptophans, W, is a protein-protein ... It was hypothesized that IQGAP1 would act as a GTPase activating protein (GAP) protein, promoting the switch of ras GTPases ...
"Protein tyrosine phosphatase epsilon inhibits signaling by mitogen-activated protein kinases". Mol. Cancer Res. 1 (7): 541-50. ... The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling ... "Entrez Gene: PTPRE protein tyrosine phosphatase, receptor type, E". Peretz A, Gil-Henn H, Sobko A, Shinder V, Attali B, Elson A ... Receptor-type tyrosine-protein phosphatase epsilon is an enzyme that in humans is encoded by the PTPRE gene. ...
The protein encoded by this gene is a scaffolding protein that brings together mitogen-activated protein kinases and their ... Extracellular signals are transduced into cells through mitogen-activated protein kinases. The structural organization of these ... C-jun-amino-terminal kinase-interacting protein 4 is a scaffold protein that in humans is encoded by the SPAG9 gene. ... Ichijo H (Nov 1999). "From receptors to stress-activated MAP kinases". Oncogene. 18 (45): 6087-93. doi:10.1038/sj.onc.1203129. ...
Voong LN, Slater AR, Kratovac S, Cressman DE (Apr 2008). "Mitogen-activated protein kinase ERK1/2 regulates the class II ... The protein uses GTP binding to facilitate its own transport into the nucleus. Once in the nucleus, the protein acts as a ... a novel zinc finger protein that binds CIITA and activates MHC gene transcription". Molecular Immunology. 44 (4): 311-21. doi: ... The CIITA protein contains an acidic transcriptional activation domain, 4 LRRs (leucine-rich repeats) and a GTP binding domain ...
"Eotaxin-2 alters eosinophil integrin function via mitogen-activated protein kinases". Am. J. Respir. Cell Mol. Biol. 26 (6): ... and is negative on monocytes and activated T lymphocytes. The protein is also a strong suppressor of colony formation by a ... C-C motif chemokine ligand 24 is a protein that in humans is encoded by the CCL24 gene. This gene belongs to the subfamily of ... The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic ...
Yang SH, Galanis A, Sharrocks AD (June 1999). "Targeting of p38 mitogen-activated protein kinases to MEF2 transcription factors ... Yang SH, Galanis A, Sharrocks AD (1999). "Targeting of p38 Mitogen-Activated Protein Kinases to MEF2 Transcription Factors". ... with a mitogen-activated protein kinase, ERK5/BMK1". Nucleic Acids Res. 26 (20): 4771-7. doi:10.1093/nar/26.20.4771. PMC 147902 ... "Smad proteins function as co-modulators for MEF2 transcriptional regulatory proteins". Nucleic Acids Res. 29 (3): 732-42. doi: ...
Yang SH, Galanis A, Sharrocks AD (Jun 1999). "Targeting of p38 mitogen-activated protein kinases to MEF2 transcription factors ... with a mitogen-activated protein kinase, ERK5/BMK1". Nucleic Acids Research. 26 (20): 4771-7. doi:10.1093/nar/26.20.4771. PMC ... with a mitogen-activated protein kinase, ERK5/BMK1". Nucleic Acids Research. 26 (20): 4771-7. doi:10.1093/nar/26.20.4771. PMC ... The encoded protein has 473 amino acids with a predicted molecular weight of 51.221 kiloDaltons. Three isoforms have been ...
Jensen LE, Whitehead AS (2003). "Pellino2 activates the mitogen activated protein kinase pathway". FEBS Lett. 545 (2-3): 199- ... Protein pellino homolog 1 is a protein that in humans is encoded by the PELI1 gene. GRCh38: Ensembl release 89: ENSG00000197329 ... Butler MP, Hanly JA, Moynagh PN (2007). "Kinase-active interleukin-1 receptor-associated kinases promote polyubiquitination and ... direct evidence for PELLINO proteins being ubiquitin-protein isopeptide ligases". J. Biol. Chem. 282 (41): 29729-29737. doi: ...
The protein encoded by this gene is a member of the MAP (mitogen-activated protein) kinase family. MAP kinases are also known ... including cyclin-dependent kinase 2 (CDK2), mitogen-activated protein kinase 12 (MAPK12), and lactotransferrin (LTF), among ... Mitogen-activated protein kinase 15, also known as MAPK15, ERK7, or ERK8, is an enzyme that in humans is encoded by the MAPK15 ... "Entrez Gene: MAPK15 mitogen-activated protein kinase 15". Chia J, Tham KM, Gill DJ, Bard-Chapeau EA, Bard FA (2014). "ERK8 is a ...
"Understanding mitogen activated protein kinase cascade in plants". NIPGR. 10 May 2018. "Vidwan - Profile Page". vidwan. ... Sinha's research is focused on Mitogen-activated protein kinase (MAPK) and its cascading effect on plants. His studies have ... Jalmi, Siddhi Kashinath; Sinha, Alok Krishna (29 November 2016). "Functional Involvement of a Mitogen Activated Protein Kinase ... Known for his research on Mitogen-activated protein kinase (MAPK) cascade in plants, he is a three-time Alexander von Humboldt ...
Huang, C. Y; Ferrell Jr, J. E (1996). "Ultrasensitivity in the mitogen-activated protein kinase cascade". Proceedings of the ... all-or-none changes in MAP kinase activity, cyclin-dependent kinase activity, and cell fate. These studies helped demonstrate ... waves of Cdk1 activity that spread faster and farther than the Cdk1 protein molecules can diffuse. They also showed that ...
Jensen LE, Whitehead AS (2003). "Pellino2 activates the mitogen activated protein kinase pathway". FEBS Lett. 545 (2-3): 199- ... Protein pellino homolog 2 is a protein that in humans is encoded by the PELI2 gene. GRCh38: Ensembl release 89: ENSG00000139946 ... 2006). "A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration". Cell. ... for the Pelle adaptor protein Pellino to mouse chromosomes 11 and 14 and human chromosomes 2p13.3 and 14q21, respectively, by ...
This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the ... "Identification of substrates and regulators of the mitogen-activated protein kinase ERK5 using chimeric protein kinases". J. ... Mitogen-activated protein kinase 7 also known as MAP kinase 7 is an enzyme that in humans is encoded by the MAPK7 gene. MAPK7 ... "Characterization of the mitogen-activated protein kinase phosphorylation sites on the connexin-43 gap junction protein". J. ...
Mitogen-activated protein kinase 13 (MAPK 13), also known as stress-activated protein kinase 4 (SAPK4), is an enzyme that in ... "Entrez Gene: mitogen-activated protein kinase 13". Efimova T, Broome AM, Eckert RL (2004). "Protein kinase Cdelta regulates ... 2008). "Implication of p38 mitogen-activated protein kinase isoforms (alpha, beta, gamma and delta) in CD4+ T-cell infection ... Efimova T (2010). "p38delta mitogen-activated protein kinase regulates skin homeostasis and tumorigenesis". Cell Cycle. 9 (3): ...
"Human mitogen-activated protein kinase kinase kinase mediates the stress-induced activation of mitogen-activated protein kinase ... Dual specificity mitogen-activated protein kinase kinase 6 also known as MAP kinase kinase 6 (MAPKK 6) or MAPK/ERK kinase 6 is ... protein kinase activity. • kinase activity. • protein binding. • protein tyrosine kinase activity. • ATP binding. • protein ... the protein kinase TAO2 and identification of its mitogen-activated protein kinase/extracellular signal-regulated kinase kinase ...
... is also known as MEK1 (see Mitogen-activated protein kinase kinase). MEK1 is a meiotic chromosome-axis-associated kinase ... protein tyrosine kinase activity. • nucleotide binding. • MAP kinase kinase activity. • protein kinase activity. • protein ... "Entrez Gene: MAP2K1 mitogen-activated protein kinase kinase 1".. *^ a b Goldfarb T, Lichten M (2010). "Frequent and efficient ... Dual specificity mitogen-activated protein kinase kinase 1 is an enzyme that in humans is encoded by the MAP2K1 gene.[5][6] ...
"Identification of regulatory phosphorylation sites in mitogen-activated protein kinase (MAPK)-activated protein kinase-1a/ ... "Phosphorylation of the c-Fos transrepression domain by mitogen-activated protein kinase and 90-kDa ribosomal S6 kinase". ... Zaheer A, Lim R (Feb 1997). "Protein kinase A (PKA)- and protein kinase C-phosphorylated glia maturation factor promotes the ... via a mitogen-activated protein kinase-independent pathway in B cells". The Journal of Biological Chemistry. 272 (29): 18200-8 ...
Yang X, Gabuzda D (November 1998). "Mitogen-activated protein kinase phosphorylates and regulates the HIV-1 Vif protein". The ... Vif is a 23-kilodalton protein that is essential for viral replication. Vif inhibits the cellular protein, APOBEC3G, from ... Viral infectivity factor, or Vif, is an accessory protein found in HIV and other lentiviruses. Its role is to disrupt the ... vif+Protein at the US National Library of Medicine Medical Subject Headings (MeSH). ...
"SynGAP regulates synaptic strength and mitogen-activated protein kinases in cultured neurons". Proceedings of the National ... "SynGAP regulates synaptic strength and mitogen-activated protein kinases in cultured neurons". Proceedings of the National ... "Regulation of the neuron-specific Ras GTPase-activating protein, synGAP, by Ca2+/calmodulin-dependent protein kinase II". The ... Synaptic Ras GTPase-activating protein 1, also known as synaptic Ras-GAP 1 or SYNGAP1, is a protein that in humans is encoded ...
"Integrin αvβ3 requirement for sustained mitogen-activated protein kinase activity during angiogenesis". Journal of Cell Biology ...
"MAP2K1 mitogen-activated protein kinase kinase 1 [Homo sapiens (human)] - Gene - NCBI". Lones MA, Raphael M, McCarthy K, ... encoding a guanylate kinase which interacts with BCL10 and activates NF-κB to regulate cell survival); 2) changes in the ... that is involved in activating T-cells), CDKN2A (encoding p16INK4a and p14arf tumor suppressor proteins) or CDKN2B (encoding ... Phosphoinositide 3-kinase inhibitors such as copanlisib, duvelisib, and idelalisib which block the phosphoinositide 3-kinase ...
Waskiewicz AJ, Flynn A, Proud CG, Cooper JA (1997). "Mitogen-activated protein kinases activate the serine/threonine kinases ... "Mitogen-activated protein kinases activate the serine/threonine kinases Mnk1 and Mnk2". EMBO J. ENGLAND. 16 (8): 1909-20. doi: ... "The mitogen-activated protein kinase signal-integrating kinase Mnk2 is a eukaryotic initiation factor 4E kinase with high ... "Negative regulation of protein translation by mitogen-activated protein kinase-interacting kinases 1 and 2". Mol. Cell. Biol. ...
The protein encoded by this gene is a member of the mitogen-activated protein kinase (MAP kinase) family. MAP kinases, also ... Mitogen-activated protein kinase 3, also known as p44MAPK and ERK1, is an enzyme that in humans is encoded by the MAPK3 gene. ... "Entrez Gene: MAPK3 mitogen-activated protein kinase 3". Buggele WA, Johnson KE, Horvath CM (2012). "Influenza A virus infection ... Meloche S, Pouysségur J (2007). "The ERK1/2 mitogen-activated protein kinase pathway as a master regulator of the G1- to S- ...
"The neuropeptide substance P activates p38 mitogen-activated protein kinase resulting in IL-6 expression independently from NF- ... "Metalloproteinases and transforming growth factor-alpha mediate substance P-induced mitogen-activated protein kinase activation ... "Substance P induces rapid and transient membrane blebbing in U373MG cells in a p21-activated kinase-dependent manner". PLOS ONE ... The molecule, which is rapidly inactivated (or at times further activated by peptidases) is rapidly released - repetitively and ...
Mijelin protein nula • Osteonektin • Protein C • Protein S • Proteoglikan • Serum amiloid P komponenta • Sialoglikoprotein ( ... Shu HB, Hu WH, Johnson H (May 1999). "TALL-1 is a novel member of the TNF family that is down-regulated by mitogens". J. Leukoc ... 1999). "Identification and characterization of a novel cytokine, THANK, a TNF homologue that activates apoptosis, nuclear ... factor-kappaB, and c-Jun NH2-terminal kinase.". J. Biol. Chem. 274 (23): 15978-81. PMID 10347144. doi:10.1074/jbc.274.23.15978. ...
... mitogen-activated protein kinase) cascade that is itself a kinase. RSK2 phosphorylates cellular proteins (including histone H3 ... RSK2 is normally activated by the ERK MAP kinase. Mutated RSK2 may be deficient for activation by ERK, or its kinase activity ... Mutations in the RPS6KA3 gene can result in expression of an RSK2 protein (ribosomal S6 kinase 2) with reduced or absent kinase ... The protein RSK2 which is encoded by the RPS6KA3 gene is a kinase which phosphorylates some substrates like CREB and histone H3 ...
"Human mitogen-activated protein kinase kinase kinase mediates the stress-induced activation of mitogen-activated protein kinase ... Deacon K, Blank JL (1997). "Characterization of the mitogen-activated protein kinase kinase 4 (MKK4)/c-Jun NH2-terminal kinase ... "Mitogen-activated protein kinase kinase 7 is an activator of the c-Jun NH2-terminal kinase". Proc. Natl. Acad. Sci. U.S.A. ... "Entrez Gene: MAP2K4 mitogen-activated protein kinase kinase 4". Marti, A; Luo Z; Cunningham C; Ohta Y; Hartwig J; Stossel T P; ...
Binding proteins: IGFBP (1, 2, 3, 4, 5, 6, 7). *Cleavage products/derivatives with unknown target: Glypromate (GPE, (1-3)IGF-1) ... The ligands interact with the two tyrosine kinase receptor monomers, PDGFRα (PDGFRA) and -Rβ (PDGFRB).[6] The PDGF family also ... PDGF[1][2] is a potent mitogen for cells of mesenchymal origin, including fibroblasts, smooth muscle cells and glial cells. In ... There are five different isoforms of PDGF that activate cellular response through two different receptors. Known ligands ...
Mitogen-activated protein kinase (EC 2.7.11.24). *Extracellular signal-regulated *MAPK1. *MAPK3 ... protein kinase activity. • kinase activity. • protein serine/threonine kinase activity. • cyclin-dependent protein serine/ ... Dephospho-(reductase kinase) kinase (EC 2.7.11.3). *AMP-activated protein kinase α *PRKAA1 ... The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene ...
GHB inhibits mitogen activated protein (MAP) kinase action via the GABAB receptor mechanism. MAP kinase is imperative for ... Ren, X.; Mody, I. (2003). "Gamma-hydroxybutyrate reduces mitogen-activated protein kinase phosphorylation via GABAB receptor ... GABA acts via binding to its receptors which include the ligand gated ion channels, GABAA and GABAC and the G-protein couple ... Taurine is a non-protein sulfur amino acid that is found in high concentrations in human milk. It has been shown to have ...
... mitogen-activated protein kinase) kinase pathway and the phosphorylation of Lck (lymphocyte-activated protein tyrosine kinase) ... mitogen-activated protein kinase) kinase pathway and the phosphorylation of Lck (lymphocyte-activated protein tyrosine kinase) ... The β chain of IL-15R recruits and also activates protein tyrosine kinases of the Src family including Lck, Fyn and Lyn kinase ... Upon binding IL-15β subunit activates Janus kinase 1 (Jak1) and γc subunit Janus kinase 3 (Jak3), which leads to ...
JUN kinase binding. • mitogen-activated protein kinase kinase binding. • mitogen-activated protein kinase kinase kinase binding ... "Entrez Gene: MAPK8IP1 mitogen-activated protein kinase 8 interacting protein 1".. *^ a b c d e f Yasuda, J; Whitmarsh A J; ... MAP-kinase scaffold activity. • protein kinase inhibitor activity. • protein binding. • kinesin binding. • protein kinase ... MAPK8IP1, IB1, JIP-1, JIP1, PRKM8IP, mitogen-activated protein kinase 8 interacting protein 1. ...
kinase binding. • mitogen-activated protein kinase kinase binding. • guanylate kinase activity. • protein binding. • protein ... SAP97 is a mammalian MAGUK-family member protein that is similar to the Drosophila protein Dlg1 (the protein is alternatively ... brain-enriched guanylate kinase-associated protein), a novel neuronal PSD-95/SAP90-binding protein". The Journal of Biological ... protein kinase binding. • L27 domain binding. • ligand-gated ion channel activity. • potassium channel regulator activity. • ...
... factor depends on heparan sulfate proteoglycans and sustained phosphorylation of mitogen-activated protein kinases p42/44". The ... protein heterodimerization activity. • growth factor activity. • serine-type endopeptidase activity. • protein tyrosine kinase ... positive regulation of protein kinase B signaling. • positive regulation of protein phosphorylation. • cytokine-mediated ... regulation of tau-protein kinase activity. • proteolysis. • positive chemotaxis. • MAPK cascade. • peptidyl-tyrosine ...
... and/or 271 by Mitogen-activated protein kinases, S6 kinase, protein kinase A (PKA), protein kinase C, Cdc2, and/or a Ca2+/ ... This chemotactic factor stimulation concurrently causes the activation of mitogen-activated protein kinases (MAPK) which in ... ALOX5 binds with the F actin-binding protein, coactin-like protein. Based on in vitro studies, this protein binding serves to ... "5-lipoxygenase and 5-lipoxygenase-activating protein are localized in the nuclear envelope of activated human leukocytes". J. ...
... cyclin-dependent kinases, and other cell cycle proteins. The phases follow one another in strict order and there are " ... the motor activates, using energy from ATP to "crawl" up the tube toward the originating centrosome. This motor activity, ... Mitogen. *Mitosis Promoting Factor. *Mitotic bookmarking. *Motor protein. References[edit]. *^ "Cell division and growth". ... Generation of pressure is dependent on formin-mediated F-actin nucleation[71] and Rho kinase (ROCK)-mediated myosin II ...
Hardie DG, Hawley SA (December 2001). "AMP-activated protein kinase: the energy charge hypothesis revisited". Bioessays 23 (12 ... Pri vseh adenozinskih receptorjih opazimo aktivacijo najmanj ene poddružine mitogen - aktiviranih proteinskih kinaz. Učinek ... Lin X, Ayrapetov M, Sun G (2005). "Characterization of the interactions between the active site of a protein tyrosine kinase ... Scheeff E, Bourne P (2005). "Structural evolution of the protein kinase-like superfamily". PLoS Comput Biol 1 (5): e49. doi: ...
... and gp130-mediated stimulation of mitogen-activated protein kinase. Evidence for participation of multiple signaling pathways ... Mijelin protein nula • Osteonektin • Protein C • Protein S • Proteoglikan • Serum amiloid P komponenta • Sialoglikoprotein ( ... 2000). „Interleukin-6 activates phosphatidylinositol-3 kinase, which inhibits apoptosis in human prostate cancer cell lines.". ... Glikoprotein 130 (takođe poznat kao gp130, IL6ST, IL6-beta ili CD130) je transmembranski protein. On je osnivački član klase ...
... synaptic NMDA excitation caused a decrease in the intracellular concentration of p38 mitogen-activated protein kinase (p38MAPK ... which contain residues that can be directly modified by a series of protein kinases and protein phosphatases, as well as ... The NMDA receptor is a glutamate and ion channel protein receptor that is activated when glycine and glutamate bind to it.[2] ... Yu XM, Askalan R, Keil GJ, Salter MW (January 1997). "NMDA channel regulation by channel-associated protein tyrosine kinase Src ...
... enterocolitica promotes deactivation of macrophage mitogen-activated protein kinases extracellular signal-regulated kinase-1/2 ... Galyov EE, Håkansson S, Forsberg A, Wolf-Watz H (1993). "A secreted protein kinase of Yersinia pseudotuberculosis is an ... "En Ladant, Daniel; Alouf, Joseph E.; Popoff, Michel R. The Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press ... "Impact of the Yersinia pseudotuberculosis-derived mitogen (YPM) on the murine immune system". Adv. Exp. Med. Biol. 529: 133-5. ...
Mitogen-activated protein kinase kinase 7 is an activator of the c-Jun NH2-terminal kinase, in Proc. Natl. Acad. Sci. U.S.A., ... Iijima S, Teraoka H, Date T, Tsukada K, DNA-activated protein kinase in Raji Burkitt's lymphoma cells. Phosphorylation of c-Myc ... Rob M Ewing, Chu Peter, Elisma Fred, Li Hongyan, Taylor Paul, et al., Large-scale mapping of human protein-protein interactions ... Gazin C, Rigolet M, Briand JP, et al., Immunochemical detection of proteins related to the human c-myc exon 1, in EMBO J., vol ...
... element-binding protein through a phosphatidylinositol 3-kinase-dependent stimulation of the mitogen-activated protein kinase ... and Mitogen-activated protein kinases (MAPK).[28] Messages are translated on the rough endoplasmic reticulum (rough ER) and ... CaMKII activates the Ras proteins, which go on to activate p42/44 MAPK, which drives AMPAR insertion directly into the ... which in turn activates protein phosphatases PP1 and calcineurin. However, AMPAR endocytosis has also been activated by voltage ...
... cell division is necessary for permanent neurotensin cell sensitization and leads to chronic mitogen-activated protein kinase ... Neurotenzinski receptor tip 1 je protein koji je kod ljudi kodiran NTSR1 genom.[1][2] ... 1999). "TRAF family proteins interact with the common neurotrophin receptor and modulate apoptosis induction.". J. Biol. Chem. ... aktivnost neurotenzinskog receptora, G-protein spregnutog. Celularna komponenta. • endoplazmatični retikulum. • Goldži aparat. ...
"Role of p38 mitogen-activated protein kinase and extracellular signal-regulated protein kinase kinase in adenosine A2B receptor ... Adenozinski A2B receptor (ADORA2B) je G-protein spregnuti adenozinski receptor. Ovaj protein je kodiran humanim ADORA2B genom.[ ... signalni put G-protein spregnutog receptora. • aktivnost adenilat ciklaze. • JNK kaskada. • izlučivanje. ... aktivnost A2B adenouinskog receptora, G-protein spregnutog. • receptorska aktivnost. Celularna komponenta. • integralno sa ...
protein tyrosine kinase activity. • phosphatidylinositol-4,5-bisphosphate 3-kinase activity. • Ras guanyl-nucleotide exchange ... positive regulation of epidermal growth factor-activated receptor activity. • تمايز خلوي. • positive regulation of cytokine ... "Epiregulin is a potent vascular smooth muscle cell-derived mitogen induced by angiotensin II, endothelin-1, and thrombin.". ... positive regulation of protein kinase activity. • ERBB2 signaling pathway. • regulation of cell motility. • epidermal growth ...
Buhl AM, Osawa S, Johnson GL (1995). "Mitogen-activated protein kinase activation requires two signal inputs from the human ... phospholipase C-activating G-protein coupled receptor signaling pathway. • retina development in camera-type eye. • Ras protein ... protein complex binding. • signal transducer activity. • protein binding. • GTPase activity. • GTPase binding. • G-protein ... 1omw: Crystal Structure of the complex between G Protein-Coupled Receptor Kinase 2 and Heterotrimeric G Protein beta 1 and ...
... a hyaluronan-binding protein that regulates ras signaling, correlates with overexpression of mitogen-activated protein kinase ... It forms links with several protein kinases associated with cell locomotion, for example, extracellular signal-regulated ... MAP kinase (MAPK), pp60(c-src), and the downstream targets of Rho kinase (ROK).[22] RHAMM can also cooperate with CD44 to ... protein kinase (ERK), p125fak, and pp60c-src.[32][33][34] During fetal development, the migration path through which neural ...
... mitogen-activated-protein kinase-activating protein kinase) has a preference for Ser40, but also phosphorylates Ser19 about ... "Phosphorylation and activation of human tyrosine hydroxylase in vitro by mitogen-activated protein (MAP) kinase and MAP-kinase- ... that are phosphorylated by a variety of protein kinases.[12][25] Ser40 is phosphorylated by the cAMP-dependent protein kinase.[ ... Tyrosine hydroxylase is activated by phosphorylation dependent binding to 14-3-3 proteins.[34] Since the 14-3-3 proteins also ...
"Spred-1 negatively regulates interleukin-3-mediated ERK/mitogen-activated protein (MAP) kinase activation in hematopoietic ... protein binding. • protein kinase binding. Cellular component. • membrane. • plasma membrane. • caveola. • cytosol. • cell ... The encoded protein can act as a homodimer or as a heterodimer with SPRED2 to regulate activation of the MAP kinase cascade.[5] ... negative regulation of protein kinase activity. • negative regulation of angiogenesis. • regulation of MAPK cascade. • negative ...
"Short-chain fatty acids induce acute phosphorylation of the p38 mitogen-activated protein kinase/heat shock protein 27 pathway ... 2003). "The Orphan G protein-coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic ... aktivnost G-protein spregnutog receptora. { • lipidno vezivanje. Celularna komponenta. • ćelijska membrana. • integralno sa ... Receptor slobodnih masnih kiselina 2 (FFA2) je G protein spregnuti receptor kodiran FFAR2 genom.[1] ...
... mitogen-activated protein kinase, MAPK)訊息的梯瀑效應(cascade)的活化、粒線體活性氧(reactive oxygen species, ROS)的產生、C型磷脂酶(phospholipase C, PLC)及 ... Regulation of Na+-K+-ATPase by cAMP-dependent protein kinase anchored on membrane via its anchoring protein Kinji Kurihara, ... 3.6.5.1: 异三聚体G蛋白(英语:
mitogen-activated protein kinase kinase kinase binding. • protein binding. • thioesterase binding. • protein kinase binding. • ... Activated Cdc42 activates by conformational changes[4] p21-activated kinases PAK1 and PAK2, which in turn initiate actin ... "The MAP kinase kinase kinase MLK2 co-localizes with activated JNK along microtubules and associates with kinesin superfamily ... Joberty G, Petersen C, Gao L, Macara IG (August 2000). "The cell-polarity protein Par6 links Par3 and atypical protein kinase C ...
... (also known as MAP2K, MEK, MAPKK) is a kinase enzyme which phosphorylates mitogen- ... Mitogen-Activated+Protein+Kinase+Kinases at the US National Library of Medicine Medical Subject Headings (MeSH) ... Retrieved from "https://en.wikipedia.org/w/index.php?title=Mitogen-activated_protein_kinase_kinase&oldid=921615706" ... The activators of p38 (MKK3 and MKK6), JNK (MKK4 and MKK7), and ERK (MEK1 and MEK2) define independent MAP kinase signal ...
A mitogen-activated protein kinase (MAPK or MAP kinase) is a type of protein kinase that is specific to the amino acids serine ... MAP kinase kinase kinase (MAP3K or MKKK). *MAP kinase kinase kinases *MAP3K1 ... Dephospho-(reductase kinase) kinase (EC 2.7.11.3). *AMP-activated protein kinase α *PRKAA1 ... is performed by members of the Ste7 protein kinase family, also known as MAP2 kinases. MAP2 kinases in turn, are also activated ...
Norway rat protein-coding gene Mapk1. Represented by 134 ESTs from 65 cDNA libraries. Corresponds to reference sequence NM_ ... Protein sequence * * Protein/EST matches (ProtEST) * * Protein/protein matches (BLink) * mitogen-activated protein kinase 1. C ... Protein sequence * * Protein/EST matches (ProtEST) * * Protein/protein matches (BLink) * mitogen-activated protein kinase 1. X ... Protein sequence * * Protein/EST matches (ProtEST) * * Protein/protein matches (BLink) * mitogen-activated protein kinase 8. C ...
Mitogen-activated protein kinase pathways.. Robinson MJ1, Cobb MH.. Author information. 1. University of Texas Southwestern ... Nearly all cell surface receptors utilize one or more of the mitogen-activated protein kinase cascades in their repertoire of ... MAP Kinase Kinase Kinase 1*. *Mammals. *Mitogen-Activated Protein Kinase Kinases*. *Protein-Serine-Threonine Kinases/metabolism ... MAP Kinase Kinase 1. *MAP2K1 protein, human. *Mitogen-Activated Protein Kinase Kinases ...
p38 mitogen-activated protein kinases are a class of mitogen-activated protein kinases (MAPKs) that are responsive to stress ... p38+Mitogen-Activated+Protein+Kinases at the US National Library of Medicine Medical Subject Headings (MeSH) P38mapkPathway p38 ... MKK3 and SEK activate p38 MAP kinase by phosphorylation at Thr-180 and Tyr-182. Activated p38 MAP kinase has been shown to ... a novel p38 mitogen-activated protein kinase inhibitor: preclinical analysis of efficacy and selectivity". The Journal of ...
Mitogen-activated protein kinase kinase kinase 6 is a protein that in humans is encoded by the MAP3K6 gene. This gene encodes a ... "Apoptosis signal-regulating kinase (ASK) 2 functions as a mitogen-activated protein kinase kinase kinase in a heteromeric ... "Entrez Gene: Mitogen-activated protein kinase kinase kinase 6". Retrieved 2018-07-10. Takeda K, Shimozono R, Noguchi T, Umeda T ... Eto N, Miyagishi M, Inagi R, Fujita T, Nangaku M (April 2009). "Mitogen-activated protein 3 kinase 6 mediates angiogenic and ...
Mitogen-activated protein kinaseSAAS annotation. Automatic assertion according to rulesi ... tr,Q6GWG4,Q6GWG4_9CHLO Mitogen-activated protein kinase (Fragment) OS=Dunaliella viridis OX=140095 PE=2 SV=1 ... View protein in InterPro. IPR011009 Kinase-like_dom_sf. IPR003527 MAP_kinase_CS. IPR000719 Prot_kinase_dom. ... View protein in InterPro. IPR011009 Kinase-like_dom_sf. IPR003527 MAP_kinase_CS. IPR000719 Prot_kinase_dom. ...
The mitogen-activated protein kinases (MAP kinases) p42mapk and p44mapk are serine/threonine kinases rapidly activated in cells ... Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation. G Pagès, P Lenormand, G ... Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation ... Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation ...
Mitogen-activated protein kinase kinase (also known as MAP2K, MEK, MAPKK) is a kinase enzyme which phosphorylates mitogen- ... Mitogen-Activated+Protein+Kinase+Kinases at the US National Library of Medicine Medical Subject Headings (MeSH) ... Retrieved from "https://en.wikipedia.org/w/index.php?title=Mitogen-activated_protein_kinase_kinase&oldid=921615706" ... The activators of p38 (MKK3 and MKK6), JNK (MKK4 and MKK7), and ERK (MEK1 and MEK2) define independent MAP kinase signal ...
Mutated mitogen-activated protein kinase: A tumor rejection antigen of mouse sarcoma. Hiroaki Ikeda, Nobuyoshi Ohta, Keiko ... The sequence of this clone was identical to ERK2 (31), a mouse mitogen-activated protein kinase, except for a single base pair ... Using a CMS5-specific CTL clone to screen a cDNA library, we identified a mutated form of mitogen-activated protein kinase as ... The gene encoding the C18-defined antigen was identified as a mutated form of a mouse mitogen-activated protein kinase, ERK2, ...
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex ... White boxes represent UTRs (untranslated regions). Orange: protein coding regions. The black lines connecting boxes represent ...
MAP kinase 15. Gene Name. MAPK15. Organism. Humans. Amino acid sequence. ,lcl,BSEQ0051828,Mitogen-activated protein kinase 15 ... lcl,BSEQ0051829,Mitogen-activated protein kinase 15 (MAPK15) ATGTGCACCGTAGTGGACCCTCGCATTGTCCGGAGATACCTACTCAGGCGGCAGCTCGGG ... a new member of the mitogen-activated protein kinase family. J Biol Chem. 2002 May 10;277(19):16733-43. Epub 2002 Mar 1. [ ... Activation of the Erk8 mitogen-activated protein (MAP) kinase by RET/PTC3, a constitutively active form of the RET proto- ...
MAP kinase activity, intracellular signal transduction, JNK cascade, regulation of gene expression ... View protein in PROSITE. PS01351, MAPK, 1 hit. PS50011, PROTEIN_KINASE_DOM, 1 hit. PS00108, PROTEIN_KINASE_ST, 1 hit. ... View protein in PROSITE. PS01351, MAPK, 1 hit. PS50011, PROTEIN_KINASE_DOM, 1 hit. PS00108, PROTEIN_KINASE_ST, 1 hit. ... Belongs to the protein kinase superfamily. CMGC Ser/Thr protein kinase family. MAP kinase subfamily.ARBA annotation. Automatic ...
Activation of the Estrogen Receptor Through Phosphorylation by Mitogen-Activated Protein Kinase ... Activation of the Estrogen Receptor Through Phosphorylation by Mitogen-Activated Protein Kinase ... Activation of the Estrogen Receptor Through Phosphorylation by Mitogen-Activated Protein Kinase ... Activation of the Estrogen Receptor Through Phosphorylation by Mitogen-Activated Protein Kinase ...
Widmann C, Gibson S, Jarpe MB, Johnson GL: Mitogen-activated protein kinase: conservation of a three-kinase module from yeast ... Specifically, members of the mitogen-activated protein (MAP) kinase family of serine-threonine kinases may contribute to the ... To test the potential for members of the mitogen-activated protein (MAP) kinase family to contribute to type 2 diabetes, we ... Enhanced Basal Activation of Mitogen-Activated Protein Kinases in Adipocytes From Type 2 Diabetes. Potential Role of p38 in the ...
... mitogen-activated protein kinase 12), Authors: Maria Isabel Cerezo-Guisado, Ana Cuenda. Published in: Atlas Genet Cytogenet ... Kinase-like_dom_sf MAP_kinase_CS MAPK_p38 Prot_kinase_dom Protein_kinase_ATP_BS ... MAPK cascade magnesium ion binding protein serine/threonine kinase activity protein serine/threonine kinase activity MAP kinase ... MAPK cascade magnesium ion binding protein serine/threonine kinase activity protein serine/threonine kinase activity MAP kinase ...
... a new MAP kinase-activated protein kinase, isolated by a novel expression screening method for identifying protein kinase ... Dephospho-(reductase kinase) kinase (EC 2.7.11.3). *AMP-activated protein kinase α *PRKAA1 ... virus type 1 and its coat protein gp120 induce apoptosis and activate JNK and ERK mitogen-activated protein kinases in human ... "The JIP group of mitogen-activated protein kinase scaffold proteins". Molecular and Cellular Biology. 19 (10): 7245-54. doi: ...
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex ... ATP + L-threonyl-[protein] = ADP + H+ + O-phospho-L-threonyl-[protein] UniProt ... This protein in other organisms (by gene name): O95819 - Homo sapiens 17 * Q9NST7 - Homo sapiens no matching PDB entries ... Protein disorder predictions are based on JRONN (Troshin, P. and Barton, G. J. unpublished), a Java implementation of RONN * ...
Previous reports demonstrated that SB203580 does not inhibit protein kinase A, protein kinase C, or other mitogen-activated ... Human serotonin transporter variants display altered sensitivity to protein kinase G and p38-mitogen-activated protein kinase. ... 1998) Extracellular signal-regulated kinase and p38 subgroups of mitogen-activated protein kinases regulate inducible nitric ... 1997) Pyridinyl imidazole inhibitors of p38 mitogen-activated protein kinase bind in the ATP site. J Biol Chem 272:12116-12121. ...
Protein kinase modulation of dendritic K+ channels in hippocampus involves a mitogen-activated protein kinase pathway. J ... Mitogen-activated protein kinases (MAPKs) are expressed in neurons and are activated after injury, for example, after sciatic ... Jin SX, Zhuang ZY, Woolf CJ, Ji RR (2003) p38 mitogen-activated protein kinase is activated after a spinal nerve ligation in ... c-Jun N-terminal kinase, p38, and ERK5/big mitogen-activated protein kinase 1] are abundant in signal transduction pathways and ...
Staurosporine Induces Platelet Apoptosis Through p38 Mitogen-Activated Protein Kinase Signaling Pathway.. [Lili Zhao, Guoyuan ... Furthermore, STS stimulation induced phosphorylation of p38 mitogen-activated protein kinase (MAPK). Inhibition of p38 MAPK ...
IPR017419 Mitogen-activated protein kinase kinase kinase 12/13. IPR027258 Mitogen-activated protein kinase kinase kinase 13 ... MAP3K13, mitogen-activated protein kinase kinase kinase 13. Orthology source: HomoloGene, HGNC ... protein coding gene. Chr16:21794346-21933439 (+). 129S1/SvImJ MGP_129S1SvImJ_G0022662. protein coding gene. Chr16:19346620- ... protein coding gene. Chr16:19188050-19228062 (+). BALB/cJ MGP_BALBcJ_G0022628. protein coding gene. Chr16:18613960-18654224 (+) ...
IPR027257 Mitogen-activated protein kinase kinase kinase 12. IPR017419 Mitogen-activated protein kinase kinase kinase 12/13 ... MAP3K12, mitogen-activated protein kinase kinase kinase 12. Orthology source: HomoloGene, HGNC ... protein coding gene. Chr15:102497646-102517064 (-). 129S1/SvImJ MGP_129S1SvImJ_G0022416. protein coding gene. Chr15:104687379- ... protein coding gene. Chr15:100562177-100581596 (-). AKR/J MGP_AKRJ_G0022353. protein coding gene. Chr15:103607328-103626744 (-) ...
Induction of mitogen-activated protein kinase phosphatase 1 by the stress-activated protein kinase signaling pathway but not by ... Mitogen-activated protein (MAP) kinase is regulated by the MAP kinase phosphatase (MKP-1) in vascular smooth muscle cells. J ... Identification of the regulatory phosphorylation sites in pp42/mitogen-activated protein kinase (MAP kinase). EMBO J. 1991;10: ... PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J Biol ...
We characterize the role of p38 mitogen-activated protein kinase/mitogen activated protein kinase kinase-3 and c-Jun-NH2- ... C57/BL6 wild-type mice and mice genetically deleted for mitogen-activated protein kinase kinase-3 (mkk-3−/−) or c-Jun-NH2- ... Mitogen-Activated Protein Kinases Regulate Susceptibility to Ventilator-Induced Lung Injury. Author: Dolinay, Tamás; Kaminski, ... Mitogen-Activated Protein Kinases Regulate Susceptibility to Ventilator-Induced Lung Injury. DSpace/Manakin Repository. * DASH ...
Antibodies for proteins involved in mitogen-activated protein kinase binding pathways, according to their Panther/Gene Ontology ... Antibodies for proteins involved in mitogen-activated protein kinase binding pathways; according to their Panther/Gene Ontology ...
However, intramolecular interactions consistent with an inactive protein kinase fold were not formed. MD with p38α showed that ... The mitogen-activated protein kinase-activated protein kinase MK5 is a substrate of the mitogen-activated protein kinases p38, ... The mitogen-activated protein kinase-activated protein kinase MK5 is a substrate of the mitogen-activated protein kinases p38, ... Comparative Molecular Dynamics Simulations of Mitogen-Activated Protein Kinase-Activated Protein Kinase 5 Inger Lindin 1, ...
Selective activation and functional significance of p38α mitogen-activated protein kinase in lipopolysaccharide-stimulated ... Selective activation and functional significance of p38α mitogen-activated protein kinase in lipopolysaccharide-stimulated ... stimulation of human neutrophils is known to result in activation of p38 mitogen-activated protein kinase (MAPk); however, the ... We investigated the MAPk kinase (MKK) that activates p38 MAPk in response to LPS, the p38 MAPk isoforms that are activated as ...
"Mitogen-Activated Protein Kinase 3" by people in Harvard Catalyst Profiles by year, and whether "Mitogen-Activated Protein ... Mitogen-Activated Protein Kinase 3 [D08.811.913.696.620.682.700.567.342.750]. *Proline-Directed Protein Kinases [D08.811. ... Protein-Serine-Threonine Kinases [D08.811.913.696.620.682.700]. *Mitogen-Activated Protein Kinases [D08.811.913.696.620.682. ... Mitogen-Activated Protein Kinase 3*Mitogen-Activated Protein Kinase 3. *Mitogen Activated Protein Kinase 3 ...
Protein-peptide complex crystallization: a case study on the ERK2 mitogen-activated protein kinase. ... Mitogen-activated protein kinase (MAPK)-binding linear motifs bind to the MAPK docking groove and represent a functionally well ... motif from a downstream MAP kinase-activated protein kinase (MAPKAP) that is a known ERK2 substrate (RSK1; Garai et al., 2012. ... Furthermore, for extracellular signal-regulated kinase 2 (ERK2) the protein-peptide docking surface is comprised of a small ...
... target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of ... Mitogen-activated protein kinases (MAPKs) target a variety of protein substrates to regulate cellular signaling processes in ... Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis ... WRKY transcription factors and proteins encoded by the genes from the "PEN" pathway required for penetration resistance to ...
  • A mitogen-activated protein kinase ( MAPK or MAP kinase ) is a type of protein kinase that is specific to the amino acids serine and threonine (i.e., a serine/threonine-specific protein kinase ). (wikipedia.org)
  • MAPKs belong to the CMGC (CDK/MAPK/GSK3/CLK) kinase group. (wikipedia.org)
  • Because MAP2 kinases display very little activity on substrates other than their cognate MAPK, classical MAPK pathways form multi-tiered, but relatively linear pathways. (wikipedia.org)
  • In comparison to the three-tiered classical MAPK pathways, some atypical MAP kinases appear to have a more ancient, two-tiered system. (wikipedia.org)
  • p38 MAP Kinase (MAPK), also called RK or CSBP (Cytokinin Specific Binding Protein), is the mammalian orthologue of the yeast Hog1p MAP kinase, which participates in a signaling cascade controlling cellular responses to cytokines and stress. (wikipedia.org)
  • Oxidative stress is the most powerfully specific stress activating p38 MAPK. (wikipedia.org)
  • We have investigated the activity and function of mitogen-activated protein kinase (MAPK) during neural specification in Xenopus . (pnas.org)
  • Because MAPK has been shown to down-regulate Smad1, MAPK may disrupt bone morphogenetic protein 4 (BMP-4) signaling during neural specification. (pnas.org)
  • Because FGF signaling is mediated largely by the mitogen-activated protein kinase (MAPK) pathway ( 26 , 27 ), these studies suggest that MAPK may play a critical role in the specification of neural fate and anteroposterior pattern. (pnas.org)
  • PD 098059 [2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one] selectively inhibited the MAPK-activating enzyme, MAPK/ERK kinase (MEK), without significant inhibitory activity of MAPK itself. (pnas.org)
  • Mitogen-activated protein kinase kinase (also known as MAP2K , MEK , MAPKK ) is a kinase enzyme which phosphorylates mitogen-activated protein kinase (MAPK). (wikipedia.org)
  • MEK is a member of the MAPK signaling cascade that is activated in melanoma. (wikipedia.org)
  • Recent research has focused on intracellular signaling pathways involved in the development of VILI, among which include the mitogen-activated protein kinase (MAPK) pathways, key regulators of inflammation [7] - [9] . (plos.org)
  • The MAPK superfamily includes three primary signaling cascades: the extracellular signal regulated kinases (ERK1/2), the c-Jun NH 2 -terminal kinases (JNK) and the p38 MAPKs. (plos.org)
  • The mitogen-activated protein kinase (MAPK) pathway is the canonical signaling pathway for many receptor tyrosine kinases, such as the Epidermal Growth Factor Receptor. (mdpi.com)
  • In recent years, it has become evident that MAPK signaling is regulated and fine-tuned by proteins that can bind to several MAPK signaling proteins simultaneously and, thereby, affect their function. (mdpi.com)
  • These so-called MAPK scaffolding proteins are, thus, important coordinators of the signaling response in cells. (mdpi.com)
  • In this review, we summarize the recent advances in the research on MAPK/extracellular signal-regulated kinase (ERK) pathway scaffolders. (mdpi.com)
  • This chamber-specific growth pattern was associated with a selective activation of p38 mitogen-activated protein kinase (MAPK) activity in the RV and simultaneous inactivation in the LV. (jci.org)
  • Mitogen-activated protein kinases (MAPK) are a family of evolutionarily conserved molecules that transduce extracellular stimuli into intracellular responses, by changing transcription as well as inducing posttranslational modifications of target proteins. (frontiersin.org)
  • To determine if differences in MAPK activation may explain the difference in response to lung surfactant between primary macrophages and the cell lines, we compared the activation of MAPKs, p38, extracelluar-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK/SAPK), in rat alveolar macrophages and three macrophage cell lines, RAW 264.7, J-774, and NR8383. (cdc.gov)
  • This Ser 118 is phosphorylated by mitogen-activated protein kinase (MAPK) in vitro and in cells treated with epidermal growth factor (EGF) and insulin-like growth factor (IGF) in vivo. (sciencemag.org)
  • Overexpression of MAPK kinase (MAPKK) or of the guanine nucleotide binding protein Ras, both of which activate MAPK, enhanced estrogen-induced and antiestrogen (tamoxifen)-induced transcriptional activity of wild-type ER, but not that of a mutant ER with an alanine in place of Ser 118 . (sciencemag.org)
  • ERK5, also known as MAPK7 or "Big MAP-Kinase 1" (BMK1) belongs to the Mitogen Activated Protein Kinase (MAPK) family, and therefore to the CGMC kinases in the human kinome (Manning et al. (atlasgeneticsoncology.org)
  • Here, we show that repeated swim stress caused activation of both κ-opioid receptor (KOR) and p38 mitogen-activated protein kinase (MAPK) coexpressed in GABAergic neurons in the nucleus accumbens, cortex, and hippocampus. (jneurosci.org)
  • Sites of activation were visualized using phosphoselective antibodies against activated κ receptors (KOR-P) and against phospho-p38 MAPK. (jneurosci.org)
  • Although the role of MAPK in signal transduction and in injury-induced regulation of gene expression is well established, the ability of these kinases to phosphorylate and modulate voltage-gated sodium channels has not been reported. (jneurosci.org)
  • It will look,in particular, at a protein enzyme called p38 mitogen−activated protein kinase (p38 MAPK for short)which controls the activation of several important pathways in the cell. (clinicaltrials.gov)
  • Furthermore, STS stimulation induced phosphorylation of p38 mitogen-activated protein kinase (MAPK). (sigmaaldrich.com)
  • Since the identification of the p38 mitogen-activated protein kinase (MAPK) as a key signal-transducing molecule in the expression of the proinflammatory cytokine tumor necrosis factor (TNF) more than 10 years ago, huge efforts have been made to develop inhibitors of p38 MAPK with the intent to modulate unwanted TNF activity in diseases such as autoimmune diseases or sepsis. (nih.gov)
  • We investigated the MAPk kinase (MKK) that activates p38 MAPk in response to LPS, the p38 MAPk isoforms that are activated as part of this pathway, and the functional responses affected by p38 MAPk activation. (jci.org)
  • Although MKK3, MKK4, and MKK6 all activated p38 MAPk in experimental models, only MKK3 was found to activate recombinant p38 MAPk in LPS-treated neutrophils. (jci.org)
  • These findings support a pathway by which LPS stimulation of neutrophils results in activation of MKK3, which in turn activates p38α MAPk, ultimately regulating adhesion, NF-κB activation, enhanced gene expression of TNF-α, and regulation of TNF-α synthesis. (jci.org)
  • Mitochondrial contents, expression, and activation status of p38 mitogen-activated protein kinase (MAPK) and PPARγ coactivator 1α (PGC-1α) were compared between skeletal muscle samples from adiponectin gene knockout, adiponectin-reconstituted, and control mice. (diabetesjournals.org)
  • p38 is a member of the mitogen-activated protein kinase (MAPK) family and has been identified as a downstream molecule in the adiponectin-signaling pathway ( 15 , 18 , 19 ). (diabetesjournals.org)
  • Many major human oncogenes contribute to cancer in large part by activating the mitogenactivated protein kinases (MAPK) ERK1 and ERK2 (ERK). (mit.edu)
  • In the search for mechanisms operating in regulating MC granule homeostasis, we here investigated the role of mitogen-activated protein kinase (MAPK) signaling. (frontiersin.org)
  • We show that inhibition of MEK1/2 (a MAPK kinase) leads to increased metachromatic staining of MC granules, indicative of increased proteoglycan content. (frontiersin.org)
  • Prior UO results in reduced postischemic phosphorylation of c-Jun N-terminal stress-activated protein kinase 1/2 (JNK1/2), p38, mitogen-activated protein kinase (MAPK) kinase 4 (MKK4), and MKK3/6. (curehunter.com)
  • Mitogen-activated protein kinases (MAPKs) play a pivotal role in the mitogenic signal transduction pathway and are essential components of the MAPK cascade, which includes MEK (also known as MAP kinase kinase), Raf-1, and Ras. (aacrjournals.org)
  • The mitogen-activated protein kinase (MAPK) cascade plays a pivotal role in diverse signaling pathways related to plant development and stress responses. (springer.com)
  • Cargnello M, Roux P (2011) Activation and function of the MAPKs and their substrates, the MAPK activated protein kinases. (springer.com)
  • Using virus-induced gene silencing, one or more mitogen-activated protein kinase (MAPK) cascades required for Mi-1- mediated aphid resistance were identified. (apsnet.org)
  • Silencing plants for MAPK kinase ( LeMKK2) and MAPKs ( LeMPK2 and LeMPK1 , or LeMPK3) resulted in attenuation of Mi-1 -mediated aphid resistance. (apsnet.org)
  • The increased p38 MAPK activity was completely abolished when the infarct-sparing effect of CCPA was abrogated by either the protein kinase C (PKC) inhibitor chelerythrine or the tyrosine kinase inhibitor lavendustin A. This is a very provocative study, and it is also the first to demonstrate activation of the p38 MAPK 24 hours after preconditioning. (ahajournals.org)
  • 5 6 Furthermore, ischemic preconditioning activates MAPKAPK2, the downstream signaling substrate of p38 MAPK, 5 6 demonstrating that activation of the p38 MAPK signaling cascade, not just one element of the MAPK module, is part of the signaling events involved in preconditioning. (ahajournals.org)
  • MAPK forms the backbone of four primary signal transduction cascades leading to the phosphorylation and activation of extracellular signal-regulated kinases 1 and 2 (ERK1--2), JNK, p38 and ERK5. (reportbuyer.com)
  • MAPK kinases 1 and 2, commonly known at MEK1--2, are referred to as MEK. (reportbuyer.com)
  • Several inhibitors of MEK1--2 (MAPK kinases 1 and 2) are nearing, or are currently in, clinical trials for oncology. (reportbuyer.com)
  • 8 Ras has emerged as a convergent molecular switch that integrates and propagates extracellular signals to downstream cascades, the best characterized of which are the phosphatidylinositol-3-kinase (PI3K) and the mitogen-activated protein kinase (MAPK) pathways. (ahajournals.org)
  • Accordingly, we next examined downstream IL-6 signaling via the STAT3, STAT1, and Ras-dependent mitogen-activated protein kinase (MAPK) cascades. (jimmunol.org)
  • A new independent 41 page research with title 'Mitogen Activated Protein Kinase Kinase Kinase 5 {Apoptosis Signal Regulating Kinase 1 or MAPK/ERK Kinase Kinase 5 or MAP3K5 or EC 2.7.11.25} - Pipeline Review, H2 2017' guarantees you will remain better informed than your competition. (medgadget.com)
  • Mitogen Activated Protein Kinase Kinase Kinase 5 (Apoptosis Signal Regulating Kinase 1 or MAPK/ERK Kinase Kinase 5 or MAP3K5 or EC 2.7.11.25) pipeline Target constitutes close to 11 molecules. (medgadget.com)
  • The latest report Mitogen Activated Protein Kinase Kinase Kinase 5 - Pipeline Review, H2 2017, outlays comprehensive information on the Mitogen Activated Protein Kinase Kinase Kinase 5 (Apoptosis Signal Regulating Kinase 1 or MAPK/ERK Kinase Kinase 5 or MAP3K5 or EC 2.7.11.25) targeted therapeutics, complete with analysis by indications, stage of development, mechanism of action (MoA), route of administration (RoA) and molecule type. (medgadget.com)
  • Mitogen Activated Protein Kinase Kinase Kinase 5 (Apoptosis Signal Regulating Kinase 1 or MAPK/ERK Kinase Kinase 5 or MAP3K5 or EC 2.7.11.25) - Mitogen-activated protein kinase kinase kinase 5 (MAP3K5) is a member of MAP kinase kinase kinase family encoded by MAP3K5 gene. (medgadget.com)
  • Furthermore, this report also reviews key players involved in Mitogen Activated Protein Kinase Kinase Kinase 5 (Apoptosis Signal Regulating Kinase 1 or MAPK/ERK Kinase Kinase 5 or MAP3K5 or EC 2.7.11.25) targeted therapeutics development with respective active and dormant or discontinued projects. (medgadget.com)
  • A p38 mitogen-activated protein kinase (MAPK) kinase and a c-Jun N-terminal-like MAPK are both transcriptionally up-regulated by Cry5B. (epfl.ch)
  • Mitogen-activated protein kinases (MAPK) mediate cellular signal transduction during stress responses, as well as diverse growth and developmental processes in eukaryotes. (apsnet.org)
  • Pathogen infection or treatments with conserved pathogen-associated molecular patterns (PAMPs) such as the bacterial flagellin-derived flg22 peptide are known to activate three Arabidopsis thaliana MAPK: MPK3, MPK4, and MPK6. (apsnet.org)
  • Taken together, future investigations of MAPK roles in stress signaling should include MPK11 as a fourth PAMP-activated MAPK. (apsnet.org)
  • The expression of MAPK target proteins was assessed by Western blotting. (karger.com)
  • Additionally, proinflammatory cytokines can activate several inflammatory transduction pathways, including mitogen activated protein kinase (MAPK). (karger.com)
  • The MAPK family includes p38MAPK, extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), which have been reported to be activated in the synovium of RA patients [ 8 , 9 ]. (karger.com)
  • The MAPK family includes the subfamilies ERK, p38 MAPK and c-Jun N-terminal kinase (JNK). (biologists.org)
  • JNK ( Barr and Bogoyevitch, 2001 ) and p38 MAPK ( New and Han, 1998 ) are mainly activated by cellular stress. (biologists.org)
  • MAPK pathways are generally thought of as three-kinase modules, consisting of a MAP kinase kinase kinase (MAP3K) upstream of a MAPK kinase kinase (MAP2K), which in turn activates the MAP kinase ( Kyriakis and Avruch, 2001 ). (biologists.org)
  • Upstream of the mammalian MAPKs, ERK1 and ERK2, is Raf (MAP3K) and MAPK/ERK kinase (MEK)1/2 (MAP2K). (biologists.org)
  • Activation of the mitogen-activated protein kinase (MAPK) pathway results in the transcriptional induction of cyclin D1 with activation of CDK4, phosphorylation of pRb, and continued cell cycle progression from G 1 to S ( 5 , 6 ). (aacrjournals.org)
  • Extracellular Signal-Regulated Kinases (ERK) also known as the Mitogen-activated Protein Kinase (MAPK), MAPK/ERK proteins are a family of protein-serine/threonine kinases that are activated via the phosphorylation of tyrosine . (novusbio.com)
  • MAPK/ERK are activated by diverse mechanisms. (novusbio.com)
  • In the classical setting, MAPK/ERK is activated by many upstream growth factors/cytokine receptors in response to radiation, hypoxia, physical forces, TNF , RANKL , and toll-like receptors (1). (novusbio.com)
  • Here, using gene knockout and knockdown techniques along with gene profiling, we show that extracellular signal-regulated kinase 3 (ERK3), a poorly characterized atypical mitogen-activated protein kinase (MAPK), regulates the epithelial architecture in vertebrates. (xenbase.org)
  • Growing evidence suggests that the Ras/mitogen-activated protein kinase (MAPK) signaling cascade represents a pivotal molecular circuitry participating directly or indirectly in prostate cancer evolution. (aacrjournals.org)
  • The Ras/mitogen-activated protein kinase (MAPK) signaling pathway has long been identified as a convergence point for numerous (normal and pathologic) signaling inputs, rendering it an appealing target for therapeutic intervention ( 4 ). (aacrjournals.org)
  • The present study was designed to examine the effect of ATP on activation of the mitogen-activated protein kinase (MAPK) signaling pathway and its physiological role in human granulosa-luteal cells. (eurekamag.com)
  • Western blot analysis, using a monoclonal antibody that detected the phosphorylated forms of extracellular signal-regulated kinase-1 and -2 (p42(mapk) and p44 (mapk), respectively), demonstrated that ATP activated MAPK in a dose- and time-dependent manner. (eurekamag.com)
  • Treatment of the cells with suramin (a P2 purinoceptor antagonist), neomycin (a phospholipase C inhibitor), staurosporin (a PKC inhibitor), or PD98059 (an MAPK/ERK kinase inhibitor) significantly attenuated the ATP-induced activation of MAPK. (eurekamag.com)
  • We show here that TPO-induced differentiation in UT7 cells is tightly dependent on a strong, long-lasting activation of the mitogen-activated protein kinase (MAPK) pathway. (asm.org)
  • Activation of substrates of p38 MAPK and cell cycle regulatory proteins were evaluated by western blotting. (arvojournals.org)
  • In Colo205 cells exposed to PEP005, a variety of signaling pathways were activated as shown by increased phosphorylation of PKCδ, Raf1, extracellular signal-regulated kinase 1/2 mitogen-activated protein kinase (MAPK), c-Jun NH 2 -terminal kinase, p38 MAPK, and PTEN. (aacrjournals.org)
  • Interestingly, PEP005 treatment also resulted in reduced expression of PKCα and reduced levels of phosphorylated active form of AKT/protein kinase B. These data suggest that PEP005-induced activation of PKCδ and reduced expression of PKCα resulted in apoptosis by mechanisms mediated by activation of Ras/Raf/MAPK and inhibition of the phosphatidylinositol 3-kinase/AKT signaling pathways. (aacrjournals.org)
  • We have investigated whether mitogen-activated protein kinases (MAPK) are involved in transmembrane signaling via the three Fc gamma R present on monocytic, polymorphonuclear, and natural killer (NK) cells. (rupress.org)
  • Our results indicate that occupancy of Fc gamma RI and Fc gamma RII on the monocytic cell line THP-I and on polymorphonuclear leukocytes (PMN) induces, transiently and with fast kinetics, MAPK phosphorylation, as indicated by decreased electrophoretic mobility in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and increased amounts of the proteins in antiphosphotyrosine antibody immunoprecipitates. (rupress.org)
  • Using the specific MAP kinase kinase inhibitor-PD 098059, we show that activation of MAPK is necessary for the Fc gamma R-dependent induction of c-fos and tumor necrosis factor alpha mRNA expression in monocytes and NK cells. (rupress.org)
  • This tandem activation loop phosphorylation (that was proposed to be either distributive or processive, dependent on cellular environment) is performed by members of the Ste7 protein kinase family, also known as MAP2 kinases . (wikipedia.org)
  • MAP2 kinases in turn, are also activated by phosphorylation, by a number of different upstream serine-threonine kinases ( MAP3 kinases ). (wikipedia.org)
  • A mitogen-activated protein kinase 14 phosphorylated form that has been activated by Thr and Tyr phosphorylation within the TxY motif. (ebi.ac.uk)
  • MKK3 and SEK activate p38 MAP kinase by phosphorylation at Thr-180 and Tyr-182. (wikipedia.org)
  • Treatment of cells with a variety of growth factors triggers a phosphorylation cascade that leads to activation of mitogen-activated protein kinases (MAPKs, also called extracellular signal-regulated kinases, or ERKs). (pnas.org)
  • p38s are commonly activated by phosphorylation, catalyzed by MAP kinase kinases (MKKs). (rcsb.org)
  • This study reports the cloning and characterization of LmxPK4, a MAP kinase kinase homologue of L. mexicana displaying putative plant-like regulatory phosphorylation sites . (ingentaconnect.com)
  • To test the potential for members of the mitogen-activated protein (MAP) kinase family to contribute to type 2 diabetes, we examined basal and insulin-stimulated Erk 1/2, JNK, and p38 phosphorylation in adipocytes isolated from healthy and type 2 diabetic individuals. (diabetesjournals.org)
  • In type 2 diabetic adipocytes, the basal phosphorylation status of these MAP kinases was significantly elevated and was associated with decreased IRS-1 and GLUT4 in these fat cells. (diabetesjournals.org)
  • Phosphorylation provides a fast posttranslational modification of proteins that has been shown to regulate the acute response of cells to a variety of stimuli. (jneurosci.org)
  • Although phosphorylation of sodium channels has been shown to produce rapid modulation of sodium currents, these studies have been primarily focused on investigating the role of cAMP-dependent protein kinase (PKA) and protein kinase C (PKC) (for review, see Cantrell and Catterall, 2001 ). (jneurosci.org)
  • However, despite the coexpression of mitogen-activated protein kinases (MAPKs) and voltage-gated sodium channels in neurons, phosphorylation and modulation of these channels by MAP kinases have not been investigated. (jneurosci.org)
  • In general, MAP kinases are activated by phosphorylation on tyrosine and threonine residues and inactivated by dephosphorylation. (ahajournals.org)
  • A common feature for activation of all MAP kinase isoforms is the requirement for phosphorylation of both a threonine and a neighboring tyrosine regulatory site by a specific upstream protein kinase for activation. (ahajournals.org)
  • 1 2 Binding of extracellular stimuli to their cell membrane receptors induces a sequence of protein kinase reaction, leading to phosphorylation and activation of MEK (MAP kinase/ERK kinase). (ahajournals.org)
  • Thus, highly specific protein kinase cascades lead to dual phosphorylation of tyrosine and threonine residues on these MAP kinases, inducing their full activation. (ahajournals.org)
  • In general, the extent of protein phosphorylation is balanced by an antagonism of kinases and phosphatases. (ahajournals.org)
  • With regard to its effect on upper-stream signal transduction, we found that fisetin reduced the expression of ultraviolet (UV)-induced ERK, JNK, and p38 phosphorylation in the mitogen-activated protein kinase (MAP kinase) pathway. (wellnessresources.com)
  • It also suppressed NF-κB translocated to the nucleus and inhibited cAMP response element-binding protein (CREB) Ser-133 phosphorylation level in the phosphoinositide 3-kinase/protein kinase B/CREB (PI3K/AKT/CREB) pathway. (wellnessresources.com)
  • Activation of leukocytes by proinflammatory stimuli selectively initiates intracellular signal transduction via sequential phosphorylation of kinases. (jci.org)
  • Evidence is provided that MAP kinase (ERK1 and ERK2) influences the cells' motility machinery by phosphorylating and, thereby, enhancing myosin light chain kinase (MLCK) activity leading to phosphorylation of myosin light chains (MLC). (rupress.org)
  • Inhibition of MAP kinase activity causes decreased MLCK function, MLC phosphorylation, and cell migration on extracellular matrix proteins. (rupress.org)
  • In contrast, expression of mutationally active MAP kinase kinase causes activation of MAP kinase leading to phosphorylation of MLCK and MLC and enhanced cell migration. (rupress.org)
  • We show here that MAP kinase activation is required for haptotaxis cell migration on a collagen substrate based on its ability to directly phosphorylate MLCK leading to the phosphorylation of MLC. (rupress.org)
  • We are using high-throughput sequencing and biochemical experiments to determine whether these phosphorylation sites control the function of MLL proteins. (mit.edu)
  • The conventional MAPKs constitute three consecutive phosphorylation events mediated by three Ser/Thr protein kinases. (mdpi.com)
  • The phosphorylation of MEK and of Raf-1, as monitored by a mobility shift in SDS-PAGE, which is reportedly associated with the activation of these kinases, occurred in 9 of 18 cases (50%) and in 6 of 11 cases (55%) respectively. (aacrjournals.org)
  • Stimulation of hemopoietic cells with IL-3, IL-4, IL-5, granulocyte-macrophage-CSF and Steel factor-(SLF) induced tyrosine phosphorylation of a number of protein substrates. (jimmunol.org)
  • Liver cancer cells with inactivation of Plxnb1, Flrt2, and B9d1 formed more tumors in mice and had increased levels of mitogen-activated protein kinase phosphorylation. (mit.edu)
  • IL-6 induced phosphorylation of JAK kinases and gp130, regardless of the proliferative response of MM cells to this growth factor. (jimmunol.org)
  • The proliferative effects of ghrelin and UAG were suppressed by inhibitors of extracellular-signal-regulated kinase (ERK) and phosphoinositide-3 kinase, and both peptides rapidly induced ERK phosphorylation. (unboundmedicine.com)
  • Furthermore, knockdown of PP2Ac expression enhances LPA-induced MEKK3-mediated IkappaB kinase beta (IKKbeta) phosphorylation and NF-kappaB activation. (sigmaaldrich.com)
  • They are the final components of the cascades , activated by phosphorylation by mitogen-activated protein kinase kinases (MAPKKs) which in turn are activated by mitogen-activated protein kinase kinase kinases (MAPKKKs). (emf-portal.org)
  • Phosphorylation of vascular and renal extracellular-signal-regulated protein kinase 1/2 (ERK1/2), p38MAP kinase and c-Jun N-terminal kinase (JNK) were assessed using phospho-specific antibodies. (portlandpress.com)
  • Quinidine and imipramine reduced the phosphorylation of renal ERK1/2, but did not modify renal p38MAP kinase or JNK. (portlandpress.com)
  • Our data demonstrate that Ang II induces severe hypertension in Sprague-Dawley rats and this is associated with increased phosphorylation of vascular and renal MAP kinases. (portlandpress.com)
  • The phosphorylation of MAP kinase is thought to be a prerequisite for translocation. (portlandpress.com)
  • Unexpectedly, tyrosine phosphorylation of MAP kinase is unchanged in the nuclear fraction during ischaemia, indicating that unphosphorylated MAP kinase translocates from the cytosol to the nucleus. (portlandpress.com)
  • During reperfusion (0-30 min), after ischaemia for 20 min, tyrosine phosphorylation of MAP kinase in the nuclear fraction is increased with a peak at 10 min of reperfusion. (portlandpress.com)
  • The activation is confirmed by MAP kinase activity with similar kinetics to the tyrosine phosphorylation. (portlandpress.com)
  • These findings demonstrate that nuclear MAP kinase is activated by tyrosine phosphorylation during reperfusion, probably by MEK-2. (portlandpress.com)
  • MAPKs are involved in directing cellular responses to a diverse array of stimuli, such as mitogens , osmotic stress , heat shock and proinflammatory cytokines . (wikipedia.org)
  • The closest relatives of MAPKs are the cyclin-dependent kinases (CDKs). (wikipedia.org)
  • These pathways can effectively convey stimuli from the cell membrane (where many MAP3Ks are activated) to the nucleus (where only MAPKs may enter) or to many other subcellular targets. (wikipedia.org)
  • [4] In contrast to the classical MAP kinases, these atypical MAPKs require only a single residue in their activation loops to be phosphorylated. (wikipedia.org)
  • p38 mitogen-activated protein kinases are a class of mitogen-activated protein kinases (MAPKs) that are responsive to stress stimuli, such as cytokines, ultraviolet irradiation, heat shock, and osmotic shock, and are involved in cell differentiation, apoptosis and autophagy. (wikipedia.org)
  • MAPKs belong to an evolutionarily conserved and ubiquitous signal transduction superfamily of Ser/Thr protein kinases that regulate multiple cellular processes including apoptosis, growth, differentiation and responses to environmental stimuli. (plos.org)
  • Differences between alveolar macrophages and cell lines in activation of mitogen-activated protein kinases (MAPKs) stimulated by lipo-polyscccharide (LPS). (cdc.gov)
  • Stimulation of primary macrophages and cell lines by LPS has been shown to activate MAPKs. (cdc.gov)
  • Evidence from exercise studies in nondiabetics suggests that the extracellular-signal-regulated kinases (Erk1/2), p38, and c-JUN NH2-terminal kinase (Jnk) mitogen-activated protein kinases (MAPKs) are important regulators of muscle adaptation. (hindawi.com)
  • p38gamma (MAPK12), also known as Stress-activated protein kinase 3 (SAPK3) belongs to the p38 subfamily of MAPKs. (atlasgeneticsoncology.org)
  • 2008). All p38 MAPKs are strongly activated in vivo by environmental stresses and inflammatory cytokines, and less by serum and growth factors. (atlasgeneticsoncology.org)
  • A feature that makes p38gamma unique among the p38 MAPKs is its short C-terminal sequence -KETXL, an amino acid sequence ideal for binding PDZ domains in proteins. (atlasgeneticsoncology.org)
  • 2002). ERK5, at 98 kDa, is twice the size of other MAPKs and hence the largest kinase within its group. (atlasgeneticsoncology.org)
  • Mitogen-activated protein kinases (MAPKs) are expressed in neurons and are activated after injury, for example, after sciatic nerve transection and hypoxia. (jneurosci.org)
  • Mammalian mitogen-activated protein kinases (MAPKs) are cytoplasmic protein-Ser/Thr kinases that participate in signal transduction by catalysing the transfer of the γ-phosphoryl group from ATP to a hydroxyl group of the protein substrate. (mdpi.com)
  • Conventional MAPKs include the extracellular signal-regulated kinases 1 and 2 (ERK1/2), p38 MAPKs (p38 α, β, γ, and δ), c-Jun terminal kinases 1-3 (JNK1-3) and the ERK5 [ 1 ]. (mdpi.com)
  • Constitutive activation of MAPKs in tumor tissue, as determined by the appearance of phosphorylated forms, was found in 12 cases (48%), and this activation was confirmed by a direct in vitro kinase assay of immunoprecipitate using myelin basic protein as the substrate. (aacrjournals.org)
  • In this context, the p38 mitogen-activated protein kinases (MAPKs), a family of stress-activated MAPKs, 2 3 have been examined as the candidate kinases during preconditioning. (ahajournals.org)
  • The data are compatible with the hypothesis that p38 MAPKs may mediate the protective signaling pathways or function as protective kinases during the late phase of pharmacological preconditioning. (ahajournals.org)
  • If activation of p38 MAPKs is a necessary signaling event for the protection to manifest on day 2, then inhibition of this kinase will lead to the abrogation of late preconditioning. (ahajournals.org)
  • Mitogen-activated kinases (MAPKs), consisting of three major categories of enzymes, ERK, p38, and JNK, couple cell-surface receptors to critical regulatory targets and gene transcription within cells. (arvojournals.org)
  • It is well known from mammalian cells that anoxia has a major impact on the mitogen-activated protein kinases, MAPKs. (biologists.org)
  • MAPKs are serine -threonine protein kinases that are activated by diverse stimuli (e.g., growth factors , stress stimuli, cytokines , ultraviolet irradiation , heat shock, and osmotic shock) via protein kinase cascades . (emf-portal.org)
  • MAPKs are subdivided in extracellular signal-regulated kinases ( ERKs ), c-Jun N-terminal kinases ( JNKs ), and p38 mitogen activated protein kinases . (emf-portal.org)
  • Mitogen-activated protein kinases (MAPKs) are evolutionary conserved enzymes which play a key role in signal transduction mediated by cytokines, growth factors, neurotransmitters and various types of environmental stresses. (semanticscholar.org)
  • Similar to the SAPK/JNK pathway, p38 MAP kinase is activated by a variety of cellular stresses including osmotic shock, inflammatory cytokines, lipopolysaccharides (LPS), Ultraviolet light, and growth factors. (wikipedia.org)
  • Downstream of the receptors, this pathway involves the activation of a kinase cascade that culminates in a transcriptional response and affects processes, such as cell migration and adhesion. (mdpi.com)
  • However, inhibition of the p38 pathway prevented the insulin-stimulated decrease in GLUT4 protein levels. (diabetesjournals.org)
  • Staurosporine Induces Platelet Apoptosis Through p38 Mitogen-Activated Protein Kinase Signaling Pathway. (sigmaaldrich.com)
  • These data suggest the induction of MKP-1, not only after stimulation of the cell growth-promoting ERK pathway but also in response to activation of stress-responsive MAP kinase signaling cascades. (ahajournals.org)
  • Thus, we define a signaling pathway directly downstream of MAP kinase, influencing cell migration on the extracellular matrix. (rupress.org)
  • To better understand the role of MAP kinase signaling in Neurospora crassa , and to identify downstream target genes of the pathway, we isolated, cloned, and disrupted the FUS3 homolog mak-2 . (genetics.org)
  • Ste12p is a transcription factor target of Fus3p that activates genes of the mating pathway in yeast, and we also characterized the N. crassa STE12 homolog pp-1 . (genetics.org)
  • The role of the MAP kinase pathway in both sexual and asexual development as well as secondary metabolism is consistent with the dual regulation of the mating process and pathogencity observed in fungal pathogens. (genetics.org)
  • MEK1/2 proteins are upstream regulators of the extracellular signal-related kinase (ERK) pathway. (reportbuyer.com)
  • Both MEK and ERK are critical components of the RAS-regulated RAF-MEK-ERK pathway, which is often activated in different types of cancers. (reportbuyer.com)
  • The receptor tyrosine kinase (RTK) signaling pathway is used reiteratively during the development of all multicellular organisms. (genetics.org)
  • AZD6244 ( ARRY-142886 ) is an investigational anticancer drug that is designed to block a critical component (MEK (methyl ethyl ketone)) of a pathway (MAP (mitogen-activated protein) kinase pathway) that causes some lung cancer cells to grow. (clinicaltrials.gov)
  • The MAP kinase pathway could be overactive in a proportion of lung cancers, including some which also have another mutation in a protein known as KRAS (Kirsten rat sarcoma viral oncogene homolog). (clinicaltrials.gov)
  • Integrins and growth factors are capable of activating the ras/MAP kinase pathway in vitro, yet how these signals influence endothelial cells during angiogenesis is unknown. (rupress.org)
  • One of the best studied signalling routes is the mitogen activated protein (MAP) kinase signal transduction pathway which plays a crucial role in many aspects of immune mediated inflammatory responses. (ebscohost.com)
  • Here, our current understanding of the MAP kinase pathway is reviewed, as well as recent advances in the design of novel agents that are able to modulate the activity of these signalling cascades. (ebscohost.com)
  • Cites a study published in the October 2001 issue of the journal 'Nature Neuroscience,' on how neurotrophins use the extracellular signal-related protein kinase 5 pathway to mediate a retrograde survival response. (ebscohost.com)
  • Cell signal transduction through the mitogen-activated protein kinase pathway. (ebscohost.com)
  • Presents a series of articles about cell signal transduction through mitogen-activated protein (MAP) kinase pathway. (ebscohost.com)
  • Presents a conserved tyrosine kinase-activated signal transduction pathway that comprises the plasma membrane-bound protein Ras and the protein kinases Raf, MAP-kinase and MAP kinase. (ebscohost.com)
  • Most interestingly, deletion of HOG1 resulted in a drastic increase in the mean survival time of systemically infected mice, supporting a role for this MAP kinase pathway in virulence of pathogenic fungi. (asm.org)
  • Our results suggest that MAP kinase activation is, at least in part, an important component for mitotic signal from the EPOR, and CTLL-2 cells probably lack signaling molecule(s) in JAK2 and the Ras-MAP kinase pathway. (biomedsearch.com)
  • In view of this, MPNST may be susceptible to inhibition of the activated Ras/Raf/mitogen-activated protein kinase pathway by the B-Raf inhibitor sorafenib. (aacrjournals.org)
  • With growth inhibition at the low nanomolar range, sorafenib, by inhibiting the mitogen-activated protein kinase pathway, may prove to be a novel therapy for patients with MPNST. (aacrjournals.org)
  • Recent highlights of Chinese herbs in treatment of allergic disease: Acting via mitogen-activated protein kinase signal pathway. (semanticscholar.org)
  • Furthermore, macrophages isolated from MKP-1-null mice showed dramatic defects in their spreading/migration and impairment in extracellular signal-regulated kinase, but not c-Jun N-terminal kinase and p38, pathway activation. (scialert.net)
  • ATP has been shown to activate the phospholipase C/diacylglycerol/protein kinase C (PKC) pathway. (eurekamag.com)
  • Control of thrombopoietin-induced megakaryocytic differentiation by the mitogen-activated protein kinase pathway. (asm.org)
  • Mitogen-activated Protein/Extracellular Signal-regulated Kinase Kinase (MEK) Inhibitors Restore Anoikis Sensitivity in Human Breast Cancer Cell Lines with a Constitutively Activated Extracellular- regulated Kinase (ERK) Pathway 1 This work was supported by a Grant-in-Aid for Cancer Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. (aacrjournals.org)
  • Another approach to therapeutically target an overactive Ras pathway is to block critical signal transduction cascades that are initiated by activated Ras. (aspetjournals.org)
  • Mitogen-activated protein kinase pathways. (nih.gov)
  • however, the endogenous signals activating these pathways are unknown ( 25 ). (pnas.org)
  • The activators of p38 (MKK3 and MKK6), JNK (MKK4 and MKK7), and ERK (MEK1 and MEK2) define independent MAP kinase signal transduction pathways. (wikipedia.org)
  • We demonstrate that mitogen-activated protein kinase pathways mediate inflammatory lung injury during ventilator-induced lung injury. (plos.org)
  • Moreover, it was recently revealed that the p38alpha is also activated via alternative pathways, which are MKK independent. (rcsb.org)
  • Therefore, recently cloned dual-specificity protein tyrosine phosphatases (PTPases), which exhibit dual-catalytic activity toward phosphotyrosine and phosphothreonine in substrate proteins, may play a pivotal role in the regulation of MAP kinase-signaling pathways. (ahajournals.org)
  • 15 16 Furthermore, the kinetics of gene expression and the cellular localization are consistent with a role for MKP-1 in the compensatory inactivation of stimulated MAP kinase-signaling pathways. (ahajournals.org)
  • Protein kinase C (PKC) isoforms are serine/threonine kinases involved in signal transduction pathways that govern a wide range of physiological processes including differentiation, proliferation, gene expression, brain function, membrane transport and the organization of cytoskeletal and. (ebscohost.com)
  • Histidine protein kinases and response regulators form the basis of phosphotransfer signal transduction pathways. (ebscohost.com)
  • In Saccharomyces cerevisiae , a model eukaryotic cell system, some of these pathways involve members of the MAP kinase family (from mitogen-activated protein kinase), a set of enzymes performing essential functions in cell physiology first discovered in mammalian cells but later shown to be also present in lower eukaryotes ( 3 , 12 ). (asm.org)
  • Because it is anticipated that several small MAP kinase inhibiting molecules will be evaluated for efficacy in inflammatory diseases, here we review current knowledge of the MAP kinase signalling pathways as well as potential inhibitory drugs. (bmj.com)
  • We reported that the mitogen-activated protein/extracellular signal-regulated kinase kinase (MEK) inhibitor U0126 inhibited anchorage-independent growth of Ki- ras -transformed rat fibroblasts by simultaneously blocking both extracellular signal-regulated kinase (ERK) and mammalian target of rapamycin (mTOR)-p70 S6K pathways. (aacrjournals.org)
  • The i.t injection of extracellular signal-regulated kinase (ERK) inhibitor blocked morphine-induced analgesia, without interfering with the morphine-induced hyperalgesia. (frontiersin.org)
  • Not like other IAPs, survivin is usually a bifunctional protein that functions being a important regulator of mitosis and inhibitor of programmed cell death. (selleckchem.com)
  • Koselugo (selumetinib) is inhibitor of mitogen-activated protein kinase kinases 1 and 2 (MEK1/2). (reportbuyer.com)
  • Randomized Phase II Study of AZD6244 (Mitogen-activated Protein Kinase Inhibitor) MEK-Inhibitor With Erlotinib in KRAS Wild Type Advanced Non-Small Cell Lung Cancer (NSCLC) and a Randomized Phase II Study of AZD6244 With Erlotinib in Mutant KRAS Adva. (clinicaltrials.gov)
  • Effects of the MEK inhibitors AZD6244, U0126, and trametinib, or the multi-kinase inhibitor sorafenib, were examined in human and mouse HCC cell lines. (mit.edu)
  • To analyze the ERK3A-Myc and ERK3B-Myc proteins, which were unstable due to proteasome- dependent degradation, animal caps (N=25, each sample) were dissected at stage 9, cultured with 10 μM MG132 (a proteasome inhibitor) until stage 12, and then lysed with 50 μl of lysis buffer. (xenbase.org)
  • In the case of classical MAP kinases, the activation loop contains a characteristic TxY (threonine-x-tyrosine) motif (TEY in mammalian ERK1 and ERK2 , TDY in ERK5 , TPY in JNKs , TGY in p38 kinases ) that needs to be phosphorylated on both the threonine and the tyrosine residues in order to lock the kinase domain in a catalytically competent conformation. (wikipedia.org)
  • Therefore, MAP kinase phosphatase-1 (MKP-1), a dual-specificity protein tyrosine phosphatase that exhibits catalytic activity toward both regulatory sites on MAP kinases, is suggested to be responsible for the downregulation of extracellular signal-regulated kinase (ERK), stress-activated protein kinase (SAPK), and p38 MAP kinase. (ahajournals.org)
  • 3 MEK, the specific activator of ERK, is a dual-specificity protein kinase that phosphorylates both threonine and tyrosine regulatory sites in ERK. (ahajournals.org)
  • Two of these proteins, designated p42 and p44, were tyrosine phosphorylated rapidly in response to treatment with IL-3, IL-5, granulocyte-macrophage-CSF and SLF, but not IL-4. (jimmunol.org)
  • Immunoblotting of column fractions with antiphosphotyrosine antibodies showed coelution of the peak of MAP kinase enzyme activity with the p42 and p44 tyrosine phosphorylated species, and with two proteins of 42 and 44 kDa which were immunoreactive with anti-MAP kinase antibodies. (jimmunol.org)
  • Receptor tyrosine kinase inhibition has been shown to be a remarkably effective mechanism to treat hematopoietic, epithelial, and mesenchymal cancers ( 2 ). (aacrjournals.org)
  • As a result, we have begun a broad-based search for small-molecule organic compounds to target tyrosine- and serine/threonine kinases critical to the survival of STS cells. (aacrjournals.org)
  • Cross-linking the receptors for the Fc domain of IgG (Fc gamma R) on leukocytes induces activation of protein tyrosine kinases. (rupress.org)
  • Furthermore, serine/threonine kinases are often involved with the regulation of gene expression by serving as intermediates in signal transduction cascades that link extracellular and intracellular stimuli to the nucleus ( 13 ). (diabetesjournals.org)
  • Thus serine/threonine kinases have the potential to contribute to the diminished GLUT4 mRNA levels in insulin-resistant adipose tissue. (diabetesjournals.org)
  • Specifically, members of the mitogen-activated protein (MAP) kinase family of serine-threonine kinases may contribute to the development of insulin resistance. (diabetesjournals.org)
  • We demonstrate that these common substrates are members of the mitogen-activated protein kinase (MAP kinase) family of protein serine/threonine kinases. (jimmunol.org)
  • The Raf family of serine/threonine kinases compromises three members: C-Raf (Raf-1), A-Raf, and B-Raf. (aacrjournals.org)
  • Nearly all cell surface receptors utilize one or more of the mitogen-activated protein kinase cascades in their repertoire of signal transduction mechanisms. (nih.gov)
  • This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. (wikipedia.org)
  • Abstract -Mitogen-activated protein (MAP) kinase cascades are major signaling systems by which cells transduce extracellular cues into intracellular responses. (ahajournals.org)
  • A serine-threonine protein kinase family whose members are components in protein kinase cascades activated by diverse stimuli. (umassmed.edu)
  • Norway rat protein-coding gene Mapk1. (nih.gov)
  • Mitogen-activated protein kinase kinase kinase 6 is a protein that in humans is encoded by the MAP3K6 gene. (wikipedia.org)
  • The MAPK12 gene encodes a 367 amino-acid protein of about 42 kDa. (atlasgeneticsoncology.org)
  • Mitogen-activated protein kinase 9 is an enzyme that in humans is encoded by the MAPK9 gene . (wikidoc.org)
  • The protein encoded by this gene is a member of the MAP kinase family. (wikidoc.org)
  • This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. (wikidoc.org)
  • This gene and MAPK8 are also known as c-Jun N-terminal kinases. (wikidoc.org)
  • The human MAPK7 gene encodes an 816 amino-acids protein of about 98 kDa. (atlasgeneticsoncology.org)
  • suggesting that MAP kinase can lead to direct activation of the intracellular motility machinery independent of de novo gene transcription. (rupress.org)
  • Indeed, MEK1/2 inhibition caused a profound increase in the expression of the gene coding for the serglycin core protein and of genes coding for various enzymes involved in the biosynthesis/sulfation of the GAGs attached to the serglycin core protein. (frontiersin.org)
  • This gene encodes a member of the mitogen-activated protein (MAP) kinase family. (antibodies-online.com)
  • The relevance of the mitogen-activated protein (MAP) kinase Hog1p in Candida albicans was addressed through the characterization of C. albicans strains without a functional HOG1 gene. (asm.org)
  • The NF1 tumor-suppressor gene encodes neurofibromin, which includes a GTPase-activating domain for Ras inactivation. (aspetjournals.org)
  • In contrast to ERK, more recently described MAP kinases such as stress-activated protein kinase (SAPK), also referred to as c-Jun N-terminal kinase (JNK), and p38 MAP kinase are suggested to inhibit cellular proliferation and to induce apoptosis. (ahajournals.org)
  • Proteolytic activation of MST/Krs, STE20-related protein kinase, by caspase during apoptosis. (ebscohost.com)
  • The apoptosis-related protein expression levels of p-p53, Bad, cleaved caspase-3, cleaved PARP and p-JNK were increased in quinalizarin-treated cells, while protein expression levels Bcl-2, p-Akt, p-ERK, and p-STAT3 were decreased. (medscimonit.com)
  • In addition, PD 098059, an antagonist of MEK (MAP kinase/ERK kinase), the upstream kinase of ERK, significantly reduced the PDGF-induced activation of ERK and potently inhibited the expression of MKP-1 after stimulation with PDGF, thereby demonstrating the induction of MKP-1 in response to activation of the ERK signaling cascade. (ahajournals.org)
  • These results demonstrate that members of the MAP kinase family are involved in common signal transduction events elicited by IL-3, IL-5, granulocyte-macrophage-CSF and Steel factor, but not those involving IL-4. (jimmunol.org)
  • Demonstrates the effect of either the down-regulation of beta6 expression or loss of the binding site on beta6 for extracellular signal-related kinase 2 on matrix metalloproteinase-9 (MMP-9) secretion. (ebscohost.com)
  • Iavarone C, Acunzo M, Carlomagno F, Catania A, Melillo RM, Carlomagno SM, Santoro M, Chiariello M: Activation of the Erk8 mitogen-activated protein (MAP) kinase by RET/PTC3, a constitutively active form of the RET proto-oncogene. (drugbank.ca)
  • Previously, we have shown that ectopic expression of a constitutively active protein (yan ACT ) inhibits the differentiation of multiple cell types. (genetics.org)
  • EPO-dependent long term proliferation of T-JER cells was conferred by expression of the constitutively activated form of MEK1. (biomedsearch.com)
  • When gain-of-function mutations occur in Ras /Raf, a commonly observed phenomenon in many types of cancers , MAP/ERK proteins become constitutively activated. (novusbio.com)
  • and (iv) TPO-induced megakaryocytic differentiation in UT7-mpl delta3 cells was partially restored by expression of a constitutively activated mutant of MEK. (asm.org)
  • U0126 selectively repressed anchorage-independent growth of MDA-MB231 and HBC4 cells, two lines with constitutively activated ERK. (aacrjournals.org)
  • Of eight breast cancer cell lines tested, U0126 inhibited anchorage-independent growth of two lines with constitutively activated ERK. (aacrjournals.org)
  • Several isoforms of the protein with molecular sizes of 43 and 48 KD exist due to multiple ALTERNATIVE SPLICING. (curehunter.com)
  • The use of synthetic peptide substrates confirmed SLF and IL-5 activate isoforms of MAP kinases. (jimmunol.org)
  • The recombinant protein has autophosphorylating activity and phosphorylates myelin basic protein. (ingentaconnect.com)
  • We show in this study that sodium channels and p38 MAP kinase colocalize in rat brain tissue and that activated p38α phosphorylates L1 of Na v 1.6, specifically at serine 553 (S553), in vitro . (jneurosci.org)
  • 4 Phosphorylated and activated ERK migrates to the nucleus, where it phosphorylates several transcription factors. (ahajournals.org)
  • Both signals converge at the Pbs2p level, which in turn phosphorylates and activates Hog1p, which mediates the intracellular accumulation of osmolytes such as glycerol ( 4 ). (asm.org)
  • Once activated, all the Raf kinases can phosphorylate MEK, which in turn phosphorylates and activates ERK ( 5 ). (aacrjournals.org)
  • The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. (wikipedia.org)
  • MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. (wikidoc.org)
  • In this study, we investigated the association of MAP kinase p38 with Na v 1.6 in brain tissue and examined the regulation by MAP kinase p38 of the Na v 1.6 sodium current. (jneurosci.org)
  • However, little is known about the kinetics and regulation of MAP kinase activity in vivo, where the more complex extracellular matrix environment in a tissue may influence both the level and duration of this activity. (rupress.org)
  • Role of mitogen-activated protein kinase in the regulation of. (ebscohost.com)
  • p38gamma (MAPK12) regulates many cellular functions by phosphorylating several proteins. (atlasgeneticsoncology.org)
  • Integrin-mediated cellular adhesion to the extracellular matrix leads to intracellular signaling, including activation of focal adhesion kinase with subsequent activation of downstream effector molecules including mitogen-activated protein (MAP) 1 kinases ERK1 and ERK2 (Q. (rupress.org)
  • ERK controls cellular phenotypes by phosphorylating over two hundred known substrate proteins, however new ERK targets are reported frequently. (mit.edu)
  • The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. (antibodies-online.com)
  • Growth factors and various cellular stresses are known to activate mitogen-activated protein (MAP) kinase, which plays a role in conveying signals from the cytosol to the nucleus. (portlandpress.com)
  • Hence members of this family of kinases have come to be appreciated as key cellular signal transducers and attractive targets for drug development. (bmj.com)
  • To determine whether MAP kinases were involved in the downregulation of IRS-1 and GLUT4 protein levels, selective inhibitors were used to inhibit these MAP kinases in 3T3-L1 adipocytes treated chronically with insulin. (diabetesjournals.org)
  • Mitogen Activated Protein Kinase Kinase 2 inhibitors - Pipeline Insight, 2021," report provides comprehensive insights about 10+ companies and 10+ pipeline drugs in Mitogen Activated Protein Kinase Kinase 2 inhibitors pipeline landscape. (reportbuyer.com)
  • MEK inhibitors have shown objective responses when used as monotherapy, particularly in tumors with known BRAF-activating mutations. (reportbuyer.com)
  • The companies and academics are working to assess challenges and seek opportunities that could influence Mitogen Activated Protein Kinase Kinase 2 inhibitors R&D. The therapies under development are focused on novel approaches for Mitogen Activated Protein Kinase Kinase 2 inhibitors. (reportbuyer.com)
  • This segment of the Mitogen Activated Protein Kinase Kinase 2 inhibitors report encloses its detailed analysis of various drugs in different stages of clinical development, including phase III, II, I, preclinical and Discovery. (reportbuyer.com)
  • 10+ key companies which are developing the Mitogen Activated Protein Kinase Kinase 2 inhibitors. (reportbuyer.com)
  • The companies which have their Mitogen Activated Protein Kinase Kinase 2 inhibitors drug candidates in the most advanced stage, i.e. phase III include, Astrazeneca. (reportbuyer.com)
  • Mitogen Activated Protein Kinase Kinase 2 inhibitors pipeline report provides the therapeutic assessment of the pipeline drugs by the Route of Administration. (reportbuyer.com)
  • An alternative would be to develop inhibitors that can target the accessory proteins that regulate MAP/ERK functions. (novusbio.com)
  • In the present in vivo study, we have investigated whether inhibitors of the Na + /Mg 2+ exchanger quinidine and imipramine influence the development of hypertension and whether this is associated with modulation of mitogen-activated protein (MAP) kinase activation in arteries and kidneys of hypertensive rats. (portlandpress.com)
  • This has led to current initiation of clinical trials in inflammatory disease states evaluating small molecule inhibitors of MAP kinase proteins and encouraging results have been obtained. (bmj.com)
  • Thus, MAP kinase kinase (MEK) inhibitors may be a rational approach to NF1 therapy. (aspetjournals.org)
  • The farnesyltransferase inhibitors were developed from biochemical experiments on H-Ras proteins, and it is likely that K-Ras (and perhaps also N-Ras) proteins can be alternatively modified by geranylgeranylation when farnesyltransferase activity is blocked ( Adjei, 2001 ). (aspetjournals.org)
  • X-ray structure of the ERK2 MAP kinase in its active form. (wikipedia.org)
  • Rabbit polyclonal antibodies to MAP kinase (ERK1 and ERK2), MEK1, and RAF-1 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-myosin IIB antibodies were kindly provided by Dr. Robert Adelstein (Molecular Cardiology, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD). Anti-MLCK antibodies have been previously described (de Lanerolle et al. (rupress.org)
  • Furthermore, for extracellular signal-regulated kinase 2 (ERK2) the protein-peptide docking surface is comprised of a small hydrophobic surface patch that is often engaged in the crystal packing of apo ERK2 crystals. (iucr.org)
  • Here, a rational surface-engineering approach is presented that involves mutating protein surface residues that are distant from the peptide-binding ERK2 docking groove to alanines. (iucr.org)
  • Unfortunately, ERK2 readily crystallized in the apo form and we only managed to grow protein-peptide cocrystals with the docking peptide from MNK1 (pepMNK1), which is an ERK2 substrate. (iucr.org)
  • Analysis of crystal-packing contacts subsequently revealed that the protein-peptide binding surface of ERK2 WT was blocked by a symmetry-related kinase molecule in all apo crystals, while ERK2-pepMNK1 crystals could `luckily' form because this peptide mediated a different type of crystal packing. (iucr.org)
  • This approach utilizes an ERK2 kinase with "gatekeeper" mutation that allows it to bind bulky ATP analogs (AS-ERK2). (mit.edu)
  • AS-ERK2 can be used to label its direct substrates with thiophosphate in an in vitro kinase reaction. (mit.edu)
  • In the whole rat heart, ERK2 is inactivated in response to ischemia, followed by translocation of the inactive kinase to the nuclear compartment ( Mizukami and Yoshida, 1997 ). (biologists.org)
  • Interestingly, ERK2 was activated in response to reperfusion, suggesting an interface capable of ERK activation in the nuclear membrane. (biologists.org)
  • We will not only review the well-known members of the family, such as kinase suppressor of Ras (KSR), but also put a special focus on the function of the recently identified or less studied scaffolders, such as fibroblast growth factor receptor substrate 2, flotillin-1 and mitogen-activated protein kinase organizer 1. (mdpi.com)
  • The mitogen-activated protein kinase-activated protein kinase MK5 is a substrate of the mitogen-activated protein kinases p38, ERK3 and ERK4. (mdpi.com)
  • Activated p38 MAP kinase has been shown to phosphorylate and activate MAPKAP kinase 2 and to phosphorylate the transcription factors ATF2, Mac and MEF2. (wikipedia.org)
  • SAPK3/p38gamma binds to a variety of these proteins, such as alpha1-syntrophin, SAP90/PSD95 and SAP97/hDlg , and under stress conditions is able to phosphorylate them and modulate their activity (Hasegawa et al. (atlasgeneticsoncology.org)
  • Once activated, MAP kinases phosphorylate a variety of proteins and relay signals downstream, often ending in activation of transcriptional factors ( Cano and Mahadevan, 1995 ). (jneurosci.org)
  • Because linear motif-containing peptides are often unstructured alone and the energy gained upon crystal packing between symmetry mates may be on a par with the binding energy of the complex, the bona fide peptide-binding protein surface may mediate crystal packing rather than physiological LM binding. (iucr.org)
  • Activated AMP-activated protein kinase and increased peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α) have been suggested to mediate the regulatory effects of adiponectin on mitochondrial biogenesis and function ( 13 , 16 - 18 ). (diabetesjournals.org)
  • Extracellular stimuli such as platelet-derived growth factor (PDGF), 12-O-tetradecanoylphorbol 13-acetate (TPA), and angiotensin II, which activated ERK but not SAPK/p38 MAP kinase, induced a transient induction of MKP-1 mRNA and its intracellular protein. (ahajournals.org)
  • Although an upstream kinase for MAP kinase, MAP kinase/extracellular signal-regulated kinase kinase (MEK)-1, remains in the cytosol throughout ischaemia and reperfusion, MEK-2, another upstream kinase for MAP kinase, is constantly present in the nucleus as well as in the cytoplasm, based on analyses by fractionation and immunohistochemistry. (portlandpress.com)
  • Antibodies and purified kinases. (jneurosci.org)
  • Search, Find and Buy Antibodies, ELISA Kits and Proteins. (antibodies-online.com)
  • Novus Biologicals offers a great selection of tools for your MAP/ERK research needs, including highly specific antibodies, RNAi and protein controls. (novusbio.com)
  • Thus the role of mammalian ERK1/2 kinases as regulators of cell proliferation is not a generic, but a highly specialized function. (wikipedia.org)
  • The crystallization of proteins in complex with linear motif-containing peptides is often challenging because the energy gained upon crystal packing between symmetry mates in the crystal may be on a par with the binding energy of the protein-peptide complex. (iucr.org)
  • The moderate binding affinity of LM-containing peptides can hinder successful crystallization of the desired protein-peptide complex. (iucr.org)
  • We offer LOC407835 mitogen-activated protein kinase kinase 2 pseudogene Peptides and LOC407835 mitogen-activated protein kinase kinase 2 pseudogene Proteins for use in common research applications: ELISA, Protein Array, Western Blot. (novusbio.com)
  • Our LOC407835 mitogen-activated protein kinase kinase 2 pseudogene Peptides and LOC407835 mitogen-activated protein kinase kinase 2 pseudogene Proteins can be used in a variety of model species: Human. (novusbio.com)
  • Choose from our LOC407835 mitogen-activated protein kinase kinase 2 pseudogene Peptides and Proteins. (novusbio.com)
  • Neurospora crassa is a well-characterized model organism ideally suited to examining the role of MAP kinase function in mating behavior and development. (genetics.org)
  • p38 mitogen-activated protein kinase activation is required for human neutrophil function triggered by TNF- α or FMLP stimulation," Journal of Immunology , vol. 160, no. 4, pp. 1982-1989, 1998. (hindawi.com)
  • The P38 MAP kinases are regulated by CYTOKINE RECEPTORS and can be activated in response to bacterial pathogens. (abbreviations.com)
  • Since both growth factor receptors and integrins activate MAP kinase in vitro, we examined the role of MAP kinase and the requirement for integrin ligation during angiogenesis in vivo. (rupress.org)
  • Moreover, its in vitro kinase activity increases with temperature rise up to 40°C. Our results suggest that LmxPK4 is involved in the differentiation process and affects virulence of Leishmania mexicana . (ingentaconnect.com)
  • Extracellular signal-regulated kinase (ERK) remains the best characterized mammalian MAP kinase. (ahajournals.org)
  • 10 Recently, MAP kinase phosphatase-1 (MKP-1), a mammalian VH-1-like dual-specificity PTPase, has been isolated. (ahajournals.org)
  • It is well known from various mammalian cells that anoxia has a major impact on the mitogen-activated protein kinase ERK, but a possible similar effect in fish cells has not been investigated. (biologists.org)
  • We associated decreased levels of NF1 and increased levels of its downstream protein HMGA2 with survival times of patients with HCC. (mit.edu)
  • Dysregulated NF-κB activity can activate genes that cause cancer cell survival, and can also activate genes that facilitate cancer cell metastasis to other tissues. (wikipedia.org)
  • We also isolated mutations in five previously uncharacterized genes, one of which, split ends , we have characterized molecularly and have shown to encode a member of the RRM family of RNA-binding proteins. (genetics.org)
  • Zou J, Wang R, Li R, Kong Y, Wang J, Ning X, Zhang L, Wang S, Hu X, Bao Z. The genome-wide identification of mitogen-activated protein kinase kinase (MKK) genes in Yesso scallop Patinopecten yessoensis and their expression responses to bacteria challenges. (umassmed.edu)
  • Fc gamma R-dependent mitogen-activated protein kinase activation in leukocytes: a common signal transduction event necessary for expression of TNF-alpha and early activation genes. (rupress.org)
  • After UV irradiation, a series of signal transductions in the skin will be activated, leading to inflammatory response and photoaged skin. (wellnessresources.com)
  • A c-jun amino-terminal kinase that is activated by environmental stress and pro-inflammatory cytokines. (curehunter.com)
  • Proinflammatory cytokines have been reported to activate several transcription factors that are intimately linked to the expression of inflammatory and catabolic signals. (karger.com)
  • Adiponectin mRNA and blood protein levels are inversely associated with obesity ( 7 ), which is a common cause of insulin resistance in humans. (diabetesjournals.org)
  • 2005). These proteins are scaffold proteins usually targeted to the plasma membrane cytoskeleton at specialised sites such as the neuromuscular junction and gap junctions through protein-protein interactions. (atlasgeneticsoncology.org)
  • Furthermore, anisomycin, a potent stimulus of SAPK and p38 MAP kinase, also induced MKP-1 mRNA expression. (ahajournals.org)
  • 8 9 Interestingly, the mechanism involved in the activation of SAPK and p38 MAP kinase is similar to that involved in the activation of ERK. (ahajournals.org)
  • MKP-1 (the human homologue is called CL100 [97% identity]) was demonstrated to dephosphorylate and inactivate not only ERK 11 12 13 14 but also SAPK and p38 MAP kinase. (ahajournals.org)
  • JNK kinases (also known as SAPK kinases) are a subfamily. (umassmed.edu)
  • 1997). Another p38gamma substrates that do not require PDZ domain binding interactions are the mitochondrial protein Sab (Court et al. (atlasgeneticsoncology.org)
  • Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. (antibodies-online.com)
  • The protein product of proto-oncogene RAS can increase activity of p38, and thereby cause excessively high activity of transcription factor NF-κB. (wikipedia.org)
  • Ischaemia (0-40 min) induces the translocation of MAP kinase from the cytosol fraction to the nuclear fraction. (portlandpress.com)
  • This is conducted by specialized enzymes of the STE protein kinase group. (wikipedia.org)
  • Deletion of the serglycin core protein abrogated the induction of enzymes operative in proteoglycan synthesis, indicating that availability of the serglycin proteoglycan core protein has a regulatory function impacting on the expression of the various serglycin-modifying enzymes. (frontiersin.org)
  • These states are regulated by the balance between the intrinsic GTPase activity of the proteins: their interactions with inhibitory proteins and with activating proteins that regulate the exchange of GDP for GTP. (aacrjournals.org)
  • In summary, type 2 diabetes is associated with an increased basal activation of the MAP kinase family. (diabetesjournals.org)
  • C57/BL6 wild-type mice and mice genetically deleted for mitogen-activated protein kinase kinase-3 ( mkk-3 −/− ) or c-Jun-NH 2 -terminal kinase-1 ( jnk1 −/− ) were ventilated, and lung injury parameters were assessed. (plos.org)
  • Experiments in transgenic mice have demonstrated the importance of these proteins in maintaining insulin sensitivity. (diabetesjournals.org)
  • mice lacking G-protein-coupled receptor kinase 3 also failed to increase p-p38-IR after KOR activation in vivo , failed to show swim stress-induced immobility, or develop conditioned place aversion to U50488. (jneurosci.org)
  • Although in vivo adiponectin overexpression reduced MKP1 protein levels, the stimulative effects of adiponectin on mitochondrial biogenesis vanished in skeletal muscle of PGC-1α knockout mice. (diabetesjournals.org)
  • We validated the observation that RAS signaling, via mitogen-activated protein kinase, contributes to formation of liver tumors in mice. (mit.edu)
  • Less en face lesion was observed in 8-month-old MKP-1 -/- mice. (scialert.net)
  • Inhibition of MAP kinase kinase (MEK) during this sustained αvβ3-dependent ERK signal blocked the formation of new blood vessels while not influencing preexisting blood vessels on the CAM. (rupress.org)
  • In vivo, ERK5 is activated to the same extent by environmental stresses, such as oxidative and osmotic shock, and by growth factors. (atlasgeneticsoncology.org)
  • In fact, recent evidence has implicated various mitogen-activated protein (MAP) kinases (ERK) in cell survival in vivo. (rupress.org)
  • Not unexpectedly, insulin resistance in cells and animals is associated with increased serine kinase activity toward IRS-1 ( 12 ). (diabetesjournals.org)
  • We suggest that this pattern of MKP-1 induction may be a negative feedback mechanism in the control of MAP kinase activity in VSMCs. (ahajournals.org)
  • Ion-exchange chromatography yielded a peak of MAP kinase activity eluting at 0.3 to 0.32 M NaCl. (jimmunol.org)
  • Time-course analyses and subsequent ion-exchange chromatography demonstrated SLF activation of MAP kinase activity was maximal after 2 min of factor treatment and decreased to basal levels after 30 min stimulation. (jimmunol.org)
  • Investigation of the role of protein kinase C in the mechanism of activation by these growth factors demonstrated that specific inhibition of protein kinase C led to a reduction, but not ablation, of the SLF and IL-3 induced stimulation of MAP kinase activity. (jimmunol.org)
  • Upon initiation of angiogenesis with basic fibroblast growth factor (bFGF) on the chick chorioallantoic membrane (CAM), endothelial cell mitogen-activated protein (MAP) kinase (ERK) activity was detected as early as 5 min yet was sustained for at least 20 h. (rupress.org)
  • Specifically, we investigated the ability of integrin αvβ3 and bFGF to influence MAP kinase activity in angiogenic blood vessels within the chick chorioallantoic membrane (CAM). (rupress.org)
  • However, the precise mechanism for the termination of MEKK3 kinase activity is not fully understood. (sigmaaldrich.com)
  • Quinidine and imipramine attenuated the development of hypertension and normalized MAP kinase activity. (portlandpress.com)
  • These NF1 cells also demonstrated increased constitutive activity of the extracellular signal-regulated kinases 1 and 2 (ERK1,2) mitogen-activated protein (MAP) kinases compared with a sporadic malignant schwannoma cell line that maintains neurofibromin expression (STS-26T). (aspetjournals.org)
  • A family of serine/threonine protein kinases, known as the mitogen-activated protein (MAP) kinases, is involved in extracellular signal perception during growth and differentiation processes in eukaryotic organisms. (genetics.org)
  • Multiple hemopoietic growth factors stimulate activation of mitogen-activated protein kinase family members. (jimmunol.org)
  • The protein encoded by MAPK1/3 is a member of the MAP kinase family. (antibodies-online.com)
  • Ahlfors R, Macioszek V, Rudd J, Brosche M, Schlichting R, Scheel D, Kangasjarvi J (2004) Stress hormone-independent activation and nuclear translocation of mitogen-activated protein kinases in Arabidopsis thaliana during ozone exposure. (springer.com)
  • Here, we investigate the translocation and activation of MAP kinase during ischaemia and reperfusion in perfused rat heart. (portlandpress.com)
  • p38gamma (MAPK12) is a Serine/Threonine protein kinase of 367 amino acids with a predicted molecular mass of 42 kDa. (atlasgeneticsoncology.org)
  • Human ERK5 (MAPK7) is a Ser/Thr protein kinase of 816 amino-acids with a predicted mass of 98 kDa. (atlasgeneticsoncology.org)