AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and ProcessesDisciplines and OccupationsAnthropology, Education, Sociology and Social PhenomenaInformation ScienceHealth Care
Macaca mulattaMonkey DiseasesMacacaMacaca fascicularisMacaca nemestrinaMacaca radiataHaplorhiniPrimate DiseasesAnimals, LaboratoryPlasmodium cynomolgiSperm AgglutinationRetroviruses, SimianSocial DominanceEuthanasia, AnimalHousing, AnimalSpecies SpecificitySimian Acquired Immunodeficiency SyndromeCebusPan troglodytesSimian immunodeficiency virusDiscrimination LearningPitheciidaeBehavior, AnimalAtelinaeSexual MaturationOesophagostomumClorazepate DipotassiumOsteochondromatosisPapioThermometryPrimatesTupaiaCallositiesHerpesvirus 1, CercopithecineTestisSaimiriMicrosporidaConcept FormationGroomingAgingModels, AnimalPhotic StimulationKisspeptinsVaricellovirusDisease Models, AnimalVasectomyPlasmodiumLuteinizing HormoneCallithrixPaternityStereotyped BehaviorBiometrySpermatogoniaPregnancyMolecular Sequence DataSocial BehaviorTestosteroneGonadotropin-Releasing HormoneFatal OutcomeImmunohistochemistryEpididymisAssociation LearningReaction TimeDiscrimination (Psychology)Time FactorsHydroxyindoleacetic AcidOrchiectomyMenstrual CycleChoice BehaviorSeminiferous TubulesAnimals, NewbornHydrocortisonePattern Recognition, VisualVisual CortexAggressionCryoprotective AgentsNeuronsPhylogeny
Macaca mulatta
A species of the genus MACACA inhabiting India, China, and other parts of Asia. The species is used extensively in biomedical research and adapts very well to living with humans.
Monkey Diseases
Diseases of Old World and New World monkeys. This term includes diseases of baboons but not of chimpanzees or gorillas (= APE DISEASES).
Macaca
A genus of the subfamily CERCOPITHECINAE, family CERCOPITHECIDAE, consisting of 16 species inhabiting forests of Africa, Asia, and the islands of Borneo, Philippines, and Celebes.
Macaca fascicularis
A species of the genus MACACA which typically lives near the coast in tidal creeks and mangrove swamps primarily on the islands of the Malay peninsula.
Macaca nemestrina
A species of the genus MACACA which inhabits Malaya, Sumatra, and Borneo. It is one of the most arboreal species of Macaca. The tail is short and untwisted.
Macaca radiata
A species of macaque monkey that mainly inhabits the forest of southern India. They are also called bonnet macaques or bonnet monkeys.
Haplorhini
A suborder of PRIMATES consisting of six families: CEBIDAE (some New World monkeys), ATELIDAE (some New World monkeys), CERCOPITHECIDAE (Old World monkeys), HYLOBATIDAE (gibbons and siamangs), CALLITRICHINAE (marmosets and tamarins), and HOMINIDAE (humans and great apes).
Primate Diseases
Diseases of animals within the order PRIMATES. This term includes diseases of Haplorhini and Strepsirhini.
Animals, Laboratory
Plasmodium cynomolgi
A protozoan parasite that occurs naturally in the macaque. It is similar to PLASMODIUM VIVAX and produces a type of malaria similar to vivax malaria (MALARIA, VIVAX). This species has been found to give rise to both natural and experimental human infections.
Sperm Agglutination
Agglutination of spermatozoa by antibodies or autoantibodies.
Retroviruses, Simian
Classes of retroviruses for which monkeys or apes are hosts. Those isolated from the West African green monkey and the Asian rhesus macaque monkey are of particular interest because of their similarities to viruses causing cancer and acquired immunodeficiency syndrome (AIDS) in humans.
Social Dominance
Social structure of a group as it relates to the relative social rank of dominance status of its members. (APA, Thesaurus of Psychological Index Terms, 8th ed.)
Euthanasia, Animal
The killing of animals for reasons of mercy, to control disease transmission or maintain the health of animal populations, or for experimental purposes (ANIMAL EXPERIMENTATION).
Housing, Animal
Species Specificity
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Simian Acquired Immunodeficiency Syndrome
Acquired defect of cellular immunity that occurs naturally in macaques infected with SRV serotypes, experimentally in monkeys inoculated with SRV or MASON-PFIZER MONKEY VIRUS; (MPMV), or in monkeys infected with SIMIAN IMMUNODEFICIENCY VIRUS.
Cebus
A genus of the family CEBIDAE, subfamily CEBINAE, consisting of four species which are divided into two groups, the tufted and untufted. C. apella has tufts of hair over the eyes and sides of the head. The remaining species are without tufts - C. capucinus, C. nigrivultatus, and C. albifrons. Cebus inhabits the forests of Central and South America.
Pan troglodytes
The common chimpanzee, a species of the genus Pan, family HOMINIDAE. It lives in Africa, primarily in the tropical rainforests. There are a number of recognized subspecies.
Simian immunodeficiency virus
Species of the genus LENTIVIRUS, subgenus primate immunodeficiency viruses (IMMUNODEFICIENCY VIRUSES, PRIMATE), that induces acquired immunodeficiency syndrome in monkeys and apes (SAIDS). The genetic organization of SIV is virtually identical to HIV.
Discrimination Learning
Learning that is manifested in the ability to respond differentially to various stimuli.
Pitheciidae
A family of New World monkeys in the infraorder PLATYRRHINI consisting of two subfamilies: Callicebinae and Pitheciinae.
Behavior, Animal
The observable response an animal makes to any situation.
Atelinae
A subfamily in the family ATELIDAE, comprising three genera: woolly monkeys (Lagothrix), spider monkeys (Ateles), and woolly spider monkeys (Brachyteles).
Sexual Maturation
Achievement of full sexual capacity in animals and in humans.
Oesophagostomum
A genus of nematodes of the superfamily STRONGYLOIDEA, parasitic in the intestines of animals. The adults are usually free in the intestinal lumen; the larvae encyst in the wall.
Clorazepate Dipotassium
A water-soluble benzodiazepine derivative effective in the treatment of anxiety. It has also muscle relaxant and anticonvulsant actions.
Osteochondromatosis
A condition marked by the presence of multiple osteochondromas. (Dorland, 27th ed)
Papio
A genus of the subfamily CERCOPITHECINAE, family CERCOPITHECIDAE, consisting of five named species: PAPIO URSINUS (chacma baboon), PAPIO CYNOCEPHALUS (yellow baboon), PAPIO PAPIO (western baboon), PAPIO ANUBIS (or olive baboon), and PAPIO HAMADRYAS (hamadryas baboon). Members of the Papio genus inhabit open woodland, savannahs, grassland, and rocky hill country. Some authors consider MANDRILLUS a subgenus of Papio.
Thermometry
Measurement of the temperature of a material, or of the body or an organ by various temperature sensing devices which measure changes in properties of the material that vary with temperature, such as ELASTICITY; MAGNETIC FIELDS; or LUMINESCENCE.
Primates
Tupaia
A genus of tree shrews of the family TUPAIIDAE which consists of about 12 species. One of the most frequently encountered species is T. glis. Members of this genus inhabit rain forests and secondary growth areas in southeast Asia.
Callosities
Localized hyperplasia of the horny layer of the epidermis due to pressure or friction. (Dorland, 27th ed)
Herpesvirus 1, Cercopithecine
A species of SIMPLEXVIRUS that causes vesicular lesions of the mouth in monkeys. When the virus is transmitted to man it causes an acute encephalitis or encephalomyelitis, which is nearly always fatal.
Testis
The male gonad containing two functional parts: the SEMINIFEROUS TUBULES for the production and transport of male germ cells (SPERMATOGENESIS) and the interstitial compartment containing LEYDIG CELLS that produce ANDROGENS.
Saimiri
A genus of the family CEBIDAE consisting of four species: S. boliviensis, S. orstedii (red-backed squirrel monkey), S. sciureus (common squirrel monkey), and S. ustus. They inhabit tropical rain forests in Central and South America. S. sciureus is used extensively in research studies.
Microsporida
An order of parasitic FUNGI found mostly in ARTHROPODS; FISHES; and in some VERTEBRATES including humans. It comprises two suborders: Pansporoblastina and APANSPOROBLASTINA.
Concept Formation
A cognitive process involving the formation of ideas generalized from the knowledge of qualities, aspects, and relations of objects.
Grooming
An animal's cleaning and caring for the body surface. This includes preening, the cleaning and oiling of feathers with the bill or of hair with the tongue.
Aging
The gradual irreversible changes in structure and function of an organism that occur as a result of the passage of time.
Models, Animal
Non-human animals, selected because of specific characteristics, for use in experimental research, teaching, or testing.
Photic Stimulation
Investigative technique commonly used during ELECTROENCEPHALOGRAPHY in which a series of bright light flashes or visual patterns are used to elicit brain activity.
Kisspeptins
Intercellular signaling peptides that were originally characterized by their ability to suppress NEOPLASM METASTASIS. Kisspeptins have since been found to play an important role in the neuroendocrine regulation of REPRODUCTION.
Varicellovirus
A genus of the family HERPESVIRIDAE, subfamily ALPHAHERPESVIRINAE. Its species include those causing CHICKENPOX and HERPES ZOSTER in humans (HERPESVIRUS 3, HUMAN), as well as several animal viruses.
Disease Models, Animal
Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.
Vasectomy
Surgical removal of the ductus deferens, or a portion of it. It is done in association with prostatectomy, or to induce infertility. (Dorland, 28th ed)
Plasmodium
A genus of protozoa that comprise the malaria parasites of mammals. Four species infect humans (although occasional infections with primate malarias may occur). These are PLASMODIUM FALCIPARUM; PLASMODIUM MALARIAE; PLASMODIUM OVALE, and PLASMODIUM VIVAX. Species causing infection in vertebrates other than man include: PLASMODIUM BERGHEI; PLASMODIUM CHABAUDI; P. vinckei, and PLASMODIUM YOELII in rodents; P. brasilianum, PLASMODIUM CYNOMOLGI; and PLASMODIUM KNOWLESI in monkeys; and PLASMODIUM GALLINACEUM in chickens.
Luteinizing Hormone
A major gonadotropin secreted by the adenohypophysis (PITUITARY GLAND, ANTERIOR). Luteinizing hormone regulates steroid production by the interstitial cells of the TESTIS and the OVARY. The preovulatory LUTEINIZING HORMONE surge in females induces OVULATION, and subsequent LUTEINIZATION of the follicle. LUTEINIZING HORMONE consists of two noncovalently linked subunits, alpha and beta. Within a species, the alpha subunit is common in the three pituitary glycoprotein hormones (TSH, LH and FSH), but the beta subunit is unique and confers its biological specificity.
Callithrix
A genus of the subfamily CALLITRICHINAE occurring in forests of Brazil and Bolivia and containing seventeen species.
Paternity
Establishing the father relationship of a man and a child.
Stereotyped Behavior
Relatively invariant mode of behavior elicited or determined by a particular situation; may be verbal, postural, or expressive.
Biometry
The use of statistical and mathematical methods to analyze biological observations and phenomena.
Spermatogonia
Euploid male germ cells of an early stage of SPERMATOGENESIS, derived from prespermatogonia. With the onset of puberty, spermatogonia at the basement membrane of the seminiferous tubule proliferate by mitotic then meiotic divisions and give rise to the haploid SPERMATOCYTES.
Pregnancy
The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.
Molecular Sequence Data
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Social Behavior
Any behavior caused by or affecting another individual, usually of the same species.
Testosterone
A potent androgenic steroid and major product secreted by the LEYDIG CELLS of the TESTIS. Its production is stimulated by LUTEINIZING HORMONE from the PITUITARY GLAND. In turn, testosterone exerts feedback control of the pituitary LH and FSH secretion. Depending on the tissues, testosterone can be further converted to DIHYDROTESTOSTERONE or ESTRADIOL.
Gonadotropin-Releasing Hormone
A decapeptide that stimulates the synthesis and secretion of both pituitary gonadotropins, LUTEINIZING HORMONE and FOLLICLE STIMULATING HORMONE. GnRH is produced by neurons in the septum PREOPTIC AREA of the HYPOTHALAMUS and released into the pituitary portal blood, leading to stimulation of GONADOTROPHS in the ANTERIOR PITUITARY GLAND.
Fatal Outcome
Death resulting from the presence of a disease in an individual, as shown by a single case report or a limited number of patients. This should be differentiated from DEATH, the physiological cessation of life and from MORTALITY, an epidemiological or statistical concept.
Immunohistochemistry
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
Epididymis
The convoluted cordlike structure attached to the posterior of the TESTIS. Epididymis consists of the head (caput), the body (corpus), and the tail (cauda). A network of ducts leaving the testis joins into a common epididymal tubule proper which provides the transport, storage, and maturation of SPERMATOZOA.
Association Learning
The principle that items experienced together enter into a connection, so that one tends to reinstate the other.
Reaction Time
The time from the onset of a stimulus until a response is observed.
Discrimination (Psychology)
Differential response to different stimuli.
Time Factors
Elements of limited time intervals, contributing to particular results or situations.
Hydroxyindoleacetic Acid
Orchiectomy
The surgical removal of one or both testicles.
Menstrual Cycle
The period from onset of one menstrual bleeding (MENSTRUATION) to the next in an ovulating woman or female primate. The menstrual cycle is regulated by endocrine interactions of the HYPOTHALAMUS; the PITUITARY GLAND; the ovaries; and the genital tract. The menstrual cycle is divided by OVULATION into two phases. Based on the endocrine status of the OVARY, there is a FOLLICULAR PHASE and a LUTEAL PHASE. Based on the response in the ENDOMETRIUM, the menstrual cycle is divided into a proliferative and a secretory phase.
Choice Behavior
The act of making a selection among two or more alternatives, usually after a period of deliberation.
Seminiferous Tubules
The convoluted tubules in the TESTIS where sperm are produced (SPERMATOGENESIS) and conveyed to the RETE TESTIS. Spermatogenic tubules are composed of developing germ cells and the supporting SERTOLI CELLS.
Animals, Newborn
Refers to animals in the period of time just after birth.
Hydrocortisone
The main glucocorticoid secreted by the ADRENAL CORTEX. Its synthetic counterpart is used, either as an injection or topically, in the treatment of inflammation, allergy, collagen diseases, asthma, adrenocortical deficiency, shock, and some neoplastic conditions.
Pattern Recognition, Visual
Mental process to visually perceive a critical number of facts (the pattern), such as characters, shapes, displays, or designs.
Visual Cortex
Area of the OCCIPITAL LOBE concerned with the processing of visual information relayed via VISUAL PATHWAYS.
Aggression
Behavior which may be manifested by destructive and attacking action which is verbal or physical, by covert attitudes of hostility or by obstructionism.
Cryoprotective Agents
Substances that provide protection against the harmful effects of freezing temperatures.
Neurons
The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.
Phylogeny
The relationships of groups of organisms as reflected by their genetic makeup.

Cerebellar Purkinje cell simple spike discharge encodes movement velocity in primates during visuomotor arm tracking. (1/10531)

Pathophysiological, lesion, and electrophysiological studies suggest that the cerebellar cortex is important for controlling the direction and speed of movement. The relationship of cerebellar Purkinje cell discharge to the control of arm movement parameters, however, remains unclear. The goal of this study was to examine how movement direction and speed and their interaction-velocity-modulate Purkinje cell simple spike discharge in an arm movement task in which direction and speed were independently controlled. The simple spike discharge of 154 Purkinje cells was recorded in two monkeys during the performance of two visuomotor tasks that required the animals to track targets that moved in one of eight directions and at one of four speeds. Single-parameter regression analyses revealed that a large proportion of cells had discharge modulation related to movement direction and speed. Most cells with significant directional tuning, however, were modulated at one speed, and most cells with speed-related discharge were modulated along one direction; this suggested that the patterns of simple spike discharge were not adequately described by single-parameter models. Therefore, a regression surface was fitted to the data, which showed that the discharge could be tuned to specific direction-speed combinations (preferred velocities). The overall variability in simple spike discharge was well described by the surface model, and the velocities corresponding to maximal and minimal discharge rates were distributed uniformly throughout the workspace. Simple spike discharge therefore appears to integrate information about both the direction and speed of arm movements, thereby encoding movement velocity.  (+info)

Onset of nucleolar and extranucleolar transcription and expression of fibrillarin in macaque embryos developing in vitro. (2/10531)

Specific aims were to characterize the onset of nucleolar and extranucleolar transcription and expression of the nucleolar protein fibrillarin during preimplantation development in vitro in macaque embryos using autoradiographic and immunocytochemical techniques. Autoradiography was performed on whole embryos cultured with [3H]uridine for assessment of nucleolar (rRNA) and extranucleolar (mRNA) transcription. Expression of fibrillarin was immunocytochemically assessed in whole embryos using a primary antibody against fibrillarin and a fluorescein isothiocyanate-conjugated secondary antibody. Extranucleolar incorporation of [3H]uridine was first detected in 2-cell embryos cultured 6-10 h with [3H]uridine. Culture with alpha-amanitin prevented incorporation of label in 2-cell embryos, and treatment with ribonuclease reduced the signal to background levels, indicating that [3H]uridine was incorporated into mRNA and not rRNA or DNA. Nucleolar incorporation of [3H]uridine was not evident in pronucleate-stage or 2- to 5-cell embryos, but it was detected in one 6-cell embryo and in all 8-cell to blastocyst-stage embryos. Fibrillarin was first expressed in some 6- to 7-cell embryos, but it was consistently expressed in all 8-cell embryos. Fibrillarin was localized to the perimeter of the nucleolar precursor bodies, forming a ring that completely encapsulated these structures. Fibrillarin was not expressed in 8- to 16-cell embryos cultured with alpha-amanitin, indicating that it is transcribed, rather than recruited, at the 8-cell stage. In conclusion, in in vitro-fertilized macaque embryos developing in vitro, extranucleolar synthesis of mRNA is initiated at the 2-cell stage while the onset of nucleolar transcription occurs at the 6- to 8-cell stage, coincident with expression of fibrillarin.  (+info)

Association of simian virus 40 with a central nervous system lesion distinct from progressive multifocal leukoencephalopathy in macaques with AIDS. (3/10531)

The primate polyomavirus SV40 is known to cause interstitial nephritis in primary infections and progressive multifocal leukoencephalopathy (PML) upon reactivation of a latent infection in SIV-infected macaques. We now describe a second central nervous system manifestation of SV40: a meningoencephalitis affecting cerebral gray matter, without demyelination, distinct from PML. Meningoencephalitis appears also to be a primary manifestation of SV40 infection and can be seen in conjunction with SV40-induced interstitial nephritis and pneumonitis. The difference in the lesions of meningoencephalitis and PML does not appear to be due to cellular tropism, as both oligodendrocytes and astrocytes are infected in PML and meningoencephalitis, as determined by in situ hybridization or immunohistochemistry for SV40 coupled with immunohistochemistry for cellular determinants. This is further supported by examination of SV40 nucleic acid sequences from the ori-enhancer and large-T-antigen regions, which reveals no tissue-or lesion-specific variation in SV40 sequences.  (+info)

Loss of D2 receptor binding with age in rhesus monkeys: importance of correction for differences in striatal size. (4/10531)

The relation between striatal dopamine D2 receptor binding and aging was investigated in rhesus monkeys with PET. Monkeys (n = 18, 39 to 360 months of age) were scanned with 11C-raclopride; binding potential in the striatum was estimated graphically. Because our magnetic resonance imaging analysis revealed a concomitant relation between size of striatum and age, the dynamic positron emission tomography (PET) data were corrected for possible partial volume (PV) artifacts before parameter estimation. The age-related decline in binding potential was 1% per year and was smaller than the apparent effect if the age-related change in size was ignored. This is the first in vivo demonstration of a decline in dopamine receptor binding in nonhuman primates. The rate of decline in binding potential is consistent with in vitro findings in monkeys but smaller than what has been measured previously in humans using PET. Previous PET studies in humans, however, have not corrected for PV error, although a decline in striatal size with age has been demonstrated. The results of this study suggest that PV correction must be applied to PET data to accurately detect small changes in receptor binding that may occur in parallel with structural changes in the brain.  (+info)

MST neuronal responses to heading direction during pursuit eye movements. (5/10531)

As you move through the environment, you see a radial pattern of visual motion with a focus of expansion (FOE) that indicates your heading direction. When self-movement is combined with smooth pursuit eye movements, the turning of the eye distorts the retinal image of the FOE but somehow you still can perceive heading. We studied neurons in the medial superior temporal area (MST) of monkey visual cortex, recording responses to FOE stimuli presented during fixation and smooth pursuit eye movements. Almost all neurons showed significant changes in their FOE selective responses during pursuit eye movements. However, the vector average of all the neuronal responses indicated the direction of the FOE during both fixation and pursuit. Furthermore, the amplitude of the net vector increased with increasing FOE eccentricity. We conclude that neuronal population encoding in MST might contribute to pursuit-tolerant heading perception.  (+info)

Eye movement deficits following ibotenic acid lesions of the nucleus prepositus hypoglossi in monkeys II. Pursuit, vestibular, and optokinetic responses. (6/10531)

The eyes are moved by a combination of neural commands that code eye velocity and eye position. The eye position signal is supposed to be derived from velocity-coded command signals by mathematical integration via a single oculomotor neural integrator. For horizontal eye movements, the neural integrator is thought to reside in the rostral nucleus prepositus hypoglossi (nph) and project directly to the abducens nuclei. In a previous study, permanent, serial ibotenic acid lesions of the nph in three rhesus macaques compromised the neural integrator for fixation but saccades were not affected. In the present study, to determine further whether the nph is the neural substrate for a single oculomotor neural integrator, the effects of those lesions on smooth pursuit, the vestibulo-ocular reflex (VOR), vestibular nystagmus (VN), and optokinetic nystagmus (OKN) are documented. The lesions were correlated with long-lasting deficits in eye movements, indicated most clearly by the animals' inability to maintain steady gaze in the dark. However, smooth pursuit and sinusoidal VOR in the dark, like the saccades in the previous study, were affected minimally. The gain of horizontal smooth pursuit (eye movement/target movement) decreased slightly (<25%) and phase lead increased slightly for all frequencies (0.3-1.0 Hz, +/-10 degrees target tracking), most noticeably for higher frequencies (0.8-0.7 and approximately 20 degrees for 1.0-Hz tracking). Vertical smooth pursuit was not affected significantly. Surprisingly, horizontal sinusoidal VOR gain and phase also were not affected significantly. Lesions had complex effects on both VN and OKN. The plateau of per- and postrotatory VN was shortened substantially ( approximately 50%), whereas the initial response and the time constant of decay decreased slightly. The initial OKN response also decreased slightly, and the charging phase was prolonged transiently then recovered to below normal levels like the VN time constant. Maximum steady-state, slow eye velocity of OKN decreased progressively by approximately 30% over the course of the lesions. These results support the previous conclusion that the oculomotor neural integrator is not a single neural entity and that the mathematical integrative function for different oculomotor subsystems is most likely distributed among a number of nuclei. They also show that the nph apparently is not involved in integrating smooth pursuit signals and that lesions of the nph can fractionate the VOR and nystagmic responses to adequate stimuli.  (+info)

Frontal cognitive impairments and saccadic deficits in low-dose MPTP-treated monkeys. (7/10531)

There is considerable overlap between the cognitive deficits observed in humans with frontal lobe damage and those described in patients with Parkinson's disease. Similar frontal impairments have been found in the 1-methyl-4-phenyl-1,2,3, 6-tetrahydropyridine (MPTP) primate model of Parkinsonism. Here we provide quantitative documentation of the cognitive, oculomotor, and skeletomotor dysfunctions of monkeys trained on a frontal task and treated with low-doses (LD) of MPTP. Two rhesus monkeys were trained to perform a spatial delayed-response task with frequent alternations between two behavioral modes (GO and NO-GO). After control recordings, the monkeys were treated with one placebo and successive LD MPTP courses. Monkey C developed motor Parkinsonian signs after a fourth course of medium-dose (MD) MPTP and later was treated with combined dopaminergic therapy (CDoT). There were no gross motor changes after the LD MPTP courses, and the average movement time (MT) did not increase. However, reaction time (RT) increased significantly. Both RT and MT were further increased in the symptomatic state, under CDoT. Self-initiated saccades became hypometric after LD MPTP treatments and their frequency decreased. Visually triggered saccades were affected to a lesser extent by the LD MPTP treatments. All saccadic parameters declined further in the symptomatic state and improved partially during CDoT. The number of GO mode (no-response, location, and early release) errors increased after MPTP treatment. The monkeys made more perseverative errors while switching from the GO to the NO-GO mode. Saccadic eye movement patterns suggest that frontal deficits were involved in most observed errors. CDoT had a differential effect on the behavioral errors. It decreased omission errors but did not improve location errors or perseverative errors. Tyrosine hydroxylase immunohistochemistry showed moderate ( approximately 70-80%) reduction in the number of dopaminergic neurons in the substantia nigra pars compacta after MPTP treatment. These results show that cognitive and motor disorders can be dissociated in the LD MPTP model and that cognitive and oculomotor impairments develop before the onset of skeletal motor symptoms. The behavioral and saccadic deficits probably result from the marked reduction of dopaminergic neurons in the midbrain. We suggest that these behavioral changes result from modified neuronal activity in the frontal cortex.  (+info)

Visuomotor processing as reflected in the directional discharge of premotor and primary motor cortex neurons. (8/10531)

Premotor and primary motor cortical neuronal firing was studied in two monkeys during an instructed delay, pursuit tracking task. The task included a premovement "cue period," during which the target was presented at the periphery of the workspace and moved to the center of the workspace along one of eight directions at one of four constant speeds. The "track period" consisted of a visually guided, error-constrained arm movement during which the animal tracked the target as it moved from the central start box along a line to the opposite periphery of the workspace. Behaviorally, the animals tracked the required directions and speeds with highly constrained trajectories. The eye movements consisted of saccades to the target at the onset of the cue period, followed by smooth pursuit intermingled with saccades throughout the cue and track periods. Initially, an analysis of variance (ANOVA) was used to test for direction and period effects in the firing. Subsequently, a linear regression analysis was used to fit the average firing from the cue and track periods to a cosine model. Directional tuning as determined by a significant fit to the cosine model was a prominent feature of the discharge during both the cue and track periods. However, the directional tuning of the firing of a single cell was not always constant across the cue and track periods. Approximately one-half of the neurons had differences in their preferred directions (PDs) of >45 degrees between cue and track periods. The PD in the cue or track period was not dependent on the target speed. A second linear regression analysis based on calculation of the preferred direction in 20-ms bins (i.e., the PD trajectory) was used to examine on a finer time scale the temporal evolution of this change in directional tuning. The PD trajectories in the cue period were not straight but instead rotated over the workspace to align with the track period PD. Both clockwise and counterclockwise rotations occurred. The PD trajectories were relatively straight during most of the track period. The rotation and eventual convergence of the PD trajectories in the cue period to the preferred direction of the track period may reflect the transformation of visual information into motor commands. The widely dispersed PD trajectories in the cue period would allow targets to be detected over a wide spatial aperture. The convergence of the PD trajectories occurring at the cue-track transition may serve as a "Go" signal to move that was not explicitly supplied by the paradigm. Furthermore, the rotation and convergence of the PD trajectories may provide a mechanism for nonstandard mapping. Standard mapping refers to a sensorimotor transformation in which the stimulus is the object of the reach. Nonstandard mapping is the mapping of an arbitrary stimulus into an arbitrary movement. The shifts in the PD may allow relevant visual information from any direction to be transformed into an appropriate movement direction, providing a neural substrate for nonstandard stimulus-response mappings.  (+info)

A computational resource for the prediction of peptide binding to Indian rhesus macaque MHC class I molecules<...A computational resource for the prediction of peptide binding to Indian rhesus macaque MHC class I molecules<...
TY - JOUR. T1 - A computational resource for the prediction of peptide binding to Indian rhesus macaque MHC class I molecules. AU - Peters, B.. AU - Bui, H. H.. AU - Sidney, J.. AU - Weng, Z.. AU - Loffredo, J. T.. AU - Watkins, D. I.. AU - Mothé, B. R.. AU - Sette, A.. PY - 2005/11/1. Y1 - 2005/11/1. N2 - Non-human primates, in general, and Indian rhesus macaques, specifically, play an important role in the development and testing of vaccines and diagnostics destined for human use. To date, several frequently expressed macaque MHC molecules have been identified and their binding specificities characterized in detail. Here, we report the development of computational algorithms to predict peptide binding and potential T cell epitopes for the common MHC class I alleles Mamu-A*01, -A*02, -A*11, -B*01 and -B*17, which cover approximately two thirds of the captive Indian rhesus macaque populations. We validated this method utilizing an SIV derived data set encompassing 59 antigenic peptides. Of all ...
https://miami.pure.elsevier.com/en/publications/a-computational-resource-for-the-prediction-of-peptide-binding-to
Evaluation of a DNA Aβ42 vaccine in adult rhesus monkeys (Macaca mulatta): Antibody kinetics and immune profile after...Evaluation of a DNA Aβ42 vaccine in adult rhesus monkeys (Macaca mulatta): Antibody kinetics and immune profile after...
TY - JOUR. T1 - Evaluation of a DNA Aβ42 vaccine in adult rhesus monkeys (Macaca mulatta). T2 - Antibody kinetics and immune profile after intradermal immunization with full-length DNA Aβ42 trimer. AU - Lambracht-Washington, Doris. AU - Fu, Min. AU - Frost, Pat. AU - Rosenberg, Roger N.. N1 - Funding Information: This study was supported by National Institute on Aging grant P30 AG12300-21 from the National Institutes of Health; the Zale Foundation; the Rudman Foundation; the McCune Foundation; the Alliance of Women for Alzheimer Research and Education (AWARE); Presbyterian Village North; and Freiberger, Losinger, and Denker Family Funds.. PY - 2017/4/26. Y1 - 2017/4/26. N2 - Background: Aggregated amyloid-β peptide 1-42 (Aβ42), derived from the cellular amyloid precursor protein, is one of the pathological hallmarks of Alzheimers disease (AD). Although active immunization against Aβ42 peptide was successful in AD mouse models and led to removal of plaques and improved memory, a similar ...
https://utsouthwestern.pure.elsevier.com/en/publications/evaluation-of-a-dna-a%CE%B242-vaccine-in-adult-rhesus-monkeys-macaca-m
Genome sequencing and comparison of two nonhuman primate animal models, the cynomolgus and Chinese rhesus macaques [Letter] ...Genome sequencing and comparison of two nonhuman primate animal models, the cynomolgus and Chinese rhesus macaques [Letter] ...
The nonhuman primates most commonly used in medical research are from the genus Macaca1. To better understand the genetic differences between these animal models, we present high-quality draft genome sequences from two macaque species, the cynomolgus/crab-eating macaque and the Chinese rhesus macaque. Comparison with the previously sequenced Indian rhesus macaque reveals that all three macaques maintain abundant genetic heterogeneity, including millions of single-nucleotide substitutions and many insertions, deletions and gross chromosomal rearrangements. By assessing genetic regions with reduced variability, we identify genes in each macaque species that may have experienced positive selection. Genetic divergence patterns suggest that the cynomolgus macaque genome has been shaped by introgression after hybridization with the Chinese rhesus macaque. Macaque genes display a high degree of sequence similarity with human disease gene orthologs and drug targets. However, we identify several ...
http://orca-mwe.cf.ac.uk/29830/
Paternal kinship among adult female rhesus macaques (Macaca mulatta)Paternal kinship among adult female rhesus macaques (Macaca mulatta)
The impact of maternal kinship on social behaviour has been studied in detail for many primate species, but it is difficult to assess the importance of kin selection in shaping the evolution of social behaviour when studies are limited to maternal kin, completely ignoring paternal kinship. This thesis aimed to investigate the extent of paternal kinship and its impact on the social relationships among adult females in one group of free-ranging rhesus macaques (Macaca mulatta) living on the island of Cayo Santiago. The main findings can be summarised as follows: Firstly, in order to access the extent of paternal kinship, paternity has been analysed for all infants of the study group born between 1993 and 1998. Results revealed that male reproduction was highly skewed over the study period as few males have sired a high number of offspring, but the majority of potential sires have sired no or few offspring. This created a kinship structure in which nearly all animals born during the study period ...
https://edoc.hu-berlin.de/handle/18452/15482?C=M
Aikeqing decreases viral loads in SHIV89.6-infected Chinese rhesus macaques | Chinese Medicine | Full TextAikeqing decreases viral loads in SHIV89.6-infected Chinese rhesus macaques | Chinese Medicine | Full Text
Aikeqing (AKQ) has been shown in clinical studies to improve quality of life of HIV/AIDS patients, but anti-HIV activity has not been determined. The SHIV-infected macaque is an important animal model for testing antiviral drugs. This study aimed to determine the anti-HIV activity of AKQ in chronically SHIV89.6-infected Chinese rhesus macaques. Nine Chinese rhesus macaques were inoculated intravenously with SHIV89.6 virus. At 11 weeks post-infection, the animals were arbitrarily divided into three groups: high-dose (AKQ 1.65 g/kg; n = 3), low-dose (AKQ 0.55 g/kg; n = 3), and control (water 1 mL/kg; n = 3). Treatment was administered by the intragastric gavage route once-daily for 8 weeks. Blood (5 mL) was collected biweekly. Viral loads were analyzed by real-time quantitative RT-PCR assays, and T cell counts were monitored by FACS analyses throughout the treatment. AKQ induced a persistent decline (P = 0.02) in plasma viral loads during treatment in the high-dose group
https://cmjournal.biomedcentral.com/articles/10.1186/s13020-016-0105-x
Primate Factsheets: Rhesus macaque (Macaca mulatta) ReferencesPrimate Factsheets: Rhesus macaque (Macaca mulatta) References
Borries C, Larney E, Kreetiyutanont K, Koenig A. 2002. The diurnal primate community in a dry evergreen forest in Phu Khieo Wildlife Sanctuary, northeast Thailand . Nat Hist Bull Siam Soc 50(1): 75-88. Catchpole HR, van Wagenen G. 1975. Reproduction in the rhesus monkey, Macaca mulatta. In: Bourne GH, editor. The rhesus monkey: management reproduction, and pathology, Volume 2. New York : Academic Pr. 117-40.. Chapais B. 1986. Why do adult male and female rhesus monkeys affiliate during the birth season? In: Rawlins RG, Kessler MJ, editors. The Cayo Santiago macaques: history, behavior, and biology. Albany (NY): State Univ New York Pr. p 173-200. Deutsch JC, Lee PC. 1991. Dominance and feeding competition in captive rhesus monkeys. Int J Primatol 12(6): 615-28.. Dixson AF, Nevison CM. 1997. The socioendocrinology of adolescent development in male rhesus monkeys ( Macaca mulatta ). Horm Behav 31(2): 126-35).. Fan Z, Song Y. 2003. Chinese primate status and primate captive breeding for biomedical ...
http://pin.primate.wisc.edu/factsheets/entry/rhesus_macaque/ref
Volumetric correlates of spatiotemporal working and recognition memory impairment in aged rhesus monkeys<...Volumetric correlates of spatiotemporal working and recognition memory impairment in aged rhesus monkeys<...
TY - JOUR. T1 - Volumetric correlates of spatiotemporal working and recognition memory impairment in aged rhesus monkeys. AU - Shamy, Jul Lea. AU - Habeck, Christian. AU - Hof, Patrick R.. AU - Amaral, David G. AU - Fong, Sania G.. AU - Buonocore, Michael H.. AU - Stern, Yaakov. AU - Barnes, Carol A.. AU - Rapp, Peter R.. PY - 2011/7. Y1 - 2011/7. N2 - Spatiotemporal and recognition memory are affected by aging in humans and macaque monkeys. To investigate whether these deficits are coupled with atrophy of memory-related brain regions, T1-weighted magnetic resonance images were acquired and volumes of the cerebrum, ventricles, prefrontal cortex (PFC), calcarine cortex, hippocampus, and striatum were quantified in young and aged rhesus monkeys. Subjects were tested on a spatiotemporal memory procedure (delayed response [DR]) that requires the integrity of the PFC and a medial temporal lobe-dependent recognition memory task (delayed nonmatching to sample [DNMS]). Region of interest analyses ...
https://ucdavis.pure.elsevier.com/en/publications/volumetric-correlates-of-spatiotemporal-working-and-recognition-m
Effects of Hypotension on Rhesus Monkeys | JAMA Neurology | The JAMA NetworkEffects of Hypotension on Rhesus Monkeys | JAMA Neurology | The JAMA Network
To the Editor.-The article by Gamache and Myers (Arch Neurol 32:374, 1975) describing the effects of hypotension on Rhesus monkeys demands our comment not only
https://jamanetwork.com/journals/jamaneurology/article-abstract/574403?redirect=true
The Rhesus Monkey Brain in Stereotaxic Coordinates by George Paxinos, Xu-Feng Huang et al.The Rhesus Monkey Brain in Stereotaxic Coordinates by George Paxinos, Xu-Feng Huang et al.
From the Back Cover The Rhesus Monkey Brain in Stereotaxic Coordinates is the most comprehensive, detailed atlas of the monkey brain ever constructed. The first chapter, Photographic and Diagrammatic Atlas of the Rhesus Monkey Brain, presents 151 plates illustrating the subcortex and parts of the cortex in high magnification, and 151 corresponding diagrams complementing each image. The second chapter, Delineation of the Rhesus Monkey Cortex on the Basis of the Distribution of a Neurofilament Protein, consists of 64 fully labeled plates depicting an entire hemisphere. Jointly, the two chapters constitute the most serious morphological work ever undertaken on the monkey. Key Features * Provides the first comprehensive delineations of cortical and subcortical structures of any primate species * Depicts the entire brain in 151 photographs paired with 151 detailed diagrams * Alternates sections stained for Nissl substance with sections reacted for acetylcholinesterase (AChE) * Contains 64 fully labeled
http://ro.uow.edu.au/hbspapers/3613/
Sex dimorphisms in the cognitive-enhancing action of the Alzheimers drug donepezil in aged Rhesus monkeys<...Sex dimorphisms in the cognitive-enhancing action of the Alzheimers drug donepezil in aged Rhesus monkeys<...
TY - JOUR. T1 - Sex dimorphisms in the cognitive-enhancing action of the Alzheimers drug donepezil in aged Rhesus monkeys. AU - Buccafusco, J. J.. AU - Jackson, W. J.. AU - Stone, J. D.. AU - Terry, Alvin V. PY - 2003/1/1. Y1 - 2003/1/1. N2 - Brain acetylcholinesterase has been targeted for the development of novel treatments for memory deficits associated with Alzheimers disease (AD) and other neurodegenerative disorders. The long-acting AChE inhibitor donepezil (Aricept™) is used to improve memory and other aspects of cognition in AD patients. Because donepezil and other cholinesterase inhibitors are effective in a restricted population of AD patients, this study was to designed to determine whether aged females monkeys receive the same level of benefit to the mnemonic action of donepezil as do males. In this study, six male and six female rhesus monkeys (,20 years) who were proficient in the performance of a delayed matching-to-sample task each received an ascending series of four doses ...
https://augusta.pure.elsevier.com/en/publications/sex-dimorphisms-in-the-cognitive-enhancing-action-of-the-alzheime
Propofol-Induced Apoptosis of Neurones and Oligodendrocytes in Fetal and Neonatal Rhesus Macaque Brain | SmartTotsPropofol-Induced Apoptosis of Neurones and Oligodendrocytes in Fetal and Neonatal Rhesus Macaque Brain | SmartTots
BACKGROUND: Exposure of the fetal or neonatal non-human primate (NHP) brain to isoflurane or ketamine for 5 h causes widespread apoptotic degeneration of neurones, and exposure to isoflurane also causes apoptotic degeneration of oligodendrocytes (OLs). The present study explored the apoptogenic potential of propofol in the fetal and neonatal NHP brain.. METHOD: Fetal rhesus macaques at gestational age 120 days were exposed in utero, or postnatal day 6 rhesus neonates were exposed directly for 5 h to propofol anaesthesia (n=4 fetuses; and n=4 neonates) or to no anaesthesia (n=4 fetuses; n=5 neonates), and the brains were systematically evaluated 3 h later for evidence of apoptotic degeneration of neurones or glia.. RESULTS: Exposure of fetal or neonatal NHP brain to propofol caused a significant increase in apoptosis of neurones, and of OLs at a stage when OLs were just beginning to myelinate axons. Apoptotic degeneration affected similar brain regions but to a lesser extent than we previously ...
http://smarttots.org/propofol-induced-apoptosis-of-neurones-and-oligodendrocytes-in-fetal-and-neonatal-rhesus-macaque-brain/
Anomaly in aortic arch alters pathological outcome of transient global ischemia in Rhesus macaques<...Anomaly in aortic arch alters pathological outcome of transient global ischemia in Rhesus macaques<...
TY - JOUR. T1 - Anomaly in aortic arch alters pathological outcome of transient global ischemia in Rhesus macaques. AU - Hara, Koichi. AU - Yasuhara, Takao. AU - Maki, Mina. AU - Matsukawa, Noriyuki. AU - Yu, Guolong. AU - Xu, Lin. AU - Tambrallo, Laura. AU - Rodriguez, Nancy A.. AU - Stern, David M.. AU - Yamashima, Tetsumori. AU - Buccafusco, Jerry J.. AU - Kawase, Takeshi. AU - Hess, David C.. AU - Borlongan, Cesario V.. PY - 2009/8/25. Y1 - 2009/8/25. N2 - We investigated a non-human primate (NHP) transient global ischemia (TGI) model which was induced by clipping the arteries originating from the aortic arch. Previously we demonstrated that our TGI model in adult Rhesus macaques (Macaca mulatta) results in marked neuronal cell loss in the hippocampal region, specifically the cornu Ammonis (CA1) region. However, we observed varying degrees of hippocampal cell loss among animals. Here, we report for the first time an anomaly of the aortic arch in some Rhesus macaques that appears as a key ...
https://augusta.pure.elsevier.com/en/publications/anomaly-in-aortic-arch-alters-pathological-outcome-of-transient-g
Multisensory Integration of Dynamic Faces and Voices in Rhesus Monkey Auditory Cortex | Journal of NeuroscienceMultisensory Integration of Dynamic Faces and Voices in Rhesus Monkey Auditory Cortex | Journal of Neuroscience
Subjects and surgery. Two adult male rhesus monkeys (Macaca mulatta) were used in the experiments. For each monkey, we used preoperative whole-head magnetic resonance imaging (4.7 T magnet, 500 μm slices) to identify the stereotaxic coordinates of the auditory cortex and to model a three-dimensional skull reconstruction. From these skull models, we constructed custom-designed, form-fitting titanium head posts and recording chambers (Logothetis et al., 2002). The monkeys underwent sterile surgery for the implantation of a scleral search coil, head post, and recording chamber. The inner diameter of the recording chamber was 19 mm and was vertically oriented to allow an approach to the superior surface of the superior temporal gyrus (Pfingst and OConnor, 1980; Recanzone et al., 2000). All experiments were performed in compliance with the guidelines of the local authorities (Regierungspraesidium, Tuebingen, Germany) and the European Union (European Communities Council Directive 86/609/EEC) for the ...
https://www.jneurosci.org/content/25/20/5004?ijkey=607ca1fc060eda8575a069a2b8ee55ce929bdce7&keytype2=tf_ipsecsha
Fetal and maternal outcome after administration of tenofovir to gravid rhesus monkeys (Macaca mulatta)<...Fetal and maternal outcome after administration of tenofovir to gravid rhesus monkeys (Macaca mulatta)<...
TY - JOUR. T1 - Fetal and maternal outcome after administration of tenofovir to gravid rhesus monkeys (Macaca mulatta). AU - Tarantal, Alice F. AU - Castillo, Alesha. AU - Ekert, Jason E.. AU - Bischofberger, Norbert. AU - Martin, R. Bruce. PY - 2002/3/1. Y1 - 2002/3/1. N2 - Tenofovir has been shown to cross the placenta in quantities sufficient to sustain reductions in viral load in simian immunodeficiency virus (SIV)-infected fetal monkeys. With chronic exposure (30 mg/kg), however, significant bone-related toxicity has been shown in ∼25% of infants studied. Further investigations were conducted to determine whether the bone-related toxicity observed was initiated during fetal life. Gravid rhesus monkeys (n = 4) were administered tenofovir subcutaneously once daily from 20 to 150 days of gestation (30 mg/kg; term: 165 ± 10 days). Fetuses were monitored sonographically, and maternal and fetal blood and urine samples were collected to assess hematologic parameters, clinical chemistry, ...
https://ucdavis.pure.elsevier.com/en/publications/fetal-and-maternal-outcome-after-administration-of-tenofovir-to-g
α-Adrenergic receptor antagonism and N-methyl-D-aspartate (NMDA) induced luteinizing hormone release in female rhesus macaques<...α-Adrenergic receptor antagonism and N-methyl-D-aspartate (NMDA) induced luteinizing hormone release in female rhesus macaques<...
TY - JOUR. T1 - α-Adrenergic receptor antagonism and N-methyl-D-aspartate (NMDA) induced luteinizing hormone release in female rhesus macaques. AU - Urbanski, Henryk F.. AU - Garyfallou, Vasilios T.. AU - Kohama, Steven G.. AU - Hess, David L.. N1 - Funding Information: We wish to thank Sherri Falls, Kevin Grund, Rick Jones, and Ty May for help in caring for the animals, Bill Baughman for surgical assistance, and Evida Katayama for technical assistance with the hormone assays. We are also grateful to Dr. K. Moriyoshi (Kyoto University, Japan) for providing us with the NMDAR1 cDNA clone. Preliminary findings from these studies were reported at the 28th Annual Meeting of the Society for the Study of Reproduction, Davis, CA, 1995 [38] . This research was supported by grants from the National Institutes of Health (HD-29186, HD-24312, HD-18185 and RR-00163). ORPRC publication number 2015. PY - 1997/1/2. Y1 - 1997/1/2. N2 - The stimulatory influence of N-methyl-D-aspartate (NMDA), a glutamate ...
https://ohsu.pure.elsevier.com/en/publications/%CE%B1-adrenergic-receptor-antagonism-and-n-methyl-d-aspartate-nmda-in-2
Primate research animal - Stock Image G352/0185 - Science Photo LibraryPrimate research animal - Stock Image G352/0185 - Science Photo Library
Primate research animal. Head of an adult rhesus monkey (Macaca mulatta). This monkey may be used to study primate behaviour & biology, the development & transmission of human diseases, or to test novel drugs. Photographed at the New England Regional Primate Research Centre, Harvard Medical School, Massachusetts, USA. - Stock Image G352/0185
http://www.sciencephoto.com/media/213677/view
A long-acting integrase inhibitor protects female macaques from repeated high-dose intravaginal SHIV challenge | Science...A long-acting integrase inhibitor protects female macaques from repeated high-dose intravaginal SHIV challenge | Science...
Fig. 2. Monthly injections of GSK744 LA protect rhesus macaques against three intravaginal SHIV challenges.. (A) Study design. Twelve female rhesus macaques were injected intramuscularly with 30 mg of Depo-Provera on weeks −3 and 2. Eight rhesus macaques were injected intramuscularly in the quadriceps with GSK744 LA (50 mg/kg) at two time points, weeks 0 and 4. Four Depo-Provera-treated rhesus macaques served as controls. All animals were challenged intravaginally on week 1 with 300 TCID50 of SHIV162P3. GSK744 LA-treated rhesus macaques were further challenged on weeks 5 and 7. All rhesus macaques were followed for 24 weeks. (B) Kaplan-Meier plot of GSK744 LA-treated and control rhesus macaques remaining aviremic after three intravaginal SHIV challenges. (C) Viral loads of control rhesus macaques (in gray) and GSK744 LA-treated rhesus macaques (in color). Open symbols represent samples sequenced for the integrase-coding region. Dotted line represents the limit of quantitation (LOQ), ,40 SHIV ...
https://stm.sciencemag.org/content/7/270/270ra4/tab-figures-data
Newborn Rhesus Monkey Uterus - How is Newborn Rhesus Monkey Uterus abbreviated?Newborn Rhesus Monkey Uterus - How is Newborn Rhesus Monkey Uterus abbreviated?
NRMU - Newborn Rhesus Monkey Uterus. Looking for abbreviations of NRMU? It is Newborn Rhesus Monkey Uterus. Newborn Rhesus Monkey Uterus listed as NRMU
https://acronyms.thefreedictionary.com/Newborn+Rhesus+Monkey+Uterus
A shared MHC supertype motif emerges by convergent evolution in macaques and mice, but is totally absent in human MHC molecules...A shared MHC supertype motif emerges by convergent evolution in macaques and mice, but is totally absent in human MHC molecules...
The SIV-infected rhesus macaque (Macaca mulatta) is the most established model of AIDS disease systems, providing insight into pathogenesis and a model system for testing novel vaccines. The understanding of cellular immune responses based on the identification and study of Major Histocompatibility Complex (MHC) molecules, including their MHC:peptide-binding motif, provides valuable information to decipher outcomes of infection and vaccine efficacy. Detailed characterization of Mamu-B*039:01, a common allele expressed in Chinese rhesus macaques, revealed a unique MHC:peptide-binding preference consisting of glycine at the second position. Peptides containing a glycine at the second position were shown to be antigenic from animals positive for Mamu-B*039:01. A similar motif was previously described for the Dd mouse MHC allele, but for none of the human HLA molecules for which a motif is known. Further investigation showed that one additional macaque allele, present in Indian rhesus macaques, Mamu-B*052
https://www.semanticscholar.org/paper/A-shared-MHC-supertype-motif-emerges-by-convergent-Sette-Sidney/47a64a44656f41a78eb0423fceb0f9341b2a44d7
9781325152605: Rhesus Monkeys / UK-Version 2017: Part B: The Rhesus Monkey (Macaca Mulatta) is a Primate of the Species of...9781325152605: Rhesus Monkeys / UK-Version 2017: Part B: The Rhesus Monkey (Macaca Mulatta) is a Primate of the Species of...
AbeBooks.com: Rhesus Monkeys / UK-Version 2017: Part B: The Rhesus Monkey (Macaca Mulatta) is a Primate of the Species of Macaques Within the Family Cercopithecidae (Calvendo Animals) (9781325152605) by Angelika Kimmig and a great selection of similar New, Used and Collectible Books available now at great prices.
https://www.abebooks.com/9781325152605/1325152609/plp
Progression to AIDS in the absence of a gene for vpr or vpx. | Journal of VirologyProgression to AIDS in the absence of a gene for vpr or vpx. | Journal of Virology
Rhesus monkeys (Macaca mulatta) were experimentally infected with strains of simian immunodeficiency virus (SIV) derived from SIVmac239 lacking vpr, vpx, or both vpr and vpx genes. These auxiliary genes are not required for virus replication in cultured cells but are consistently conserved within the SIVmac/human immunodeficiency virus type 2/SIVsm group of primate lentiviruses. All four rhesus monkeys infected with the vpr deletion mutant showed an early spike in plasma antigenemia, maintained high virus burdens, exhibited declines in CD4+ lymphocyte concentrations, and had significant changes in lymph node morphology, and two have died to date with AIDS. The behavior of the vpr deletion mutant was indistinguishable from that of the parental, wild-type virus. Rhesus monkeys infected with the vpx deletion mutant showed lower levels of plasma antigenemia, lower virus burdens, and delayed declines in CD4+ lymphocyte concentrations but nonetheless progressed with AIDS to a terminal stage. The ...
https://jvi.asm.org/content/69/4/2378?ijkey=cfddc53c4623036aec352f36f45eabbf8e7ee0ad&keytype2=tf_ipsecsha
Macaca mulatta (Rhesus macaque) NACHT, LRR and PYD domains-containing protein 3 (NLRP3), partial GENTAUR-58bb61f205e2e |...Macaca mulatta (Rhesus macaque) NACHT, LRR and PYD domains-containing protein 3 (NLRP3), partial GENTAUR-58bb61f205e2e |...
Macaca mulatta (Rhesus macaque) NACHT, LRR and PYD domains-containing protein 3 (NLRP3), partial datasheet and description hight quality product and Backed by our Guarantee
https://gentaursearch.com/product/rhesus/1352721/macaca-mulatta-rhesus-macaque-nacht-lrr-and-pyd-domains-containing-protein-3-nlrp3-partial.html
Plus itPlus it
Cannabis-related impairments to cognitive function may represent novel therapeutic targets for cannabis-use disorder, although the nature, persistence, and reversibility of those deficits remain unclear. Adult male rhesus monkeys (N=6) responded in the mornings on tasks designed to assess different cognitive domains using CANTAB touchscreens followed by responding maintained under a fixed-ratio (FR) 10 schedule of food presentation in different operant chambers. First, the acute effects of Δ9-tetrahydrocannabinol (THC; 0.01-0.56 mg/kg, i.v.) on cognitive performance, FR responding and body temperature were determined. Next, THC (1.0-2.0 mg/kg, s.c.) was administered daily after FR10 sessions for 12 weeks during which the residual effects of THC (i.e., 22 hrs after administration) on cognition were examined and the acute effects of THC were redetermined. In a subgroup of monkeys, dopamine D2/D3 receptor availability was assessed after 4 weeks of chronic THC exposure and compared to drug-naive ...
http://jpet.aspetjournals.org/content/early/2017/12/04/jpet.117.244194
Reversible inactivation of pSTS suppresses social gaze following in the macaque (Macaca mulatta)<...Reversible inactivation of pSTS suppresses social gaze following in the macaque (Macaca mulatta)<...
TY - JOUR. T1 - Reversible inactivation of pSTS suppresses social gaze following in the macaque (Macaca mulatta). AU - Roy, Arani. AU - Shepherd, Stephen V.. AU - Platt, Michael L.. PY - 2014/2. Y1 - 2014/2. N2 - Humans and other primates shift their attention to follow the gaze of others [gaze following (GF)]. This behavior is a foundational component of joint attention, which is severely disrupted in neurodevelopmental disorders such as autism and schizophrenia. Both cortical and subcortical pathways have been implicated in GF, but their contributions remain largely untested. While the proposed subcortical pathway hinges crucially on the amygdala, the cortical pathway is thought to require perceptual processing by a region in the posterior superior temporal sulcus (pSTS). To determine whether pSTS is necessary for typical GF behavior, we engaged rhesus macaques in a reward discrimination task confounded by leftward- and rightward-facing social distractors following saline or muscimol ...
https://experts.umn.edu/en/publications/reversible-inactivation-of-psts-suppresses-social-gaze-following-
Showing results for tags Iodine. - CR Society ForumShowing results for tags Iodine. - CR Society Forum
Ever since CR pioneer Roy Walford died of amyotrophic lateral sclerosis (ALS - or something resembling ALS), there has been some concern that CR may not protect against, and may in fact hasten, neurodegenerative diseases, particularly those involving dopaminergic neurons, like ALS, Parkinsons Disease (PD) and Multiple Sclerosis (MS). This new study [1] by Ingram et al posted by James in his latest weekly CR research update (thanks James!), suggests otherwise. It found that adult-onset CR in rats was protective against bradykinesia, a slowness of movement which is a hallmark of Parkinsons disease. They also found elevated levels of dopamine in an important brain region implicated in PD, the substantia nigra. This result supports an earlier, perhaps more germane finding from a study of primates done by Ingrams group in 2004 [2]. In [2], Ingram et al found that 30% CR for six months in adult male rhesus monkeys protected against a drop in dopamine level and dopamine neuron cell death when the ...
https://www.crsociety.org/search/?tags=Iodine&page=1&sortby=relevancy
OpenEmory | Search ResultsOpenEmory | Search Results
Purpose: To translate a recombinant peptide containing the amino-terminal fragment (ATF) of urokinase plasminogen activator receptor-targeted magnetic iron oxide (IO) nanoparticles (uPAR-targeted human ATF-IONPs) into clinical applications, we conducted a pilot study to evaluate the toxicity and pharmacokinetics of this nanoparticle in normal rhesus monkeys. Methods: We assessed the changes in the following: magnetic resonance imaging (MRI) signals from pretreatment stage to 14 days posttreatment, serum iron concentrations from 5 minutes posttreatment to 12 weeks posttreatment, routine blood examination and serum chemistry analysis results from pretreatment stage to 12 weeks after administration, and results of staining of the liver with Perls Prussian Blue and hematoxylin-eosin at 24 hours and 3 months posttreatment in two rhesus monkeys following an intravenous administration of the targeted nanoparticles either with a polyethylene glycol (ATF-PEG-IONP) or without a PEG (ATF-IONP) coating. ...
https://open.library.emory.edu/publications/search/?keywords=a&keywords=pharmaci&keywords=pharmacokinet&keywords=topic&keywords=biomedicin&keywords=nanotechnolog&subject=Health+Sciences%2C+Pharmacology&author=Mao%2C+Hui&author=Wang,%20Yongqiang%20Andrew
OpenEmory | Search ResultsOpenEmory | Search Results
Purpose: To translate a recombinant peptide containing the amino-terminal fragment (ATF) of urokinase plasminogen activator receptor-targeted magnetic iron oxide (IO) nanoparticles (uPAR-targeted human ATF-IONPs) into clinical applications, we conducted a pilot study to evaluate the toxicity and pharmacokinetics of this nanoparticle in normal rhesus monkeys. Methods: We assessed the changes in the following: magnetic resonance imaging (MRI) signals from pretreatment stage to 14 days posttreatment, serum iron concentrations from 5 minutes posttreatment to 12 weeks posttreatment, routine blood examination and serum chemistry analysis results from pretreatment stage to 12 weeks after administration, and results of staining of the liver with Perls Prussian Blue and hematoxylin-eosin at 24 hours and 3 months posttreatment in two rhesus monkeys following an intravenous administration of the targeted nanoparticles either with a polyethylene glycol (ATF-PEG-IONP) or without a PEG (ATF-IONP) coating. ...
https://open.library.emory.edu/publications/search/?keywords=a&subject=Health+Sciences%2C+Pharmacology&author=Gao%2C+Ning&keywords=self
Macaca mulatta Mamu-B 01 antigen Summary Report | CureHunterMacaca mulatta Mamu-B 01 antigen Summary Report | CureHunter
Macaca mulatta Mamu-B 01 antigen: a MHC class I B locus allele-restricted similan immunodeficiency virus envelope CTL epitope in rhesus monkeys; amino acid sequence given in first source
http://www.curehunter.com/public/keywordSummaryC092249-Macaca-mulatta-Mamu-B-01-antigen.do
NewswiseNewswise
Newswise - MADISON, Wis. - University of Wisconsin-Madison researchers studying monkeys have shown that one infection with Zika virus protects against future infection, though pregnancy may drastically prolong the time the virus stays in the body.. The researchers, led by UW-Madison pathology Professor David OConnor, published a study today (June 28, 2016) in the journal Nature Communications describing their work establishing rhesus macaque monkeys at the Wisconsin National Primate Research Center as a model for studying the way Zika virus infections may progress in people.. The team of UW and Duke University scientists - which includes specialists in emergent and insect-borne diseases, genetics and immunology, pediatrics and pregnancy - have been working with infected monkeys for months.. What weve shown in the monkey model matches a lot of what people have observed in epidemiological studies of humans, says Emma Mohr, a pediatric infectious disease fellow at UW-Madison and first author on ...
http://www.newswise.com/articles/view/656056?print-article
Plus itPlus it
Background: Vincristine has been used as standard therapy for adult and pediatric malignancies for 50 years. Cumulative neurotoxicity often requires capping the maximum single and cumulative VCR dose. VSLI is a novel preparation of VCR encapsulated in sphingomyelin/cholesterol liposomes. Following clinical trials that demonstrated safety, tolerability and efficacy in adults with relapsed/refractory acute lymphoblastic leukemia, VSLI has been granted FDA accelerated approval at a dose of 2.25 mg/m2given once weekly for that population. A pediatric Phase I trial is ongoing. We evaluated plasma and CSF PK of intravenously (IV) administered VCR and total VSLI (liposomal encapsulated and non-encapsulated) in our NHP model.. Methods: 0.1 mg/kg (1.2 mg/m2 human-equivalent dose) VCR over 1 minute or VSLI over 15 minutes was administered on separate occasions to each of 3 adult rhesus monkeys (Macaca mulatta). Serial paired plasma and CSF samples were collected for up to 48 hrs. Drug concentrations were ...
http://cancerres.aacrjournals.org/content/73/8_Supplement/3356
Antioxidants | Free Full-Text | The Subcellular Distribution of Alpha-Tocopherol in the Adult Primate Brain and Its...Antioxidants | Free Full-Text | The Subcellular Distribution of Alpha-Tocopherol in the Adult Primate Brain and Its...
The relationship between α-tocopherol, a known antioxidant, and polyunsaturated fatty acid (PUFA) oxidation, has not been directly investigated in the primate brain. This study characterized the membrane distribution of α-tocopherol in brain regions and investigated the association between membrane α-tocopherol and PUFA content, as well as brain PUFA oxidation products. Nuclear, myelin, mitochondrial, and neuronal membranes were isolated using a density gradient from the prefrontal cortex (PFC), cerebellum (CER), striatum (ST), and hippocampus (HC) of adult rhesus monkeys (n = 9), fed a stock diet containing vitamin E (α-, γ-tocopherol intake: ~0.7 µmol/kg body weight/day, ~5 µmol/kg body weight/day, respectively). α-tocopherol, PUFAs, and PUFA oxidation products were measured using high performance liquid chromatography (HPLC), gas chromatography (GC) and liquid chromatography-gas chromatography/mass spectrometry (LC-GC/MS) respectively. α-Tocopherol (ng/mg protein) was highest in nuclear
http://www.mdpi.com/2076-3921/6/4/97
Extremely Promising: HIV Monkey Vaccine Eradicates all Traces of Virus | EURwebExtremely Promising: HIV Monkey Vaccine Eradicates all Traces of Virus | EURweb
British Publication, The Daily Mirror is reporting that a vaccine which could completely clear the body of all traces of the Aids virus has been developed.. Scientists have successfully controlled the disease in monkeys, raising hopes they may finally conquer the human form, the report goes on to say.. This large experimental study was in 67 male rhesus macaque monkeys that were given the monkey form of HIV, called Simian Immunodeficiency Virus (SIV). The vaccine was tested in 24 monkeys, 13 of which showed complete control over the SIV virus. Further analysis showed that 12 of these were still protected after a year. In contrast, macaques that did not get the vaccine continued to show high levels of the virus.. This research has re-ignited debate within the research community that a HIV vaccine for humans may be possible. Experts have called this early research exciting and described it as a breakthrough. The technique will now need to be adapted to see if it can be used in treating ...
http://www.eurweb.com/2011/05/extremely-promising-hiv-monkey-vaccine-eradicates-all-traces-of-virus/
Color-detection thresholds in rhesus macaque monkeys and humans | JOV | ARVO JournalsColor-detection thresholds in rhesus macaque monkeys and humans | JOV | ARVO Journals
The present experiments provide some insight into the time course of perceptual learning for chromatic targets. Access to this information is difficult to obtain from previous comparative experiments, which often used aversive conditioning that over time engenders a long-term avoidance response to the testing situation. The present results show that subjects needed a variable number of sessions to reach plateau performance for different colors, but that the range was the same between monkey and human subjects (one to seven sessions). Monkeys and humans also showed similar variability in the number of sessions necessary to reach plateau performance (SD = 1.9 for monkeys, 1.8 for humans). Once plateau performance was achieved, optimal performance was maintained across long time gaps in task activity (Supplementary Figure S2). The results show a striking asymmetry in the improvement in performance over training for the +S versus −S targets for both humans and monkeys: the learning effect for +S ...
http://jov.arvojournals.org/article.aspx?articleid=2194035
Buy Purified Rhesus Macaque Monkey NK Cells | iQ BiosciencesBuy Purified Rhesus Macaque Monkey NK Cells | iQ Biosciences
Buy highly-enriched (typically | 90%) rhesus monkey NK cells and other high-quality cellular products (for research only) at iQ Biosciences.
https://iqbiosciences.com/product/purified-rhesus-nk-cells/
Anatomy and Physiology: Anatomy and Physiology v. 1 by Geoffrey Bourne - The Smart Womans E-booksAnatomy and Physiology: Anatomy and Physiology v. 1 by Geoffrey Bourne - The Smart Womans E-books
The rhesus monkey (Macaca mulatta) is conventional for biomedical and mental reports. consequently, an incredible fund of clinical details comes in papers and a few gathered facts. This booklet is mostly a suite of knowledge from over 2000 papers on rhesus monkey. It covers subject matters at the cerebral angiography, electrocardiogram, and vector cardiogram of the rhesus monkey. It additionally offers more information on morphology and serve as of rhesus kidney; the improvement and eruption of tooth in rhesus; and the histology and histochemistry of the rhesus monkey ...
http://www.smartwomanshealth.com/index.php/pdf/anatomy-and-physiology-anatomy-and-physiology-v-1
Effects of provisioning in rhesus macaques and ecosystems | National Institute of Advanced StudiesEffects of provisioning in rhesus macaques and ecosystems | National Institute of Advanced Studies
Have you fed a monkey when you are at a place of worship, or at a bus stand? This act of kindness towards a fellow primate can cause changes to entire forest food webs and ecosystem processes, finds a recent study. For starters, the amount of fruits monkeys ate decreased by almost half when they had access to human food.. Asmita Sengupta from the National Institute of Advanced Studies and her advisors have recently conducted a study to understand the effects of provisioning - providing of extra food - by humans on the rhesus macaque. Although the rhesus macaque (Macaca mulatta) is not recognized to be a keystone species, a recent study shows thatit is an important seed disperser for many fruit species in the forests. Interestingly, these monkeys are also highly tolerant to human disturbances and are often provisioned with human food even in protected areas.. Provisioning of wild animals have been shown to have several ill effects at both the individual level and at the population level. This ...
http://nias.res.in/content/effects-provisioning-rhesus-macaques-and-ecosystems
Zika Rhesus Macaque Model | IITRIZika Rhesus Macaque Model | IITRI
In response to the recent emergence of Zika virus (ZIKV) in North and South America, there is an urgent need for animal models to test vaccines and therapeutics against this zoonotic pathogen. Non-human primates models are often needed for vaccine and immunomodulatory therapeutic evaluation due to their close evolutionary proximity to humans and the similarity of their physiology and immunology. IITRI has developed a Rhesus macaque Zika infection model for the preclinical testing of vaccines and antiviral therapeutics. ###Experimental Summary###
http://iitri.org/zika-rhesus-macaque-model
Accelerated heterologous adenovirus prime-boost SIV vaccine in neonatal rhesus monkeys. | Harvard Catalyst Profiles | Harvard...Accelerated heterologous adenovirus prime-boost SIV vaccine in neonatal rhesus monkeys. | Harvard Catalyst Profiles | Harvard...
Liu J, Li H, Iampietro MJ, Barouch DH. Accelerated heterologous adenovirus prime-boost SIV vaccine in neonatal rhesus monkeys. J Virol. 2012 Aug; 86(15):7829-35 ...
https://connects.catalyst.harvard.edu/Profiles/display/872841
Plus itPlus it
Subjects. Five male rhesus monkeys (Macaca mulatta) were used in studies of schedule-controlled responding, three male monkeys were used in studies of thermal nociception, three male and female monkeys were used in the single-key assay of drug self-administration, and three male monkeys were used in studies of food versus drug choice. Subjects weighed 4.5 to 12 kg during the course of these studies. All monkeys had prior exposure to drugs (primarily dopaminergic and opioid compounds) and to the behavioral procedures in which they were tested. The subjects were individually housed, and water was freely available. Their diet consisted of PMI Feeds Jumbo monkey diet (two to six biscuits per day; PMI Feeds, Inc., St. Louis, MO). This diet was supplemented with fresh fruit twice daily. In addition, monkeys in the assays of schedule-controlled behavior and food versus drug choice could earn additional food pellets during experimental sessions. A 12-h light/12-h dark cycle was in effect (lights on from ...
http://jpet.aspetjournals.org/content/314/1/221
Isoflurane-induced Apoptosis of Neurons and Oligodendrocytes in the Fetal Rhesus Macaque Brain | Anesthesiology | ASA...Isoflurane-induced Apoptosis of Neurons and Oligodendrocytes in the Fetal Rhesus Macaque Brain | Anesthesiology | ASA...
Specific staining protocols10,11 were as follows: Our DeOlmos cupric silver method and nonfluorescent staining methods for AC3 have been described previously.4,8-12 For MBP (1:100; MAB 395; EMD Millipore, Billerica, MA), fractin (1:400; AB3150; EMD Millipore), Iba1 (1:500; 019-18741; Wako Chemicals, Richmond, VA), and CC-1 (1:200; OP80; Calbiochem, San Diego, CA) immunostaining methods, we used the Vectastain Elite ABC kit with Vector VIP as chromogen (Vector Laboratories, Inc., Burlingame, CA).4,8-12 Immunofluorescent detection of caspase-mediated cell death employed an AC3 rabbit primary polyclonal antibody (9661B; 1:500; Cell Signaling Technology, Inc., Danvers, MA). Floating sections were incubated overnight at room temperature. After the sections were rinsed in phosphate-buffered saline (3 × 5 min) they were incubated for 2 h at room temperature with fluorescent goat antirabbit Alexa Fluor 555 (1:1,000, Invitrogen™, Life Technologies™, Grand Island, NY), rinsed in phosphate-buffered ...
http://anesthesiology.pubs.asahq.org/article.aspx?articleid=1917895
Influence of prenatal iron deficiency and MAOA genotype on response to social challenge in rhesus monkey infants. - PubMed -...Influence of prenatal iron deficiency and MAOA genotype on response to social challenge in rhesus monkey infants. - PubMed -...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
https://www.ncbi.nlm.nih.gov/pubmed/?term=22340208
Monkeys can use basic logic to decipher the order of items in a list | Science NewsMonkeys can use basic logic to decipher the order of items in a list | Science News
Rhesus macaque monkeys dont need rewards to learn and remember how items are ranked in a list, a mental feat that may prove handy in the wild.
https://www.sciencenews.org/article/monkeys-can-use-basic-logic-decipher-order-items-list?tgt=nr
MK-8591 CONCENTRATIONS AT SITES OF HIV TRANSMISSION AND REPLICATIONMK-8591 CONCENTRATIONS AT SITES OF HIV TRANSMISSION AND REPLICATION
MK-8591 is a long acting nucleoside reverse transcriptase translocation inhibitor (NRTTI) that has demonstrated potent antiviral activity in HIV-1 infected subjects administered a once-weekly (QW) 10 mg dose as monotherapy in a clinical trial and in SIV-infected rhesus macaque models. MK-8591 extended duration dosing potential was suggested by the long-intracellular half-life of MK-8591-triphosphate (MK-8591-TP) in peripheral blood mononuclear cells (PBMCs) in vitro and in preclinical models. Here we describe the tissue distribution of MK-8591 and its anabolites in rats by quantitative whole body autoradiography and in rhesus vaginal and rectal mucosa by biopsy.. Wistar Hannover rats dosed orally at 50 mpk (mg/kg) of [14C]-MK-8591 were sacrificed at 0.5 hr and 24 hr, cryo-sectioned (40 μm thick sagittal), and phosphor imaged for 4 days. Radioactivity in tissues was quantified using the blood standards along with Raytest AIDA image analysis software. For rectal and vaginal tissue distribution ...
https://www.croiconference.org/abstract/mk-8591-concentrations-sites-hiv-transmission-and-replication-0/
Indian-origin man jailed 10 yrs for killing woman in Spore | Business Standard NewsIndian-origin man jailed 10 yrs for killing woman in Spore | Business Standard News
Read more about Indian-origin man jailed 10 yrs for killing woman in Spore on Business Standard. A 32-year-old Indian-origin man was today sentenced to 10 years of jail and 12 strokes of the cane for murdering a woman 16 years ago during an attempt to rob her at knife-point in a lift. Gunasegaran Ramasamy was sentenced to the maximum 10 years
http://www.business-standard.com/article/pti-stories/indian-origin-man-jailed-10-yrs-for-killing-woman-in-s-pore-117032000807_1.html
NCR3 - Natural cytotoxicity triggering receptor 3 precursor - Macaca mulatta (Rhesus macaque) - NCR3 gene & proteinNCR3 - Natural cytotoxicity triggering receptor 3 precursor - Macaca mulatta (Rhesus macaque) - NCR3 gene & protein
Cell membrane receptor of natural killer/NK cells that is activated by binding of extracellular ligands including BAG6 and NCR3LG1. Stimulates NK cells cytotoxicity toward neighboring cells producing these ligands. It controls, for instance, NK cells cytotoxicity against tumor cells. Engagement of NCR3 by BAG6 also promotes myeloid dendritic cells (DC) maturation, both through killing DCs that did not acquire a mature phenotype, and inducing the release by NK cells of TNFA and IFNG that promote DC maturation.
http://www.uniprot.org/uniprot/Q8MJ02
CCR3 - C-C chemokine receptor type 3 - Macaca mulatta (Rhesus macaque) - CCR3 gene & proteinCCR3 - C-C chemokine receptor type 3 - Macaca mulatta (Rhesus macaque) - CCR3 gene & protein
Receptor for a C-C type chemokine. Binds to eotaxin, MCP-3, MCP-4 and RANTES and subsequently transduces a signal by increasing the intracellular calcium ions level.
http://www.uniprot.org/uniprot/P56483
Kinetics of Expression of Rhesus Monkey Rhadinovirus (RRV) and Identification and Characterization of a Polycistronic...Kinetics of Expression of Rhesus Monkey Rhadinovirus (RRV) and Identification and Characterization of a Polycistronic...
Rhesus monkey rhadinovirus (RRV) is a close relative of Kaposis sarcoma-associated herpesvirus (KSHV; human herpesvirus 8). RRV serves as an in vitro and an in vivo model for KSHV, and the mapping of its transcription program during lytic replication is significant since it represents de novo infection in the absence of stimulation with phorbol esters. Further, the RRV lytic system facilitates the making of recombinant viruses, and hence transcription profiling of the wild-type virus is important. Currently, the kinetics of lytic gene expression of RRV, the function of the RRV Orf50/Rta gene, and the presence of the RRV R8 and R8.1 genes are not known. This study details the transcription profile seen during RRV lytic replication and shows that RRV latency-associated nuclear antigen, viral FLIP (vFLIP), and vCyclin are transcribed during the RRV lytic phase. In addition, this study describes the identification of three new spliced products of the RRV Orf50, R8, and R8.1 genes, which are ...
https://jvi.asm.org/content/76/19/9819.abstract
Isolation and Detection of Zika Virus-Infected Rhesus Macaques Lymph Node Cells and Splenocytes<...Isolation and Detection of Zika Virus-Infected Rhesus Macaques Lymph Node Cells and Splenocytes<...
TY - CHAP. T1 - Isolation and Detection of Zika Virus-Infected Rhesus Macaques Lymph Node Cells and Splenocytes. AU - Haese, Nicole. AU - Hirsch, Alec J.. AU - Streblow, Daniel N.. N1 - Funding Information: The work presented in this manuscript was supported by the Pilot Program support from the Oregon National Primate Research Center (ONPRC) P51-ODO11092 and R21-HD091032 awarded by the National Institutes of Health. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Veterinarian and husbandry staff provide excellent care for the animals used in this study. Publisher Copyright: © 2020, Springer Science+Business Media, LLC, part of Springer Nature. Copyright: Copyright 2020 Elsevier B.V., All rights reserved.. PY - 2020. Y1 - 2020. N2 - Zika virus (ZIKV) is a mosquito-borne viral infection that is shed in biological fluids promoting vertical and sexual transmission. Recent outbreaks of ZIKV have been ...
https://ohsu.pure.elsevier.com/en/publications/isolation-and-detection-of-zika-virus-infected-rhesus-macaques-ly
UniProt: Q77NJ5 9GAMAUniProt: Q77NJ5 9GAMA
ID Q77NJ5_9GAMA Unreviewed; 69 AA. AC Q77NJ5; DT 05-JUL-2004, integrated into UniProtKB/TrEMBL. DT 05-JUL-2004, sequence version 1. DT 07-OCT-2020, entry version 24. DE RecName: Full=Cytoplasmic envelopment protein 3 {ECO:0000256,HAMAP-Rule:MF_04042}; GN Name=ORF38 {ECO:0000313,EMBL:AAF60017.1}; OS Rhesus monkey rhadinovirus H26-95. OC Viruses; Duplodnaviria; Heunggongvirae; Peploviricota; Herviviricetes; OC Herpesvirales; Herpesviridae; Gammaherpesvirinae; Rhadinovirus. OX NCBI_TaxID=69256 {ECO:0000313,EMBL:AAF60017.1, ECO:0000313,Proteomes:UP000162467}; RN [1] {ECO:0000313,EMBL:AAF60017.1, ECO:0000313,Proteomes:UP000162467} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=Macaca mulatta rhadinovirus isolate 26-95 RC {ECO:0000313,EMBL:AAF60017.1}; RX PubMed=10708456; DOI=10.1128/JVI.74.7.3388-3398.2000; RA Alexander L., Denekamp L., Knapp A., Auerbach M.R., Damania B., RA Desrosiers R.C.; RT The primary sequence of rhesus monkey rhadinovirus isolate 26-95: sequence RT similarities ...
https://www.genome.jp/entry/up:Q77NJ5_9GAMA
Computational analysis of functional connectivity between areas of primate cerebral cortexComputational analysis of functional connectivity between areas of primate cerebral cortex
Recent analyses of association fibre networks in the primate cerebral cortex have revealed a small number of densely intra-connected and hierarchically organized structural systems. Corresponding analyses of data on functional connectivity are required to establish the significance of these structural systems. We therefore built up a relational database by systematically collating published data on the spread of activity after strychnine-induced disinhibition in the macaque cerebral cortex in vivo. After mapping these data to two different parcellation schemes, we used three independent methods of analysis which demonstrate that the cortical network of functional interactions is not homogeneous, but shows a clear segregation into functional assemblies of mutually interacting areas. The assemblies suggest a principal division of the cortex into visual, somatomotor and orbito-temporo-insular systems, while motor and somatosensory areas are inseparably interrelated. These results are largely ...
https://www.isi.edu/people/burns/publications/computational_analysis_functional_connectivity_between_areas_primate_cereb
Concurrent overproduction of synapses in diverse regions of the primate cerebral cortex | ScienceConcurrent overproduction of synapses in diverse regions of the primate cerebral cortex | Science
Synapses develop concurrently and at identical rates in different layers of the visual, somatosensory, motor, and prefrontal areas of the primate cerebral cortex. This isochronic course of synaptogenesis in anatomically and functionally diverse regions indicates that the entire cerebral cortex develops as a whole and that the establishment of cell-to-cell communication in this structure may be orchestrated by a single genetic or humoral signal. This is in contrast to the traditional view of hierarchical development of the cortical regions and provides new insight into the maturation of cortical functions. ...
https://science.sciencemag.org/content/232/4747/232?ijkey=5fdb686d672fe38b39b3234bd80799c4f7a9677e&keytype2=tf_ipsecsha
Aging in the Nervous System, Boston University School of Medicine, Department of Anatomy and NeurobiologyAging in the Nervous System, Boston University School of Medicine, Department of Anatomy and Neurobiology
Affiliations: Yerkes National Primate Research Center, New England National Primate Research Center Mission: The Laboratory for Cognitive Neurobiology is focused on understanding the neurological basis in health and disease of higher cognitive functions including learning, memory and executive system functions.. Principal Research Programs: The main program is centered on the effects of aging in the central nervous system of the rhesus monkey, Macaca mulatta. Monkeys are initially behaviorally tested to assess their memory and cognitive functions, after which the brains are examined to determine the structural, neurochemical and functional changes that may account for age-related cognitive impairments. Other investigations are examing the interaction of aging with untreated hypertension and with recovery from cortical stroke. Another study using behavioral, anatomical and fMRI methods examines the interaction of the prefrontal cortex and medial temporal limbic system in memory and executive ...
http://pin.primate.wisc.edu/idp/idp/entry/302
Alzheimers Abeta vaccination of rhesus monkeys (Macaca mulatta). - Zurich Open Repository and ArchiveAlzheimers Abeta vaccination of rhesus monkeys (Macaca mulatta). - Zurich Open Repository and Archive
Recent preliminary data suggest that vaccination with Alzheimers Abeta might reduce senile plaque load and stabilize cognitive decline in human Alzheimers disease. To examine the mechanisms and consequences of anti-Abeta-antibody formation in a species more closely related to humans, rhesus monkeys (Macaca mulatta) were vaccinated with aggregated Abeta(1-42). Immunized monkeys developed anti-Abeta titers exceeding 1:1000, and their plasma Abeta levels were 5-10-fold higher than the plasma Abeta levels observed in monkeys vaccinated with aggregated amylin. These data support the use of non-human primates to model certain phenomena associated with vaccination of humans with aggregated Alzheimers Abeta. ...
http://www.zora.uzh.ch/id/eprint/1941/
PETA Statement: Another Monkey Dies at UW Primate Center | PETAPETA Statement: Another Monkey Dies at UW Primate Center | PETA
Please see the following statement from PETA Vice President Alka Chandna on the death of a monkey at the Washington National Primate Research Center Please see the following statement from PETA Vice President Alka Chandna on the death of a monkey at the Washington National Primate Research Center following an experimental surgery:
https://www.peta.org/media/news-releases/peta-statement-another-monkey-dies-at-uw-primate-center/
Identification and spontaneous immune targeting of an endogenous retrovirus K envelope protein in the Indian rhesus macaque...Identification and spontaneous immune targeting of an endogenous retrovirus K envelope protein in the Indian rhesus macaque...
Endogenous retroviruses (ERVs) are remnants of ancient retroviral infections that have invaded the germ line of both humans and non-human primates. Most ERVs are functionally crippled by deletions, mutations, and hypermethylation, leading to the view that they are inert genomic fossils. However, some ERVs can produce mRNA transcripts, functional viral proteins, and even non-infectious virus particles during certain developmental and pathological processes. While there have been reports of ERV-specific immunity associated with ERV activity in humans, adaptive immune responses to ERV-encoded gene products remain poorly defined and have not been investigated in the physiologically relevant non-human primate model of human disease. Here, we identified the rhesus macaque equivalent of the biologically active human ERV-K (HML-2), simian ERV-K (SERV-K1), which retains intact open reading frames for both Gag and Env on chromosome 12 in the macaque genome. From macaque cells we isolated a spliced mRNA product
https://retrovirology.biomedcentral.com/articles/10.1186/s12977-016-0238-0/figures/5
Identification of the R1 oncogene and its protein product from the rhadinovirus of rhesus monkeys<...Identification of the R1 oncogene and its protein product from the rhadinovirus of rhesus monkeys<...
TY - JOUR. T1 - Identification of the R1 oncogene and its protein product from the rhadinovirus of rhesus monkeys. AU - Damania, Blossom. AU - Li, Mengtao. AU - Choi, Joong Kook. AU - Alexander, Louis. AU - Jung, Jae U.. AU - Desrosiers, Ronald C.. PY - 1999. Y1 - 1999. N2 - Rhesus monkey rhadinovirus (RRV) is a gamma-2 herpesvirus that is most closely related to the human Kaposis sarcoma-associated herpesvirus (KSHV). We have identified a distinct open reading frame at the left end of RRV and designated it R1. The position of the R1 gene is equivalent to that of the saimiri transforming protein (STP) of herpesvirus saimiri (HVS) and of K1 of KSHV, other members of the gamma-2 or rhadinovirus subgroup of herpesviruses. The R1 sequence revealed an open reading frame encoding a product of 423 amino acids that was predicted to contain an extracellular domain, a transmembrane domain, and a C-terminal cytoplasmic tail reflective of a type I membrane-bound protein. The predicted structural motifs of ...
https://miami.pure.elsevier.com/en/publications/identification-of-the-r1-oncogene-and-its-protein-product-from-th
Plasma and Cerebrospinal Fluid Pharmacokinetics of Naproxen in ChildrenPlasma and Cerebrospinal Fluid Pharmacokinetics of Naproxen in Children
The aim of this study was to characterize pediatric pharmacokinetics and central nervous system exposure of naproxen after oral administration. The pharmacokinetics of naproxen was studied in 53 healthy children aged 3 months to 12 years undergoing surgery with spinal anesthesia. Children received preoperatively a single dose of 10 mg/kg oral naproxen suspension. A single cerebrospinal fluid (CSF) sample (n = 52) was collected at the induction of anesthesia, and plasma samples (n = 270) were collected before, during, and after the operation (up to 51 hours after administration). A population pharmacokinetic model was built using the NONMEM software. Naproxen concentrations in plasma were well described by a 2-compartment model. The estimated oral clearance (CL/F) was 0.62 L/h when linearly scaled by weight to 70 kg. The apparent volume of distribution at steady state (Vss/F) was 12.5 L/70 kg. The findings are consistent with previously reported pharmacokinetic parameters for children older than ...
http://uu.diva-portal.org/smash/record.jsf?pid=diva2:513538
Plus itPlus it
CRP is produced by the liver in response to factors released from macrophages and adipocytes. High circulating CRP concentrations are therefore an indicator of inflammation and/or injury. We examined the effects of dietary fructose on plasma CRP concentrations in a nonhuman primate model of diet-induced metabolic syndrome. Adult male rhesus macaques 12±3 years of age, weighing 16.2±1.9 kg (n=29) maintained on chow (LabDiet 5047) ad libitum were provided with flavored fructose beverages containing 75g of fructose (300 kcal/day). Fasting plasma samples were collected at baseline and after 1 and 3 months. Indices of glucose homeostasis (insulin, glucose, HOMA-IR), adiposity/metabolic homeostasis (leptin, adiponectin) and lipid metabolism (TG, cholesterol, LDL-C, HDL-C, VLDL-C, ApoA1, ApoB, ApoC3 and ApoE) were analyzed. Fructose consumption induced weight gain +1.5±0.2 kg, and insulin resistance, accompanied by increases of plasma leptin, decreased adiponectin, hypertriglyceridemia and increases ...
https://diabetes.diabetesjournals.org/content/68/Supplement_1/1856-P
Rhesus Monkeys - India, Social, Adult, and Females - JRank ArticlesRhesus Monkeys - India, Social, Adult, and Females - JRank Articles
Rhesus monkeys have the widest geographic distribution of any species of non-human primate, occurring naturally in Afghanistan, Pakistan, India, Nepal, Bhutan, Myanmar, Laos, Thailand, Vietnam, and China. In India, rhesus monkeys live in desert habitats of Rajasthan, the agricultural plains of the Gangetic Basin, the tropical forests of southeastern Asia, the temperate pine forests of the Himalaya mountains, and the rugged mountains of north central China. Rhesus monkeys are the most adaptable of all non-human primates, with the broadest range of habitat, and the most cosmopolitan food habits. These monkeys are generally herbivorous, eating a wide variety of natural and cultivated plants, but they also forage occasionally for insects. In agricultural areas, rhesus monkeys frequently raid both field crops such as rice, wheat, pulses (a leguminous, bean-like plant), and sugar cane, and garden vegetables and fruits, such as bananas, papayas, mangos, tomatoes, squash, and melons. In forest areas, ...
https://science.jrank.org/pages/5861/Rhesus-Monkeys.html
Flavobacterium macacae sp. nov., isolated from Macaca mulatta faeces | Microbiology SocietyFlavobacterium macacae sp. nov., isolated from Macaca mulatta faeces | Microbiology Society
A yellow, Gram-stain-negative, aerobic, non-gliding, non-spore-forming, rod-shaped strain, designated YIM 102600T, was isolated from the faeces of Macaca mulatta dwelling in the Yunnan Wild Animal Park, Yunnan Province, South-West PR China. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain YIM 102600T was a member of the genus Flavobacterium , and closely related to Flavobacterium qiangtangense F3T (96.9 % similarity) and Flavobacterium noncentrifugens R-HLS-17T (96.0 % similarity). Phylogenetic trees showed that strain YIM 102600T formed a clade with F. qiangtangense F3T and F. noncentrifugens R-HLS-17T. Growth occurred at 4-30 °C (optimum, 28 °C), pH 7.0-8.0 (pH 7.5) and NaCl concentration 0-2 % (w/v; 0-1 %, w/v). The major fatty acids were iso-C15:0 and summed feature 3 (comprising C16:1 ω7c and/or C16:1 ω6c). The predominant polar lipid was phosphatidylethanolamine and the sole respiratory quinone was menaquinone-6. The DNA G+C content was 36.4 mol%. The calculated
https://www.microbiologyresearch.org/content/journal/ijsem/10.1099/ijsem.0.003708
Decreases in Electrocardiographic R-Wave Amplitude and QT Interval Predict Myocardial Ischemic Infarction in Rhesus Monkeys...Decreases in Electrocardiographic R-Wave Amplitude and QT Interval Predict Myocardial Ischemic Infarction in Rhesus Monkeys...
TY - JOUR. T1 - Decreases in Electrocardiographic R-Wave Amplitude and QT Interval Predict Myocardial Ischemic Infarction in Rhesus Monkeys with Left Anterior Descending Artery Ligation. AU - Sun, Xiaorong. AU - Cai, Jindan. AU - Fan, Xin. AU - Han, Pengfei. AU - Xie, Yuping. AU - Chen, Jianmin. AU - Xiao, Ying. AU - Kang, Yujian. PY - 2013/8/13. Y1 - 2013/8/13. N2 - Clinical studies have demonstrated the predictive values of changes in electrocardiographic (ECG) parameters for the preexisting myocardial ischemic infarction. However, a simple and early predictor for the subsequent development of myocardial infarction during the ischemic phase is of significant value for the identification of ischemic patients at high risk. The present study was undertaken by using non-human primate model of myocardial ischemic infarction to fulfill this gap. Twenty male Rhesus monkeys at age of 2-3 years old were subjected to left anterior descending artery ligation. This ligation was performed at varying ...
https://uthsc.pure.elsevier.com/en/publications/decreases-in-electrocardiographic-r-wave-amplitude-and-qt-interva
Zoological ResearchZoological Research
Polymeric immunoglobulin receptors(pIgR) are key participants in the formation and secretion of secretory IgA(S-IgA), which is critical for the prevention of microbial infection and colonization in the respiratory system. Although increased respiratory colonization and infections are common in HIV/AIDS, little is known about the expression of pIgR in the airway mucosa of these patients. To address this, the expression levels of pIgR in the tracheal mucosa and lungs of SHIV/SIV-infected rhesus macaques were examined by real-time RTPCR and confocal microscopy. We found that the levels of both PIGR mRNA and pIgR immunoreactivity were lower in the tracheal mucosa of SHIV/SIV-infected rhesus macaques than that in non-infected rhesus macaques, and the difference in pIgR immunoreactivity was statistically significant. IL-17A, which enhances pIgR expression, was also changed in the same direction as that of pIgR. In contrast to changes in the tracheal mucosa, pIgR and IL-17A levels were higher in the ...
http://www.zoores.ac.cn/EN/volumn/volumn_1353.shtml
Natural killer cells can help control virus in primate model of HIV/AIDS | Lab LandNatural killer cells can help control virus in primate model of HIV/AIDS | Lab Land
A combination immunotherapy of IL-21 and IFN-alpha, when added to antiviral therapy, is effective in generating highly functional natural killer cells that can help control and reduce SIV (simian immunodeficiency virus) in animal models. This finding, from Yerkes National Primate Research Center scientists in collaboration with Institut Pasteur, could be key for developing additional treatment options to control HIV/AIDS.. The results were published in Nature Communications.. Antiviral therapy (ART) is the current leading treatment for HIV/AIDS, and is capable of reducing the virus to undetectable levels, but is not a cure and is hampered by issues such as cost, adherence to medication treatment plan and social stigma.. To reduce reliance on ART, the Yerkes, Emory and Institut Pasteur research team worked with 16 SIV-positive, ART-treated rhesus macaques. In most nonhuman primates (NHPs), including rhesus macaques, untreated SIV infection progresses to AIDS-like disease and generates natural ...
https://www.emoryhealthsciblog.com/natural-killer-cells-can-help-control-virus-in-primate-model-of-hiv-aids/
Cutting Edge: T Cells Monitor N-Myristoylation of the Nef Protein in Simian Immunodeficiency Virus-Infected Monkeys | The...Cutting Edge: T Cells Monitor N-Myristoylation of the Nef Protein in Simian Immunodeficiency Virus-Infected Monkeys | The...
An additional series of mutational analyses revealed a fine specificity for the lipopeptide recognition by the T cells. The 5-mer Nef peptide conjugated with a shorter (C10) saturated fatty acid (C10-GGAIS) showed reduced T cell stimulation activity compared with C14nef5, and no T cell response was detected for C6-GGAIS (Fig. 1F), further confirming that the peptide modification with a fatty acid of the C14 chain length (myristic acid) was essential for activation of the 2N5.1 cells. The N-terminal amino acid sequence (GGAIS) of the Nef protein matches with a typical N-myristoylation motif, Gly-X-X-X-(Ser/Thr), in which X is any amino acid (3). Whereas the serine-to-threonine substitution (C14-GGAIT) did not affect the antigenic activity, alanine substitution for either the second glycine residue (C14-GAAIS) or the isoleucine residue (C14-GGAAS) located between the conserved flanking amino acid residues totally abrogated the activity (Fig. 1F). Furthermore, addition of an amide linkage to the ...
http://www.jimmunol.org/content/187/2/608
ASMscience | Non-Human Primate ModelsASMscience | Non-Human Primate Models
Among the animal models of tuberculosis (TB), the non-human primates (NHPs), particularly rhesus macaques (Macaca fascicularis) and cynomolgus macaques (Macaca mulatta), share the greatest anatomical and physiological similarities with humans. Macaques are highly susceptible to Mycobacterium tuberculosis infection and manifest the complete spectrum of clinical and pathological manifestations of TB as seen in humans. Therefore, the macaque models have been used extensively for investigating the pathogenesis of M. tuberculosis infection and for preclinical testing of drugs and vaccines against TB. This review focuses on published major studies that exemplify how the rhesus and cynomolgus macaques have enhanced and may continue to advance global efforts in TB research.
https://www.asmscience.org/content/book/10.1128/9781555819569.chap8
Envelope-modified single-cycle simian immunodeficiency virus selective by Michael D. Alpert, Andrew R. Rahmberg et al.Envelope-modified single-cycle simian immunodeficiency virus selective by Michael D. Alpert, Andrew R. Rahmberg et al.
Immunization of rhesus macaques with strains of simian immunodeficiency virus (SIV) that are limited to a single cycle of infection elicits T-cell responses to multiple viral gene products and antibodies capable of neutralizing lab-adapted SIV, but not neutralization-resistant primary isolates of SIV. In an effort to improve upon the antibody responses, we immunized rhesus macaques with three strains of single-cycle SIV (scSIV) that express envelope glycoproteins modified to lack structural features thought to interfere with the development of neutralizing antibodies. These envelope-modified strains of scSIV lacked either five potential N-linked glycosylation sites in gp120, three potential N-linked glycosylation sites in gp41, or 100 amino acids in the V1V2 region of gp120. Three doses consisting of a mixture of the three envelope-modified strains of scSIV were administered on weeks 0, 6, and 12, followed by two booster inoculations with vesicular stomatitis virus (VSV) G trans-complemented scSIV on
https://escholarship.umassmed.edu/prevbeh_pp/287/
ESCRS | European Society of Cataract & Refractive SurgeonsESCRS | European Society of Cataract & Refractive Surgeons
Five Chinese rhesus macaques which received decellularized porcine corneal lamellae and were followed up for at least 6 months underwent full-thickness corneal allotransplantation. Previous xeno-grafts (7.5mm in diameter) were removed with 8.0mm trephines and 8.5mm-sized grafts from donor macaques were transplanted. Clinically applicable minimal immunosuppression was done based on topical, subconjunctival and systemic corticosteroids. Rejection signs and serial changes in recipients blood profile, including memory T cell subset, anti-Gal and donor pig specific antibodies, and complement were evaluated. Changes in aqueous complement concentration were also assessed at 4 weeks after transplantation. The mixed lymphocytes reaction (MLR) was analyzed in three rhesus macaques (KPed rhesus) with clear allografts that survived more than 6 months. MLR was done using peripheral blood mononuclear cells (PBMC). PBMCs from the recipient rhesus and normal rhesus were used as responder cells and PBMCs from ...
http://www.escrs.org/milan2012/programme/poster-details.asp?id=13122
Early restoration of mucosal CD4 memory CCR5 T cells in the gut of SIV-infected rhesus predicts long term non-progression. -...Early restoration of mucosal CD4 memory CCR5 T cells in the gut of SIV-infected rhesus predicts long term non-progression. -...
OBJECTIVES : To use SIVmac-infected Chinese-origin rhesus macaques (Ch Rh) to characterize the immunopathology of the long term non-progressor (LTNP) state. The key questions addressed were whether or not LTNP experience an early and rapid loss of mucosal CD4 T cells during the acute infection and the mechanisms by which they maintain the LTNP state. METHODS : Ch Rh were infected with SIVmac239. Polychromatic flow cytometry was used to analyze T lymphocyte subsets from blood, lymph nodes and gut tissues during SIV infection. Plasma viral loads were monitored by bDNA assay. Two LTNP were treated with anti-CD8 antibody to deplete CD8 cells in vivo. RESULTS : Thirty-one percent (5/16) of SIVmac239-infected ChRh having low viral loads for as long as 6 years were LTNP. Both LTNP and progressors had similar levels of gut memory CD4/CCR5 T cells (target cells) before infection and there was an early and profound depletion of target cells in both groups. LTNP were distinguished by gradual restoration of
https://www.semanticscholar.org/paper/Early-restoration-of-mucosal-CD4-memory-CCR5-T-cel-Ling-Veazey/01cd91efd1f09a5858ec241ad1dbbdf651066e18
Blocking of α4β7 Gut-Homing Integrin during Acute Infection Leads to Decreased Plasma and Gastrointestinal Tissue Viral Loads...Blocking of α4β7 Gut-Homing Integrin during Acute Infection Leads to Decreased Plasma and Gastrointestinal Tissue Viral Loads...
To better understand the role of the α4β7 integrin during acute SIV infection, we administered a rhesus recombinant form of an Ab targeting this integrin molecule to a group of SIV-infected rhesus macaques. Two administrations maintained plasma levels of ,10 μg/ml of the Ab for the first 8 wk of SIV infection. What is not clear is whether the Ab administered was able to reach all of the target tissues in an effective manner, particularly the GALT, which comprises 70% of all lymphoid cells in the body as compared with peripheral blood, which represents only 2% of the total lymphoid cells (39). The finding of nearly complete blocking of the α4β7 integrin on cells isolated from all of the tissues examined, including the jejunal and colorectal biopsies of the anti-α4β7 mAb-treated animals, suggests that such therapy was quite effective (see Fig. 1B). The mechanisms by which the in vivo administration of anti-α4β7 mAb delayed and decreased plasma and gut tissue viremia and proviral DNA ...
https://www.jimmunol.org/content/186/2/1044?ijkey=afcb4af2a8ddc4a8c91ec9df117c043e5d05a0eb&keytype2=tf_ipsecsha
Body odor sets female rhesus monkeys apartBody odor sets female rhesus monkeys apart
Rhesus monkeys (Macaca mulatta) make use of their sense of smell to distinguish between members of their own and other social groups, according to new research, led by Stefanie Henkel (University of Leipzig, Germany), published in Springers journal Behavioral Ecology and Sociobiology.
https://phys.org/news/2015-11-body-odor-female-rhesus-monkeys.html
Rhesus macaque - WikipediaRhesus macaque - Wikipedia
Work on the genome of the rhesus macaque was completed in 2007, making the species the second nonhuman primate whose genome was sequenced.[55] Humans and macaques apparently share about 93% of their DNA sequence and shared a common ancestor roughly 25 million years ago.[56] The rhesus macaque has 21 pairs of chromosomes.[57] Comparison of rhesus macaques, chimpanzees, and humans revealed the structure of ancestral primate genomes, positive selection pressure and lineage-specific expansions, and contractions of gene families. The goal is to reconstruct the history of every gene in the human genome, said Evan Eichler, University of Washington, Seattle. DNA from different branches of the primate tree will allow us to trace back the evolutionary changes that occurred at various time points, leading from the common ancestors of the primate clade to Homo sapiens, said Bruce Lahn, University of Chicago.[58] After the human and chimpanzee genomes were sequenced and compared, it was usually ...
https://en.wikipedia.org/wiki/Rhesus_macaque
honing-et-al-2012b (Music Cognition Group Publications)honing-et-al-2012b (Music Cognition Group Publications)
Honing, H., Merchant, H., Háden, G.P., Prado, L. & Bartolo, R. (2012). Rhesus monkeys (Macaca mulatta) detect rhythmic groups in music, but not the beat. PLoS ONE, 7(12): e51369. doi: 10.1371/journal.pone.0051369 It was recently shown that rhythmic entrainment, long considered a human-specific mechanism, can be demonstrated in a selected group of bird species, and, somewhat surprisingly, not in more closely related species such as nonhuman primates. This observation supports the vocal learning hypothesis that suggests rhythmic entrainment to be a by-product of the vocal learning mechanisms that are shared by several bird and mammal species, including humans, but that are only weakly developed, or missing entirely, in nonhuman primates. To test this hypothesis we measured auditory event-related potentials (ERPs) in two rhesus monkeys (Macaca mulatta), probing a well-documented component in humans, the mismatch negativity (MMN) to study rhythmic expectation. We demonstrate for the first time in ...
http://mcg.uva.nl/abstracts/honing-et-al-2012b.html
Encoding of Stimulus Probability in Macaque Inferior Temporal Cortex. - PSYEncoding of Stimulus Probability in Macaque Inferior Temporal Cortex. - PSY
Optimal perceptual decisions require sensory signals to be combined with prior information about stimulus probability. Although several theories propose that probabilistic information about stimulus occurrence is encoded in sensory cortex, evidence from neuronal recordings has not yet fully supported this view. We recorded activity from single neurons in inferior temporal cortex (IT) while monkeys performed a task that involved discriminating degraded images of faces and fruit. The relative probability of the cue being a face versus a fruit was manipulated by a latent variable that was not revealed to the monkeys and that changed unpredictably over the course of each recording session. In addition to responding to stimulus identity (face or fruit), population responses in IT encoded the long-term stimulus probability of whether a face or a fruit stimulus was more likely to occur. Face-responsive neurons showed reduced firing rates to expected faces, an effect consistent with expectation suppression,
https://www.psy.ox.ac.uk/publications/640500
Why some primates, but not humans, can live with immunodeficiency viruses and not progre... ( Key differences in immune system...Why some primates, but not humans, can live with immunodeficiency viruses and not progre... ( Key differences in immune system...
...Key differences in immune system signaling and the production of speci...Following the identification of HIV (Human Immunodeficiency Virus) as ...Surprisingly the natural hosts for the AIDS viruses such as the mang...A team of scientists from Yerkes National Primate Research Center and ...,Why,some,primates,,but,not,humans,,can,live,with,immunodeficiency,viruses,and,not,progress,to,AIDS,biological,biology news articles,biology news today,latest biology news,current biology news,biology newsletters
http://www.bio-medicine.org/biology-news-1/Why-some-primates--but-not-humans--can-live-with-immunodeficiency-viruses-and-not-progress-to-AIDS-4907-1/
Penile foreskin is immunologically complete: raises new vaccine possibilities for HIV vaccinePenile foreskin is immunologically complete: raises new vaccine possibilities for HIV vaccine
Rhesus macaque monkeys infected with simian immunodeficiency virus (SIV) harbor immunoglobulin G (IgG) and SIV-specific antibodies and T cells in the foreskin of the penis, according to a study in the July 2012 Journal of ...
https://medicalxpress.com/news/2012-07-penile-foreskin-immunologically-vaccine-possibilities.html
KEGG PATHWAY: Viral carcinogenesis - Macaca mulatta (rhesus monkey)KEGG PATHWAY: Viral carcinogenesis - Macaca mulatta (rhesus monkey)
There is a strong association between viruses and the development of human malignancies. We now know that at least six human viruses, Epstein-Barr virus (EBV), hepatitis B virus (HBV), hepatitis C virus (HCV), human papilloma virus (HPV), human T-cell lymphotropic virus (HTLV-1) and Kaposis associated sarcoma virus (KSHV) contribute to 10-15% of the cancers worldwide. Via expression of many potent oncoproteins, these tumor viruses promote an aberrant cell-proliferation via modulating cellular cell-signaling pathways and escape from cellular defense system such as blocking apoptosis. Human tumor virus oncoproteins can also disrupt pathways that are necessary for the maintenance of the integrity of host cellular genome. Viruses that encode such activities can contribute to initiation as well as progression of human cancers ...
http://www.genome.jp/kegg-bin/show_pathway?mcc05203+706667
TSR1 gene cDNA ORF clone, Macaca mulatta(Rhesus monkey) - GenScriptTSR1 gene cDNA ORF clone, Macaca mulatta(Rhesus monkey) - GenScript
Next-day shipping cDNA ORF clones derived from TSR1 TSR1, ribosome maturation factor available at GenScript, starting from $99.00.
https://www.genscript.com/gene/macaca-mulatta/703311/tsr1.html
Discovering the Effects of a Hidden Virus - NPRCDiscovering the Effects of a Hidden Virus - NPRC
Cytomegalovirus, or CMV, is a common virus found in almost every person on the planet. For most of them, it causes no harm and leads to no symptoms. But for newborn babies and people with compromised immune systems, it can lead to birth defects, serious illness and even death.. Now, researchers associated with the California National Primate Research Center (CNPRC) at the University of California, Davis have discovered that low levels of CMV changed microbe and immune cell populations and response to the flu vaccine in rhesus macaques. CMV infection generally increased immune activity but also diminished antibodies responding to influenza vaccination. The study also found that low levels of CMV make the body susceptible to changes in environmental conditions that could accentuate their impact.. Subclinical CMV infection alters the immune system and the gut microbiota in the host and that impacts how we respond to vaccines, environmental stimuli and pathogens, said Satya Dandekar, who chairs ...
https://nprc.org/research/discovering-the-effects-of-a-hidden-virus/
CellNEWS: Xenotransplanting embryonic pig pancreatic cellsCellNEWS: Xenotransplanting embryonic pig pancreatic cells
Cross-species transplant in rhesus macaques is step toward diabetes cure for humans Friday, 19 October 2007 With an eye on curing diabetes, scientists at Washington University School of Medicine in St. Louis have successfully transplanted embryonic pig pancreatic cells destined to produce insulin into diabetic macaque monkeys - all without the need for risky immune suppression drugs that prevent rejection. The transplanted cells, known as primordia, are in the earliest stages of developing into pancreatic tissues. Within several weeks of the transplants, the cells became engrafted, or established, within the three rhesus macaque monkeys that received them. The cells also released pig insulin in response to rising blood glucose levels, as would be expected in healthy animals and humans. The approach reduced the animals need for insulin injections and has promise for curing diabetes in humans, says senior investigator Marc Hammerman, M.D., the Chromalloy Professor of Renal Diseases in Medicine. ...
http://cellnews-blog.blogspot.com/2007/10/xenotransplantation-embryonic-pig.html
Molecular characterization of the rhesus rhadinovirus (RRV) ORF4 gene and the RRV complement control protein it encodes -...Molecular characterization of the rhesus rhadinovirus (RRV) ORF4 gene and the RRV complement control protein it encodes -...
Mark, L, Spiller, OB, Okroj, M, Chanas, S, Aitken, JA, Wong, SW, Damania, B, Blom, AM and Blackbourn, DJ (2007) Molecular characterization of the rhesus rhadinovirus (RRV) ORF4 gene and the RRV complement control protein it encodes ...
http://epubs.surrey.ac.uk/825395/
Prevention of Rectal Simian HIV Transmission in Macaques by Intermittent Pre-exposure Prophylaxis with Oral TruvadaPrevention of Rectal Simian HIV Transmission in Macaques by Intermittent Pre-exposure Prophylaxis with Oral Truvada
Methods: We evaluated 3 modalities of a 2-dose iPrEP regimen with Truvada in 6 male rhesus macaques by using an established rectal transmission model consisting of 14 weekly virus (simian HIV [SHIV]162p3,10 TCID50) exposures. Truvada at human equivalent dosing was delivered by oral gavage. Drug doses were given at different intervals relative to virus exposure: 2 groups of macaques received the 2 doses of Truvada over a 24-hour period, either 2 hours before and 22 hours after virus exposure (group I) or 22 hours before and 2 hours after exposure (group II). Group III received the first dose of Truvada 3 days before exposure and a second dose 2 hours after exposure. A fourth group of 6 macaques received 2 PEP doses 2 hours and 26 hours after exposure. Infection was monitored by serology and polymerase chain reaction (PCR) amplification of SHIV sequences from plasma and peripheral blood mononuclear cells (PBMC). The Cox proportional hazards model was used to estimate the risk of infection in ...
http://www.natap.org/2009/CROI/croi_189.htm
Simian Immunodeficiency Vaccine Update | LASSSimian Immunodeficiency Vaccine Update | LASS
A post we made last week suggested a new vaccine can protect macaques against the monkey equivalent of HIV, however the vaccine using the common virus cytomegalovirus (CMV) as the vector or container of proteins from the simian immunodeficiency virus (SIV) protected none of a group of 24 rhesus macaques from infection. But in 13…
https://blog.lass.org.uk/2011/05/19/simian-immunodeficiency-vaccine-update/
Petition · STOP Torturing Monkeys for Human Obesity! · Change.orgPetition · STOP Torturing Monkeys for Human Obesity! · Change.org
Oregon health and Science University is practicing the barbaric act of using primates to test largely preventable human conditions: OBESITY & DIABETES.. Shiva and her colony which are mostly Rhesus Macaques are fattened up being fed daily with fattening foods, allowed no exercise, caged and once obese enough, they test various drugs and procedures on them.. Dr Grove said: Our research model is a sedentary lifestyle with calorically dense diets. Monkeys in this facility receive daily painful insulin shots to treat the human inflicted diabetes, and some develop clogged arteries. One monkey already died from a heart attack at a very young age. The unfortunate primate that is going through this suffers between months and years for human conditions that can largely be prevented by eating a healthy diet, which is obvious from this information. They had to fatten up the monkeys with unhealthy foods to be able to test these preventable diseases.. This doesnt stop there as some endure the painful ...
https://www.change.org/p/stop-torturing-monkeys-for-human-obesity
PublikationenPublikationen
Anatomical description of the periprostatic nerves in the male rhesus monkey (Macaca mulatta). Ganzer R, Neuhaus J, Gratzke C, Blana A, Wieland WF, Stolzenburg JU. World J Urol. 2011 Jun;29(3):375-80. No mutations of FGFR3 in normal urothelium in the vicinity of urothelial carcinoma of the bladder harbouring activating FGFR3 mutations in patients with bladder cancer. Otto W, Denzinger S, Bertz S, Gaumann A, Wild PJ, Hartmann A, Stoehr R. Int J Cancer. 2009 Nov 1;125(9):2205-8. Mdm2-SNP309 polymorphism in prostate cancer: no evidence for association with increased risk or histopathological tumour characteristics. Stoehr R, Hitzenbichler F, Kneitz B, Hammerschmied CG, Burger M, Tannapfel A, Hartmann A. Br J Cancer. 2008 Jul 8;99(1):78-82. Topographical anatomy of periprostatic and capsular nerves: quantification and computerised planimetry. Ganzer R, Blana A, Gaumann A, Stolzenburg JU, Rabenalt R, Bach T, Wieland WF, Denzinger S. Eur Urol. 2008 Aug;54(2):353-61. Pax-5 protein expression in bladder ...
http://www.caritasstjosef.de/forschung/node_4436.htm
Macaques at Shimla, India photo WP00397Macaques at Shimla, India photo WP00397
Photograph of A family of Rhesus Macaques (Macaca mulatta) groom each other. India & Southeast Asia. Rights managed image. Warren Photographic WP00397
https://www.warrenphotographic.co.uk/00397-macaques-at-shimla-india
University of Oxford | labanimaltour.orgUniversity of Oxford | labanimaltour.org
Welcome to Oxford Universitys primate research facility.. This facility has been specially designed to accommodate behavioural neuroscience research involving Rhesus Macaque (Macaca mulatta) monkeys. Macaques are socially and cognitively complex animals, characteristics that make them ideal subjects for our behavioural neuroscience studies. Because of these characteristics it is really important that we provide high standards of care.. Our species-specific environmental enrichment program and reward-based training strategies are key to ensuring the animals are appropriately acclimatised to the staff, the laboratory environment and the research procedures.. During this virtual tour you will have an opportunity to meet the staff and animals, to see the facilities and to learn about some of the studies that we carry out.. ...
http://labanimaltour.org/oxford
Nature Picture Library Rhesus Macaque (Macaca mulatta) on roadside between Darjeeling and Bagdogra, West Bengal, India - ...Nature Picture Library Rhesus Macaque (Macaca mulatta) on roadside between Darjeeling and Bagdogra, West Bengal, India - ...
Macaca mulatta) on roadside between Darjeeling and Bagdogra, West Bengal, India - Bernard Castelein ... Rhesus Macaque (Macaca mulatta) on roadside between Darjeeling and Bagdogra, West Bengal, India. ... Rhesus Macaque (Macaca mulatta) on roadside between Darjeeling and Bagdogra, West Bengal, India ...
https://www.naturepl.com/stock-photo-rhesus-macaque-nature-image01209618.html
Macaca mulatta snoRNA :SNORD52Macaca mulatta snoRNA :SNORD52
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300240
Macaca mulatta snoRNA :SNORD83Macaca mulatta snoRNA :SNORD83
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300562
Macaca mulatta snoRNA :SNORD115Macaca mulatta snoRNA :SNORD115
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300082
Macaca mulatta snoRNA :SNORD94Macaca mulatta snoRNA :SNORD94
Macaca_mulatta SNORD94. sequence CAGGCTGTGATGATTGGCGCAGGGGTACGGACCTCAGCTGAGTCATGGGAGCTGAATGT. ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300638
Macaca mulatta snoRNA :SNORA52Macaca mulatta snoRNA :SNORA52
Macaca_mulatta SNORA52. sequence TGGTCCATCCTAATCCCTGCTGGTCCGTCTGTGGCCTGCCAGGTTTCGCTTGTGGACCA. GAGCA ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300644
Macaca mulatta snoRNA :SNORD81Macaca mulatta snoRNA :SNORD81
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300342
Macaca mulatta snoRNA :SNORD30Macaca mulatta snoRNA :SNORD30
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300021
Macaca mulatta snoRNA :SNORA70Macaca mulatta snoRNA :SNORA70
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300136
Macaca mulatta snoRNA :SNORD116Macaca mulatta snoRNA :SNORD116
Macaca_mulatta SNORD116. sequence GGATCGATGATGAGTCCCCTATAAAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGA. GAACTCATACCGTCGTTCTCATCGGATCTGA ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300315
Macaca mulatta snoRNA :SNORA62Macaca mulatta snoRNA :SNORA62
Macaca_mulatta SNORA62. sequence TATTCTTCTTGTTAGAGCTTGGAGTTGAAGCCACTGACTGGCCAATGAACTCACAAGTG. TAGACAGGGTGCTACGCAAGGGACAAATTA ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300640
Macaca mulatta snoRNA :SNORD113Macaca mulatta snoRNA :SNORD113
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300500
Macaca mulatta snoRNA :SNORA51Macaca mulatta snoRNA :SNORA51
Macaca_mulatta SNORA51. sequence AGCCTCCTCGTGCTCAGCATAGGATATGTTATTACCCCAACCAAACAGAAAGAGGAGGC. ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300378
Macaca mulatta Locus STIM1Macaca mulatta Locus STIM1
1001..1702, 109088..109218, 154922..155036, 183754..183865, 187176..187291, 195004..195181, 199533..199710, 207910..208077, 208606..208706, 208989..209224, 212211..212277, 216978..218897 ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=code_seq_info&id=Macaca_mulatta100449
Macaca mulatta Locus ENSMMUG00000001027Macaca mulatta Locus ENSMMUG00000001027
1001..1127, 1608..1790, 2006..2180, 3006..3127, 3373..3557, 4132..4290, 4392..4514, 7734..7946, 8329..8373, 8744..8814, 10310..10496 ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=code_seq_info&id=Macaca_mulatta100427
Macaca mulatta snoRNA :SNORD86Macaca mulatta snoRNA :SNORD86
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300528
Macaca mulatta snoRNA :SNORD25Macaca mulatta snoRNA :SNORD25
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300220
Macaca mulatta Locus ENSMMUG00000000582Macaca mulatta Locus ENSMMUG00000000582
1001..1253, 8447..8523, 10652..10704, 15343..15464, 17821..17957, 22034..22098, 24953..25087, 25658..25803, 27480..27606, 30019..30182, 31713..31847, 32172..32233, 34585..34718, 36374..36513, 36903..37176 ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=code_seq_info&id=Macaca_mulatta100506
Macaca mulatta snoRNA :SNORA77Macaca mulatta snoRNA :SNORA77
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300572
Macaca mulatta snoRNA :SNORD22Macaca mulatta snoRNA :SNORD22
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300227
Macaca mulatta Locus MATR3Macaca mulatta Locus MATR3
1001..1059, 2857..2886, 5116..5197, 5835..5913, 38719..39809, 46103..46164, 47141..47182, 47516..47628, 48486..48538, 49039..49164, 50046..50171, 50801..50968, 52759..52890, 53353..53396, 53488..53857, 56394..56616, 57119..57240, 60317..61347 ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=code_seq_info&id=Macaca_mulatta100499
Macaca mulatta snoRNA :SNORD113Macaca mulatta snoRNA :SNORD113
snOPY is an original database product, copyright Kenmochi Laboratories.
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=sno_info&id=Macaca_mulatta300161
Macaca mulatta Locus Mono:26:SNORA26Macaca mulatta Locus Mono:26:SNORA26
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=code_seq_info&id=Macaca_mulatta100330
Macaca mulatta Locus Mono:156:SNORD22Macaca mulatta Locus Mono:156:SNORD22
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=code_seq_info&id=Macaca_mulatta100089
Macaca mulatta Locus Mono:124:SNORA5Macaca mulatta Locus Mono:124:SNORA5
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights ...
http://snoopy.med.miyazaki-u.ac.jp/snorna_db.cgi?mode=code_seq_info&id=Macaca_mulatta100039
Domain assignment for ENSMMUP00000035121 from Macaca mulatta 76 1Domain assignment for ENSMMUP00000035121 from Macaca mulatta 76 1
... for ENSMMUP00000035121 from Macaca mulatta 76_1. Plus protein sequence and external database links. ... Domain assignment for ENSMMUP00000035121 from Macaca mulatta 76_1. Domain architecture *Other proteins with this domain ...
https://supfam.mrc-lmb.cam.ac.uk/SUPERFAMILY/cgi-bin/gene.cgi?genome=ru&seqid=ENSMMUP00000035121
The rhesus macaque (macaca mulatta) sperm proteome<...The rhesus macaque (macaca mulatta) sperm proteome<...
The rhesus macaque (macaca mulatta) sperm proteome. Sheri Skerget, Matthew Rosenow, Ashoka Polpitiya, Konstantinos Petritis, ... Skerget, S., Rosenow, M., Polpitiya, A., Petritis, K., Dorus, S., & Karr, T. L. (2013). The rhesus macaque (macaca mulatta) ... Skerget, S, Rosenow, M, Polpitiya, A, Petritis, K, Dorus, S & Karr, TL 2013, The rhesus macaque (macaca mulatta) sperm ... The rhesus macaque (macaca mulatta) sperm proteome. / Skerget, Sheri; Rosenow, Matthew; Polpitiya, Ashoka; Petritis, ...
https://experts.syr.edu/en/publications/the-rhesus-macaque-macaca-mulatta-sperm-proteome
Domain assignment for ENSMMUP00000029762 from Macaca mulatta 76 1Domain assignment for ENSMMUP00000029762 from Macaca mulatta 76 1
... for ENSMMUP00000029762 from Macaca mulatta 76_1. Plus protein sequence and external database links. ... Domain assignment for ENSMMUP00000029762 from Macaca mulatta 76_1. Domain architecture *Other proteins with this domain ...
https://supfam.mrc-lmb.cam.ac.uk/SUPERFAMILY/cgi-bin/gene.cgi?genome=ru&seqid=ENSMMUP00000029762
Domain assignment for ENSMMUP00000012442 from Macaca mulatta 76 1Domain assignment for ENSMMUP00000012442 from Macaca mulatta 76 1
... for ENSMMUP00000012442 from Macaca mulatta 76_1. Plus protein sequence and external database links. ... Domain assignment for ENSMMUP00000012442 from Macaca mulatta 76_1. Domain architecture *Other proteins with this domain ...
https://supfam.mrc-lmb.cam.ac.uk/SUPERFAMILY/cgi-bin/gene.cgi?genome=ru&seqid=ENSMMUP00000012442
Domain assignment for ENSMMUP00000034032 from Macaca mulatta 76 1Domain assignment for ENSMMUP00000034032 from Macaca mulatta 76 1
... for ENSMMUP00000034032 from Macaca mulatta 76_1. Plus protein sequence and external database links. ... Domain assignment for ENSMMUP00000034032 from Macaca mulatta 76_1. Domain architecture *Other proteins with this domain ...
https://supfam.mrc-lmb.cam.ac.uk/SUPERFAMILY/cgi-bin/gene.cgi?genome=ru&seqid=ENSMMUP00000034032
MacaqueMonkeysFascicularisMacaquesPrimateGenusZimmermannProteinMRNAIndiaSearch1970AssamensisElectronMulata1798KidneyBiomedicalRhesus monkeys2021CaptiveAnimals
Macaque16
  • Native organism(s) affected: Native macaque Macaca fuscata , vegetation, crops. (go.jp)
  • Systematic review of the rhesus macaque, Macaca mulatta (Zimmermann, 1780). (wisc.edu)
  • NCI: A pale brown macaque, Macaca mulatta. (linkedlifedata.com)
  • The use of a urinary estrone conjugate assay for detection of optimal mating time in the cynomologus macaque ( Macaca fascicularis ). (springer.com)
  • Macaques, especially the Rhesus macaque (Macaca mulatta) are one the species of monkeys commonly used for this purpose. (labroots.com)
  • as, { Macaca maurus }, the moor macaque of the East Indies . (define.com)
  • The cynomolgus macaque ( Macaca fascicularis ), also known as the long-tailed or crab-eating macaque, is an Old World monkey living in Southeast Asia. (biomedcentral.com)
  • We present a spontaneous tumor of the meninges (meningioma) in a female pig-tailed macaque ( Macaca nemestrina ) more than 24 years old. (copernicus.org)
  • Taxonomy and Distribution of Tibetan Macaque (Macaca thibetana). (zoores.ac.cn)
  • The rhesus macaque ( Macaca mulatta ), colloquially rhesus monkey , [4] [5] is a species of Old World monkey . (wikipedia.org)
  • Today, this is known as the Indian rhesus macaque M. m. mulatta , which includes the morphologically similar M. rhesus villosus , described by True in 1894, from Kashmir , and M. m. mcmahoni , described by Pocock in 1932 from Kootai, Pakistan . (wikipedia.org)
  • the two most commonly used in research and testing are the cynomolgus macaque ( Macaca fascicularis ) and the rhesus macaque ( Macaca mulatta ). (nc3rs.org.uk)
  • In this study, we sequenced 32 blood transcriptomes from 16 breast-feeding rhesus macaque ( Macaca mulatta ) infants and their lactating mothers. (zoores.ac.cn)
  • We present a high-quality de novo genome assembly (rheMacS) of the Chinese rhesus macaque ( Macaca mulatta ) using long-read sequencing and multiplatform scaffolding approaches. (nature.com)
  • Rhesus macaque ( Macaca mulatta ) is the most widely studied nonhuman primate (NHP) in biomedical science 1 , and the closest human relative where gene editing has been approved for generating animal models. (nature.com)
  • Suborder: Haplorhini Infraorder: Simiiformes Parvorder: Catarrhini Superfamily: Cercopithecoidea Family: Cercopithecidae (Old World monkeys) Genus: Macaca Assam macaque, M. assamensis NT Rhesus macaque, M. mulatta LC Subfamily: Colobinae Genus: Semnopithecus Tarai gray langur, S. hector NT Nepal gray langur, S. schistaceus LC The elephants comprise three living species and are the largest living land animals. (wikipedia.org)
Monkeys17
  • The socioendocrinology of adolescent development in male rhesus monkeys ( Macaca mulatta ). (wisc.edu)
  • Here we compared the grey matter volume and asymmetry of the PT in chimpanzees and three other species of nonhuman primate in two Genera including vervet monkeys (Chlorocebus aethiops sabaeus), rhesus macaques (Macaca mulatta) and bonnet macaques (Macaca radiata). (nih.gov)
  • Macaca mulatta monkeys infected with the Hackeri strain of Plasmodium fieldi had maximum parasite counts ranging from 1,300 to 301,320/μL. (ajtmh.org)
  • Observations on periodicity, mosquito infection, and transmission to Macaca mulatta monkeys. (ajtmh.org)
  • To learn more about the course of Babesia microti infections in primates, six Macaca mulatta monkeys with blood-induced B. microti infections were followed for 270 days with regular thick blood smears. (ajtmh.org)
  • Alzheimer's Abeta vaccination of rhesus monkeys (Macaca mulatta). (uzh.ch)
  • To examine the mechanisms and consequences of anti-Abeta-antibody formation in a species more closely related to humans, rhesus monkeys (Macaca mulatta) were vaccinated with aggregated Abeta(1-42). (uzh.ch)
  • American Journal of Primatology 11:53-62 (1986) Estradiol Increases Somatomedin-C Concentrations in Adolescent Rhesus Macaques (Macaca mulatta) ERIN L. OSTERUD, SUZETTE LACKEY, AND MARK E. WILSON Yerkes Regional Primate Research Center ofEmory University, Field Station, Lawrenceuille, Georgia Estradiol (E2) may enhance somatomedin-C(Sm-C)secretion during puberty in female rhesus monkeys. (docme.ru)
  • Alzheimer A beta vaccination of rhesus monkeys (Macaca mulatta. (mysciencework.com)
  • Role of metallothionein in metal detoxification and metal tolerance in protein calorie malnutrition and calcium deficient monkeys (Macaca mulatta). (semanticscholar.org)
  • To determine the viewer-dependent factors in the scanpaths of monkeys, we trained three adult males (Macaca mulatta) to look for 3 s at images of conspecific facial expressions with either direct or averted gaze. (elsevier.com)
  • Gibboni, RR, Zimmerman, PE & Gothard, KM 2009, ' Individual differences in scanpaths correspond with serotonin transporter genotype and behavioral phenotype in rhesus monkeys (Macaca mulatta) ', Frontiers in Behavioral Neuroscience , vol. 3, no. (elsevier.com)
  • Non-reversal shifts after selective prefrontal ablations in monkeys (Macaca mulatta). (ox.ac.uk)
  • Nursery-Rearing of Infant Rhesus Monkeys(Macaca mulatta). (zoores.ac.cn)
  • Here, we tested the hypothesis that the number and morphology (straight, curved, or donut-shaped) of mitochondria in dlPFC presynaptic boutons are altered with aging and menopause in rhesus monkeys ( Macaca mulatta ) and that these metrics correlate with delayed response (DR) accuracy, a well-characterized measure of dlPFC-dependent working memory. (pnas.org)
  • Pre-clinical toxicity & immunobiological evaluation of DNA rabies vaccine & combination rabies vaccine in rhesus monkeys (Macaca mulatta). (bvsalud.org)
  • Macaca mulatta (rhesus) Macaca fascicularis (cynomolgus) The Wisconsin National Primate Research Center is home to about 1,100 rhesus monkeys and 100 cyno-molgus monkeys. (sputtr.com)
Fascicularis3
  • All the species of Macaca (except for M. cyclopis , M. fascicularis , M. mulatta , and M. fuscata ) are designated as Uncategorized Alien Species by the Invasive Alien Species Act (import and keeping in Japan require 6 months investigation for risk assessment). (go.jp)
  • Cynomolgus macaques ( Macaca fascicularis ) are widely used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as rhesus macaques ( M. mulatta ). (biomedcentral.com)
  • The TNF-α promoter region was sequenced in a sample of 40 macaques including five M. mulatta of Chinese and Indian ancestry and 35 M. fascicularis of Malaysian, Mauritian, Indonesian, and Philippine ancestry. (elsevier.com)
Macaques17
  • A four-year study of the association between male dominance rank, residency status, and reproductive activity in rhesus macaques ( Macaca mulatta ). (wisc.edu)
  • A longitudinal study of age-specific reproductive output and body condition among male rhesus macaques, Macaca mulatta . (wisc.edu)
  • Geophagy as a therapeutic mediator of endoparasitism in a free-ranging group of rhesus macaques ( Macaca mulatta ). (wisc.edu)
  • A new SARS animal model was established by inoculating SARS coronavirus (SARS-CoV) into rhesus macaques (Macaca mulatta) through the nasal cavity. (nih.gov)
  • To evaluate the role of female skin color in the context of sexual signaling further, we investigated whether changes in sexual skin color contain information about the timing of the fertile phase in rhesus macaques ( Macaca mulatta ), a species in which adult females do not develop sexual swellings, but do express visually detectable changes in the skin color of the face and hindquarters. (springer.com)
  • Rhesus macaques ( Macaca mulatta ) are the most widely studied nonhuman primate. (upenn.edu)
  • Estradiol increases somatomedin-C concentrations in adolescent rhesus macaques (Macaca mulatta). (docme.ru)
  • A genus of macaques including the rhesus monkey ({ Macaca mulatta }), much used in laboratory biomedical research . (define.com)
  • Here, we use a captive new group formation of rhesus macaques ( Macaca mulatta ) as a model of social instability during fusions and examine differences in male and female chronic stress responses to male-pattern and female-pattern trauma (i.e., trauma inflicted by males or by females, respectively). (springer.com)
  • Beisner BA, Vandeleest JJ, Hsieh F, Fujii K, McCowan B (2014) Mean dominance relationship certainty is better than rank at predicting diarrhea incidence and wounding in captive rhesus macaques ( Macaca mulatta ). (springer.com)
  • The signaling context has been found to change the meaning of the silent bared-teeth display (SBT) in pigtail macaques (Macaca nemestrina) such that the SBT in apparently peaceful contexts communicates subordination, a long-term pattern of behavior, whereas in conflict contexts it communicates immediate submission (PNAS, 104: 1581-1586). (cdc.gov)
  • Although macaques (Macaca spp. (elsevier.com)
  • Indian-origin rhesus macaques (Macaca mulatta) have long served as an animal model for the study of human disease and behavior. (elsevier.com)
  • The Relationship Between Kinship and Grooming in the Tanaxpillo Colony of Stumptail Macaques ( Macaca arctoides ), by K. R. Crooks & D. R. Rasmussen. (brown.edu)
  • A colony of stumptail macaques ( Macaca arctoides ) living on Tanaxpillo Island in Lake Catemaco, Mexico, forms a major tourist attraction in Veracruz State (Jolly & Rasmussen, 1991). (brown.edu)
  • Odontogenic Abscesses in Rhesus Macaques (Macaca mulatta) of Cayo Sant" by Hong Li, Wenjing Luo et al. (unlv.edu)
  • Lactational Performance in primiparous and multiparous captive rhesus macaques ( Macaca mulatta ) American Society of Primatologists Meeting, San Antonio, Texas, August. (sputtr.com)
Primate1
  • A medium-sized diurnal primate, the Macaca mulatta has a diet of plant material and insects that it can store in pouches in its mouth. (linkedlifedata.com)
Genus5
  • A species of the genus MACACA inhabiting India, China, and other parts of Asia. (definitions.net)
  • Suborder: Odontoceti Superfamily: Platanistoidea Family: Platanistidae Genus: Platanista South Asian river dolphin, P. gangetica EN The bats' most distinguishing feature is that their forelimbs are developed as wings, making them the only mammals capable of flight. (wikipedia.org)
  • Family: Ochotonidae (pikas) Genus: Ochotona Black-lipped pika, O. curzoniae LC Himalayan pika, O. himalayana LC Large-eared pika, O. macrotis LC Nubra pika, O. nubrica LC Royle's pika, O. roylei LC Family: Leporidae (rabbits, hares) Genus: Caprolagus Hispid hare, C. hispidus EN Genus: Lepus Indian hare, L. nigricollis LC Woolly hare, L. oiostolus LC --- The odd-toed ungulates are browsing and grazing mammals. (wikipedia.org)
  • Family: Elephantidae (elephants) Genus: Elephas Asian elephant, E. maximus EN Rodents make up the largest order of mammals, with over 40% of mammalian species. (wikipedia.org)
  • Family: Manidae Genus: Manis Indian pangolin, M. crassicaudata EN Chinese pangolin, M. pentadactyla CR The following species are locally extinct in the country: Tibetan antelope, Pantholops hodgsonii Pygmy hog, Porcula salvanius List of chordate orders Lists of mammals by region List of prehistoric mammals Mammal classification List of mammals described in the 2000s IUCN SSC Antelope Specialist Group (2016). (wikipedia.org)
Zimmermann1
  • [ 3 ] Agora o seu nome científico é Macaca mulatta (Zimmermann, 1780), que é máis antigo. (wikipedia.org)
Protein1
  • Genetic Diversity Among Macaca mulatta From Six Regions in Yunnan Province Based on Protein Electrophoresis. (zoores.ac.cn)
MRNA3
  • Macaca mulatta ubiquitin specific peptidase 33 (USP33), transcript variant X1, mRNA. (genscript.com)
  • Macaca mulatta lin-7 homolog C, crumbs cell polarity complex component (LIN7C), mRNA. (genscript.com)
  • Studies on Immunohistochemistry and In situ Hybridization of Calcitonin Gene-Related Peptide and Its mRNA In Lungs of Macaca mulatta. (zoores.ac.cn)
India3
  • Os límites de distribución sur e norte do M. mulatta e do M. radiata , actualmente corren paralelamente un doutro na parte oeste da India, están separados por un gran espazo no centro e converxen na costa leste da península para formar unha zona de distribución solapada. (wikipedia.org)
  • A extensión da área de distribución do macaco rhesus, debido a un proceso natural nalgunhas áreas e unha consecuencia directa da introdución polos humanos noutras, ten graves implicacións para as poboacións en declive ou endémicas dos M. radiata no sur da India. (wikipedia.org)
  • Hoxe, esa poboación coñécese como macaco rhesus da India, M. m. mulatta , que inclúe os morfoloxicamene similares M. rhesus villosus , descrito por True en 1894, de Caxemira , e M. m. mcmahoni , descrito por Pocock en 1932, de Kootai, Paquistán . (wikipedia.org)
Search1
  • To find current references for Macaca mulatta , search PrimateLit . (wisc.edu)
19701
  • Zurich 1970, vol. 3, pp. 180-191 87 ( Karger, Basel 1971) Sexual Climax in Female Macaca mulatta FRANCES D. BURTON Department of Anthropology, University of Toronto, Toronto Permission to reprint this article here was kindly given by S. Karger, AG. (sputtr.com)
Assamensis1
Electron1
  • Marsh, Loyal Douglas, "The ductuli efferentes in Macaca mulatta : electron microscopic evaluation of changes after vasectomy" (1980). (pdx.edu)
Mulata1
  • After leaving the group, Chinchilla formed a new band, Macaca Mulata, with former members of London Punk band, Rhesus. (wikipedia.org)
17981
  • O seu nome común de macaco rhesus procede do que lle deu o naturalista francés Jean-Baptiste Audebert , que o chamou Macaca rhesus (Audebert, 1798). (wikipedia.org)
Kidney1
Biomedical1
  • Macaca mulatta } is the { Rhesus monkey }, much used in biomedical research , and namesake of the Rh factor used in blood typing ( due to discovery of that factor in the Rhesus monkey ). (define.com)
Rhesus monkeys1
  • Her first publication emanating from this study was published in April 2019 in the American Journal of Primatology: "A descriptive analysis of gut microbiota composition in differentially reared infant rhesus monkeys ( Macaca mulatta ) across the first 6 months of life. (asp.org)
20211
  • 2021. Happiness, welfare, and personality in rhesus macaques (Macaca mulatta). (awionline.org)
Captive1
  • 2018. Coping style and cortisol levels in infancy predict hair cortisol following new group formation in captive rhesus macaques (Macaca mulatta). (awionline.org)
Animals1
  • We present data of genetic analyses in an old closed colony of rhesus macaques (Macaca mulatta) that was established in 1932 with 100 animals. (elsevier.com)

No images available that match "macaca mulatta"