A diverse class of enzymes that interact with UBIQUITIN-CONJUGATING ENZYMES and ubiquitination-specific protein substrates. Each member of this enzyme group has its own distinct specificity for a substrate and ubiquitin-conjugating enzyme. Ubiquitin-protein ligases exist as both monomeric proteins multiprotein complexes.
Poly(deoxyribonucleotide):poly(deoxyribonucleotide)ligases. Enzymes that catalyze the joining of preformed deoxyribonucleotides in phosphodiester linkage during genetic processes during repair of a single-stranded break in duplex DNA. The class includes both EC 6.5.1.1 (ATP) and EC 6.5.1.2 (NAD).
A subset of ubiquitin protein ligases that are formed by the association of a SKP DOMAIN PROTEIN, a CULLIN DOMAIN PROTEIN and a F-BOX DOMAIN PROTEIN.
A family of structurally related proteins that were originally discovered for their role in cell-cycle regulation in CAENORHABDITIS ELEGANS. They play important roles in regulation of the CELL CYCLE and as components of UBIQUITIN-PROTEIN LIGASES.
The act of ligating UBIQUITINS to PROTEINS to form ubiquitin-protein ligase complexes to label proteins for transport to the PROTEASOME ENDOPEPTIDASE COMPLEX where proteolysis occurs.
Catalyze the joining of preformed ribonucleotides or deoxyribonucleotides in phosphodiester linkage during genetic processes. EC 6.5.1.
A highly conserved 76-amino acid peptide universally found in eukaryotic cells that functions as a marker for intracellular PROTEIN TRANSPORT and degradation. Ubiquitin becomes activated through a series of complicated steps and forms an isopeptide bond to lysine residues of specific proteins within the cell. These "ubiquitinated" proteins can be recognized and degraded by proteosomes or be transported to specific compartments within the cell.
A zinc-binding domain defined by the sequence Cysteine-X2-Cysteine-X(9-39)-Cysteine-X(l-3)-His-X(2-3)-Cysteine-X2-Cysteine -X(4-48)-Cysteine-X2-Cysteine, where X is any amino acid. The RING finger motif binds two atoms of zinc, with each zinc atom ligated tetrahedrally by either four cysteines or three cysteines and a histidine. The motif also forms into a unitary structure with a central cross-brace region and is found in many proteins that are involved in protein-protein interactions. The acronym RING stands for Really Interesting New Gene.
Enzymes that catalyze the formation of acyl-CoA derivatives. EC 6.2.1.
A class of enzymes that form a thioester bond to UBIQUITIN with the assistance of UBIQUITIN-ACTIVATING ENZYMES. They transfer ubiquitin to the LYSINE of a substrate protein with the assistance of UBIQUITIN-PROTEIN LIGASES.
An enzyme that catalyzes the conversion of linear RNA to a circular form by the transfer of the 5'-phosphate to the 3'-hydroxyl terminus. It also catalyzes the covalent joining of two polyribonucleotides in phosphodiester linkage. EC 6.5.1.3.
A family of proteins that share the F-BOX MOTIF and are involved in protein-protein interactions. They play an important role in process of protein ubiquition by associating with a variety of substrates and then associating into SCF UBIQUITIN LIGASE complexes. They are held in the ubiquitin-ligase complex via binding to SKP DOMAIN PROTEINS.
A set of protein subcomplexes involved in PROTEIN SORTING of UBIQUITINATED PROTEINS into intraluminal vesicles of MULTIVESICULAR BODIES and in membrane scission during formation of intraluminal vesicles, during the final step of CYTOKINESIS, and during the budding of enveloped viruses. The ESCRT machinery is comprised of the protein products of Class E vacuolar protein sorting genes.
A family of proteins that are structurally-related to Ubiquitin. Ubiquitins and ubiquitin-like proteins participate in diverse cellular functions, such as protein degradation and HEAT-SHOCK RESPONSE, by conjugation to other proteins.
A large multisubunit complex that plays an important role in the degradation of most of the cytosolic and nuclear proteins in eukaryotic cells. It contains a 700-kDa catalytic sub-complex and two 700-kDa regulatory sub-complexes. The complex digests ubiquitinated proteins and protein activated via ornithine decarboxylase antizyme.
Ligases that catalyze the joining of adjacent AMINO ACIDS by the formation of carbon-nitrogen bonds between their carboxylic acid groups and amine groups.
Complexes of enzymes that catalyze the covalent attachment of UBIQUITIN to other proteins by forming a peptide bond between the C-terminal GLYCINE of UBIQUITIN and the alpha-amino groups of LYSINE residues in the protein. The complexes play an important role in mediating the selective-degradation of short-lived and abnormal proteins. The complex of enzymes can be broken down into three components that involve activation of ubiquitin (UBIQUITIN-ACTIVATING ENZYMES), conjugation of ubiquitin to the ligase complex (UBIQUITIN-CONJUGATING ENZYMES), and ligation of ubiquitin to the substrate protein (UBIQUITIN-PROTEIN LIGASES).
An oligomer formed from the repetitive linking of the C-terminal glycine of one UBIQUITIN molecule via an isopeptide bond to a lysine residue on a second ubiquitin molecule. It is structurally distinct from UBIQUITIN C, which is a single protein containing a tandemly arrayed ubiquitin peptide sequence.
A class of enzymes that catalyzes the ATP-dependent formation of a thioester bond between itself and UBIQUITIN. It then transfers the activated ubiquitin to one of the UBIQUITIN-PROTEIN LIGASES.
Enzymes that catalyze the joining of two molecules by the formation of a carbon-oxygen bond. EC 6.1.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Proto-oncogene proteins that negatively regulate RECEPTOR PROTEIN-TYROSINE KINASE signaling. It is a UBIQUITIN-PROTEIN LIGASE and the cellular homologue of ONCOGENE PROTEIN V-CBL.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Cleavage of proteins into smaller peptides or amino acids either by PROTEASES or non-enzymatically (e.g., Hydrolysis). It does not include Protein Processing, Post-Translational.
A family of structurally-related proteins that were originally identified by their ability to complex with cyclin proteins (CYCLINS). They share a common domain that binds specifically to F-BOX MOTIFS. They take part in SKP CULLIN F-BOX PROTEIN LIGASES, where they can bind to a variety of F-BOX PROTEINS.
A family of structurally related proteins that are constitutively expressed and that negatively regulate cytokine-mediated SIGNAL TRANSDUCTION PATHWAYS. PIAS proteins inhibit the activity of signal transducers and activators of transcription.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
A 1.5-kDa small ubiquitin-related modifier protein that can covalently bind via an isopeptide link to a number of cellular proteins. It may play a role in intracellular protein transport and a number of other cellular processes.
A class of structurally related proteins of 12-20 kDa in size. They covalently modify specific proteins in a manner analogous to UBIQUITIN.
A type of POST-TRANSLATIONAL PROTEIN MODIFICATION by SMALL UBIQUITIN-RELATED MODIFIER PROTEINS (also known as SUMO proteins).
Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.
Adenine nucleotide containing one phosphate group esterified to the sugar moiety in the 2'-, 3'-, or 5'-position.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Transport proteins that carry specific substances in the blood or across cell membranes.
Derangement in size and number of muscle fibers occurring with aging, reduction in blood supply, or following immobilization, prolonged weightlessness, malnutrition, and particularly in denervation.
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
Macromolecular complexes formed from the association of defined protein subunits.
Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.
Cell surface receptors for AUTOCRINE MOTILITY FACTOR, which is the secreted form of GLUCOSE-6-PHOSPHATE ISOMERASE. The receptor has an unusual composition in that it shares some structural similarities with G-PROTEIN-COUPLED RECEPTORS and functions as an ubiquitin protein ligase when internalized.
An E3 ubiquitin ligase primarily involved in regulation of the metaphase-to-anaphase transition during MITOSIS through ubiquitination of specific CELL CYCLE PROTEINS. Enzyme activity is tightly regulated through subunits and cofactors, which modulate activation, inhibition, and substrate specificity. The anaphase-promoting complex, or APC-C, is also involved in tissue differentiation in the PLACENTA, CRYSTALLINE LENS, and SKELETAL MUSCLE, and in regulation of postmitotic NEURONAL PLASTICITY and excitability.
A cell line generated from human embryonic kidney cells that were transformed with human adenovirus type 5.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
An essential amino acid. It is often added to animal feed.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Screening techniques first developed in yeast to identify genes encoding interacting proteins. Variations are used to evaluate interplay between proteins and other molecules. Two-hybrid techniques refer to analysis for protein-protein interactions, one-hybrid for DNA-protein interactions, three-hybrid interactions for RNA-protein interactions or ligand-based interactions. Reverse n-hybrid techniques refer to analysis for mutations or other small molecules that dissociate known interactions.
Established cell cultures that have the potential to propagate indefinitely.
Proteins that originate from plants species belonging to the genus ARABIDOPSIS. The most intensely studied species of Arabidopsis, Arabidopsis thaliana, is commonly used in laboratory experiments.
Members of the peptidase C19 family which regulate signal transduction by removing UBIQUITIN from specific protein substrates via a process known as deubiquitination or deubiquitylation.
Any of various enzymatically catalyzed post-translational modifications of PEPTIDES or PROTEINS in the cell of origin. These modifications include carboxylation; HYDROXYLATION; ACETYLATION; PHOSPHORYLATION; METHYLATION; GLYCOSYLATION; ubiquitination; oxidation; proteolysis; and crosslinking and result in changes in molecular weight and electrophoretic motility.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
The protein constituents of muscle, the major ones being ACTINS and MYOSINS. More than a dozen accessory proteins exist including TROPONIN; TROPOMYOSIN; and DYSTROPHIN.
The aggregation of soluble ANTIGENS with ANTIBODIES, alone or with antibody binding factors such as ANTI-ANTIBODIES or STAPHYLOCOCCAL PROTEIN A, into complexes large enough to fall out of solution.
The reconstruction of a continuous two-stranded DNA molecule without mismatch from a molecule which contained damaged regions. The major repair mechanisms are excision repair, in which defective regions in one strand are excised and resynthesized using the complementary base pairing information in the intact strand; photoreactivation repair, in which the lethal and mutagenic effects of ultraviolet light are eliminated; and post-replication repair, in which the primary lesions are not repaired, but the gaps in one daughter duplex are filled in by incorporation of portions of the other (undamaged) daughter duplex. Excision repair and post-replication repair are sometimes referred to as "dark repair" because they do not require light.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The facilitation of biochemical reactions with the aid of naturally occurring catalysts such as ENZYMES.
An enzyme that catalyzes the transfer of a phosphate group to the 5'-terminal hydroxyl groups of DNA and RNA. EC 2.7.1.78.
Hydrolases that specifically cleave the peptide bonds found in PROTEINS and PEPTIDES. Examples of sub-subclasses for this group include EXOPEPTIDASES and ENDOPEPTIDASES.
An E3 UBIQUITIN LIGASE that interacts with and inhibits TUMOR SUPPRESSOR PROTEIN P53. Its ability to ubiquitinate p53 is regulated by TUMOR SUPPRESSOR PROTEIN P14ARF.
A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.
Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.
Virulent bacteriophage and type species of the genus T4-like phages, in the family MYOVIRIDAE. It infects E. coli and is the best known of the T-even phages. Its virion contains linear double-stranded DNA, terminally redundant and circularly permuted.
The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.
A degradation process whereby incorrectly folded proteins are selectively transported out of the ENDOPLASMIC RETICULUM and into the CYTOSOL. The misfolded proteins are subsequently ubiquitinated and degraded by the PROTEASOME.
The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Protein modules with conserved ligand-binding surfaces which mediate specific interaction functions in SIGNAL TRANSDUCTION PATHWAYS and the specific BINDING SITES of their cognate protein LIGANDS.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A thioester hydrolase which acts on esters formed between thiols such as DITHIOTHREITOL or GLUTATHIONE and the C-terminal glycine residue of UBIQUITIN.
A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.
The ability of a protein to retain its structural conformation or its activity when subjected to physical or chemical manipulations.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Systems of enzymes which function sequentially by catalyzing consecutive reactions linked by common metabolic intermediates. They may involve simply a transfer of water molecules or hydrogen atoms and may be associated with large supramolecular structures such as MITOCHONDRIA or RIBOSOMES.
The relationships of groups of organisms as reflected by their genetic makeup.
Together with the Apc2 subunit, forms the catalytic core of the E3 ubiquitin ligase, anaphase-promoting complex-cyclosome. It has a RING H2 domain which interacts with the cullin domain of Apc2. Apc11 also interacts with the E2 ubiquitin ligases involved in APC-C ubiquitination reactions.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.
Proteins prepared by recombinant DNA technology.
Injuries to DNA that introduce deviations from its normal, intact structure and which may, if left unrepaired, result in a MUTATION or a block of DNA REPLICATION. These deviations may be caused by physical or chemical agents and occur by natural or unnatural, introduced circumstances. They include the introduction of illegitimate bases during replication or by deamination or other modification of bases; the loss of a base from the DNA backbone leaving an abasic site; single-strand breaks; double strand breaks; and intrastrand (PYRIMIDINE DIMERS) or interstrand crosslinking. Damage can often be repaired (DNA REPAIR). If the damage is extensive, it can induce APOPTOSIS.
An order of stalked, sessile, single-celled EUKARYOTES. They are considered the transitional link between the flagellated protozoa and the SPONGES, the most primitive metazoans.
Proteins and peptides that are involved in SIGNAL TRANSDUCTION within the cell. Included here are peptides and proteins that regulate the activity of TRANSCRIPTION FACTORS and cellular processes in response to signals from CELL SURFACE RECEPTORS. Intracellular signaling peptide and proteins may be part of an enzymatic signaling cascade or act through binding to and modifying the action of other signaling factors.
An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in plants.
Proteins covalently modified with UBIQUITINS or UBIQUITIN-LIKE PROTEINS.
A group of alicyclic hydrocarbons with the general formula R-C5H9.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
A single protein comprised of tandem repeats of the UBIQUITIN 78-amino acid sequence. It is a product of the polyubiquitin gene which contains multiple copies of the ubiquitin coding sequence. Proteolytic processing of ubiquitin C results in the formation of individual ubiquitin molecules. This protein is distinct from POLYUBIQUITIN, which is a protein formed through isopeptide linkage of multiple ubiquitin species.
A genus of ascomycetous fungi of the family Schizosaccharomycetaceae, order Schizosaccharomycetales.
Enzymes that catalyze the joining of two molecules by the formation of a carbon-sulfur bond. EC 6.2.
Methods for determining interaction between PROTEINS.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
ENDOPEPTIDASES which have a cysteine involved in the catalytic process. This group of enzymes is inactivated by CYSTEINE PROTEINASE INHIBITORS such as CYSTATINS and SULFHYDRYL REAGENTS.
Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.
Gram-negative aerobic rods found in warm water (40-79 degrees C) such as hot springs, hot water tanks, and thermally polluted rivers.
Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
The artificial induction of GENE SILENCING by the use of RNA INTERFERENCE to reduce the expression of a specific gene. It includes the use of DOUBLE-STRANDED RNA, such as SMALL INTERFERING RNA and RNA containing HAIRPIN LOOP SEQUENCE, and ANTI-SENSE OLIGONUCLEOTIDES.
Compounds that inhibit the function or proteolytic action of the PROTEASOME.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
The rate dynamics in chemical or physical systems.
A family of large icosahedral DNA viruses infecting insects and poikilothermic vertebrates. Genera include IRIDOVIRUS; RANAVIRUS; Chloriridovirus; Megalocytivirus; and Lymphocystivirus.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
A ubiquitin-protein ligase that mediates OXYGEN-dependent polyubiquitination of HYPOXIA-INDUCIBLE FACTOR 1, ALPHA SUBUNIT. It is inactivated in VON HIPPEL-LINDAU SYNDROME.
A conserved class of proteins that control APOPTOSIS in both VERTEBRATES and INVERTEBRATES. IAP proteins interact with and inhibit CASPASES, and they function as ANTI-APOPTOTIC PROTEINS. The protein class is defined by an approximately 80-amino acid motif called the baculoviral inhibitor of apoptosis repeat.
Motifs in DNA- and RNA-binding proteins whose amino acids are folded into a single structural unit around a zinc atom. In the classic zinc finger, one zinc atom is bound to two cysteines and two histidines. In between the cysteines and histidines are 12 residues which form a DNA binding fingertip. By variations in the composition of the sequences in the fingertip and the number and spacing of tandem repeats of the motif, zinc fingers can form a large number of different sequence specific binding sites.
A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymes
Nuclear phosphoprotein encoded by the p53 gene (GENES, P53) whose normal function is to control CELL PROLIFERATION and APOPTOSIS. A mutant or absent p53 protein has been found in LEUKEMIA; OSTEOSARCOMA; LUNG CANCER; and COLORECTAL CANCER.
Proteins obtained from the species Schizosaccharomyces pombe. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
An increased tendency of the GENOME to acquire MUTATIONS when various processes involved in maintaining and replicating the genome are dysfunctional.
Interruptions in the sugar-phosphate backbone of DNA, across both strands adjacently.
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
Enzymes that catalyze the joining of either ammonia or an amide with another molecule, in which the linkage is in the form of a carbon-nitrogen bond. EC 6.3.1.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
A system of cisternae in the CYTOPLASM of many cells. In places the endoplasmic reticulum is continuous with the plasma membrane (CELL MEMBRANE) or outer membrane of the nuclear envelope. If the outer surfaces of the endoplasmic reticulum membranes are coated with ribosomes, the endoplasmic reticulum is said to be rough-surfaced (ENDOPLASMIC RETICULUM, ROUGH); otherwise it is said to be smooth-surfaced (ENDOPLASMIC RETICULUM, SMOOTH). (King & Stansfield, A Dictionary of Genetics, 4th ed)
A guanine nucleotide containing one phosphate group esterified to the sugar moiety and found widely in nature.
PLANTS, or their progeny, whose GENOME has been altered by GENETIC ENGINEERING.
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
A cell line derived from cultured tumor cells.
The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
A part of the embryo in a seed plant. The number of cotyledons is an important feature in classifying plants. In seeds without an endosperm, they store food which is used in germination. In some plants, they emerge above the soil surface and become the first photosynthetic leaves. (From Concise Dictionary of Biology, 1990)
Release of a virus from the host cell following VIRUS ASSEMBLY and maturation. Egress can occur by host cell lysis, EXOCYTOSIS, or budding through the plasma membrane.
Proteins found in any species of bacterium.
A group of cell cycle proteins that negatively regulate the activity of CYCLIN/CYCLIN-DEPENDENT KINASE complexes. They inhibit CELL CYCLE progression and help control CELL PROLIFERATION following GENOTOXIC STRESS as well as during CELL DIFFERENTIATION.
A family of DNA plant viruses that infect eukaryotic algae.
Proteins produced from GENES that have acquired MUTATIONS.
A subclass of PEPTIDE HYDROLASES that catalyze the internal cleavage of PEPTIDES or PROTEINS.
Enzymes that catalyze the joining of glutamine-derived ammonia and another molecule. The linkage is in the form of a carbon-nitrogen bond. EC 6.3.5.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
A family of double-stranded DNA viruses infecting mammals (including humans), birds and insects. There are two subfamilies: CHORDOPOXVIRINAE, poxviruses of vertebrates, and ENTOMOPOXVIRINAE, poxviruses of insects.
Anaerobic hyperthermophilic species of ARCHAEA, isolated from hydrothermal fluid samples. It is obligately heterotrophic with coccoid cells that require TRYPTOPHAN for growth.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
A process that changes the nucleotide sequence of mRNA from that of the DNA template encoding it. Some major classes of RNA editing are as follows: 1, the conversion of cytosine to uracil in mRNA; 2, the addition of variable number of guanines at pre-determined sites; and 3, the addition and deletion of uracils, templated by guide-RNAs (RNA, GUIDE).
A subtype of striated muscle, attached by TENDONS to the SKELETON. Skeletal muscles are innervated and their movement can be consciously controlled. They are also called voluntary muscles.
Proteins to which calcium ions are bound. They can act as transport proteins, regulator proteins, or activator proteins. They typically contain EF HAND MOTIFS.
New abnormal growth of tissue. Malignant neoplasms show a greater degree of anaplasia and have the properties of invasion and metastasis, compared to benign neoplasms.
Processes involved in the formation of TERTIARY PROTEIN STRUCTURE.
The assembly of the QUATERNARY PROTEIN STRUCTURE of multimeric proteins (MULTIPROTEIN COMPLEXES) from their composite PROTEIN SUBUNITS.
Proteins found in any species of virus.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.
A coenzyme composed of ribosylnicotinamide 5'-diphosphate coupled to adenosine 5'-phosphate by pyrophosphate linkage. It is found widely in nature and is involved in numerous enzymatic reactions in which it serves as an electron carrier by being alternately oxidized (NAD+) and reduced (NADH). (Dorland, 27th ed)
The extent to which an enzyme retains its structural conformation or its activity when subjected to storage, isolation, and purification or various other physical or chemical manipulations, including proteolytic enzymes and heat.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
Single chains of amino acids that are the units of multimeric PROTEINS. Multimeric proteins can be composed of identical or non-identical subunits. One or more monomeric subunits may compose a protomer which itself is a subunit structure of a larger assembly.
Large, multinucleate single cells, either cylindrical or prismatic in shape, that form the basic unit of SKELETAL MUSCLE. They consist of MYOFIBRILS enclosed within and attached to the SARCOLEMMA. They are derived from the fusion of skeletal myoblasts (MYOBLASTS, SKELETAL) into a syncytium, followed by differentiation.
Cellular uptake of extracellular materials within membrane-limited vacuoles or microvesicles. ENDOSOMES play a central role in endocytosis.
Proteins that are normally involved in holding cellular growth in check. Deficiencies or abnormalities in these proteins may lead to unregulated cell growth and tumor development.
A class of enzymes that transfers nucleotidyl residues. EC 2.7.7.
A non-essential amino acid that occurs in high levels in its free state in plasma. It is produced from pyruvate by transamination. It is involved in sugar and acid metabolism, increases IMMUNITY, and provides energy for muscle tissue, BRAIN, and the CENTRAL NERVOUS SYSTEM.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
A species of fruit fly much used in genetics because of the large size of its chromosomes.
A family of conserved cell surface receptors that contain EPIDERMAL GROWTH FACTOR repeats in their extracellular domain and ANKYRIN repeats in their cytoplasmic domains. The cytoplasmic domain of notch receptors is released upon ligand binding and translocates to the CELL NUCLEUS where it acts as transcription factor.
An inhibitory smad protein that associates with TRANSFORMING GROWTH FACTOR BETA RECEPTORS and BONE MORPHOGENETIC PROTEIN RECEPTORS. It negatively regulates SIGNAL TRANSDUCTION PATHWAYS by inhibiting PHOSPHORYLATION of RECEPTOR-REGULATED SMAD PROTEINS.
The process by which two molecules of the same chemical composition form a condensation product or polymer.
A general term for single-celled rounded fungi that reproduce by budding. Brewers' and bakers' yeasts are SACCHAROMYCES CEREVISIAE; therapeutic dried yeast is YEAST, DRIED.
A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.
Technique for limiting use, activity, or movement by immobilizing or restraining animal by suspending from hindlimbs or tails. This immobilization is used to simulate some effects of reduced gravity and study weightlessness physiology.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
Cells of the higher organisms, containing a true nucleus bounded by a nuclear membrane.
Abscission-accelerating plant growth substance isolated from young cotton fruit, leaves of sycamore, birch, and other plants, and from potatoes, lemons, avocados, and other fruits.
A subclass of enzymes that aminoacylate AMINO ACID-SPECIFIC TRANSFER RNA with their corresponding AMINO ACIDS.
An inhibitor of apoptosis protein that is translated by a rare cap-independent mechanism. It blocks caspase-mediated cellular destruction by inhibiting CASPASE 3; CASPASE 7; and CASPASE 9.
Proteins found in any species of fungus.
An octanoic acid bridged with two sulfurs so that it is sometimes also called a pentanoic acid in some naming schemes. It is biosynthesized by cleavage of LINOLEIC ACID and is a coenzyme of oxoglutarate dehydrogenase (KETOGLUTARATE DEHYDROGENASE COMPLEX). It is used in DIETARY SUPPLEMENTS.
A broad category of proteins involved in the formation, transport and dissolution of TRANSPORT VESICLES. They play a role in the intracellular transport of molecules contained within membrane vesicles. Vesicular transport proteins are distinguished from MEMBRANE TRANSPORT PROTEINS, which move molecules across membranes, by the mode in which the molecules are transported.
CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Graphs representing sets of measurable, non-covalent physical contacts with specific PROTEINS in living organisms or in cells.
Nuclear antigen with a role in DNA synthesis, DNA repair, and cell cycle progression. PCNA is required for the coordinated synthesis of both leading and lagging strands at the replication fork during DNA replication. PCNA expression correlates with the proliferation activity of several malignant and non-malignant cell types.
A phylum of anoxygenic, phototrophic bacteria including the family Chlorobiaceae. They occur in aquatic sediments, sulfur springs, and hot springs and utilize reduced sulfur compounds instead of oxygen.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.
Any of the hormones produced naturally in plants and active in controlling growth and other functions. There are three primary classes: auxins, cytokinins, and gibberellins.
The repair of DOUBLE-STRAND DNA BREAKS by rejoining the broken ends of DNA to each other directly.
Enzymes that catalyze the first step leading to the oxidation of succinic acid by the reversible formation of succinyl-CoA from succinate and CoA with the concomitant cleavage of ATP to ADP (EC 6.2.1.5) or GTP to GDP (EC 6.2.1.4) and orthophosphate. Itaconate can act instead of succinate and ITP instead of GTP.EC 6.2.1.-.
Hydroxycinnamic acid and its derivatives. Act as activators of the indoleacetic acid oxidizing system, thereby producing a decrease in the endogenous level of bound indoleacetic acid in plants.
That portion of the electromagnetic spectrum immediately below the visible range and extending into the x-ray frequencies. The longer wavelengths (near-UV or biotic or vital rays) are necessary for the endogenous synthesis of vitamin D and are also called antirachitic rays; the shorter, ionizing wavelengths (far-UV or abiotic or extravital rays) are viricidal, bactericidal, mutagenic, and carcinogenic and are used as disinfectants.
Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.
The process by which a DNA molecule is duplicated.
A hemoflagellate subspecies of parasitic protozoa that causes nagana in domestic and game animals in Africa. It apparently does not infect humans. It is transmitted by bites of tsetse flies (Glossina).
The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.
A group of acylated oligopeptides produced by Actinomycetes that function as protease inhibitors. They have been known to inhibit to varying degrees trypsin, plasmin, KALLIKREINS, papain and the cathepsins.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
Viruses whose nucleic acid is DNA.
Peptides composed of two amino acid units.

The human F box protein beta-Trcp associates with the Cul1/Skp1 complex and regulates the stability of beta-catenin. (1/2980)

Ubiquitin-conjugation targets numerous cellular regulators for proteasome-mediated degradation. Thus, the identification of ubiquitin ligases and their physiological substrates is crucially important, especially for those cases in which aberrant levels of regulatory proteins (e.g., beta-catenin, p27) result from a deregulated ubiquitination pathway. In yeast, the proteolysis of several G1 regulators is controlled by ubiquitin ligases (or SCFs) formed by three subunits: Skp1, Cul A (Cdc53), and one of many F-box proteins. Specific F-box proteins (Fbps) recruit different substrates to the SCF. Although many Fbps have been identified in mammals, their specific substrates and the existence of multiple SCFs have not yet been reported. We have found that one human Fbp, beta-Trcp (beta-Transducin repeat containing protein), does indeed form a novel SCF with human Skp1 and Cul1. Consistent with recent reports indicating that Xenopus and Drosophila beta-Trcp homologs act as negative regulators of the Wnt/beta-catenin signaling pathway, we report here that human beta-Trcp interacts with beta-catenin in vivo. Furthermore, beta-catenin is specifically stabilized in vivo by the expression of a dominant negative beta-Trcp. These results indicate that the Cul1/Skp1/beta-Trcp complex forms a ubiquitin ligase that mediates the degradation of beta-catenin.  (+info)

Identification of a human HECT family protein with homology to the Drosophila tumor suppressor gene hyperplastic discs. (2/2980)

Use of the differential display technique to isolate progestin-regulated genes in T-47D human breast cancer cells led to identification of a novel gene, EDD. The cDNA sequence contains a 2799 amino acid open reading frame sharing 40% identity with the predicted 2894 amino acid product of the Drosophila melanogaster tumor suppressor gene hyperplastic discs, while the carboxy-terminal 889 amino acids show 96% identity to a rat 100 kDa HECT domain protein. EDD mRNA was progestin-induced in T-47D cells and was highly abundant in testes and expressed at moderately high levels in other tissues, suggesting a broad role for EDD. Anti-EDD antibodies immunoprecipitated an approximately 300 kDa protein from T-47D cell lysates. HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. EDD is likely to function as an E3 as in vitro translated protein bound ubiquitin reversibly through a conserved HECT domain cysteine residue. EDD was localized by FISH to chromosome 8q22, a locus disrupted in a variety of cancers. Given the homology between EDD and the hyperplastic discs protein, which is required for control of imaginal disc growth in Drosophila, EDD potentially has a role in regulation of cell proliferation or differentiation.  (+info)

Function of WW domains as phosphoserine- or phosphothreonine-binding modules. (3/2980)

Protein-interacting modules help determine the specificity of signal transduction events, and protein phosphorylation can modulate the assembly of such modules into specific signaling complexes. Although phosphotyrosine-binding modules have been well-characterized, phosphoserine- or phosphothreonine-binding modules have not been described. WW domains are small protein modules found in various proteins that participate in cell signaling or regulation. WW domains of the essential mitotic prolyl isomerase Pin1 and the ubiquitin ligase Nedd4 bound to phosphoproteins, including physiological substrates of enzymes, in a phosphorylation-dependent manner. The Pin1 WW domain functioned as a phosphoserine- or phosphothreonine-binding module, with properties similar to those of SRC homology 2 domains. Phosphoserine- or phosphothreonine-binding activity was required for Pin1 to interact with its substrates in vitro and to perform its essential function in vivo.  (+info)

Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of twitching motility. (4/2980)

Pseudomonas aeruginosa is a ubiquitous environmental bacterium and an important human pathogen. The production of several virulence factors by P. aeruginosa is controlled through two quorum-sensing systems, las and rhl. We have obtained evidence that both the las and rhl quorum-sensing systems are also required for type 4 pilus-dependent twitching motility and infection by the pilus-specific phage D3112cts. Mutants which lack the ability to synthesize PAI-1, PAI-2, or both autoinducers were significantly or greatly impaired in twitching motility and in susceptibility to D3112cts. Twitching motility and phage susceptibility in the autoinducer-deficient mutants were partially restored by exposure to exogenous PAI-1 and PAI-2. Both twitching motility and infection by pilus-specific phage are believed to be dependent on the extension and retraction of polar type 4 pili. Western blot analysis of whole-cell lysates and enzyme-linked immunosorbent assays of intact cells were used to measure the amounts of pilin on the cell surfaces of las and rhl mutants relative to that of the wild type. It appears that PAI-2 plays a crucial role in twitching motility and phage infection by affecting the export and assembly of surface type 4 pili. The ability of P. aeruginosa cells to adhere to human bronchial epithelial cells was also found to be dependent on the rhl quorum-sensing system. Microscopic analysis of twitching motility indicated that mutants which were unable to synthesize PAI-1 were defective in the maintenance of cellular monolayers and migrating packs of cells. Thus, PAI-1 appears to have an essential role in maintaining cell-cell spacing and associations required for effective twitching motility.  (+info)

Identification of determinants in E2 ubiquitin-conjugating enzymes required for hect E3 ubiquitin-protein ligase interaction. (5/2980)

Members of the hect domain protein family are characterized by sequence similarity of their C-terminal regions to the C terminus of E6-AP, an E3 ubiquitin-protein ligase. An essential intermediate step in E6-AP-dependent ubiquitination is the formation of a thioester complex between E6-AP and ubiquitin in the presence of distinct E2 ubiquitin-conjugating enzymes including human UbcH5, a member of the UBC4/UBC5 subfamily of E2s. Similarly, several hect domain proteins, including Saccharomyces cerevisiae RSP5, form ubiquitin thioester complexes, indicating that hect domain proteins in general have E3 activity. We show here, by the use of chimeric E2s generated between UbcH5 and other E2s, that a region of UbcH5 encompassing the catalytic site cysteine residue is critical for its ability to interact with E6-AP and RSP5. Of particular importance is a phenylalanine residue at position 62 of UbcH5 that is conserved among the members of the UBC4/UBC5 subfamily but is not present in any of the other known E2s, whereas the N-terminal 60 amino acids do not contribute significantly to the specificity of these interactions. The conservation of this phenylalanine residue throughout evolution underlines the importance of the ability to interact with hect domain proteins for the cellular function of UBC4/UBC5 subfamily members.  (+info)

Histone ubiquitination and chromatin remodeling in mouse spermatogenesis. (6/2980)

Male infertility in HR6B knockout mice is associated with impairment of spermatogenesis. The HR6B gene is a mammalian, autosomal homolog of the Saccharomyces cerevisiae gene Rad6 encoding a ubiquitin-conjugating enzyme. In addition, X-chromosomal HR6A has been identified, in human and mouse. RAD6 in yeast is required for a variety of cellular functions, including sporulation, DNA repair, and mutagenesis. Since RAD6 and its mammalian homologs can ubiquitinate histones in vitro, we have investigated the pattern of histone ubiquitination in mouse testis. By immunoblot and immunohistochemical analysis of wild-type mouse testis, a high amount of ubiquitinated H2A (uH2A) was detected in pachytene spermatocytes. This signal became undetectable in round spermatids, but then increased again during a relatively short developmental period, in elongating spermatids. No other ubiquitinated histones were observed. In the HR6B knockout mice, we failed to detect an overt defect in the overall pattern of histone ubiquitination. For somatic cell types, it has been shown that histone ubiquitination is associated with destabilization of nucleosomes, in relation to active gene transcription. Unexpectedly, the most intense uH2A signal in pachytene spermatocytes was detected in the sex body, an inactive nuclear structure that contains the heterochromatic X and Y chromosomes. The postmeiotic uH2A immunoexpression in elongating spermatids indicates that nucleosome destabilization induced by histone ubiquitination may play a facilitating role during histone-to-protamine replacement.  (+info)

A wide variety of mutations in the parkin gene are responsible for autosomal recessive parkinsonism in Europe. French Parkinson's Disease Genetics Study Group and the European Consortium on Genetic Susceptibility in Parkinson's Disease. (7/2980)

Autosomal recessive juvenile parkinsonism (AR-JP, PARK2; OMIM 602544), one of the monogenic forms of Parkinson's disease (PD), was initially described in Japan. It is characterized by early onset (before age 40), marked response to levodopa treatment and levodopa-induced dyskinesias. The gene responsible for AR-JP was recently identified and designated parkin. We have analysed the 12 coding exons of the parkin gene in 35 mostly European families with early onset autosomal recessive parkinsonism. In one family, a homozygous deletion of exon 4 could be demonstrated. By direct sequencing of the exons in the index patients of the remaining 34 families, eight previously undescribed point mutations (homozygous or heterozygous) were detected in eight families that included 20 patients. The mutations segregated with the disease in the families and were not detected on 110-166 control chromosomes. Four mutations caused truncation of the parkin protein. Three were frameshifts (202-203delAG, 255delA and 321-322insGT) and one a nonsense mutation (Trp453Stop). The other four were missense mutations (Lys161Asn, Arg256Cys, Arg275Trp and Thr415Asn) that probably affect amino acids that are important for the function of the parkin protein, since they result in the same phenotype as truncating mutations or homozygous exon deletions. Mean age at onset was 38 +/- 12 years, but onset up to age 58 was observed. Mutations in the parkin gene are therefore not invariably associated with early onset parkinsonism. In many patients, the phenotype is indistinguishable from that of idiopathic PD. This study has shown that a wide variety of different mutations in the parkin gene are a common cause of autosomal recessive parkinsonism in Europe and that different types of point mutations seem to be more frequently responsible for the disease phenotype than are deletions.  (+info)

Inhibitory phosphorylation of the APC regulator Hct1 is controlled by the kinase Cdc28 and the phosphatase Cdc14. (8/2980)

BACKGROUND: Exit from mitosis requires inactivation of mitotic cyclin-dependent kinases (CDKs). A key mechanism of CDK inactivation is ubiquitin-mediated cyclin proteolysis, which is triggered by the late mitotic activation of a ubiquitin ligase known as the anaphase-promoting complex (APC). Activation of the APC requires its association with substoichiometric activating subunits termed Cdc20 and Hct1 (also known as Cdh1). Here, we explore the molecular function and regulation of the APC regulatory subunit Hct1 in Saccharomyces cerevisiae. RESULTS: Recombinant Hct1 activated the cyclin-ubiquitin ligase activity of APC isolated from multiple cell cycle stages. APC isolated from cells arrested in G1, or in late mitosis due to the cdc14-1 mutation, was more responsive to Hct1 than APC isolated from other stages. We found that Hct1 was phosphorylated in vivo at multiple CDK consensus sites during cell cycle stages when activity of the cyclin-dependent kinase Cdc28 is high and APC activity is low. Purified Hct1 was phosphorylated in vitro at these sites by purified Cdc28-cyclin complexes, and phosphorylation abolished the ability of Hct1 to activate the APC in vitro. The phosphatase Cdc14, which is known to be required for APC activation in vivo, was able to reverse the effects of Cdc28 by catalyzing Hct1 dephosphorylation and activation. CONCLUSIONS: We conclude that Hct1 phosphorylation is a key regulatory mechanism in the control of cyclin destruction. Phosphorylation of Hct1 provides a mechanism by which Cdc28 blocks its own inactivation during S phase and early mitosis. Following anaphase, dephosphorylation of Hct1 by Cdc14 may help initiate cyclin destruction.  (+info)

RNA 3-terminal phosphate cyclase, RNA 2-O-methyltransferase, RNA, Rn, Online Electronic Medical Dictionary Terminology, Articles, Glossary
Comparison of the initial 3H/14C ratios in specifically labelled d-glucose 6-phosphates with the final ratios in myo-inositol produced by glucose 6-phosphate-d-myo-inositol 1-phosphate cyclase from rat testis showed that, during the conversion, the hydrogen atoms at C-1 and C-3 were fully retained, one hydrogen atom was lost from C-6, and that at C-5 was apparently retained to the extent of 80-90%. The loss of 3H could not be stimulated by addition of unlabelled NADH, and when unlabelled substrate was used 3H from [3H]NADH and [3H]water was not incorporated. Treatment of the enzyme with charcoal abolished the activity, and this was restored to 25-50% of the original activity by NAD+. The charcoal-treated enzyme again apparently gave 85% retention of hydrogen with [5−3H]glucose 6-phosphate as substrate in the presence of NAD+ alone, but the retention was decreased to 65% with excess of NADH. The results are interpreted as indicating that the cyclization proceeds by an aldol condensation in ...
Does not have cyclase activity. Plays a role in 40S-ribosomal-subunit biogenesis in the early pre-rRNA processing steps at sites A0, A1 and A2 that are required for proper maturation of the 18S RNA (By similarity).
Kit Component:- KN222877G1, RFPL4B gRNA vector 1 in pCas-Guide vector- KN222877G2, RFPL4B gRNA vector 2 in pCas-Guide vector- KN222877D, donor vector…
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
ubiquitin carrier protein kinase: a 300 kDa kinase consisting of 3 subunits of MWs 70, 105 & 120; requires Mg2+ but inhibited by high concentration; from HeLa cells
Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Specifically monoubiquitinates the N-terminus of various substrates, including ATXN3, MAPT/TAU, POLR2H/RPB8 and STUB1/CHIP, by recognizing backbone atoms of disordered N-termini. Involved in degradation of misfolded chaperone substrates by mediating monoubiquitination of STUB1/CHIP, leading to recruitment of ATXN3 to monoubiquitinated STUB1/CHIP, and restriction of the length of ubiquitin chain attached to STUB1/CHIP substrates by ATXN3. After UV irradiation, but not after mitomycin-C (MMC) treatment, acts as a specific E2 ubiquitin-conjugating enzyme for the Fanconi anemia complex by associating with E3 ubiquitin-protein ligase FANCL and catalyzing monoubiquitination of FANCD2, a key step in the DNA damage pathway. In vitro catalyzes Lys-11-linked polyubiquitination. UBE2W-catalyzed ubiquitination occurs also in the presence of inactive RING/U-box type E3s, i.e. lacking the active site cysteine residues to
Reagents for the antigen UBE2I / ubiquitin-conjugating enzyme E2I / UBC9 stained with APC-Cy7™ in the Antibody Database
UBR5 (ubiquitin protein ligase E3 component n-recognin 5), Authors: Dessen P. Published in: Atlas Genet Cytogenet Oncol Haematol.
Compare mindbomb E3 ubiquitin protein ligase 1 ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
E3 ubiquitin-protein ligase which binds polysumoylated chains covalently attached to proteins and mediates Lys-6-, Lys-11-, Lys-48- and Lys-63-linked polyubiquitination of those substrates and their subsequent targeting to the proteasome for degradation. Regulates the degradation of several proteins including PML and the transcriptional activator PEA3. Involved in chromosome alignment and spindle assembly, it regulates the kinetochore CENPH-CENPI-CENPK complex by targeting polysumoylated CENPI to proteasomal degradation. Regulates the cellular responses to hypoxia and heat shock through degradation of respectively EPAS1 and PARP1. Alternatively, it may also bind DNA/nucleosomes and have a more direct role in the regulation of transcription for instance enhancing basal transcription and steroid receptor-mediated transcriptional activation ...
Protein target information for Chain A, E3 ubiquitin-protein ligase UBR2 (human). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
UBE1C - UBE1C (untagged)-Human ubiquitin-activating enzyme E1C (UBA3 homolog, yeast) (UBE1C), transcript variant 3 available for purchase from OriGene - Your Gene Company.
C25-140 Featured C25-140 is a specific, first-in-class small molecule inhibitor of the TRAF6-Ubc13 interaction, binds TRAF6, inhibits TRAF6-Ubc13 interaction and TRAF6 activity.. ...
Réactivité: Roussette (Chauve-souris), Poulet, Boeuf (Vache) and more. Comparez 113 UBE2K Anticorps. Commandez directement chez anticorps-enligne.fr.
Reaktivität: Fledermaus, Huhn, Rind (Kuh) and more. verschiedene UBE2D1 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
Reaktivität: Huhn, Rind (Kuh), Hund and more. 54 verschiedene UBE2D3 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
Regulator of Notch signaling, a signaling pathway involved in cell-cell communications that regulates a broad spectrum of cell-fate determinations (By similarity). Functions as a ubiquitin ligase protein in vivo, mediating Lys48-linked polyubiquitination and promoting degradation of TBK1, targeting to TBK1 requires interaction with NLRP4 ...
Albert, T.K.; Hanzawa, H.; Legtenberg, Y. I.A.; de Ruwe, M.J.; van den Heuvel, F.A.J.; Collart, M.A.; Boelens, R.; Timmers, H.T.M ...
Opens the Highlight Feature Bar and highlights feature annotations from the FEATURES table of the record. The Highlight Feature Bar can be used to navigate to and highlight other features and provides links to display the highlighted region separately. Links in the FEATURES table will also highlight the corresponding region of the sequence. More... ...
SpecificityC TerminusStorage/StabilityAliquot and store at -20°C Minimize freezing and thawing More InformationImmunogenThe immunogen was a 12-residue peptide matching a sequence from the C Terminus of RFPL2 See Accession Number s NP_006596 2 NP_001091997 2 NP_001153017 1 NP_001153018 1
En ubiquitin-conjugating enzym som regulerer cellesyklus fremmer kromosom missegregation og tumordannelse, ifølge van Ree et al. i januar 11 Utgave av Journal of Cell Biology (www.jcb.org)
UBE2D3 overexpression lysate, 0.1 mg. Transient overexpression lysate of ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3), transcript variant 1
Complete information for UBR1 gene (Protein Coding), Ubiquitin Protein Ligase E3 Component N-Recognin 1, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
UBE2D1 antibody (ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)) for ICC/IF, IHC-P, WB. Anti-UBE2D1 pAb (GTX109257) is tested in Human, Mouse samples. 100% Ab-Assurance.
ARIH1 antibody (ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)) for WB. Anti-ARIH1 pAb (GTX23891) is tested in Human, Mouse samples. 100% Ab-Assurance.
Complete information for NEURL3 gene (Protein Coding), Neuralized E3 Ubiquitin Protein Ligase 3, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Cullin 1) is a Protein Coding gene. Diseases associated with CUL1 include Vaccinia and Weaver Syndrome. Among its related pathways are Apoptosis-related network due to altered Notch3 in ovarian cancer and Signaling by NOTCH1. Gene Ontology (GO) annotations related to this gene include ubiquitin protein ligase binding. An important paralog of this gene is CUL2 ...
Ubiquitin-activating enzymes, also known as E1 enzymes, catalyze the first step in the ubiquitination reaction, which (among other things) can target a protein for degradation via a proteasome. This covalent attachment of ubiquitin or ubiquitin-like proteins to targeted proteins is a major mechanism for regulating protein function in eukaryotic organisms. Many processes such as cell division, immune responses and embryonic development are also regulated by post-translational modification by ubiquitin and ubiquitin-like proteins. Ubiquitin-activating enzyme (E1) starts the ubiquitination process (Figure 1). The E1 enzyme along with ATP binds to the ubiquitin protein. The E1 enzyme then passes the ubiquitin protein to a second protein, called Ubiquitin carrier or conjugation protein (E2). The E2 protein complexes with a Ubiquitin protein ligase (E3). This Ubiquitin protein ligase recognizes which protein needs to be tagged and catalyzes the transfer of ubiquitin to that protein. This pathway ...
The activities of two lipogenic enzymes, acetyl-CoA carboxylase and fatty acid synthase, were determined in two transplantable mammary adenocarcinomas (13762 and R3230AC) carried by non-pregnant, pregnant and lactating rats, and in mammary tissue of control animals (non-tumour-carrying) of comparable physiological states. During mammary-gland differentiation of control or tumour-carrying animals, the activities of acetyl-CoA carboxylase and fatty acid synthase in the lactating gland increased by about 40-50-fold over the values found in non-pregnant animals. On the other hand, in tumours carried by lactating dams there were only modest increases (1.5-2-fold) in acetyl-CoA carboxylase and fatty acid synthase compared with the neoplasms carried by non-pregnant animals. On the basis of the Km values for different substrates and immunodiffusion and immunotitration data, the fatty acid synthase of neoplastic tissues appeared to be indistinguishable from the control mammary-gland enzyme. However, a ...
ID RTCA_SULIM Reviewed; 337 AA. AC C3MU91; DT 22-SEP-2009, integrated into UniProtKB/Swiss-Prot. DT 16-JUN-2009, sequence version 1. DT 25-OCT-2017, entry version 52. DE RecName: Full=RNA 3-terminal phosphate cyclase {ECO:0000255,HAMAP-Rule:MF_00200}; DE Short=RNA cyclase {ECO:0000255,HAMAP-Rule:MF_00200}; DE Short=RNA-3-phosphate cyclase {ECO:0000255,HAMAP-Rule:MF_00200}; DE EC=6.5.1.4 {ECO:0000255,HAMAP-Rule:MF_00200}; GN Name=rtcA {ECO:0000255,HAMAP-Rule:MF_00200}; GN OrderedLocusNames=M1425_0235; OS Sulfolobus islandicus (strain M.14.25 / Kamchatka #1). OC Archaea; Crenarchaeota; Thermoprotei; Sulfolobales; Sulfolobaceae; OC Sulfolobus. OX NCBI_TaxID=427317; RN [1] RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=M.14.25 / Kamchatka #1; RX PubMed=19435847; DOI=10.1073/pnas.0808945106; RA Reno M.L., Held N.L., Fields C.J., Burke P.V., Whitaker R.J.; RT Biogeography of the Sulfolobus islandicus pan-genome.; RL Proc. Natl. Acad. Sci. U.S.A. 106:8605-8610(2009). CC -!- FUNCTION: ...
TY - JOUR. T1 - The ubiquitin-conjugating enzyme UBCH7 acts as a coactivator for steroid hormone receptors. AU - Verma, Seema. AU - Ismail, Ayesha. AU - Gao, Xiuhua. AU - Fu, Guilian. AU - Li, Xiaotao. AU - OMalley, Bert W.. AU - Nawaz, Zafar. PY - 2004/10/1. Y1 - 2004/10/1. N2 - We investigated the role of the ubiquitin-conjugating enzyme UBCH7 in nuclear receptor transactivation. Using transient transfection assays, we demonstrated that UBCH7 modulates the transcriptional activity of progesterone receptor (PR) and glucocorticoid, androgen, and retinoic acid receptors in a hormone-dependent manner and that the ubiquitin conjugation activity of UBCH7 is required for its ability to potentiate transactivation by steroid hormone receptors (SHR). However, UBCH7 showed no significant effect on the transactivation functions of p53 and VP-16 activation domain. Depletion of endogenous UBCH7 protein by small interfering RNAs suggests that UBCH7 is required for the proper function of SHR. Furthermore, a ...
The RAD6 gene of Saccharomyces cerevisiae is required for DNA repair, DNA damage-induced mutagenesis, and sporulation. RAD6 protein is a ubiquitin-conjugating enzyme (E2) that has been shown to attach multiple molecules of ubiquitin to histones H2A and H2B. We have now examined whether the E2 activity of RAD6 is involved in its various biological functions. Since the formation of a thioester adduct between E2 and ubiquitin is necessary for E2 activity, the single cysteine residue (Cys-88) present in RAD6 was changed to alanine or valine. The mutant proteins were overproduced in yeast cells and purified to near homogeneity. We show that the rad6 Ala-88 and rad6 Val-88 mutant proteins lack the capacity for thioester formation with ubiquitin and, as a consequence, are totally devoid of any E2 activity. The rad6 Ala-88 and rad6 Val-88 mutations confer a defect in DNA repair, mutagenesis, and sporulation equivalent to that in the rad6 null allele. We suggest that the biological functions of RAD6 ...
TY - JOUR. T1 - Translational outcomes in a full gene deletion of ubiquitin protein ligase E3A rat model of Angelman syndrome. AU - Berg, E. L.. AU - Pride, M. C.. AU - Petkova, S. P.. AU - Lee, R. D.. AU - Copping, N. A.. AU - Shen, Y.. AU - Adhikari, A.. AU - Fenton, T. A.. AU - Pedersen, L. R.. AU - Noakes, L. S.. AU - Nieman, B. J.. AU - Lerch, J. P.. AU - Harris, S.. AU - Born, H. A.. AU - Peters, M. M.. AU - Deng, P.. AU - Cameron, D. L.. AU - Fink, K. D.. AU - Beitnere, U.. AU - OGeen, H.. AU - Anderson, A. E.. AU - Dindot, S. V.. AU - Nash, K. R.. AU - Weeber, E. J.. AU - Wöhr, M.. AU - Ellegood, J.. AU - Segal, D. J.. AU - Silverman, J. L.. PY - 2020/1/27. Y1 - 2020/1/27. N2 - Angelman syndrome (AS) is a rare neurodevelopmental disorder characterized by developmental delay, impaired communication, motor deficits and ataxia, intellectual disabilities, microcephaly, and seizures. The genetic cause of AS is the loss of expression of UBE3A (ubiquitin protein ligase E6-AP) in the brain, ...
TY - JOUR. T1 - Characterization of novel yeast Rad6 (UBC2) ubiquitin-conjugating enzyme mutants constructed by charge-to-alanine scanning mutagenesis. AU - McDonough, Michele M. AU - Sagan, P. AU - Gonda, D. PY - 1995. Y1 - 1995. N2 - Ubiquitination of intracellular proteins by the yeast RAD6 (UBC2) ubiquitin-conjugating (E2) enzyme is required for cellular processes as diverse as DNA repair, selective proteolysis, and normal growth. For most RAD6-dependent functions, the relevant in vivo targets, as well as the mechanisms and cofactors that govern RAD6 substrate selectivity, are unknown. We have explored the utility of charge-to-alanine scanning mutagenesis to generate novel RAD6 mutants that are enzymatically competent with respect to unfacilitated (E3-independent) ubiquitination but that are nevertheless severely handicapped with respect to several in vivo functions. Five of the nine mutants we generated show defects in their in vivo functions, but almost all of the most severely affected ...
We approached the problem of E2 specificity with the simple assumption that the unique determinants of specificity for each E2 catalytic domain could be identified by searching for amino acids whose transposition from one E2 to another resulted in a corresponding transposition of function. Such an approach has previously been used to make a single amino acid substitution in NEDD8, making it a substrate for the ubiquitin pathway (56). The ubiquitin-conjugating enzymes UBC4 and RAD6 (UBC2) from S. cerevisiae were employed, as each carries out a distinct, nonoverlapping function and their respective biological properties can be easily measured by determining cell viability in simple plating experiments.. Initially, comparisons of the sequence similarities and differences both within and among the six members of the RAD6 and UBC4 families from S. cerevisiae, Schizosaccharomyces pombe,Drosophila melanogaster, Caenorhabditis elegans,Arabidopsis thaliana, and H. sapiens were carried out (6, 9, 24, 25, ...
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
Read Over-expression of tobacco UBC1 encoding a ubiquitin-conjugating enzyme increases cadmium tolerance by activating the 20S/26S proteasome and by decreasing Cd accumulation and oxidative stress in tobacco (Nicotiana tabacum), Plant Molecular Biology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
E3 Ubiquitin-Protein Ligase XIAP (Baculoviral IAP Repeat-Containing Protein 4 or IAP-Like Protein or X-Linked Inhibitor Of Apoptosis Protein or XIAP or EC
Muona M, Ishimura R, Laari A, Ichimura Y, Linnankivi T, Keski-Filppula R, Herva R, Rantala H, Paetau A, Pöyhönen M, Obata M, Uemura T, Karhu T, Bizen N, Takebayashi H, McKee S, Parker MJ, Akawi N, McRae J, Hurles ME, Kuismin O, Kurki MI, Anttonen AK, Tanaka K, Palotie A, Waguri S, Lehesjoki AE, Komatsu M. Biallelic Variants in UBA5 Link Dysfunctional UFM1 Ubiquitin-like Modifier Pathway to Severe Infantile-Onset Encephalopathy. Am J Hum Genet. 2016 09 01; 99(3):683-694 ...
Abstract. Despite the promise of targeting B-cell receptor-associated signaling kinases in indolent lymphomas, new agents in this class show limited activity in
Abstract. Despite the promise of targeting B-cell receptor-associated signaling kinases in indolent lymphomas, new agents in this class show limited activity i
Anti-Acetyl CoA Carboxylase Antibody, Unconjugated from Cell Signaling Technology,Acetyl CoA Carboxylase Antibody,biological,biology supply,biology supplies,biology product
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Acetyl-CoA Carboxylase alpha/ACACA products available through Novus Biologicals. Browse our Acetyl-CoA Carboxylase alpha/ACACA product catalog backed by our Guarantee+.
left-handed. Box 6-1 DNA Has 10.5 Base Pairs per Turn of the Helix in Solution: The Mica Experiment. This value of 10 base pairs per turn vanes somewhat under different conditions. A classic experiment that was earned out in the 1970s demonstrated that DNA absorbed on a surface has somewhat greater than 10 base pairs per turn. Short segments of DNA were allowed to btnd to a mica surface. The presence of 5-terminal phosphates on the DNAs field them in a fixed orientation on the mica. The mica-bound DNAs were then exposed to DNAse I, an enzyme (a rieoxyrifconude-ase) that deaves the phosphodiester bonds in the DNA backbone. Because the enzyme is bulky, it t5 onfy able to deave phosphodiester bonds on the DNA surface furthest from the mica (think of the DNA as a cylinder lying down on a flat surface) due to the stenc difficulty of reaching the sides or bottom, surface of the DNA. As a result, the length of the resulting fragments should reflect the periodicity of the DNA, the number Of base pairs ...
The RASSF1A tumor suppressor is one of the most commonly inactivated genes in cancer. To understand why epigenetic silencing of RASSF1A promotes tumorigenesis, I employed a loss of function approach to elucidate the role ...
Rabbit monoclonal antibody raised against a human RFPL1 peptide using ARM Technology. A synthetic peptide of human RFPL1 is used for rabbit immunization.Customer or Abnova will decide on the preferred peptide sequence. (H00005988-K) - Products - Abnova
Recombinant Human Von Hippel-Lindau Protein b-domain produced in E.Coli is a single, non-glycosylated polypeptide chain containing 174 amino acids.
M.R. Munday; Regulation of mammalian acetyl-CoA carboxylase. Biochem Soc Trans 1 October 2002; 30 (5): A101. doi: https://doi.org/10.1042/bst030a101c. Download citation file:. ...
A scientific resource for the VHL protein domain containing information on structure, function, and domain binding to hydroxylated proline residues.
Smurf2 - Smurf2 (untagged ORF) - Rat SMAD specific E3 ubiquitin protein ligase 2 (Smurf2), (10 ug) available for purchase from OriGene - Your Gene Company.
pep:known chromosome:VEGA66:11:106822025:106920470:-1 gene:OTTMUSG00000003584 transcript:OTTMUST00000007723 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:Smurf2 description:SMAD specific E3 ubiquitin protein ligase 2 ...
Gentaur molecular products has all kinds of products like :search , ARP \ Antigens Elongin B, 1-118aa, Human, Recombinant, E.coli \ 01-2008 for more molecular products just contact us
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
HsCD00329761 ------------------------------------------------------------ NM_006605.3 ------------------------------------------------------------ NM_021026.2 ------------------------------------------------------------ NM_006604.2 ------------------------------------------------------------ XM_005261310.1 ------------------------------------------------------------ NM_001098527.2 ATGGAGGTGGCTGAATTAGGCTTCCCAGAGACTGCAGTGTCCCAATCCAGGATCTGTCTA NM_001159545.1 ------------------------------------------------------------ NM_001098535.1 ------------------------------------------------------------ NM_001159546.1 ------------------------------------------------------------ HsCD00329761 ------------------------------------------------------------ NM_006605.3 ------------------------------------------------------------ NM_021026.2 ------------------------------------------------------------ NM_006604.2 ------------------------------------------------------------ XM_005261310.1 ...
Zaradi pogoste uporabe betalaktamskih zdravil so nekatere bakterije razvile odpornost proti njim. Nekatere bakterije proizvajajo prej omejeni encim betalaktamazo, ki izniči učinek betalaktamskega antibiotika, ker cepi betalaktamski obroč.. Za preprečitev tovrstne odpornosti bakterij so na trgu kombinacije betalaktamskih antibiotikov z zaviralci betalaktamaze. Takšna kombinacija je npr. amoksicilin + klavulanska kislina. Klavulanska kislina je zaviralec betalaktamaze, ker se nepovratno veže na encim in slednji se več ne more vezati na betalaktamsko učinkovino (v tem primeru amoksicilin).. ...
RNA ligases[edit]. Of particular interest are DNA ligases.[5] These molecules have demonstrated remarkable chemoselectivity in ... The new RNA ligase deoxyribozyme contained just twelve point mutations, two of which had no effect on activity, and had a ... Although each repeating unit in a RNA strand owns a free hydroxyl group, the DNA ligase takes just one of them as a branching ... In another recent study, an RNA ligase ribozyme was converted into a deoxyribozyme through in vitro evolution of the inactive ...
Enzymes called DNA ligases can rejoin cut or broken DNA strands.[120] Ligases are particularly important in lagging strand DNA ... Nucleases and ligases. Nucleases are enzymes that cut DNA strands by catalyzing the hydrolysis of the phosphodiester bonds. ... Topoisomerases are enzymes with both nuclease and ligase activity. These proteins change the amount of supercoiling in DNA. ... This enzyme makes discontinuous segments (called Okazaki fragments) before DNA ligase joins them together. ...
This enzyme belongs to the family of ligases, specifically those forming carbon-nitrogen bonds as acid-D-amino-acid ligases ( ... "Synthases and Ligases". IUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN), and Nomenclature Commission of IUB (NC- ... Li H, Xu H, Graham DE, White RH (Aug 2003). "Glutathione synthetase homologs encode alpha-L-glutamate ligases for methanogenic ... Galperin MY, Koonin EV (1997). "A diverse superfamily of enzymes with ATP-dependent carboxylate-amine/thiol ligase activity". ...
DNA ligase 1 is an enzyme that in humans is encoded by the LIG1 gene. DNA ligase I is the only known eukaryotic DNA ligase ... Eukaryotic DNA ligase 1 catalyzes a reaction that is chemically universal to all ligases. DNA ligase 1 utilizes adenosine ... Ligase I is involved in the LP-BER pathway, whereas ligase III is involved in the major SN-BER pathway(2). LP-BER proceeds in 4 ... Defects in DNA ligase 1 can thus lead to different forms of autosomal recessive, partial DNA ligase 1 deficiency leading to an ...
Other NAD-dependent enzymes include bacterial DNA ligases, which join two DNA ends by using NAD+ as a substrate to donate an ... This contrasts with eukaryotic DNA ligases, which use ATP to form the DNA-AMP intermediate. Li et al. have found that NAD+ ... Schär P, Herrmann G, Daly G, Lindahl T (1997). "A newly identified DNA ligase of Saccharomyces cerevisiae involved in RAD52- ... Wilkinson A, Day J, Bowater R (2001). "Bacterial DNA ligases". Mol. Microbiol. 40 (6): 1241-8. doi:10.1046/j.1365-2958.2001. ...
The E6 proteins of HPV will bind to the N-terminus of the cellular E6-AP E3 ubiquitin ligase, redirecting the complex to bind ... Ligation: E3 ubiquitin ligases catalyse the final step of the ubiquitination cascade. Most commonly, they create an isopeptide ... Identification of E3 ligase substrates is critical to understand its implication in human diseases since deregulation of E3- ... They are highly specific, as are the E3 ligases that attach the ubiquitin, with only a few substrates per enzyme. They can ...
Ardley HC, Tan NG, Rose SA, Markham AF, Robinson PA (June 2001). "Features of the parkin/ariadne-like ubiquitin ligase, HHARI, ... Deshaies RJ, Joazeiro CA (2009). "RING domain E3 ubiquitin ligases". Annual Review of Biochemistry. 78: 399-434. doi:10.1146/ ... and ubiquitin-protein ligases (E3s). E2s play a key role in the whole ubiquitin (Ub) transfer pathway and are responsible for ... protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1". Proc. Natl. Acad. Sci. U.S.A ...
6, 9-20 Deshaies, R.J. and Joazeiro, C.A.P. (2009). RING domain E3 ubiquitin ligases. Annu. Rev. Biochem. 78, 399-434 Verma, R ... SCF and cullin-RING ubiquitin ligases: As a postdoctoral fellow working with Dr. Marc Kirschner at the University of California ... Cell 91, 221-230 Petroski, M.D. and Deshaies, R. J. (2005). Function and regulation of cullin-RING ubiquitin ligases. Nat. Rev ... Cdc53/cullin and the essential Hrt1 RING-H2 subunit of SCF define a ubiquitin ligase module that activates the E2 enzyme Cdc34 ...
Enchev RI, Schulman BA, Peter M (January 2015). "Protein neddylation: beyond cullin-RING ligases". Nature Reviews. Molecular ... performed by ubiquitin ligases (E3). The result of this process is the formation of a covalent bond between the C-terminus of ...
The metabolic pathway for this begins with the conversion of benzoate by butyrate-CoA ligase into an intermediate product, ... "butyrate-CoA ligase". BRENDA. Technische Universität Braunschweig. Retrieved 7 May 2014. Substrate/Product "glycine N- ...
... is metabolized by butyrate-CoA ligase into an intermediate product, benzoyl-CoA, which is then metabolized by ... "butyrate-CoA ligase". BRENDA. Technische Universität Braunschweig. Retrieved 7 May 2014. Substrate/Product "glycine N- ...
CYP2D6, dopamine β-hydroxylase, flavin-containing monooxygenase 3, butyrate-CoA ligase, and glycine N-acyltransferase are the ... "Substrate/Product". butyrate-CoA ligase. BRENDA. Technische Universität Braunschweig. "Substrate/Product". glycine N- ...
2. DNA ligase During normal DNA replication, DNA ligase catalyzes end-to-end joining (ligation) of short fragments of DNA, ... DNA ligase can ligate complementary sticky and blunt ends, but blunt-end ligation is inefficient and requires a higher ... For the purposes of DNA cloning, purified DNA ligase is used to covalently join the ends of a restriction fragment and vector ... "Structure and Function of Mammalian DNA Ligases." Mutation Research/DNA Repair 407.1 (1998): 1-9. Print. Hung, Mien-Chie, and ...
Different combinations of Cullin and FBPs can generate on the order of a hundred types of E3 ubiquitin ligases that target ... Skp, Cullin, F-box containing complex (or SCF complex) is a multi-protein E3 ubiquitin ligase complex that catalyzes the ... Next, biochemical studies revealed that Cdc34 is an E2 enzyme that physically interacts with an E3 ubiquitin ligase complex ... Sun, L. Jia and Y. (2011-02-28). "SCF E3 Ubiquitin Ligases as Anticancer Targets". Current Cancer Drug Targets. 11 (3): 347-356 ...
Nakayama KI, Nakayama K (May 2006). "Ubiquitin ligases: cell-cycle control and cancer". Nat. Rev. Cancer. 6 (5): 369-81. doi: ... the ubiquitin ligase that regulates proteolysis of p27 in G1 phase". J. Biol. Chem. 280 (18): 17694-700. doi:10.1074/jbc. ...
DNA ligase III-alpha mRNA encodes nuclear and mitochondrial versions of DNA ligase III-alpha. Nuclear DNA ligase III-alpha ... DNA ligase 3 is an enzyme that, in humans, is encoded by the LIG3 gene. The human LIG3 gene encodes ATP-dependent DNA ligases ... Compared with DNA ligases I and IV, DNA ligase III is the most active enzyme in the intermolecular joining of DNA duplexes. ... DNA ligase III-alpha has, however, been indirectly implicated in cancer and neurodegenerative diseases. In cancer, DNA ligase ...
E3 ubiquitin ligases MEX and MIB2 (EC). Dystrophin and its homologues Single copies of the ZZ zinc finger occur in the ... Nishito Y, Hasegawa M, Inohara N, Núñez G (June 2006). "MEX is a testis-specific E3 ubiquitin ligase that promotes death ... ZZ-type zinc finger domains have also been identified in the testis-specific E3 ubiquitin ligase MEX that promotes death ...
In eubacteria these ligases are powered by NAD+ rather than ATP. Each nick site requires 1 ATP or 1 NAD+ to power the ligase ... Ligases have a metal binding site which is capable of recognizing nicks in DNA. The ligase forms a DNA-adenylate complex, ... One particular example of a ligase catalyzing nick closure is the E. coli NAD+ dependent DNA ligase, LigA. LigA is a relevant ... Ligases are versatile and ubiquitous enzymes that join the 3' hydroxyl and 5' phosphate ends to form a phosphodiester bond, ...
It is structurally similar to Muramyl ligases. Aboulmagd E, Oppermann-Sanio FB, Steinbüchel A (November 2000). "Molecular ... L-aspartate ligase (ADP-forming). This enzyme catalyses the following chemical reaction ATP + [L-Asp(4-L-Arg)]n + L-Asp ⇌ {\ ...
The E3 Ubiquitin ligase enzyme is a main component that provides specificity in protein degradation pathways, including immune ... Craig, A.; Ewan, R.; Mesmar, J.; Gudipati, V.; Sadanandom, A. (10 March 2009). "E3 ubiquitin ligases and plant innate immunity ...
... subunit of several ubiquitin ligases. This conjugation, called neddylation, is required for optimal ubiquitin ligase activity. ...
... (also known as Ligase IV syndrome) is an extremely rare condition caused by mutations in the DNA Ligase IV (LIG4 ... Severity of symptoms depends on the degree of reduced enzymatic activity of Ligase IV or gene expression. Ligase IV is a ... "LIGASE IV, DNA, ATP-DEPENDENT; LIG4". OMIM. Retrieved 2 January 2012. Altmann T, Gennery AR (October 2016). "DNA ligase IV ... Ben-Omran TI, Cerosaletti K, Concannon P, Weitzman S, Nezarati MM (2005). "A patient with mutations in DNA Ligase IV: clinical ...
Burger A, Amemiya Y, Kitching R, Seth AK (2006). "Novel RING E3 ubiquitin ligases in breast cancer". Neoplasia. 8 (8): 689-95. ... "The RING-H2 protein RNF11 is overexpressed in breast cancer and is a target of Smurf2 E3 ligase". Br. J. Cancer. 89 (8): 1538- ... "The RING-H2 protein RNF11 is differentially expressed in breast tumours and interacts with HECT-type E3 ligases". Biochim. ... of multiple proteins expressed in murine embryos as binding partners for the WW domains of the ubiquitin-protein ligase Nedd4 ...
... and one of many E3 ubiquitin ligase. The specificity of ubiquitination is provided by the E3 ligases; these ligases physically ... Li X, Zhao Q, Liao R, Sun P, Wu X (August 2003). "The SCF(Skp2) ubiquitin ligase complex interacts with the human replication ... Bornstein G, Bloom J, Sitry-Shevah D, Nakayama K, Pagano M, Hershko A (July 2003). "Role of the SCFSkp2 ubiquitin ligase in the ... Bashir T, Dorrello NV, Amador V, Guardavaccaro D, Pagano M (March 2004). "Control of the SCF(Skp2-Cks1) ubiquitin ligase by the ...
Sakane A, Hatakeyama S, Sasaki T (2007). "Involvement of Rabring7 in EGF receptor degradation as an E3 ligase". Biochem. ... 2006). "A novel RING-type ubiquitin ligase breast cancer-associated gene 2 correlates with outcome in invasive breast cancer". ... "Novel RING E3 ubiquitin ligases in breast cancer". Neoplasia. 8 (8): 689-95. doi:10.1593/neo.06469. PMC 1601945. PMID 16925951 ...
E3 ubiquitin-protein ligase MARCH5, also known as membrane-associated ring finger (C3HC4) 5, is an enzyme that, in humans, is ... Park YY, Lee S, Karbowski M, Neutzner A, Youle RJ, Cho H (Feb 2010). "Loss of MARCH5 mitochondrial E3 ubiquitin ligase induces ... Shi HX, Liu X, Wang Q, Tang PP, Liu XY, Shan YF, Wang C (May 2011). "Mitochondrial ubiquitin ligase MARCH5 promotes TLR7 ... The human E3 ubiquitin-protein ligase MARCH5 protein, a member of the transmembrane RING‐finger protein family is 31 kDa in ...
His laboratory has played a central role in elucidating the role of a family of enzymes, the cullin-RING ubiquitin ligases ( ... Petroski, Matthew D.; Deshaies, Raymond J. (January 2005). "Function and regulation of cullin-RING ubiquitin ligases". Nature ... Skaar, Jeffrey R.; Pagan, Julia K.; Pagano, Michele (December 2014). "SCF ubiquitin ligase-targeted therapies". Nature Reviews ... Cardozo, Timothy; Pagano, Michele (September 2004). "The SCF ubiquitin ligase: insights into a molecular machine". Nature ...
"TTL tubulin tyrosine ligase (human)". Entrez Gene. "CHIC2 cysteine rich hydrophobic domain 2 (human)". Entrez Gene. "MDS2 ... a Long-chain-fatty-acid-CoA ligase); h) transporter gene ARNT (binds to ligand-bound aryl hydrocarbon receptor to aid in its ...
One approach for selecting a ligase ribozyme involves using biotin tags, which are covalently linked to the substrate. If a ... Paul, Natasha; Joyce, Gerald F. (2002-10-01). "A self-replicating ligase ribozyme". Proceedings of the National Academy of ... molecule possesses the desired ligase activity, a streptavidin matrix can be used to recover the active molecules. Lincoln and ...
The common names of ligases often include the word "ligase", such as DNA ligase, an enzyme commonly used in molecular biology ... DNA ligase. References[edit]. *^ "Synthases and ligases". chem.qmul.ac.uk. Archived from the original on October 15, 2012. ... This article is about general ligases. For DNA specific ligases, see DNA ligase. ... Membrane-associated ligases[edit]. Some ligases associate with biological membranes as peripheral membrane proteins or anchored ...
Stage two involves four key Mur ubiquitin ligase enzymes: MurC (EC),[1] MurD (EC),[2] MurE (EC) [3] and MurF (EC).[4] These ... 6-diaminopimelate ligase (MurE), and UDP-N-acetylmuramoyl-tripeptide-D-alanyl-D-alanine ligase (MurF). This entry also includes ... All four Mur ligases are topologically similar to one another, even though they display low sequence identity. They are each ... Smith CA (September 2006). "Structure, function and dynamics in the mur family of bacterial cell wall ligases". J. Mol. Biol. ...
ligase* Any of a class of enzymes that catalyse the formation of covalent bonds using the energy released by the cleavage of ... Ligases are important in the synthesis and repair of many biological molecules, including DNA (see DNA ligase), and are used in ... ligase Any of a class of enzymes that catalyse the formation of covalent bonds using the energy released by the cleavage of ATP ... ligase An enzyme that catalyses a reaction which joins 2 substrates, using energy derived from the simultaneous hydrolysis of a ...
Springer Handbook of Enzymes provides data on enzymes sufficiently well characterized. It offers concise and complete descriptions of some 5,000 enzymes and their application areas. Data sheets are ar
Succinate-CoA ligase deficiency is an inherited disorder that affects the early development of the brain and other body systems ... Succinate-CoA ligase deficiency results from mutations in the SUCLA2 or SUCLG1 gene. SUCLG1 gene mutations can cause fatal ... Succinate-CoA ligase deficiency is an inherited disorder that affects the early development of the brain and other body systems ... The SUCLA2 and SUCLG1 genes each provide instructions for making one part (subunit) of an enzyme called succinate-CoA ligase. ...
GO:0004812 aminoacyl-tRNA ligase activity GO:0004822 isoleucine-tRNA ligase activity GO:0005524 ATP binding ...
Isoleucine-tRNA ligase (IPR002301). Short name: Ile-tRNA-ligase Family relationships *Isoleucine-tRNA ligase (IPR002301) * ... Isoleucine-tRNA ligase (also known as Isoleucyl-tRNA synthetase)(EC:6.1.1.5) is an alpha monomer that belongs to class Ia. The ... The aminoacyl-tRNA synthetase (also known as aminoacyl-tRNA ligase) catalyse the attachment of an amino acid to its cognate ... Then, in a second, "editing" step, the ligase itself rapidly hydrolyses only the valylated products [PMID: 9554847, PMID: ...
Pyruvate Carboxylase Genes and a PutativeEscherichia coli-Type Bifunctional Biotin Protein Ligase Gene (bpl/birA) Exhibit a ...
Select from our array of cloning enzymes such as ligases, polymerases and PNK, DNA modifying enzymes (e.g., phosphatases and ... Ligase Nuclease Polynucleotide Kinase RNA Polymerase RNase Inhibitors TdT Primers. Phage Promoter Primers pUC/M13 Reporter ... Promega offers a variety of cloning enzymes including DNA and RNA ligases and polymerases. T7, T3, and SP6 RNA Polymerases are ... Cloning enzymes include DNA ligases, which are typically used for ligation of DNA inserts into vectors, DNA polymerases for ...
... Andy amcshea at world.std.com Tue Mar 11 12:02:02 EST 1997 *Previous message: What is Decon 90? ... Any thoughts on how Pharmacia make that ready-to-go dried pellet of ligase or RT? I like this superstable enzyme stuff and ...
... catalyzes the ATP-dependent ligation of single-stranded RNA or DNA onto the 5´-phosphoryl termini of single- ... T4 RNA Ligase is provided with 10X Reaction Buffer: 500mM Tris-HCl (pH 7.8 at 25°C), 100mM MgCl2, 50mM DTT, 10mM ATP. ... T4 DNA Ligase. Joins two dsDNA strands with cohesive or blunt ends by using the 5´-phosphate and the 3´-hydroxyl groups of ... T4 RNA Ligase catalyzes the ATP-dependent ligation of single-stranded RNA or DNA onto the 5´-phosphoryl termini of single- ...
... Dima Klenchin klenchin at REMOVE_TO_REPLY.facstaff.wisc.edu Mon Aug 6 00:03:11 EST 2001 *Previous message: ... will ligase start eating up DNA and act as a DNAse ,(considering the ligation reaction being a real chemical ,reaction DNA1 + ... DNA2 + ATP ,=, ligated_DNA + ADP + P) ? T4 ligase, AFAIK, does not have nuclease activity. If so, absense of ATP would mean no ...
... also known as PBCV-1 DNA Ligase or Chorella virus DNA Ligase, efficiently catalyzes the ligation of adjacent, single-stranded ... making SplintR ligase a superior choice for demanding RNA detection technologies. ... SplintR Ligase, also known as PBCV-1 DNA Ligase or Chlorella virus DNA Ligase, efficiently catalyzes the ligation of adjacent, ... SplintR Ligase Reaction Buffer 10 X Product Categories:. RNA Isolation & Enrichment Products, DNA Ligases Products. ...
RNA Ligases. Current Protocols in Molecular Biology. 84:III:3.15:3.15.1-3.15.4. ...
View a chart of NEBs DNA and RNA ligases, their differences, and recommendations for optimal performance. ... Hi-T4 DNA Ligase displays increased thermotolerance compared to T4 DNA Ligase. Hi-T4 DNA Ligase can withstand temperatures as ... See also notes for T4 DNA Ligase.. T3 DNA Ligase. M0317S/L. 25°C. (4-37°C). N. ATP. A salt-tolerant enzyme for the ligation of ... 9°N™ DNA Ligase. M0238S/L. 60°C. (45-70°C). N. ATP. Thermostable ATP dependent ligase that ligates only nicks in dsDNA with a ...
Gene Ontology (GO) annotations for ligase All GO annotations for Gclm (34) ...
Ubiquitin ligases mediate growth and development by promoting protein death.. Stone SL1, Callis J. ...
PLN03113; DNA ligase 1; Provisional. pfam04675. Location:257 → 428. DNA_ligase_A_N; DNA ligase N terminus. ... PLN03113; DNA ligase 1; Provisional. pfam04675. Location:220 → 391. DNA_ligase_A_N; DNA ligase N terminus. ... PLN03113; DNA ligase 1; Provisional. pfam04675. Location:287 → 458. DNA_ligase_A_N; DNA ligase N terminus. ... PLN03113; DNA ligase 1; Provisional. pfam04675. Location:258 → 429. DNA_ligase_A_N; DNA ligase N terminus. ...
Background RBR ubiquitin ligases are components of the ubiquitin-proteasome system present in all eukaryotes. They are ...
... and inhibitors of cell division are targeted for degradation by a recently described family of E3 ubiquitin protein ligases ... SCF ubiquitin protein ligases and phosphorylation-dependent proteolysis Philos Trans R Soc Lond B Biol Sci. 1999 Sep 29;354( ... The concepts of SCF ubiquitin ligase function are illustrated by analysis of the degradation pathway for the G1 cyclin Cln2. ... and inhibitors of cell division are targeted for degradation by a recently described family of E3 ubiquitin protein ligases ...
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
In this review, we will discuss the regulation of CRL ubiquitin ligases and their roles in control of DNA damage response. ... In this review, we will discuss the regulation of CRL ubiquitin ligases and their roles in control of DNA damage response. ... comprise the largest subfamily of ubiquitin ligases and are involved in various biological processes. One of the main functions ... comprise the largest subfamily of ubiquitin ligases and are involved in various biological processes. One of the main functions ...
Phosphoribosylamine--glycine ligase. A. 431. Yersinia pestis CO92. Mutation(s): 0 Gene Names: purD, y0501, YPO3729, YP_3092. EC ... X-ray crystal structure of phosphoribosylamine-glycine ligase from Yersinia pestis.. Osipiuk, J., Zhou, M., Papazisi, L., ...
Localization of the Rsp5p Ubiquitin-Protein Ligase at Multiple Sites within the Endocytic Pathway Guangli Wang, J. Michael ... The SCFHOS/β-TRCP-ROC1 E3 Ubiquitin Ligase Utilizes Two Distinct Domains within CUL1 for Substrate Targeting and Ubiquitin ... Latent Membrane Protein 2A of Epstein-Barr Virus Binds WW Domain E3 Protein-Ubiquitin Ligases That Ubiquitinate B-Cell Tyrosine ... Nonperiodic Activity of the Human Anaphase-Promoting Complex-Cdh1 Ubiquitin Ligase Results in Continuous DNA Synthesis ...
IPR024928 E3_ub_ligase_SMURF1. IPR000569 HECT_dom. IPR035983 Hect_E3_ubiquitin_ligase. IPR001202 WW_dom. IPR036020 WW_dom_sf. ... IPR024928 E3_ub_ligase_SMURF1. IPR000569 HECT_dom. IPR035983 Hect_E3_ubiquitin_ligase. IPR001202 WW_dom. IPR036020 WW_dom_sf. ... LigaseImported. ,p>Information which has been imported from another database using automatic procedures.,/p> ,p>,a href="/ ... E3 ubiquitin-protein ligaseUniRule annotation. Automatic assertion according to rulesi ...
T7 DNA Ligase[sunting , sunting sumber]. T7 DNA ligase merupakan DNA ligase dengan ukuran terkecil, yaitu sebesar 41 kDa.[2] ... DNA ligase ATP-dependent yang umum adalah T4 DNA ligase dan T7 DNA ligase.[2] ... T4 DNA Ligase[sunting , sunting sumber]. T4 DNA ligase berasal dari T4 bakteriofage.[5] Enzim ini akan meligasi fragmen DNA ... DNA ligase dapat digolongkan menjadi 2 jenis berdasarkan kofaktor yang diperlukan, yaitu NAD+ atau ATP.[1] DNA ligase NAD+- ...
Gene Ontology Term: SCF ubiquitin ligase complex. GO ID. GO:0019005 Aspect. Cellular Component. Description. A ubiquitin ligase ... CDL1 complex, CRL1 complex, Cul1-RING ubiquitin ligase complex, cullin-RING ligase 1, SCF complex, SCF complex substrate ...
ZNRF proteins are E3 ubiquitin ligases. Many proteins containing RING finger(s) function as E3 ubiquitin ligases; we therefore ... thus defining a novel family of ZNRF E3 ubiquitin ligases. Both ZNRF1 and ZNRF2 have E3 ubiquitin ligase activity and are ... ZNRF protein ubiquitin ligase activity requires the RING finger motif. A, Schematic representation of wild-type and mutant ZNRF ... Hatakeyama S, Yada M, Matsumoto M, Ishida N, Nakayama KI (2001) U box proteins as a new family of ubiquitin-protein ligases. J ...
  • In biochemistry , a ligase is an enzyme that can catalyze the joining of two large molecules by forming a new chemical bond , usually with accompanying hydrolysis of a small pendant chemical group on one of the larger molecules or the enzyme catalyzing the linking together of two compounds, e.g., enzymes that catalyze joining of C-O, C-S, C-N, etc. (wikipedia.org)
  • The common names of ligases often include the word "ligase", such as DNA ligase , an enzyme commonly used in molecular biology laboratories to join together DNA fragments. (wikipedia.org)
  • It is also said that a synthase is a lyase (a lyase is an enzyme that catalyzes the breaking of various chemical bonds by means other than hydrolysis and oxidation, often forming a new double bond or a new ring structure) and does not require any energy, whereas a synthetase is a ligase (a ligase is an enzyme that binds two chemicals or compounds) and thus requires energy. (wikipedia.org)
  • The conserved sequence motifs found in the four Mur enzymes also map to other members of the Mur ligase family, including folylpolyglutamate synthetase, cyanophycin synthetase and the capB enzyme from Bacillales. (wikipedia.org)
  • In biochemistry, a ligase is an enzyme that can catalyze the joining (ligation) of two large molecules by forming a new chemical bond. (wikipedia.org)
  • ligase An enzyme that catalyses a reaction that joins two substrates , using energy derived from the simultaneous hydrolysis of a nucleotide triphosphate. (encyclopedia.com)
  • The SUCLA2 and SUCLG1 genes each provide instructions for making one part (subunit) of an enzyme called succinate-CoA ligase. (medlineplus.gov)
  • The enzyme, isoleucine-tRNA ligase, activates not only the cognate substrate L-isoleucine but also the minimally distinct L-valine in the first, aminoacylation step. (ebi.ac.uk)
  • The robust activity of the enzyme and its affinity for RNA-splinted DNA substrates (apparent Km = 1 nM) enable sub-nanomolar detection of unique RNA species within a complex mixture, making SplintR ligase a superior choice for demanding RNA detection technologies. (neb.com)
  • 5X enzyme concentration over standard T4 DNA Ligase, good for increasing reaction rates or for bulk users. (neb.com)
  • In this pathway, target proteins are covalently linked to the 76 amino acid Ub protein by the sequential action of three enzymes (the E1 activating enzyme, the E2 conjugating enzyme, and the E3 ubiquitin-ligase). (frontiersin.org)
  • The last step of the ubiquitination pathway is regulated by enzyme type 3 (E3) ubiquitin ligases. (sciencemag.org)
  • Ubiquitin-protein ligase (UPL) ( E3 ) or E3 ubiquitin-protein ligase in combination with ubiquitin-conjugating enzyme (E2) causes the attachment of ubiquitin to lysine in a target protein [1] . (proteopedia.org)
  • The enzyme 4-coumarate:coenzyme A ligase (4CL) is important in providing activated thioester substrates for phenylpropanoid natural product biosynthesis. (plantphysiol.org)
  • Anza T4 DNA Ligase Master Mix is part of the Anza™ Restriction Enzyme Cloning System, unifying the traditional cloning processes. (thermofisher.com)
  • Our interest in fatty acyl-CoA synthetase stems from the identification of this enzyme, long-chain fatty acyl-CoA ligase (LCFA) by microarray analysis. (hindawi.com)
  • On the basis of the data presented in this work, we propose that long-chain fatty acyl-CoA ligase enzyme serves as an important protein and a potential target candidate for development of selective inhibitors against leishmaniasis. (hindawi.com)
  • One interesting target which emerged from our microarray experiments [ 4 ] was long-chain fatty acid-CoA ligase (EC 6.2.1.3) (GenBank Accession No. XM_001681734), a key enzyme involved in the metabolism of fatty acids in all organisms [ 5 - 9 ]. (hindawi.com)
  • Long-chain fatty acyl-CoA ligase is critical enzyme processing long-chain fatty acid acylation which is essential for lysophosphatidylinositol (lyso-PI) incorporation into glycosyl phosphatidylinositols (GPIs) [ 16 , 17 ]. (hindawi.com)
  • DNA ligase is an enzyme that binds two strands of DNA (deoxyribonucleic acid) together. (sciencephoto.com)
  • After trying T4 DNA ligases from different vendors, we decided to use highly concentrated enzyme (10 Weiss units/[micro]L) (23) provided by Epicentre. (thefreedictionary.com)
  • Quick-Stick Ligase is a T4 DNA Ligase that has been mutated to improve enzyme activity and which contains a specially developed 4x Quick-Stick Buffer. (bioline.com)
  • A ready-to-use E3 ligase activity enzymatic assay, the E3LITE kit , has been recently designed enabling researchers to screen for E3 enzyme inhibitors and potentially new therapeutical drugs. (tebu-bio.com)
  • Ubiquitin ligases mediate growth and development by promoting protein death. (nih.gov)
  • Many key activators and inhibitors of cell division are targeted for degradation by a recently described family of E3 ubiquitin protein ligases termed Skp1-Cdc53-F-box protein (SCF) complexes. (nih.gov)
  • Here we describe the identification of a closely related protein, ZNRF2, thus defining a novel family of ZNRF E3 ubiquitin ligases. (jneurosci.org)
  • The carboxy-terminus of Hsc70 interacting protein (CHIP) is a cochaperone E3 ligase containing three tandem repeats of tetratricopeptide (TPR) motifs and a C-terminal U-box domain separated by a charged coiled-coil region. (hindawi.com)
  • The carboxyl-terminus of Hsc70 interacting protein or CHIP (referred to hereafter as CHIP) is a U-box type chaperone associated E3 ligase. (hindawi.com)
  • This dual-function cochaperone/E3 ligase protein activates HSF1 under various stress conditions and confers protection against apoptosis. (hindawi.com)
  • Figure 1: The ubiquitin-protein ligase activity of gp78 is required for metastasis of HT1080 sarcoma cells. (nature.com)
  • The tumor autocrine motility factor receptor, gp78, is a ubiquitin protein ligase implicated in degradation from the endoplasmic reticulum. (nature.com)
  • Overexpression of the tumor autocrine motility factor receptor Gp78, a ubiquitin protein ligase, results in increased ubiquitinylation and decreased secretion of apolipoprotein B100 in HepG2 cells. (nature.com)
  • AAA ATPase p97/valosin-containing protein interacts with gp78, a ubiquitin ligase for endoplasmic reticulum-associated degradation. (nature.com)
  • The G protein β subunit functions as an adaptor subunit for an E3 ligase that ubiquitylates the G protein-coupled receptor kinase GRK2. (sciencemag.org)
  • The Gam protein of transposable phage Mu is an ortholog of eukaryotic and bacterial Ku proteins, which carry out nonhomologous DNA end joining (NHEJ) with the help of dedicated ATP-dependent ligases. (pnas.org)
  • E3 Ub-ligases recognize structural motifs in the target, bind the substrate protein, and catalyze the formation of an amide isopeptide linkage between Gly 76 in the C-terminus of the Ub molecule (brought to the E3 by the E2) and the ε-amino group of a lysine residue in the target protein. (frontiersin.org)
  • RING finger ubiquitin-protein ligases (E3s) are the most abundant class of E3 that mediate protein ubiquitylation (also known as ubiquitination). (nature.com)
  • Fundamental to the specificity of this system are ubiquitin-protein ligases (E3s). (nature.com)
  • In the present study, we identified F-box protein 28 (FBXO28), a substrate-recruiting component of the Skp1-Cul1-F-box (SCF) ligase complex, as a regulator of pancreatic β-cell survival. (mdpi.com)
  • For E3 ubiquitin-protein ligase parkin see Parkin . (proteopedia.org)
  • The role of ubiquitin-protein ligases in neurodegenerative disease. (proteopedia.org)
  • Your search returned 5 mindbomb E3 ubiquitin protein ligase 1 ELISA ELISA Kit across 3 suppliers. (biocompare.com)
  • To gain biochemical understanding on TRIM25 E3 ligase activity we have successfully purified this protein. (europa.eu)
  • We then showed that this protein functions as E3 ligase in an in vitro system comprising pure proteins. (europa.eu)
  • Specificity of human Phosphopantothenate-cysteine ligase antibody verified on a Protein Array containing target protein plus 383 other non-specific proteins. (novusbio.com)
  • Previous studies have shown that HECT domain containing proteins are ubiquitin E3 ligases that play an important role in protein degradation. (ahajournals.org)
  • DNA Ligase III gene product migrates as a 100 kDa (a-form) protein in somatic tissues, is ubiquitously expressed and complexes with XRCC-1 and a 97 kDa (beta form) protein that is found in testis. (thermofisher.com)
  • The joining of Okazaki fragments during lagging strand DNA replication in mammalian cells is due to DNA ligase I. A combination of DNA polymerase epsilon, PCNA, replication factor C, replication protein A, and DNA ligase I is well-suited to the task of creating nucleotide excision repair patches. (novusbio.com)
  • PARK2 (also known as Parkin RBR E3 ubiquitin protein ligase) is one of the largest genes in our genome. (atlasgeneticsoncology.org)
  • however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrates for proteasomal degradation. (atlasgeneticsoncology.org)
  • Ozz directs destruction of â-catenin by assembling an active ubiquitin ligase complex, Ozz-E3, which breaks down this pool of the protein in muscle cells. (innovations-report.com)
  • In the first step, Escherichia coli lipoic acid ligase (LplA) site-specifically attaches 10-bromodecanoic acid onto a 13 amino acid recognition sequence that is genetically fused to a protein of interest. (mit.edu)
  • We found that an E3 ubiquitin ligase complex containing the FBXL5 protein targets IRP2 for proteasomal degradation. (sciencemag.org)
  • Molecular model of the DNA (deoxyribonucleic acid) repair protein XRCC4 complexed with DNA ligase IV. (sciencephoto.com)
  • Ubiquitination of proteins by the Nedd4 family of ubiquitin ligases is a significant mechanism in protein trafficking and degradation and provides for tight spatiotemporal regulation. (epfl.ch)
  • This review will focus on the Nedd4 and Nedd4-2 E3 ubiquitin ligases that are implicated in an increasing number of neuronal protein-protein interactions. (epfl.ch)
  • Some ligases associate with biological membranes as peripheral membrane proteins or anchored through a single transmembrane helix , [2] for example certain ubiquitin ligase related proteins. (wikipedia.org)
  • This review is focused on a conserved ubiquitin ligase complex known as SCF that plays a key role in marking a variety of regulatory proteins for destruction by the 26S proteasome. (nih.gov)
  • These data suggest that ZNRF proteins play a role in the establishment and maintenance of neuronal transmission and plasticity via their ubiquitin ligase activity. (jneurosci.org)
  • More recently, it has become clear that a large number of proteins containing RING finger motifs function as E3 ligases, with the RING finger motif itself serving to recruit specific E2s ( Pickart, 2001 ). (jneurosci.org)
  • however, few E3 ubiquitin ligases that target membrane proteins (e.g. (jneurosci.org)
  • CHIP is known to function as a central quality control E3 ligase and regulates several proteins involved in a myriad of physiological and pathological processes. (hindawi.com)
  • Ubiquitin ligase trapping identifies an SCF(Saf1) pathway targeting unprocessed vacuolar/lysosomal proteins. (yeastgenome.org)
  • By selecting the target proteins, the E3-ligases serve as the primary regulators of ubiquitylation. (frontiersin.org)
  • Ligases are, therefore, commercially-valuable proteins. (uea.ac.uk)
  • Other proteins regulate the activity of Siah1 and some assemble together with Siah1 into multi-component E3 ligase complexes. (iucr.org)
  • There are four distinct ligase proteins found in mammalian cells. (thermofisher.com)
  • In this study, we showed that exacerbated hypertrophy induced by pressure overload in cardiac-deleted Pak1 mice was attributable to a failure to upregulate the antihypertrophic E3 ligase, Fbxo32, responsible for targeting proteins for the ubiquitin-degradation pathway. (ahajournals.org)
  • 21 Glutamate-Cysteine Ligase, Catalytic Subunit (GCLC) ELISA Kits from 9 manufacturers are available on www.antibodies-online.com. (antibodies-online.com)
  • Further purification and properties of polynucleotide ligase from Escherichia coli infected with bacteriophage T4. (currentprotocols.com)
  • The novel finding is that MuGam, in concert with Escherichia coli ligase, endows the cell with a nonhomologous end-joining repair pathway. (pnas.org)
  • Ensemble and single-molecule experiments reveal that MuGam binds to DNA ends, slows the progress of RecBCD exonuclease, promotes binding of NAD + -dependent Escherichia coli ligase A, and stimulates ligation. (pnas.org)
  • SplintR Ligase, also known as PBCV-1 DNA Ligase or Chlorella virus DNA Ligase, efficiently catalyzes the ligation of adjacent, single-stranded DNA splinted by a complementary RNA strand. (neb.com)
  • Salt-T4 DNA Ligase is insensitive to salt carried over from other reaction components (vector or insert DNA) and allows ligation reactions to proceed in alternative reaction buffers with higher levels of salt (e.g. (neb.com)
  • Stimulation of intermolecular ligation with E. coli DNA ligase by high concentrations of monovalent cations in polyethylene glycol solutions. (currentprotocols.com)
  • Regulation of inter‐ and intramolecular ligation with T4 DNA ligase in the presence of polyethylene glycol. (currentprotocols.com)
  • Polymer‐stimulated ligation: Enhanced blunt‐ or cohesive‐end ligation of DNA or deoxyribooligonucleotides by T4 DNA ligase in polymer solutions. (currentprotocols.com)
  • Both blunt and cohesive end DNA ligation, as well as single-stranded nick repair of DNA, RNA and DNA/RNA, are possible via the T4 DNA ligase. (clontech.com)
  • Lei Zhang et al, Archaeal RNA Ligase from Thermoccocus Kodakarensis for Template Dependent Ligation, RNA Biology (2016). (phys.org)
  • Quick-Stick Ligase is designed to carry out fast and efficient ligation of both cohesive and blunt-ended DNA at room temperature. (bioline.com)
  • In this multi-step process, adapter ligation via the use of T4 DNA ligase is the limiting step in complete conversion of sample to ligated library fragments. (codexis.com)
  • Succinate-CoA ligase deficiency results from mutations in the SUCLA2 or SUCLG1 gene. (medlineplus.gov)
  • Mutations in either the SUCLA2 or SUCLG1 gene disrupt the normal function of succinate-CoA ligase. (medlineplus.gov)
  • Cloning, overexpression and nucleotide sequence of a thermostable DNA ligase‐encoding gene. (currentprotocols.com)
  • Many biotechnological companies investigate ligases due to their importance in the regulation of gene expression. (uea.ac.uk)
  • In the present study, we confirm the presence of long-chain fatty acyl-CoA ligase gene in the genome of clinical isolates of Leishmania donovani collected from the disease endemic area in India. (hindawi.com)
  • As a large and versatile gene family the RING type ubiquitin E3 ligases were chosen as targets of the genomic screen. (helsinki.fi)
  • DNA ligase I is functionally homologous to the DNA ligase encoded by the Saccharomyces cerevisiae Cdc9 gene. (novusbio.com)
  • Other common names for ligases include the word "synthetase", because they are used to synthesize new molecules. (wikipedia.org)
  • Isoleucine-tRNA ligase (also known as Isoleucyl-tRNA synthetase)( EC:6.1.1.5 ) is an alpha monomer that belongs to class Ia. (ebi.ac.uk)
  • The aminoacyl-tRNA synthetase (also known as aminoacyl-tRNA ligase) catalyse the attachment of an amino acid to its cognate transfer RNA molecule in a highly specific two-step reaction [ PMID: 10704480 , PMID: 12458790 ]. (ebi.ac.uk)
  • Examples of ligases include the synthetase enzymes. (thefreedictionary.com)
  • Immunohistochemistry: Phosphopantothenate-cysteine ligase Antibody [NBP2-38181] - Staining of human smooth muscle shows distinct cytoplasmic positivity in smooth muscle cells. (novusbio.com)
  • There are no publications for Phosphopantothenate-cysteine ligase Antibody (NBP2-38181). (novusbio.com)
  • The following antibody was used in this experiment: DNA Ligase III Polyclonal Antibody from Thermo Fisher Scientific, catalog # PA5-102510, RRID AB_2851912. (thermofisher.com)
  • By Western blot, this antibody detects a band of 125 kDa, which corresponds to the predicted molecular weight of DNA ligase I. (novusbio.com)
  • 14 ) correlated higher values from ligase chain reactions (LCR) in clinical samples with higher chlamydial burdens observed by direct fluorescent antibody testing. (asm.org)
  • A key component of ubiquitination pathways, the ubiquitin ligase, controls both the specificity and timing of substrate ubiquitination. (nih.gov)
  • This all depends on the extent to which the ligase is template dependent and its structural specificity. (phys.org)
  • Ubiquitination requires a cascade of enzymes, with the target or substrate specificity finally defined by the E3 ubiquitin ligase component, a noncatalytic component of the active complex that is formed with an E2 ligase. (iucr.org)
  • Objective: Specificity in the ubiquitin-proteasome system is largely conferred by ubiquitin E3 ligases (E3s). (thefreedictionary.com)
  • Diamond's Electron Bio-Imaging Facility (eBIC) has been used to generate the first 3D structure of the Fanconi anaemia (FA) core complex, a multi-subunit E3 ubiquitin ligase required for the repair of damaged DNA. (lightsources.org)
  • 2004. Staphylococcus aureus DNA ligase: characterization of its kinetics of catalysis and development of a high-throughput screening compatible chemiluminescent hybridization protection assay. (wikipedia.org)
  • A High Throughput Assay of Bacterial DNA Ligase for Antibacterial Drug Discovery. (wikipedia.org)
  • The assay platforms will aid in the identification and further characterization of the approximately 100 DUBs and 700 ligases in the human genome. (thefreedictionary.com)
  • Modification of the standard Chlamydia trachomatis ligase chain reaction (LCR) detection assay resulted in a quantitative test. (asm.org)
  • Predictive of its U-box, CHIP was identified as the first chaperone associated E3 ligase that targets Hsp90 (partially folded) and Hsp70 (misfolded) clients for degradation through the 26S proteasome [ 6 - 9 ] and is suggested to be also involved in substrate delivery to the proteasome [ 6 , 10 ]. (hindawi.com)
  • Indisulam is a small molecule that works by guiding the cells ubiquitin ligase system to degrade a novel substrate, the RNA splicing factor RBM39. (thefreedictionary.com)
  • KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases. (harvard.edu)
  • The concepts of SCF ubiquitin ligase function are illustrated by analysis of the degradation pathway for the G1 cyclin Cln2. (nih.gov)
  • Song, B.L., Sever, N. & DeBose-Boyd, R.A. Gp78, a membrane-anchored ubiquitin ligase, associates with Insig-1 and couples sterol-regulated ubiquitination to degradation of HMG CoA reductase. (nature.com)
  • Shen, Y., Ballar, P. & Fang, S. Ubiquitin ligase gp78 increases solubility and facilitates degradation of the Z variant of α-1-antitrypsin. (nature.com)
  • Siah1 is an E3 ubiquitin ligase that contributes to proteasome-mediated degradation of multiple targets in key cellular processes and which shows promise as a therapeutic target in oncology. (iucr.org)
  • HLI 373 is an inhibitor of Hdm2 ubiquitin ligase (E3) which blocks Hdm2-mediated ubiquitylation, proteasomal degradation of p53 and activates p53-dependent transcription. (adooq.com)
  • Recombinant fragment corresponding to Human DNA Ligase III (C terminal). (abcam.com)
  • Recombinant fragment containing a sequence corresponding to a region within amino acids 116-403 of Human DNA Ligase III (NP_039269). (abcam.com)
  • Four biochemically distinct DNA ligases, termed ligases I-IV, have been identified in mammalian cells. (novusbio.com)
  • MIR1 and MIR2 are two E3 ubiquitin ligases encoded by Kaposi's sarcoma-associated herpesvirus that mediate the ubiquitination of major histocompatibility complex class I (MHC I) molecules and subsequent internalization. (sciencemag.org)
  • SMAD ubiquitination regulatory factors 1 and 2 (Smurf1/2) are members of the HECT domain E3 ligase family which play crucial roles in the regulation of cell cycle progression, planar cell polarity, cancer metastasis and cell apoptosis. (sdbonline.org)
  • In this review, we will discuss the regulation of CRL ubiquitin ligases and their roles in control of the DDR. (frontiersin.org)
  • Petroski MD and Deshaies RJ (2005) Function and regulation of cullin-RING ubiquitin ligases. (yeastgenome.org)
  • In addition, there is still much that we don't understand about the nature and regulation of E3-ligase/target interactions and about the co-evolution of E3s and their targets. (frontiersin.org)
  • The E3 ubiquitin ligase Siah2 contributes to castration-resistant prostate cancer by regulation of androgen receptor transcriptional activity. (ipbs.fr)
  • Cullin/RING ubiquitin ligases (CRL) comprise the largest subfamily of ubiquitin ligases. (frontiersin.org)
  • A hitchhiker's guide to the cullin ubiquitin ligases: SCF and its kin. (yeastgenome.org)
  • The RING family is by far the largest class, and is divide into multiple subfamilies, including the monomeric/dimeric/heterodimeric RINGs, the a naphase- p romoting c omplex/ c yclosome (APC/C), and the Cullin-RING ligases. (frontiersin.org)
  • T4 ligase, AFAIK, does not have nuclease activity. (bio.net)
  • Hi-T4 DNA Ligase can withstand temperatures as high as 45°C for extended periods (up to 72 hours) without any significant loss in activity. (neb.com)
  • Salt-T4 DNA Ligase will join cohesive end termini at salt concentrations as high as 300 mM without any loss in activity. (neb.com)
  • Both ZNRF1 and ZNRF2 have E3 ubiquitin ligase activity and are highly expressed in the nervous system, particularly during development. (jneurosci.org)
  • The unexpected E3 ubiquitin ligase activity of a histone demethylase suppresses cancer cell growth. (sciencemag.org)
  • Direct comparison of nick‐joining activity of the nucleic acid ligases from bacteriophage T4. (currentprotocols.com)
  • Strikingly, Dma1 / 2 interact physically with both formins, while their ubiquitin-ligase activity is required for formin function and polarized localization. (genetics.org)
  • Currently we are attempting to generate crystal structure of TRIM25 in complex with E2 enzymes in order to understand, at the atomic level, the mechanism of TRIM25 E3 ligase activity. (europa.eu)
  • EDD has however, also been shown to regulate transcription independent of its E3 ligase activity. (ahajournals.org)
  • The activity of these DNA ligases is required for the joining of DNA strand breaks that occur during DNA replication, repair and recombination. (thermofisher.com)
  • HLI-98C, an analog, indeed inhibited Mdm2 E3 ligase activity. (adooq.com)
  • Notably, MMD-related mutations in the ubiquitin ligase domain of mysterin significantly impaired its fat-stabilizing activity. (rupress.org)
  • The researchers showed that the delicate balance between accumulation and removal of â-catenin at a specific cellular site, the sarcolemma - the membrane covering each muscle fiber - is achieved by the activity of the Ozz-E3 ligase. (innovations-report.com)
  • In general, a ligase catalyzes the following reaction: Ab + C → A-C + b or sometimes Ab + cD → A-D + b + c + d + e + f where the lowercase letters can signify the small, dependent groups. (wikipedia.org)
  • [1] DNA ligase NAD + - dependent ditemukan hanya di bakteri. (wikipedia.org)
  • [1] Sementara itu, DNA ligase ATP- dependent ditemukan di bakteriofage , eubacteria , archaea , dan virus . (wikipedia.org)
  • [2] DNA ligase ATP- dependent yang umum adalah T4 DNA ligase dan T7 DNA ligase. (wikipedia.org)
  • Belongs to the ATP-dependent DNA ligase family. (abcam.com)
  • A template-dependent RNA ligase will fuse two RNA strands only when one strand is aligned adjacently with the other strand onto a template. (phys.org)
  • The probes are then paired or "hybridized" with a target RNA strand in the presence of template dependent ligase. (phys.org)
  • Eukaryotic DNA ligases are ATP-dependent enzymes that catalyse the joining of single and double-strand DNA breaks, which is an essential final step in DNA replication, recombination and repair. (novusbio.com)
  • T4 DNA Ligase forms an energy dependent phosphodiester linkage between the termini of adjacent polynucleotides of duplex DNA. (sigmaaldrich.com)
  • Molecular model of NAD(+)-dependent DNA ligase bound to AMP (adenosine monophosphate). (sciencephoto.com)
  • If the mutation is not present, the structure of the hybrid molecule is disrupted and the ligase will not seal the nick. (phys.org)
  • Quick-Stick Ligase will ligate 99% of λ/ Hind III cohesive-ended fragments, or 80% of λ/ Eco RV blunt-ended fragments, in 5 minutes at room temperature. (bioline.com)
  • We found this targeting method to be specific, fast, and fully orthogonal to a previously reported and analogous quantum dot targeting method using E. coli biotin ligase and streptavidin. (mit.edu)
  • The NHEJ ligase complex is then recruited, and LigIV, XRCC4 and XLF-Cernunnos work to connect the two DNA strands. (kenyon.edu)
  • Structure of the catalytic region of DNA Ligase IV in complex with an artemis fragment sheds light on double-strand break repair. (kenyon.edu)
  • As our designs became more complex, we grew increasingly frustrated at the lack of specialized enzymes, such as ligases. (phys.org)
  • The megadalton FA core complex acts as an E3 ubiquitin ligase to initiate removal of these DNA crosslinks, helping to repair the damage caused. (lightsources.org)
  • A vertebrate hemerythrin domain in an E3 ubiquitin ligase complex senses and regulates cellular iron levels. (sciencemag.org)
  • There are several amino acid sequence motifs associated with E3 ligases, including the RING finger, HECT (homologous to the E6-AP carboxyl terminus), F box, and U box domain ( von Arnim, 2001 ). (jneurosci.org)
  • PYL9 interacted with two highly homologous plant U-box E3 ubiquitin ligases PUB22 and PUB23. (mdpi.com)
  • DNA ligase that seals nicks in double-stranded DNA during DNA replication, DNA recombination and DNA repair. (abcam.com)
  • Artemis C-terminal region facilitates V(D)J recombination through its interactions with DNA Ligase IV and DNA-PKcs. (kenyon.edu)
  • Ligases are classified as EC 6 in the EC number classification of enzymes. (wikipedia.org)
  • Based on their domain characteristics, ubiquitin ligases can be separated into two sub-groups, HECT domain E3 ligases and RING finger domain E3 ligases ( Pickart, 2004 ). (frontiersin.org)
  • E3 Ub-ligases group into four main types: the RING ( r eally- i nteresting n ew g ene) family, the U-box family, the HECT ( h omologous to the E 6AP c arboxyl t erminus) family, and the RBR ( R ING-in- b etween- R ING) family. (frontiersin.org)
  • To achieve this, polymerases and ligases used in traditional library preparations must be optimized to bind to minimal amounts of genomic input. (thefreedictionary.com)
  • A simple, three‐step procedure for the large scale purification of DNA ligase from a hybrid lambda lysogen constructed in vitro. (currentprotocols.com)
  • Brown researchers have developed a new ligase for laboratory use that could aid in in-vitro diagnostics and sequencing. (phys.org)
  • SMER3 is a selective inhibitor of a yeast SCF family E3 ubiquitin ligase (SCFMet30) in vitro and in vivo. (adooq.com)
  • Your search returned 2 DNA Ligase 3 ELISA ELISA Kit across 1 supplier. (biocompare.com)
  • Ligase can join two complementary fragments of nucleic acid and repair single stranded breaks that arise in double stranded DNA during replication. (wikipedia.org)
  • Whereas most previous efforts have focused on genetic mechanisms for the loss of metastasis suppressor genes, our results provide new evidence for post-translational downregulation of a metastasis suppressor by its ubiquitin ligase, resulting in abrogation of its metastasis-suppressing effects. (nature.com)
  • Derivatives of the bacterial plasmid pET-16b containing genes from bacteriophage T4 that allow for the expression of one DNA (T4Dnl) and two RNA ligases (T4Rnl1A, and T4Rnl2) have been developed. (uea.ac.uk)
  • Ligases are vital for the production of recombinant DNA used to insert genes into plasmids, which are important tools in genetic engineering where they are used to express, clone or amplify certain genes. (uea.ac.uk)
  • Furthermore, EDD significantly augmented myocardin's ability to induce expression of endogenous SMC marker genes, and these effects of EDD were independent on its E3 ligase function. (ahajournals.org)
  • Thus far, more than 600 ubiquitin ligases have been identified in the human genome, although many of them have not been linked to any substrates or biological activities. (frontiersin.org)
  • ligase Any of a class of enzymes that catalyse the formation of covalent bonds using the energy released by the cleavage of ATP. (encyclopedia.com)
  • Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections) analysis of rat brain tissue labelling DNA Ligase III with ab185815 at 1/200. (abcam.com)
  • 2018. "An SCF FBXO28 E3 Ligase Protects Pancreatic β-Cells from Apoptosis. (mdpi.com)
  • also known as Gm288 in mouse and CCNB1IP1 in human), a putative B-type cyclin E3 ubiquitin ligase. (middlebury.edu)
  • While mysterin is known to exert ubiquitin ligase and putative mechanical ATPase activities with a RING finger domain and two adjacent AAA+ modules, its biological role is poorly understood. (rupress.org)
  • T4 ligase plays an active role in repair of DNA and RNA nicks. (sigmaaldrich.com)