(2S-(2 alpha,3 beta,4 beta))-2-Carboxy-4-(1-methylethenyl)-3-pyrrolidineacetic acid. Ascaricide obtained from the red alga Digenea simplex. It is a potent excitatory amino acid agonist at some types of excitatory amino acid receptors and has been used to discriminate among receptor types. Like many excitatory amino acid agonists it can cause neurotoxicity and has been used experimentally for that purpose.
Drugs that bind to and activate excitatory amino acid receptors.
Clinical or subclinical disturbances of cortical function due to a sudden, abnormal, excessive, and disorganized discharge of brain cells. Clinical manifestations include abnormal motor, sensory and psychic phenomena. Recurrent seizures are usually referred to as EPILEPSY or "seizure disorder."
A class of ionotropic glutamate receptors characterized by their affinity for KAINIC ACID.
A prolonged seizure or seizures repeated frequently enough to prevent recovery between episodes occurring over a period of 20-30 minutes. The most common subtype is generalized tonic-clonic status epilepticus, a potentially fatal condition associated with neuronal injury and respiratory and metabolic dysfunction. Nonconvulsive forms include petit mal status and complex partial status, which may manifest as behavioral disturbances. Simple partial status epilepticus consists of persistent motor, sensory, or autonomic seizures that do not impair cognition (see also EPILEPSIA PARTIALIS CONTINUA). Subclinical status epilepticus generally refers to seizures occurring in an unresponsive or comatose individual in the absence of overt signs of seizure activity. (From N Engl J Med 1998 Apr 2;338(14):970-6; Neurologia 1997 Dec;12 Suppl 6:25-30)
A curved elevation of GRAY MATTER extending the entire length of the floor of the TEMPORAL HORN of the LATERAL VENTRICLE (see also TEMPORAL LOBE). The hippocampus proper, subiculum, and DENTATE GYRUS constitute the hippocampal formation. Sometimes authors include the ENTORHINAL CORTEX in the hippocampal formation.
Substances that act in the brain stem or spinal cord to produce tonic or clonic convulsions, often by removing normal inhibitory tone. They were formerly used to stimulate respiration or as antidotes to barbiturate overdose. They are now most commonly used as experimental tools.
A convulsant primarily used in experimental animals. It was formerly used to induce convulsions as a alternative to electroshock therapy.
An amino acid that, as the D-isomer, is the defining agonist for the NMDA receptor subtype of glutamate receptors (RECEPTORS, NMDA).
The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.
Toxic substances from microorganisms, plants or animals that interfere with the functions of the nervous system. Most venoms contain neurotoxic substances. Myotoxins are included in this concept.
The repeated weak excitation of brain structures, that progressively increases sensitivity to the same stimulation. Over time, this can lower the threshold required to trigger seizures.
A pharmaceutical agent that displays activity as a central nervous system and respiratory stimulant. It is considered a non-competitive GAMMA-AMINOBUTYRIC ACID antagonist. Pentylenetetrazole has been used experimentally to study seizure phenomenon and to identify pharmaceuticals that may control seizure susceptibility.
The lower portion of the BRAIN STEM. It is inferior to the PONS and anterior to the CEREBELLUM. Medulla oblongata serves as a relay station between the brain and the spinal cord, and contains centers for regulating respiratory, vasomotor, cardiac, and reflex activities.
A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.
A localization-related (focal) form of epilepsy characterized by recurrent seizures that arise from foci within the temporal lobe, most commonly from its mesial aspect. A wide variety of psychic phenomena may be associated, including illusions, hallucinations, dyscognitive states, and affective experiences. The majority of complex partial seizures (see EPILEPSY, COMPLEX PARTIAL) originate from the temporal lobes. Temporal lobe seizures may be classified by etiology as cryptogenic, familial, or symptomatic (i.e., related to an identified disease process or lesion). (From Adams et al., Principles of Neurology, 6th ed, p321)
Cell surface receptors that bind signalling molecules released by neurons and convert these signals into intracellular changes influencing the behavior of cells. Neurotransmitter is used here in its most general sense, including not only messengers that act to regulate ion channels, but also those which act on second messenger systems and those which may act at a distance from their release sites. Included are receptors for neuromodulators, neuroregulators, neuromediators, and neurohumors, whether or not located at synapses.
Nerve cells where transmission is mediated by NITRIC OXIDE.
A neurotoxic isoxazole (similar to KAINIC ACID and MUSCIMOL) found in AMANITA mushrooms. It causes motor depression, ataxia, and changes in mood, perceptions and feelings, and is a potent excitatory amino acid agonist.
A disorder characterized by recurrent episodes of paroxysmal brain dysfunction due to a sudden, disorderly, and excessive neuronal discharge. Epilepsy classification systems are generally based upon: (1) clinical features of the seizure episodes (e.g., motor seizure), (2) etiology (e.g., post-traumatic), (3) anatomic site of seizure origin (e.g., frontal lobe seizure), (4) tendency to spread to other structures in the brain, and (5) temporal patterns (e.g., nocturnal epilepsy). (From Adams et al., Principles of Neurology, 6th ed, p313)
An inhibitor of the enzyme TYROSINE 3-MONOOXYGENASE, and consequently of the synthesis of catecholamines. It is used to control the symptoms of excessive sympathetic stimulation in patients with PHEOCHROMOCYTOMA. (Martindale, The Extra Pharmacopoeia, 30th ed)
Axons of certain cells in the DENTATE GYRUS. They project to the polymorphic layer of the dentate gyrus and to the proximal dendrites of PYRAMIDAL CELLS of the HIPPOCAMPUS. These mossy fibers should not be confused with mossy fibers that are cerebellar afferents (see NERVE FIBERS).
Cell-surface proteins that bind glutamate and trigger changes which influence the behavior of cells. Glutamate receptors include ionotropic receptors (AMPA, kainate, and N-methyl-D-aspartate receptors), which directly control ion channels, and metabotropic receptors which act through second messenger systems. Glutamate receptors are the most common mediators of fast excitatory synaptic transmission in the central nervous system. They have also been implicated in the mechanisms of memory and of many diseases.
The four cellular masses in the floor of the fourth ventricle giving rise to a widely dispersed special sensory system. Included is the superior, medial, inferior, and LATERAL VESTIBULAR NUCLEUS. (From Dorland, 27th ed)
Derivatives of GLUTAMIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain the 2-aminopentanedioic acid structure.
Loss of functional activity and trophic degeneration of nerve axons and their terminal arborizations following the destruction of their cells of origin or interruption of their continuity with these cells. The pathology is characteristic of neurodegenerative diseases. Often the process of nerve degeneration is studied in research on neuroanatomical localization and correlation of the neurophysiology of neural pathways.
The production of a dense fibrous network of neuroglia; includes astrocytosis, which is a proliferation of astrocytes in the area of a degenerative lesion.
A non-essential amino acid naturally occurring in the L-form. Glutamic acid is the most common excitatory neurotransmitter in the CENTRAL NERVOUS SYSTEM.
An agonist at two subsets of excitatory amino acid receptors, ionotropic receptors that directly control membrane channels and metabotropic receptors that indirectly mediate calcium mobilization from intracellular stores. The compound is obtained from the seeds and fruit of Quisqualis chinensis.
Drugs intended to prevent damage to the brain or spinal cord from ischemia, stroke, convulsions, or trauma. Some must be administered before the event, but others may be effective for some time after. They act by a variety of mechanisms, but often directly or indirectly minimize the damage produced by endogenous excitatory amino acids.
Central gray matter surrounding the CEREBRAL AQUEDUCT in the MESENCEPHALON. Physiologically it is probably involved in RAGE reactions, the LORDOSIS REFLEX; FEEDING responses, bladder tonus, and pain.
The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.
A strain of albino rat developed at the Wistar Institute that has spread widely at other institutions. This has markedly diluted the original strain.
An IBOTENIC ACID homolog and glutamate agonist. The compound is the defining agonist for the AMPA subtype of glutamate receptors (RECEPTORS, AMPA). It has been used as a radionuclide imaging agent but is more commonly used as an experimental tool in cell biological studies.
A metabolite of tryptophan with a possible role in neurodegenerative disorders. Elevated CSF levels of quinolinic acid are correlated with the severity of neuropsychological deficits in patients who have AIDS.
Genetically identical individuals developed from brother and sister matings which have been carried out for twenty or more generations or by parent x offspring matings carried out with certain restrictions. This also includes animals with a long history of closed colony breeding.
Drugs used to prevent SEIZURES or reduce their severity.
Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.
Endogenous amino acids released by neurons as excitatory neurotransmitters. Glutamic acid is the most common excitatory neurotransmitter in the brain. Aspartic acid has been regarded as an excitatory transmitter for many years, but the extent of its role as a transmitter is unclear.
The termination of the cell's ability to carry out vital functions such as metabolism, growth, reproduction, responsiveness, and adaptability.
Involuntary rhythmical movements of the eyes in the normal person. These can be naturally occurring as in end-position (end-point, end-stage, or deviational) nystagmus or induced by the optokinetic drum (NYSTAGMUS, OPTOKINETIC), caloric test, or a rotating chair.
A class of ionotropic glutamate receptors characterized by affinity for N-methyl-D-aspartate. NMDA receptors have an allosteric binding site for glycine which must be occupied for the channel to open efficiently and a site within the channel itself to which magnesium ions bind in a voltage-dependent manner. The positive voltage dependence of channel conductance and the high permeability of the conducting channel to calcium ions (as well as to monovalent cations) are important in excitotoxicity and neuronal plasticity.
Increased levels of PROLACTIN in the BLOOD, which may be associated with AMENORRHEA and GALACTORRHEA. Relatively common etiologies include PROLACTINOMA, medication effect, KIDNEY FAILURE, granulomatous diseases of the PITUITARY GLAND, and disorders which interfere with the hypothalamic inhibition of prolactin release. Ectopic (non-pituitary) production of prolactin may also occur. (From Joynt, Clinical Neurology, 1992, Ch36, pp77-8)
The injection of very small amounts of fluid, often with the aid of a microscope and microsyringes.
Injections into the cerebral ventricles.
Recording of electric currents developed in the brain by means of electrodes applied to the scalp, to the surface of the brain, or placed within the substance of the brain.
GRAY MATTER situated above the GYRUS HIPPOCAMPI. It is composed of three layers. The molecular layer is continuous with the HIPPOCAMPUS in the hippocampal fissure. The granular layer consists of closely arranged spherical or oval neurons, called GRANULE CELLS, whose AXONS pass through the polymorphic layer ending on the DENDRITES of PYRAMIDAL CELLS in the hippocampus.
The front part of the hindbrain (RHOMBENCEPHALON) that lies between the MEDULLA and the midbrain (MESENCEPHALON) ventral to the cerebellum. It is composed of two parts, the dorsal and the ventral. The pons serves as a relay station for neural pathways between the CEREBELLUM to the CEREBRUM.
A slowly hydrolyzed muscarinic agonist with no nicotinic effects. Pilocarpine is used as a miotic and in the treatment of glaucoma.
Drugs that bind to but do not activate excitatory amino acid receptors, thereby blocking the actions of agonists.
Striped GRAY MATTER and WHITE MATTER consisting of the NEOSTRIATUM and paleostriatum (GLOBUS PALLIDUS). It is located in front of and lateral to the THALAMUS in each cerebral hemisphere. The gray substance is made up of the CAUDATE NUCLEUS and the lentiform nucleus (the latter consisting of the GLOBUS PALLIDUS and PUTAMEN). The WHITE MATTER is the INTERNAL CAPSULE.
The observable response an animal makes to any situation.
A potent excitatory amino acid antagonist with a preference for non-NMDA iontropic receptors. It is used primarily as a research tool.
A flavoprotein that reversibly oxidizes NADPH to NADP and a reduced acceptor. EC 1.6.99.1.
A class of large neuroglial (macroglial) cells in the central nervous system - the largest and most numerous neuroglial cells in the brain and spinal cord. Astrocytes (from "star" cells) are irregularly shaped with many long processes, including those with "end feet" which form the glial (limiting) membrane and directly and indirectly contribute to the BLOOD-BRAIN BARRIER. They regulate the extracellular ionic and chemical environment, and "reactive astrocytes" (along with MICROGLIA) respond to injury.
A set of forebrain structures common to all mammals that is defined functionally and anatomically. It is implicated in the higher integration of visceral, olfactory, and somatic information as well as homeostatic responses including fundamental survival behaviors (feeding, mating, emotion). For most authors, it includes the AMYGDALA; EPITHALAMUS; GYRUS CINGULI; hippocampal formation (see HIPPOCAMPUS); HYPOTHALAMUS; PARAHIPPOCAMPAL GYRUS; SEPTAL NUCLEI; anterior nuclear group of thalamus, and portions of the basal ganglia. (Parent, Carpenter's Human Neuroanatomy, 9th ed, p744; NeuroNames, http://rprcsgi.rprc.washington.edu/neuronames/index.html (September 2, 1998)).

In vivo intracellular analysis of granule cell axon reorganization in epileptic rats. (1/1468)

In vivo intracellular recording and labeling in kainate-induced epileptic rats was used to address questions about granule cell axon reorganization in temporal lobe epilepsy. Individually labeled granule cells were reconstructed three dimensionally and in their entirety. Compared with controls, granule cells in epileptic rats had longer average axon length per cell; the difference was significant in all strata of the dentate gyrus including the hilus. In epileptic rats, at least one-third of the granule cells extended an aberrant axon collateral into the molecular layer. Axon projections into the molecular layer had an average summed length of 1 mm per cell and spanned 600 microm of the septotemporal axis of the hippocampus-a distance within the normal span of granule cell axon collaterals. These findings in vivo confirm results from previous in vitro studies. Surprisingly, 12% of the granule cells in epileptic rats, and none in controls, extended a basal dendrite into the hilus, providing another route for recurrent excitation. Consistent with recurrent excitation, many granule cells (56%) in epileptic rats displayed a long-latency depolarization superimposed on a normal inhibitory postsynaptic potential. These findings demonstrate changes, occurring at the single-cell level after an epileptogenic hippocampal injury, that could result in novel, local, recurrent circuits.  (+info)

Preferential Zn2+ influx through Ca2+-permeable AMPA/kainate channels triggers prolonged mitochondrial superoxide production. (2/1468)

Synaptically released Zn2+ can enter and cause injury to postsynaptic neurons. Microfluorimetric studies using the Zn2+-sensitive probe, Newport green, examined levels of [Zn2+]i attained in cultured cortical neurons on exposure to N-methyl-D-asparte, kainate, or high K+ (to activate voltage-sensitive Ca2+ channels) in the presence of 300 microM Zn2+. Indicating particularly high permeability through Ca2+-permeable alpha-amino3-hydroxy-5-methyl-4-isoxazolepropionic-acid/kainate (Ca-A/K) channels, micromolar [Zn2+]i rises were observed only after kainate exposures and only in neurons expressing these channels [Ca-A/K(+) neurons]. Further studies using the oxidation-sensitive dye, hydroethidine, revealed Zn2+-dependent reactive oxygen species (ROS) generation that paralleled the [Zn2+]i rises, with rapid oxidation observed only in the case of Zn2+ entry through Ca-A/K channels. Indicating a mitochondrial source of this ROS generation, hydroethidine oxidation was inhibited by the mitochondrial electron transport blocker, rotenone. Additional evidence for a direct interaction between Zn2+ and mitochondria was provided by the observation that the Zn2+ entry through Ca-A/K channels triggered rapid mitochondrial depolarization, as assessed by using the potential-sensitive dye tetramethylrhodamine ethylester. Whereas Ca2+ influx through Ca-A/K channels also triggers ROS production, the [Zn2+]i rises and subsequent ROS production are of more prolonged duration.  (+info)

Glutamate-, kainate- and NMDA-evoked membrane currents in identified glial cells in rat spinal cord slice. (3/1468)

The effect of L-glutamate, kainate and N-methyl-D-aspartate (NMDA) on membrane currents of astrocytes, oligodendrocytes and their respective precursors was studied in acute spinal cord slices of rats between the ages of postnatal days 5 and 13 using the whole-cell patch-clamp technique. L-glutamate (10(-3) M), kainate (10(-3) M), and NMDA (2x10(-3) M) evoked inward currents in all glial cells. Kainate evoked larger currents in precursors than in astrocytes and oligodendrocytes, while NMDA induced larger currents in astrocytes and oligodendrocytes than in precursors. Kainate-evoked currents were blocked by the AMPA/kainate receptor antagonist CNQX (10(-4) M) and were, with the exception of the precursors, larger in dorsal than in ventral horns, as were NMDA-evoked currents. Currents evoked by NMDA were unaffected by CNQX and, in contrast to those seen in neurones, were not sensitive to Mg2+. In addition, they significantly decreased during development and were present when synaptic transmission was blocked in a Ca2+-free solution. NMDA-evoked currents were not abolished during the block of K+ inward currents in glial cells by Ba2+; thus they are unlikely to be mediated by an increase in extracellular K+ during neuronal activity. We provide evidence that spinal cord glial cells are sensitive to the application of L-glutamate, kainate and transiently, during postnatal development, to NMDA.  (+info)

The distribution of neurons expressing calcium-permeable AMPA receptors in the superficial laminae of the spinal cord dorsal horn. (4/1468)

The superficial dorsal horn is a major site of termination of nociceptive primary afferents. Fast excitatory synaptic transmission in this region is mediated mainly by release of glutamate onto postsynaptic AMPA and NMDA receptors. NMDA receptors are known to be Ca2+-permeable and to provide synaptically localized Ca2+ signals that mediate short-term and long-term changes in synaptic strength. Less well known is a subpopulation of AMPA receptors that is Ca2+-permeable and has been shown to be synaptically localized on dorsal horn neurons in culture (Gu et al., 1996) and expressed by dorsal horn neurons in situ (Nagy et al., 1994; Engelman et al., 1997). We used kainate-induced cobalt uptake as a functional marker of neurons expressing Ca2+-permeable AMPA receptors and combined this with markers of nociceptive primary afferents in the postnatal rat dorsal horn. We have shown that cobalt-positive neurons are located in lamina I and outer lamina II, a region strongly innervated by nociceptors. These cobalt-positive neurons colocalize with afferents labeled by LD2, and with the most dorsal region of capsaicin-sensitive and IB4- and LA4-positive afferents. In contrast, inner lamina II has a sparser distribution of cobalt-positive neurons. Some lamina I neurons expressing the NK1 receptor, the receptor for substance P, are also cobalt positive. These neurons are likely to be projection neurons in the nociceptive pathway. On the basis of all of these observations, we propose that Ca2+-permeable AMPA receptors are localized to mediate transmission of nociceptive information.  (+info)

Lateral hypothalamic NMDA receptor subunits NR2A and/or NR2B mediate eating: immunochemical/behavioral evidence. (5/1468)

Cells within the lateral hypothalamic area (LHA) are important in eating control. Glutamate or its analogs, kainic acid (KA) and N-methyl-D-aspartate (NMDA), elicit intense eating when microinjected there, and, conversely, LHA-administered NMDA receptor antagonists suppress deprivation- and NMDA-elicited eating. The subunit composition of LHA NMDA receptors (NMDA-Rs) mediating feeding, however, has not yet been determined. Identifying this is important, because distinct second messengers/modulators may be activated by NMDA-Rs with differing compositions. To begin to address this, we detected LHA NR2A and NR2B subunits by immunoblotting and NR2B subunits by immunohistochemistry using subunit-specific antibodies. To help determine whether NMDA-Rs mediating feeding might contain these subunits, we conducted behavioral studies using LHA-administered ifenprodil, an antagonist selective for NR2A- and/or NR2B-containing NMDA-Rs at the doses we used (0.001-100 nmol). Ifenprodil maximally suppressed NMDA- and deprivation-elicited feeding by 63 and 39%, respectively, but failed to suppress KA-elicited eating, suggesting its actions were behaviorally specific. Collectively, these results suggest that LHA NMDA-Rs, some of which contribute to feeding control, are composed of NR2A and/or NR2B subunits, and implicate NR2A- and/or NR2B-linked signal transduction in feeding behavior.  (+info)

Subtype-specific effects of lithium on glutamate receptor function. (6/1468)

We report that substitution of sodium with lithium (Li+) in the extracellular solution causes subtype-specific changes in the inward and outward currents of glutamate receptors (GluRs), without a shift in reversal potential. Li+ produces an increase of inward and outward currents of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate receptors and decreases in the currents of kainate (KA) and N-methyl-D-aspartate receptors. The greatest effect of Li+ was observed with GluR3. A concentration-response curve for GluR3 reveals that the potentiation caused by Li+ is greatest at saturating agonist concentrations. GluR1, which shows no potentiation by Li+ at 100 microM KA, shows a small but significant potentiation at saturating KA and glutamate concentrations. The effects of Li+ on outward current, where Li+ is not the primary charge carrier, and the lack of reversal potential shift argue for a mechanism of potentiation not associated with Li+ permeation. This potentiation of current is specific for Li+ because rubidium, although causing an increase of inward current, shifted the reversal potential and did not increase outward current. The effects of Li+ are different for KA, a weak desensitizing agonist, and glutamate, a strong desensitizing agonist, suggesting that Li+ might interact with a mechanism of desensitization. By using cyclothiazide (CTZ) to reduce desensitization of GluR3, we find that for low concentrations of KA and glutamate potentiation of the response by a combination of CTZ and Li+ is no greater than by CTZ or Li+ alone. However, at high concentrations of agonist, the potentiation of the response by a combination of CTZ and Li+ is significantly greater than by CTZ or Li+ alone. This potentiation was additive for glutamate but not for KA. At high agonist concentration in the presence of CTZ, the intrinsically lower desensitization produced with KA-evoked responses may preclude Li+ from potentiating the current to the same degree as it can potentiate glutamate-evoked responses. The additive effects of CTZ and Li+ were unique to the flop variant of GluR3.  (+info)

Recurrent mossy fiber pathway in rat dentate gyrus: synaptic currents evoked in presence and absence of seizure-induced growth. (7/1468)

A common feature of temporal lobe epilepsy and of animal models of epilepsy is the growth of hippocampal mossy fibers into the dentate molecular layer, where at least some of them innervate granule cells. Because the mossy fibers are axons of granule cells, the recurrent mossy fiber pathway provides monosynaptic excitatory feedback to these neurons that could facilitate seizure discharge. We used the pilocarpine model of temporal lobe epilepsy to study the synaptic responses evoked by activating this pathway. Whole cell patch-clamp recording demonstrated that antidromic stimulation of the mossy fibers evoked an excitatory postsynaptic current (EPSC) in approximately 74% of granule cells from rats that had survived >10 wk after pilocarpine-induced status epilepticus. Recurrent mossy fiber growth was demonstrated with the Timm stain in all instances. In contrast, antidromic stimulation of the mossy fibers evoked an EPSC in only 5% of granule cells studied 4-6 days after status epilepticus, before recurrent mossy fiber growth became detectable. Notably, antidromic mossy fiber stimulation also evoked an EPSC in many granule cells from control rats. Clusters of mossy fiber-like Timm staining normally were present in the inner third of the dentate molecular layer at the level of the hippocampal formation from which slices were prepared, and several considerations suggested that the recorded EPSCs depended mainly on activation of recurrent mossy fibers rather than associational fibers. In both status epilepticus and control groups, the antidromically evoked EPSC was glutamatergic and involved the activation of both AMPA/kainate and N-methyl-D-aspartate (NMDA) receptors. EPSCs recorded in granule cells from rats with recurrent mossy fiber growth differed in three respects from those recorded in control granule cells: they were much more frequently evoked, a number of them were unusually large, and the NMDA component of the response was generally much more prominent. In contrast to the antidromically evoked EPSC, the EPSC evoked by stimulation of the perforant path appeared to be unaffected by a prior episode of status epilepticus. These results support the hypothesis that recurrent mossy fiber growth and synapse formation increases the excitatory drive to dentate granule cells and thus facilitates repetitive synchronous discharge. Activation of NMDA receptors in the recurrent pathway may contribute to seizure propagation under depolarizing conditions. Mossy fiber-granule cell synapses also are present in normal rats, where they may contribute to repetitive granule cell discharge in regions of the dentate gyrus where their numbers are significant.  (+info)

Role of the Botzinger complex in fastigial nucleus-mediated respiratory responses. (8/1468)

We have reported that the phrenic neurogram (PN) is modulated by stimulation of the fastigial nucleus (FN) of the cerebellum. The present study was undertaken to search for brainstem site(s) involved in the FN efferent pathway to modulate phrenic nerve activities. Experiments were performed on 35 anesthetized, paralyzed, and ventilated cats, using the PN as the index of the respiratory motor output. Results showed that bilateral electrolytic lesions of the red nucleus (RN), the paramedian reticular nucleus (PRN), or the pontine respiratory group (PRG) had little effect on the ability of FN stimulation to modulate the respiratory output. However, the modulation was abolished by bilateral electrolytic lesions of the Botzinger complex (BotC). Further studies showed that bilateral chemical inactivation of BotC neurons produced by topical microinjection of kainic acid or cobalt chloride failed to abolish the modulation. We concluded that fibers of passage, not synapses or cell bodies in the BotC, were involved in the modulatory effect of FN stimulation on the PN. The RN, PRN, and PRG appear not to be important in the neural circuitry responsible for the FN modulation of the phrenic activity.  (+info)

Neurotrophins have long been recognized for their crucial roles in growth, differentiation, and survival in the developing nervous system. Recent findings demonstrating that the pro- form of NGF induces cell death via the p75NTR suggest that the consequences of neurotrophin signaling depend on many factors, in particular the balance between pro- and mature neurotrophins and the regulation of that balance, which may be altered in pathophysiological situations. Since p75NTR is upregulated in many types of neural injury and disease (Park et al., 2000; Troy et al., 2002; Harrington et al., 2004), the increased availability of a ligand that can stimulate apoptotic signaling through this receptor creates an environment in which these neurons are vulnerable. Thus, understanding neurotrophin processing is an important step toward understanding the pathway that a cell takes toward survival or death, especially in disease or after injury. We have detected increased proNGF levels in the CSF following ...
Kainic acid (KA) treatment is a well-established model of hippocampal neuron death mediated in large part by KA receptor-induced excitotoxicity. KA-induced, delayed neuron death has been shown previously to follow the induction of seizures and exhibit characteristics of both apoptosis and necrosis. …
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Neuronal damage after seizure is correlated with blood-brain barrier (BBB) leakage. Adiponectin (Ad) has shown protective effects on endothelial function. In this study, we investigated the effects of Ad on cell survival and BBB integrity in the mouse hippocampus after kainic acid (KA) treatment. Tw …
The effect of intracerebroventricular kainate injection on the elemental composition of the hippocampus was studied in adult Wistar rats, at 1 day and 1, 2, 3, and 4 weeks postinjection, using a nuclear microscope. An increase in calcium concentration was observed on the injected side from 1 day postinjection. The increase peaked at 3 weeks postinjection, reaching a concentration of 18 times normal. Large numbers of glial cells but no neurons were observed in the lesioned CA fields at this time, suggesting that an increased calcium level was present in glial cells. This was confirmed by high-resolution elemental maps of the lesioned areas, which showed very high intracellular calcium concentrations in almost all glial cells. It is possible that the high intracellular calcium level could activate calcium- dependent enzymes, including calpain II and cytosolic phospholipase A2, shown to be expressed in reactive glial cells after kainate injections. In addition to calcium, an increase in iron ...
Health, ... DOMA Technologies has launched the latest version of its revolution...Virginia Beach VA (PRWEB) - DOMA Technologies (a href http://www.do...DOMA Technologies success comes from helping hospitals physician pr...The users of iCodeRx iDocs and iCharts drove the enhancements of v...,DOMA,Transforms,Healthcare,IT,with,Increased,Security,While,Reducing,Cost,--,iCodeRx/iDocs/iCharts,6.0,Debuts,at,AHIMA,National,Convention,medicine,medical news today,latest medical news,medical newsletters,current medical news,latest medicine news
Korhonen, L., Belluardo, N., Mudo, G. and Lindholm, D. (2003), Increase in Bcl-2 phosphorylation and reduced levels of BH3-only Bcl-2 family proteins in kainic acid-mediated neuronal death in the rat brain. European Journal of Neuroscience, 18: 1121-1134. doi: 10.1046/j.1460-9568.2003.02826.x ...
鉤藤是中藥的一種,由於它有平肝熄風的作用,所以傳統中醫常用鉤藤來治療癲癇。我們先前研究已知鉤藤在大鼠可抑制kainic acid(KA)所誘發的癲癇發作,這個作用可能與降低大腦皮質的脂質過氧化作用有關,但鉤藤的有效成份至今而然是一個謎。本研究的目的是為了進一步暸解鉤藤的抗癲癇成份,用KA誘發Sprague-Dawley(SD)大鼠大腦皮質的脂質過氧化,使脂質過氧化物濃度升高, 來比較鉤藤五種萃取物的抗脂質過氧化作用之效用。方法是將6隻SD大鼠腹腔注射pentobarbital(50mg/kg)麻醉後,將它們犧牲取腦,並剝離出大腦皮質,磨碎製成懸浮液,然後將上清液加入KA(120 μg/ml)後,分別加入不同濃度(1mg/ml,0.1mg/ml,0.01mg/ml)之五種鉤藤萃取物或Vitamin E(10mM),以thiobarbituric acid ...
1S50: Crystal structures of the GluR5 and GluR6 ligand binding cores: Molecular mechanisms underlying kainate receptor selectivity
V prejšnji oddaji X Factor je pevka in žirantka Jadranka Juras presenetila s svojo zunanjo podobo, kjer je izstopala z bujno rdečo kreacijo ter pričesko,…
http://thinkprogress.org/justice/2012/10/18/1040901/breaking-federal-appeals-court-strikes-down-doma-in-opinion-by-republican-appointed-judge/?mobile=nc
vies, co si myslim? ak mas doma test, tak skus, ak nemas, kasli na to, naschval ist kupovat, podla mna zbytocne vyhodenie eur, chod radsej rovno k lekarovi a budes mat istotu, uz neznies tak hystericky, to je dobre, no a tak trosku ti aj zavidim, aby si ma pochopila, ja planujem vsetko, zahnam infosky, ale mozno by bolo lepsie, keby som sa k mimi dostala hopom, lebo vela rozumu mam pocit tiez ...
Naprave BIOPTRON so medicinske naprave, ki se uporabljajo v profesionalne namene v bolnišnicah, specialističnih ustanovah, wellness in športnih centrih kakor tudi doma. Sistem svetlobne terapije BIOPTRON je za vsakogar: širok obseg uporabe, preprostost uporabe, brez bolečin, kratek čas zdravljenja, brez znanih negativnih stranskih učinkov in izdelan v Švici!
Vishay 1.5KA18 datasheet, Transient Voltage Suppressors (1-page), 1.5KA18 datasheet, 1.5KA18 pdf, 1.5KA18 datasheet pdf, 1.5KA18 pinouts
The excitatory amino acid domoic acid is the causative agent of amnesic shellfish poisoning in humans. The in vitro effects of domoic acid on rat neonatal brain microglia were compared with E. coli lipopolysaccharide (LPS), a known activator of microglia mediator release over a 4 to 24 hour observation period. LPS [3 ng/mL] but not domoic acid [1mM] stimulated a statistically significant increase in TNF-α mRNA and protein generation. Furthermore, both LPS and domoic acid did not significantly affect TGF- β1 gene expression and protein release. Finally, an in vitro exposure of microglia to LPS resulted in statistically significant MMP-9 expression and release, thus extending and confirming our previous observations. However, in contrast, no statistically significant increase in MMP-9 expression and release was observed after domoic acid treatment. Taken together our observations do not support the hypothesis that a short term (4 to 24 hours) in vitro exposure to domoic acid, at a concentration toxic to
Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of
DHEA, together with DHEAS, is the most abundant steroid in the blood of young adult humans. Levels in humans decline with age and during certain types of illness or stress. We have found that DHEA(S) can prevent or reduce the neurotoxic actions in the hippocampus of the glutamate agonists N-methyl-d-aspartic acid (NMDA) both in vitro and in vivo or α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainic acid in vitro. Pre-treatment with DHEA (10-100 nM for 6-8 h) protected primary hippocampal cultures from embryonic day 18 (E18) embryos against NMDA-induced toxicity (0.1, 1, 10, and 50 mM). DHEA added either with NMDA (1 mM) or 1 h later had lesser, but still significant, protective actions. DHEAS also reduced NMDA-induced toxicity (1 mM), although the lowest effective dose of DHEAS (100 nM) was higher than that of DHEA (10 nM). DHEA (100 nM) protected cultured neurons against the neurotoxic actions of either AMPA (25 μM) or kainic acid (1 mM) as well. In vivo, s.c. pellets of ...
Griesser, C A.; Cuenod, M; and Henke, H, Kainic acid receptor sites in the cerebellum of nervous, purkinje cell degeneration, reeler, staggerer and weaver mouse mutant strains. (1982). Subject Strain Bibliography 1982. 4154 ...
EEG and video recording was performed during a 3 month experimental period, animals were put into a Plexiglas cage, and a microconnector was plugged to the EEG recording system via cables with swivel junctions (SL6C; Plastics One). EEG and video recordings (EMKA Technologies) were started after an adaptation period of 30 min. The EEG signals were amplified, filtered between 0.3 and 500 Hz, and digitized at 1000 samples/s. The duration of the recordings was 12 h each day. Animals had access to food and water ad libitum during the experiments.. On the day before the kainic acid injection, the baseline EEG was recorded for 12 h. On the morning of the first day thereafter, the animals were given a single intra-amygdaloid injection of kainic acid (750 ng) (Ben-Ari et al., 1980; Berger et al., 1986) during the period of EEG and video recording. An infusion cannula (C315I; Plastics One) with a polyethylene tube extension (PE 20) was put into the guide cannula and fixed by a captive collar of the ...
TY - JOUR. T1 - Kainic Acid-Induced Golgi Complex Fragmentation/Dispersal Shifts the Proteolysis of Reelin in Primary Rat Neuronal Cells. T2 - An In Vitro Model of Early Stage Epilepsy. AU - Kaneko, Yuji. AU - Sullivan, Robert. AU - Dailey, Travis. AU - Vale Diaz, Fernando. AU - Tajiri, Naoki. AU - Borlongan, Cesar V.. N1 - Funding Information: This work was supported by USF OR&I HSC-18330 & COM HSC-18300 (YK), NIH NINDS RO1 1R01NS071956-01 (CVB), James and Esther King Biomedical Research Program 09?KB-01-23123 (CVB) and 1KG01-33966 (CVB), and USF Department of Neurosurgery and Brain Repair Funds (CVB). Part of this manuscript was presented as an abstract, Golgi complex fragmentation/dispersal initiates neuronal aggravation in epilepsy: Reelin poses as a potential therapeutic target at the American Society for Neural Therapy and Repair 21st Annual Conference, April 24?26, 2014, Clearwater, Florida. Publisher Copyright: © 2015, The Author(s).. PY - 2016/4/1. Y1 - 2016/4/1. N2 - The endoplasmic ...
Kitano Y, Komiyama C, Makino M, Takasuna K, Satoh H, Aoki T, Kinoshita M, Takazawa A, Yamauchi T, Sakurada S. Anticonvulsant and neuroprotective effects of the novel nootropic agent nefiracetam on kainic acid-induced seizures in rats. New Product Research Laboratories II, Daiichi Pharmaceutical Co., Ltd., 1-16-13 Kita-Kasai, Edogawa-ku, Tokyo 134-8630, Japan. [email protected] [1]. Moriguchi S, Shioda N, Han F, Narahashi T, Fukunaga K. CaM kinase II and protein kinase C activations mediate enhancement of long-term potentiation by nefiracetam in the rat hippocampal CA1 region. Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Japan. [email protected] [2]. Robinson RG, Jorge RE, Clarence-Smith K. Double-blind randomized treatment of poststroke depression using nefiracetam. Department of Psychiatry, The University of Iowa, 200 Hawkins Dr., Iowa City, IA 52242, USA. [email protected] [3]. Kitano Y, Komiyama C, Makino M, ...
Kitano Y, Komiyama C, Makino M, Takasuna K, Satoh H, Aoki T, Kinoshita M, Takazawa A, Yamauchi T, Sakurada S. Anticonvulsant and neuroprotective effects of the novel nootropic agent nefiracetam on kainic acid-induced seizures in rats. New Product Research Laboratories II, Daiichi Pharmaceutical Co., Ltd., 1-16-13 Kita-Kasai, Edogawa-ku, Tokyo 134-8630, Japan. [email protected] [1]. Moriguchi S, Shioda N, Han F, Narahashi T, Fukunaga K. CaM kinase II and protein kinase C activations mediate enhancement of long-term potentiation by nefiracetam in the rat hippocampal CA1 region. Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Japan. [email protected] [2]. Robinson RG, Jorge RE, Clarence-Smith K. Double-blind randomized treatment of poststroke depression using nefiracetam. Department of Psychiatry, The University of Iowa, 200 Hawkins Dr., Iowa City, IA 52242, USA. [email protected] [3]. Kitano Y, Komiyama C, Makino M, ...
Armstrong RA, Winsper SJ, Blair JA (1995) Hypothesis: is Alzheimers disease a metal_induced immune disorder? Neurodegeneration 4:107_111 Bennett SA, Stevenson B, Staines WA, Roberts DC (1995) Periodic acid_Schiff (PAS)_positive deposits in brain following kainic acid_induced seizures: relationships to fos induction, neuronal necrosis, reactive gliosis, and blood_brain barrier breakdown. Acta Neuropathol Berl 89:126_138 Cras P, Smith MA, Richey PL, Siedlak SL, Mulvihill P, Perry G (1995) Extracellular neurofibrillary tangles reflect neuronal loss and provide further evidence of extensive protein cross_linking in Alzheimer disease. Acta Neuropathol Berl 89:291_295 Das S, Potter H (1995) Expression of the Alzheimer amyloid_promoting factor antichymotrypsin is induced in human astrocytes by IL_1. Neuron 14:447_456 De Simone R, Giampaolo A, Giometto B, Gallo P, Levi G, Peschle C, Aloisi F (1995) The costimulatory molecule B7 is expressed on human microglia in culture and in multiple sclerosis acute ...
2S-(2 alpha,3 beta,4 beta))-2-Carboxy-4-(1-methylethenyl)-3-pyrrolidineacetic acid. Ascaricide obtained from the red alga Digenea simplex. It is a potent excitatory amino acid agonist at some types of excitatory amino acid receptors and has been used to discriminate among receptor types. Like many excitatory amino acid agonists it can cause neurotoxicity and has been used experimentally for that purpose ...
TY - JOUR. T1 - Dexamethasone attenuates kainate-induced AP-1 activation in rat brain. AU - Unlap, Tino. AU - Jope, Richard S.. PY - 1994/7. Y1 - 1994/7. N2 - The goal of this investigation was to determine if administration of the synthetic glucocorticoid dexamethasone modulates rat brain AP-1 DNA binding activity. Treatment with the selective excitatory amino acid agonist kainate was used to activate AP-1 formation. Kainate (12 mg/kg) administration induced a biphasic activation of AP-1 in rat cerebral cortex and hippocampus with maximal levels observed at 1.5 h and 4.5 h and lower levels at 3 h and 6 h. Kainate also induced biphasic increases in the concentrations of some of the AP-1 constituent proteins (immediate early gene protein products), with initial increases of c-Jun, Fos, and Jun B occurring at 1.5 h and secondary larger increases at 4.5 h, but the level of Jun D was not altered by kainate treatment. Pretreatment with dexamethasone (1 mg/kg) reduced AP-1 activity at both 1.5 h and ...
Effects of kainic acid on nuncio RNA levels of IL-1 beta, IL-6, TNF alpha and LIF in the rat brain. BPMN is largely hand-me-down in compensation the manifest modeling of occupation processes and it is well suited on the side of integration tasks performed not later than a computer system. Do that t(Added: Sun Jan 07 2018 ...
When algae found off the West Coast make a deadly neurotoxin called domoic acid, casualties rocket up the food chain. Now we know more about why.
On the other hand, Jnk1 (-/-) null mice did not shown any changes in AKT action in the hippocampus and probably could make plain why shrinkage of Jnk1 or Jnk2 did not fair any effects against KA treatment (Brecht et al. The counter acting unsusceptible responses (Th1/Th2) in leishmaniasis mull over a complex immunological scenario, suggesting that additional regulatory molecules may be distinguished players in the disease pathogenesis, which may allow for Th17 responses. Functional message of sequence polymorphisms in the adman of myeloid differentiation-2 promethazine 25mg with visa allergy nasal drip. A bantam learn about reported on 22 patients with ESS, of whom 31 % (4/13) of patients receiving adjuvant progestins recurred, compared with 67 % (6/9) recurrence in patients who did not meet with hormonal therapy [36]. This book may contain some secret nuggets of thought and to be sure for the capable and informed, but we are most reassuring that it may inspire hip ambitions and rosy careers ...
Hochschulschriften Innsbruck. Sprouty2/4 deficiency reduces neurodegeneration and stimulates astrocytosis induced by kainic acid in the dorsal hippocampus / Sitthisak Thongrong. 2014
collapsCat options: Array ( [title] => Article Categories [showPostCount] => 0 [inExclude] => exclude [inExcludeCats] => default-title,uncategorized,featured-articles,180,1651,ce-accessories [showPosts] => 0 [showPages] => 0 [linkToCat] => 1 [olderThan] => 0 [excludeAll] => 0 [catSortOrder] => ASC [catSort] => catName [postSortOrder] => ASC [postSort] => postTitle [expand] => 4 [defaultExpand] => [debug] => 1 [postTitleLength] => 0 [catfeed] => none [taxonomy] => category [post_type] => post [postDateAppend] => after [postDateFormat] => m/d [showPostDate] => 0 [useCookies] => 0 [postsBeforeCats] => 0 [expandCatPost] => 1 [showEmptyCat] => 1 [showTopLevel] => 1 [useAjax] => 0 [customExpand] => [customCollapse] => [style] => kubrick [accordion] => 1 [title_link] => [addMisc] => 0 [addMiscTitle] => [number] => 2 [includeCatArray] => Array ( ) [expandSym] => [collapseSym] => ) postsToExclude: Array ( ) CATEGORY QUERY RESULTS Array ( [0] => WP_Term Object ( [term_id] => 165 [name] => 2.o™ HPLC ...
V petek sem res pretežno počivala in se dobro naspala, ostali so se že zgodaj odpravljali na Smrekovc, midva sva se pa veselo tiščala drug k drugemu in ni se nama mudilo vstat. Zvečer, doma sva končno pogledala film Everest. V soboto je budilka vseeno prehitro zazvonila in bilo je treba v mrzlo jutro (-5 stopinj), na štart že praktično tradicionalnega Knap trail-a. Naslednje leto bodo celo tri razdalje (še Hajerska). Zelo pozno sva se odpravila od doma, še majčken zašla in zadnji hip ujela štart - Slavka je najine štartne številke že dala na stran, ker je mislila, da naju ne bo. Brez ogrevanja in še malo raztrešena, sem se pognala v daljši vzpon. Noge so bile težke, podplati zmrznjeni, cilj pa neskončno daleč. Najprej sem razmišljala o topli postelji doma, zakaj mi je tega treba, a naposled sem le ujela svoj ritem, neozirajoč se na druge in začela uživati v teku. Pot je bila super označena, stezice prekrasne za tek. Po ravnem in v dolino mi je šlo dobro, klance sem ...
1S9T: Crystal structures of the GluR5 and GluR6 ligand binding cores: molecular mechanisms underlying kainate receptor selectivity.
Tudi osma oddaja nepozabnih preobrazb je prinesla vrsto presenečenj ter seveda novega zmagovalca. To je postal Matic Supovec, ki je s svojo odlično interpretacijo…
Papilloma je nádor benígnej povahy, farba sa nelíši od tónu ľudskej pokožky. Jeho veľkosť môže dosiahnuť 0,2 - 10 milimetrov. Všetky jej papilómy sú...
Osnovna naloga in cilj varnostnika telesnega stražarja je, da prepreči napad in druge oblike ogrožanja varovane osebe. Varnostniki svoje delo opravljajo v civilni obleki in so lahko tudi oboroženi z osebno oborožitvijo.. Zaposleni v našem podjetju, skupaj z zunanjimi sodelavci, imamo bogate izkušnje pri varovanju varovanih oseb in objektov. Večino teh izkušenj smo si pridobili z sodelovanjem pri načrtovanju, vodenju in izvajanju varovanj domačih in tujih varovanih oseb z najvišjo stopnjo tveganja, katere smo si posamezniki v podjetju pridobili med opravljanjem dela varovanja.. Pred samim varovanjem se opravi operativni sestanek z naročnikom, kjer se pridobijo in razčlenijo vse informacije, ki so potrebne za izvedbo varovanja in se določi stopnja ogroženosti varovane osebe. Na tej podlagi se aktivirajo vse varnostne aktivnosti.. V primeru, da Želite več informacij, kliknite tukaj. ...
17. 5. 2012 , Mathematical physics seminar Enej Ilievski: Thermodynamic bounds on Drude weights in terms of almost-conserved quantities Enej Ilievski Fakulteta za matematiko in fiziko, Oddelek za fiziko, UL Predavanje bo v torek 22.5.2012, ob 16:15 v predavalnici 3.07 na Jadranski 21. Petnajst minut pred predavanjem vabljeni na klepet ob čaju. Več informacij na domači strani seminarja: http://www.fmf.uni-lj.si/mafisem ...
Prvi slovenski modni portal. Vsak dan za vas sledimo in ažurno poročamo o najnovejših modnih trendih, lepoti, glamurju in modnem dogajanju doma in po svetu.
Addgene NGS Result AATGCGCCGCTACAGGGCGCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGC GGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCC AGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAA TTGGGTACCTTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCT CTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAG GCGTGCTTGTCAATGAGGTAAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCAT GATTATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTTA CGTGATAACTTATTATATATATATTTTCTTGTTATAGATATCATAATTTAAACAAGCAAAACCAAATTAA GGGCCAGCTCATTCCTCCCACTCATGATCTATAGATCTGGATCCGTCGAGTTTACTCCCTATCAGTGATA GAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGATGTCGAGTTTACTCCCTATCAGTGAT AGAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGTG ATAGAGAACGTATGTCGAGTTTATCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGT GATAGAGAACGTATGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAAC ...
The diversity of Pseudo-nitzschia (Bacillariophyceae) and accumulation of the neurotoxin domoic acid (DA) in two types of shellfish; tuberculate cockles (Acanthocardia tuberculata) and sweet clams (Challista chione) was explored in Mdiq Bay,Morocco during 2007. The highest abundances of Pseudo-nitzschia were found during the period from March to October, with peaks occurring in May and September. Toxin analysis showed an accumulation of domoic acid in shellfish sampled during spring and autumn. The maximum toxin concentration was 4.9 mg DAg-1 of the whole tissue recorded in sweet clam during spring. Using transmission electron microscopy, thirteen Pseudo-nitzschia species were identified, eight of which are known as producers of domoic acid: P. multistriata, P. cuspidata, P. galaxiae, P. multiseries, P. pseudodelicatissima, P. pungens var. aveirensis, P. calliantha and P. fraudulenta. The five non- toxic species observed were P. subpacifica, P. arenysensis, P. dolorosa, P. subfraudulenta, and ...
1. By measuring the apparent reversal potential (aErev) of kainate- and alpha-amino-3-hydroxyl-5-methyl-4-isoxazole propionic acid (AMPA)-evoked currents associated with changes in extracellular Ca2+ concentration ([Ca2+]e), we have been able to identify embryonic dorsal horn neurons grown in tissue culture that express Ca(2+)-permeable non-N-methyl-D-aspartic acid (NMDA) receptors. 2. The relative expression of Ca(2+)-permeable and Ca(2+)-impermeable non-NMDA receptors varies from cell to cell. This was evident from the range of a ErevS observed for kainate-evoked currents in a 0 mM [Na+]e, 10 mM [Ca2+]e bath. Under these conditions, aErev ranged from -96 to -21 mV, suggesting that the percentage of the non-NMDA receptors on each neuron that are Ca(2+)-permeable is variable. 3. To determine the extent to which the variability in aErev is due to variable receptor expression rather than experimental variability, we compared the effects of changes in [Ca2+]e on kainate-evoked currents and ...
TY - JOUR. T1 - Presynaptic kainate receptors regulate spinal sensory transmission. AU - Kerchner, Geoffrey A.. AU - Wilding, Timothy J.. AU - Li, Ping. AU - Zhuo, Min. AU - Huettner, James E.. PY - 2001/1/1. Y1 - 2001/1/1. N2 - Small diameter dorsal root ganglion (DRG) neurons, which include cells that transmit nociceptive information into the spinal cord, are known to express functional kainate receptors. It is well established that exposure to kainate will depolarize C-fiber afferents arising from these cells. Although the role of kainate receptors on sensory afferents is unknown, it has been hypothesized that presynaptic kainate receptors may regulate glutamate release in the spinal cord. Here we show that kainate, applied at low micromolar concentrations in the presence of the AMPA-selective antagonist (RS)-4-(4-aminophenyl)-1,2-dihydro1-methyl-2-propyl-carbamoyl-6,7 -methylenedioxyphthalazine, suppressed spontaneous NMDA receptor-mediated EPSCs in cultures of spinal dorsal horn neurons. In ...
In adult brain, the inhibitory GABAergic neurons utilize two distinct molecular forms of the GABA-synthesizing enzyme glutamate decarboxylase (GAD), GAD65 and GAD67. During embryonic development, two truncated forms of GAD67 are also expressed (GAD25 and GAD44), which are translated from two embryonic-specific splice variants of GAD67 messenger RNA. It has recently been established that the excitatory dentate granule cells, in addition to the neurotransmitter glutamate, also contain low levels of GABA and GAD67, which are increased after limbic seizures. To study the seizure-induced activation of glutamate decarboxylase, we investigated the expression of both embryonic and adult glutamate decarboxylase messenger RNAs in the adult rat hippocampus after kainic acid administration by semi-quantitative reverse transcription-coupled polymerase chain reaction, in situ hybridization and immunoblotting. We observed a rapid induction of the embryonic glutamate decarboxylase messenger RNA in the granule cells of
We show that in the acute phase of kainate-induced epilepsy, in rats, the transient loss of NPY Y2 receptor-mediated inhibition of glutamate release can contribute to increase hyperexcitability of the hippocampal tissue and account for the generation of seizures. Moreover, in the chronic phase of kainate-induced epilepsy the increased expression of NPY and increased levels of Y2 receptors may act together to control neuronal hyperexcitability by triggering a tonic-like inhibition of glutamate release by involving increased NPY release and activation of NPY Y2 receptors ...
These results indicate that pretreatment of rats with the synthetic catalytic scavenger of ROS, EUK-134, prevents oxidative stress and produces a significant degree of protection against the pathological manifestations of KA-induced seizure activity in hippocampus and piriform cortex. Although numerous studies have suggested that ROS are critically involved in excitotoxicity (see refs. 5, 30, and 31 for reviews), very few studies have demonstrated convincingly, in an in vivo excitotoxic model, a causal relationship between increased production of ROS and neuronal damage (7, 32). A clear demonstration of the crucial role of ROS in excitotoxicity should include: (i) evidence for increased production of ROS specifically in neuronal populations at risk with excitotoxicity before overt signs of neuronal damage and (ii) evidence that manipulations aimed at preventing ROS accumulation reduce neuronal damage without interfering with excitatory amino acid receptor functions. The former has been difficult ...
Selective stimulation of excitatory amino acid receptor subtypes and the survival of cerebellar granule cells in culture: effect of kainic acid. ...
In this project we will elucidate the essential features of kainate receptor intracellular trafficking and biosynthesis. These processes are poorly understood, as is their importance to selective synaptic targeting and activity-dependent modulation of neuronal kainate receptors. Ample evidence exists for selective targeting of kainate receptors in neurons; these receptors are localized to a subset of pre- and postsynaptic sites in the mammalian brain, where they play several roles in excitatory and inhibitory neurotransmission. For example, in hippocampal CA3 pyramidal neurons kainate receptors are expressed postsynaptically apposed to mossy fiber terminals but to not either associational/commissural or perforant path excitatory inputs. Conversely, presynaptic kainate receptors are found in mossy fiber axons and terminals but not at postsynaptic sites in granule cell dendrites in the stratum moleculare. These observations strongly suggest that cellular mechanisms exist to selectively target ...
Excitotoxicity is the pathological process by which nerve cells are damaged or killed by excessive stimulation by neurotransmitters such as glutamate and similar substances. This occurs when receptors for the excitatory neurotransmitter glutamate (glutamate receptors) such as the NMDA receptor and AMPA receptor are overactivated by glutamatergic storm. Excitotoxins like NMDA and kainic acid which bind to these receptors, as well as pathologically high levels of glutamate, can cause excitotoxicity by allowing high levels of calcium ions (Ca2+) to enter the cell. Ca2+ influx into cells activates a number of enzymes, including phospholipases, endonucleases, and proteases such as calpain. These enzymes go on to damage cell structures such as components of the cytoskeleton, membrane, and DNA. Excitotoxicity may be involved in spinal cord injury, stroke, traumatic brain injury, hearing loss (through noise overexposure or ototoxicity), and in neurodegenerative diseases of the central nervous system ...
We are interested in understanding how kainate receptors, a family of ionotropic glutamate receptors in the mammalian CNS, operate at a molecular and biophysical level. Kainate receptors are modulatory proteins that help to balance excitatory and inhibitory tone through diverse actions at pre- and postsynaptic sites. They also have been shown to be promising drug targets in several pathologies (particularly epilepsy and chronic pain). A current project focuses on how an associated family of auxiliary proteins, known as Neto-1 and Neto-2, shape kainate receptor function. We would like to identify which domains in both the receptor subunits and auxiliary proteins are key for allosteric modulation by Neto proteins ...
Such observations reinforced the prospect that the biological events underlying chemi- cally induced toxicity are complex and that the encapsulate concentrations of covalently bound adducts in macromolecules is not the solitary determinant of toxicity per se. A swatting following kainate-induced seizures showed that the cyclin D1 mRNA was induced in the vulnerable CA3 part, and to a lesser extent, in non-vulnerable regions, while that the expression of CDK4 and cyclin D1 was upregu- lated in neurons of the rat piriform cortex and amygdala 1В-3 days after KA administra- tion in vivo. Who Is Agonistic by Fibromyalgia toradol 10 mg on-line pain medication for dogs aleve. The thin film of a childish stripling may let someone have the visualization of cursory venous circulation across the abdomen. Perhaps a couple of centuries later, the grey Hebrews displayed presumptuousness with this pursuit: in the Out-moded Testament, the perpetually tormented Responsibility cries prohibited The arrows of the ...
Such observations reinforced the prospect that the biological events underlying chemi- cally induced toxicity are complex and that the encapsulate concentrations of covalently bound adducts in macromolecules is not the solitary determinant of toxicity per se. A swatting following kainate-induced seizures showed that the cyclin D1 mRNA was induced in the vulnerable CA3 part, and to a lesser extent, in non-vulnerable regions, while that the expression of CDK4 and cyclin D1 was upregu- lated in neurons of the rat piriform cortex and amygdala 1В-3 days after KA administra- tion in vivo. Who Is Agonistic by Fibromyalgia toradol 10 mg on-line pain medication for dogs aleve. The thin film of a childish stripling may let someone have the visualization of cursory venous circulation across the abdomen. Perhaps a couple of centuries later, the grey Hebrews displayed presumptuousness with this pursuit: in the Out-moded Testament, the perpetually tormented Responsibility cries prohibited The arrows of the ...
Genetic studies in humans have suggested that certain types of KA subtype receptors may be linked to behavioral anxiety or depression [47]. Due to the limitation of selective compounds that inhibit or activate selective subtypes of KA receptors, basic mechanisms of how KA receptors contribute to these mood disorders remain unclear. The generation of gene knockout mice help us at a certain level for the potential functions of KA receptors. For example, in GluK2 KO mice, behavior fear is reduced along with the reduction of LTP in the amygdala induced by theta-burst stimulation (TBS) [33]. In GluK4 KO mice, reduce anxiety has also been reported [48]; and in mice with overexpression of GluK4 in the forebrain, behavioral anxiety is enhanced [49]. However, due to complexed effects of KA receptors at excitatory and inhibitory synapses; as well as presynaptic vs postsynaptic locations, it is difficult to determine the functions of selective subtypes of KA receptors even within the same central region. ...
History and purpose: A fresh class of heterotricyclic glutamate analogues lately was generated by incorporating structural components of two excitotoxic marine compounds, kainic acid and neodysiherbaine A. decreased excitatory synaptic transmitting in neuronal civilizations, and IKM-159 inhibited synaptic currents from CA1 pyramidal neurons in hippocampal pieces. IKM-159 inhibited glutamate-evoked whole-cell currents from recombinant GluA2- and GluA4-formulated with -amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) receptors…. ...
The reporter asks some good questions. Isnt it time that someone in the administration publicly apologized and explained what the hell happened that this brief was permitted to be filed? Im surprised that none of our organizations, or our allies in Congress, seem very interested in getting some basic answers to some obvious questions:. 1. How high up in Justice and the White House was this brief cleared? Who was the highest political appointee in Justice to see the brief, or be informed of the brief, before it was filed, and who was the highest political appointee in the White House?. 2. Is it true that the Obama administration actually used a rehashed version, with some deletions, of an earlier Bush administration brief on DOMA?. 3. Is the White House going to defend DOMA again in the upcoming brief due in only 7 days? Will the White House let DOJ reiterate the pedophilia and incest comparison? Will the White House have DOJ remove any of the other offensive language from the brief, such as ...
Molekulsko kloniranje je skup eksperimentalnih metoda molekularne biologije koji ise koriste za formiranje molekula rekombinantne DNK i za usmeravanje njene replikacije unutar organizma domaćina.[1] Reč kloniranje se koristi jer metod vrši replikaciju jednog molekula DNK počevši od jedne ćelije i generiše veliku popolaciju ćelija koje sadrže identične DNK molekule. Molekularno kloniranje generalno koristi DNK sekvence dva različita organizma: vrste koja je izvor DNK koja se klonira i vrste koja služi kao živi domaćin za replikaciju rekombinantne DNK. Metodi molekularnog kloniranja su centralni za mnoge savremene oblasti biologije i medicine.[2] U konvencionalnom eksperimentu molekulskog kloniranja, DNK koja se klonira se dobija iz željenog organizma, i zatim se tretira sa enzimima u epruveti da bi se formirali manji fragmenti. Naknadno se ti fragmenti kombinuju sa DNK vektorom da bi se formirali rekombinantni DNK molekuli. Oni se zatim uvode u organizam domaćina (tipično u ...
Začetek pomladi je čas, ko se vitamini pojavijo na tržnicah Severne Osetije, ki so bili v hladni sezoni tako pomanjkljivi. Eden prvih v sezoni zbiranja daril gozda je ramson, in sicer mladi poganjki veljajo za najbolj koristne za telo. Bogata z vitamini, na gorskih obronkih republike rastejo dišeči zeleni: nekateri domačini zbirajo čebulo za obnavljanje družinskega proračuna, drugi pa pripravljajo domače obroke. Kako donosna je prodaja divjega česna, kako, ne da bi škodovali zbiranju rastline, in kaj so jedi v Severni Osetiji priljubljene, je ugotovil 15. dopisnik regije.. Ramson je precej pogosta rastlina, ki je bila znana našim prednikom. Že od nekdaj se pogosto imenuje medvedni lok: žival, ki se zbudi iz zimskega spanja, se z veseljem prepušča svojemu izčrpanemu organizmu s prvo vitaminsko travo. Zaradi geografske lege Severne Osetije se ta sezonska rastlina nahaja v vseh regijah republike. Vendar pa smo obiskali enega od velikih tržišč v Vladikavkazu in prepričali smo ...
The Defense of Marriage Act took another hit on Wednesday when a New York federal judge ruled it unconstitutional, this time because it interferes with the states' right to regulate marriage.
Kdy doma najdete lou i ku i rozkousanou pantofli, neznamen to, e v s ty noh p tel nem r d. M e to b t zn mka toho, e se zkr tka nec t dob e. Existuje st le v ce p pad , kdy psychick tr pen zv at zp sobuje lov k sv m hektick m zp sobem ivota.
Jaz sem jo zasral? Pa dej pober se, ti povem še enkrat. Prbasal si se z trapastim žaljivim komentarjem s katerim si se obrukal, da se bolj nisi mogel. A si ti ta telefon dejansko kdaj videl v živo. Odprtega karkoli, daj ne seri. Ne, da bi se hvalil ampak imam telefon doma. Sklepanje pa je bilo čisto na mestu in ni bilo potrebe po nekem žaljivem komentarju, ki te je postavil na nivo, za katerega sem ti že enkrat povedal. Tako, da pssst in ne brukaj se več. S tabo se sploh ne mislim več ukvarjat, ker nisi vreden mojega časa ...
But, in spite of everything she had been taught, something had stirred in her soul when she witnessed the sacking of Maranda - so many civilian lives lost, and for no purpose. And when the orders to poison the citizens of Doma came through, she had known for certain that something was wrong ...
I. Effects of kainic acid-induced lesions". Journal of Neurophysiology. 52 (2): 290-304. doi:10.1152/jn.1984.52.2.290. PMID ...
"Lesion of Striatal Neurons with Kainic Acid Provides a Model for Huntington's Chorea". Nature. 246: 244-46. Cruz, Lourdes J.; ... Nadler; Victor, J.; Perry, Bruce W.; Cotman, Carl W. (1978). "Intraventricular Kainic Acid Preferentially Destroys Hippocampal ... Caramboxin is a new nonpeptide amino acid toxin that stimulate the glutamate receptors in neurons. Caramboxin is an agonist of ... It is known that the mercuric ion inhibits amino acid (AA) and glutamate (Glu) transport, potentially leading to excitotoxic ...
Jakuš J., Stránsky A., Poliaèek I., Baráni H., Bošelová ¼.: Kainic acid lesion to the Lateral tegmental field of medulla. ...
They have five subunits, divided into two main families: GluK1,2, and GluK5,6,7. An endogenous ligand, either kainic acid or ... It is well characterized that injection of kainic acid can induce seizures, including temporal lobe epilepsy months after ... Consistent with these findings, transgenic mice with knocked out GluK1 have reduced seizures after treatment with kainic acid. ... Bunch, Lennart; Krogsgaard‐Larsen, Povl (2009). "Subtype selective kainic acid receptor agonists: Discovery and approaches to ...
"Huprine X Attenuates The Neurotoxicity Induced by Kainic Acid, Especially Brain Inflammation". Basic & Clinical Pharmacology & ...
Kainic acid as a tool for the study of temporal lobe epilepsy". Life Sci. 29 (20): 2031-42. doi:10.1016/0024-3205(81)90659-7. ... Ben-Ari Y (February 1985). "Limbic seizure and brain damage produced by kainic acid: mechanisms and relevance to human temporal ... RNA editing of the Q/R site can affect inhibition of the channel by membrane fatty acids such as arachidonic acid and ... "Amino acid substitutions in the pore helix of GluR6 control inhibition by membrane fatty acids". J. Gen. Physiol. 132 (1): 85- ...
Ed., 46, 5734-5736 (2007). A Practical Synthesis of (-)-Kainic Acid, S. Takita, S. Yokoshima, and T. Fukuyama, Org. Lett., 13, ...
Similar results are obtained after injection of kainic acid, an analog of glutamic acid which causes a severe neurodegenerative ... Tg mice treated with kainic acid show a significant reduction of inflammatory responses and a much stronger protection against ... Other ApoD ligands include E-3-methyl-2-hexenoïc acid, a molecule present in axillary secretions; retinoic acid which is ... "Differential expression of apolipoprotein D and apolipoprotein E in the kainic acid-lesioned rat hippocampus". Neuroscience. 79 ...
Part 10: A Concise Synthesis of (−)-Kainic Acid via Sulfanyl Radical Addition-Cyclization-Elimination Reaction". Tetrahedron. ... α-kainic acid, asperparalines, and alkaloids such as narciclasine and lycoricidine. Intramolecular thiol-ene reactions provide ...
2006). "Kainic acid-induced recurrent mossy fiber innervation of dentate gyrus inhibitory interneurons: possible anatomical ... 1985). "Evidence of functional mossy fiber sprouting in hippocampal formation of kainic acid-treated rats". Journal of ... Schwarzer C.; Sperk G. (1995). "Hippocampal granule cells express glutamic acid decarboxylase-67 after limbic seizures in the ...
5-Iodowillardiine ATPA Domoic acid Glutamic acid (glutamate) - the endogenous agonist Kainic acid - a synthetic agonist after ... The convulsant kainic acid induces seizures, in part, by activation of kainate receptors containing the GluK2 subunit and also ... Kainate receptors, or kainic acid receptors (KARs), are ionotropic receptors that respond to the neurotransmitter glutamate. ... which the receptor is named LY-339,434 SYM-2081 CNQX DNQX Ethanol - non-selective NS102 Kynurenic acid - endogenous ligand ...
Kainic acid is an example of an excitatory amino acid used in this type of lesion. One crucial benefit to this lesion is its ... An excitotoxic lesion is the process of an excitatory amino acid being injected into the brain using a cannula. The amino acid ...
Godaux E, Mettens P, Cheron G (1993). "Differential effect of injections of kainic acid into the prepositus and the vestibular ... Cheron, G.; Godaux, E. (1 December 1987). "Disabling of the oculomotor neural integrator by kainic acid injections in the ... Cheron G, Godaux E (1987). "Disabling of the oculomotor neural integrator by kainic acid injections in the prepositus- ... Cheron G, Godaux E (1987). "Disabling of the oculomotor neural integrator by kainic acid injections in the prepositus- ...
Kainic acid, used to model TLE and related scleroses, affects primarily the mossy fiber synapses in CA3. It is thought that at ... These receptors are most dense in sectors CA3 and CA2 of the hippocampus, where nanomolar (nM) concentrations of kainic acid ...
Hong YM, Jo DG, Lee MC, Kim SY, Jung YK (2003). "Reduced expression of calsenilin/DREAM/KChIP3 in the brains of kainic acid- ...
Selectracetam has been demonstrated to not significantly affect currents gated by NMDA, AMPA, GABA, glycine, or kainic acid. ... The main metabolic mechanism is the hydrolysis of an acetamide to a carboxylic acid. Seletracetam exhibits first-order mono- ... is excreted in the form of an inactive carboxylic acid metabolite. ...
... reduces reactive gliosis and protects hippocampal hilar neurons from kainic acid excitotoxicity". Journal of Neuroscience ...
... and kainic acid. However, this denatured venom did not inhibit seizures induced by pentylenetetrazole. These findings imply ... implying the presence of free amino acids. These free amino acids would need to be further studied to determine their exact ...
It has also been shown in different animal models, such as the kainic acid model, pilocarpine model, and kindling model. But ... "Abnormalities of granule cell dendritic structure are a prominent feature of the intrahippocampal kainic acid model of epilepsy ...
... inhibited seizures evoked by bicuculline, pentylenetetrazole, and kainic acid as well as increasing the latency of ... erythravine prevented death in all the animals tested with the four convulsants except a few of those treated with kainic acid ...
In certain cases, seizures tend to appear to originate from the claustrum when they are involved in early kainic acid induced ...
... such as kainic acid treated animals. Fluoro-Jade stained tissue can be visualized under an epifluorescent microscope using a ... cupric-staining methodologies in a variety of neurotoxic models of neurodegeneration such as injection of kainic acid, MPTP, or ... terepthalic acid, and (3) disodium 2,5-bis(6-hydroxy-3-oxo-3H-xanthen-9yl)terepthalic acid. All three fluoro-jade species have ... fuchsine acid, could successfully bind to damaged neurons after a hyperglycemic insult presumably by the same electrostatic ...
... administration have shown a neuroprotective effect on hippocampal neurons in seizure models induced by kainic acid. The proper ...
... in human epileptic brain and in kainic acid--treated rats with chronic seizures". Epilepsia. 40 (2): 127-37. doi:10.1111/j.1528 ...
Another type of lesion is excitotoxic lesions, which can be caused by excitatory amino acids like kainic acid, which kill ...
... kainic acid and N-methyl-D-aspartic acid (NMDA) channels. In the synapse, these receptors serve very different purposes. AMPA ... AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) is a compound that is a specific agonist for the AMPA receptor, ...
"Lesion of Striatal Neurons with Kainic Acid Provides a Model for Huntington's Chorea." Nature, 246: 244-46. ... Nadler, J. Victor, Bruce W. Perry, and Carl W. Cotman (1978) "Intraventricular Kainic Acid Preferentially Destroys Hippocampal ... Rothman, S., J. Thurston, and R. Hauhart (1987) "Delayed Neurotoxicity of Excitatory Amino Acids In Vitro." Neuroscience, 22 (2 ... Meldrum, B., and J. Garthwaite (1990) "Excitatory Amino Acid Neurotoxicity and Neurodegenerative Disease." Trends in ...
... worked on this perplexing disorder and have found that the symptoms can be induced by injecting kainic acid or ibotenic acid ...
For example, kainic acid-induced seizures, antidepressant (fluoxetine), neurotransmitters such as GABA and growth factors ( ...
... kainic acid MeSH D03.383.773.475 - lincomycin MeSH D03.383.773.475.125 - clindamycin MeSH D03.383.773.589 - nafoxidine MeSH ... pipemidic acid MeSH D03.383.725.547.650 - piromidic acid MeSH D03.383.725.547.900 - 3-pyridinecarboxylic acid, 1,4-dihydro-2,6- ... niflumic acid MeSH D03.066.515.635 - pipemidic acid MeSH D03.066.515.650 - piromidic acid MeSH D03.066.515.950 - xanthinol ... nalidixic acid MeSH D03.438.810.835.055.550 - nedocromil MeSH D03.438.810.835.055.580 - oxolinic acid MeSH D03.438.810.835.188 ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Some cases of anemia, possibly related to folic acid deficiency, have been described.[18] ...
Kainic acid. *L-(-)-threo-3-Hydroxyaspartic acid. *L-αAA. *L-CCG-III ((2S,3S,4R)-CCG) ... derived from the related proteinogenic L-amino acid glutamic acid. Theanine is an analog of this amino acid, and its primary ... Theanine /ˈθiːəniːn/, also known as L-γ-glutamylethylamide and N5-ethyl-L-glutamine, is an amino acid analogue of the ... to the amide formed from ethylamine and L-glutamic acid at its γ- (5-) side chain carboxylic acid group (as the name γ-L- ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Valerian constituents (e.g., isovaleric acid, isovaleramide, valerenic acid, valerenol). *Unsorted benzodiazepine site positive ... This reaction is catalyzed by a variety of Lewis acids, mainly aluminium chloride, iron(III) chloride, or zinc chloride. The 1, ... Quinolines (e.g., 4-hydroxyquinoline, 4-hydroxyquinoline-3-carboxylic acid, 5,7-CIQA, 7-CIQ, 7-TFQ, 7-TFQA) ...
... and kainic acid". Mol Cell Biochem, Oct. 4 (151): 49-54.. ... Domoic Acid and Amnesiac Shellfish Poisoning" (PDF). Архивирано ... B. Jakobsen, A. Tasker & J. Zimmer (2002). „Domoic acid neurotoxicity in hippocampal slice cultures". Amino Acids. 23: 37-44. ... JS Teitelbaum; RJ Zatorre; S Carpenter; D Gendron; AC Evans; A Gjedde & NR Cashman (1990). „Neurologic sequelae of domoic acid ... In 1998, The Marine Mammal Center diagnosed the first case of domoic acid toxicosis in marine mammals, and has conducted ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... 2E,4E,6E,8E,10E,12E,14E)-2,6,11,15-Tetramethylhexadeca-2,4,6,8,10,12,14-heptaenedioic acid[2] ... Crocetin is a natural apocarotenoid dicarboxylic acid that is found in the crocus flower and Gardenia jasminoides[3] (fruits). ...
Kainic acid. *L-(-)-threo-3-Hydroxyaspartic acid. *L-αAA. *L-CCG-III ((2S,3S,4R)-CCG) ... Glutamic acid decarboxylase is the rate-limiting enzyme in the synthesis of γ-aminobutyric acid (GABA), and impaired function ... "Exogenous γ-aminobutyric acid treatment affects citrate and amino acid accumulation to improve fruit quality and storage ... Glutamate decarboxylase or glutamic acid decarboxylase (GAD) is an enzyme that catalyzes the decarboxylation of glutamate to ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Homoquinolinic acid - synthetic glutamate site partial agonist. *N-Methyl-D-aspartic acid (NMDA) - synthetic glutamate site ... Homocysteic acid - endogenous glutamate site agonist. *Ibotenic acid - naturally occurring glutamate site agonist found in ... The discovery of NMDA receptors was followed by the synthesis and study of N-methyl-D-aspartic acid (NMDA) in the 1960s by Jeff ...
Coyle JT, Schwarcz R (1976). "Lesion of striatal neurones with kainic acid provides a model for Huntington's chorea". Nature. ...
... (DA) is a kainic acid analog neurotoxin that causes amnesic shellfish poisoning (ASP).[1] It is produced by algae ... Domoic acid is a structural analog of kainic acid, proline, and endogenous excitatory neurotransmitter glutamate.[8] Ohfune and ... "Domoic Acid Toxicity". The Marine Mammal Center. Retrieved 2 April 2015.. *^ "Domoic Acid Poisoning". Northwest Fisheries ... "Domoic acid". IPCS INCHEM.. *. "Domoic Acid - A Major Concern to Washington State's Shellfish Lovers". Washington Department of ...
... chemical lesions by kainic acid. Hypothesis after Ewert 1974 and 2004 ...
... s play a key role in the generation and spread of epileptic seizures.[68] Kainic acid, a convulsant that is widely ... Ibotenic acid - a naturally occurring agonist found in Amanita muscaria. *Quisqualic acid - a naturally occurring agonist found ... Domoic acid - a naturally occurring agonist that causes amnesic shellfish poisoning. *Glutamic acid (glutamate) - the ... The α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (also known as AMPA receptor, AMPAR, or quisqualate receptor ...
"Lesion of Striatal Neurons with Kainic Acid Provides a Model for Huntington's Chorea." Nature, 246: 244-46. ... Nadler, J. Victor, Bruce W. Perry, and Carl W. Cotman (1978) "Intraventricular Kainic Acid Preferentially Destroys Hippocampal ... Rothman, S., J. Thurston, and R. Hauhart (1987) "Delayed Neurotoxicity of Excitatory Amino Acids In Vitro." Neuroscience, 22 (2 ... Meldrum, B., and J. Garthwaite (1990) "Excitatory Amino Acid Neurotoxicity and Neurodegenerative Disease." Trends in ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Acetylcysteine is the N-acetyl derivative of the amino acid L-cysteine, and is a precursor in the formation of the antioxidant ... It is being studied in conditions such as autism, where cysteine and related sulfur amino acids may be depleted due to ... Buijtels PC, Petit PL (July 2005). "Comparison of NaOH-N-acetyl cysteine and sulfuric acid decontamination methods for recovery ...
Nadler, J. Victor, Bruce W. Perry, and Carl W. Cotman (1978) "Intraventricular Kainic Acid Preferentially Destroys Hippocampal ...
R1-amino acid + R2-α-ketoacid ⇌ R1-α-ketoacid + R2-amino acid. A very common α-keto acid is α-ketoglutarate, an intermediate in ... Kainic acid. *Monopotassium glutamate. *Tien Chu Ve-Tsin. ReferencesEdit. *^ "L-Glutamic acid CAS#: 56-86-0". www.chemicalbook. ... Glutamic acid (symbol Glu or E;[4] the ionic form is known as glutamate) is an α-amino acid that is used by almost all living ... At pH values between about 2.5 and 4.1,[6] the carboxylic acid closer to the amine generally loses a proton, and the acid ...
Ethanol is mixed with a strong acid, typically sulfuric acid, H2SO4. The acid dissociates in the aqueous environment producing ... Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Valerian constituents (e.g., isovaleric acid, isovaleramide, valerenic acid, valerenol). *Unsorted benzodiazepine site positive ... This process uses solid-supported phosphoric acid catalysts and can be adjusted to make more ether if the need arises.[8] Vapor ...
Kainic acid. *L-(-)-threo-3-Hydroxyaspartic acid. *L-αAA. *L-CCG-III ((2S,3S,4R)-CCG) ... The four amino acids bind to the site by their common atoms, "the main chain" of amino acids.[5] Glutamate is another product ... "Nucleic Acids Research. 46 (19): 10082-10094. doi:10.1093/nar/gky709. PMC 6212724. PMID 30085248.. ... It is a double-ringed dodecamer of identical chains.[23] It is much larger (about 700 amino acids) than the GSI (450 to 470 ...
With acid chlorides, one obtains the amidocarboxylic acid, such as hippuric acid[23] and acetylglycine.[24] With nitrous acid, ... It is the simplest amino acid (since carbamic acid is unstable), with the chemical formula NH2‐CH2‐COOH. Glycine is one of the ... Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Amino acid neurotransmitter. References[edit]. *^ The Merck Index: An Encyclopedia of Chemicals, Drugs, and Biologicals (11th ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Rigby AC, Baleja JD, Li L, Pedersen LG, Furie BC, Furie B (December 1997). "Role of gamma-carboxyglutamic acid in the calcium- ... It differs from Con-R mainly in the C-terminal amino acids and, like Con-R, it induces sleep-like symptoms in young mice, with ... a novel peptide antagonist to the N-methyl-D-aspartic acid (NMDA) receptor". Neuroscience Letters. 118 (2): 241-4. doi:10.1016/ ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Like some related amines, it is used in oil industry for the extraction of acid gas. ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... 1-Aminocyclopropane-1-carboxylic acid (ACC) is a disubstituted cyclic α-amino acid in which a three-membered cyclopropane ring ... "Nucleic Acids Res. 34 (Database issue): D511-6. doi:10.1093/nar/gkj128. PMC 1347490 . PMID 16381923.. ... 1-Aminocyclopropane-1-carboxylic acid. From Wikipedia, the free encyclopedia. (Redirected from 1-Aminocyclopropanecarboxylic ...
Kainic acid. *L-(-)-threo-3-Hydroxyaspartic acid. *L-αAA. *L-CCG-III ((2S,3S,4R)-CCG) ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ...
Not to be confused with Glutamine or Glutaric acid.. Glutamic acid (symbol Glu or E)[4] is an α-amino acid that is used by ... R1-amino acid + R2-α-ketoacid ⇌ R1-α-ketoacid + R2-amino acid. A very common α-keto acid is α-ketoglutarate, an intermediate in ... Kainic acid. *Monosodium glutamate. ReferencesEdit. *^ "L-Glutamic acid CAS#: 56-86-0". www.chemicalbook.com.. .mw-parser- ... At pH values between about 2.5 and 4.1,[6] the carboxylic acid closer to the amine generally loses a proton, and the acid ...
Rindi, G; Ferrari, G (1959). "The γ-Aminobutyric Acid and Glutamic Acid Content of Brains of Rats treated with Toxopyrimidine ...
Kainic acid. *Monosodium glutamate. References[edit]. *^ "L-Glutamic acid CAS#: 56-86-0". www.chemicalbook.com.. .mw-parser- ... R1-amino acid + R2-α-ketoacid ⇌ R1-α-ketoacid + R2-amino acid. A very common α-keto acid is α-ketoglutarate, an intermediate in ... Glutamic acid (symbol Glu or E)[4] is an α-amino acid that is used by almost all living beings in the biosynthesis of proteins ... At pH values between about 2.5 and 4.1,[6] the carboxylic acid closer to the amine generally loses a proton, and the acid ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Valerian constituents (e.g., isovaleric acid, isovaleramide, valerenic acid, valerenol). *Unsorted benzodiazepine site positive ... Products of this catabolic process include methoxyfluoroacetic acid (MFAA), dichloroacetic acid (DCAA), and inorganic fluoride. ... Quinolines (e.g., 4-hydroxyquinoline, 4-hydroxyquinoline-3-carboxylic acid, 5,7-CIQA, 7-CIQ, 7-TFQ, 7-TFQA) ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... NAAG consists of N-acetylaspartic acid (NAA) and glutamic acid coupled via a peptide bond. ... a b Spaglumic Acid, drugs.com. *^ CURATOLO A, D ARCANGELO P, LINO A, BRANCATI A (1965). "Distribution Of N-Acetyl-Aspartic And ... N-Acetylaspartylglutamic acid (N-acetylaspartylglutamate or NAAG) is a peptide neurotransmitter and the third-most-prevalent ...
Kainic acid. *LY-339434. *Proline. *Quisqualic acid. *SYM-2081; Positive allosteric modulators: Cyclothiazide ... Valerian constituents (e.g., isovaleric acid, isovaleramide, valerenic acid, valerenol). *Unsorted benzodiazepine site positive ... 2,2,2-trichloroethanol is an effective protecting group for carboxylic acids due to its ease in addition and removal.[6] ... Quinolines (e.g., 4-hydroxyquinoline, 4-hydroxyquinoline-3-carboxylic acid, 5,7-CIQA, 7-CIQ, 7-TFQ, 7-TFQA) ...
Kainic acid, or kainate, is an acid that naturally occurs in some seaweed. Kainic acid is a potent neuroexcitatory amino acid ... Kainic acid is commonly injected into laboratory animal models to study the effects of experimental ablation. Kainic acid is a ... In addition to inducing seizures, kainic acid is excitotoxic and epileptogenic. Kainic acid induces seizures via activation of ... concentrated doses kainic acid can be considered a neurotoxin, and in small doses of dilute solution kainic acid will ...
Temporal aspects of synergy with kainic acid.. Sapolsky RM.. Abstract. Excessive exposure to glucocorticoids can damage neurons ... present report examines the temporal parameters with which corticosterone modulates the toxicity of the excitotoxin kainic acid ...
... Kyoung Hoon Jeong,1,2 ... Q. Wang, S. Yu, A. Simonyi, G. Y. Sun, and A. Y. Sun, "Kainic acid-mediated excitotoxicity as a model for neurodegeneration," ... J. J. Shacka, J. Lu, Z.-L. Xie, Y. Uchiyama, K. A. Roth, and J. Zhang, "Kainic acid induces early and transient autophagic ... Y. Jin, C.-M. Lim, S.-W. Kim et al., "Fluoxetine attenuates kainic acid-induced neuronal cell death in the mouse hippocampus," ...
Kainic acid (KA) is well known as a chemical compound to study epileptic seizures and neuronal excitotoxicity. KA-induced ... Kainic acid (KA) is well known as a chemical compound to study epileptic seizures and neuronal excitotoxicity. KA-induced ... Q. Wang, S. Yu, A. Simonyi, G. Y. Sun, and A. Y. Sun, "Kainic acid-mediated excitotoxicity as a model for neurodegeneration," ... J. J. Shacka, J. Lu, Z.-L. Xie, Y. Uchiyama, K. A. Roth, and J. Zhang, "Kainic acid induces early and transient autophagic ...
Systemic or intracerebral injection of the neurotoxin kainic acid (KA) in rats induces a limbic seizure and brain damage ... Berger, M.L., Charton, G., and Ben-Ari, Y., The effect of seizures induced by intra-amygdaloid kainic acid on kainic acid ... Limbic Seizures Induced by Systemically Applied Kainic Acid: How Much Kainic Acid Reaches the Brain?. ... Maturation of kainic acid seizure-brain damage syndrome. III. Postnatal development of kainic acid binding sites in the limbic ...
To analyze the role of SP in excitotoxicity, kainic acid (KA) was administered to rats and in situ hybridization was used to ... A tachykinin NK1 receptor antagonist, CP-122,721-1, attenuates kainic acid-induced seizure activity.. Zachrisson O1, Lindefors ...
Juiz JM, Rueda J, Merchán JA, Sala ML (1989) The effects of kainic acid on the cochlear ganglion of the rat. Hear Res 40:65-74 ... Bledsoe SC, Bobbin RP, Chihal DM (1981) Kainic acid: an evaluation of its action on cochlear potentials. Hear Res 4:109-120 ... Zheng XY, Salvi RJ, Fadden SLMC et al (1999) Recovery of kainic acid excitotoxicity in chinchilla cochlea. Ann N Y Acad Sci 884 ... Sun H, Salvi RJ, Ding DL, Hashino E, Shero M, Zheng XY (2000) Excitotoxic effect of kainic acid on chicken otoacoustic ...
Sensitive indices of neural injury were used to evaluate the time course of kainic acid (KA)-induced hippocampal damage in ... Sensitive indicators of injury reveal hippocampal damage in C57BL/6J mice treated with kainic acid in the absence of tonic- ... Sensitive indices of neural injury were used to evaluate the time course of kainic acid (KA)-induced hippocampal damage in ... indices reported here reveals the C57BL/6J mouse is sensitive to excitotoxic neural damage caused by kainic acid, in the ...
Increase in Bcl-2 phosphorylation and reduced levels of BH3-only Bcl-2 family proteins in kainic acid-mediated neuronal death ... Increase in Bcl-2 phosphorylation and reduced levels of BH3-only Bcl-2 family proteins in kainic acid-mediated neuronal death ...
Kainic acid (KA) treatment is a well-established model of hippocampal neuron death mediated in large part by KA receptor- ... Kainic acid induces early and transient autophagic stress in mouse hippocampus Neurosci Lett. 2007 Feb 27;414(1):57-60. doi: ... Kainic acid (KA) treatment is a well-established model of hippocampal neuron death mediated in large part by KA receptor- ...
... As alkene metathesis has developed into one of ... of the important neuropharmacological tool (-)-kainic acid (7), Tohru Fukuyama of the University of Tokyo prepared the key ... To prepare the substrate for the macrolide construction, the alcohol 8 and the acid 9, each prepared by chiral auxiliary ... The substrate for cyclization was prepared by coupling the acid 15 with the alcohol 16, followed by selective deprotection and ...
... ... of this study to investigate the GABA system in the SN and its response to seizures induced by the neuroexcitant kainic acid ( ... Gamma-aminobutyric acid (GABA) is an inhibitory neurotransmitter implicated in the control of generalized seizures induced by ... are generally in conflict with those obtained by many researchers using the activity of the GABA synthetic enzyme glutamic acid ...
... a substantial decrease in adult neurogenesis influences epileptogenesis evoked by the intra-amygdala injection of kainic acid ( ... a substantial decrease in adult neurogenesis influences epileptogenesis evoked by the intra-amygdala injection of kainic acid ( ...
Kainic acid lesions of the dorsal nucleus of the lateral lemniscus: effects on binaural evoked responses in rat auditory cortex ... Kainic acid lesions of the dorsal nucleus of the lateral lemniscus: effects on binaural evoked responses in rat auditory cortex ... Kainic acid lesions of the dorsal nucleus of the lateral lemniscus: effects on binaural evoked responses in rat auditory cortex ... Kainic acid lesions of the dorsal nucleus of the lateral lemniscus: effects on binaural evoked responses in rat auditory cortex ...
8A,B). However, this increase was less pronounced in kainic acid-injected GAERS than in kainic acid-injected Wistar rats (p , ... This breakdown may depend on the greater severity of the insult with kainic acid. Kainic acid or kindling models in rats with ... 1986) Effects of seizure-induced by intra-amygdaloid kainic acid on kainic acid binding sites in rat hippocampus and amygdala. ... p , 0.001, less-pronounced increase in kainic acid-injected GAERS than in kainic acid-injected Wistar rats. ...
"Kainic Acid" by people in this website by year, and whether "Kainic Acid" was a major or minor topic of these publications. ... Glutamic acid decarboxylase mRNA in rat brain: regional distribution and effects of intrastriatal kainic acid. Brain Res. 1987 ... "Kainic Acid" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical Subject ... Below are the most recent publications written about "Kainic Acid" by people in Profiles. ...
Systemic injection of kainic acid (KA) in the rat produces an animal model of human temporal lobe epilepsy. We examined the ... Glutamic Acid / metabolism*. Humans. Kainic Acid. Male. Neurons / cytology, metabolism. Patch-Clamp Techniques. Rats. Rats, ... 0/Amino Acid Transport System X-AG; 0/Excitatory Amino Acid Agonists; 0/Excitatory Amino Acid Transporter 3; 0/Glutamate Plasma ... Systemic injection of kainic acid (KA) in the rat produces an animal model of human temporal lobe epilepsy. We examined the ...
Kainic acid (KA) exposure causes neuronal degeneration featured by Alzheimer-like tau hyperphosphorylation and memory deficits ... Kainic acid (KA) exposure causes neuronal degeneration featured by Alzheimer-like tau hyperphosphorylation and memory deficits ... Kainic Acid Treatment Boosts Tau Phosphorylation in Hippocampal Neurons. Kainic acid (KA) has been known to cause status ... Four milliliters of double-distilled water and thiobarbituric acid reagent (0.67% 2-thiobarbituric acid/acetic acid 1:1) were ...
Systematic administration of kainic acid (KA) in rodents causes severe limbic seizures, selective neuronal loss, and ... Pirfenidone Attenuates Microglial Reactivity and Reduces Inducible Nitric Oxide Synthase mRNA Expression After Kainic Acid- ...
Endocannabinoid Enhancement Protects against Kainic Acid-Induced Seizures and Associated Brain Damage. David A. Karanian, ... Endocannabinoid Enhancement Protects against Kainic Acid-Induced Seizures and Associated Brain Damage. David A. Karanian, ... Endocannabinoid Enhancement Protects against Kainic Acid-Induced Seizures and Associated Brain Damage. David A. Karanian, ... Endocannabinoid Enhancement Protects against Kainic Acid-Induced Seizures and Associated Brain Damage ...
Strong c-Jun immunoreactivity, as revealed with the antibody c-Jun/AP-1 (N) which is raised against the amino acids 91-105 ... 0/Excitatory Amino Acid Agonists; 0/Proto-Oncogene Proteins c-jun; 0/Transcription Factor AP-1; 487-79-6/Kainic Acid ... Kainic Acid / toxicity*. Male. Proto-Oncogene Proteins c-jun / biosynthesis*, drug effects, radiation effects. Rats. Rats, ... c-Jun expression in kainic acid-treated rats, as revealed with the c-Jun/AP-1 (N) antibody, is found in the nuclei of a ...
Effects of sustained seizures produced by intrahippocampal injection of kainic acid on noradrenergic neurons: evidence for ... Effects of sustained seizures produced by intrahippocampal injection of kainic acid on noradrenergic neurons: evidence for ... Effects of sustained seizures produced by intrahippocampal injection of kainic acid on noradrenergic neurons: evidence for ... Effects of sustained seizures produced by intrahippocampal injection of kainic acid on noradrenergic neurons: evidence for ...
Mice Lacking Functional Fas Death Receptors Are Protected from Kainic Acid-Induced Apoptosis in the Hippocampus. - ... to study the role of the Fas pathway in the apoptotic process that occurs in a kainic acid (KA) mice experimental model. In ...
... ... Although similar in catalytic activity, MMP-9 and MMP-2 may play different roles in response to kainic acid-induced seizure and ... These data demonstrate that MMP-9 and MMP-2 are differentially expressed with respect to time after kainic acid injection, and ... GFAP levels were induced 3 days after kainic acid injection in brain regions where MMP-2 was elevated. Nissl staining displayed ...
Check out our best-in-class prices for Kainic Acid (synthetic) at AG Scientific, Inc. With more than 20 years of experience in ... Kainic Acid: An Excitatory Amino Acid Receptor Agonist Selective for Kainate Receptor Subtype ... Kainic acid is a natural marine product originally isolated from the red marine alga D. Simplex. It is a potent central nervous ... 30 mg/kg in mice. Kainic acid is utilized in primary neuronal cell cultures and acute brain slice preparations to study the ...
Kainic acid (KA) is a glutamate analog that binds to and activates ionotropic glutamate receptors. Administration of KA causes ... Granule Cell Dentate Gyrus Mossy Fiber Opioid Peptide Kainic Acid These keywords were added by machine and not by the authors. ... Kainic acid (KA) is a glutamate analog that binds to and activates ionotropic glutamate receptors. Administration of KA causes ... J. S. Hong, L. Grimes, T. Kanamatsu, and J. F. McGinty, Kainic acid as a tool to study the regulation and function of opioid ...
Synthesis of C-N Natural Products: (-)-α-Kainic Acid (Helmchen), (+)-Tylophorine (Opatz), (-)-Lycoperine A (Rychnovsky), ... Retrosynthetic analysis of Fluvirucinine A2 (16) could lead to an acyclic amino acid, that could be cyclized to the macrolactam ...
Adenomatous polyposis coli Astrocytes Oligodendrocytes GSK-3beta Beta-catenin Kainic acid This is a preview of subscription ... Zhang X, Le Gal La Salle G, Ridoux V et al (1997) Prevention of kainic acid-induced limbic seizures and Fos expression by the ... Expression of Adenomatous Polyposis Coli Protein in Reactive Astrocytes in Hippocampus of Kainic Acid-Induced Rat. ... Degeneration of hippocampal CA3 pyramidal cells induced by intraventricular kainic acid. J Comp Neurol 192:333-359CrossRef ...
"The Effects of Kainic Acid Injections on Guanylate Cyclase Activity in the Rat Caudatoputamen, Nucleus Accumbens and Septum, ... The Effects of Kainic Acid Injections on Guanylate Cyclase Activity in the Rat Caudatoputamen,... Walaas, Ivar 1981-01-01 00:00 ... The Effects of Kainic Acid Injections on Guanylate Cyclase Activity in the Rat Caudatoputamen, Nucleus Accumbens and Septum. ... The Effects of Kainic Acid Injections on Guanylate Cyclase Activity in the Rat Caudatoputamen, Nucleus Accumbens and Septum. ...
... pilocarpine and kainic acid, Brain Research" on DeepDyve, the largest online rental service for scholarly research with ... The ontogeny of excitatory amino acid receptors in the rat forebrain-II. Kainic acid receptors ... Effect of sparteine on status epilepticus induced in rats by pentylenetetrazole, pilocarpine and kainic acid. Villalpando- ... Effect of sparteine on status epilepticus induced in rats by pentylenetetrazole, pilocarpine and kainic acid. Effect of ...
  • Kainic acid is a potent central nervous system excitant that is used in epilepsy research to induce seizures in experimental animals, at a typical dose of 10-30 mg/kg in mice. (wikipedia.org)
  • In addition to inducing seizures, kainic acid is excitotoxic and epileptogenic. (wikipedia.org)
  • Kainic acid induces seizures via activation of kainate receptors containing the GluK2 subunit and also through activation of AMPA receptors, for which it serves as a partial agonist. (wikipedia.org)
  • Kainic acid (KA) is well known as a chemical compound to study epileptic seizures and neuronal excitotoxicity. (hindawi.com)
  • Treatment with kainic acid (KA), an analog of excitotoxic glutamate, induces seizures with hippocampal pyramidal neuron death [ 1 ]. (hindawi.com)
  • Limbic Seizures Induced by Systemically Applied Kainic Acid: How Much Kainic Acid Reaches the Brain? (springer.com)
  • Sensitive indicators of injury reveal hippocampal damage in C57BL/6J mice treated with kainic acid in the absence of tonic-clonic seizures. (cdc.gov)
  • The battery of neuropathological indices reported here reveals the C57BL/6J mouse is sensitive to excitotoxic neural damage caused by kainic acid, in the absence of tonic-clonic seizures. (cdc.gov)
  • Gamma-aminobutyric acid (GABA) is an inhibitory neurotransmitter implicated in the control of generalized seizures induced by various convulsants. (osu.edu)
  • It was the objective of this study to investigate the GABA system in the SN and its response to seizures induced by the neuroexcitant kainic acid (KA). (osu.edu)
  • After the injection of kainic acid, all animals experienced convulsive seizures for at least 3 h. (jneurosci.org)
  • Systematic administration of kainic acid (KA) in rodents causes severe limbic seizures, selective neuronal loss, and neuroinflammation in the hippocampus that are attributed to the excitotoxic process. (sigmaaldrich.com)
  • Effects of sustained seizures produced by intrahippocampal injection of kainic acid on noradrenergic neurons: evidence for local control of norepinephrine release. (aspetjournals.org)
  • T. Popovici, A. Represa, V. Crepel, G. Barbin, M. Beaudoin, and Y. Ben Ari, Effects of kainic acid-induced seizures and ischemia on c-fos-like proteins in rat brain. (springer.com)
  • DNA damage and nonhomologous end joining in excitotoxicity: neuroprotective role of DNA-PKcs in kainic acid-induced seizures. (ox.ac.uk)
  • By day 1, and extending through 4 days following kainic acid-induced seizures, brains from DNA-PKcs null mice showed widespread neurodegeneration that encompassed the entire hippocampal CA1-CA3 pyramidal cell layer, entorhinal cortex, and lateral septum, with relative sparing of the dentate gyrus granule cell layer and hilus, as judged by toluidine blue, Fluoro-Jade B, and terminal dUTP nick end labeling staining. (ox.ac.uk)
  • Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. (mdpi.com)
  • Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid poisoning and unusual behaviors in animal subjects, notably conspecific aggression. (mdpi.com)
  • It is also evident that domoic acid can trigger a separate process of epileptogeneis, which, over a latent "silent" period of weeks to months, causes a disease state of progressive recurrent seizures and behavioral abnormalities [ 8 , 9 , 10 , 11 ]. (mdpi.com)
  • The aims of the present study were to determine whether treatment with a polysaccharide fraction (GCPS-2) from a Mexican Ganoderma curtisii strain can reduce seizures, and the increases in the levels of apoptotic molecules and inflammatory cytokines in kainic acid-induced seizure mouse model. (phcogj.com)
  • Background Administration of kainic acid (KA), an analog of 116539-60-7 the excitotoxin glutamate, to rodents results in neuronal death and seizures [1], which provides a well-characterized model for studies of human neurodegenerative diseases [2-4]. (cancer-ecosystem.com)
  • Rodents with spontaneous recurrent seizures have been generated by using chemoconvulsants, primarily pilocarpine and kainic acid. (dovepress.com)
  • Kainic acid is a direct agonist of the glutamic kainate receptors and large doses of concentrated solutions produce immediate neuronal death by overstimulating neurons to death. (wikipedia.org)
  • Thus, in large, concentrated doses kainic acid can be considered a neurotoxin, and in small doses of dilute solution kainic acid will chemically stimulate neurons. (wikipedia.org)
  • Also, infusion with kainic acid in the hippocampus of animals results in major damage of pyramidal neurons and subsequent seizure activity. (wikipedia.org)
  • An autophagic mechanism is involved in apoptotic death of rat striatal neurons induced by the non-N-methyl-D-aspartate receptor agonist kainic acid," Autophagy , vol. 4, no. 2, pp. 214-226, 2008. (hindawi.com)
  • Local injections of kainic acid, which destroyed cholinergic and GABA neurons in the caudatoputamen and in the nucleus accumbens, caused a rapid (70-90%) decrease in the soluble guanylate cyclase and a slower 50‐60% fall in the particulate guanylate cyclase in these nuclei. (deepdyve.com)
  • In this study, we investigated a role of COX isoforms (COX-1 and COX-2) in kainic acid-induced neuronal death in cultured murine cortical or hippocampal neurons. (elsevier.com)
  • In primary cortical neurons, both indomethacin (COX-1/-2 nonselective inhibitor) and aspirin (COX-1 preferential inhibitor) reduced basal and kainic acid-induced PGE 2 production significantly and prevented neuronal cell death after kainic acid treatment. (elsevier.com)
  • In hippocampal neurons, however, COX-2 inhibitors prevented both kainic acid-induced neuronal death and PGE 2 production. (elsevier.com)
  • In conclusion, we suggest that the release of PGE 2 induced by kainic acid occurred through COX-1 activity rather than COX-2 in cortical neurons. (elsevier.com)
  • The inhibition of PGE 2 release by COX-1 inhibitors prevented kainic acid-induced cortical neuronal death, while in the hippocampal neurons, COX-2 inhibitors prevented kainic acid-induced PGE 2 release and hippocampal neuronal death. (elsevier.com)
  • Bromodeoxyuridine labeled neurons increased at least 6-fold on the side ipsilateral to the kainic acid injection compared to controls, but significantly, were also increased, by at least 3-fold on the side contralateral to the injection. (cf.ac.uk)
  • In this article we cultured axotomized rat dorsal root ganglion neurons to investigate the effects of corticosterone and a glutamate receptor agonist kainic acid on neurite outgrowth. (elsevier.com)
  • Western blot analysis and immunocytochemical studies revealed an increase of expressions of both TrkA and growth-associated protein GAP-43 in dorsal root ganglion neurons with combined treatment of corticosterone and kainic acid. (elsevier.com)
  • Immunocytochemistry showed that corticosterone+kainic acid increase nerve growth factor immunoreactivity in dorsal root ganglion neurites and enhance GAP-43 immunointensity in dorsal root ganglion neurons. (elsevier.com)
  • Here we further studied in vivo the sensitivity of the hippocampal CA1 neurons in response to CTZ in epileptogenesis in comparison with two other classic convulsants of kainic acid (KA) and pentylenetetrazol (PTZ). (naver.com)
  • Kainic acid is utilised in primary neuronal cell cultures and in the acute brain slice preparation to study the physiological effect of excitotoxicity and assess the neuroprotective capabilities of potential therapeutics. (wikipedia.org)
  • To analyze the role of SP in excitotoxicity, kainic acid (KA) was administered to rats and in situ hybridization was used to analyze the levels of the SP encoding preprotachykinin-A (PPT-A) mRNA in striatal and hippocampal subregions 1, 4, and 24 h and 7 days after KA. (nih.gov)
  • Kainic acid (KA) treatment is a well-established model of hippocampal neuron death mediated in large part by KA receptor-induced excitotoxicity. (nih.gov)
  • Kainic acid (KA), an analog of glutamate, has been used to establish excitotoxicity models. (frontiersin.org)
  • Pirfenidone Attenuates Microglial Reactivity and Reduces Inducible Nitric Oxide Synthase mRNA Expression After Kainic Acid-Mediated Excitotoxicity in Pubescent Rat Hippocampus. (sigmaaldrich.com)
  • Radiation-induced apoptosis in developing rats and kainic acid-induced excitotoxicity in adult rats are associated with distinctive morphological and biochemical c-Jun/AP-1 (N) expression. (biomedsearch.com)
  • Involvement of nitric oxide in kainic acid-induced excitotoxicity in rat brain. (tci-thaijo.org)
  • Our results provide the first direct evidence of a causal role of caspase 3 activation in the cellular changes during kainic acid-mediated excitotoxicity. (biomedcentral.com)
  • Therefore, the most effective ablation studies are performed in comparison to a sham lesion that duplicates all the steps of producing a brain lesion except the one that actually causes the brain damage, that is, injection of kainic acid or administration of an electrical shock. (wikipedia.org)
  • The goal of this study was to determine whether a substantial decrease in adult neurogenesis influences epileptogenesis evoked by the intra-amygdala injection of kainic acid (KA). (nih.gov)
  • We now investigate the effect of intra-amygdaloid injection of kainic acid, as another model of temporal lobe epilepsy, focusing on epileptogenesis, spike-and-wave discharges (SWDs), and the transition from basal to SWD states in GAERS. (jneurosci.org)
  • SWDs and increases in power of the delta, alpha, and beta frequency ranges during the transition period disappeared after the kainic acid injection for 1-3 d and gradually reappeared. (jneurosci.org)
  • We have further evaluated the interplay between absence epilepsy and limbic epilepsy by using intra-amygdaloid injection of kainic acid in adult GAERS as another model of temporal lobe epilepsy ( Sperk, 1994 ) to compare with intra-amygdaloid kindling. (jneurosci.org)
  • Systemic injection of kainic acid (KA) in the rat produces an animal model of human temporal lobe epilepsy. (biomedsearch.com)
  • Intraperitoneal injection of kainic acid at convulsant doses to the adult rat produces cell death with morphological features of necrosis, together with the appearance of cells with fine granular chromatin degeneration and small numbers of apoptotic-like cells, in the entorhinal and piriform cortices, basal amygdala, certain thalamic nuclei, and CA1 region of the hippocampus. (biomedsearch.com)
  • The vast majority of c-Jun-immunoreactive cells have normal nuclear morphology, whereas necrotic cells are negative and only a few cells with fine granular chromatin condensation and apoptotic cells following kainic acid injection are stained with c-Jun antibodies. (biomedsearch.com)
  • Western blotting, using the same antibody, shows a p39 band in control rats, which is accompanied by a band at about p26 from 6 h onwards following kainic acid injection. (biomedsearch.com)
  • GFAP levels were induced 3 days after kainic acid injection in brain regions where MMP-2 was elevated. (ovid.com)
  • These data demonstrate that MMP-9 and MMP-2 are differentially expressed with respect to time after kainic acid injection, and suggest that they are regulated by convulsion and/or neurodegenerative-associated mechanisms, respectively. (ovid.com)
  • In this study, we evaluated the expression of APC and its association with β-catenin signaling pathway, following the induction of an excitotoxic lesion by kainic acid (KA) injection, which cause pyramidal cell degeneration. (springer.com)
  • Intraventricular injection of kainic acid produced a characteristic necrosis in the hippocampal CA3 region of adult rabbits. (elsevier.com)
  • The animals were sacrificed by decapitation on the 1st, 4th and 10th day after injection of the kainic acid. (ndsl.kr)
  • 3. After injection of the kainic acid the neurites of the inner plexiform layer were swollen at the first, and thereafter those changes were gradually disappeared until the 10th day. (ndsl.kr)
  • We report here for the first time that granule cell neurogenesis is increased bilaterally 1 week after a single unilateral intracerebroventricular injection of kainic acid. (cf.ac.uk)
  • Injection of kainic acid (KA) can induce neurodegeneration and epilepsy in the experimental study. (tci-thaijo.org)
  • Here, we investigate hippocampal changes using a mouse model that receive a single kainic acid-intracerebral ventricle injection. (biomedcentral.com)
  • The effects of caspase 3 inhibition on these changes were detected during a period of 1 to 7 days post kainic acid injection. (biomedcentral.com)
  • The co-injection of caspase 3 inhibitor did not rescue kainic acid-mediated neurodegeneration but seriously and reversibly disturb the structural integrity of axon and dendrite. (biomedcentral.com)
  • The kainic acid-induced events include microglia activation, the proliferation of radial glial cells, neurogenesis, and calcineurin A cleavage were significantly inhibited by the co-injection of caspase 3 inhibitor, suggesting the direct involvement of caspase 3 in these events. (biomedcentral.com)
  • The EEG was recorded from the hippocampus and cortex of adult GAERS and Wistar rats before kainic acid injections into the basolateral amygdala and for 3 months thereafter. (jneurosci.org)
  • Here, AM374 (palmitylsulfonyl fluoride), an irreversible inhibitor of fatty acid amide hydrolase (FAAH), was injected i.p. into rats to test for endocannabinoid enhancement. (aspetjournals.org)
  • To evaluate the neuroprotective nature of the FAAH inhibitor, we tested AM374 in a seizure model involving rats insulted with kainic acid (KA). (aspetjournals.org)
  • c-Jun expression in kainic acid-treated rats, as revealed with the c-Jun/AP-1 (N) antibody, is found in the nuclei of a minority of cells in the same areas. (biomedsearch.com)
  • Decreased c-Jun N-terminal kinase 1 expression, as revealed on western blots, is observed in kainic acid-treated rats. (biomedsearch.com)
  • In order to test the hypotheses that stimulation of non-N-methyl-D-aspartate (NMDA) receptors in the neostriatum causes the release of gamma-aminobutyric acid (GABA) from nigrostriatal neurones, dual microdialysis was carried out in the neostriatum and substantia nigra of freely moving rats. (ox.ac.uk)
  • Current study was to focus on the proton MRS detection of metabolite profile of spinal cord gray matter just caudal to a kainic acid injury in rats 14 days after administration of the excitotoxic agent, and further to correlate the MRS findings to the histopathology of the animal model. (ismrm.org)
  • Neurogenesis in the suprapyramidal and infrapyramidal blades of the rostral dentate gyrus was investigated following kainic acid (KA)-induced status epilepticus (SE) in adult rats. (geoscience.net)
  • Walaas, Ivar 1981-01-01 00:00:00 Abstract: The activity of soluble and particulate guanylate cyclase (EC 4.6.1.2) has been compared with the distribution of neurotransmitter candidates in three rat forebrain nuclei, and the effects of local kainic acid injections into these nuclei have been tested. (deepdyve.com)
  • abstract = "Kainic acid (KA) selectively damages afferent synapses that innervate, in chickens, mainly tall hair cells. (elsevier.com)
  • abstract = "The distribution of [3H]kainic acid (KA) binding sites in the rat CNS was determined by in vitro autoradiography. (nebraska.edu)
  • The effect of kainic acid on the release of GABA in rat neostriatum and substantia nigra. (ox.ac.uk)
  • Selective stimulation of excitatory amino acid receptor subtypes and the survival of cerebellar granule cells in culture: effect of kainic acid. (ku.dk)
  • We analyzed spectral changes of the EEG during kainic acid-induced status epilepticus, SWDs, for 10 s before (silent period) and for 2 s before (transition period) SWDs. (jneurosci.org)
  • Administration of simvastatin after kainic acid-induced status epilepticus restrains chronic temporal lobe epilepsy. (tci-thaijo.org)
  • A tachykinin NK1 receptor antagonist, CP-122,721-1, attenuates kainic acid-induced seizure activity. (nih.gov)
  • Although similar in catalytic activity, MMP-9 and MMP-2 may play different roles in response to kainic acid-induced seizure and neuronal degeneration. (ovid.com)
  • After sparteine pretreatment (13mg/kg, administered 30min before the convulsive drug), the animals administered pentylenetetrazole and pilocarpine exhibited reduced mortality rates compared with the corresponding control groups, while the animals administered kainic acid exhibited a delayed onset of convulsive behavior and decreased seizure duration compared with the corresponding control group. (deepdyve.com)
  • As such, we utilized RNAseq analysis upon microglia isolated from the hippocampus to determine expression pattern alterations following kainic acid induced seizure. (europeanhealthjournal.com)
  • Effects of rutin on oxidative stress in mice with kainic acid-induced seizure. (tci-thaijo.org)
  • antiworming agent neuroscience research neurodegenerative agent modeling of epilepsy modeling of Alzheimer's disease Dihydrokainic acid Domoic acid Kainate receptor Carlson, Neil R. (2013). (wikipedia.org)
  • A study of the changes in dentate granule cell excitability and inhibition in the kainic acid model of temporal lobe epilepsy. (wikipedia.org)
  • Ben-Ari, Y., Tremblay, E., and Ottersen, 0.P., 1980, Injections of kainic acid into the amygdaloid complex of the rat: an electrographic, clinical and histological study in relation to the pathology of epilepsy, Neuroscience 5: 515. (springer.com)
  • kainic acid: mechanisms and relevance to human temporal lobe epilepsy, Neuroscience 14:375. (springer.com)
  • Translocation of glutamate transporter subtype excitatory amino acid carrier 1 protein in kainic acid-induced rat epilepsy. (biomedsearch.com)
  • We examined the temporal expression of the sodium-dependent neuronal glutamate transporter, excitatory amino acid carrier 1 (EAAC1), in KA-induced rat epilepsy. (biomedsearch.com)
  • To investigate the pathophysiological role of phospholipase D (PLD)-mediated signaling, changes in the expression of the PLD isozymes PLD1 and PLD2 were investigated in the rat kainic acid (KA) model of human temporal lobe epilepsy. (elsevier.com)
  • The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. (mdpi.com)
  • Gluck MR, Jayatilleke E, Shaw S, Rowan AJ, Haroutunian V. CNS oxidative stress associated with the kainic acid rodent model of experimental epilepsy. (tci-thaijo.org)
  • Kainic acid (KA) is an excitotoxic agent commonly used to induce epilepsy in rodents. (elsevier.com)
  • kainic acid (KA) is one of the most common chemoconvulsants used to create SE models of temporal lobe epilepsy (TLE). (biomedcentral.com)
  • In recent years, kainic acid has been used as a research tool to study human neurological conditions such as epilepsy and Alzheimer's disease. (ucsd.edu)
  • Kainic acid is a potent neuroexcitatory amino acid agonist that acts by activating receptors for glutamate, the principal excitatory neurotransmitter in the central nervous system. (wikipedia.org)
  • It is a potent excitatory amino acid agonist at some types of excitatory amino acid receptors and has been used to discriminate among receptor types. (umassmed.edu)
  • Like many excitatory amino acid agonists it can cause neurotoxicity and has been used experimentally for that purpose. (umassmed.edu)
  • Retrosynthetic analysis of Fluvirucinine A 2 ( 16 ) could lead to an acyclic amino acid, that could be cyclized to the macrolactam. (organic-chemistry.org)
  • We have utilized such kainic acid lesions to evaluate the disposition of amino acid transmitter candidates in different neuronal populations of the cerebellum. (elsevier.com)
  • Tran, VT & Snyder, SH 1979, ' Amino acid neurotransmitter candidates in rat cerebellum: Selective effects of kainic acid lesions ', Brain Research , vol. 167, no. 2, pp. 345-353. (elsevier.com)
  • However, different retinal cell types differ largely in their susceptibility to excitatory amino acid-induced neurotoxicity. (lu.se)
  • It is concluded that excitatory amino acid receptor stimulation of the neostriatum releases GABA from striatonigral neurones and that stimulation of the substantia nigra causes the release from striatonigral terminals and/or the collaterals of nigrofugal neurones. (ox.ac.uk)
  • Selective stimulation of excitatory amino acid receptor subtypes and t. (ku.dk)
  • Excitotoxic amino acid. (abcam.com)
  • Ibotenic acid is a neuroexcitatory amino acid originally isolated from Amanita species that functions as a NMDA and metabotropic glutamate receptor agonist. (adooq.com)
  • p>This subsection describes interesting single amino acid sites on the sequence that are not defined in any other subsection. (uniprot.org)
  • Homotaurine is an amino acid that is found in some seaweeds. (webmd.com)
  • Fluoxetine attenuates kainic acid-induced neuronal cell death in the mouse hippocampus," Brain Research , vol. 1281, pp. 108-116, 2009. (hindawi.com)
  • PDF] Inhibition of eNOS/sGC/PKG Pathway Decreases Akt Phosphorylation Induced by Kainic Acid in Mouse Hippocampus. (semanticscholar.org)
  • Kainic Acid-induced Neuronal Death is Attenuated by Aminoguanidine but Aggravated by L-NAME in Mouse Hippocampus. (semanticscholar.org)
  • Kainic acid injections directly into the cerebellum destroy Purkinje, stellate, basket and Golgi II cells selectively with much less damage to granule cells. (elsevier.com)
  • In this study, we found that kainic acid (KA) treatment in vitro and in vivo reduced the level of IP 3 K-A mRNA. (elsevier.com)
  • In this study, we found that kainic acid (KA) treatment in vitro and in vivo reduced the level of IP3K-A mRNA. (elsevier.com)
  • We found that kainic acid not only induced neurodegeneration but also arouse several caspase 3-mediated molecular and cellular changes including dendritic plasticity, neurogenesis, and gliosis. (biomedcentral.com)
  • Kainic acid is an agonist for kainate receptors, a type of ionotropic glutamate receptor. (wikipedia.org)
  • Kainic acid (KA) is a glutamate analog that binds to and activates ionotropic glutamate receptors. (springer.com)
  • Receptors, Kainic Acid" is a descriptor in the National Library of Medicine's controlled vocabulary thesaurus, MeSH (Medical Subject Headings) . (uchicago.edu)
  • A class of ionotropic glutamate receptors characterized by their affinity for KAINIC ACID. (uchicago.edu)
  • This graph shows the total number of publications written about "Receptors, Kainic Acid" by people in this website by year, and whether "Receptors, Kainic Acid" was a major or minor topic of these publications. (uchicago.edu)
  • Below are the most recent publications written about "Receptors, Kainic Acid" by people in Profiles. (uchicago.edu)
  • Kainic acid activates excitatory glutamate receptors that control cell-to-cell communication in the brain and are critical for short-term memory. (ucsd.edu)
  • A team of scientists at Scripps Institution of Oceanography at the University of California San Diego and the J. Craig Venter Institute ( JCVI ) has developed a new way to produce kainic acid, a natural seaweed neurochemical and powerful reagent used in brain research. (ucsd.edu)
  • In a new study published April 17 in the journal Angewandte Chemie International Edition , the scientists were able to sequence the genome of a seaweed known to produce kainic acid, and they identified the enzymes responsible for production of the natural chemical. (ucsd.edu)
  • This biotransformation approach allows us to quickly produce kainic acid in a cheaper and more environmentally friendly way than traditional chemical synthesis. (ucsd.edu)
  • Dr. Moore's lab set out to identify the genes that code for the production of kainic acid in red seaweed and found that these genes enabled the seaweed to produce kainic acid in only two steps. (newswise.com)
  • We have investigated the vulnerability of GABAergic cells in the rabbit retina to the non-NMDA receptor agonist kainic acid (KA). (lu.se)
  • IL-18 deficiency aggravates kainic acid-induced hippocampal neurodegeneration in C57BL/6 mice due to an overcompensation by IL-12. (tci-thaijo.org)
  • Background Previously, we found that interleukin (IL)-18 deficiency aggravates kainic acid (KA)-induced hippocampal neurodegeneration in young C57BL/6 mice due to an over-compensation by IL-12. (cancer-ecosystem.com)
  • Postnatal development of kainic acid binding sites in the limbic system, Neuroscience 13: 1095. (springer.com)
  • Hilmas et al 2001 J. of Neuroscience) Kynurenic acid may modulate the synaptic transmission through blockade of the alpha 7 nicotine cholinergic rezeptors (nACh), while7nChRs). (shakyradunn.com)
  • Recently, Dr. Moore discovered a faster and more environmentally friendly way to synthesize kainic acid-a compound produced by some types of red seaweed-that's valuable for neuroscience research. (newswise.com)
  • The objective of this study was to determine whether MMPs are expressed in various regional areas of rat brain after administration of the neurotoxin, kainic acid. (ovid.com)
  • Their research builds upon the team's recent work on discovering the genetic origin of domoic acid, a potent neurotoxin produced by planktonic microalgae. (ucsd.edu)
  • The substrate for cyclization was prepared by coupling the acid 15 with the alcohol 16 , followed by selective deprotection and oxidation. (organic-chemistry.org)
  • In contrast, NS398 (COX-2 selective inhibitor) had no effect on kainic acid-induced neuronal cell death. (elsevier.com)
  • Franck, JE & Schwartzkroin, PA 1984, ' Immature rabbit hippocampus is damaged by systemic but not intraventricular kainic acid ', Developmental Brain Research , vol. 13, no. 2, pp. 219-227. (elsevier.com)
  • Sensitive indices of neural injury were used to evaluate the time course of kainic acid (KA)-induced hippocampal damage in adult C57BL/6J mice (4 months), a strain previously reported to be resistant to kainate-induced neurotoxicity. (cdc.gov)
  • We have shown previously, that mice lacking tumor necrosis factor-α (TNF-α) receptor 1 (TNFR1) exhibit greater hippocampal neurodegeneration, suggesting that TNFR1 may be protective in kainic acid (KA)-induced neurotoxicity. (eurekaselect.com)
  • Kainic acid hyperphosphorylates tau via inflammasome activation in MAPT transgenic mice. (alzforum.org)
  • Curcumin attenuates the kainic acid-induced hippocampal cell death in the mice. (greenmedinfo.com)
  • Supraphysiological levels of the stress hormone corticosterone attenuate blood-brain barrier disruption and microglial activation in hippocampus of C57BL/6J mice treated with kainic acid. (cdc.gov)
  • Kainic acid intoxication in C57BL/6J mice causes neuronal damage and the activation of glial cells. (cdc.gov)
  • Control and implanted mice were injected intraperitoneally with saline or 25 mg/kg kainic acid, and sacrificed at 1, 3, 6, and 12 hours post treatment. (cdc.gov)
  • Older Abr;Bcr -deficient mice show spontaneous mid-brain glial hypertrophy, which can further be markedly enhanced by kainic acid. (biologists.org)
  • These results are generally in conflict with those obtained by many researchers using the activity of the GABA synthetic enzyme glutamic acid decarboxylase (GAD) as a measure of GABA levels. (osu.edu)
  • Glutamic acid decarboxylase mRNA in rat brain: regional distribution and effects of intrastriatal kainic acid. (umassmed.edu)
  • Kainic acid lesions produce a 65-70% decrease in high affinity [ 3 H]GABA uptake into synaptosomal fractions and a similar decrease in glutamic acid decarboxylase with a 50% reduction in endogenous GABA. (elsevier.com)
  • The roles of caspase 3 on the kainic acid-mediated neurodegeneration, dendritic plasticity alteration, neurogenesis, microglial activation and gliosis are not fully understood. (biomedcentral.com)
  • The present study evaluated the antioxidatives and anti-inflammatory effect of melatonin on kainic acid (KA)-induced neuronal injury in the hippocampus in vivo. (bvsalud.org)
  • Temporal aspects of synergy with kainic acid. (nih.gov)
  • The present report examines the temporal parameters with which corticosterone modulates the toxicity of the excitotoxin kainic acid (KA). (nih.gov)
  • Synaptosomal accumulation of [ 3 H]glutamate and [ 3 H]-aspartate is reduced 25-30% following such lesions while no decline in uptake of numerous other amino acids is observed. (elsevier.com)
  • The kit contains (S)-AMPA, ( ab120005 ), (S)-5-Fluorowillardiine hydrochloride ( ab120399 ), Cyclothiazide ( ab120061 ), Aniracetam ( ab120316 ), Kainic acid ( ab120100 ), (S)-5-Iodowillardiine hydrochloride ( ab120401 ), NMDA ( ab120052 ) and D-serine ( ab120048 ). (abcam.com)
  • 3APS) protects from the convulsant and cytotoxic effect of systemically administered kainic acid. (webmd.com)
  • Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. (mdpi.com)
  • We now define domoic acid epileptic disease as distinct consequence of domoic acid poisoning that occurs in the absence of domoic acid. (mdpi.com)
  • However, in the case of domoic acid, we use the term "disease" because it is caused by a known external factor with a defined sequence of events and course of prognosis. (mdpi.com)
  • This concept report focuses on those essential characteristics of domoic acid poisoning that lead to epileptic disease drawing on case studies in humans and sea lions and a rat model to elucidate the structural basis specific to domoic acid epileptic maturation. (mdpi.com)
  • The domoic acid study helped the scientists develop a hypothesis for how a chemical compound like kainic acid is formed within a living organism-in this case seaweed-in a process known as biosynthesis. (ucsd.edu)
  • All that remains for the synthesis of kainic acid (1.1) are olefination, ring-opening of carbamate, oxidation and deprotection. (sussex.ac.uk)
  • Design, synthesis and evaluation of novel ferulic acid derivatives as multi-target-directed ligands for the treatment of Alzheimer's disease. (alzforum.org)
  • Therefore, chemical stimulation by kainic acid is more localized than electrical stimulation. (wikipedia.org)
  • Neurology, 1993 Kynurenic acid and ageing B. Kepplinge H. Baran et al. (shakyradunn.com)
  • The effect of alcohols (ethanol, 1-propanol, propylene glycol, glycerin, sucrose) on the phase behavior and emulsification of sucrose stearic acid ester (SSE)/water/edible vegetable oil (EVO) systems was investigated. (bireme.br)
  • Kainic acid (KA) exposure causes neuronal degeneration featured by Alzheimer-like tau hyperphosphorylation and memory deficits. (frontiersin.org)
  • Using complementary approaches, a plausible reaction pathway of kainic acid formation is established. (ntnu.edu.tw)
  • The sequencing and assembly with the long reads and the large amount of data enabled us to assemble the genes in the kainic acid pathway. (ucsd.edu)