AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and Processes
Kainic AcidExcitatory Amino Acid AgonistsSeizuresReceptors, Kainic AcidStatus EpilepticusHippocampusConvulsantsFlurothylN-MethylaspartateNeuronsNeurotoxinsKindling, NeurologicPentylenetetrazoleMedulla OblongataRats, Sprague-DawleyEpilepsy, Temporal LobeReceptors, NeurotransmitterQuinolinic AcidsNitrergic NeuronsIbotenic AcidEpilepsyalpha-MethyltyrosineMossy Fibers, HippocampalReceptors, GlutamateVestibular NucleiGlutamatesPyrrolidinesNerve DegenerationGliosisGlutamic AcidQuisqualic AcidNeuroprotective AgentsPeriaqueductal GrayBrainRats, Wistaralpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic AcidQuinolinic AcidRats, Inbred StrainsAnticonvulsantsDisease Models, AnimalExcitatory Amino AcidsCell DeathNystagmus, PhysiologicReceptors, N-Methyl-D-AspartateHyperprolactinemiaMicroinjectionsInjections, IntraventricularElectroencephalographyDentate GyrusPonsPilocarpineExcitatory Amino Acid AntagonistsCorpus StriatumBehavior, Animal6-Cyano-7-nitroquinoxaline-2,3-dioneNADPH DehydrogenaseQuinoxalinesAstrocytesLimbic System
Kainic Acid: (2S-(2 alpha,3 beta,4 beta))-2-Carboxy-4-(1-methylethenyl)-3-pyrrolidineacetic acid. Ascaricide obtained from the red alga Digenea simplex. It is a potent excitatory amino acid agonist at some types of excitatory amino acid receptors and has been used to discriminate among receptor types. Like many excitatory amino acid agonists it can cause neurotoxicity and has been used experimentally for that purpose.Excitatory Amino Acid Agonists: Drugs that bind to and activate excitatory amino acid receptors.Seizures: Clinical or subclinical disturbances of cortical function due to a sudden, abnormal, excessive, and disorganized discharge of brain cells. Clinical manifestations include abnormal motor, sensory and psychic phenomena. Recurrent seizures are usually referred to as EPILEPSY or "seizure disorder."Receptors, Kainic Acid: A class of ionotropic glutamate receptors characterized by their affinity for KAINIC ACID.Status Epilepticus: A prolonged seizure or seizures repeated frequently enough to prevent recovery between episodes occurring over a period of 20-30 minutes. The most common subtype is generalized tonic-clonic status epilepticus, a potentially fatal condition associated with neuronal injury and respiratory and metabolic dysfunction. Nonconvulsive forms include petit mal status and complex partial status, which may manifest as behavioral disturbances. Simple partial status epilepticus consists of persistent motor, sensory, or autonomic seizures that do not impair cognition (see also EPILEPSIA PARTIALIS CONTINUA). Subclinical status epilepticus generally refers to seizures occurring in an unresponsive or comatose individual in the absence of overt signs of seizure activity. (From N Engl J Med 1998 Apr 2;338(14):970-6; Neurologia 1997 Dec;12 Suppl 6:25-30)Hippocampus: A curved elevation of GRAY MATTER extending the entire length of the floor of the TEMPORAL HORN of the LATERAL VENTRICLE (see also TEMPORAL LOBE). The hippocampus proper, subiculum, and DENTATE GYRUS constitute the hippocampal formation. Sometimes authors include the ENTORHINAL CORTEX in the hippocampal formation.Convulsants: Substances that act in the brain stem or spinal cord to produce tonic or clonic convulsions, often by removing normal inhibitory tone. They were formerly used to stimulate respiration or as antidotes to barbiturate overdose. They are now most commonly used as experimental tools.Flurothyl: A convulsant primarily used in experimental animals. It was formerly used to induce convulsions as a alternative to electroshock therapy.N-Methylaspartate: An amino acid that, as the D-isomer, is the defining agonist for the NMDA receptor subtype of glutamate receptors (RECEPTORS, NMDA).Neurons: The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.Neurotoxins: Toxic substances from microorganisms, plants or animals that interfere with the functions of the nervous system. Most venoms contain neurotoxic substances. Myotoxins are included in this concept.Kindling, Neurologic: The repeated weak excitation of brain structures, that progressively increases sensitivity to the same stimulation. Over time, this can lower the threshold required to trigger seizures.Pentylenetetrazole: A pharmaceutical agent that displays activity as a central nervous system and respiratory stimulant. It is considered a non-competitive GAMMA-AMINOBUTYRIC ACID antagonist. Pentylenetetrazole has been used experimentally to study seizure phenomenon and to identify pharmaceuticals that may control seizure susceptibility.Medulla Oblongata: The lower portion of the BRAIN STEM. It is inferior to the PONS and anterior to the CEREBELLUM. Medulla oblongata serves as a relay station between the brain and the spinal cord, and contains centers for regulating respiratory, vasomotor, cardiac, and reflex activities.Rats, Sprague-Dawley: A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.Epilepsy, Temporal Lobe: A localization-related (focal) form of epilepsy characterized by recurrent seizures that arise from foci within the temporal lobe, most commonly from its mesial aspect. A wide variety of psychic phenomena may be associated, including illusions, hallucinations, dyscognitive states, and affective experiences. The majority of complex partial seizures (see EPILEPSY, COMPLEX PARTIAL) originate from the temporal lobes. Temporal lobe seizures may be classified by etiology as cryptogenic, familial, or symptomatic (i.e., related to an identified disease process or lesion). (From Adams et al., Principles of Neurology, 6th ed, p321)Receptors, Neurotransmitter: Cell surface receptors that bind signalling molecules released by neurons and convert these signals into intracellular changes influencing the behavior of cells. Neurotransmitter is used here in its most general sense, including not only messengers that act to regulate ion channels, but also those which act on second messenger systems and those which may act at a distance from their release sites. Included are receptors for neuromodulators, neuroregulators, neuromediators, and neurohumors, whether or not located at synapses.Quinolinic AcidsNitrergic Neurons: Nerve cells where transmission is mediated by NITRIC OXIDE.Ibotenic Acid: A neurotoxic isoxazole (similar to KAINIC ACID and MUSCIMOL) found in AMANITA mushrooms. It causes motor depression, ataxia, and changes in mood, perceptions and feelings, and is a potent excitatory amino acid agonist.Epilepsy: A disorder characterized by recurrent episodes of paroxysmal brain dysfunction due to a sudden, disorderly, and excessive neuronal discharge. Epilepsy classification systems are generally based upon: (1) clinical features of the seizure episodes (e.g., motor seizure), (2) etiology (e.g., post-traumatic), (3) anatomic site of seizure origin (e.g., frontal lobe seizure), (4) tendency to spread to other structures in the brain, and (5) temporal patterns (e.g., nocturnal epilepsy). (From Adams et al., Principles of Neurology, 6th ed, p313)alpha-Methyltyrosine: An inhibitor of the enzyme TYROSINE 3-MONOOXYGENASE, and consequently of the synthesis of catecholamines. It is used to control the symptoms of excessive sympathetic stimulation in patients with PHEOCHROMOCYTOMA. (Martindale, The Extra Pharmacopoeia, 30th ed)Mossy Fibers, Hippocampal: Axons of certain cells in the DENTATE GYRUS. They project to the polymorphic layer of the dentate gyrus and to the proximal dendrites of PYRAMIDAL CELLS of the HIPPOCAMPUS. These mossy fibers should not be confused with mossy fibers that are cerebellar afferents (see NERVE FIBERS).Receptors, Glutamate: Cell-surface proteins that bind glutamate and trigger changes which influence the behavior of cells. Glutamate receptors include ionotropic receptors (AMPA, kainate, and N-methyl-D-aspartate receptors), which directly control ion channels, and metabotropic receptors which act through second messenger systems. Glutamate receptors are the most common mediators of fast excitatory synaptic transmission in the central nervous system. They have also been implicated in the mechanisms of memory and of many diseases.Vestibular Nuclei: The four cellular masses in the floor of the fourth ventricle giving rise to a widely dispersed special sensory system. Included is the superior, medial, inferior, and LATERAL VESTIBULAR NUCLEUS. (From Dorland, 27th ed)Glutamates: Derivatives of GLUTAMIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain the 2-aminopentanedioic acid structure.PyrrolidinesNerve Degeneration: Loss of functional activity and trophic degeneration of nerve axons and their terminal arborizations following the destruction of their cells of origin or interruption of their continuity with these cells. The pathology is characteristic of neurodegenerative diseases. Often the process of nerve degeneration is studied in research on neuroanatomical localization and correlation of the neurophysiology of neural pathways.Gliosis: The production of a dense fibrous network of neuroglia; includes astrocytosis, which is a proliferation of astrocytes in the area of a degenerative lesion.Glutamic Acid: A non-essential amino acid naturally occurring in the L-form. Glutamic acid is the most common excitatory neurotransmitter in the CENTRAL NERVOUS SYSTEM.Quisqualic Acid: An agonist at two subsets of excitatory amino acid receptors, ionotropic receptors that directly control membrane channels and metabotropic receptors that indirectly mediate calcium mobilization from intracellular stores. The compound is obtained from the seeds and fruit of Quisqualis chinensis.Neuroprotective Agents: Drugs intended to prevent damage to the brain or spinal cord from ischemia, stroke, convulsions, or trauma. Some must be administered before the event, but others may be effective for some time after. They act by a variety of mechanisms, but often directly or indirectly minimize the damage produced by endogenous excitatory amino acids.Periaqueductal Gray: Central gray matter surrounding the CEREBRAL AQUEDUCT in the MESENCEPHALON. Physiologically it is probably involved in RAGE reactions, the LORDOSIS REFLEX; FEEDING responses, bladder tonus, and pain.Brain: The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.Rats, Wistar: A strain of albino rat developed at the Wistar Institute that has spread widely at other institutions. This has markedly diluted the original strain.alpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid: An IBOTENIC ACID homolog and glutamate agonist. The compound is the defining agonist for the AMPA subtype of glutamate receptors (RECEPTORS, AMPA). It has been used as a radionuclide imaging agent but is more commonly used as an experimental tool in cell biological studies.Quinolinic Acid: A metabolite of tryptophan with a possible role in neurodegenerative disorders. Elevated CSF levels of quinolinic acid are correlated with the severity of neuropsychological deficits in patients who have AIDS.Rats, Inbred Strains: Genetically identical individuals developed from brother and sister matings which have been carried out for twenty or more generations or by parent x offspring matings carried out with certain restrictions. This also includes animals with a long history of closed colony breeding.Anticonvulsants: Drugs used to prevent SEIZURES or reduce their severity.Disease Models, Animal: Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.Excitatory Amino Acids: Endogenous amino acids released by neurons as excitatory neurotransmitters. Glutamic acid is the most common excitatory neurotransmitter in the brain. Aspartic acid has been regarded as an excitatory transmitter for many years, but the extent of its role as a transmitter is unclear.Cell Death: The termination of the cell's ability to carry out vital functions such as metabolism, growth, reproduction, responsiveness, and adaptability.Nystagmus, Physiologic: Involuntary rhythmical movements of the eyes in the normal person. These can be naturally occurring as in end-position (end-point, end-stage, or deviational) nystagmus or induced by the optokinetic drum (NYSTAGMUS, OPTOKINETIC), caloric test, or a rotating chair.Receptors, N-Methyl-D-Aspartate: A class of ionotropic glutamate receptors characterized by affinity for N-methyl-D-aspartate. NMDA receptors have an allosteric binding site for glycine which must be occupied for the channel to open efficiently and a site within the channel itself to which magnesium ions bind in a voltage-dependent manner. The positive voltage dependence of channel conductance and the high permeability of the conducting channel to calcium ions (as well as to monovalent cations) are important in excitotoxicity and neuronal plasticity.Hyperprolactinemia: Increased levels of PROLACTIN in the BLOOD, which may be associated with AMENORRHEA and GALACTORRHEA. Relatively common etiologies include PROLACTINOMA, medication effect, KIDNEY FAILURE, granulomatous diseases of the PITUITARY GLAND, and disorders which interfere with the hypothalamic inhibition of prolactin release. Ectopic (non-pituitary) production of prolactin may also occur. (From Joynt, Clinical Neurology, 1992, Ch36, pp77-8)Microinjections: The injection of very small amounts of fluid, often with the aid of a microscope and microsyringes.Injections, Intraventricular: Injections into the cerebral ventricles.Electroencephalography: Recording of electric currents developed in the brain by means of electrodes applied to the scalp, to the surface of the brain, or placed within the substance of the brain.Dentate Gyrus: GRAY MATTER situated above the GYRUS HIPPOCAMPI. It is composed of three layers. The molecular layer is continuous with the HIPPOCAMPUS in the hippocampal fissure. The granular layer consists of closely arranged spherical or oval neurons, called GRANULE CELLS, whose AXONS pass through the polymorphic layer ending on the DENDRITES of PYRAMIDAL CELLS in the hippocampus.Pons: The front part of the hindbrain (RHOMBENCEPHALON) that lies between the MEDULLA and the midbrain (MESENCEPHALON) ventral to the cerebellum. It is composed of two parts, the dorsal and the ventral. The pons serves as a relay station for neural pathways between the CEREBELLUM to the CEREBRUM.Pilocarpine: A slowly hydrolyzed muscarinic agonist with no nicotinic effects. Pilocarpine is used as a miotic and in the treatment of glaucoma.Excitatory Amino Acid Antagonists: Drugs that bind to but do not activate excitatory amino acid receptors, thereby blocking the actions of agonists.Corpus Striatum: Striped GRAY MATTER and WHITE MATTER consisting of the NEOSTRIATUM and paleostriatum (GLOBUS PALLIDUS). It is located in front of and lateral to the THALAMUS in each cerebral hemisphere. The gray substance is made up of the CAUDATE NUCLEUS and the lentiform nucleus (the latter consisting of the GLOBUS PALLIDUS and PUTAMEN). The WHITE MATTER is the INTERNAL CAPSULE.Behavior, Animal: The observable response an animal makes to any situation.6-Cyano-7-nitroquinoxaline-2,3-dione: A potent excitatory amino acid antagonist with a preference for non-NMDA iontropic receptors. It is used primarily as a research tool.NADPH Dehydrogenase: A flavoprotein that reversibly oxidizes NADPH to NADP and a reduced acceptor. EC 1.6.99.1.QuinoxalinesAstrocytes: A class of large neuroglial (macroglial) cells in the central nervous system - the largest and most numerous neuroglial cells in the brain and spinal cord. Astrocytes (from "star" cells) are irregularly shaped with many long processes, including those with "end feet" which form the glial (limiting) membrane and directly and indirectly contribute to the BLOOD-BRAIN BARRIER. They regulate the extracellular ionic and chemical environment, and "reactive astrocytes" (along with MICROGLIA) respond to injury.Limbic System: A set of forebrain structures common to all mammals that is defined functionally and anatomically. It is implicated in the higher integration of visceral, olfactory, and somatic information as well as homeostatic responses including fundamental survival behaviors (feeding, mating, emotion). For most authors, it includes the AMYGDALA; EPITHALAMUS; GYRUS CINGULI; hippocampal formation (see HIPPOCAMPUS); HYPOTHALAMUS; PARAHIPPOCAMPAL GYRUS; SEPTAL NUCLEI; anterior nuclear group of thalamus, and portions of the basal ganglia. (Parent, Carpenter's Human Neuroanatomy, 9th ed, p744; NeuroNames, http://rprcsgi.rprc.washington.edu/neuronames/index.html (September 2, 1998)).

In vivo intracellular analysis of granule cell axon reorganization in epileptic rats. (1/1468)

In vivo intracellular recording and labeling in kainate-induced epileptic rats was used to address questions about granule cell axon reorganization in temporal lobe epilepsy. Individually labeled granule cells were reconstructed three dimensionally and in their entirety. Compared with controls, granule cells in epileptic rats had longer average axon length per cell; the difference was significant in all strata of the dentate gyrus including the hilus. In epileptic rats, at least one-third of the granule cells extended an aberrant axon collateral into the molecular layer. Axon projections into the molecular layer had an average summed length of 1 mm per cell and spanned 600 microm of the septotemporal axis of the hippocampus-a distance within the normal span of granule cell axon collaterals. These findings in vivo confirm results from previous in vitro studies. Surprisingly, 12% of the granule cells in epileptic rats, and none in controls, extended a basal dendrite into the hilus, providing another route for recurrent excitation. Consistent with recurrent excitation, many granule cells (56%) in epileptic rats displayed a long-latency depolarization superimposed on a normal inhibitory postsynaptic potential. These findings demonstrate changes, occurring at the single-cell level after an epileptogenic hippocampal injury, that could result in novel, local, recurrent circuits.  (+info)

Preferential Zn2+ influx through Ca2+-permeable AMPA/kainate channels triggers prolonged mitochondrial superoxide production. (2/1468)

Synaptically released Zn2+ can enter and cause injury to postsynaptic neurons. Microfluorimetric studies using the Zn2+-sensitive probe, Newport green, examined levels of [Zn2+]i attained in cultured cortical neurons on exposure to N-methyl-D-asparte, kainate, or high K+ (to activate voltage-sensitive Ca2+ channels) in the presence of 300 microM Zn2+. Indicating particularly high permeability through Ca2+-permeable alpha-amino3-hydroxy-5-methyl-4-isoxazolepropionic-acid/kainate (Ca-A/K) channels, micromolar [Zn2+]i rises were observed only after kainate exposures and only in neurons expressing these channels [Ca-A/K(+) neurons]. Further studies using the oxidation-sensitive dye, hydroethidine, revealed Zn2+-dependent reactive oxygen species (ROS) generation that paralleled the [Zn2+]i rises, with rapid oxidation observed only in the case of Zn2+ entry through Ca-A/K channels. Indicating a mitochondrial source of this ROS generation, hydroethidine oxidation was inhibited by the mitochondrial electron transport blocker, rotenone. Additional evidence for a direct interaction between Zn2+ and mitochondria was provided by the observation that the Zn2+ entry through Ca-A/K channels triggered rapid mitochondrial depolarization, as assessed by using the potential-sensitive dye tetramethylrhodamine ethylester. Whereas Ca2+ influx through Ca-A/K channels also triggers ROS production, the [Zn2+]i rises and subsequent ROS production are of more prolonged duration.  (+info)

Glutamate-, kainate- and NMDA-evoked membrane currents in identified glial cells in rat spinal cord slice. (3/1468)

The effect of L-glutamate, kainate and N-methyl-D-aspartate (NMDA) on membrane currents of astrocytes, oligodendrocytes and their respective precursors was studied in acute spinal cord slices of rats between the ages of postnatal days 5 and 13 using the whole-cell patch-clamp technique. L-glutamate (10(-3) M), kainate (10(-3) M), and NMDA (2x10(-3) M) evoked inward currents in all glial cells. Kainate evoked larger currents in precursors than in astrocytes and oligodendrocytes, while NMDA induced larger currents in astrocytes and oligodendrocytes than in precursors. Kainate-evoked currents were blocked by the AMPA/kainate receptor antagonist CNQX (10(-4) M) and were, with the exception of the precursors, larger in dorsal than in ventral horns, as were NMDA-evoked currents. Currents evoked by NMDA were unaffected by CNQX and, in contrast to those seen in neurones, were not sensitive to Mg2+. In addition, they significantly decreased during development and were present when synaptic transmission was blocked in a Ca2+-free solution. NMDA-evoked currents were not abolished during the block of K+ inward currents in glial cells by Ba2+; thus they are unlikely to be mediated by an increase in extracellular K+ during neuronal activity. We provide evidence that spinal cord glial cells are sensitive to the application of L-glutamate, kainate and transiently, during postnatal development, to NMDA.  (+info)

The distribution of neurons expressing calcium-permeable AMPA receptors in the superficial laminae of the spinal cord dorsal horn. (4/1468)

The superficial dorsal horn is a major site of termination of nociceptive primary afferents. Fast excitatory synaptic transmission in this region is mediated mainly by release of glutamate onto postsynaptic AMPA and NMDA receptors. NMDA receptors are known to be Ca2+-permeable and to provide synaptically localized Ca2+ signals that mediate short-term and long-term changes in synaptic strength. Less well known is a subpopulation of AMPA receptors that is Ca2+-permeable and has been shown to be synaptically localized on dorsal horn neurons in culture (Gu et al., 1996) and expressed by dorsal horn neurons in situ (Nagy et al., 1994; Engelman et al., 1997). We used kainate-induced cobalt uptake as a functional marker of neurons expressing Ca2+-permeable AMPA receptors and combined this with markers of nociceptive primary afferents in the postnatal rat dorsal horn. We have shown that cobalt-positive neurons are located in lamina I and outer lamina II, a region strongly innervated by nociceptors. These cobalt-positive neurons colocalize with afferents labeled by LD2, and with the most dorsal region of capsaicin-sensitive and IB4- and LA4-positive afferents. In contrast, inner lamina II has a sparser distribution of cobalt-positive neurons. Some lamina I neurons expressing the NK1 receptor, the receptor for substance P, are also cobalt positive. These neurons are likely to be projection neurons in the nociceptive pathway. On the basis of all of these observations, we propose that Ca2+-permeable AMPA receptors are localized to mediate transmission of nociceptive information.  (+info)

Lateral hypothalamic NMDA receptor subunits NR2A and/or NR2B mediate eating: immunochemical/behavioral evidence. (5/1468)

Cells within the lateral hypothalamic area (LHA) are important in eating control. Glutamate or its analogs, kainic acid (KA) and N-methyl-D-aspartate (NMDA), elicit intense eating when microinjected there, and, conversely, LHA-administered NMDA receptor antagonists suppress deprivation- and NMDA-elicited eating. The subunit composition of LHA NMDA receptors (NMDA-Rs) mediating feeding, however, has not yet been determined. Identifying this is important, because distinct second messengers/modulators may be activated by NMDA-Rs with differing compositions. To begin to address this, we detected LHA NR2A and NR2B subunits by immunoblotting and NR2B subunits by immunohistochemistry using subunit-specific antibodies. To help determine whether NMDA-Rs mediating feeding might contain these subunits, we conducted behavioral studies using LHA-administered ifenprodil, an antagonist selective for NR2A- and/or NR2B-containing NMDA-Rs at the doses we used (0.001-100 nmol). Ifenprodil maximally suppressed NMDA- and deprivation-elicited feeding by 63 and 39%, respectively, but failed to suppress KA-elicited eating, suggesting its actions were behaviorally specific. Collectively, these results suggest that LHA NMDA-Rs, some of which contribute to feeding control, are composed of NR2A and/or NR2B subunits, and implicate NR2A- and/or NR2B-linked signal transduction in feeding behavior.  (+info)

Subtype-specific effects of lithium on glutamate receptor function. (6/1468)

We report that substitution of sodium with lithium (Li+) in the extracellular solution causes subtype-specific changes in the inward and outward currents of glutamate receptors (GluRs), without a shift in reversal potential. Li+ produces an increase of inward and outward currents of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate receptors and decreases in the currents of kainate (KA) and N-methyl-D-aspartate receptors. The greatest effect of Li+ was observed with GluR3. A concentration-response curve for GluR3 reveals that the potentiation caused by Li+ is greatest at saturating agonist concentrations. GluR1, which shows no potentiation by Li+ at 100 microM KA, shows a small but significant potentiation at saturating KA and glutamate concentrations. The effects of Li+ on outward current, where Li+ is not the primary charge carrier, and the lack of reversal potential shift argue for a mechanism of potentiation not associated with Li+ permeation. This potentiation of current is specific for Li+ because rubidium, although causing an increase of inward current, shifted the reversal potential and did not increase outward current. The effects of Li+ are different for KA, a weak desensitizing agonist, and glutamate, a strong desensitizing agonist, suggesting that Li+ might interact with a mechanism of desensitization. By using cyclothiazide (CTZ) to reduce desensitization of GluR3, we find that for low concentrations of KA and glutamate potentiation of the response by a combination of CTZ and Li+ is no greater than by CTZ or Li+ alone. However, at high concentrations of agonist, the potentiation of the response by a combination of CTZ and Li+ is significantly greater than by CTZ or Li+ alone. This potentiation was additive for glutamate but not for KA. At high agonist concentration in the presence of CTZ, the intrinsically lower desensitization produced with KA-evoked responses may preclude Li+ from potentiating the current to the same degree as it can potentiate glutamate-evoked responses. The additive effects of CTZ and Li+ were unique to the flop variant of GluR3.  (+info)

Recurrent mossy fiber pathway in rat dentate gyrus: synaptic currents evoked in presence and absence of seizure-induced growth. (7/1468)

A common feature of temporal lobe epilepsy and of animal models of epilepsy is the growth of hippocampal mossy fibers into the dentate molecular layer, where at least some of them innervate granule cells. Because the mossy fibers are axons of granule cells, the recurrent mossy fiber pathway provides monosynaptic excitatory feedback to these neurons that could facilitate seizure discharge. We used the pilocarpine model of temporal lobe epilepsy to study the synaptic responses evoked by activating this pathway. Whole cell patch-clamp recording demonstrated that antidromic stimulation of the mossy fibers evoked an excitatory postsynaptic current (EPSC) in approximately 74% of granule cells from rats that had survived >10 wk after pilocarpine-induced status epilepticus. Recurrent mossy fiber growth was demonstrated with the Timm stain in all instances. In contrast, antidromic stimulation of the mossy fibers evoked an EPSC in only 5% of granule cells studied 4-6 days after status epilepticus, before recurrent mossy fiber growth became detectable. Notably, antidromic mossy fiber stimulation also evoked an EPSC in many granule cells from control rats. Clusters of mossy fiber-like Timm staining normally were present in the inner third of the dentate molecular layer at the level of the hippocampal formation from which slices were prepared, and several considerations suggested that the recorded EPSCs depended mainly on activation of recurrent mossy fibers rather than associational fibers. In both status epilepticus and control groups, the antidromically evoked EPSC was glutamatergic and involved the activation of both AMPA/kainate and N-methyl-D-aspartate (NMDA) receptors. EPSCs recorded in granule cells from rats with recurrent mossy fiber growth differed in three respects from those recorded in control granule cells: they were much more frequently evoked, a number of them were unusually large, and the NMDA component of the response was generally much more prominent. In contrast to the antidromically evoked EPSC, the EPSC evoked by stimulation of the perforant path appeared to be unaffected by a prior episode of status epilepticus. These results support the hypothesis that recurrent mossy fiber growth and synapse formation increases the excitatory drive to dentate granule cells and thus facilitates repetitive synchronous discharge. Activation of NMDA receptors in the recurrent pathway may contribute to seizure propagation under depolarizing conditions. Mossy fiber-granule cell synapses also are present in normal rats, where they may contribute to repetitive granule cell discharge in regions of the dentate gyrus where their numbers are significant.  (+info)

Role of the Botzinger complex in fastigial nucleus-mediated respiratory responses. (8/1468)

We have reported that the phrenic neurogram (PN) is modulated by stimulation of the fastigial nucleus (FN) of the cerebellum. The present study was undertaken to search for brainstem site(s) involved in the FN efferent pathway to modulate phrenic nerve activities. Experiments were performed on 35 anesthetized, paralyzed, and ventilated cats, using the PN as the index of the respiratory motor output. Results showed that bilateral electrolytic lesions of the red nucleus (RN), the paramedian reticular nucleus (PRN), or the pontine respiratory group (PRG) had little effect on the ability of FN stimulation to modulate the respiratory output. However, the modulation was abolished by bilateral electrolytic lesions of the Botzinger complex (BotC). Further studies showed that bilateral chemical inactivation of BotC neurons produced by topical microinjection of kainic acid or cobalt chloride failed to abolish the modulation. We concluded that fibers of passage, not synapses or cell bodies in the BotC, were involved in the modulatory effect of FN stimulation on the PN. The RN, PRN, and PRG appear not to be important in the neural circuitry responsible for the FN modulation of the phrenic activity.  (+info)

Matrix Metalloproteinase-7 Regulates Cleavage of Pro-Nerve Growth Factor and Is Neuroprotective following Kainic Acid-Induced...Matrix Metalloproteinase-7 Regulates Cleavage of Pro-Nerve Growth Factor and Is Neuroprotective following Kainic Acid-Induced...
Neurotrophins have long been recognized for their crucial roles in growth, differentiation, and survival in the developing nervous system. Recent findings demonstrating that the pro- form of NGF induces cell death via the p75NTR suggest that the consequences of neurotrophin signaling depend on many factors, in particular the balance between pro- and mature neurotrophins and the regulation of that balance, which may be altered in pathophysiological situations. Since p75NTR is upregulated in many types of neural injury and disease (Park et al., 2000; Troy et al., 2002; Harrington et al., 2004), the increased availability of a ligand that can stimulate apoptotic signaling through this receptor creates an environment in which these neurons are vulnerable. Thus, understanding neurotrophin processing is an important step toward understanding the pathway that a cell takes toward survival or death, especially in disease or after injury. We have detected increased proNGF levels in the CSF following ...
GABA benzodiazepine and histamine-H1 receptors in the guinea pig cerebellum: effects of kainic acid injections studied by...GABA benzodiazepine and histamine-H1 receptors in the guinea pig cerebellum: effects of kainic acid injections studied by...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Adiponectin protects hippocampal neurons against kainic acid-induced excitotoxicityAdiponectin protects hippocampal neurons against kainic acid-induced excitotoxicity
Neuronal damage after seizure is correlated with blood-brain barrier (BBB) leakage. Adiponectin (Ad) has shown protective effects on endothelial function. In this study, we investigated the effects of Ad on cell survival and BBB integrity in the mouse hippocampus after kainic acid (KA) treatment. Tw …
A nuclear microscopic study of elemental changes in the rat hippocampus after kainate-induced neuronal injury | ScholarBank@NUSA nuclear microscopic study of elemental changes in the rat hippocampus after kainate-induced neuronal injury | [email protected]
The effect of intracerebroventricular kainate injection on the elemental composition of the hippocampus was studied in adult Wistar rats, at 1 day and 1, 2, 3, and 4 weeks postinjection, using a nuclear microscope. An increase in calcium concentration was observed on the injected side from 1 day postinjection. The increase peaked at 3 weeks postinjection, reaching a concentration of 18 times normal. Large numbers of glial cells but no neurons were observed in the lesioned CA fields at this time, suggesting that an increased calcium level was present in glial cells. This was confirmed by high-resolution elemental maps of the lesioned areas, which showed very high intracellular calcium concentrations in almost all glial cells. It is possible that the high intracellular calcium level could activate calcium- dependent enzymes, including calpain II and cytosolic phospholipase A2, shown to be expressed in reactive glial cells after kainate injections. In addition to calcium, an increase in iron ...
DOMA Transforms Healthcare IT with Increased Security While Reducing Cost -- iCodeRx/iDocs/iCharts 6.0 Debuts at AHIMA National...DOMA Transforms Healthcare IT with Increased Security While Reducing Cost -- iCodeRx/iDocs/iCharts 6.0 Debuts at AHIMA National...
Health, ... DOMA Technologies has launched the latest version of its revolution...Virginia Beach VA (PRWEB) - DOMA Technologies (a href http://www.do...DOMA Technologies success comes from helping hospitals physician pr...The users of iCodeRx iDocs and iCharts drove the enhancements of v...,DOMA,Transforms,Healthcare,IT,with,Increased,Security,While,Reducing,Cost,--,iCodeRx/iDocs/iCharts,6.0,Debuts,at,AHIMA,National,Convention,medicine,medical news today,latest medical news,medical newsletters,current medical news,latest medicine news
Increase in Bcl-2 phosphorylation and reduced levels of BH3-only Bcl-2 family proteins in kainic acid-mediated neuronal death...Increase in Bcl-2 phosphorylation and reduced levels of BH3-only Bcl-2 family proteins in kainic acid-mediated neuronal death...
Korhonen, L., Belluardo, N., Mudo, G. and Lindholm, D. (2003), Increase in Bcl-2 phosphorylation and reduced levels of BH3-only Bcl-2 family proteins in kainic acid-mediated neuronal death in the rat brain. European Journal of Neuroscience, 18: 1121-1134. doi: 10.1046/j.1460-9568.2003.02826.x ...
Sequence Similarity - 1S50: X-ray structure of the GluR6 ligand binding core (S1S2A) in complex with glutamate at 1...Sequence Similarity - 1S50: X-ray structure of the GluR6 ligand binding core (S1S2A) in complex with glutamate at 1...
1S50: Crystal structures of the GluR5 and GluR6 ligand binding cores: Molecular mechanisms underlying kainate receptor selectivity
Fed appeals court strikes down DOMAFed appeals court strikes down DOMA
http://thinkprogress.org/justice/2012/10/18/1040901/breaking-federal-appeals-court-strikes-down-doma-in-opinion-by-republican-appointed-judge/?mobile=nc
Reumatoidná artritída. Môžem otehotnieť? - Zdravot... - str. 49Reumatoidná artritída. Môžem otehotnieť? - Zdravot... - str. 49
vies, co si myslim? ak mas doma test, tak skus, ak nemas, kasli na to, naschval ist kupovat, podla mna zbytocne vyhodenie eur, chod radsej rovno k lekarovi a budes mat istotu, uz neznies tak hystericky, to je dobre, no a tak trosku ti aj zavidim, aby si ma pochopila, ja planujem vsetko, zahnam infosky, ale mozno by bolo lepsie, keby som sa k mimi dostala hopom, lebo vela rozumu mam pocit tiez ...
1.5KA18 datasheet PDF1.5KA18 datasheet PDF
Vishay 1.5KA18 datasheet, Transient Voltage Suppressors (1-page), 1.5KA18 datasheet, 1.5KA18 pdf, 1.5KA18 datasheet pdf, 1.5KA18 pinouts
Marine Drugs | Free Full-Text | Differential Effects of Domoic Acid and E. coli Lipopolysaccharide on Tumor Necrosis Factor-α,...Marine Drugs | Free Full-Text | Differential Effects of Domoic Acid and E. coli Lipopolysaccharide on Tumor Necrosis Factor-α,...
The excitatory amino acid domoic acid is the causative agent of amnesic shellfish poisoning in humans. The in vitro effects of domoic acid on rat neonatal brain microglia were compared with E. coli lipopolysaccharide (LPS), a known activator of microglia mediator release over a 4 to 24 hour observation period. LPS [3 ng/mL] but not domoic acid [1mM] stimulated a statistically significant increase in TNF-α mRNA and protein generation. Furthermore, both LPS and domoic acid did not significantly affect TGF- β1 gene expression and protein release. Finally, an in vitro exposure of microglia to LPS resulted in statistically significant MMP-9 expression and release, thus extending and confirming our previous observations. However, in contrast, no statistically significant increase in MMP-9 expression and release was observed after domoic acid treatment. Taken together our observations do not support the hypothesis that a short term (4 to 24 hours) in vitro exposure to domoic acid, at a concentration toxic to
Marine Drugs | Free Full-Text | Domoic Acid Epileptic Disease | HTMLMarine Drugs | Free Full-Text | Domoic Acid Epileptic Disease | HTML
Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of
Dehydroepiandrosterone (DHEA) and DHEA-sulfate (DHEAS) protect hippocampal neurons against excitatory amino acid-induced...Dehydroepiandrosterone (DHEA) and DHEA-sulfate (DHEAS) protect hippocampal neurons against excitatory amino acid-induced...
DHEA, together with DHEAS, is the most abundant steroid in the blood of young adult humans. Levels in humans decline with age and during certain types of illness or stress. We have found that DHEA(S) can prevent or reduce the neurotoxic actions in the hippocampus of the glutamate agonists N-methyl-d-aspartic acid (NMDA) both in vitro and in vivo or α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and kainic acid in vitro. Pre-treatment with DHEA (10-100 nM for 6-8 h) protected primary hippocampal cultures from embryonic day 18 (E18) embryos against NMDA-induced toxicity (0.1, 1, 10, and 50 mM). DHEA added either with NMDA (1 mM) or 1 h later had lesser, but still significant, protective actions. DHEAS also reduced NMDA-induced toxicity (1 mM), although the lowest effective dose of DHEAS (100 nM) was higher than that of DHEA (10 nM). DHEA (100 nM) protected cultured neurons against the neurotoxic actions of either AMPA (25 μM) or kainic acid (1 mM) as well. In vivo, s.c. pellets of ...
Kainic acid receptor sites in the cerebellum of nervous, purkinje cell by C A. Griesser, M Cuenod et al."Kainic acid receptor sites in the cerebellum of nervous, purkinje cell" by C A. Griesser, M Cuenod et al.
Griesser, C A.; Cuenod, M; and Henke, H, "Kainic acid receptor sites in the cerebellum of nervous, purkinje cell degeneration, reeler, staggerer and weaver mouse mutant strains." (1982). Subject Strain Bibliography 1982. 4154 ...
Plus itPlus it
EEG and video recording was performed during a 3 month experimental period, animals were put into a Plexiglas cage, and a microconnector was plugged to the EEG recording system via cables with swivel junctions (SL6C; Plastics One). EEG and video recordings (EMKA Technologies) were started after an adaptation period of 30 min. The EEG signals were amplified, filtered between 0.3 and 500 Hz, and digitized at 1000 samples/s. The duration of the recordings was 12 h each day. Animals had access to food and water ad libitum during the experiments.. On the day before the kainic acid injection, the baseline EEG was recorded for 12 h. On the morning of the first day thereafter, the animals were given a single intra-amygdaloid injection of kainic acid (750 ng) (Ben-Ari et al., 1980; Berger et al., 1986) during the period of EEG and video recording. An infusion cannula (C315I; Plastics One) with a polyethylene tube extension (PE 20) was put into the guide cannula and fixed by a captive collar of the ...
Nefiracetam - On NootropicsNefiracetam - On Nootropics
Kitano Y, Komiyama C, Makino M, Takasuna K, Satoh H, Aoki T, Kinoshita M, Takazawa A, Yamauchi T, Sakurada S. Anticonvulsant and neuroprotective effects of the novel nootropic agent nefiracetam on kainic acid-induced seizures in rats. New Product Research Laboratories II, Daiichi Pharmaceutical Co., Ltd., 1-16-13 Kita-Kasai, Edogawa-ku, Tokyo 134-8630, Japan. [email protected] [1]. Moriguchi S, Shioda N, Han F, Narahashi T, Fukunaga K. CaM kinase II and protein kinase C activations mediate enhancement of long-term potentiation by nefiracetam in the rat hippocampal CA1 region. Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Japan. [email protected] [2]. Robinson RG, Jorge RE, Clarence-Smith K. Double-blind randomized treatment of poststroke depression using nefiracetam. Department of Psychiatry, The University of Iowa, 200 Hawkins Dr., Iowa City, IA 52242, USA. [email protected] [3]. Kitano Y, Komiyama C, Makino M, ...
radu - On Nootropicsradu - On Nootropics
Kitano Y, Komiyama C, Makino M, Takasuna K, Satoh H, Aoki T, Kinoshita M, Takazawa A, Yamauchi T, Sakurada S. Anticonvulsant and neuroprotective effects of the novel nootropic agent nefiracetam on kainic acid-induced seizures in rats. New Product Research Laboratories II, Daiichi Pharmaceutical Co., Ltd., 1-16-13 Kita-Kasai, Edogawa-ku, Tokyo 134-8630, Japan. [email protected] [1]. Moriguchi S, Shioda N, Han F, Narahashi T, Fukunaga K. CaM kinase II and protein kinase C activations mediate enhancement of long-term potentiation by nefiracetam in the rat hippocampal CA1 region. Department of Pharmacology, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Japan. [email protected] [2]. Robinson RG, Jorge RE, Clarence-Smith K. Double-blind randomized treatment of poststroke depression using nefiracetam. Department of Psychiatry, The University of Iowa, 200 Hawkins Dr., Iowa City, IA 52242, USA. [email protected] [3]. Kitano Y, Komiyama C, Makino M, ...
Microglia and Alzheimer DiseaseMicroglia and Alzheimer Disease
Armstrong RA, Winsper SJ, Blair JA (1995) Hypothesis: is Alzheimers disease a metal_induced immune disorder? Neurodegeneration 4:107_111 Bennett SA, Stevenson B, Staines WA, Roberts DC (1995) Periodic acid_Schiff (PAS)_positive deposits in brain following kainic acid_induced seizures: relationships to fos induction, neuronal necrosis, reactive gliosis, and blood_brain barrier breakdown. Acta Neuropathol Berl 89:126_138 Cras P, Smith MA, Richey PL, Siedlak SL, Mulvihill P, Perry G (1995) Extracellular neurofibrillary tangles reflect neuronal loss and provide further evidence of extensive protein cross_linking in Alzheimer disease. Acta Neuropathol Berl 89:291_295 Das S, Potter H (1995) Expression of the Alzheimer amyloid_promoting factor antichymotrypsin is induced in human astrocytes by IL_1. Neuron 14:447_456 De Simone R, Giampaolo A, Giometto B, Gallo P, Levi G, Peschle C, Aloisi F (1995) The costimulatory molecule B7 is expressed on human microglia in culture and in multiple sclerosis acute ...
Kainic Acid | Profiles RNSKainic Acid | Profiles RNS
2S-(2 alpha,3 beta,4 beta))-2-Carboxy-4-(1-methylethenyl)-3-pyrrolidineacetic acid. Ascaricide obtained from the red alga Digenea simplex. It is a potent excitatory amino acid agonist at some types of excitatory amino acid receptors and has been used to discriminate among receptor types. Like many excitatory amino acid agonists it can cause neurotoxicity and has been used experimentally for that purpose ...
Dexamethasone attenuates kainate-induced AP-1 activation in rat brain<...Dexamethasone attenuates kainate-induced AP-1 activation in rat brain<...
TY - JOUR. T1 - Dexamethasone attenuates kainate-induced AP-1 activation in rat brain. AU - Unlap, Tino. AU - Jope, Richard S.. PY - 1994/7. Y1 - 1994/7. N2 - The goal of this investigation was to determine if administration of the synthetic glucocorticoid dexamethasone modulates rat brain AP-1 DNA binding activity. Treatment with the selective excitatory amino acid agonist kainate was used to activate AP-1 formation. Kainate (12 mg/kg) administration induced a biphasic activation of AP-1 in rat cerebral cortex and hippocampus with maximal levels observed at 1.5 h and 4.5 h and lower levels at 3 h and 6 h. Kainate also induced biphasic increases in the concentrations of some of the AP-1 constituent proteins (immediate early gene protein products), with initial increases of c-Jun, Fos, and Jun B occurring at 1.5 h and secondary larger increases at 4.5 h, but the level of Jun D was not altered by kainate treatment. Pretreatment with dexamethasone (1 mg/kg) reduced AP-1 activity at both 1.5 h and ...
New: Sunday, January 07 2018: New Press ReleasesNew: Sunday, January 07 2018: New Press Releases
Effects of kainic acid on nuncio RNA levels of IL-1 beta, IL-6, TNF alpha and LIF in the rat brain. BPMN is largely hand-me-down in compensation the manifest modeling of occupation processes and it is well suited on the side of integration tasks performed not later than a computer system. Do that t(Added: Sun Jan 07 2018 ...
seГ±orita beeg desnuda - tchonglife.fr - Les ArmaniacsseГ±orita beeg desnuda - tchonglife.fr - Les Armaniacs
On the other hand, Jnk1 (-/-) null mice did not shown any changes in AKT action in the hippocampus and probably could make plain why shrinkage of Jnk1 or Jnk2 did not fair any effects against KA treatment (Brecht et al. The counter acting unsusceptible responses (Th1/Th2) in leishmaniasis mull over a complex immunological scenario, suggesting that additional regulatory molecules may be distinguished players in the disease pathogenesis, which may allow for Th17 responses. Functional message of sequence polymorphisms in the adman of myeloid differentiation-2 promethazine 25mg with visa allergy nasal drip. A bantam learn about reported on 22 patients with ESS, of whom 31 % (4/13) of patients receiving adjuvant progestins recurred, compared with 67 % (6/9) recurrence in patients who did not meet with hormonal therapy [36]. This book may contain some secret nuggets of thought and to be sure for the capable and informed, but we are most reassuring that it may inspire hip ambitions and rosy careers ...
Hochschulschriften Innsbruck / Sprouty2/4 deficiency reduces neurodegeneration and stimulates...Hochschulschriften Innsbruck / Sprouty2/4 deficiency reduces neurodegeneration and stimulates...
Hochschulschriften Innsbruck. Sprouty2/4 deficiency reduces neurodegeneration and stimulates astrocytosis induced by kainic acid in the dorsal hippocampus / Sitthisak Thongrong. 2014
RCSB PDB for 1S9TRCSB PDB for 1S9T
1S9T: Crystal structures of the GluR5 and GluR6 ligand binding cores: molecular mechanisms underlying kainate receptor selectivity.
Davidu se je po pogajanjih vendarle uresničila želja, postal bo Ceca - Domači trači - Govori.seDavidu se je po 'pogajanjih' vendarle uresničila želja, postal bo Ceca - Domači trači - Govori.se
Tudi osma oddaja nepozabnih preobrazb je prinesla vrsto presenečenj ter seveda novega zmagovalca. To je postal Matic Supovec, ki je s svojo odlično interpretacijo…
Ako odstrániť papilómy a bradavice doma | Liečba HPVAko odstrániť papilómy a bradavice doma | Liečba HPV
Papilloma je nádor benígnej povahy, farba sa nelíši od tónu ľudskej pokožky. Jeho veľkosť môže dosiahnuť 0,2 - 10 milimetrov. Všetky jej papilómy sú...
Varovanje oseb - Proline VarovanjeVarovanje oseb - Proline Varovanje
Osnovna naloga in cilj varnostnika telesnega stražarja je, da prepreči napad in druge oblike ogrožanja varovane osebe. Varnostniki svoje delo opravljajo v civilni obleki in so lahko tudi oboroženi z osebno oborožitvijo.. Zaposleni v našem podjetju, skupaj z zunanjimi sodelavci, imamo bogate izkušnje pri varovanju varovanih oseb in objektov. Večino teh izkušenj smo si pridobili z sodelovanjem pri načrtovanju, vodenju in izvajanju varovanj domačih in tujih varovanih oseb z najvišjo stopnjo tveganja, katere smo si posamezniki v podjetju pridobili med opravljanjem dela varovanja.. Pred samim varovanjem se opravi operativni sestanek z naročnikom, kjer se pridobijo in razčlenijo vse informacije, ki so potrebne za izvedbo varovanja in se določi stopnja ogroženosti varovane osebe. Na tej podlagi se aktivirajo vse varnostne aktivnosti.. V primeru, da Želite več informacij, kliknite tukaj. ...
Napovedniki predavanj, seminarjev in srečanj in the year 2012Napovedniki predavanj, seminarjev in srečanj in the year 2012
17. 5. 2012 , Mathematical physics seminar Enej Ilievski: Thermodynamic bounds on Drude weights in terms of almost-conserved quantities Enej Ilievski Fakulteta za matematiko in fiziko, Oddelek za fiziko, UL Predavanje bo v torek 22.5.2012, ob 16:15 v predavalnici 3.07 na Jadranski 21. Petnajst minut pred predavanjem vabljeni na klepet ob čaju. Več informacij na domači strani seminarja: http://www.fmf.uni-lj.si/mafisem ...
Addgene: KA2944 pPB-TREtight-Esrrb-FLAG-InO SequencesAddgene: KA2944 pPB-TREtight-Esrrb-FLAG-InO Sequences
Addgene NGS Result AATGCGCCGCTACAGGGCGCGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGC GGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCC AGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAA TTGGGTACCTTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCT CTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAG GCGTGCTTGTCAATGAGGTAAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCAT GATTATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTTA CGTGATAACTTATTATATATATATTTTCTTGTTATAGATATCATAATTTAAACAAGCAAAACCAAATTAA GGGCCAGCTCATTCCTCCCACTCATGATCTATAGATCTGGATCCGTCGAGTTTACTCCCTATCAGTGATA GAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGATGTCGAGTTTACTCCCTATCAGTGAT AGAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGTG ATAGAGAACGTATGTCGAGTTTATCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGT GATAGAGAACGTATGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAAC ...
Pseudo-nitzschia Peragallo (Bacillariophyceae) diversity and domoic acid accumulation in tuberculate cockles and sweet clams in...Pseudo-nitzschia Peragallo (Bacillariophyceae) diversity and domoic acid accumulation in tuberculate cockles and sweet clams in...
The diversity of Pseudo-nitzschia (Bacillariophyceae) and accumulation of the neurotoxin domoic acid (DA) in two types of shellfish; tuberculate cockles (Acanthocardia tuberculata) and sweet clams (Challista chione) was explored in Mdiq Bay,Morocco during 2007. The highest abundances of Pseudo-nitzschia were found during the period from March to October, with peaks occurring in May and September. Toxin analysis showed an accumulation of domoic acid in shellfish sampled during spring and autumn. The maximum toxin concentration was 4.9 mg DAg-1 of the whole tissue recorded in sweet clam during spring. Using transmission electron microscopy, thirteen Pseudo-nitzschia species were identified, eight of which are known as producers of domoic acid: P. multistriata, P. cuspidata, P. galaxiae, P. multiseries, P. pseudodelicatissima, P. pungens var. aveirensis, P. calliantha and P. fraudulenta. The five non- toxic species observed were P. subpacifica, P. arenysensis, P. dolorosa, P. subfraudulenta, and ...
Variable distributions of Ca(2+)-permeable and Ca(2+)-impermeable AMPA receptors on embryonic rat dorsal horn neurons. |...Variable distributions of Ca(2+)-permeable and Ca(2+)-impermeable AMPA receptors on embryonic rat dorsal horn neurons. |...
1. By measuring the apparent reversal potential (aErev) of kainate- and alpha-amino-3-hydroxyl-5-methyl-4-isoxazole propionic acid (AMPA)-evoked currents associated with changes in extracellular Ca2+ concentration ([Ca2+]e), we have been able to identify embryonic dorsal horn neurons grown in tissue culture that express Ca(2+)-permeable non-N-methyl-D-aspartic acid (NMDA) receptors. 2. The relative expression of Ca(2+)-permeable and Ca(2+)-impermeable non-NMDA receptors varies from cell to cell. This was evident from the range of a ErevS observed for kainate-evoked currents in a 0 mM [Na+]e, 10 mM [Ca2+]e bath. Under these conditions, aErev ranged from -96 to -21 mV, suggesting that the percentage of the non-NMDA receptors on each neuron that are Ca(2+)-permeable is variable. 3. To determine the extent to which the variability in aErev is due to variable receptor expression rather than experimental variability, we compared the effects of changes in [Ca2+]e on kainate-evoked currents and ...
Differential regulation of adult and embryonic glutamate decarboxylases in rat dentate granule cells after kainate-induced...Differential regulation of adult and embryonic glutamate decarboxylases in rat dentate granule cells after kainate-induced...
In adult brain, the inhibitory GABAergic neurons utilize two distinct molecular forms of the GABA-synthesizing enzyme glutamate decarboxylase (GAD), GAD65 and GAD67. During embryonic development, two truncated forms of GAD67 are also expressed (GAD25 and GAD44), which are translated from two embryonic-specific splice variants of GAD67 messenger RNA. It has recently been established that the excitatory dentate granule cells, in addition to the neurotransmitter glutamate, also contain low levels of GABA and GAD67, which are increased after limbic seizures. To study the seizure-induced activation of glutamate decarboxylase, we investigated the expression of both embryonic and adult glutamate decarboxylase messenger RNAs in the adult rat hippocampus after kainic acid administration by semi-quantitative reverse transcription-coupled polymerase chain reaction, in situ hybridization and immunoblotting. We observed a rapid induction of the embryonic glutamate decarboxylase messenger RNA in the granule cells of
João O. Malva - Neurosciences - FBNJoão O. Malva - Neurosciences - FBN
We show that in the acute phase of kainate-induced epilepsy, in rats, the transient loss of NPY Y2 receptor-mediated inhibition of glutamate release can contribute to increase hyperexcitability of the hippocampal tissue and account for the generation of seizures. Moreover, in the chronic phase of kainate-induced epilepsy the increased expression of NPY and increased levels of Y2 receptors may act together to control neuronal hyperexcitability by triggering a tonic-like inhibition of glutamate release by involving increased NPY release and activation of NPY Y2 receptors ...
EUK-134, a synthetic superoxide dismutase and catalase mimetic, prevents oxidative stress and attenuates kainate-induced...EUK-134, a synthetic superoxide dismutase and catalase mimetic, prevents oxidative stress and attenuates kainate-induced...
These results indicate that pretreatment of rats with the synthetic catalytic scavenger of ROS, EUK-134, prevents oxidative stress and produces a significant degree of protection against the pathological manifestations of KA-induced seizure activity in hippocampus and piriform cortex. Although numerous studies have suggested that ROS are critically involved in excitotoxicity (see refs. 5, 30, and 31 for reviews), very few studies have demonstrated convincingly, in an in vivo excitotoxic model, a causal relationship between increased production of ROS and neuronal damage (7, 32). A clear demonstration of the crucial role of ROS in excitotoxicity should include: (i) evidence for increased production of ROS specifically in neuronal populations at risk with excitotoxicity before overt signs of neuronal damage and (ii) evidence that manipulations aimed at preventing ROS accumulation reduce neuronal damage without interfering with excitatory amino acid receptor functions. The former has been difficult ...
Selective stimulation of excitatory amino acid receptor subtypes and the survival of cerebellar granule cells in culture:...Selective stimulation of excitatory amino acid receptor subtypes and the survival of cerebellar granule cells in culture:...
Selective stimulation of excitatory amino acid receptor subtypes and the survival of cerebellar granule cells in culture: effect of kainic acid. ...
Swanson, Geoffrey, PhD | NUINSwanson, Geoffrey, PhD | NUIN
In this project we will elucidate the essential features of kainate receptor intracellular trafficking and biosynthesis. These processes are poorly understood, as is their importance to selective synaptic targeting and activity-dependent modulation of neuronal kainate receptors. Ample evidence exists for selective targeting of kainate receptors in neurons; these receptors are localized to a subset of pre- and postsynaptic sites in the mammalian brain, where they play several roles in excitatory and inhibitory neurotransmission. For example, in hippocampal CA3 pyramidal neurons kainate receptors are expressed postsynaptically apposed to mossy fiber terminals but to not either associational/commissural or perforant path excitatory inputs. Conversely, presynaptic kainate receptors are found in mossy fiber axons and terminals but not at postsynaptic sites in granule cell dendrites in the stratum moleculare. These observations strongly suggest that cellular mechanisms exist to selectively target ...
Excitotoxicity - WikipediaExcitotoxicity - Wikipedia
Excitotoxicity is the pathological process by which nerve cells are damaged or killed by excessive stimulation by neurotransmitters such as glutamate and similar substances. This occurs when receptors for the excitatory neurotransmitter glutamate (glutamate receptors) such as the NMDA receptor and AMPA receptor are overactivated by glutamatergic storm. Excitotoxins like NMDA and kainic acid which bind to these receptors, as well as pathologically high levels of glutamate, can cause excitotoxicity by allowing high levels of calcium ions (Ca2+) to enter the cell. Ca2+ influx into cells activates a number of enzymes, including phospholipases, endonucleases, and proteases such as calpain. These enzymes go on to damage cell structures such as components of the cytoskeleton, membrane, and DNA. Excitotoxicity may be involved in spinal cord injury, stroke, traumatic brain injury, hearing loss (through noise overexposure or ototoxicity), and in neurodegenerative diseases of the central nervous system ...
Kainate receptor structure and function: Geoffrey Swanson Lab: Feinberg School of Medicine: Northwestern UniversityKainate receptor structure and function: Geoffrey Swanson Lab: Feinberg School of Medicine: Northwestern University
We are interested in understanding how kainate receptors, a family of ionotropic glutamate receptors in the mammalian CNS, operate at a molecular and biophysical level. Kainate receptors are modulatory proteins that help to balance excitatory and inhibitory tone through diverse actions at pre- and postsynaptic sites. They also have been shown to be promising drug targets in several pathologies (particularly epilepsy and chronic pain). A current project focuses on how an associated family of auxiliary proteins, known as Neto-1 and Neto-2, shape kainate receptor function. We would like to identify which domains in both the receptor subunits and auxiliary proteins are key for allosteric modulation by Neto proteins ...
Chào mừng đến với M88bet / Đăng ký thành viên M88Bet / M88 Diễn đàn thành viên M88betChào mừng đến với M88bet / Đăng ký thành viên M88Bet / M88 Diễn đàn thành viên M88bet
Such observations reinforced the prospect that the biological events underlying chemi- cally induced toxicity are complex and that the encapsulate concentrations of covalently bound adducts in macromolecules is not the solitary determinant of toxicity per se. A swatting following kainate-induced seizures showed that the cyclin D1 mRNA was induced in the vulnerable CA3 part, and to a lesser extent, in non-vulnerable regions, while that the expression of CDK4 and cyclin D1 was upregu- lated in neurons of the rat piriform cortex and amygdala 1В-3 days after KA administra- tion in vivo. Who Is Agonistic by Fibromyalgia toradol 10 mg on-line pain medication for dogs aleve. The thin film of a childish stripling may let someone have the visualization of cursory venous circulation across the abdomen. Perhaps a couple of centuries later, the grey Hebrews displayed presumptuousness with this pursuit: in the Out-moded Testament, the perpetually tormented Responsibility cries prohibited The arrows of the ...
Chào mừng đến với M88bet / Đăng ký thành viên M88Bet / M88 Diễn đàn thành viên M88betChào mừng đến với M88bet / Đăng ký thành viên M88Bet / M88 Diễn đàn thành viên M88bet
Such observations reinforced the prospect that the biological events underlying chemi- cally induced toxicity are complex and that the encapsulate concentrations of covalently bound adducts in macromolecules is not the solitary determinant of toxicity per se. A swatting following kainate-induced seizures showed that the cyclin D1 mRNA was induced in the vulnerable CA3 part, and to a lesser extent, in non-vulnerable regions, while that the expression of CDK4 and cyclin D1 was upregu- lated in neurons of the rat piriform cortex and amygdala 1В-3 days after KA administra- tion in vivo. Who Is Agonistic by Fibromyalgia toradol 10 mg on-line pain medication for dogs aleve. The thin film of a childish stripling may let someone have the visualization of cursory venous circulation across the abdomen. Perhaps a couple of centuries later, the grey Hebrews displayed presumptuousness with this pursuit: in the Out-moded Testament, the perpetually tormented Responsibility cries prohibited The arrows of the ...
Cortical kainate receptors and behavioral anxiety | Molecular Brain | Full TextCortical kainate receptors and behavioral anxiety | Molecular Brain | Full Text
Genetic studies in humans have suggested that certain types of KA subtype receptors may be linked to behavioral anxiety or depression [47]. Due to the limitation of selective compounds that inhibit or activate selective subtypes of KA receptors, basic mechanisms of how KA receptors contribute to these mood disorders remain unclear. The generation of gene knockout mice help us at a certain level for the potential functions of KA receptors. For example, in GluK2 KO mice, behavior fear is reduced along with the reduction of LTP in the amygdala induced by theta-burst stimulation (TBS) [33]. In GluK4 KO mice, reduce anxiety has also been reported [48]; and in mice with overexpression of GluK4 in the forebrain, behavioral anxiety is enhanced [49]. However, due to complexed effects of KA receptors at excitatory and inhibitory synapses; as well as presynaptic vs postsynaptic locations, it is difficult to determine the functions of selective subtypes of KA receptors even within the same central region. ...
5 topics5 topics
History and purpose: A fresh class of heterotricyclic glutamate analogues lately was generated by incorporating structural components of two excitotoxic marine compounds, kainic acid and neodysiherbaine A. decreased excitatory synaptic transmitting in neuronal civilizations, and IKM-159 inhibited synaptic currents from CA1 pyramidal neurons in hippocampal pieces. IKM-159 inhibited glutamate-evoked whole-cell currents from recombinant GluA2- and GluA4-formulated with -amino-3-hydroxyl-5-methyl-4-isoxazole-propionate (AMPA) receptors…. ...
While White House holds secret gay outreach call, while Gibbs suggests White House still stands by anti-gay DOMA brief that...While White House holds secret gay outreach call, while Gibbs suggests White House still stands by anti-gay DOMA brief that...
The reporter asks some good questions. Isnt it time that someone in the administration publicly apologized and explained what the hell happened that this brief was permitted to be filed? Im surprised that none of our organizations, or our allies in Congress, seem very interested in getting some basic answers to some obvious questions:. 1. How high up in Justice and the White House was this brief cleared? Who was the highest political appointee in Justice to see the brief, or be informed of the brief, before it was filed, and who was the highest political appointee in the White House?. 2. Is it true that the Obama administration actually used a rehashed version, with some deletions, of an earlier Bush administration brief on DOMA?. 3. Is the White House going to defend DOMA again in the upcoming brief due in only 7 days? Will the White House let DOJ reiterate the pedophilia and incest comparison? Will the White House have DOJ remove any of the other offensive language from the brief, such as ...
Molekulsko kloniranje - WikipediaMolekulsko kloniranje - Wikipedia
Molekulsko kloniranje je skup eksperimentalnih metoda molekularne biologije koji ise koriste za formiranje molekula rekombinantne DNK i za usmeravanje njene replikacije unutar organizma domaćina.[1] Reč kloniranje se koristi jer metod vrši replikaciju jednog molekula DNK počevši od jedne ćelije i generiše veliku popolaciju ćelija koje sadrže identične DNK molekule. Molekularno kloniranje generalno koristi DNK sekvence dva različita organizma: vrste koja je izvor DNK koja se klonira i vrste koja služi kao živi domaćin za replikaciju rekombinantne DNK. Metodi molekularnog kloniranja su centralni za mnoge savremene oblasti biologije i medicine.[2] U konvencionalnom eksperimentu molekulskog kloniranja, DNK koja se klonira se dobija iz željenog organizma, i zatim se tretira sa enzimima u epruveti da bi se formirali manji fragmenti. Naknadno se ti fragmenti kombinuju sa DNK vektorom da bi se formirali rekombinantni DNK molekuli. Oni se zatim uvode u organizam domaćina (tipično u ...
Another Federal Judge Rules DOMA Unconstitutional - The AtlanticAnother Federal Judge Rules DOMA Unconstitutional - The Atlantic
The Defense of Marriage Act took another hit on Wednesday when a New York federal judge ruled it unconstitutional, this time because it interferes with the states' right to regulate marriage.
Kdy v m va e ko ka nebo pes schv ln ni byt, je asi ve stresu - iDNES.czKdy v m va e ko ka nebo pes schv ln ni byt, je asi ve stresu - iDNES.cz
Kdy doma najdete lou i ku i rozkousanou pantofli, neznamen to, e v s ty noh p tel nem r d. M e to b t zn mka toho, e se zkr tka nec t dob e. Existuje st le v ce p pad , kdy psychick tr pen zv at zp sobuje lov k sv m hektick m zp sobem ivota.
Mobilni aparati proizvajalca Huawei @ Slo-TechMobilni aparati proizvajalca Huawei @ Slo-Tech
Jaz sem jo zasral? Pa dej pober se, ti povem še enkrat. Prbasal si se z trapastim žaljivim komentarjem s katerim si se obrukal, da se bolj nisi mogel. A si ti ta telefon dejansko kdaj videl v živo. Odprtega karkoli, daj ne seri. Ne, da bi se hvalil ampak imam telefon doma. Sklepanje pa je bilo čisto na mestu in ni bilo potrebe po nekem žaljivem komentarju, ki te je postavil na nivo, za katerega sem ti že enkrat povedal. Tako, da pssst in ne brukaj se več. S tabo se sploh ne mislim več ukvarjat, ker nisi vreden mojega časa ...
Laughter by Stephen..."Laughter" by Stephen...
But, in spite of everything she had been taught, something had stirred in her soul when she witnessed the sacking of Maranda - so many civilian lives lost, and for no purpose. And when the orders to poison the citizens of Doma came through, she had known for certain that something was wrong ...
Protective effect of excitatory amino acids on cold-restraint stress-induced gastric ulcers in mice: Role of cyclic nucleotides...Protective effect of excitatory amino acids on cold-restraint stress-induced gastric ulcers in mice: Role of cyclic nucleotides...
TY - JOUR. T1 - Protective effect of excitatory amino acids on cold-restraint stress-induced gastric ulcers in mice. T2 - Role of cyclic nucleotides. AU - Chen, Sheng Hsuan. AU - Lei, Hsiao Ling. AU - Huang, Lih Ron. AU - Tsai, Li Hsueh. PY - 2001. Y1 - 2001. N2 - Previous studies have shown that excitatory amino acids (EAAs) and their receptors may play important roles in the mammalian enteric system. In this study, we investigated whether EEAs, including L-glutamate (L-Glu) and subtypes N-methyl-D-aspartate (NMDA), kainic acid (KA), and quisqualic acid (QA), reduce cyclic AMP (cAMP) levels and play a role in protecting gastric lesions in cold-restraint stress (CRS) mice. First, we found that dose-dependent administration of four selected EAAs significantly attenuated the increase of cAMP content and exhibited a protective effect on the development of gastric lesions induced by CRS. Second, CRS treatment exhibited a decrease of cGMP content and an increase of cAMP content with marked ...
Health Sciences Research Commons - GW Research Days 2016 - Present: Effects of Low-Frequency Stimulation of Anterior Piriform...Health Sciences Research Commons - GW Research Days 2016 - Present: Effects of Low-Frequency Stimulation of Anterior Piriform...
RATIONALE: Recent evidence in animals and humans suggests that low-frequency stimulation (LFS) has significant antiseizure properties. The anterior piriform cortex (APC) has been demonstrated to be a highly susceptible seizure-trigger zone, and may be critical for the initiation and propagation of seizures originating from cortical and limbic foci. We studied the effect of LFS of the APC on seizure frequency, severity, and duration in the kainate seizure model in rats. METHODS: Adult Sprague-Dawley rats (n=7; Hilltop Lab Animals Inc, Scottdale, PA) were implanted with tripolar electrodes in the left APC, and recording electrodes bilaterally in the hippocampal CA3 regions. Rats were monitored continuously with video-EEG for the emergence of spontaneous recurrent seizures after induction of status epilepticus by intraperitoneal kainic acid injections (KA). After emergence of spontaneous seizures, animals underwent 2 weeks of baseline recordings to determine seizure frequency and duration. Then, LFS of the
Distribution of kainate receptor subunit mRNAs in human hippocampus, neocortex and cerebellum, and bilateral reduction of...Distribution of kainate receptor subunit mRNAs in human hippocampus, neocortex and cerebellum, and bilateral reduction of...
The mRNAs encoding kainic acid (KA) preferring glutamate receptor subunits (GluR5-7, KA1 and KA2) are differentially expressed in rat brain. We have used regional and cellular in situ hybridization histochemistry with subunit-specific 35S-labelled oligodeoxyribonucleotides to examine these mRNAs in adult human hippocampus, neocortex and cerebellum. GluR5 mRNA was detected only in Purkinje cells and a few scattered hippocampal neurons. GluR6 mRNA was relatively abundant in all areas, notably in dentate gyrus, pyramidal neurons of CA3, and cerebellar granule cells, as well as being present in superficial and deep laminae of the neocortex. Moderate signal for GluR7 mRNA was seen in deep laminae of the neocortex with a weak signal in the dentate gyrus; in dipped sections GluR7 mRNA was also apparent over some pyramidal and non-pyramidal cells in hippocampus and over putative cerebellar stellate/basket cells. KA1 mRNA was detected in the dentate gyrus but not reliably elsewhere. The expression profile and
Receptors, Kainic Acid | Profiles RNSReceptors, Kainic Acid | Profiles RNS
Suto N, Tanabe LM, Austin JD, Creekmore E, Vezina P. Previous exposure to VTA amphetamine enhances cocaine self-administration under a progressive ratio schedule in an NMDA, AMPA/kainate, and metabotropic glutamate receptor-dependent manner. Neuropsychopharmacology. 2003 Apr; 28(4):629-39 ...
Frontiers | Altered Biogenesis and MicroRNA Content of Hippocampal Exosomes Following Experimental Status Epilepticus |...Frontiers | Altered Biogenesis and MicroRNA Content of Hippocampal Exosomes Following Experimental Status Epilepticus |...
Repetitive or prolonged seizures (status epilepticus) can damage neurons within the hippocampus, trigger gliosis, and generate an enduring state of hyperexcitability. Recent studies have suggested that microvesicles including exosomes are released from brain cells following stimulation and tissue injury, conveying contents between cells including microRNAs (miRNAs). Here, we characterized the effects of experimental status epilepticus on the expression of exosome biosynthesis components and analyzed miRNA content in exosome-enriched fractions. Status epilepticus induced by unilateral intra-amygdala kainic acid in mice resulted in acute subfield-specific, bi-directional changes in hippocampal transcripts associated with exosome biosynthesis including up-regulation of endosomal sorting complexes required for transport (ESCRT)-dependent and -independent pathways. Increased expression of exosome components including Alix were detectable in samples obtained 2 weeks after status epilepticus and changes
Distinct functions of kainate receptors in the brain are determined by the auxiliary subunit Neto1<...Distinct functions of kainate receptors in the brain are determined by the auxiliary subunit Neto1<...
TY - JOUR. T1 - Distinct functions of kainate receptors in the brain are determined by the auxiliary subunit Neto1. AU - Straub, Christoph. AU - Hunt, David L.. AU - Yamasaki, Miwako. AU - Kim, Kwang S.. AU - Watanabe, Masahiko. AU - Castillo, Pablo E.. AU - Tomita, Susumu. PY - 2011/7. Y1 - 2011/7. N2 - Ionotropic glutamate receptors principally mediate fast excitatory transmission in the brain. Among the three classes of ionotropic glutamate receptors, kainate receptors (KARs) have a unique brain distribution, which has been historically defined by 3 H-radiolabeled kainate binding. Compared with recombinant KARs expressed in heterologous cells, synaptic KARs exhibit characteristically slow rise-time and decay kinetics. However, the mechanisms responsible for these distinct KAR properties remain unclear. We found that both the high-affinity binding pattern in the mouse brain and the channel properties of native KARs are determined by the KAR auxiliary subunit Neto1. Through modulation of ...
Differential effects of granule cell transplantation on two sprouted axonal systems in granuloprival coeruleocerebellar...Differential effects of granule cell transplantation on two sprouted axonal systems in granuloprival coeruleocerebellar...
TY - JOUR. T1 - Differential effects of granule cell transplantation on two sprouted axonal systems in granuloprival coeruleocerebellar cultures. AU - Seil, Fredrick J.. AU - Woodward, William. PY - 1988/9/1. Y1 - 1988/9/1. N2 - Exposure of coeruleocerebellar cultures to cytosine arabinoside for the first 5 days in vitro destroyed granule cells and induced sprouting of cortical neurites (Purkinje cell recurrent axon collaterals) and catecholaminergic fibers. Transplantation of such granuloprival cultures with kainic acid-treated cerebellar explants as a source of granule cells resulted in a reduction of silver-positive cortical neurites, but not of histofluorescent catecholaminergic axons. Tissue levels of catecholamines were similar in transplanted and non-transplanted cultures. Differences in types of contacts made with target Purkinje cells in vitro may account for the difference in response to granule cell transplantation by the two axonal groups.. AB - Exposure of coeruleocerebellar ...
Neuroscience2014 | Per sessionNeuroscience2014 | Per session
Introduction: The mammalian adult brain has a limited potential for repair. Attempts are aimed to introduce new approaches toward enhancing the brains repair potential in neurodegenerative diseases and traumatic brain injuries. Here we have reported increased neurogenesis in the hippocampal CA3 area of mice suffering from kainic acid (KA) induced neurodegeneration after treatment with valproic acid (VPA) and in vivo transfection with Oct4 expressing viral particles. Methods: Dox-inducible Oct4 expressing viral particles and pluripotency inducers such as BIX01294, Bayk8644 and RG-108 were injected i.c.v and VPA was systematic administered via oral gavages. After one or two weeks, induction of pluripotency (Oct4, Klf4, Nanog, c-Myc and Sox2) and neural stem markers (Pax6 and Sox1) were measured using RT-PCR. For further analysis, Oct4, Nanog and SSEA1 expression is also studied by immunohistofluerescence. To induce neurodegeneration on both sides of the CA3 area of the hippocampus, KA was applied ...
L2-Galvano ForumL2-Galvano Forum
In especial, inquiry of IL-1 and IL-1Ra mRNAs after systemic injection of kainic acid in rats has shown that these transcripts are significantly induced in microglial cells in the hippocampus as extravagantly as in other areas of the limbic modus operandi (Yabuuchi et al. Of one of a kind involved with in the toddler years is the increase of speech and jargon in potentially bilingual children. Tissue-specific contributions of pneumococcal injuriousness factors to pathogenesis ,a href=http://jump-studios.com/content/public/project19/stage16/,500 mg azulfidine overnight delivery,/a, kidney pain treatment. GABA analogue cis-4-aminocrotonic acid (CACA) selectively activates a third assort of GABAA Rs in the mammalian CNS. Undertaking potentials were not detected when the verbatim at the same time stimulus was applied to the right-sided S2 DR after spinal cord transection. How do we take our bodies ,a href=http://jump-studios.com/content/public/project19/stage19/,buy aristocort 10mg lowest price,/a, ...
Page:United States Statutes at Large Volume 109 Part 2.djvu/434 - Wikisource, the free online libraryPage:United States Statutes at Large Volume 109 Part 2.djvu/434 - Wikisource, the free online library
109 STAT. 1406 PROCLAMATION 6763-DEC. 23, 1994 Annex (con.) - 357- SecClon A. (continued) (370). (con.): Table 1. (eon.) I WM JOSAMYCIN KAINIC ACID KALARMGIN KALLIDINOGENASE KANANYCIN KEBUZ ON E KERACYANIN KETAMINE KETAN SERIN KETA ZOCI NE KETA ZOLAN KETIHI PRAHI NE KETO BENID ONE KETO CAIN E KETOUINOL KETOC ONAZ OIE KETOP ROFE N KETORF ANOL KETOROUC KE TOTI FEN KE TOTRE XATE KE TOXAL KH ELLIN KH ELLO SIDE KI TASANT CIN LABETAL OL UCIDIPINE LAC TALFAT E UCTITO. UWTULOSE LAIOL CNYCIN LAMIVU DINE LAN0TR I6INE LAMTID INE LANATO SIDE C LANOCCW AZOLE LANRE OTIDE LANSOPR AZOLE LAPIR IUN C HLOR IDE LAPRAF TLLINE USALKID UTANOXEF UTANOPROST LAUDEXIUM MET ILS ULF ATE LAURALKONIUM C HLO RID E LAURIXAMINE LA UROCAP RAH LA UROGUA OINE LA UROLINIU M ACE TAT E LA URONACRO GOL 4 0 0 UVOLTIDINE LA ZABEMI DE LE DAZEROL LE FETAMINE CAS Nur ber 1 6846- 24-5 48 7-7 9-6 1 1048 -15- 0 9001-01-8 59- 01- 8 85 3-3 4-9 1 8719-76- 1 6740 -88- 1 740 50-9 8-9 3 629 2-6 9-0 2722 3-3 5-4 796- 29-2 46 9-7 9-4 1092- 46-2 ...
Classification and properties of acidic amino acid receptors in hippocampus. III. Supersensitivity during the postnatal period...Classification and properties of acidic amino acid receptors in hippocampus. III. Supersensitivity during the postnatal period...
The effects of excitatory amino acids on 22Na efflux rate in rat hippocampal slices were determined at various postnatal days and following removal of a major afferent system. Two weeks after a unilateral hippocampal aspiration, the 22Na efflux induc
PA widow files new state DOMA challenge | Philadelphia Gay NewsPA widow files new state DOMA challenge | Philadelphia Gay News
The suit contends the state Defense of Marriage Act and subsequent inheritance-tax law violate the state constitutional uniformity clause, equal-rights amendment, equal-protection and due-process guarantees, as well as federal equal-protection and due-process guarantees.. Palmer said Baus is seeking to rectify the states discriminatory inheritance-tax law, as well as challenge the overarching state ban on same-sex marriage.. "She is seeking to have the state DOMA declared unconstitutional on state and federal constitutional grounds and if she is successful, it would be struck down," she said. "As a minimum, she is seeking for the court to rule that same-sex spouses do not have to pay inheritance tax. They are essentially being treated the same as an unmarried couple.". Baus said shes ultimately looking for the state to respect her relationship.. "Basically it is the right thing to do and the fair thing to do," she told PGN. "There is no reason why the LGBT community should be discriminated ...
Grifitov eksperiment - Википедија, слободна енциклопедијаGrifitov eksperiment - Википедија, слободна енциклопедија
Grifitov eksperiment, koji je objavio Frederik Grifit 1928,[1] je bio prvi eksperiment koji je sugerisao da bakterije imaju sposobnost transfera genetičke informacije putem procesa poznatog kao transformacija.[2][3] Grifit je koristio dve vrste bakterija pneumokoka (Streptococcus pneumoniae) koje inficiraju miševe: tip III-S (glatku) i tip II-R (grubu) vrstu. III-S vrsta se prekriva polisaharidnim kapsulom koja je štiti od imunskog sistema domaćina. Rezultat toga je smrt domaćina. II-R vrsta nema tu zaštitnu kapsulu, te je imunski sistem domaćina uništava. Nemački bakteriolog, Fred Nojfeld, je otkrio tri tipa pneumokoka (Tupivu I, II, i III), kao i način za njihovu identifikaciju in vitro.[4] Do vremena Grifitovog eksperimenta, bakteriolozi su smatrali da su tipovi fiksni i nepromenljivi, iz jedne generacije u drugu. U ovom eksperimentu, bakterije III-S vrste su ubijene toplotom, i njihovi ostaci su dodati u II-R vrstu bakterija. Dok ni jedna od ovih komponenti samostalno nije nanosila ...
Snail Hollow Gazette: Gay in the News: Colorado DOMASnail Hollow Gazette: "Gay" in the News: Colorado DOMA
Comments are nice. All thoughtful comments, critical or otherwise are equally welcome. Spam will not be tolerated. Dont waste time posting spammy comments, or trying to advertise your own blog, because I moderate all comments, and anything I deem to be spam will disappear without a trace. Unmannered or inordinately rude dissenters will receive similar treatment, and be summarily moderated by the neck until dead ...
HyPhy message board - Amino acid model selectionHyPhy message board - Amino acid model selection
Ill add these models (and the +F variants) to the next HyPhy build. This should happen in about 2 weeks - we are finishing the GTK (Linux) port of the HyPhy GUI, so Ill roll the models into the next major build ...
Berkeley 2017: Nejlepších 20 Berkeley- rekreačních pronájmů, prázdninových domů a pronájmů apartmánů - Airbnb Berkeley,...Berkeley 2017: Nejlepších 20 Berkeley- rekreačních pronájmů, prázdninových domů a pronájmů apartmánů - Airbnb Berkeley,...
16. Pro 2017 - Pronajímej od lidí v Berkeley, Kalifornie od $20/noc. Najdi jedinečná místa k pobytu u místních hostitelů ve 191 zemích. S Airbnb budeš všude jako doma.
Pitna Destilirana voda @ Slo-TechPitna Destilirana voda @ Slo-Tech
Sploh pa zakaj sem se odločil sam za izdelavo koloidnega srebra. Prvo kot prvo je to, da ljudje prodajajo pol litra koloidnega srebra za 30-40€. Jaz sem za komponente za izdelavo frekvenčnega generatorja, 60cm 99,99% žice čistega srebra(sprejemljiva čistost je od 99,9% naprej), porabil reči piši 35€. S temle lahko izdelam cca 500L koloidnega srebra. Drugič; koloidno srebro naj nebi bilo izpostavljeno svetlobi, naj bi bilo vsaj 50cm oddaljeno od vseh elektronskih naprav in napeljav, ter naj se nebi uporabljalo z kovinsko žlico. Zdaj kdo mi lahko zagotovi, da mi bo pošta dostavila pošiljko tako da bo 50cm oddaljena od vseh elektronskin naprav in napeljav (nemogoče). Koloidno srebro kot ste mogoče še opazili ima določen razpon delcev srebra na miljon delcev (PPM - parts per million). Ta je od 15-30 PPM. Če si sam ne izdelaš nikoli neveš ali je ta koncentracija pravilna. Doma namreč imam Hanna TSD1 meter, ki meri tole količino delcev na miljon delcev. Skratka varneje in ...
Visi Vaistai >...Visi Vaistai >...
Informacija apie visus Lietuvos vaistinėse pardavinėjamus vaistus, maisto papildus, medicinines prekes. Vaistų paieška bei visos Lietuvos vaistinių tinklų akcijos.
Visi Vaistai >...Visi Vaistai >...
Informacija apie visus Lietuvos vaistinėse pardavinėjamus vaistus, maisto papildus, medicinines prekes. Vaistų paieška bei visos Lietuvos vaistinių tinklų akcijos.
HypokinesiaHypokinesia
NeurotoxinNeurotoxin
Jan JakušJan Jakuš
GRIK2GRIK2
Tohru FukuyamaTohru Fukuyama
Temporal lobe epilepsyTemporal lobe epilepsy
Kainate receptorKainate receptor
Ablative brain surgeryAblative brain surgery
CalsenilinCalsenilin
SeletracetamSeletracetam
Ro5-4864Ro5-4864
Polybia occidentalisPolybia occidentalis
Granule cell dispersionGranule cell dispersion
ErythravineErythravine
Fluoro-Jade stainFluoro-Jade stain
Catamenial epilepsyCatamenial epilepsy
Sharp waves and ripplesSharp waves and ripples
LesionLesion
AMPAAMPA
HemiballismusHemiballismus
Dihydrokainic acidDihydrokainic acid
Glutamic acidGlutamic acid
Endogenous regenerationEndogenous regeneration
List of MeSH codes (D03)List of MeSH codes (D03)
ConvulsantConvulsant
List of drugs: KList of drugs: K
W. SelvamurthyW. Selvamurthy
ExcitotoxicityExcitotoxicity
Eyeblink conditioningEyeblink conditioning
Excitatory amino acid receptor agonistExcitatory amino acid receptor agonist
BudipineBudipine
TheanineTheanine
1,1,1-Trichloroethane1,1,1-Trichloroethane
Domoinska kiselina - Википедија, слободна енциклопедијаDomoinska kiselina - Википедија, слободна енциклопедија
CrocetinCrocetin
Glutamate decarboxylaseGlutamate decarboxylase
ಹಂಟಿಂಗ್ಟನ್‌‌ನ ಕಾಯಿಲೆ - ವಿಕಿಪೀಡಿಯಹಂಟಿಂಗ್ಟನ್‌‌ನ ಕಾಯಿಲೆ - ವಿಕಿಪೀಡಿಯ
Domoic acidDomoic acid
Vision in toadsVision in toads
AMPA receptorAMPA receptor
NeurotoksinNeurotoksin
Neurotoksin Bahasa Melayu, ensiklopedia bebasNeurotoksin Bahasa Melayu, ensiklopedia bebas
Glutamic acidGlutamic acid
Diethyl etherDiethyl ether
GlycineGlycine
ConantokinConantokin
DiethylenetriamineDiethylenetriamine
1-Aminocyclopropane-1-carboxylic acid1-Aminocyclopropane-1-carboxylic acid
Trypan blueTrypan blue
Huperzine AHuperzine A
Glutamic acidGlutamic acid
ToxopyrimidineToxopyrimidine
MethoxyfluraneMethoxyflurane
N-Acetylaspartylglutamic acidN-Acetylaspartylglutamic acid
2,2,2-Trichloroethanol2,2,2-Trichloroethanol
Sodium thiopentalSodium thiopental
CarisoprodolCarisoprodol
ExcitotoxicityExcitotoxicity
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and Processes
Kainic AcidExcitatory Amino Acid AgonistsSeizuresReceptors, Kainic AcidStatus EpilepticusHippocampusConvulsantsFlurothylN-MethylaspartateNeuronsNeurotoxinsKindling, NeurologicPentylenetetrazoleMedulla OblongataRats, Sprague-DawleyEpilepsy, Temporal LobeReceptors, NeurotransmitterQuinolinic AcidsNitrergic NeuronsIbotenic AcidEpilepsyalpha-MethyltyrosineMossy Fibers, HippocampalReceptors, GlutamateVestibular NucleiGlutamatesPyrrolidinesNerve DegenerationGliosisGlutamic AcidQuisqualic AcidNeuroprotective AgentsPeriaqueductal GrayBrainRats, Wistaralpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic AcidQuinolinic AcidRats, Inbred StrainsAnticonvulsantsDisease Models, AnimalExcitatory Amino AcidsCell DeathNystagmus, PhysiologicReceptors, N-Methyl-D-AspartateHyperprolactinemiaMicroinjectionsInjections, IntraventricularElectroencephalographyDentate GyrusPonsPilocarpineExcitatory Amino Acid AntagonistsCorpus StriatumBehavior, Animal6-Cyano-7-nitroquinoxaline-2,3-dioneNADPH DehydrogenaseQuinoxalinesAstrocytesLimbic System
Increase in Bcl-2 phosphorylation and reduced levels of BH3-only Bcl-2 family proteins in kainic acid-mediated neuronal death...Increase in Bcl-2 phosphorylation and reduced levels of BH3-only Bcl-2 family proteins in kainic acid-mediated neuronal death...
Kainic acid - WikipediaKainic acid - Wikipedia
Glucocorticoid toxicity in the hippocampus. Temporal aspects of synergy with kainic acid. - PubMed - NCBIGlucocorticoid toxicity in the hippocampus. Temporal aspects of synergy with kainic acid. - PubMed - NCBI
Naringin Attenuates Autophagic Stress and Neuroinflammation in Kainic Acid-Treated Hippocampus In VivoNaringin Attenuates Autophagic Stress and Neuroinflammation in Kainic Acid-Treated Hippocampus In Vivo
Naringin Attenuates Autophagic Stress and Neuroinflammation in Kainic Acid-Treated Hippocampus In VivoNaringin Attenuates Autophagic Stress and Neuroinflammation in Kainic Acid-Treated Hippocampus In Vivo
Limbic Seizures Induced by Systemically Applied Kainic Acid: How Much Kainic Acid Reaches the Brain? | SpringerLinkLimbic Seizures Induced by Systemically Applied Kainic Acid: How Much Kainic Acid Reaches the Brain? | SpringerLink
A tachykinin NK1 receptor antagonist, CP-122,721-1, attenuates kainic acid-induced seizure activity. - PubMed - NCBIA tachykinin NK1 receptor antagonist, CP-122,721-1, attenuates kainic acid-induced seizure activity. - PubMed - NCBI
Persistent Auditory Nerve Damage Following Kainic Acid Excitotoxicity in the Budgerigar ( Melopsittacus undulatus) |...Persistent Auditory Nerve Damage Following Kainic Acid Excitotoxicity in the Budgerigar ( Melopsittacus undulatus) |...
NIOSHTIC-2 Publications Search - 20025893 - Sensitive indicators of injury reveal hippocampal damage in C57BL/6J mice treated...NIOSHTIC-2 Publications Search - 20025893 - Sensitive indicators of injury reveal hippocampal damage in C57BL/6J mice treated...
Alkene Metathesis: Synthesis of Kainic Acid, Pladienolide B and Amphidinolide YAlkene Metathesis: Synthesis of Kainic Acid, Pladienolide B and Amphidinolide Y
Kainic Acid Induced Seizures and the GABA System in the Substantia NigraKainic Acid Induced Seizures and the GABA System in the Substantia Nigra
Epileptogenesis following Kainic Acid-Induced Status Epilepticus in Cyclin D2 Knock-Out Mice with Diminished Adult NeurogenesisEpileptogenesis following Kainic Acid-Induced Status Epilepticus in Cyclin D2 Knock-Out Mice with Diminished Adult Neurogenesis
Kainic acid lesions of the dorsal nucleus of the lateral lemniscus: effects on binaural evoked responses in rat auditory cortex...Kainic acid lesions of the dorsal nucleus of the lateral lemniscus: effects on binaural evoked responses in rat auditory cortex...
Intra-Amygdaloid Injection of Kainic Acid in Rats with Genetic Absence Epilepsy: The Relationship of Typical Absence Epilepsy...Intra-Amygdaloid Injection of Kainic Acid in Rats with Genetic Absence Epilepsy: The Relationship of Typical Absence Epilepsy...
Kainic Acid | Profiles RNSKainic Acid | Profiles RNS
Translocation of glutamate transporter subtype excitatory amino acid carrier 1 protein in kainic acid-induced rat epilepsy.Translocation of glutamate transporter subtype excitatory amino acid carrier 1 protein in kainic acid-induced rat epilepsy.
Frontiers | Melatonin Mitigates Kainic Acid-Induced Neuronal Tau Hyperphosphorylation and Memory Deficits through Alleviating...Frontiers | Melatonin Mitigates Kainic Acid-Induced Neuronal Tau Hyperphosphorylation and Memory Deficits through Alleviating...
Pirfenidone Attenuates Microglial Reactivity and Reduces Inducible Nitric Oxide Synthase mRNA Expression After Kainic Acid...Pirfenidone Attenuates Microglial Reactivity and Reduces Inducible Nitric Oxide Synthase mRNA Expression After Kainic Acid...
Endocannabinoid Enhancement Protects against Kainic Acid-Induced Seizures and Associated Brain Damage | Journal of Pharmacology...Endocannabinoid Enhancement Protects against Kainic Acid-Induced Seizures and Associated Brain Damage | Journal of Pharmacology...
Radiation-induced apoptosis in developing rats and kainic acid-induced excitotoxicity in adult rats are associated with...Radiation-induced apoptosis in developing rats and kainic acid-induced excitotoxicity in adult rats are associated with...
Ketogenic diet-induced peroxisome proliferator-activated receptor-γ activation decreases neuroinflammation in the mouse...Ketogenic diet-induced peroxisome proliferator-activated receptor-γ activation decreases neuroinflammation in the mouse...
Effects of sustained seizures produced by intrahippocampal injection of kainic acid on noradrenergic neurons: evidence for...Effects of sustained seizures produced by intrahippocampal injection of kainic acid on noradrenergic neurons: evidence for...
DIGITAL.CSIC: Mice Lacking Functional Fas Death Receptors Are Protected from Kainic Acid-Induced Apoptosis in the HippocampusDIGITAL.CSIC: Mice Lacking Functional Fas Death Receptors Are Protected from Kainic Acid-Induced Apoptosis in the Hippocampus
Regional and differential expression of gelatinases in rat brain after systemic kainic acid or bicuculline administrationRegional and differential expression of gelatinases in rat brain after systemic kainic acid or bicuculline administration
Kainic Acid (synthetic) | CAS 58002-62-3 | Apoptosis Inducer | AGSKainic Acid (synthetic) | CAS 58002-62-3 | Apoptosis Inducer | AGS
Long-Term Expression of Proenkephalin and Prodynorphin in the Rat Brain after Systemic Administration of Kainic Acid - an in...Long-Term Expression of Proenkephalin and Prodynorphin in the Rat Brain after Systemic Administration of Kainic Acid - an in...
Synthesis of C-N Natural Products: (-)-α-Kainic Acid (Helmchen), (+)-Tylophorine (Opatz), (-)-Lycoperine A (Rychnovsky),...Synthesis of C-N Natural Products: (-)-α-Kainic Acid (Helmchen), (+)-Tylophorine (Opatz), (-)-Lycoperine A (Rychnovsky),...
Expression of Adenomatous Polyposis Coli Protein in Reactive Astrocytes in Hippocampus of Kainic Acid-Induced Rat | Springer...Expression of Adenomatous Polyposis Coli Protein in Reactive Astrocytes in Hippocampus of Kainic Acid-Induced Rat | Springer...
The Effects of Kainic Acid Injections on Guanylate Cyclase Activity in the Rat Caudatoputamen, Nucleus Accumbens and Septum,...The Effects of Kainic Acid Injections on Guanylate Cyclase Activity in the Rat Caudatoputamen, Nucleus Accumbens and Septum,...
Effect of sparteine on status epilepticus induced in rats by pentylenetetrazole, pilocarpine and kainic acid, Brain Research |...Effect of sparteine on status epilepticus induced in rats by pentylenetetrazole, pilocarpine and kainic acid, Brain Research |...
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and Processes
Kainic AcidExcitatory Amino Acid AgonistsSeizuresReceptors, Kainic AcidStatus EpilepticusHippocampusConvulsantsFlurothylN-MethylaspartateNeuronsNeurotoxinsKindling, NeurologicPentylenetetrazoleMedulla OblongataRats, Sprague-DawleyEpilepsy, Temporal LobeReceptors, NeurotransmitterQuinolinic AcidsNitrergic NeuronsIbotenic AcidEpilepsyalpha-MethyltyrosineMossy Fibers, HippocampalReceptors, GlutamateVestibular NucleiGlutamatesPyrrolidinesNerve DegenerationGliosisGlutamic AcidQuisqualic AcidNeuroprotective AgentsPeriaqueductal GrayBrainRats, Wistaralpha-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic AcidQuinolinic AcidRats, Inbred StrainsAnticonvulsantsDisease Models, AnimalExcitatory Amino AcidsCell DeathNystagmus, PhysiologicReceptors, N-Methyl-D-AspartateHyperprolactinemiaMicroinjectionsInjections, IntraventricularElectroencephalographyDentate GyrusPonsPilocarpineExcitatory Amino Acid AntagonistsCorpus StriatumBehavior, Animal6-Cyano-7-nitroquinoxaline-2,3-dioneNADPH DehydrogenaseQuinoxalinesAstrocytesLimbic System
NeuronsExcitotoxicityInjectionAmino acidAbstractEffect of kainic acidSeizureReceptorsEpilepsyMiceInjectionsSystemicAgonist kainic acidProduce kainic acidNeurotoxinSelectiveAMPANeurodegenerationNeuroscienceAstrocytesInhibitorConvulsantDomoic2000StimulationGlutamicStearic AcidNeuronal degenerationAttenuatesProteinGABANeurology
Neurons14
  • Kainic acid is a direct agonist of the glutamic kainate receptors and large doses of concentrated solutions produce immediate neuronal death by overstimulating neurons to death. (wikipedia.org)
  • Thus, in large, concentrated doses kainic acid can be considered a neurotoxin, and in small doses of dilute solution kainic acid will chemically stimulate neurons. (wikipedia.org)
  • An autophagic mechanism is involved in apoptotic death of rat striatal neurons induced by the non-N-methyl-D-aspartate receptor agonist kainic acid," Autophagy , vol. 4, no. 2, pp. 214-226, 2008. (hindawi.com)
  • Local injections of kainic acid, which destroyed cholinergic and GABA neurons in the caudatoputamen and in the nucleus accumbens, caused a rapid (70-90%) decrease in the soluble guanylate cyclase and a slower 50‐60% fall in the particulate guanylate cyclase in these nuclei. (deepdyve.com)
  • In this study, we investigated a role of COX isoforms (COX-1 and COX-2) in kainic acid-induced neuronal death in cultured murine cortical or hippocampal neurons. (elsevier.com)
  • In primary cortical neurons, both indomethacin (COX-1/-2 nonselective inhibitor) and aspirin (COX-1 preferential inhibitor) reduced basal and kainic acid-induced PGE 2 production significantly and prevented neuronal cell death after kainic acid treatment. (elsevier.com)
  • In hippocampal neurons, however, COX-2 inhibitors prevented both kainic acid-induced neuronal death and PGE 2 production. (elsevier.com)
  • In conclusion, we suggest that the release of PGE 2 induced by kainic acid occurred through COX-1 activity rather than COX-2 in cortical neurons. (elsevier.com)
  • The inhibition of PGE 2 release by COX-1 inhibitors prevented kainic acid-induced cortical neuronal death, while in the hippocampal neurons, COX-2 inhibitors prevented kainic acid-induced PGE 2 release and hippocampal neuronal death. (elsevier.com)
  • Bromodeoxyuridine labeled neurons increased at least 6-fold on the side ipsilateral to the kainic acid injection compared to controls, but significantly, were also increased, by at least 3-fold on the side contralateral to the injection. (cf.ac.uk)
  • In this article we cultured axotomized rat dorsal root ganglion neurons to investigate the effects of corticosterone and a glutamate receptor agonist kainic acid on neurite outgrowth. (elsevier.com)
  • Western blot analysis and immunocytochemical studies revealed an increase of expressions of both TrkA and growth-associated protein GAP-43 in dorsal root ganglion neurons with combined treatment of corticosterone and kainic acid. (elsevier.com)
  • Immunocytochemistry showed that corticosterone+kainic acid increase nerve growth factor immunoreactivity in dorsal root ganglion neurites and enhance GAP-43 immunointensity in dorsal root ganglion neurons. (elsevier.com)
  • Here we further studied in vivo the sensitivity of the hippocampal CA1 neurons in response to CTZ in epileptogenesis in comparison with two other classic convulsants of kainic acid (KA) and pentylenetetrazol (PTZ). (naver.com)
Excitotoxicity7
Injection21
  • Therefore, the most effective ablation studies are performed in comparison to a sham lesion that duplicates all the steps of producing a brain lesion except the one that actually causes the brain damage, that is, injection of kainic acid or administration of an electrical shock. (wikipedia.org)
  • The goal of this study was to determine whether a substantial decrease in adult neurogenesis influences epileptogenesis evoked by the intra-amygdala injection of kainic acid (KA). (nih.gov)
  • We now investigate the effect of intra-amygdaloid injection of kainic acid, as another model of temporal lobe epilepsy, focusing on epileptogenesis, spike-and-wave discharges (SWDs), and the transition from basal to SWD states in GAERS. (jneurosci.org)
  • SWDs and increases in power of the delta, alpha, and beta frequency ranges during the transition period disappeared after the kainic acid injection for 1-3 d and gradually reappeared. (jneurosci.org)
  • We have further evaluated the interplay between absence epilepsy and limbic epilepsy by using intra-amygdaloid injection of kainic acid in adult GAERS as another model of temporal lobe epilepsy ( Sperk, 1994 ) to compare with intra-amygdaloid kindling. (jneurosci.org)
  • Systemic injection of kainic acid (KA) in the rat produces an animal model of human temporal lobe epilepsy. (biomedsearch.com)
  • Intraperitoneal injection of kainic acid at convulsant doses to the adult rat produces cell death with morphological features of necrosis, together with the appearance of cells with fine granular chromatin degeneration and small numbers of apoptotic-like cells, in the entorhinal and piriform cortices, basal amygdala, certain thalamic nuclei, and CA1 region of the hippocampus. (biomedsearch.com)
  • The vast majority of c-Jun-immunoreactive cells have normal nuclear morphology, whereas necrotic cells are negative and only a few cells with fine granular chromatin condensation and apoptotic cells following kainic acid injection are stained with c-Jun antibodies. (biomedsearch.com)
  • Western blotting, using the same antibody, shows a p39 band in control rats, which is accompanied by a band at about p26 from 6 h onwards following kainic acid injection. (biomedsearch.com)
  • GFAP levels were induced 3 days after kainic acid injection in brain regions where MMP-2 was elevated. (ovid.com)
  • These data demonstrate that MMP-9 and MMP-2 are differentially expressed with respect to time after kainic acid injection, and suggest that they are regulated by convulsion and/or neurodegenerative-associated mechanisms, respectively. (ovid.com)
  • In this study, we evaluated the expression of APC and its association with β-catenin signaling pathway, following the induction of an excitotoxic lesion by kainic acid (KA) injection, which cause pyramidal cell degeneration. (springer.com)
  • Intraventricular injection of kainic acid produced a characteristic necrosis in the hippocampal CA3 region of adult rabbits. (elsevier.com)
  • The animals were sacrificed by decapitation on the 1st, 4th and 10th day after injection of the kainic acid. (ndsl.kr)
  • 3. After injection of the kainic acid the neurites of the inner plexiform layer were swollen at the first, and thereafter those changes were gradually disappeared until the 10th day. (ndsl.kr)
  • We report here for the first time that granule cell neurogenesis is increased bilaterally 1 week after a single unilateral intracerebroventricular injection of kainic acid. (cf.ac.uk)
  • Injection of kainic acid (KA) can induce neurodegeneration and epilepsy in the experimental study. (tci-thaijo.org)
  • Here, we investigate hippocampal changes using a mouse model that receive a single kainic acid-intracerebral ventricle injection. (biomedcentral.com)
  • The effects of caspase 3 inhibition on these changes were detected during a period of 1 to 7 days post kainic acid injection. (biomedcentral.com)
  • The co-injection of caspase 3 inhibitor did not rescue kainic acid-mediated neurodegeneration but seriously and reversibly disturb the structural integrity of axon and dendrite. (biomedcentral.com)
  • The kainic acid-induced events include microglia activation, the proliferation of radial glial cells, neurogenesis, and calcineurin A cleavage were significantly inhibited by the co-injection of caspase 3 inhibitor, suggesting the direct involvement of caspase 3 in these events. (biomedcentral.com)
Amino acid18
Abstract3
  • Walaas, Ivar 1981-01-01 00:00:00 Abstract: The activity of soluble and particulate guanylate cyclase (EC 4.6.1.2) has been compared with the distribution of neurotransmitter candidates in three rat forebrain nuclei, and the effects of local kainic acid injections into these nuclei have been tested. (deepdyve.com)
  • abstract = "Kainic acid (KA) selectively damages afferent synapses that innervate, in chickens, mainly tall hair cells. (elsevier.com)
  • abstract = "The distribution of [3H]kainic acid (KA) binding sites in the rat CNS was determined by in vitro autoradiography. (nebraska.edu)
Effect of kainic acid1
Seizure5
Receptors8
Epilepsy9
  • antiworming agent neuroscience research neurodegenerative agent modeling of epilepsy modeling of Alzheimer's disease Dihydrokainic acid Domoic acid Kainate receptor Carlson, Neil R. Physiology of Behavior. (wikipedia.org)
  • Ben-Ari, Y., Tremblay, E., and Ottersen, 0.P., 1980, Injections of kainic acid into the amygdaloid complex of the rat: an electrographic, clinical and histological study in relation to the pathology of epilepsy, Neuroscience 5: 515. (springer.com)
  • kainic acid: mechanisms and relevance to human temporal lobe epilepsy, Neuroscience 14:375. (springer.com)
  • To investigate the pathophysiological role of phospholipase D (PLD)-mediated signaling, changes in the expression of the PLD isozymes PLD1 and PLD2 were investigated in the rat kainic acid (KA) model of human temporal lobe epilepsy. (elsevier.com)
  • The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. (mdpi.com)
  • Gluck MR, Jayatilleke E, Shaw S, Rowan AJ, Haroutunian V. CNS oxidative stress associated with the kainic acid rodent model of experimental epilepsy. (tci-thaijo.org)
  • kainic acid (KA) is one of the most common chemoconvulsants used to create SE models of temporal lobe epilepsy (TLE). (biomedcentral.com)
  • The present study used continuous electroencephalography ( EEG ) to evaluate the therapeutic efficacy of RG in intrahippocampal kainic acid (IHKA) animal model of temporal lobe epilepsy . (bvsalud.org)
  • In recent years, kainic acid has been used as a research tool to study human neurological conditions such as epilepsy and Alzheimer's disease. (ucsd.edu)
Mice9
  • Sensitive indices of neural injury were used to evaluate the time course of kainic acid (KA)-induced hippocampal damage in adult C57BL/6J mice (4 months), a strain previously reported to be resistant to kainate-induced neurotoxicity. (cdc.gov)
  • Kainic acid hyperphosphorylates tau via inflammasome activation in MAPT transgenic mice. (alzforum.org)
  • IL-18 deficiency aggravates kainic acid-induced hippocampal neurodegeneration in C57BL/6 mice due to an overcompensation by IL-12. (tci-thaijo.org)
  • Seventy adult male KM mice were subjected to microinjections into the hippocampus of kainic acid (KA) or 500, 1000, or 2000 µg/ml tunicamycin (TM). (bvsalud.org)
  • Curcumin attenuates the kainic acid-induced hippocampal cell death in the mice. (greenmedinfo.com)
  • Supraphysiological levels of the stress hormone corticosterone attenuate blood-brain barrier disruption and microglial activation in hippocampus of C57BL/6J mice treated with kainic acid. (cdc.gov)
  • Kainic acid intoxication in C57BL/6J mice causes neuronal damage and the activation of glial cells. (cdc.gov)
  • Control and implanted mice were injected intraperitoneally with saline or 25 mg/kg kainic acid, and sacrificed at 1, 3, 6, and 12 hours post treatment. (cdc.gov)
  • Older Abr;Bcr -deficient mice show spontaneous mid-brain glial hypertrophy, which can further be markedly enhanced by kainic acid. (biologists.org)
Injections2
  • Kainic acid injections directly into the cerebellum destroy Purkinje, stellate, basket and Golgi II cells selectively with much less damage to granule cells. (elsevier.com)
  • Following the IHKA injections , one group received treatments of RG (250 mg/kg/day) for 4 weeks (RG group, n=7) while another group received valproic acid (VPA, 30 mg/kg/day) (VPA group, n=7). (bvsalud.org)
Systemic1
  • Franck, JE & Schwartzkroin, PA 1984, ' Immature rabbit hippocampus is damaged by systemic but not intraventricular kainic acid ', Developmental Brain Research , vol. 13, no. 2, pp. 219-227. (elsevier.com)
Agonist kainic acid1
Produce kainic acid4
  • A team of scientists at Scripps Institution of Oceanography at the University of California San Diego and the J. Craig Venter Institute ( JCVI ) has developed a new way to produce kainic acid, a natural seaweed neurochemical and powerful reagent used in brain research. (ucsd.edu)
  • In a new study published April 17 in the journal Angewandte Chemie International Edition , the scientists were able to sequence the genome of a seaweed known to produce kainic acid, and they identified the enzymes responsible for production of the natural chemical. (ucsd.edu)
  • This biotransformation approach allows us to quickly produce kainic acid in a cheaper and more environmentally friendly way than traditional chemical synthesis. (ucsd.edu)
  • Dr. Moore's lab set out to identify the genes that code for the production of kainic acid in red seaweed and found that these genes enabled the seaweed to produce kainic acid in only two steps. (newswise.com)
Neurotoxin2
  • The objective of this study was to determine whether MMPs are expressed in various regional areas of rat brain after administration of the neurotoxin, kainic acid. (ovid.com)
  • Their research builds upon the team's recent work on discovering the genetic origin of domoic acid, a potent neurotoxin produced by planktonic microalgae. (ucsd.edu)
Selective2
AMPA1
  • The kit contains (S)-AMPA, ( ab120005 ), (S)-5-Fluorowillardiine hydrochloride ( ab120399 ), Cyclothiazide ( ab120061 ), Aniracetam ( ab120316 ), Kainic acid ( ab120100 ), (S)-5-Iodowillardiine hydrochloride ( ab120401 ), NMDA ( ab120052 ) and D-serine ( ab120048 ). (abcam.com)
Neurodegeneration2
Neuroscience3
  • Postnatal development of kainic acid binding sites in the limbic system, Neuroscience 13: 1095. (springer.com)
  • Hilmas et al 2001 J. of Neuroscience) Kynurenic acid may modulate the synaptic transmission through blockade of the alpha 7 nicotine cholinergic rezeptors (nACh), while7nChRs). (shakyradunn.com)
  • Recently, Dr. Moore discovered a faster and more environmentally friendly way to synthesize kainic acid-a compound produced by some types of red seaweed-that's valuable for neuroscience research. (newswise.com)
Astrocytes1
Inhibitor1
  • The neurotrophic effect of corticosterone and kainic acid was attenuated by the receptor tyrosine kinase A (TrkA) inhibitor AG-879. (elsevier.com)
Convulsant1
  • 3APS) protects from the convulsant and cytotoxic effect of systemically administered kainic acid. (webmd.com)
Domoic5
  • Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. (mdpi.com)
  • We now define domoic acid epileptic disease as distinct consequence of domoic acid poisoning that occurs in the absence of domoic acid. (mdpi.com)
  • However, in the case of domoic acid, we use the term "disease" because it is caused by a known external factor with a defined sequence of events and course of prognosis. (mdpi.com)
  • This concept report focuses on those essential characteristics of domoic acid poisoning that lead to epileptic disease drawing on case studies in humans and sea lions and a rat model to elucidate the structural basis specific to domoic acid epileptic maturation. (mdpi.com)
  • The domoic acid study helped the scientists develop a hypothesis for how a chemical compound like kainic acid is formed within a living organism-in this case seaweed-in a process known as biosynthesis. (ucsd.edu)
20002
  • Supply shortages beginning in 2000 have caused the cost of kainic acid to rise significantly. (wikipedia.org)
  • Worldwide shortages of the seaweed natural product in 2000 prompted researchers to use chemical synthetic versions of kainic acid. (ucsd.edu)
Stimulation1
Glutamic4
  • These results are generally in conflict with those obtained by many researchers using the activity of the GABA synthetic enzyme glutamic acid decarboxylase (GAD) as a measure of GABA levels. (osu.edu)
  • Glutamic acid decarboxylase mRNA in rat brain: regional distribution and effects of intrastriatal kainic acid. (umassmed.edu)
  • Kainic acid lesions produce a 65-70% decrease in high affinity [ 3 H]GABA uptake into synaptosomal fractions and a similar decrease in glutamic acid decarboxylase with a 50% reduction in endogenous GABA. (elsevier.com)
  • Hippocampal sections were processed for Nissl stain, Prox1-immunocytochemistry, GluR2-immunocytochemistry, Timm stain, glial fibrillary acidic protein-immunocytochemistry, glutamic acid decarboxylase in situ hybridization, and parvalbumin-immunocytochemistry. (stanford.edu)
Stearic Acid1
  • The effect of alcohols (ethanol, 1-propanol, propylene glycol, glycerin, sucrose) on the phase behavior and emulsification of sucrose stearic acid ester (SSE)/water/edible vegetable oil (EVO) systems was investigated. (bireme.br)
Neuronal degeneration1
  • Kainic acid (KA) exposure causes neuronal degeneration featured by Alzheimer-like tau hyperphosphorylation and memory deficits. (frontiersin.org)
Attenuates1
Protein1
  • Alternatively, the kainic acid-mediated astrogliosis is not caspase 3-dependent, although caspase 3 cleavage of glial fibrillary acidic protein occurred. (biomedcentral.com)
GABA3
  • Home Research Outputs Distribution of GABA immunoreactivity in kainic acid-treated. (lu.se)
  • Application of kainic acid to the neostriatum caused a dose-dependent release of GABA both locally and, at the same time, from the ipsilateral substantia nigra. (ox.ac.uk)
  • Direct application of kainic acid to the substantia nigra caused a DNQX-sensitive local release of GABA. (ox.ac.uk)
Neurology1
Matrix Metalloproteinase-7 Regulates Cleavage of Pro-Nerve Growth Factor and Is Neuroprotective following Kainic Acid-Induced...
Matrix Metalloproteinase-7 Regulates Cleavage of Pro-Nerve Growth Factor and Is Neuroprotective following Kainic Acid-Induced... (jneurosci.org)
Plus it
Plus it (jneurosci.org)
Frontiers | Disrupted Co-activation of Interneurons and Hippocampal Network after Focal Kainate Lesion | Frontiers in Neural...
Frontiers | Disrupted Co-activation of Interneurons and Hippocampal Network after Focal Kainate Lesion | Frontiers in Neural... (frontiersin.org)
Pure and Applied Chemistry
Pure and Applied Chemistry (degruyter.com)
Infiltrating monocytes promote brain inflammation and exacerbate neuronal damage after status epilepticus | PNAS
Infiltrating monocytes promote brain inflammation and exacerbate neuronal damage after status epilepticus | PNAS (pnas.org)
Central nervous system - Nova Science Publishers
Central nervous system - Nova Science Publishers (novapublishers.com)
Limbic Seizures Induced by Systemically Applied Kainic Acid: How Much Kainic Acid Reaches the Brain? | SpringerLink
Limbic Seizures Induced by Systemically Applied Kainic Acid: How Much Kainic Acid Reaches the Brain? | SpringerLink (link.springer.com)
Persistent Auditory Nerve Damage Following Kainic Acid Excitotoxicity in the Budgerigar ( Melopsittacus undulatus) |...
Persistent Auditory Nerve Damage Following Kainic Acid Excitotoxicity in the Budgerigar ( Melopsittacus undulatus) |... (link.springer.com)
JNK Isoforms Are Involved in the Control of Adult Hippocampal Neurogenesis in Mice, Both in Physiological Conditions and in an...
JNK Isoforms Are Involved in the Control of Adult Hippocampal Neurogenesis in Mice, Both in Physiological Conditions and in an... (link.springer.com)
The role of the microRNA-146a/complement factor H/interleukin-1β-mediated inflammatory loop circuit in the perpetuate...
The role of the microRNA-146a/complement factor H/interleukin-1β-mediated inflammatory loop circuit in the perpetuate... (dmm.biologists.org)
Expression of Human Apolipoprotein E3 or E4 in the Brains ofApoe−/− Mice: Isoform-Specific Effects on Neurodegeneration |...
Expression of Human Apolipoprotein E3 or E4 in the Brains ofApoe−/− Mice: Isoform-Specific Effects on Neurodegeneration |... (jneurosci.org)
Plus it
Plus it (jneurosci.org)
TLR4-activated microglia require IFN-γ to induce severe neuronal dysfunction and death in situ | PNAS
TLR4-activated microglia require IFN-γ to induce severe neuronal dysfunction and death in situ | PNAS (pnas.org)
Plus it
Plus it (jneurosci.org)
Brain Injury: Hippocampal Damage | GreenMedInfo | Disease | Natural
Brain Injury: Hippocampal Damage | GreenMedInfo | Disease | Natural (greenmedinfo.com)
Studies of Damage to Hippocampal Neurons in Inbred Mouse Lines in Models of Epilepsy Using Kainic Acid and Pilocarpine |...
Studies of Damage to Hippocampal Neurons in Inbred Mouse Lines in Models of Epilepsy Using Kainic Acid and Pilocarpine |... (link.springer.com)
Plus it
Plus it (jneurosci.org)
Antagonism of PACAP or Microglia Function Worsens the Cardiovascular Consequences of Kainic-Acid-Induced Seizures in Rats |...
Antagonism of PACAP or Microglia Function Worsens the Cardiovascular Consequences of Kainic-Acid-Induced Seizures in Rats |... (jneurosci.org)
Pharmacological Rescue of Cortical Synaptic and Network Potentiation in a Mouse Model for Fragile X Syndrome |...
Pharmacological Rescue of Cortical Synaptic and Network Potentiation in a Mouse Model for Fragile X Syndrome |... (nature.com)
Frontiers | Astrocytic Insulin-Like Growth Factor-1 Protects Neurons Against Excitotoxicity | Cellular Neuroscience
Frontiers | Astrocytic Insulin-Like Growth Factor-1 Protects Neurons Against Excitotoxicity | Cellular Neuroscience (frontiersin.org)
Analysis of Proteins That Rapidly Change Upon Mechanistic/Mammalian Target of Rapamycin Complex 1 (mTORC1) Repression...
Analysis of Proteins That Rapidly Change Upon Mechanistic/Mammalian Target of Rapamycin Complex 1 (mTORC1) Repression... (mcponline.org)
Frontiers | Melatonin Mitigates Kainic Acid-Induced Neuronal Tau Hyperphosphorylation and Memory Deficits through Alleviating...
Frontiers | Melatonin Mitigates Kainic Acid-Induced Neuronal Tau Hyperphosphorylation and Memory Deficits through Alleviating... (frontiersin.org)
6 Recent Advances in Developmental Biology | Scientific Frontiers in Developmental Toxicology and Risk Assessment | The...
6 Recent Advances in Developmental Biology | Scientific Frontiers in Developmental Toxicology and Risk Assessment | The... (nap.edu)
NIOSHTIC-2 Publications Search - 20025893 - Sensitive indicators of injury reveal hippocampal damage in C57BL/6J mice treated...
NIOSHTIC-2 Publications Search - 20025893 - Sensitive indicators of injury reveal hippocampal damage in C57BL/6J mice treated... (cdc.gov)
Alkene Metathesis: Synthesis of Kainic Acid, Pladienolide B and Amphidinolide Y
Alkene Metathesis: Synthesis of Kainic Acid, Pladienolide B and Amphidinolide Y (organic-chemistry.org)
Kainic Acid | Profiles RNS
Kainic Acid | Profiles RNS (profiles.umassmed.edu)
Drugs and their NT Flashcards by Erika Ruhnke | Brainscape
Drugs and their NT Flashcards by Erika Ruhnke | Brainscape (brainscape.com)
GRIK5 Gene - GeneCards | GRIK5 Protein | GRIK5 Antibody
GRIK5 Gene - GeneCards | GRIK5 Protein | GRIK5 Antibody (genecards.org)
Epigenetic suppression of hippocampal calbindin-D28k by ΔFosB drives seizure-related cognitive deficits | Nature Medicine
Epigenetic suppression of hippocampal calbindin-D28k by ΔFosB drives seizure-related cognitive deficits | Nature Medicine (nature.com)
Kainic Acid Induced Seizures and the GABA System in the Substantia Nigra
Kainic Acid Induced Seizures and the GABA System in the Substantia Nigra (kb.osu.edu)