The sodium salt of 4-hydroxybutyric acid. It is used for both induction and maintenance of ANESTHESIA.
Salts and esters of hydroxybutyric acid.
4-carbon straight chain aliphatic hydrocarbons substituted with two hydroxyl groups. The hydroxyl groups cannot be on the same carbon atom.
An enzyme that plays a role in the GLUTAMATE and butanoate metabolism pathways by catalyzing the oxidation of succinate semialdehyde to SUCCINATE using NAD+ as a coenzyme. Deficiency of this enzyme, causes 4-hydroxybutyricaciduria, a rare inborn error in the metabolism of the neurotransmitter 4-aminobutyric acid (GABA).
The most common inhibitory neurotransmitter in the central nervous system.
One of the FURANS with a carbonyl thereby forming a cyclic lactone. It is an endogenous compound made from gamma-aminobutyrate and is the precursor of gamma-hydroxybutyrate. It is also used as a pharmacological agent and solvent.
The action of a drug that may affect the activity, metabolism, or toxicity of another drug.
An approach of practicing medicine with the goal to improve and evaluate patient care. It requires the judicious integration of best research evidence with the patient's values to make decisions about medical care. This method is to help physicians make proper diagnosis, devise best testing plan, choose best treatment and methods of disease prevention, as well as develop guidelines for large groups of patients with the same disease. (from JAMA 296 (9), 2006)
Agents that are administered in association with anesthetics to increase effectiveness, improve delivery, or decrease required dosage.
Polymers of organic acids and alcohols, with ester linkages--usually polyethylene terephthalate; can be cured into hard plastic, films or tapes, or fibers which can be woven into fabrics, meshes or velours.
BUTYRIC ACID substituted in the beta or 3 position. It is one of the ketone bodies produced in the liver.
Authoritative treatises on drugs and preparations, their description, formulation, analytic composition, physical constants, main chemical properties used in identification, standards for strength, purity, and dosage, chemical tests for determining identity and purity, etc. They are usually published under governmental jurisdiction (e.g., USP, the United States Pharmacopoeia; BP, British Pharmacopoeia; P. Helv., the Swiss Pharmacopoeia). They differ from FORMULARIES in that they are far more complete: formularies tend to be mere listings of formulas and prescriptions.
Salts and derivatives of acetoacetic acid.
A gram-negative, facultatively chemoautotrophic bacterium, formerly called Wautersia eutropha, found in water and soil.
Derivatives of BUTYRIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain the carboxypropane structure.
Production of drugs or biologicals which are unlikely to be manufactured by private industry unless special incentives are provided by others.
A sport in which weights are lifted competitively or as an exercise.
Products in capsule, tablet or liquid form that provide dietary ingredients, and that are intended to be taken by mouth to increase the intake of nutrients. Dietary supplements can include macronutrients, such as proteins, carbohydrates, and fats; and/or MICRONUTRIENTS, such as VITAMINS; MINERALS; and PHYTOCHEMICALS.
These compounds stimulate anabolism and inhibit catabolism. They stimulate the development of muscle mass, strength, and power.
Benzoic acid or benzoic acid esters substituted with one or more bromine atoms.
A life-threatening complication of diabetes mellitus, primarily of TYPE 1 DIABETES MELLITUS with severe INSULIN deficiency and extreme HYPERGLYCEMIA. It is characterized by KETOSIS; DEHYDRATION; and depressed consciousness leading to COMA.
A condition characterized by an abnormally elevated concentration of KETONE BODIES in the blood (acetonemia) or urine (acetonuria). It is a sign of DIABETES COMPLICATION, starvation, alcoholism or a mitochondrial metabolic disturbance (e.g., MAPLE SYRUP URINE DISEASE).
Narrow pieces of material impregnated or covered with a substance used to produce a chemical reaction. The strips are used in detecting, measuring, producing, etc., other substances. (From Dorland, 28th ed)
An imagined sequence of events or mental images, e.g., daydreams.
Polymeric materials (usually organic) of large molecular weight which can be shaped by flow. Plastic usually refers to the final product with fillers, plasticizers, pigments, and stabilizers included (versus the resin, the homogeneous polymeric starting material). (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Publications printed and distributed daily, weekly, or at some other regular and usually short interval, containing news, articles of opinion (as editorials and letters), features, advertising, and announcements of current interest. (Webster's 3d ed)
Instruments or technological means of communication that reach large numbers of people with a common message: press, radio, television, etc.

Effects of glucagon and insulin on lipolysis and ketogenesis in sheep. (1/964)

The hepatic and portal productions of acetoacetate and beta-hydroxybutyrate and lipolysis were studied in normal and insulin-controlled alloxan-diabetic sheep. Since hyperinsulinemia is associated with glucagon administration, the latter group of sheep were used to maintain constant plasma insulin levels. After control values were obtained glucagon was infused intraportally at 90 mug/hr for two hours. The ketone body production by portal drained viscera was not significantly affected by glucagon. In alloxanized sheep, glucagon significantly (P less than 0.01) increased net hepatic production of acetoacetate (from -0.54 +/- 0.08 to 0.46 +/- 0.07 g/hr). Lipolysis also increased. However, in the normal sheep, hyperinsulinemia prevented any stimulatory effect of glucagon on hepatic ketogenesis and lipolysis. Therefore, while glucagon appears capable of stimulating ketogenesis andlipolysis, these effects are readily suppressed by insulin.  (+info)

The role of gamma-hydroxybutyric acid in the treatment of alcoholism: from animal to clinical studies. (2/964)

Since its discovery nearly 40 years ago, gamma-hydroxybutyric acid (GHB) has attracted several waves of scientific interest due to new developments in the knowledge of its mechanisms of action and ideas for its potential use in clinical practice. Its effects have been claimed to treat different psychiatric conditions, but over time its use has become limited to a few specific situations (e.g. sedating patients in non-painful surgical procedures and narcolepsy). New interest in the drug derives from its potential use in the treatment of alcoholism. Recent studies demonstrated a marked effect of the substance in suppressing ethanol (ETOH) withdrawal symptoms and in reducing craving for alcohol, compared to other available drugs. However, GHB has to be given under very careful supervision because of its side-effects, including the risk of abuse and dependence and possible interference with the metabolic pathways of endogenous GHB and ETOH. This short review discusses these and related issues and we hope that it will stimulate further interest in GHB.  (+info)

Effects of vanadium complexes with organic ligands on glucose metabolism: a comparison study in diabetic rats. (3/964)

1. Vanadium compounds can mimic actions of insulin through alternative signalling pathways. The effects of three organic vanadium compounds were studied in non-ketotic, streptozotocin-diabetic rats: vanadyl acetylacetonate (VAc), vanadyl 3-ethylacetylacetonate (VEt), and bis(maltolato)oxovanadium (VM). A simple inorganic vanadium salt, vanadyl sulphate (VS) was also studied. 2. Oral administration of the three organic vanadium compounds (125 mg vanadium element 1(-1) in drinking fluids) for up to 3 months induced a faster and larger fall in glycemia (VAc being the most potent) than VS. Glucosuria and tolerance to a glucose load were improved accordingly. 3. Activities and mRNA levels of key glycolytic enzymes (glucokinase and L-type pyruvate kinase) which are suppressed in the diabetic liver, were restored by vanadium treatment. The organic forms showed greater efficacy than VS, especially VAc. 4. VAc rats exhibited the highest levels of plasma or tissue vanadium, most likely due to a greater intestinal absorption. However, VAc retained its potency when given as a single i.p. injection to diabetic rats. Moreover, there was no relationship between plasma or tissue vanadium levels and any parameters of glucose homeostasis and hepatic glucose metabolism. Thus, these data suggest that differences in potency between compounds are due to differences in their insulin-like properties. 5. There was no marked toxicity observed on hepatic or renal function. However, diarrhoea occurred in 50% of rats chronically treated with VS, but not in those receiving the organic compounds. 6. In conclusion, organic vanadium compounds, in particular VAc, correct the hyperglycemia and impaired hepatic glycolysis of diabetic rats more safely and potently than VS. This is not simply due to improved intestinal absorption, indicating more potent insulin-like properties.  (+info)

Relationship between succinate transport and production of extracellular poly(3-hydroxybutyrate) depolymerase in Pseudomonas lemoignei. (4/964)

The relationship between extracellular poly(3-hydroxybutyrate) (PHB) depolymerase synthesis and the unusual properties of a succinate uptake system was investigated in Pseudomonas lemoignei. Growth on and uptake of succinate were highly pH dependent, with optima at pH 5.6. Above pH 7, growth on and uptake of succinate were strongly reduced with concomitant derepression of PHB depolymerase synthesis. The specific succinate uptake rates were saturable by high concentrations of succinate, and maximal transport rates of 110 nmol/mg of cell protein per min were determined between pH 5.6 and 6. 8. The apparent KS0.5 values increased with increasing pH from 0.2 mM succinate at pH 5.6 to more than 10 mM succinate at pH 7.6. The uptake of [14C]succinate was strongly inhibited by several monocarboxylates. Dicarboxylates also inhibited the uptake of succinate but only at pH values near the dissociation constant of the second carboxylate function (pKa2). We conclude that the succinate carrier is specific for the monocarboxylate forms of various carboxylic acids and is not able to utilize the dicarboxylic forms. The inability to take up succinate2- accounts for the carbon starvation of P. lemoignei observed during growth on succinate at pH values above 7. As a consequence the bacteria produce high levels of extracellular PHB depolymerase activity in an effort to escape carbon starvation by utilization of PHB hydrolysis products.  (+info)

Analyses of a polyhydroxyalkanoic acid granule-associated 16-kilodalton protein and its putative regulator in the pha locus of Paracoccus denitrificans. (5/964)

The polyhydroxyalkanoic acid (PHA) granule-associated 16-kDa protein (GA16 protein) of Paracoccus denitrificans was identified, and its corresponding gene was cloned and analyzed at the molecular level. The N-terminal amino acid sequence of GA16 protein revealed that its structural gene is located downstream from the PHA synthase gene (phaCPd) cloned recently (S. Ueda, T. Yabutani, A. Maehara, and T. Yamane, J. Bacteriol. 178:774-779, 1996). Gene walking around phaCPd revealed two new open reading frames (ORFs) possibly related to PHA synthesis, one of which was the phaPPd gene, encoding GA16 protein, and the other was the phaRPd gene, encoding a protein that is putatively involved in the regulation of the expression of phaPPd. Overproduction of PhaPPd was observed in Escherichia coli carrying phaPPd, but the overproduction was not observed in the presence of phaRPd. Coexpression of phaPPd and PHA biosynthesis genes in E. coli caused increases in both the number of poly-(3-hydroxybutyric acid) (PHB) granules and PHB content and caused decreases in both the size of the granules and the molecular weight of PHB. GA16 protein was considered a phasin protein. The phaRPd gene had significant similarities to stdC, a possible transcriptional factor of Comamonas testosteroni, as well as to other ORFs of unknown function previously found in other PHA-synthetic bacteria.  (+info)

Carbon and ammonia metabolism of Spirillum lipoferum. (6/964)

Intact cells and extracts from Spirillum lipoferum rapidly oxidized malate, succinate, lactate, and pyruvate. Glucose, galactose, fructose, acetate, and citrate did not increase the rate of O2 uptake by cells above the endogenous rate. Cells grown on NH+/4 oxidized the various substrates at about the same rate as did cells grown on N2. Added oxidized nicotinamide adenine dinucleotide generally enhanced O2 uptake by extracts supplied organic acids, whereas oxidized nicotinamide adenine dinucleotide phosphate had little effect. Nitrogenase synthesis repressed by growth of cells in the presence of NH+/4 was derepressed by methionine sulfoximine or methionine sulfone. The total glutamine synthetase activity from N2-grown cells was about eight times that from NH+/4-grown S. lipoferum; the response of glutamate dehydrogenase was the opposite. The total glutamate synthetase activity from N2-grown S. lipoferum was 1.4 to 2.6 times that from NH+/4-grown cells. The levels of poly-beta-hydroxybutyrate and beta-hydroxybutyrate dehydrogenase were elevated in cells grown on N2 as compared with those grown on NH+/4. Cell-free extracts capable of reducing C2H2 have been prepared; both Mg2+ and Mn2+ are required for good activity.  (+info)

Comparison of metabolism of free fatty acid by isolated perfused livers from male and female rats. (7/964)

Livers from normal, fed male and female rats were perfused with different amounts of [1-14C]oleate under steady state conditions, and the rates of uptake and utilization of free fatty acid (FFA) were measured. The uptake of FFA by livers from either male or female rats was proportional to the concentration of FFA in the medium. The rate of uptake of FFA, per g of liver, by livers from female rats exceeded that of the males for the same amount of FFA infused. The incorporation by the liver of exogenous oleic acid into triglyceride, phospholipid, and oxidation products was proportional to the uptake of FFA. Livers from female rats incorporated more oleate into triglyceride (TG) and less into phospholipid (PL) and oxidation products than did livers from male animals. Livers from female rats secreted more TG than did livers from male animals when infused with equal quantities of oleate. The incorporation of endogenous fatty acid into TG of the perfusate was inhibite) by exogenous oleate. At low concentrations of perfusate FFA, however, endogenous fatty acids contributed substantially to the increased output of TG by livers from female animals. Production of 14CO2 and radioactive ketone bodies increased with increasing uptake of FFA. The partition of oleate between oxidative pathways (CO2 production and ketogenesis) was modified by the availability of the fatty acid substrate with livers from either sex. The percent incorporation of radioactivity into CO2 reached a maximum, whereas incorporation into ketone bodies continued to increase. The output of ketone bodies was dependent on the uptake of FFA, and output by livers from female animals was less than by livers from male rats. The increase in rate of ketogenesis was dependent on the influx of exogenous FFA, while ketogenesis from endogenous sources remained relatively stable. The output of glucose by the liver increased with the uptake of FFA, but no difference due to sex was observed. The output of urea by livers from male rats was unaffected by oleate, while the output of urea by livers from females decreased as the uptake of FFA increased. A major conclusion to be derived from this work is that oleate is not metabolized identically by livers from the two sexes, but rather, per gram of liver, livers from female rats take up and esterify more fatty acid to TG and oxidize less than do livers from male animals; livers from female animals synthesize and secrete more triglyceride than do livers from male animals when provided with equal quantities of free fatty acid.  (+info)

Removal of endotoxin during purification of poly(3-hydroxybutyrate) from gram-negative bacteria. (8/964)

Poly(3-hydroxybutyrate) (PHB) was produced by cultivating several gram-negative bacteria, including Ralstonia eutropha, Alcaligenes latus, and recombinant Escherichia coli. PHB was recovered from these bacteria by two different methods, and the endotoxin levels were determined. When PHB was recovered by the chloroform extraction method, the endotoxin level was less than 10 endotoxin units (EU) per g of PHB irrespective of the bacterial strains employed and the PHB content in the cell. The NaOH digestion method, which was particularly effective for the recovery of PHB from recombinant E. coli, was also examined for endotoxin removal. The endotoxin level present in PHB recovered by 0.2 N NaOH digestion for 1 h at 30 degrees C was higher than 10(4) EU/g of PHB. Increasing the digestion time or NaOH concentration reduced the endotoxin level to less than 1 EU/g of PHB. It was concluded that PHB with a low endotoxin level, which can be used for various biomedical applications, could be produced by chloroform extraction. Furthermore, PHB with a much lower endotoxin level could be produced from recombinant E. coli by simple NaOH digestion.  (+info)

(2S)-2-amino-4-hydroxybutanoic acid,hydrochloride 196950-52-4 route of synthesis, (2S)-2-amino-4-hydroxybutanoic acid,hydrochloride chemical synthesis methods, (2S)-2-amino-4-hydroxybutanoic acid,hydrochloride synthetic routes ect.
2-Hydroxybutyric acid, also known as alpha-hydroxybutyrate and α-hydroxybutyrate, is a hydroxybutyric acid with the hydroxyl group on the carbon adjacent to the carboxyl. It is a chiral compound having two enantiomers, D-2-hydroxybutyric acid and L-2-hydroxybutyric acid. (R)-2-hydroxybutyric acid (S)-2-hydroxybutyric acid 2-Hydroxybutyrate, the conjugate base of 2-hydroxybutyric acid, is produced in mammalian tissues (principally hepatic) that catabolize L-threonine or synthesize glutathione. Oxidative stress or detoxification demands can dramatically increase the rate of hepatic glutathione synthesis. Under such metabolic stress conditions, supplies of L-cysteine for glutathione synthesis become limiting, so homocysteine is diverted from the transmethylation pathway forming methionine into the transsulfuration pathway forming cystathionine. 2-Hydroxybutyrate is released as a byproduct when cystathionine is cleaved to cysteine that is incorporated into glutathione. Chronic shifts in the rate of ...
R)-3-Hydroxybutyric acid is a butyric acid substituted with a hydroxyl group in the beta or 3 position. It is involved in the synthesis and degradation of ketone bodies. Like the other ketone bodies (acetoacetate and acetone), levels of beta-hydroxybutyrate are raised in the blood and urine in ketosis. Beta-hydroxybutyrate is a typical partial-degradation product of branched-chain amino acids (primarily valine) released from muscle for hepatic and renal gluconeogenesis This acid is metabolized by 3-hydroxybutyrate dehydrogenase (catalyzes the oxidation of D-3-hydroxybutyrate to form acetoacetate, using NAD+ as an electron acceptor). The enzyme functions in nervous tissues and muscles, enabling the use of circulating hydroxybutyrate as a fuel. In the liver mitochondrial matrix, the enzyme can also catalyze the reverse reaction, a step in ketogenesis. 3-Hydroxybutyric acid is a chiral compound having two enantiomers, D-3-hydroxybutyric acid and L-3-hydroxybutyric acid. In humans, ...
phdthesis{4347398, author = {Ingels, Ann-Sofie}, keywords = {mass spectrometry,Gas Chromatography,dried blood spots,headspace-trap,Gamma-hydroxybutyric acid}, language = {eng}, pages = {XIV, 265}, publisher = {Ghent University. Faculty of Pharmaceutical Sciences}, school = {Ghent University}, title = {Determination of gamma-hydroxybutyric acid in microvolumes of biological fluids following direct derivatization and gas chromatography mass spectrometry}, year = {2013 ...
摘要:Based on the metabolic analysis, a succinate and polyhydroxybutyrate (PHB) co-production pathway was designed and engineered in Escherichia coli MG1655. Batch cultivation of the engineered E. coli revealed that it was able to accumulate both extracellular succinate and intracellular PHB simultaneously. PHB accumulation not only improved succinate production, but also reduced pyruvate and acetate secretion. With a consumption of 45 g l(-1) glucose, E. coli QZ1112 was shown to accumulate 24.6 g l(-1) succinate and 4.95 g l(-1) PHB in batch fermentation. The PHB content reached 41.3 wt.% of its cell dry weight, which suggested that the cell debris can be used as value added by-product. ...
3-Hydroxybutyric acid (or beta-hydroxybutyrate) is a ketone body. Like the other ketone bodies (acetoacetate and acetone), levels of 3-hydroxybutyrate in blood and urine are raised in ketosis. In humans, 3-hydroxybutyrate is synthesized in the liver from acetyl-CoA, and can be used as an energy source by the brain when blood glucose is low. Blood levels of 3-Hydroxybutyric acid levels may be monitored in diabetic patients to look for diabetic ketoacidosis. Persistent mild hyperketonemia is a common finding in newborns. Ketone bodies serve as an indispensable source of energy for extrahepatic tissues, especially the brain and lung of developing mammals. Another important function of ketone bodies is to provide acetoacetyl-CoA and acetyl-CoA for synthesis of cholesterol, fatty acids, and complex lipids. During the early postnatal period, acetoacetate (AcAc) and beta-hydroxybutyrate are preferred over glucose as substrates for synthesis of phospholipids and sphingolipids in accord with requirements ...
Polymers based on olefins have wide commercial applicability. However, they are made from non-renewable resources and are characterised by difficulty in disposal where recycle and re-use is not feasible. Poly-beta-hydroxybutyric acid (PHB) provides one example of a polymer made from renewable resources. Before motivating its widespread use, the advantages of a renewable polymer must be weighed against the environmental aspects of its production. Previous studies relating the environmental impacts of petroleum-based and bio-plastics have centred on the impact categories of global warming and fossil fuel depletion. Cradle-to-grave studies report equivalent or reduced global warming impacts, in comparison to equivalent polyolefin processes. This stems from a perceived CO(2) neutral status of the renewable resource. Indeed, no previous work has reported the results of a life cycle assessment (LCA) giving the environmental impacts in all major categories. This study investigates a cradle-to-gate LCA ...
Production of the biopolymer polyhydroxybutyrate (PHB) in Saccharomyces cerevisiae starts at the end of exponential phase particularly when the specific growth rate is decreased due to the depletion of glucose in the medium. The specific growth rate and the type of carbon source (fermentable/non-fermentable) have been known to influence the cell physiology and hence affect the fermentability of S. cerevisiae. The production of PHB utilizes cytosolic acetyl-CoA as a precursor and the S. cerevisiae employed in this study is therefore a strain with the enhanced cytosolic acetyl-CoA supply. Growth and PHB production at different specific growth rates were evaluated on glucose, ethanol and a mixture of glucose and ethanol as carbon source. Ethanol as carbon source yielded a higher PHB production compared to glucose since it can be directly used for cytosolic acetyl-CoA production and hence serves as a precursor for PHB production. However, this carbon source results in lower biomass yield and hence it was
Polyhydroxybutyrate (PHB) is one of the polyhydroxyalkanoates (PHAs) which has biodegradable and biocompatible properties. They are adopted in the biomedical field, in, for example, medical implants and drug delivery carriers. This study seeks to promote the production of PHB by Vibrio sp. BM-1, isolated from a marine environment by improving constituents of medium and implementing an appropriate fermentation strategy. This study successfully developed a glycerol-yeast extract-tryptone (GYT) medium that can facilitate the growth of Vibrio sp. BM-1 and lead to the production of 1.4 g/L PHB at 20 h cultivation. This study also shows that 1.57 g/L PHB concentration and 16% PHB content were achieved, respectively, when Vibrio sp. BM-1 was cultivated with MS-GYT medium (mineral salts-supplemented GYT medium) for 12 h. Both cell dry weight (CDW) and residual CDW remained constant at around 8.2 g/L and 8.0 g/L after the 12 h of cultivation, until the end of the experiment. However, both 16% of PHB content and
4-Hydroxybutyric acid (GHB) is a precursor and a metabolite of gamma-aminobutyric acid (GABA), it is anticipated that GHB acts as a central nervous. system (CNS)neuromodulator, mediating its effects through GABA and GHB-specific receptors, or by affecting dopamine transmission.(PMID: 16620539 ). Gamma-hydroxybutyric acid (GHB) occurs naturally in all. mammals, but its function remains unknown. GHB is labeled as an illegal drug in most countries,but also used as a legal drug (Xyrem) in patients with narcolepsy. In high doses, GHB inhibits the CNS, inducing sleep and inhibiting the respiratory drive. In lower doses, its euphoriant effect predominates (PMID: 17658710 ...
rdf:RDF xmlns:dcterms=http://purl.org/dc/terms/ xmlns:dc=http://purl.org/dc/elements/1.1/ xmlns:rdf=http://www.w3.org/1999/02/22-rdf-syntax-ns# xmlns:bibo=http://purl.org/ontology/bibo/ xmlns:dspace=http://digital-repositories.org/ontologies/dspace/0.1.0# xmlns:foaf=http://xmlns.com/foaf/0.1/ xmlns:void=http://rdfs.org/ns/void# xmlns:xsd=http://www.w3.org/2001/XMLSchema# , ,rdf:Description rdf:about=https://kops.uni-konstanz.de/rdf/resource/123456789/8572, ,dcterms:isPartOf rdf:resource=https://kops.uni-konstanz.de/rdf/resource/123456789/28/, ,dcterms:abstract xml:lang=deu,Ilyobacter delafieldii produced an extracellular poly-[3-hydroxybutyrate (PHB) depolymerase when grown on PHB; activity was not detected in cultures grown on 3-hydroxybutyrate, crotonate, pyruvate or lactate. PHB depolymerase activity was largely associated with the PHB granules (supplied as growth substrate), and only 16 % was detected free in the culture supernatant. Monomeric 3-hydroxybutyrate was ...
γ-Hydroxybutyric acid (GHB), a drug of abuse, exhibits saturable renal clearance and capacity-limited metabolism. The objectives of this study were to construct a mechanistic toxicokinetic (TK) model describing saturable renal reabsorption and capacity-limited metabolism of GHB and to predict the effects of inhibition
2) Gamma-butyrolactone (other names include: GBL; dihydro-2(3H)-furanone; 1,2-butanolide; 1,4-butanolide; 4-hydroxybutanoic acid lactone; gamma-hydroxybutyric acid lactone); ...
Discover exactly what 4 Amino 3 Hydroxybutyric Acid does for your skin. Heres everything you need to know about this skincare ingredient.
Poly(3-hydroxybutyrate) (PHB) synthesis was analyzed under microaerobic conditions in a recombinant Escherichia coli arcA mutant using glycerol as the main carbon source. The effect of several additives was assessed in a semi-synthetic medium by the one-factor-at-a-time technique. Casein amino aci …
The mechanism of the enzymatic degradation of poly([R]-3-hydroxybutyrate) (PHB) was investigated by using well-defined model substrates, including both linear and cyclic [R]-3-hydroxybutyrate (3HB) and [R]-3-hydroxyvalerate (3HV) oligomers, with two different PHB depolymerases. The linear and cyclic oligomers containing from 2 to 10 repeating units were hydrolyzed in solutions of the depolymerase isolated from Aspergillus fumigatus and Alcaligenes faecalis, and the rates of hydrolysis and types of products formed were characterized. Both of the depolymerases catalyzed the hydrolysis of the cyclic oligomers (macrolides) which contained more than three 3HB and 3HV repeating units. The degradation reactions of the linear and cyclic 3HB oligomers with the A. fumigatus depolymerase gave similar ratios of monomer-to-dimer products, but PHB itself formed mostly monomer on hydrolysis, indicating that the enzymatic hydrolysis reactions occurred by different mechanisms for these different types of ...
R.C.O is an online chemical store known for its professional services and high-quality products. We have been selling -liquid-g-bl-cas-no-96-48-0 in the USA, UK, Canada, Germany, and Australia for an extended period. You can place your order for -liquid-g-bl-cas-no-96-48-0 from any edge of the world. We are accessible to all our customers at the global level. Hence you can buy -liquid-g-bl-cas-no-96-48-0 online at any time from anywhere.buy colorless liquid GBL online ...
R.C.O is an online chemical store known for its professional services and high-quality products. We have been selling -liquid-g-bl-cas-no-96-48-0 in the USA, UK, Canada, Germany, and Australia for an extended period. You can place your order for -liquid-g-bl-cas-no-96-48-0 from any edge of the world. We are accessible to all our customers at the global level. Hence you can buy -liquid-g-bl-cas-no-96-48-0 online at any time from anywhere.buy colorless liquid GBL online ...
The National Institute of Standards and Technology (NIST) uses its best efforts to deliver a high quality copy of the Database and to verify that the data contained therein have been selected on the basis of sound scientific judgment. However, NIST makes no warranties to that effect, and NIST shall not be liable for any damage that may result from errors or omissions in the Database ...
PHA research has increased in an effort to understand its potential, as well as to counteract some of the issues preventing its widespread use. Because of its high cost, PHB has been used mostly for specialized medical applications, including bone fixation, drug delivery systems and degradable sutures (Knowles, 1993: Kose, 2004; Holmes, 1985: Chen, 2005), and less for commercial packaging. High expense is the primary factor preventing industrial scale PHB production and commercialization. A low estimate for the cost of PHB production is $3-5/kg PHB versus $1/kg petroleum-based plastics (Choi, 1997). Some of the factors that contribute to this cost difference are reactor operation, substrate costs, and the extraction and downstream processing procedures (Coats 2005). There are many techniques that have been researched, or are currently being researched, to eliminate some of these major costs. Production methods for PHB involve the use of recombinant microorganisms, crops of transgenic PHB ...
PHA research has increased in an effort to understand its potential, as well as to counteract some of the issues preventing its widespread use. Because of its high cost, PHB has been used mostly for specialized medical applications, including bone fixation, drug delivery systems and degradable sutures (Knowles, 1993: Kose, 2004; Holmes, 1985: Chen, 2005), and less for commercial packaging. High expense is the primary factor preventing industrial scale PHB production and commercialization. A low estimate for the cost of PHB production is $3-5/kg PHB versus $1/kg petroleum-based plastics (Choi, 1997). Some of the factors that contribute to this cost difference are reactor operation, substrate costs, and the extraction and downstream processing procedures (Coats 2005). There are many techniques that have been researched, or are currently being researched, to eliminate some of these major costs. Production methods for PHB involve the use of recombinant microorganisms, crops of transgenic PHB ...
putative poly(3-hydroxybutyrate) depolymerase [polyhydroxybutyrate depolymerase] ATGCAGCCGCCGCCGTTCCGGGGAATCCTCACCCCGCTGTTCCCCCTCTCCTCCTCGCCG CCGGTCGGGTCGTTGTCGCGTCCGGGACGGCGGGGGGTGCTCACCCGTCTCGTGGCCGTC GTGGCCCTCGTACTCGGAGCGGCCCTGCTCGGCCCGGCGCCGACGGCCCACGCCGCGGCG GGCCTGGCCAAGCCCGGTCTGACCAAGGCGGACCTGACCGAGGTCGCGGACTTCGGCACG AACCCGGGCCGGCTGAACATGTACGTCTACCGGCCCGCGTCCCTGCCCGCGGAGCCGGCG GTGGTGTTCGCCCTGCACGGTTGCACCCAGGACGCCCAGGGCTACGCCGACAACTCCGGC CTGCTCTCATTCGCGGACCGCTATGGCTTCCTGCTCGTGTTCGCCGAGACCACGTCGTCG AACAACGCGAACAGGTGCTTCAACTGGTTCCAGAGCAGCGACAACCGCAGGGGCCAGGGC GAAGCCGCGTCGATCCGGCAGATGGCCGCTCACACCGTCTCCGCCTACGGCGCGGACCCC CAGCGCACCTACATCACCGGGCTGTCCGCCGGCGGTGCCATGACGTCGGTGATGCTCGCC ACCTATCCGGACGTCTTCCAGGCCGGCGCGGTCGTCGCCGGCCTGCCCTTCGGCTGTGCC ACCGACGTCAGCAGCGCGTACCTGTGCATGAACCCCGGGACCGACCTGACCGCGGACCAG TGGGCGCGGCGGGTCCGTGACGGCTACCCCTCGTGGTCGGGCCCGTGGCCGCGCGTGGCC ATCTGGCACGGCGACAAGGACACCACCGTCGCGCCGCGCAACGCCGACGAGTTGCGCGAC CAGTGGACCGCTGTGCACGGCGTGTCCCAGACGCCGGACCGTACCTCGGTGATCGGCCCG ...
In previous situations the hydrocarbons were degraded only to form biomass and CO2. It is interesting to see how much product could be made from hydrocarbons. PHB is a polymer of polyhydroxybutyrate. The production pathway of PHB is well known. PHB is a solid product which is easy to recover in the down stream process. The pathway is displayed in figure 12. The lumped reaction was implemented in CNA as; 2 acetyl-CoA + NADPH -, (R)-3-hydroxybutanoyl-CoA the polymerization reaction just consumes (R)-3-hydroxybutanoyl-CoA, because a solid has no concentration in the liquid and therefore does not need to fulfill the steady-state condition. There are limiting factors to this reaction, but those are not considered in this analysis. ...
In previous situations the hydrocarbons were degraded only to form biomass and CO2. It is interesting to see how much product theoretically could be made from hydrocarbons. PHB is a polymer of polyhydroxybutyrate. The production pathway of PHB is well known. PHB is a solid product which is easy to recover in the down stream process. The pathway is displayed in figure 12. The lumped reaction was implemented in CNA as; 2 acetyl-CoA + NADPH -, (R)-3-hydroxybutanoyl-CoA the polymerization reaction just consumes (R)-3-hydroxybutanoyl-CoA, because a solid has no concentration in the liquid and therefore does not need to fulfill the steady-state condition. There are limiting factors to this reaction, but those are not considered in this analysis. ...
Elindítottam a League of Legends-et de a gép RADS hibát írt ki akkor mi a teendő hogy elhárítsam azt?Próbáltam már újra rakni a játékot de akkor is azt írja ki.Légyszíves segítsetek.
Can you name the Phar 401 Druglist Test your knowledge on this science quiz to see how you do and compare your score to others. Quiz by mpchiang
Study Phar1603 using smart web & mobile flashcards created by top students, teachers, and professors. Prep for a quiz or learn for fun!
Looking for online definition of 3-hydroxybutanoic acid in the Medical Dictionary? 3-hydroxybutanoic acid explanation free. What is 3-hydroxybutanoic acid? Meaning of 3-hydroxybutanoic acid medical term. What does 3-hydroxybutanoic acid mean?
Previous studies (24, 31) that investigated the effect of PhaP on PHB accumulation in recombinant E. coli carrying pha from C. necator have shown an increase in polymer accumulation and a higher number of smaller PHA granules in strains carrying phaP. York et al. (31) reported a 100% increase in polymer production in 105-h flask cultures in LB containing 2% glucose. We analyzed the effect of phaP of Azotobacter sp. strain FA8 on PHB accumulation and bacterial growth in recombinant E. coli carrying the pha-synthesizing genes from this strain. As expected, the cells carrying PhaP accumulated more polymer. When the effect of PhaP on cell growth was first analyzed in flask cultures grown in minimal medium with lactose, no differences were observed, but when cells were grown in conditions in which higher cell densities were achieved, those carrying phaP grew more and accumulated more PHB. When cultures were grown in a bioreactor using glycerol, the differences observed were greater. The increase in ...
SUMMARY: This is a final rule issued by the Deputy Administrator of the Drug Enforcement Administration (DEA) placing gamma-hydroxybutyric acid (GHB) and its salts, isomers, and salts of isomers into Schedule I of the Controlled Substances Act (CSA) pursuant to Public Law 106-172. Public. [[Page 13236]]. Law 106-172 also imposes Schedule III physical security requirements for storage on registered manufacturers and distributors of GHB when it is manufactured, distributed or possessed in accordance with Food and Drug Administration (FDA)-authorized Investigational New Drug (IND) exemptions under the Federal Food, Drug and Cosmetic Act (FFDCA). In addition, this final rule places FDA-approved products containing GHB into Schedule III, if or when they are approved.. EFFECTIVE DATE: March 13, 2000.. FOR FURTHER INFORMATION CONTACT: Frank Sapienza, Chief, Drug and Chemical Evaluation Section, Office of Diversion Control, Drug Enforcement Administration, Washington, DC 20537, (202) ...
EIIANtr is a member of a truncated phosphotransferase (PTS) system that serves regulatory functions and exists in many Proteobacteria in addition to the sugar transport PTS. In Escherichia coli, EIIANtr regulates K+ homeostasis through interaction with the K+ transporter TrkA and sensor kinase KdpD. In the β-Proteobacterium Ralstonia eutropha H16, EIIANtr influences formation of the industrially important bioplastic poly(3-hydroxybutyrate) (PHB). PHB accumulation is controlled by the stringent response and induced under conditions of nitrogen deprivation. Knockout of EIIANtr increases the PHB content. In contrast, absence of enzyme I or HPr, which deliver phosphoryl groups to EIIANtr, has the opposite effect. To clarify the role of EIIANtr in PHB formation, we screened for interacting proteins that co-purify with Strep-tagged EIIANtr from R. eutropha cells. This approach identified the bifunctional ppGpp synthase/hydrolase SpoT1, a key enzyme of the stringent response. Two-hybrid and far-Western
We describe the rapid and sensitive detection of 4-hydroxybutyric acid, which is a marker compound for succinic semialdehyde dehydrogenase (SSADH) deficiency. Urinary 4-hydroxybutyric acid and 3,4-dihydroxybutyric acid were targeted, quantified by gas chromatography-mass spectrometry after simplifie …
Ralstonia eutropha H16 is a facultatively autotrophic hydrogen-oxidizing bacterium capable of producing polyhydroxybutyrate (PHB)-based bioplastics. As PHBs physical properties may be improved by incorporation of medium-chain-length fatty acids (MCFAs), and MCFAs are valuable on their own as fuel and chemical intermediates, we engineered R. eutropha for MCFA production. Expression of UcFatB2, a medium-chain-length-specific acyl-ACP thioesterase, resulted in production of 14 mg/L laurate in wild-type R. eutropha. Total fatty acid production (22 mg/L) could be increased up to 2.5-fold by knocking out PHB synthesis, a major sink for acetyl-CoA, or by knocking out the acyl-CoA ligase fadD3, an entry point for fatty acids into β-oxidation. As ΔfadD3 mutants still consumed laurate, and because the R. eutropha genome is predicted to encode over 50 acyl-CoA ligases, we employed RNA-Seq to identify acyl-CoA ligases upregulated during growth on laurate. Knockouts of the three most highly upregulated acyl-CoA
A method for controlling and modifying biopolymer synthesis by manipulation of the genetics and enzymology of synthesis of polyhydroxybutyrate (PHB) and polyhydroxyalkanoate (PHA) polyesters at the molecular level in procaryotic and eukaryotic cells, especially plants. Examples demonstrate the isolation, characterization, and expression of the genes involved in the production of PHB and PHA polymers. Genes encoding the enzymes in the PHB and PHA synthetic pathway (beta-ketothiolase, acetoacetyl-CoA reductase and PHB polymerass or PHA polymerase) from Zoogloea ramigera strain I-16-M, Alcaligenes eutrophus, Nocardia salmonicolur, and P. olevorans were identified or isolated and expressed in a non-PHB producing organism, E. coli. Specific modifications to the polymers include variation in the chain length of the polymers and incorporation of different monomers into the polymers to produce co-polymers with different physical properties.
Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte associated with important agricultural crops. It produces polyhydroxybutyrate (PHB) which is stored intracellularly as granules. However, PHB metabolism and regulatory control is not yet well studied in this organism. In this work we describe the characterization of the PhbF protein from H. seropedicae SmR1 which was purified and characterized after expression in E. coli. The purified PhbF protein was able to bind to eleven putative promoters of genes involved in PHB metabolism in H. seropedicae SmR1. In silico analyses indicated a probable DNA-binding sequence which was shown to be protected in DNA footprinting assays using purified PhbF. Analyses using lacZ fusions showed that PhbF can act as a repressor protein controlling the expression of PHB metabolism-related genes. Our results indicate that H. seropedicae SmR1 PhbF regulates expression of phb-related genes by acting as a transcriptional repressor. The knowledge of the PHB metabolism
Leading Italian studies support the use of γ-hydroxybutyric acid (GHB), not only in the treatment of the alcohol withdrawal syndrome, but also in maintaining alcohol abstinence. GHB gives a better result than naltrexone and disulfiram in maintaining abstinence, and it has a better effect on craving than placebo or disulfiram. The problem is that about 30-40% of alcoholics are non-responders to GHB therapy. In our clinical practice, we speculate that by combining disulfiram with GHB treatment we may be able to achieve a kind of antagonist effect by using the psychological threat of disulfiram (adversative effect) while taking advantage of the anticraving effect of GHB, despite the limitation of its non-blockade effect on alcohol. In this context, to improve the outcome in GHB long-term treated alcoholics, we added disulfiram to GHB in the management of GHB treatment-resistant alcoholics. In this study we compared retention in treatment of 52 patients who were treated with the GHB-disulfiram
Abstract: Determined optimum fermentation medium of Pseudomonas sp. koreensis that carbon, nitrogen species were glucose and ammonium chloride by single factor test. At the same time, with changing concentration of each component in culture medium, test results showed that three factors of glucose, ammonium chloride and potassium hydrogen phosphate were major on PHB yield. Based on single factor test, using Design Expert8.0 to design Box-Behnken response response surface experimental with three factors and three levels, five central points in 17 groups, fit regression equation was get. Finally, determined optimum fermentation medium was glucose concentration 16.64g/L, chloride concentration 3.94g/L and potassium hydrogen phosphate concentration 1.45g/L, PHB production reached 3.18g/L, compared with before optimization increased by 1.8 times, effect was significant. ...
Definition of ß-hydroxybutyric acid. Provided by Stedmans medical dictionary and Drugs.com. Includes medical terms and definitions.
3-hydroxybutyric acid) (PHB) is the most commonly produced polyhydroxyalkanoate formed naturally inside many genera of bacteria and archaea when nutrients are limited and a carbon-source is available in excess. These water-insoluble biopolyester spherical beads in the size range of 20-800 nm can be recombinantly produced by insertion of the required PHB biosynthesis genes into alternative bacterial hosts and then culturing the organisms under suitable conditions. A gene fusion can also be made to enable production of PHB beads which display the selected proteins abundantly at the surface of the bead. Vaccines are needed which stimulate cell-mediated immunity and are effective at reducing intracellular infections such as tuberculosis, neosporosis and many viral infections. These diseases are responsible for a huge burden to human and animal health. Particulate vaccines target antigen presenting cells and cellular immune responses to protein antigens are enhanced when particulate vaccines are ...
Gamma Butyrolactone Gamma Butyrolactone (GBL) Product Name: Gamma Butyrolactone Key words: Gamma Butyrolactone, gamma -BLO, 1, 4-Butyrolactone, 4-Hydroxybutyric acid lactone, 4-Hydroxybutanoic acid lactone 4-Butanolide 1. CAS: 96-48-0 2. Molecular...
Shop Beta-ketothiolase ELISA Kit, Recombinant Protein and Beta-ketothiolase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
In this work, sludge was submitted to aerobic dynamic substrate feeding. Two sequencing batch reactors were operated, with acetate or propionate as carbon substrates. When acetate was used the system only produced a homopolymer of polyhydroxybutyrate (PHB). In order to maximize the PHB production, tests with different concentrations of acetate and ammonia were preformed. The best results (67.2% of PHB by cell dry weight) were obtained for 0.7 Nmmol/l of ammonia and 180 Cmmol/l of acetate. The PHB cell content was further improved by pupulse addition of substrate, three times 60 Cmmol/l of acetate, reaching a value of 78.5%. Propionate can be used as a precursor for hydroxyvalerate. In conjunction with other substrates, it allows for the formation of copolymers, which present better processing properties on commercial applications. Tests with different concentrations of propionate and ammonia were performed. Under the operating conditions used, the maximum PHA accumulated inside cells was 34.8%, ...
Most commercial plastics are synthetic polymers derived from petrochemicals. They tend to resist biodegradation. PHB-derived plastics are attractive because they are compostable and derived from renewables and are bio-degradable. ICI had developed the material to pilot plant stage in the 1980s, but interest faded when it became clear that the cost of material was too high, and its properties could not match those of polypropylene. In 1996 Monsanto (who sold PHB as a copolymer with PHV under the trade name Biopol) bought all patents for making the polymer from ICI/Zeneca. However, Monsantos rights to Biopol were sold to the American company Metabolix in 2001[5] and Monsantos fermenters producing PHB from bacteria were closed down at the start of 2004. Monsanto began to focus on producing PHB from plants instead of bacteria.[6] But now with so much media attention on GM crops, there has been little news of Monsantos plans for PHB.[7]. In June 2005, a US company, Metabolix, received the ...
When HCrO4- is reduced by formate in solutions buffered by 2-ethyl-2-hydroxybutanoic acid and its anion, chelated complexes of both Cr(IV) and Cr(V), both of them stabilized in the medium used, are formed. It appears that Cr(V) is not generated directly from the Cr(VI)-formate reaction but arises instead from oxidation of Cr(IV) by Cr(VI). When the Cr(VI)-formate reaction is allowed to go to completion in the presence of [Cl(NH3)5Co]2+, a scavenger for Cr(II), 84-86% of the Cr(VI) taken is found to be converted to Cr(II), indicating that nearly all of the reacting system proceeds through Cr(IV) and bypasses the more usual state Cr(III). Initial rates for formation of Cr(IV) lead to a rate law pointing to a transition state containing the two redox partners, two ligating carboxyl groups, and two units of H+. Substitution of DCO2- for HCO2- retards formation of Cr(IV) by a factor of 3.3, whereas the solvent isotope affect, rate D2O/rate H2O, favors the deuterated system by a factor of 1.4. Our
HBD has been used as a substitute for LDH-1 (heart) isoenzyme measurement. Actually, HBD is total LDH that is forced to act on a a-ketobutyric acid substrate instead of pyruvic or lactic acid. Under these conditions, LDH-1 and LDH-2 show relatively greater activity than LDH-5, so that HBD therefore indirectly measures LDH-1 (heart) activity. However, if the LDH-5 (liver) value is elevated sufficiently, it will also produce measurable HBD effect. Therefore, HBD is not as specific as electrophoresis or heat fractionation in separating heart from liver isoenzymes. Nevertheless, since HBD assay is easier to perform (and therefore cheaper) than LDH isoenzyme assay, some follow the practice of using a more specific isoenzyme method if in doubt about LDH heart versus liver contribution. Once there is proof that the heart fraction is elevated, they follow subsequent activity levels with HBD.. Causes of lactic dehydrogenase fraction 1 elevation ...
Supplier of Metals, Alloys, Ceramics, Polymers, Compounds, Intermetallics & Composites for research & industrial markets. View our small quantity catalog.
Glycerol, a byproduct of many industrial processes, mainly in biodiesel production, is generated in quantities far beyond current consumption in traditional applications, thus making it a residue for which interesting applications are lacking. The objective of this work was the conversion of the glycerol-rich byproduct obtained in biodiesel production facilities into biopolymers using a Pseudomonas strain. Two distinct biopolymers were simultaneously produced: an extracellular polysaccharide (EPS) and intracellular polyhydroxybutyrate (PHB). Under optimized EPS production conditions in fed-batch mode, the maximum cellular PHB content was 39 % of CDW and the maximum EPS concentration was 12 g/l. The process is rather versatile since it may be controlled to favor the production of one or both biopolymers. This new process constitutes a promising technology for the valorization of glycerol-rich byproduct, since it accomplishes attractive EPS productivities with relatively low production costs. In addition,
Mémoire. Introduction: ----------------- In this short discussion I will discuss about 3 classes of memory modulators: A.Cannabinoids B.Benzodiazepines G.Gamma-Hydroxybutyric acid(Gamma-OH,4-OHB,GHB) The structure of Memory ----------------------------------- Through an original research I have discovered that biological memories of complex organisms,like mammals,are organised in basic,fractal-like,structures of which the reiterative elements are called M.H.Vs(Motifs Homologiquement Variants),in French,which can be translated,into English,as Patterns of Homologuous Variations(see:http://dog.net.uk/claude) These MHV are organised in such a way so as to put clear physiological limits on what is possible or not possible in memory modulation and recall. For instance,what we call consciousness can only exist within a limited range of metabolic activity. If the metabolic activity going on in MHVs is too low we cannot,then,properly recall our memories. If the metabolic activity going on in MHVs ...
This morning, Ellen and I awoke bright and early to get to the hospital for Hibas surgery. We walked with Malika (Hibas mother) and Hiba back to the surgical waiting room and played with maracas, small wagons, and balloon gloves. Hiba was in very good spirits going into surgery. When she went into her surgery, Malika was extremely excited. She has been waiting for this for a long time, and this surgery was the first surgery done in Israel on a Moroccan child. So it was a monumental day for all. Hiba was out of surgery within three and a half hours, and her mother followed as they wheeled ther through corridor to the ICU. In this video you can hear her saying Alhamdulillah, or praise God. ...
Identifying drugs.View drugs with images view drugs.As list view paraphernalia.Narcotics opioids drugs of concern.Drug paraphernalia qa.How to identify drug paraphernalia.Benzodiazepines.Dxm dextromethorphan ecstasy or mdma also known as molly flakka alpha-pvp ghb - gamma-hydroxybutyric acid.Methamphetamine.Pcp phencyclidine.
TY - JOUR. T1 - Competition of glycerol with other oxidizable substrates in rat brain. AU - McKenna, M. C.. AU - Bezold, L. I.. AU - Kimatian, S. J.. AU - Tildon, J. T.. PY - 1986/1/1. Y1 - 1986/1/1. N2 - The rate of conversion of [1,3-14C]glycerol into 14CO2 was measured in the presence and absence of unlabelled alternative substrates in whole homogenates from the brains of young (4-6 and 18-20 days old) and adult rats. Unlabelled glucose decreased 14CO2 production from [1,3-14C]glycerol by about 40% at all ages studied. Unlabelled 3-hydroxybutyrate significantly decreased the 14CO2 production from both low (0.2 mM) and high (2.0 mM) concentrations of glycerol in 4-6- and 18-20-day-old rat pups. However, the addition of 3-hydroxybutyrate had no effect on the rate of 14CO2 production from 2.0 mM-glycerol in adult rats, suggesting that the interaction of 3-hydroxybutyrate with glycerol in adult rat brain is complex and may be related to the biphasic kinetics previously reported for glycerol ...
...Poly-3-hydroxybutyrate (PHB) is a thermoplastic polyester which occurs...PHB is synthesised in bacteria from acetyl-CoA using the enzymes -keto...Dr. Franziska Hempel and Prof Uwe Maier from the LOEWE-Centre Synmikro...In the quest to find biodegradable and renewable sources of plastics t...,Plastic,fantastic,-,the,future,of,biodegradables,biological,biology news articles,biology news today,latest biology news,current biology news,biology newsletters
This is a magnesium salt of beta-hydroxybutyric acid, a compound normally made by the body in times of stress. It is one of the first ketone-forming compounds to form during times of starvation and intense physical exercise. It serves as a biochemical messenger to tell other cells to speed up their metabolism, and it also serves as a ready fuel source for brain cells.. Diets such as the keto diet rely on BHB to provide energy during severe calorie restriction. BHB rises during uncontrolled diabetes mellitus. Despite high blood sugar levels in diabetes, the cells that are supposed to benefit from insulin are starving from lack of insulin, and they produce BHB.. Administration of BHB has several potential benefits. It has been shown to interfere with inflammation, particularly in the brain where neuro-inflammation leads to depression.F The human body produces cell components called inflammasomes that contain the information and components needed to stimulate the whole cascade of events that lead ...
The test strip contains a reagent with an enzyme that measures the level of D-3-hydroxybutyrate in whole blood. This method is based upon the oxidation of D-3-hydroxybutyrate to acetoacetate by the enzyme D-3-hydroxybutyrate dehydrogenase. The reaction generates hydrogen ions which are converted to an electrical current and measured by the meter.. ...
Overdose of & γ;-hydroxybutyrate (GHB) frequently causes respiratory depression, occasionally resulting in death; however, little is known about the dose
Kinetics and mechanism of the monomeric products from abiotic hydrolysis of poly[(R)-3-hydroxybutyrate] under acidic and alkaline ...
Looking for TCI AMERICAS Ethyl (s)-4-Chloro-3-hydroxyButyrate,5g (29MA39)? Graingers got your back. Price:$196.00. Easy ordering & convenient delivery. Log-in or register for your pricing.
Sigma-Aldrich offers Aldrich-460524, Ethyl (S)-(−)-4-chloro-3-hydroxybutyrate for your research needs. Find product specific information including CAS, MSDS, protocols and references.
Generic leflunomide hygien, Buy now cheap leflunomide australia, Buy leflunomide rx, Purchase cheapest leflunomide online mastercard, How to order a leflunomide dose pack, Buy leflunomide 120 mg uk
Leflunomide dealers canada, Cheap leflunomide purchase australia, Leflunomide tablets asda, Buy leflunomide online cheap canada, Kaiser leflunomide, Leflunomide price uk
GHB (gamma hydroxybutyric acid) was developed in the early 1960s as a human anaesthetic but was discontinued due to unwanted side effects. It is a naturally occurring component of human cells. GHB is used most commonly in the form of a chemical salt (Na-GHB or K-GHB), which is taken recreationally as a depressant with effects quite similar to those of alcohol. These salts are
We describe the morphology and behavior of a hitherto unknown bacterial species that forms conspicuous veils (typical dimensions, 30 by 30 mm) on sulfidic marine sediment. The new bacteria were enriched on complex sulfidic medium within a benthic gradient chamber in oxygen-sulfide countergradients, but the bacteria have so far not been isolated in pure culture, and a detailed characterization of their metabolism is still lacking. The bacteria are colorless, gram-negative, and vibrioid-shaped (1.3- to 2.5- by 4- to 10- m) cells that multiply by binary division and contain several spherical inclusions of poly- -hydroxybutyric acid. The cells have bipolar polytrichous flagella and exhibit a unique swimming pattern, rotating and translating along their short axis. Free-swimming cells showed aerotaxis and aggregated at ca. 2 M oxygen within opposing oxygen-sulfide gradients, where they were able to attach via a mucous stalk, forming a cohesive whitish veil at the oxic-anoxic interface. Bacteria ...
We describe the morphology and behavior of a hitherto unknown bacterial species that forms conspicuous veils (typical dimensions, 30 by 30 mm) on sulfidic marine sediment. The new bacteria were enriched on complex sulfidic medium within a benthic gradient chamber in oxygen-sulfide countergradients, but the bacteria have so far not been isolated in pure culture, and a detailed characterization of their metabolism is still lacking. The bacteria are colorless, gram-negative, and vibrioid-shaped (1.3- to 2.5- by 4- to 10- m) cells that multiply by binary division and contain several spherical inclusions of poly- -hydroxybutyric acid. The cells have bipolar polytrichous flagella and exhibit a unique swimming pattern, rotating and translating along their short axis. Free-swimming cells showed aerotaxis and aggregated at ca. 2 M oxygen within opposing oxygen-sulfide gradients, where they were able to attach via a mucous stalk, forming a cohesive whitish veil at the oxic-anoxic interface. Bacteria ...
Branching and crosslinking of polyhydroxybutyrate (PHB) is accomplished for the first time through reactive modification in the melt state, using dicumyl peroxide (DCP) as the free-radical initiator and a tri-functional ...
Cheapest leflunomide order now canada, Generic leflunomide online reviews, Leflunomide discount card canada, Buy leflunomide manufacturer, Leflunomide pill
Gamma-hydroxybutyrate MS Spectrum EMCDDA Report on the risk assessment of GHB in the framework of the joint action on new ... It is commonly used in the form of a salt, such as sodium γ-hydroxybutyrate (NaGHB, sodium oxybate, or Xyrem) or potassium γ- ... "Gamma Hydroxybutyrate (GHB)". 2002. Archived from the original on 31 December 2005. Retrieved 2016-11-20. Iversen, Les (3 ... Maitre M, Humbert JP, Kemmel V, Aunis D, Andriamampandry C (March 2005). "[A mechanism for gamma-hydroxybutyrate (GHB) as a ...
Laborit published "Sodium 4-hydroxybutyrate" in the International Journal of Neuropharmacology in September 1964. Laborit ... Laborit, H. (September 1964). "Sodium 4-hydroxybutyrate". International Journal of Neuropharmacology. 3 (4): 433-451. doi: ...
Gamma-hydroxybutyrate, etc.) Combining multiple depressants can be very dangerous because the central nervous system's ...
Lane RS, Shapley A, Dekker EE (1971). "2-keto-4-hydroxybutyrate aldolase. Identification as 2-keto-4-hydroxyglutarate aldolase ... 2-keto-4-hydroxybutyrate aldolase, and 4-hydroxy-2-oxoglutarate glyoxylate-lyase. This enzyme participates in arginine and ...
The test does not measure β-hydroxybutyrate, the most abundant ketone in the body; during treatment of ketoacidosis β- ... 3-Hydroxybutyrate dehydrogenase "Front Matter". Nomenclature of Organic Chemistry : IUPAC Recommendations and Preferred Names ... hydroxybutyrate is converted to acetoacetate so the test is not useful after treatment begins and may be falsely low at ...
Moskowitz GJ, Merrick JM (1969). "Metabolism of poly-beta-hydroxybutyrate. II. Enzymatic synthesis of D-(−)-beta hydroxybutyryl ...
HOCPCA γ-Crotonolactone Godfrey Tunnicliff; Christopher D. Cash (2 September 2003). Gamma-Hydroxybutyrate: Pharmacological and ... "Novel cyclic gamma-hydroxybutyrate (GHB) analogs with high affinity and stereoselectivity of binding to GHB sites in rat brain ...
The biosynthesis proceeds via 4-hydroxybutyrate. 1,4-Butanediol is used industrially as a solvent and in the manufacture of ... Gamma-Hydroxybutyrate, eMedicine, retrieved 2009-08-29 Poldrugo, Flavio; Snead, O. Carter, III (1984), "1,4-butanediol, γ- ... ", "One Four Bee" or "One Four B-D-O". It exerts effects similar to γ-hydroxybutyrate (GHB), which is a metabolic product of 1, ...
Beaucage, G. (1997). "Persistence Length of Isotactic Poly(hydroxy butyrate)". Macromolecules. 30 (14): 4158-4162. Bibcode: ...
Soc., 1980, 102, 5703-5711 Barnard, G. N.; Sanders, J. K. (1989). "The poly-beta-hydroxybutyrate granule in vivo. A new insight ...
... and it is this acetoacetate that is reduced into β-hydroxybutyrate, catalyzed by the β-hydroxybutyrate dehydrogenase enzyme. ... In fact, β-Hydroxybutyrate is the most abundant ketone in the blood during ketosis. Acetone is an organic compound with the ... Although, β-hydroxybutyrate is technically not a ketone due to the structure of the molecule (OH- attached to carbonyl group ... β-Hydroxybutyrate is also synthesized within liver cells; this is accomplished through the metabolism of fatty acids. Through a ...
An example is oligo-(R)-3-hydroxybutyrate. Oligopeptide Fyles, Thomas Murray; Luong, Horace (2009). "Solid-phase synthesis of a ... 3-hydroxybutyrate". Biochim Biophys Acta. 1768 (11): 2660-6. doi:10.1016/j.bbamem.2007.06.019. PMC 2266070. PMID 17659252. v t ...
Wedin, Gregory P.; Hornfeldt, Carl S.; Ylitalo, Lisa M. (2006). "The clinical development of gamma-hydroxybutyrate (GHB)". ... Dyer, JE (July 1991). "gamma-Hydroxybutyrate: a health-food product producing coma and seizurelike activity". The American ... Carter, Lawrence P.; Pardi, Daniel; Gorsline, Jane; Griffiths, Roland R. (2009). "Illicit gamma-hydroxybutyrate (GHB) and ... "Gamma-hydroxybutyrate: an emerging drug of abuse that causes physical dependence". Addiction. 92 (1): 89-96. doi:10.1111/j.1360 ...
... can degrade poly(3-hydroxybutyrate) (PHB). LPSN lpsn.dsmz.de Straininfo of Nocardiopsis aegyptia UniProt ...
Ligands: Agonists: GABA, Baclofen, gamma-Hydroxybutyrate, Phenibut etc. Positive Allosteric Modulators: CGP-7930, Fendiline, ...
Time Galloway GP, Frederick SL, Staggers FE, Gonzales M, Stalcup SA, Smith DE (1997). "Gamma-hydroxybutyrate: an emerging drug ... "Club Drugs: MDMA, Gamma-Hydroxybutyrate (GHB), Rohypnol, and Ketamine". In Am Fam Physician. 2004 Jun 1;69(11):2619-2627. "Club ...
... , also known as alpha-hydroxybutyrate and α-hydroxybutyrate, is a hydroxybutyric acid with the hydroxyl ... α-hydroxybutyrate may be useful as an early indicator of insulin resistance in non-diabetic subjects. Moreover, elevated serum ... 2-Hydroxybutyrate is released as a byproduct when cystathionine is cleaved to cysteine that is incorporated into glutathione. ... R)-2-hydroxybutyric acid (S)-2-hydroxybutyric acid 2-Hydroxybutyrate, the conjugate base of 2-hydroxybutyric acid, is produced ...
Gahlinger PM (June 2004). "Club drugs: MDMA, gamma-hydroxybutyrate (GHB), Rohypnol, and ketamine". American Family Physician. ...
Tekin, Ebru; Ateş, Mustafa; Kahraman, Özge (2012). "Poly-3-hydroxybutyrate-producing extreme halophilic archaeon: Haloferax sp ...
It has the ability to accumulate poly-β-hydroxybutyrate. A.C. Parte. "Delftia". LPSN. Retrieved 2016-08-18. "LMG 25724 Strain ... nov., a poly-β-hydroxybutyrate-accumulating bacterium isolated from a freshwater shrimp culture pond". International Journal of ... nov., a poly-β-hydroxybutyrate-accumulating bacterium isolated from a freshwater shrimp culture pond". International Journal of ...
Gahlinger, PM (1 June 2004). "Club drugs: MDMA, gamma-hydroxybutyrate (GHB), Rohypnol, and ketamine". American Family Physician ...
Gamma-hydroxybutyrate (GHB) is a central nervous system depressant. It has no odor and tastes salty, but the taste can be ...
... and 2-beta-hydroxybutyrate". Biochimica et Biophysica Acta. 12 (1-2): 188-202. doi:10.1016/0006-3002(53)90138-3. PMID 13115428 ...
Cite magazine requires ,magazine= (help) Gahlinger, Paul M. (1 June 2004). "Club Drugs: MDMA, Gamma-Hydroxybutyrate (GHB), ...
nov., a poly(3-hydroxybutyrate)-degrading, manganese-oxidizing thermophile". International Journal of Systematic and ...
The carboxylate anion and the esters of hydroxybutyric acids are known as hydroxybutyrates. β-hydroxybutyric acid is relevant ... beta-Hydroxy beta-methylbutyric acid Sodium oxybate Hydroxybutyrates at the US National Library of Medicine Medical Subject ...
This pathway is called the 3-hydroxypropionate/4-hydroxybutyrate cycle. Yet another variant of the 3-hydroxypropionate cycle is ... Berg IA, Kockelkorn D, Buckel W, Fuchs G (December 2007). "A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide ... June 2008). "A dicarboxylate/4-hydroxybutyrate autotrophic carbon assimilation cycle in the hyperthermophilic Archaeum ... the dicarboxylate/4-hydroxybutyrate cycle. It was discovered in anaerobic archaea. It was proposed in 2008 for the ...
Traub SJ, Nelson LS, Hoffman RS (2002). "Physostigmine as a treatment for gamma-hydroxybutyrate toxicity: a review". Journal of ... Recently,[when?] physostigmine has been proposed as an antidote for intoxication with gamma hydroxybutyrate (GHB, a potent ... Zvosec DL, Smith SW, Litonjua R, Westfal RE (2007). "Physostigmine for gamma-hydroxybutyrate coma: inefficacy, adverse events, ...
Berton, F.; Brancucci, A.; Beghè, F.; Cammalleri, M.; Demuro, A.; Francesconi, W.; Gessa G. L. (1999). "Gamma-Hydroxybutyrate ... Ren, X.; Mody, I. (2003). "Gamma-hydroxybutyrate reduces mitogen-activated protein kinase phosphorylation via GABAB receptor ...
β-Hydroxybutyrate can be extracted from poly(3-hydroxybutyrate) by acid hydrolysis. The concentration of β-hydroxybutyrate in ... This elevated β-hydroxybutyrate level is naturally expected, as β-hydroxybutyrate is formed from acetoacetate. The compound can ... The biosynthesis of D-β-hydroxybutyrate from acetoacetate is catalyzed by the β-hydroxybutyrate dehydrogenase enzyme. Butyrate ... its conjugate base is β-hydroxybutyrate, also known as 3-hydroxybutyrate. β-Hydroxybutyric acid is a chiral compound with two ...
Beta hydroxybutyrate is a ketone body that improves memory, learning, and slows signs of aging. Learn more about why Tim ... Benefits of Beta Hydroxybutyrate. There are a host of benefits of beta hydroxybutyrate, but it is primarily known as a fuel ... How and Why to Buy Beta Hydroxybutyrate. A normal product of plain beta hydroxybutyrate is not easy to find at a local health ... Beta Hydroxybutyrate Dosage. The standard dosage of beta hydroxybutyrate is 10 - 12 grams per serving. Dosage is important when ...
NAD+-β-hydroxybutyrate dehydrogenase hydroxybutyrate oxidoreductase β-hydroxybutyrate dehydrogenase D-β-hydroxybutyrate ... 3-hydroxybutyrate dehydrogenase β-hydroxybutyric acid dehydrogenase 3-D-hydroxybutyrate dehydrogenase β-hydroxybutyric ... In enzymology, 3-hydroxybutyrate dehydrogenase (EC 1.1.1.30) is an enzyme that catalyzes the chemical reaction: (R)-3- ... "Purification and properties of crystalline 3-hydroxybutyrate dehydrogenase from Rhodopseudomonas spheroides". Biochem. J. 102 ( ...
Kaufman EE, Nelson T (1991). "An overview of gamma-hydroxybutyrate catabolism: the role of the cytosolic NADP+-dependent ... In enzymology, a 4-hydroxybutyrate dehydrogenase (EC 1.1.1.61) is an enzyme that catalyzes the chemical reaction 4- ... This enzyme is also called gamma-hydroxybutyrate dehydrogenase. This enzyme participates in butanoate metabolism and the ...
... is a hydroxy fatty acid anion (CHEBI:59835) 4-hydroxybutyrate (CHEBI:16724) is a short-chain ... 4-hydroxybutyrate (CHEBI:16724) has role intravenous anaesthetic (CHEBI:38877) 4-hydroxybutyrate (CHEBI:16724) is a 4-hydroxy ... 4-hydroxybutyrate (CHEBI:16724) has functional parent butyrate (CHEBI:17968) 4-hydroxybutyrate (CHEBI:16724) has role ... CHEBI:16724 - 4-hydroxybutyrate. Main. ChEBI Ontology. Automatic Xrefs. Reactions. Pathways. Models. ...
Mus musculus 3-hydroxybutyrate dehydrogenase mRNA, partial cds. P. NM_001122683.1. Mus musculus 3-hydroxybutyrate dehydrogenase ... D-beta-hydroxybutyrate dehydrogenase, mitochondrial precursor. M. musculus. 100.0. 342. NP_004042.1 * Conserved domains (CDD) * ... D-beta-hydroxybutyrate dehydrogenase, mitochondrial precursor. H. sapiens. 91.2. 342. NP_001082978.1 * Conserved domains (CDD) ... Mus musculus 3-hydroxybutyrate dehydrogenase, type 1, mRNA (cDNA clone MGC:49289 IMAGE:5133856), complete cds. PA. ...
D-beta-hydroxybutyrate dehydrogenase, mitochondrial. D. rerio. 65.3. 288. NP_001090337.1 * Conserved domains (CDD) * * Gene ... D-beta-hydroxybutyrate dehydrogenase, mitochondrial precursor. G. gallus. 100.0. 338. NP_780386.3 * Conserved domains (CDD) * * ... D-beta-hydroxybutyrate dehydrogenase, mitochondrial precursor. M. musculus. 80.2. 342. NP_004042.1 * Conserved domains (CDD) * ... D-beta-hydroxybutyrate dehydrogenase, mitochondrial precursor. H. sapiens. 80.1. 342. NP_001082978.1 * Conserved domains (CDD) ...
2003) Specific gamma-hydroxybutyrate-binding sites but loss of pharmacological effects of gamma-hydroxybutyrate in GABA(B)(1)- ... 1992) Gamma-hydroxybutyrate hyperpolarizes hippocampal neurones by activating GABAB receptors. Eur J Pharmacol 212:291-294. ... 1999) Gamma-hydroxybutyrate is a weak agonist at recombinant GABA(B) receptors. Neuropharmacology 38:1667-1673. ... 2002) Stereoselectivity of NCS-382 binding to gamma-hydroxybutyrate receptor in the rat brain. Eur J Pharmacol 446:1-5. ...
In some cases (including the Poly-3-hydroxy butyrate (PHB) viewed here), the lamella twist as they grow outwards, in phase with ...
encoded search term (Gamma-Hydroxybutyrate Toxicity) and Gamma-Hydroxybutyrate Toxicity What to Read Next on Medscape ... Gamma-Hydroxybutyrate Toxicity. Updated: Oct 11, 2019 * Author: Theodore I Benzer, MD, PhD; Chief Editor: Sage W Wiener, MD ... Trends in gamma-hydroxybutyrate (GHB) and related drug intoxication: 1999 to 2003. Ann Emerg Med. 2006 Feb. 47(2):177-83. [ ... Gamma hydroxybutyrate (GHB), gamma butyrolactone (GBL) and 1,4-butanediol (1,4-BD; BDO): A literature review with a focus on UK ...
Find patient medical information for BETA-HYDROXYBUTYRATE BHB on WebMD including its uses, effectiveness, side effects and ... See All NamesBeta-Hydroxybutyric Acid, BHB, Calcium-D,L-3-Hydroxybutyrate, D-3-Hydroxybutyrate, D-Beta-Hydroxybutyrate, D-Beta- ... Beta-Hydroxybutyric Acid, BHB, Calcium-D,L-3-Hydroxybutyrate, D-3-Hydroxybutyrate, D-Beta-Hydroxybutyrate, D-Beta- ... BETA-HYDROXYBUTYRATE BHB Side Effects & Safety. When taken by mouth: A chemical that turns into beta-hydroxybutyrate in the ...
New health promotion for chemsex and γ-hydroxybutyrate (GHB) BMJ 2015; 351 :h6281 ... This is not the case with γ-hydroxybutyrate (GHB), crystallised methamphetamine, and mephedrone, which can increase arousal, ... New health promotion for chemsex and γ-hydroxybutyrate (GHB). BMJ 2015; 351 doi: https://doi.org/10.1136/bmj.h6281 (Published ...
Gamma-Hydroxybutyrate (Ghb) information based on scientific evidence includes description, drug interactions, safety concerns, ... Gamma-Hydroxybutyrate, Gamma-Hydroxy-Butyrate, Gamma Hydroxy-Butyrate de Sodium, Gamma Hydroxybutyrate Sodium, Gamma ... Sodium gamma-hydroxybutyrate, Sodium Oxybate, Sodium Oxybutyrate.. What is Gamma-hydroxybutyrate (ghb)?. Gamma hydroxybutyrate ... Dosing considerations for Gamma-hydroxybutyrate (ghb).. What other names is Gamma-hydroxybutyrate (ghb) known by?. 4- ...
... Author(s). Li, Zhengjun; Qiao, Kangjian; Liu, Nian; ... Strains of Yarrowia lipolytica were engineered to express the poly-3-hydroxybutyrate (PHB) biosynthetic pathway. The genes for ... "Engineering Yarrowia Lipolytica for Poly-3-Hydroxybutyrate Production." Journal of Industrial Microbiology & Biotechnology 44, ...
4-chloro-3-hydroxybutyrate for your research needs. Find product specific information including CAS, MSDS, protocols and ...
Gamma Hydroxybutyrate Sodium, Gamma-OH, 4-Hydroxy Butyrate, Gamma Hydrate, and Somatomax PM. It is distributed as the sodium ... Epidemiologic Notes and Reports Multistate Outbreak of Poisonings Associated with Illicit Use of Gamma Hydroxy Butyrate On ... Vayer P, Mandel P, Maitre M. Minireview: gamma-hydroxybutyrate, a possible neurotransmitter. Life Sci 1987;41:1547-57. ... and the California Department of Health Services of acute poisonings attributed to ingestion of gamma hydroxy butyrate (GHB), ...
Intracellular poly(3-hydroxybutyrate) depolymerase in Alcaligenes eutrophus.Can. J. Microbiol.41 (Suppl. 1)1995187191. ... Poly-3-hydroxybutyrate in Legionella pneumophila, an energy source for survival in low-nutrient environments.Appl. Environ. ... Mobilization of Poly(3-Hydroxybutyrate) inRalstonia eutropha. René Handrick, Simone Reinhardt, Dieter Jendrossek ... Mobilization of Poly(3-Hydroxybutyrate) inRalstonia eutropha Message Subject (Your Name) has forwarded a page to you from ...
... Goldberg, Emily L. ... Here, we identified that ketogenic diet (KD) increases beta-hydroxybutyrate (BHB) and alleviates urate crystal-induced gout ...
Relationship of Blood Acetoacetate and 3-Hydroxybutyrate in Diabetes Message Subject (Your Name) has forwarded a page to you ... The ratio of blood ketone bodies 3-hydroxybutyrate to acetoacetate, once thought to be fairly constant, has been shown to vary ... Administration of insulin lowers the ratio because the fall of blood 3-hydroxybutyrate occurs earlier and more rapidly than ... which may persist at a high levelfor several hours despite improvement of the patient and falling 3-hydroxybutyrate and glucose ...
Gamma Hydroxy Butyrate Usage, Effects and UK Prices. Results from 1999-2002 IDMU Surveys. 1 Introduction ... 6] Laborit G, Kind A, de Leon RC (1960) [220 cas d anaesthesie en neuro-chirugie avec le 4-hydroxybutyrate de sodium] [article ... 1.1 Gamma hydroxy butyrate (GHB) usually appears as an odorless, colorless, tasteless liquid - in proprietary form as a 20% ... 25] Miglani JS, Kim KY, Chahil R. (2000) Gamma-hydroxy butyrate withdrawal delirium: a case report. Gen Hosp Psychiatry 22(3): ...
Patented Beta-Hydroxybutyrates (Calcium, Sodium, Magnesium) - Orange Mango: Health & Personal Care ... Ingredients: Keto Drive Performance Complex [Calcium Beta-Hydroxybutyrate (as goBHB), Sodium beta-Hydroxybutyrate (as goBHB), ... KETO DRIVE with BHB Ketones + Caffeine, Patented Beta-Hydroxybutyrates & Electrolytes (Calcium… $36.00($4.29 / 1 Ounce) Only 9 ... This keto complex of patented beta-hydroxybutyrates (BHB) was designed to help you achieve ketosis and perform at your peak. ...
Poly(3-hydroxybutyrate) (P3HB) is a polyester of 3-hydroxybutyrate that is synthesized by a variety of microorganisms as ... Metabolic Engineering of Escherichia coli for Poly(3-hydroxybutyrate) Production under Microaerobic Condition. Xiao-Xing Wei,1 ... P. I. Nikel, M. J. Pettinari, M. A. Galvagno, and B. S. Méndez, "Poly(3-hydroxybutyrate) synthesis by recombinant Escherichia ... P. I. Nikel, M. J. Pettinari, M. A. Galvagno, and B. S. Méndez, "Poly(3-hydroxybutyrate) synthesis from glycerol by a ...
4-Chloro-3-hydroxyButyrate,5g (29MA39)? Graingers got your back. Price:$196.00. Easy ordering & convenient delivery. Log-in or ...
D-β-hydroxybutyrate (DβHB); l-β-hydroxybutyrate (LβHB); 3-nitropropionic acid (3-NP); tyrosine hydroxylase (TH); 1-methyl-4- ... D-beta-hydroxybutyrate protects neurons in models of Alzheimers and Parkinsons disease. Proc. Natl. Acad. Sci. U. S. A. 2000 ... D-β-Hydroxybutyrate rescues mitochondrial respiration and mitigates features of Parkinson disease. Kim Tieu,1 Celine Perier,1 ... D-β-Hydroxybutyrate (DβHB) is a ketone body produced by hepatocytes and, to a lesser extent, by astrocytes (11). It is an ...
SIMPLE BLOOD TEST OF D-3-HYDROXYBUTYRATE FOR DIABETES. Printer-friendly version ... D-3 HYDROXYBUTYRATE (HB) IS A PRIMARY METABOLITE IN DIABETIC KETOACIDOSIS, ALCOHOLISM, AND STARVATION. THE UNTREATED ... GDS TECHNOLOGY, INC., HAS RECENTLY DEVELOPED A THERMOSTABLE D-3-HYDROXYBUTYRATE DEHYDROGENASE (HBD) THAT WILL FORM THE BASIS ...
Compound Slows Bone Loss and Extends Lifespan in Animal Studies, May Aid in Treatments to Slow Aging Benzoxazole, the compound that slowed bone aging by up to 31% over the course of a years treatment in the mice, was first identified as one of five compounds that extended nematode lifespan in the Lithgow lab in a study that appeared in Nature in 2011.. ...
Table 3: The results of DSC analysis: effect of electrospinning process and PHB/Coll ratio on PHB melting and degree of crystallinity ...
... poly-4-hydroxybutyrate mesh, primary endpoints, prospective evaluation, recurrence rate, renal insufficiency, reoperation, ...
Learn more about Gamma-hydroxybutyrate (ghb) uses, side effects, health benefits, interactions, safety concerns, and ... Gamma-Hydroxybutyrate, Gamma-Hydroxy-Butyrate, Gamma Hydroxy-Butyrate de Sodium, Gamma Hydroxybutyrate Sodium, Gamma ... What is Gamma-hydroxybutyrate (ghb)?. Gamma hydroxybutyrate (GHB) is a chemical found in the brain and other areas of the body ... What other names is Gamma-hydroxybutyrate (ghb) known by?. 4-Hydroxybutanoate, 4-Hydroxy Butyrate, 4-hydroxybutyric acid, Acide ...
Favorable Outcome After Physiologic Dose of Sodium-d,l-3-Hydroxybutyrate in Severe MADD. Willemijn J. Van Rijt, M. Rebecca ... Favorable Outcome After Physiologic Dose of Sodium-d,l-3-Hydroxybutyrate in Severe MADD ... Favorable Outcome After Physiologic Dose of Sodium-d,l-3-Hydroxybutyrate in Severe MADD ... Favorable Outcome After Physiologic Dose of Sodium-d,l-3-Hydroxybutyrate in Severe MADD ...
Poly-3-hydroxybutyrate (PHB) is a thermoplastic polyester which occurs...PHB is synthesised in bacteria from acetyl-CoA using ... Poly-3-hydroxybutyrate (PHB) is a thermoplastic polyester which occurs naturally in bacteria as Ralstonia eutropha and Bacillus ... Poly-3-hydroxybutyrate (PHB) is a thermoplastic polyester which occurs...PHB is synthesised in bacteria from acetyl-CoA using ...
  • Beta hydroxybutyrate (BHB) is the first ketone body produced in a fasting state. (nootropedia.com)
  • Diets that are low in carbohydrates and high in fatty acids can either prompt the body to produce ketone bodies, such as beta hydroxybutyrate, or allow people to consume them exogenously (outside the body) instead. (nootropedia.com)
  • Although supplementation of beta hydroxybutyrate has been described as "jet fuel" [4] and undesirable, modern iterations of exogenous ketones are making it easier for anyone to utilize these ketone bodies for optimal brain performance. (nootropedia.com)
  • As I prepare to embark on an experiment doing cyclical ketosis with my girlfriend, exogenous ketone bodies like beta hydroxybutyrate will be incredibly important for kickstarting ketosis (for her especially). (nootropedia.com)
  • The addition of beta hydroxybutyrate will make the ketogenic process easier, though I'm not sure how much. (nootropedia.com)
  • There are a host of benefits of beta hydroxybutyrate, but it is primarily known as a fuel source in the absence of glucose. (nootropedia.com)
  • Within 24 - 72 hours without food, the body no longer uses glucose as the main fuel support system, which is when ketones like beta hydroxybutyrate kick into production. (nootropedia.com)
  • Evidence suggests that beta hydroxybutyrate can increase the level of brain-derived neurotrophic factor (BDNF) in the hippocampus, which is the main memory center of the brain [5]. (nootropedia.com)
  • This is some of the only published literature about the performance enhancing effects of beta hydroxybutyrate, though there are several self-experiments. (nootropedia.com)
  • Most of the evidence regarding beta hydroxybutyrate utilizes this exogenous ketone as a way to recovery from memory damage or impairment or as a neuroprotective agent. (nootropedia.com)
  • In one 2004 study of memory-impaired adults, beta hydroxybutyrate successfully aided in improving memory recall [7]. (nootropedia.com)
  • For Alzheimer's patients, using beta hydroxybutyrate is particularly helpful as a neuroprotective agent [8]. (nootropedia.com)
  • Many of the long-term and neuroprotective benefits of beta hydroxybutyrate are closely linked to reduced carbohydrate and glucose consumption as well [9][10]. (nootropedia.com)
  • The benefits of beta hydroxybutyrate are not only for people who are currently experiencing nutritional ketosis. (nootropedia.com)
  • There are few known side effects of beta hydroxybutyrate when consumed in the recommended dosage ranges. (nootropedia.com)
  • The standard dosage of beta hydroxybutyrate is 10 - 12 grams per serving. (nootropedia.com)
  • Dosage is important when using beta hydroxybutyrate. (nootropedia.com)
  • One potential side effect of beta hydroxybutyrate is overdosing and death at high ranges. (nootropedia.com)
  • The toxicity range in animals is quite high, but it is best to stay within the recommended range of beta hydroxybutyrate. (nootropedia.com)
  • A normal product of plain beta hydroxybutyrate is not easy to find at a local health food store. (nootropedia.com)
  • You can buy beta hydroxybutyrate online with certain vendors, but it is important to find the right one. (nootropedia.com)
  • Beta-hydroxybutyrate is a chemical that is made by the body to provide energy in times when not enough carbohydrates or sugars have been eaten. (webmd.com)
  • Beta-hydroxybutyrate can also be made in the lab and taken as a supplement. (webmd.com)
  • Beta-hydroxybutyrate is placed in the eye for dry eye and taken by mouth for athletic performance, migraine , Alzheimer disease , memory loss with age, Parkinson disease, and many other conditions, but there is no good scientific evidence to support these uses. (webmd.com)
  • Beta-hydroxybutyrate is a chemical that is used as energy by some cells of the body when sugar levels are low. (webmd.com)
  • Beta-hydroxybutyrate seems to help nerves and the brain to work better. (webmd.com)
  • Beta-hydroxybutyrate might be used as energy by muscles in the body to improve exercise ability. (webmd.com)
  • Early research shows that taking a chemical called 3-hydroxybutyl-3-hydroxybutyrate, which turns into beta-hydroxybutyrate in the body, might help athletes to run faster. (webmd.com)
  • Applying eye drops containing beta-hydroxybutyrate doesn't seem to improve eye symptoms in patients with dry eyes. (webmd.com)
  • Early research suggests that beta-hydroxybutyrate might help to preserve muscle mass and reduce feelings of hunger in obese people who are on a very low-calorie diet or a starvation diet. (webmd.com)
  • More evidence is needed to rate the effectiveness of beta-hydroxybutyrate for these uses. (webmd.com)
  • A chemical that turns into beta-hydroxybutyrate in the body, called 3-hydroxybutyl-3-hydoxybutyrate, is POSSIBLY SAFE when taken daily for up to 5 days. (webmd.com)
  • Beta-hydroxybutyrate is POSSIBLY SAFE . (webmd.com)
  • An eye drop containing 1% beta-hydroxybutyrate has been used without side effects for up to 4 weeks. (webmd.com)
  • There isn't enough reliable information to know if beta-hydroxybutyrate is safe to use when pregnant or breast-feeding. (webmd.com)
  • The appropriate dose of beta-hydroxybutyrate depends on several factors such as the user's age, health, and several other conditions. (webmd.com)
  • At this time there is not enough scientific information to determine an appropriate range of doses for beta-hydroxybutyrate. (webmd.com)
  • Here, we identified that ketogenic diet (KD) increases beta-hydroxybutyrate (BHB) and alleviates urate crystal-induced gout without impairing immune defense against bacterial infection. (diva-portal.org)
  • Traditional high-fat diets are characterized by enhanced fatty acid oxidation (which produces ketone bodies such as beta-hydroxybutyrate) and a reduction in glycolytic flux, whereas the LGIT is predicated mainly on the latter observation of reduced blood glucose levels. (frontiersin.org)
  • Beta-hydroxybutyrate (BHB), a by-product of fatty acid oxidation, exerts both anti-seizure and neuroprotective effects. (frontiersin.org)
  • 1) A deficiency in this system is that urine dipsticks of this type do not detect beta-hydroxybutyrate , a reduced form of acetoacetate. (thefreedictionary.com)
  • A group has prospectively measured blood beta-hydroxybutyrate levels by a reagent strip with serum ketone levels measured by the nitroprusside reaction in 19 patients with diabetic ketoacidosis. (thefreedictionary.com)
  • No, they have a natural ligand, beta hydroxybutyrate. (blogspot.com)
  • Beta hydroxybutyrate is a substance dear to my heart, and your heart too, see here . (blogspot.com)
  • Well, elevated HDL cholesterol appears to be a marker of a high fat, low carbohydrate diet and its associated beta hydroxybutyrate. (blogspot.com)
  • When rats were given 30% of their calories as corn starch, palm oil, or beta hydroxybutyrate (BHB, the most quantitatively important ketone body), those that got the ketones had about half the glucose and insulin levels of the group given starch. (alivebynature.com)
  • High activities in oxidative tissues of enzymes of ketone body metabolism, including D-beta-hydroxybutyrate dehydrogenase, indicate that, like elasmobranchs, ketone bodies are of central importance in spotted ratfish. (gopubmed.org)
  • D-beta-hydroxybutyrate dehydrogenase (d-beta-HBDH) was high in most tissues confirming the importance of ketone bodies in elasmobranchs. (gopubmed.org)
  • Characterization of two D - beta -hydroxybutyrate dehydrogenase populations in heavy and light mitochondria from jerboa (Jaculus orientalis) liver. (gopubmed.org)
  • The activity of the enzyme, glutamate dehydrogenase was significantly higher whereas the activity of D-beta-hydroxybutyrate dehydrogenase enzyme was significantly lower in liver and kidney of alloxan-induced diabetic rats. (gopubmed.org)
  • Purification and characterization of the D - beta -hydroxybutyrate dehydrogenase from dromedary liver mitochondria. (gopubmed.org)
  • It can be shown that the 17 beta-hydroxysteroid dehydrogenase type 2 enzyme is more closely related to D-beta-hydroxybutyrate dehydrogenase than it is to 17 beta-hydroxysteroid dehydrogenase type 1. (gopubmed.org)
  • A simple protein precipitation extraction procedure was used, and the analytical GC-MS method was adapted from the in-house method for analysis of GHB/beta-hydroxybutyrate (BHB) in blood. (gla.ac.uk)
  • Methods are described for direct assays of lactate, pyruvate, beta-hydroxybutyrate, and acetoacetate in plasma with the GEMSAEC centrifugal analyzer. (semanticscholar.org)
  • The methods for lactate, beta-hydroxybutyrate, and acetoacetate are kinetic and ratiometric, eliminating the need for specimen-blank assays. (semanticscholar.org)
  • Kinetic measurement of the combined concentrations of acetoacetate and beta-hydroxybutyrate in serum. (semanticscholar.org)
  • Beta-hydroxybutyrate (3-OHB) is the main physiological ketone body, whose concentration can reach plasma levels of 2-6 mM during KDs or fasting. (uni-wuerzburg.de)
  • When you follow a very-low carb, very-high fat diet - also known as the ketogenic diet - your body starts producing organic ketone compounds, including the type called beta hydroxybutyrate (BHB or beta-hydroxybutyrate), which serve as an alternative fuel source to carbohydrates. (draxe.com)
  • What is beta hydroxybutyrate used for in the body? (draxe.com)
  • Some of the most noteworthy beta hydroxybutyrate benefits and uses include supporting weight loss, preventing or treating diabetes and insulin resistance, helping to treat epilepsy, fighting cancer, protecting the brain, improving cognitive function, and potentially increasing life span/longevity. (draxe.com)
  • What Is Beta Hydroxybutyrate? (draxe.com)
  • The definition of beta hydroxybutyrate is a ketone body (or simply a ketone) that is an intermediate product of the breakdown of fats in the body. (draxe.com)
  • Beta-hydroxybutyrate or BHB, other than being an intimidating tongue twister, is a molecule that often features in ketosis discussions. (hvmn.com)
  • BHB or beta-hydroxybutyrate is also known as Beta-hydroxybutyric acid or 3-hydroxybutyrate. (hvmn.com)
  • Beta-hydroxybutyrate (BHB) is 1 of 3 sources of ketone bodies. (mayocliniclabs.com)
  • The beta-hydroxybutyrate (BHB)/acetoacetate ratio is typically between 3:1 and 7:1 in severe ketotic states. (mayocliniclabs.com)
  • In enzymology, 3-hydroxybutyrate dehydrogenase (EC 1.1.1.30) is an enzyme that catalyzes the chemical reaction: (R)-3-hydroxybutanoate + NAD+ ⇌ {\displaystyle \rightleftharpoons } acetoacetate + NADH + H+ Thus, the two substrates of this enzyme are (R)-3-hydroxybutanoate and NAD+, whereas its three products are acetoacetate, NADH, and H+. (wikipedia.org)
  • Other names in common use include: NAD+-β-hydroxybutyrate dehydrogenase hydroxybutyrate oxidoreductase β-hydroxybutyrate dehydrogenase D-β-hydroxybutyrate dehydrogenase D-3-hydroxybutyrate dehydrogenase D-(-)-3-hydroxybutyrate dehydrogenase β-hydroxybutyric acid dehydrogenase 3-D-hydroxybutyrate dehydrogenase β-hydroxybutyric dehydrogenase As of late 2007, two structures have been solved for this class of enzymes, with PDB accession codes 1WMB and 1X1T. (wikipedia.org)
  • This enzyme is also called gamma-hydroxybutyrate dehydrogenase. (wikipedia.org)
  • Samples of R. eutropha taken during mobilization of PHB were used for morphological and biochemical characterization of native PHB granules and for determination of i-PHB depolymerase, NAD + -dependent 3-hydroxybutyrate dehydrogenase (3HB DH), p -nitrophenylbutyrate esterase ( p -NPB esterase), and p -nitrophenylacetate esterase activity. (asm.org)
  • 3 -Hydroxybutyrate dehydrogenase -2 and ferritin-H synergistically regulate intracellular iron. (gopubmed.org)
  • A member of the short-chain dehydrogenase family of reductases, 3-hydroxybutyrate dehydrogenase-2, catalyzes a rate-limiting step in the biogenesis of the mammalian siderophore. (gopubmed.org)
  • Closed complex of the D- 3 -hydroxybutyrate dehydrogenase induced by an enantiomeric competitive inhibitor. (gopubmed.org)
  • D-3-Hydroxybutyrate dehydrogenase (HBDH) from Pseudomonas fragi showed a strict stereospecificity to the d-enantiomer of 3-hydroxybutyrate (d-3-HB) as a substrate. (gopubmed.org)
  • The structures of Alcaligenes faecalis D- 3 -hydroxybutyrate dehydrogenase before and after NAD+ and acetate binding suggest a dynamical reaction mechanism as a member of the SDR family. (gopubmed.org)
  • D-3-Hydroxybutyrate dehydrogenase, which catalyzes the reversible reaction between D-3-hydroxybutyrate and acetoacetate, has been classified into the short-chain dehydrogenase/reductase family and is a useful marker in the assay of diabetes mellitus and/or ketoacidosis. (gopubmed.org)
  • Cosubstrate-induced dynamics of D- 3 -hydroxybutyrate dehydrogenase from Pseudomonas putida. (gopubmed.org)
  • D-3-Hydroxybutyrate dehydrogenase from Pseudomonas putida belongs to the family of short-chain dehydrogenases/reductases. (gopubmed.org)
  • Molecular basis of substrate recognition in D- 3 -hydroxybutyrate dehydrogenase from Pseudomonas putida. (gopubmed.org)
  • R)-3-Hydroxybutyrate dehydrogenase (BDH) is a lipid-requiring mitochondrial enzyme that has a specific requirement of phosphatidylcholine (PC) for function. (gopubmed.org)
  • The method for β-HB determination is based upon the oxidation of D-3-Hydroxybutyrate to acetoacetate by the enzyme 3-hydroxybutyrate dehydrogenase.16 Concomitant with this oxidation, the cofactor NAD+ is reduced to NADH. (creativebiomart.net)
  • Here the coupling with a phenazine methosulphate-p-iodonitrotetrazolium violet (PMS-INT) system directs the enzymatic redox reaction of both NADH oxidation and 3-HB reduction by the 3-hydroxybutyrate dehydrogenase (HBDH) and thus precludes an interfering backward reaction. (bio-protocol.org)
  • Here we show that the infusion of the ketone body D -β-hydroxybutyrate (DβHB) in mice confers partial protection against dopaminergic neurodegeneration and motor deficits induced by MPTP. (jci.org)
  • D-3-hydroxybutyrate (3-HB), a major circulating ketone body, has been demonstrated to be effective in neurological disorders such as Alzheimer's, Parkinson's, and found to attenuate corneal disorder in dry eye condition. (arvojournals.org)
  • This enzyme, now designated PhbZ1, is associated to the poly-3-hydroxybutyrate (PHB) granules and when expressed in Escherichia coli , it showed in vitro PHB depolymerizing activity on native or artificial PHB granules, but not on crystalline PHB. (springer.com)
  • Agus J, Kahar P, Abe H, Doi Y, Tsuge T (2006) Altered expression of polyhydroxyalkanoate synthase gene and its effect on poly[( R )-3-hydroxybutyrate] synthesis in recombinant Escherichia coli . (springer.com)
  • We assessed the effects of different arcA mutations on poly(3-hydroxybutyrate) (PHB) synthesis in recombinant Escherichia coli strains carrying the pha synthesis genes from Azotobacter sp. (asm.org)
  • Production of poly(3-hydroxybutyrate) by fed-batch culture of filamentation-suppressed recombinant Escherichia coli. (asm.org)
  • Recombinant Escherichia coli XL1-Blue harboring a high-copy-number plasmid containing the Alcaligenes eutrophus polyhydroxyalkanoate synthesis genes could efficiently synthesize poly(3-hydroxybutyrate) (PHB) in a complex medium containing yeast extract and tryptone but not in a defined medium. (asm.org)
  • Upon prolonged fasting, hepatic mitochondrial FAO fuels synthesis of ketone bodies (KB) acetoacetate and 3-hydroxybutyrate, as important alternative energy sources for the brain, skeletal muscle, and heart. (nature.com)
  • Ralstonia eutropha H16 degraded (mobilized) previously accumulated poly(3-hydroxybutyrate) (PHB) in the absence of an exogenous carbon source and used the degradation products for growth and survival. (asm.org)
  • Poly(3-hydroxybutyrate) (P3HB) is a polyester of 3-hydroxybutyrate that is synthesized by a variety of microorganisms as intracellular carbon and energy storages under unbalanced nutrients conditions [ 1 ]. (hindawi.com)
  • Abe T, Kobayashi T, Saito T (2005) Properties of a novel intracellular poly(3-hydroxybutyrate) depolymerase with high specific activity (PhaZd) in Wautersia eutropha H16 . (springer.com)
  • An intracellular D(-)-3-hydroxybutyrate (3HB)-oligomer hydrolase gene from Ralstonia eutropha (formerly Alcaligenes eutrophus) H16 was cloned, sequenced, and characterized. (nih.gov)
  • Most of the carbon supplied by the plant is used to fuel nitrogen fixation, however, under certain circumstances, some of the carbon appears to be diverted by the bacteroid into the production of intracellular carbon storage polymers such as poly-3-hydroxybutyrate (PHB). (biomedcentral.com)
  • The mechanism of degradation of denatured, exogenous, crystalline poly(3-hydroxybutyrate) (PHB) by extracellular PHB depolymerases has been extensively studied during the last decade (for a recent review, see reference 6 ). (asm.org)
  • Hydrolytic degradation and protein release studies of thermogelling polyurethane copolymers consisting of poly[(R)-3-hydroxybutyrate], poly(ethylene glycol), and poly(propylene glycol). (alfa.com)
  • This work investigated the effect of adding nanoparticulate (29 nm) bioactive glass particles on the bioactivity, degradation and in vitro cytocompatibility of poly(3-hydroxybutyrate) (P(3HB)) composites/nano-sized bioactive glass (n-BG). (royalsocietypublishing.org)
  • We are presenting a combination of hydrolytic degradation of PHB to 3-hydroxybutyrate (3-HB) in alkaline regime, and a coupled colorimetric enzymatic assay. (bio-protocol.org)
  • We sought to evaluate the utility of proton MR spectroscopy for the detection of β-hydroxybutyrate in a cohort of children with epilepsy treated with the ketogenic diet and to correlate brain parenchymal metabolite ratios obtained from spectroscopy with β-hydroxybutyrate serum concentrations. (ajnr.org)
  • Metabolite ratios were compared with serum β-hydroxybutyrate concentrations, and partial correlation coefficients were calculated using patient age as a covariate. (ajnr.org)
  • Diurnal variations in the concentrations of blood acetoacetate, 3-hydroxybutyrate and glucose in normal persons. (semanticscholar.org)
  • The aim of the present study was to investigate the association between serum concentrations of ß- hydroxybutyrate (BHBA) and fatty acid (FA) profile of milk with emphasis in conjugated linoleic acid (CLA) in a population of early lactation Holstein cows. (biomedcentral.com)
  • Ethyl (S)-(+)-3-hydroxybutyrate is used for synthesis of optically active products, used as medical and organic intermediates, an important amino protective agents, pharmaceuticals and synthetic organic makes intermediates, organic synthesis used to introduce t-Boc protect gene. (alfa.com)
  • Ethyl ( R )-4-chloro-3-hydroxybutyrate (( R )-CHBE) is a versatile chiral precursor for many pharmaceuticals. (biomedcentral.com)
  • Patients were mechanically ventilated and sedated with gamma-hydroxybutyrate (GHB), a naturally occurring metabolite of gamma-aminobutyric acid (GABA), which acts on the GABA(B) receptors. (biomedsearch.com)
  • The metabolite β-hydroxybutyrate, which increases after prolonged exercise, induces the activities of Bdnf promoters, particularly promoter I, which is activity-dependent. (mit.edu)
  • The level of β-hydroxybutyrate, a metabolite, was determined by liquid chromatographytandem mass spectrometry, and to gain further insight into the effect of donepezil on ketogenesis, the effects of donepezil were investigated in a mouse model. (eurekaselect.com)
  • The STAT-Site® M ß-HB system is intended for the quantitative determination of ß-Hydroxybutyrate in serum or plasma, aiding in the diagnosis and monitoring of ketoacidosis. (selectscience.net)
  • Direct determination of poly(3-hydroxybutyrate) accumulated in bacteria by thermally assisted. (deepdyve.com)
  • In our previous study, β-hydroxybutyrate (BHB) was found to prolong survival time and to inhibit cerebral edema by improving energy metabolism in the hypoxia, anoxia and global cerebral ischemia models. (nii.ac.jp)
  • This results in the accumulation of ketone bodies (acetoacetate (AcAc), β-hydroxybutyrate (β-OHB) and acetone) and a consequent metabolic acidosis. (pathcare.co.za)
  • however when the production of ketone bodies (acetoacetate, acetone, ß- hydroxybutyrate) is above certain levels a subclinical disorder may appear. (biomedcentral.com)
  • activity was not detected in cultures grown on 3-hydroxybutyrate, crotonate, pyruvate or lactate. (uni-konstanz.de)
  • Twenty-three spectroscopic datasets acquired at a TE of 288 ms in children on the ketogenic diet were analyzed with LCModel using a modified basis set that included a simulated β-hydroxybutyrate resonance. (ajnr.org)
  • Clinical MR spectroscopy in pediatric patients on the ketogenic diet demonstrated measurable β-hydroxybutyrate, with a strong correlation to β-hydroxybutyrate blood levels. (ajnr.org)
  • An inverse correlation between serum β-hydroxybutyrate levels and brain tissue N -acetylaspartate suggests that altered amino acid handling contributes to the antiepileptogenic effect of the ketogenic diet. (ajnr.org)
  • GHB has been illegally marketed under a variety of names, including Gamma Hydroxybutyric Acid, Sodium Oxybate, Sodium Oxybutyrate, Gamma Hydroxybutyrate Sodium, Gamma-OH, 4-Hydroxy Butyrate, Gamma Hydrate, and Somatomax PM. It is distributed as the sodium salt in powder or tablet form and is commonly dissolved in water. (cdc.gov)
  • The prescription medication gamma hydroxybutyrate (sodium oxybate) is POSSIBLY SAFE for adults who are taking it under close medical supervision for symptoms of a condition called narcolepsy. (emedicinehealth.com)
  • Sodium Oxybate (γ-Hydroxybutyrate): Anesthetic Agent or Source of Anesthetic Interactions? (ebscohost.com)
  • A novel poly-3-hydroxybutyrate depolymerase was identified in Azotobacter vinelandii . (springer.com)
  • Monomeric 3-hydroxybutyrate was detectable as a product of depolymerase activity. (uni-konstanz.de)
  • Here, we discuss the evidence for one glycolytic inhibitor, 2-deoxyglucose (2DG) and one metabolic substrate, β-hydroxybutyrate (BHB) exerting direct effects on neuronal excitability, highlight their mechanistic differences, and provide the strengthening scientific rationale for their individual or possibly combined use in the clinical arena of seizure management. (frontiersin.org)
  • From marine anoxic mud, a new strictly anaerobic, Gram-negative, non-sporeforming bacterium was isolated with 3-hydroxybutyrate as substrate. (springer.com)
  • This study covers the application of the biopolymer poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) on a paper substrate via extrusion coating. (fraunhofer.de)
  • During the treatment of ketoacidosis there is usually an initial increase of the acetoacetate which may persist at a high levelfor several hours despite improvement of the patient and falling 3-hydroxybutyrate and glucose levels. (diabetesjournals.org)
  • In chemostat cultures little poly-β-hydroxybutyrate accumulated in organisms that were nitrogen-limited, but when oxygen limited a much increased yield of cells per mol of glucose was observed, and the organisms contained up to 50% of their dry weight of poly-β-hydroxybutyrate. (portlandpress.com)
  • In carbon-limited cultures ( D , the dilution rate,=0.035-0.240h −1 ), the growth yield ranged from 13.1 to 19.8g/mol of glucose and the poly-β-hydroxybutyrate content did not exceed 3.0% of the dry weight. (portlandpress.com)
  • In oxygen-limited cultures ( D =0.049-0.252h −1 ) the growth yield ranged from 48.4 to 70.1g/mol of glucose and the poly-β-hydroxybutyrate content was between 19.6 and 44.6% of dry weight. (portlandpress.com)
  • In nitrogen-limited cultures ( D =0.053-0.255h −1 ) the growth yield ranged from 7.45 to 19.9g/mol of glucose and the poly-β-hydroxybutyrate content was less than 1.5% of dry weight. (portlandpress.com)
  • These findings are discussed in relation to poly-β-hydroxybutyrate formation, growth efficiency and growth yield during growth on glucose. (portlandpress.com)
  • Poly(3-hydroxybutyrate) (P3HB, M n = 2.6 × 10 5 g mol -1 , Đ M =2.7) was from Sigma-Aldrich (St. Louis, MO,USA). (jeol.co.jp)
  • Strains of Yarrowia lipolytica were engineered to express the poly-3-hydroxybutyrate (PHB) biosynthetic pathway. (mit.edu)
  • Yamane, Tsuneo 2018-06-27 00:00:00 AbstractThere is considerable interest in the development of simple methods for quantifying production of the biodegradable polyester poly(3-hydroxybutyrate) [P(3HB)] by bacteria. (deepdyve.com)
  • γ-Hydroxybutyrate (GHB) is a psychotropic compound endogenous to the brain. (aspetjournals.org)
  • Gamma-hydroxybutyrate (GHB) is a short-chain fatty acid that is not only endogenous to the mammalian body, but can also be prescribed medicinally and be used as a drug of abuse. (gla.ac.uk)
  • 3-Hydroxybutyrate and crotonate were fermented to acetate and butyrate. (springer.com)
  • Donepezil increased the plasma and liver levels of β-hydroxybutyrate in mice as well as the hepatic expression of PGC-1α and the mitochondrial expression of HMG-CoA synthetase 2 (HMGCS2) in response to fasting, causing a subsequent increase in ketogenesis. (eurekaselect.com)
  • Donepezil had effects on ketogenesis in mice and reversed the decrease in the level of β-hydroxybutyrate found in patients with AD. (eurekaselect.com)
  • Poly-3-hydroxybutyrate (PHB) is a thermoplastic polyester which occurs. (bio-medicine.org)
  • Poly-3-hydroxybutyrate (PHB) is a thermoplastic polyester which occurs naturally in bacteria as Ralstonia eutropha and Bacillus megaterium . (bio-medicine.org)
  • The effects of feeding Artemia nauplii enriched with or without poly--hydroxybutyrate (PHB) and/or highly unsaturated fatty acids (HUFA) on Siberian sturgeon (Acipenser baerii) larvae were investigated. (ugent.be)
  • Gamma hydroxybutyrate (GHB) is a chemical found in the brain and other areas of the body. (rxlist.com)
  • Gamma hydroxybutyrate affects several nerve pathways in the brain, including activating the body's pain-killing (opioid) system and raising levels of growth hormone. (emedicinehealth.com)
  • The ability of gamma-hydroxybutyrate to antagonize only the K + -induced release of newly formed DA may explain why this agent causes a rapid and selective increase in brain dopamine. (biomedsearch.com)
  • β-hydroxybutyrate blood levels were highly correlated to brain β-hydroxybutyrate levels, referenced as either choline, creatine, or N -acetylaspartate. (ajnr.org)
  • Cyanobacteria synthesize a variety of chemically-different, high-value biopolymers such as glycogen (polyglucose), poly- β -hydroxybutyrate (PHB), cyanophycin (polyamide of arginine and aspartic acid) and volutin (polyphosphate) under excess conditions. (bio-protocol.org)
  • The small acid 3-hydroxybutyrate in plasma was found to be differentiated for urinary tract infection, with an area under the curve = 0.97 (95% confidence interval: 0.93-1.00, accuracy = 0.91, sensitivity = 0.92 and specificity = 0.91). (kcl.ac.uk)
  • The encoded protein catalyzes the interconversion of acetoacetate and (R)-3-hydroxybutyrate, the two major ketone bodies produced during fatty acid catabolism. (nih.gov)
  • This keto complex of patented beta-hydroxybutyrates (BHB) was designed to help you achieve ketosis and perform at your peak. (amazon.com)
  • Water uptake characteristics of poly(hydroxybutyrate-co-hydroxyvalerate) (PHBV-) based composite tissue engineering (TE) scaffolds incorporating nanosized hydroxyapatite (nHA) have been investigated. (hindawi.com)
  • Nanocomposites of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) and tungsten disulfide inorganic nanotubes (INT-WS2) were prepared by blending in solution, and the effects of INT-WS2 on the isothermal crystallization behavior and kinetics of PHBV were investigated for the first time. (upm.es)
  • We demonstrate the highly productive biosynthesis of PHA copolyesters consisting of 3-hydroxybuytrate (3HB) and 4-hydroxybutyrate (4HB) monomers. (mdpi.com)
  • This paper reports on the development and characterization of oxygen scavenging films made of poly(3-hydroxybutyrate) (PHB) containing palladium nanoparticles (PdNPs) prepared by electrospinning followed by annealing treatment at 160 °C. The PdNPs were modified with the intention to optimize their dispersion and distribution in PHB by means of two different surfactants permitted for food contact applications, i.e., hexadecyltrimethylammonium bromide (CTAB) and tetraethyl orthosilicate (TEOS). (mdpi.com)
  • The report then estimates 2016-2021 market development trends of SODIUM 2-HYDROXYBUTYRATE industry. (reportsnreports.com)
  • γ-Hydroxybutyrate-induced neuronal hyperpolarization is blocked by antagonists for metabotropic, heterodimeric GABA B receptors ( 7 ). (pnas.org)
  • The K + -induced release of this pool of DA was, however, not antagonized by gamma-hydroxybutyrate.Potassium (53.0 mM) also increased the release from striatal slices of (3)H-5-hydroxytryptamine (5-HT) newly synthesized from (3)H-tryptophan. (biomedsearch.com)