The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.
A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.
Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.
The proportion of one particular in the total of all ALLELES for one genetic locus in a breeding POPULATION.
A latent susceptibility to disease at the genetic level, which may be activated under certain conditions.
Genotypic differences observed among individuals in a population.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
The relationships of groups of organisms as reflected by their genetic makeup.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.
Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.
The genetic constitution of individuals with respect to one member of a pair of allelic genes, or sets of genes that are closely linked and tend to be inherited together such as those of the MAJOR HISTOCOMPATIBILITY COMPLEX.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
An individual in which both alleles at a given locus are identical.
The application of molecular biology to the answering of epidemiological questions. The examination of patterns of changes in DNA to implicate particular carcinogens and the use of molecular markers to predict which individuals are at highest risk for a disease are common examples.
Individuals whose ancestral origins are in the southeastern and eastern areas of the Asian continent.
A phenotypically recognizable genetic trait which can be used to identify a genetic locus, a linkage group, or a recombination event.
A country spanning from central Asia to the Pacific Ocean.
A flavoprotein amine oxidoreductase that catalyzes the reversible conversion of 5-methyltetrahydrofolate to 5,10-methylenetetrahydrofolate. This enzyme was formerly classified as EC 1.1.1.171.
An aspect of personal behavior or lifestyle, environmental exposure, or inborn or inherited characteristic, which, on the basis of epidemiologic evidence, is known to be associated with a health-related condition considered important to prevent.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
An individual having different alleles at one or more loci regarding a specific character.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Methods used to determine individuals' specific ALLELES or SNPS (single nucleotide polymorphisms).
A transferase that catalyzes the addition of aliphatic, aromatic, or heterocyclic FREE RADICALS as well as EPOXIDES and arene oxides to GLUTATHIONE. Addition takes place at the SULFUR. It also catalyzes the reduction of polyol nitrate by glutathione to polyol and nitrite.
INFLAMMATION of the LIVER in humans caused by HEPATITIS C VIRUS, a single-stranded RNA virus. Its incubation period is 30-90 days. Hepatitis C is transmitted primarily by contaminated blood parenterally, and is often associated with transfusion and intravenous drug abuse. However, in a significant number of cases, the source of hepatitis C infection is unknown.
Nonrandom association of linked genes. This is the tendency of the alleles of two separate but already linked loci to be found together more frequently than would be expected by chance alone.
INFLAMMATION of the LIVER in humans that is caused by HEPATITIS C VIRUS lasting six months or more. Chronic hepatitis C can lead to LIVER CIRRHOSIS.
Ribonucleic acid that makes up the genetic material of viruses.
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
A nucleoside antimetabolite antiviral agent that blocks nucleic acid synthesis and is used against both RNA and DNA viruses.
The type species of the genus ORTHOHEPADNAVIRUS which causes human HEPATITIS B and is also apparently a causal agent in human HEPATOCELLULAR CARCINOMA. The Dane particle is an intact hepatitis virion, named after its discoverer. Non-infectious spherical and tubular particles are also seen in the serum.
A set of statistical methods used to group variables or observations into strongly inter-related subgroups. In epidemiology, it may be used to analyze a closely grouped series of events or cases of disease or other health-related phenomenon with well-defined distribution patterns in relation to time or place or both.
Enzyme that catalyzes the movement of a methyl group from S-adenosylmethionone to a catechol or a catecholamine.
A peptidyl-dipeptidase that catalyzes the release of a C-terminal dipeptide, -Xaa-*-Xbb-Xcc, when neither Xaa nor Xbb is Pro. It is a Cl(-)-dependent, zinc glycoprotein that is generally membrane-bound and active at neutral pH. It may also have endopeptidase activity on some substrates. (From Enzyme Nomenclature, 1992) EC 3.4.15.1.
Agents used in the prophylaxis or therapy of VIRUS DISEASES. Some of the ways they may act include preventing viral replication by inhibiting viral DNA polymerase; binding to specific cell-surface receptors and inhibiting viral penetration or uncoating; inhibiting viral protein synthesis; or blocking late stages of virus assembly.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
One of the type I interferons produced by peripheral blood leukocytes or lymphoblastoid cells. In addition to antiviral activity, it activates NATURAL KILLER CELLS and B-LYMPHOCYTES, and down-regulates VASCULAR ENDOTHELIAL GROWTH FACTOR expression through PI-3 KINASE and MAPK KINASES signaling pathways.
Individuals whose ancestral origins are in the continent of Europe.
A class of protein components which can be found in several lipoproteins including HIGH-DENSITY LIPOPROTEINS; VERY-LOW-DENSITY LIPOPROTEINS; and CHYLOMICRONS. Synthesized in most organs, Apo E is important in the global transport of lipids and cholesterol throughout the body. Apo E is also a ligand for LDL receptors (RECEPTORS, LDL) that mediates the binding, internalization, and catabolism of lipoprotein particles in cells. There are several allelic isoforms (such as E2, E3, and E4). Deficiency or defects in Apo E are causes of HYPERLIPOPROTEINEMIA TYPE III.
A variety of simple repeat sequences that are distributed throughout the GENOME. They are characterized by a short repeat unit of 2-8 basepairs that is repeated up to 100 times. They are also known as short tandem repeats (STRs).
An enzyme that catalyzes the transfer of acetyl groups from ACETYL-COA to arylamines. It can also catalyze acetyl transfer between arylamines without COENZYME A and has a wide specificity for aromatic amines, including SEROTONIN. However, arylamine N-acetyltransferase should not be confused with the enzyme ARYLALKYLAMINE N-ACETYLTRANSFERASE which is also referred to as SEROTONIN ACETYLTRANSFERASE.
Deoxyribonucleic acid that makes up the genetic material of viruses.
Tandem arrays of moderately repetitive, short (10-60 bases) DNA sequences which are found dispersed throughout the GENOME, at the ends of chromosomes (TELOMERES), and clustered near telomeres. Their degree of repetition is two to several hundred at each locus. Loci number in the thousands but each locus shows a distinctive repeat unit.
Studies in which subsets of a defined population are identified. These groups may or may not be exposed to factors hypothesized to influence the probability of the occurrence of a particular disease or other outcome. Cohorts are defined populations which, as a whole, are followed in an attempt to determine distinguishing subgroup characteristics.
The discipline studying genetic composition of populations and effects of factors such as GENETIC SELECTION, population size, MUTATION, migration, and GENETIC DRIFT on the frequencies of various GENOTYPES and PHENOTYPES using a variety of GENETIC TECHNIQUES.
The complete genetic complement contained in a DNA or RNA molecule in a virus.
A large group of cytochrome P-450 (heme-thiolate) monooxygenases that complex with NAD(P)H-FLAVIN OXIDOREDUCTASE in numerous mixed-function oxidations of aromatic compounds. They catalyze hydroxylation of a broad spectrum of substrates and are important in the metabolism of steroids, drugs, and toxins such as PHENOBARBITAL, carcinogens, and insecticides.
A branch of genetics which deals with the genetic variability in individual responses to drugs and drug metabolism (BIOTRANSFORMATION).
The ratio of two odds. The exposure-odds ratio for case control data is the ratio of the odds in favor of exposure among cases to the odds in favor of exposure among noncases. The disease-odds ratio for a cohort or cross section is the ratio of the odds in favor of disease among the exposed to the odds in favor of disease among the unexposed. The prevalence-odds ratio refers to an odds ratio derived cross-sectionally from studies of prevalent cases.
Sodium chloride-dependent neurotransmitter symporters located primarily on the PLASMA MEMBRANE of serotonergic neurons. They are different than SEROTONIN RECEPTORS, which signal cellular responses to SEROTONIN. They remove SEROTONIN from the EXTRACELLULAR SPACE by high affinity reuptake into PRESYNAPTIC TERMINALS. Regulates signal amplitude and duration at serotonergic synapses and is the site of action of the SEROTONIN UPTAKE INHIBITORS.
Polymers of ETHYLENE OXIDE and water, and their ethers. They vary in consistency from liquid to solid depending on the molecular weight indicated by a number following the name. They are used as SURFACTANTS, dispersing agents, solvents, ointment and suppository bases, vehicles, and tablet excipients. Some specific groups are NONOXYNOLS, OCTOXYNOLS, and POLOXAMERS.
The total number of cases of a given disease in a specified population at a designated time. It is differentiated from INCIDENCE, which refers to the number of new cases in the population at a given time.
Any method used for determining the location of and relative distances between genes on a chromosome.
A major and the second most common isoform of apolipoprotein E. In humans, Apo E4 differs from APOLIPOPROTEIN E3 at only one residue 112 (cysteine is replaced by arginine), and exhibits a lower resistance to denaturation and greater propensity to form folded intermediates. Apo E4 is a risk factor for ALZHEIMER DISEASE and CARDIOVASCULAR DISEASES.
A technique for identifying individuals of a species that is based on the uniqueness of their DNA sequence. Uniqueness is determined by identifying which combination of allelic variations occur in the individual at a statistically relevant number of different loci. In forensic studies, RESTRICTION FRAGMENT LENGTH POLYMORPHISM of multiple, highly polymorphic VNTR LOCI or MICROSATELLITE REPEAT loci are analyzed. The number of loci used for the profile depends on the ALLELE FREQUENCY in the population.
A positive-stranded RNA virus species in the genus HEPEVIRUS, causing enterically-transmitted non-A, non-B hepatitis (HEPATITIS E).
The quantity of measurable virus in a body fluid. Change in viral load, measured in plasma, is sometimes used as a SURROGATE MARKER in disease progression.
A cytochrome P450 enzyme that catalyzes the hydroxylation of many drugs and environmental chemicals, such as DEBRISOQUINE; ADRENERGIC RECEPTOR ANTAGONISTS; and TRICYCLIC ANTIDEPRESSANTS. This enzyme is deficient in up to 10 percent of the Caucasian population.
INFLAMMATION of the LIVER in humans caused by a member of the ORTHOHEPADNAVIRUS genus, HEPATITIS B VIRUS. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact.
Deliberate breeding of two different individuals that results in offspring that carry part of the genetic material of each parent. The parent organisms must be genetically compatible and may be from different varieties or closely related species.
Using MOLECULAR BIOLOGY techniques, such as DNA SEQUENCE ANALYSIS; PULSED-FIELD GEL ELECTROPHORESIS; and DNA FINGERPRINTING, to identify, classify, and compare organisms and their subtypes.
An analysis comparing the allele frequencies of all available (or a whole GENOME representative set of) polymorphic markers in unrelated patients with a specific symptom or disease condition, and those of healthy controls to identify markers associated with a specific disease or condition.
A glutathione transferase that catalyzes the conjugation of electrophilic substrates to GLUTATHIONE. This enzyme has been shown to provide cellular protection against redox-mediated damage by FREE RADICALS.
Biochemical identification of mutational changes in a nucleotide sequence.
The production of offspring by selective mating or HYBRIDIZATION, GENETIC in animals or plants.
The combined effects of genotypes and environmental factors together on phenotypic characteristics.
Proteins encoded by a VIRAL GENOME that are produced in the organisms they infect, but not packaged into the VIRUS PARTICLES. Some of these proteins may play roles within the infected cell during VIRUS REPLICATION or act in regulation of virus replication or VIRUS ASSEMBLY.
Acute INFLAMMATION of the LIVER in humans; caused by HEPATITIS E VIRUS, a non-enveloped single-stranded RNA virus. Similar to HEPATITIS A, its incubation period is 15-60 days and is enterically transmitted, usually by fecal-oral transmission.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
Genetic loci associated with a QUANTITATIVE TRAIT.
Procedures for identifying types and strains of bacteria. The most frequently employed typing systems are BACTERIOPHAGE TYPING and SEROTYPING as well as bacteriocin typing and biotyping.
The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
INFLAMMATION of the LIVER in humans caused by HEPATITIS B VIRUS lasting six months or more. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact.
The co-inheritance of two or more non-allelic GENES due to their being located more or less closely on the same CHROMOSOME.
The degree of similarity between sequences. Studies of AMINO ACID SEQUENCE HOMOLOGY and NUCLEIC ACID SEQUENCE HOMOLOGY provide useful information about the genetic relatedness of genes, gene products, and species.
Detection of a MUTATION; GENOTYPE; KARYOTYPE; or specific ALLELES associated with genetic traits, heritable diseases, or predisposition to a disease, or that may lead to the disease in descendants. It includes prenatal genetic testing.
The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.
Enzymes catalyzing the dehydrogenation of secondary amines, introducing a C=N double bond as the primary reaction. In some cases this is later hydrolyzed.
Inhaling and exhaling the smoke of burning TOBACCO.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Infection with any of the rotaviruses. Specific infections include human infantile diarrhea, neonatal calf diarrhea, and epidemic diarrhea of infant mice.
A genus of REOVIRIDAE, causing acute gastroenteritis in BIRDS and MAMMALS, including humans. Transmission is horizontal and by environmental contamination. Seven species (Rotaviruses A thru G) are recognized.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A form of gene interaction whereby the expression of one gene interferes with or masks the expression of a different gene or genes. Genes whose expression interferes with or masks the effects of other genes are said to be epistatic to the effected genes. Genes whose expression is affected (blocked or masked) are hypostatic to the interfering genes.
Differential and non-random reproduction of different genotypes, operating to alter the gene frequencies within a population.
A characteristic showing quantitative inheritance such as SKIN PIGMENTATION in humans. (From A Dictionary of Genetics, 4th ed)
Deoxyribonucleic acid that makes up the genetic material of protozoa.
Technique that utilizes low-stringency polymerase chain reaction (PCR) amplification with single primers of arbitrary sequence to generate strain-specific arrays of anonymous DNA fragments. RAPD technique may be used to determine taxonomic identity, assess kinship relationships, analyze mixed genome samples, and create specific probes.
The probability that an event will occur. It encompasses a variety of measures of the probability of a generally unfavorable outcome.
Statistical models which describe the relationship between a qualitative dependent variable (that is, one which can take only certain discrete values, such as the presence or absence of a disease) and an independent variable. A common application is in epidemiology for estimating an individual's risk (probability of a disease) as a function of a given risk factor.
A specific mannose-binding member of the collectin family of lectins. It binds to carbohydrate groups on invading pathogens and plays a key role in the MANNOSE-BINDING LECTIN COMPLEMENT PATHWAY.
Excrement from the INTESTINES, containing unabsorbed solids, waste products, secretions, and BACTERIA of the DIGESTIVE SYSTEM.
The age, developmental stage, or period of life at which a disease or the initial symptoms or manifestations of a disease appear in an individual.
Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.
Former kingdom, located on Korea Peninsula between Sea of Japan and Yellow Sea on east coast of Asia. In 1948, the kingdom ceased and two independent countries were formed, divided by the 38th parallel.
Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.
A constitution or condition of the body which makes the tissues react in special ways to certain extrinsic stimuli and thus tends to make the individual more than usually susceptible to certain diseases.
A genus in the family CALICIVIRIDAE, associated with epidemic GASTROENTERITIS in humans. The type species, NORWALK VIRUS, contains multiple strains.
Observation of a population for a sufficient number of persons over a sufficient number of years to generate incidence or mortality rates subsequent to the selection of the study group.
Elements of limited time intervals, contributing to particular results or situations.
Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)
A genus of coccidian parasites of the family CRYPTOSPORIDIIDAE, found in the intestinal epithelium of many vertebrates including humans.
A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
Specific regions that are mapped within a GENOME. Genetic loci are usually identified with a shorthand notation that indicates the chromosome number and the position of a specific band along the P or Q arm of the chromosome where they are found. For example the locus 6p21 is found within band 21 of the P-arm of CHROMOSOME 6. Many well known genetic loci are also known by common names that are associated with a genetic function or HEREDITARY DISEASE.
A distribution in which a variable is distributed like the sum of the squares of any given independent random variable, each of which has a normal distribution with mean of zero and variance of one. The chi-square test is a statistical test based on comparison of a test statistic to a chi-square distribution. The oldest of these tests are used to detect whether two or more population distributions differ from one another.
The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.
Sudden increase in the incidence of a disease. The concept includes EPIDEMICS and PANDEMICS.
INFLAMMATION of any segment of the GASTROINTESTINAL TRACT from ESOPHAGUS to RECTUM. Causes of gastroenteritis are many including genetic, infection, HYPERSENSITIVITY, drug effects, and CANCER.
Neoplasms of the skin and mucous membranes caused by papillomaviruses. They are usually benign but some have a high risk for malignant progression.
The external elements and conditions which surround, influence, and affect the life and development of an organism or population.
A statistical technique that isolates and assesses the contributions of categorical independent variables to variation in the mean of a continuous dependent variable.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
The detection of RESTRICTION FRAGMENT LENGTH POLYMORPHISMS by selective PCR amplification of restriction fragments derived from genomic DNA followed by electrophoretic analysis of the amplified restriction fragments.
Virus diseases caused by CALICIVIRIDAE. They include HEPATITIS E; VESICULAR EXANTHEMA OF SWINE; acute respiratory infections in felines, rabbit hemorrhagic disease, and some cases of gastroenteritis in humans.
The genetic process of crossbreeding between genetically dissimilar parents to produce a hybrid.
Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).
A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)
Intestinal infection with organisms of the genus CRYPTOSPORIDIUM. It occurs in both animals and humans. Symptoms include severe DIARRHEA.
Those hepatitis B antigens found on the surface of the Dane particle and on the 20 nm spherical and tubular particles. Several subspecificities of the surface antigen are known. These were formerly called the Australia antigen.
The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.
A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.
A country in northern Africa between ALGERIA and LIBYA. Its capital is Tunis.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Functions constructed from a statistical model and a set of observed data which give the probability of that data for various values of the unknown model parameters. Those parameter values that maximize the probability are the maximum likelihood estimates of the parameters.
A coordinated international effort to identify and catalog patterns of linked variations (HAPLOTYPES) found in the human genome across the entire human population.
A member of the vitamin B family that stimulates the hematopoietic system. It is present in the liver and kidney and is found in mushrooms, spinach, yeast, green leaves, and grasses (POACEAE). Folic acid is used in the treatment and prevention of folate deficiencies and megaloblastic anemia.
A thiol-containing amino acid formed by a demethylation of METHIONINE.
The science dealing with the earth and its life, especially the description of land, sea, and air and the distribution of plant and animal life, including humanity and human industries with reference to the mutual relations of these elements. (From Webster, 3d ed)
The intergenic DNA segments that are between the ribosomal RNA genes (internal transcribed spacers) and between the tandemly repeated units of rDNA (external transcribed spacers and nontranscribed spacers).
Therapy with two or more separate preparations given for a combined effect.
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
A set of three nucleotides in a protein coding sequence that specifies individual amino acids or a termination signal (CODON, TERMINATOR). Most codons are universal, but some organisms do not produce the transfer RNAs (RNA, TRANSFER) complementary to all codons. These codons are referred to as unassigned codons (CODONS, NONSENSE).
The worsening of a disease over time. This concept is most often used for chronic and incurable diseases where the stage of the disease is an important determinant of therapy and prognosis.
Antibodies to the HEPATITIS C ANTIGENS including antibodies to envelope, core, and non-structural proteins.
Individuals whose ancestral origins are in the continent of Africa.
A liver microsomal cytochrome P-450 monooxygenase capable of biotransforming xenobiotics such as polycyclic hydrocarbons and halogenated aromatic hydrocarbons into carcinogenic or mutagenic compounds. They have been found in mammals and fish. This enzyme, encoded by CYP1A1 gene, can be measured by using ethoxyresorufin as a substrate for the ethoxyresorufin O-deethylase activity.
A species of gram-positive, aerobic bacteria that produces TUBERCULOSIS in humans, other primates, CATTLE; DOGS; and some other animals which have contact with humans. Growth tends to be in serpentine, cordlike masses in which the bacilli show a parallel orientation.
Process of determining and distinguishing species of bacteria or viruses based on antigens they share.
The ability of viruses to resist or to become tolerant to chemotherapeutic agents or antiviral agents. This resistance is acquired through gene mutation.
Age as a constituent element or influence contributing to the production of a result. It may be applicable to the cause or the effect of a circumstance. It is used with human or animal concepts but should be differentiated from AGING, a physiological process, and TIME FACTORS which refers only to the passage of time.
One of three major isoforms of apolipoprotein E. In humans, Apo E2 differs from APOLIPOPROTEIN E3 at one residue 158 where arginine is replaced by cysteine (R158--C). In contrast to Apo E3, Apo E2 displays extremely low binding affinity for LDL receptors (RECEPTORS, LDL) which mediate the internalization and catabolism of lipoprotein particles in liver cells. ApoE2 allelic homozygosity is associated with HYPERLIPOPROTEINEMIA TYPE III.
Simultaneous infection of a host organism by two or more pathogens. In virology, coinfection commonly refers to simultaneous infection of a single cell by two or more different viruses.
Proteins, usually found in the cytoplasm, that specifically bind calcitriol, migrate to the nucleus, and regulate transcription of specific segments of DNA with the participation of D receptor interacting proteins (called DRIP). Vitamin D is converted in the liver and kidney to calcitriol and ultimately acts through these receptors.
Any of the ruminant mammals with curved horns in the genus Ovis, family Bovidae. They possess lachrymal grooves and interdigital glands, which are absent in GOATS.
A family of small, non-enveloped DNA viruses infecting birds and most mammals, especially humans. They are grouped into multiple genera, but the viruses are highly host-species specific and tissue-restricted. They are commonly divided into hundreds of papillomavirus "types", each with specific gene function and gene control regions, despite sequence homology. Human papillomaviruses are found in the genera ALPHAPAPILLOMAVIRUS; BETAPAPILLOMAVIRUS; GAMMAPAPILLOMAVIRUS; and MUPAPILLOMAVIRUS.
Widely distributed enzymes that carry out oxidation-reduction reactions in which one atom of the oxygen molecule is incorporated into the organic substrate; the other oxygen atom is reduced and combined with hydrogen ions to form water. They are also known as monooxygenases or hydroxylases. These reactions require two substrates as reductants for each of the two oxygen atoms. There are different classes of monooxygenases depending on the type of hydrogen-providing cosubstrate (COENZYMES) required in the mixed-function oxidation.
Diseases of plants.
Maleness or femaleness as a constituent element or influence contributing to the production of a result. It may be applicable to the cause or effect of a circumstance. It is used with human or animal concepts but should be differentiated from SEX CHARACTERISTICS, anatomical or physiological manifestations of sex, and from SEX DISTRIBUTION, the number of males and females in given circumstances.
Plasma glycoproteins that form a stable complex with hemoglobin to aid the recycling of heme iron. They are encoded in man by a gene on the short arm of chromosome 16.
OXIDOREDUCTASES which mediate vitamin K metabolism by converting inactive vitamin K 2,3-epoxide to active vitamin K.
An enzyme that oxidizes an aldehyde in the presence of NAD+ and water to an acid and NADH. This enzyme was formerly classified as EC 1.1.1.70.
A fatal disease of the nervous system in sheep and goats, characterized by pruritus, debility, and locomotor incoordination. It is caused by proteinaceous infectious particles called PRIONS.
Those characteristics that distinguish one SEX from the other. The primary sex characteristics are the OVARIES and TESTES and their related hormones. Secondary sex characteristics are those which are masculine or feminine but not directly related to reproduction.
A family of enzymes accepting a wide range of substrates, including phenols, alcohols, amines, and fatty acids. They function as drug-metabolizing enzymes that catalyze the conjugation of UDPglucuronic acid to a variety of endogenous and exogenous compounds. EC 2.4.1.17.
Statistical formulations or analyses which, when applied to data and found to fit the data, are then used to verify the assumptions and parameters used in the analysis. Examples of statistical models are the linear model, binomial model, polynomial model, two-parameter model, etc.
Proteins prepared by recombinant DNA technology.
Parliamentary democracy located between France on the northeast and Portugual on the west and bordered by the Atlantic Ocean and the Mediterranean Sea.
A 34-kDa glycosylated protein. A major and most common isoform of apolipoprotein E. Therefore, it is also known as apolipoprotein E (ApoE). In human, Apo E3 is a 299-amino acid protein with a cysteine at the 112 and an arginine at the 158 position. It is involved with the transport of TRIGLYCERIDES; PHOSPHOLIPIDS; CHOLESTEROL; and CHOLESTERYL ESTERS in and out of the cells.
The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.
Includes the spectrum of human immunodeficiency virus infections that range from asymptomatic seropositivity, thru AIDS-related complex (ARC), to acquired immunodeficiency syndrome (AIDS).
A group of people with a common cultural heritage that sets them apart from others in a variety of social relationships.
Diseases of domestic swine and of the wild boar of the genus Sus.
The different ways GENES and their ALLELES interact during the transmission of genetic traits that effect the outcome of GENE EXPRESSION.
A country in western Europe bordered by the Atlantic Ocean, the English Channel, the Mediterranean Sea, and the countries of Belgium, Germany, Italy, Spain, Switzerland, the principalities of Andorra and Monaco, and by the duchy of Luxembourg. Its capital is Paris.
An infant during the first month after birth.
Procedures for finding the mathematical function which best describes the relationship between a dependent variable and one or more independent variables. In linear regression (see LINEAR MODELS) the relationship is constrained to be a straight line and LEAST-SQUARES ANALYSIS is used to determine the best fit. In logistic regression (see LOGISTIC MODELS) the dependent variable is qualitative rather than continuously variable and LIKELIHOOD FUNCTIONS are used to find the best relationship. In multiple regression, the dependent variable is considered to depend on more than a single independent variable.
The statistical reproducibility of measurements (often in a clinical context), including the testing of instrumentation or techniques to obtain reproducible results. The concept includes reproducibility of physiological measurements, which may be used to develop rules to assess probability or prognosis, or response to a stimulus; reproducibility of occurrence of a condition; and reproducibility of experimental results.
A prediction of the probable outcome of a disease based on a individual's condition and the usual course of the disease as seen in similar situations.
The mating of plants or non-human animals which are closely related genetically.
Computer-based representation of physical systems and phenomena such as chemical processes.
Identification of genetic carriers for a given trait.
Direct nucleotide sequencing of gene fragments from multiple housekeeping genes for the purpose of phylogenetic analysis, organism identification, and typing of species, strain, serovar, or other distinguishable phylogenetic level.
Expanded structures, usually green, of vascular plants, characteristically consisting of a bladelike expansion attached to a stem, and functioning as the principal organ of photosynthesis and transpiration. (American Heritage Dictionary, 2d ed)
The edible portions of any animal used for food including domestic mammals (the major ones being cattle, swine, and sheep) along with poultry, fish, shellfish, and game.
The largest of the continents. It was known to the Romans more specifically as what we know today as Asia Minor. The name comes from at least two possible sources: from the Assyrian asu (to rise) or from the Sanskrit usa (dawn), both with reference to its being the land of the rising sun, i.e., eastern as opposed to Europe, to the west. (From Webster's New Geographical Dictionary, 1988, p82 & Room, Brewer's Dictionary of Names, 1992, p34)
The usually underground portions of a plant that serve as support, store food, and through which water and mineral nutrients enter the plant. (From American Heritage Dictionary, 1982; Concise Dictionary of Biology, 1990)
Formerly known as Siam, this is a Southeast Asian nation at the center of the Indochina peninsula. Bangkok is the capital city.
Studies used to test etiologic hypotheses in which inferences about an exposure to putative causal factors are derived from data relating to characteristics of persons under study or to events or experiences in their past. The essential feature is that some of the persons under study have the disease or outcome of interest and their characteristics are compared with those of unaffected persons.
Proteins that form the CAPSID of VIRUSES.
A field of study concerned with the principles and processes governing the geographic distributions of genealogical lineages, especially those within and among closely related species. (Avise, J.C., Phylogeography: The History and Formation of Species. Harvard University Press, 2000)
The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.
The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.

Sulfhydryl compounds in melanocytes of yellow (Ay/a), nonagouti (a/a), and agouti (A/A) mice. (1/50503)

CLEFFMANN (1953, 1963a,b) has reported that yellow but not black melanocytes of agouti (A/A) rabbits contained reducing sulfhydryl compounds. We have attempted to repeat CLEFFMANN's observations in mouse melanocytes of the lethal yellow (Ay/a), nonagouti (a/a) and agouti (A/A) genotypes. Our results contradict those of CLEFFMANN and reveal that yellow and black melanocytes, regardless of genotype, possess equivalent amounts of histochemically detectable sulfhydryl compounds. These results do not support the hypothesis that agouti-locus genes act by controlling the sulfhydryl metabolism of pigment cells.  (+info)

JunB is essential for mammalian placentation. (2/50503)

Lack of JunB, an immediate early gene product and member of the AP-1 transcription factor family causes embryonic lethality between E8.5 and E10.0. Although mutant embryos are severely retarded in growth and development, cellular proliferation is apparently not impaired. Retardation and embryonic death are caused by the inability of JunB-deficient embryos to establish proper vascular interactions with the maternal circulation due to multiple defects in extra-embryonic tissues. The onset of the phenotypic defects correlates well with high expression of junB in wild-type extra-embryonic tissues. In trophoblasts, the lack of JunB causes a deregulation of proliferin, matrix metalloproteinase-9 (MMP-9) and urokinase plasminogen activator (uPA) gene expression, resulting in a defective neovascularization of the decidua. As a result of downregulation of the VEGF-receptor 1 (flt-1), blood vessels in the yolk sac mesoderm appeared dilated. Mutant embryos which escape these initial defects finally die from a non-vascularized placental labyrinth. Injection of junB-/- embryonic stem (ES) cells into tetraploid wild-type blastocysts resulted in a partial rescue, in which the ES cell-derived fetuses were no longer growth retarded and displayed a normal placental labyrinth. Therefore, JunB appears to be involved in multiple signaling pathways regulating genes involved in the establishment of a proper feto-maternal circulatory system.  (+info)

Metallothionein-null mice absorb less Zn from an egg-white diet, but a similar amount from solutions, although with altered intertissue Zn distribution. (3/50503)

The influence of metallothionein (MT) on Zn transfer into non-gut tissues was investigated in MT-null (MT-/-) and normal (MT+/+) mice 4 h after oral gavage of aqueous 65ZnSO4solution at doses of 154, 385, 770 and 1540 nmol Zn per mouse. Zn transfer was not significantly different between MT+/+ and MT-/- mice and was directly proportional to the oral dose (slope = 0.127, r = 0.991; 0. 146, r = 0.994, respectively). Blood 65Zn and plasma Zn concentrations increased progressively in MT-/- mice at doses >154 nmol Zn, reaching levels of 2.4% of oral dose and 60 micromol/L, respectively, at the 1540 nmol Zn dose. The corresponding values for MT+/+ mice were approximately half, 1.0% and 29 micromol/L. Intergenotypic differences were found in tissue distribution of 65Zn within the body; MT-/- mice had higher 65Zn levels in muscle, skin, heart and brain, whereas MT+/+ mice retained progressively more Zn in the liver, in conjunction with a linear increase in hepatic MT up to the highest Zn dose. MT induction in the small intestine reached its maximum at an oral dose of 385 nmol Zn and did not differ at higher doses. Absorption of a 770 nmol 65Zn dose from a solid egg-white diet was only one fourth (MT+/+) and one eighth (MT-/-) of the Zn absorption from the same dose of 65Zn in aqueous solution. MT+/+ mice had greater (P < 0.05) Zn absorption from the egg-white diet than did MT-/- mice, indicating that gut MT confers an absorptive advantage, but only when Zn is incorporated into solid food.  (+info)

Hereditary juvenile haemochromatosis: a genetically heterogeneous life-threatening iron-storage disease. (4/50503)

Juvenile haemochromatosis is a rare inborn error of iron metabolism with clinical manifestations before 30 years of age. Unlike adult haemochromatosis which principally affects men, juvenile haemochromatosis affects the sexes equally; it causes early endocrine failure, dilated cardiomyopathy and joint disease. We report four patients (two of each sex) from three pedigrees affected by juvenile haemochromatosis with a mean onset at 22 years (range 14-30). All had endocrine deficiency with postpubertal gonadal failure secondary to pituitary disease; two suffered near-fatal cardiomyopathy with heart failure. Mean time to diagnosis from the first clinical signs of disease was 9.8 years (range 0.5-20) but general health and parameters of iron storage responded favourably to iron-depletion therapy. A 24-year-old man listed for heart transplantation because of cardiomyopathy [left ventricular (LV) ejection fraction 16%] responded to intravenous iron chelation with desferrioxamine combined with phlebotomy (ejection fraction 31%). A 27-year-old woman with subacute biventricular heart failure refractory to medication required orthotopic cardiac transplantation before the diagnosis was established (LV ejection fraction 25%). Genetic studies showed that these two patients with cardiomyopathy from unrelated families were heterozygous for the HFE 845G-->A (C282Y) mutation and wild-type at the H63D locus: complete sequencing of the intron-exon boundaries and entire coding sequence of the HFE gene failed to identify additional lesions. Two siblings in a pedigree without cardiomyopathy were wild-type at the HFE C282Y locus; although the brother harboured a single copy of the 187C-->G (H63D) allele, segregation analysis showed that in neither sibling was the iron-storage disease linked to MHC Class I markers on chromosome 6p. Juvenile haemochromatosis is thus a genetically heterogenous disorder distinct from the common adult variant.  (+info)

Clusters of Pneumocystis carinii pneumonia: analysis of person-to-person transmission by genotyping. (5/50503)

Genotyping at the internal transcribed spacer (ITS) regions of the nuclear rRNA operon was performed on isolates of P. carinii sp. f. hominis from three clusters of P. carinii pneumonia among eight patients with haematological malignancies and six with HIV infection. Nine different ITS sequence types of P. carinii sp. f. hominis were identified in the samples from the patients with haematological malignancies, suggesting that this cluster of cases of P. carinii pneumonia was unlikely to have resulted from nosocomial transmission. A common ITS sequence type was observed in two of the patients with haematological malignancies who shared a hospital room, and also in two of the patients with HIV infection who had prolonged close contact on the ward. In contrast, different ITS sequence types were detected in samples from an HIV-infected homosexual couple who shared the same household. These data suggest that person-to-person transmission of P. carinii sp. f. hominis may occur from infected to susceptible immunosuppressed patients with close contact within hospital environments. However direct transmission between patients did not account for the majority of cases within the clusters, suggesting that person-to-person transmission of P. carinii sp. f. hominis infection may be a relatively infrequent event and does not constitute the major route of transmission in man.  (+info)

Structure of cag pathogenicity island in Japanese Helicobacter pylori isolates. (6/50503)

BACKGROUND: cag pathogenicity island (PAI) is reported to be a major virulence factor of Helicobacter pylori. AIM: To characterise cagA and the cag PAI in Japanese H pylori strains. METHODS: H pylori isolates from Japanese patients were evaluated for CagA by immunoblot, for cagA transcription by northern blot, and for cagA and 13 other cag PAI genes by Southern blot. cagA negative strains from Western countries were also studied. Induction of interleukin-8 secretion from gastric epithelial cells was also investigated. RESULTS: All Japanese strains retained cagA. Fifty nine of 63 (94%) strains had all the cag PAI genes. In the remaining four, cag PAI was partially deleted, lacking cagA transcripts and not producing CagA protein. Details of the PAI of these strains were checked; three lacked cagB to cagQ (cagI) and continuously cagS to cag13 (cagII), and the remaining one lacked cagB to cag8. Western cagA negative strains completely lacked cag PAI including cagA. Nucleotide sequence analysis in one strain in which the cag PAI was partially deleted showed that the partial deletion contained 25 kb of cag PAI and the cagA promoter. Interleukin-8 induction was lower with the cag PAI partial deletion strains than with the intact ones. All Japanese cag PAI deleted strains were derived from patients with non-ulcer dyspepsia, whereas 41 of 59 (70%) CagA-producing strains were from patients with peptic ulcers or gastric cancer (p<0.05). CONCLUSIONS: Most Japanese H pylori strains had the intact cag PAI. However, some lacked most of the cag PAI in spite of the presence of cagA. Thus the presence of the cagA gene is not an invariable marker of cag PAI related virulence in Japanese strains.  (+info)

Disruption of the Toxoplasma gondii bradyzoite-specific gene BAG1 decreases in vivo cyst formation. (7/50503)

The bradyzoite stage of the Apicomplexan protozoan parasite Toxoplasma gondii plays a critical role in maintenance of latent infection. We reported previously the cloning of a bradyzoite-specific gene BAG1/hsp30 (previously referred to as BAG5) encoding a cytoplasmic antigen related to small heat shock proteins. We have now disrupted BAG1 in the T. gondii PLK strain by homologous recombination. H7, a cloned null mutant, and Y8, a control positive for both cat and BAG1, were chosen for further characterization. Immunofluorescence and Western blot analysis of bradyzoites with BAG1 antisera demonstrated expression of BAG1 in the Y8 and the PLK strain but no expression in H7. All three strains expressed a 116 kDa bradyzoite cyst wall antigen, a 29 kDa matrix antigen and the 65 kDa matrix reactive antigen MAG1. Mice inoculated with H7 parasites formed significantly fewer cysts than those inoculated with the Y8 and the PLK strains. H7 parasites were complemented with BAG1 using phleomycin selection. Cyst formation in vivo for the BAG1-complemented H7 parasites was similar to wild-type parasites. We therefore conclude that BAG1 is not essential for cyst formation, but facilitates formation of cysts in vivo.  (+info)

Ovine MHC class II DRB1 alleles associated with resistance or susceptibility to development of bovine leukemia virus-induced ovine lymphoma. (8/50503)

For the further characterization of bovine leukemia virus (BLV)-induced leukemogenesis, we investigated the association between polymorphism of ovine leukocyte antigen (OLA)-DRB1 gene and tumor development after infection of sheep with BLV. We infected 28 sheep with BLV and cloned exon 2 of the OLA-DRB1 gene from asymptomatic animals and from animals with lymphoma Sequence analysis revealed that, among 12 healthy sheep without any evidence of tumor, ten (83.3%) carried DRB1 alleles encoding Arg-Lys (RK) at positions beta70/71 as compared with only 6 (37.5%) of the 16 sheep with lymphoma, which suggested that alleles encoding the RK motif might protect against development of tumors after infection by BLV. By contrast, alleles encoding Ser-Arg (SR) at positions beta70/71 were present at a significantly elevated frequency in sheep with lymphoma as compared with the healthy carriers, which indicated that OLA-DRB1 alleles encoding the SR motif might be positively related to susceptibility to tumor development. The two amino acids in these motifs line a pocket that accommodates the side chain of a bound peptide according to a model of the crystal structure of human leukocyte antigen (HLA)-DR1. To analyze immunoreactions of sheep with alleles that encoded RK or SR at beta70/71, we selected sheep with either the RK/SR genotypes or the SR/SR genotypes and immunized them with a mixture of multiple synthetic antigenic peptides that corresponded to T-helper, T-cytotoxic, and B-cell epitopes of the BLV envelope glycoprotein gp51. Two weeks after the last immunization, all of the sheep were challenged with BLV. Sheep with the RK/SR genotype produced neutralizing antibodies against BLV; they eliminated BLV completely within 28 weeks of the BLV challenge, and they gave strong lymphocyte-proliferative responses to the peptides used for immunization. Moreover, such animals did not develop lymphoma. By contrast, sheep with the SR/SR genotype continued to produce BLV throughout the experimental period and developed terminal disease. Our results indicate that the differences in immunoresponse were due to differences in major histocompatibility complex class II alleles and reflected the risk of BLV-induced leukemogenesis. In addition, it appears that susceptibility to tumor development may be determined to some extent by polymorphic residues binding to antigenic peptides directly within the binding cleft of the OLA-DR molecule.  (+info)

Hepatitis C virus (HCV) genotyping is a tool used to optimize antiviral treatment regimens. The newly developed Versant HCV genotype assay (LiPA) 2.0 uses sequence information from both the 5 untranslated region and the core region, allowing distinction between HCV genotype 1 and subtypes c to l of genotype 6 and between subtypes a and b of genotype 1. HCV-positive samples were genotyped manually using the Versant HCV genotype assay (LiPA) 2.0 system according to the manufacturers instructions. For the comparison study, Versant HCV genotype assay (LiPA) 1.0 was used. In this study, 99.7% of the samples could be amplified, the genotype of 96.0% of samples could be determined, and the agreement with the reference method was 99.4% when a genotype was determined. The reproducibility study showed no significant differences in performance across sites (P = 0.43) or across lots (P = 0.88). In the comparison study, 13 samples that were uninterpretable or incorrectly genotyped with Versant HCV genotype ...
© 2014 The Authors. Hepatitis C virus (HCV) exhibits high genetic diversity, characterized by regional variations in genotype prevalence. This poses a challenge to the improved development of vaccines and pan-genotypic treatments, which require the consideration of global trends in HCV genotype prevalence. Here we provide the first comprehensive survey of these trends. To approximate national HCV genotype prevalence, studies published between 1989 and 2013 reporting HCV genotypes are reviewed and combined with overall HCV prevalence estimates from the Global Burden of Disease (GBD) project. We also generate regional and global genotype prevalence estimates, inferring data for countries lacking genotype information. We include 1,217 studies in our analysis, representing 117 countries and 90% of the global population. We calculate that HCV genotype 1 is the most prevalent worldwide, comprising 83.4 million cases (46.2% of all HCV cases), approximately one-third of which are in East Asia. Genotype 3 is
Genotype Genotype_name UNIQUE ?Text // e.g. unc-1(e103);unc-2(e234) Genotype_component Gene ?Gene XREF Component_of_genotype #Evidence Variation ?Variation XREF Component_of_genotype UNIQUE Text // Zygosity Rearrangement ?Rearrangement XREF Component_of_genotype UNIQUE Text // Zygosity Transgene ?Transgene XREF Component_of_genotype UNIQUE Text // Zygosity // Zygosity text entry should be one of the following: // Homozygous, Heterozygous_with_wildtype, or Heteroallelic_combination Other_component UNIQUE ?Text // Free text components including RNAi Is_genotype_for_strain ?Strain XREF Genotype Has_background_strain UNIQUE ?Strain XREF Is_background_for // Only use when NOT N2 Relation_to_other_genotypes Has_maternal_genotype UNIQUE ?Genotype XREF Is_maternal_genotype_for Has_paternal_genotype UNIQUE ?Genotype XREF Is_paternal_genotype_for Is_maternal_genotype_for ?Genotype XREF Has_maternal_genotype Is_paternal_genotype_for ?Genotype XREF Has_paternal_genotype Disease_info Models_disease ...
The diagnosis of mixed genotype hepatitis C virus (HCV) infection is rare and information on incidence in the UK, where genotypes 1a and 3 are the most prevalent, is sparse. Considerable variations in the efficacies of direct-acting antivirals (DAAs) for the HCV genotypes have been documented and the ability of DAAs to treat mixed genotype HCV infections remains unclear, with the possibility that genotype switching may occur.. In order to estimate the prevalence of mixed genotype 1a/3 infections in Scotland, a cohort of 512 samples was compiled and then screened using a genotype-specific nested PCR assay. Mixed genotype 1a/3 infections were found in 3.8% of samples tested, with a significantly higher prevalence rate of 6.7% (p,0.05) observed in individuals diagnosed with genotype 3 infections than genotype 1a (0.8%). An analysis of the samples using genotypic-specific qPCR assays found that in two-thirds of samples tested, the minor strain contributed ,1% of the total viral load. The potential ...
Hepatitis C virus (HCV) genotype and other host and viral factors influence treatment outcome in chronic HCV infection. We evaluated the effect of race and genotype on interferon and ribavirin treatment outcome in 70 Southeast Asian (SEA) and 50 white patients. Genotype was based on the 5 untranslated region (5UTR) with a commonly used line probe assay (INNO-LiPA HCV II) that may mistype genotype 7, 8, or 9 as 1b. HCV core region sequencing resulted in reclassification of 8 genotype 1 and 25 genotype 1b SEA subjects as genotype 7, 8, or 9. Twenty-six SEA genotype 7, 8, and 9 (79%) and 10 SEA true genotype 1b (59%) patients achieved a sustained virologic response (SVR) compared with 15 (34%) white genotype 1b patients. Logistic regression analysis showed that SEA patients with genotype 7, 8, or 9 were more likely to achieve a SVR than white genotype 1b patients (OR 16.56; 95%CI 4.16, 65.91) as were SEA true genotype 1b patients compared with white genotype 1b patients (OR 4.63; 95%CI 1.19, ...
Probing gene-environment interactions that affect neural processing is crucial for understanding individual differences in behavior and disease vulnerability. Here, we tested whether the current environmental context, which affects the acute brain state, modulates genotype effects on brain function
The goal of the present study was to examine the hypothesis of the physical association of multiple genotypes in a single OB for the maintenance of virus diversity. Previous studies have demonstrated that during the systemic phase of infection, single cells in an insect can be co-infected by multiple BV particles, each carrying a single genotype (Godfray et al. 1997; Bull et al. 2001). To maintain genetic diversity during between-host transmission, it is necessary that the larva acquire different genotypes at the moment of primary infection. As the number of OBs required to kill a larva is usually low, the occurrence of multiple genotype infection would be improbable for highly susceptible larvae that can be infected by a single or very few OBs. Under these conditions, maintaining diversity within a larva could be compromised if genotypes are segregated among different OBs, except perhaps during the course of an epizootic, when unusually high densities of OBs may be present briefly in the ...
Find all HIV Genotype Assay Labs in Gurgaon Sector 52,Gurgaon. Now View Prices, Normal Range, Sample Results & Book Online for HIV Genotype Assay Labs in Gurgaon Sector 52 Gurgaon only on | Practo
Find all HIV Genotype Assay Labs in Gurgaon Sector 54,Gurgaon. Now View Prices, Normal Range, Sample Results & Book Online for HIV Genotype Assay Labs in Gurgaon Sector 54 Gurgaon only on | Practo
PCR-Based Genotyping Methods. An introduction to PCR-RFLP/CAPS, and dCAPS. Common PCR-based Genotyping Methods for SNP Analysis. SNPs can have up to 4 alleles (A/C/G/T), but two alleles are most common . These methods can only positively detect one allele. PCR -RFLP / CAPS Slideshow 6726805 by tatiana-stanley
The relationships among isolates of bacterial species typically are displayed with a clustering algorithm, which identifies closely related genotypes but, in the absence of a realistic model of clonal expansion, provides no information about the founding genotypes or the likely patterns of evolutionary descent within the clusters. We address this important problem by using a new implementation of an algorithm that extracts this information from MLST data (or, in principle, other multilocus data). A full description of the features of eBURST is available in the documentation provided at http://eburst.mlst.net . The BURST algorithm was also recently incorporated as a set of priority rules into the minimum-spanning-tree method within the latest BioNumerics cluster analysis module (Applied Maths, Sint-Martens-Latem, Belgium).. The S. pneumoniae example is a very simple one, because the selected clonal complex is less than 50 years old and all isolates (except for a single DLV) are SLVs of the ...
Background: Hepatic steatosis in HCV patients has been postulated as a risk factor associated with a higher frequency of fibrosis and cirrhosis. A single genetic variant, PNPLA3 I148M, has been widely associated with increased hepatic steatosis. Previous studies of the PNPLA3 I148M sequence variant in HCV infected individuals have reported an association between this variant and prevalence of steatosis, fibrosis, and cirrhosis. To evaluate the impact of PNPLA3 I148M variant on metabolic traits and treatment response in HCV genotype 2 and 3 infected patients.. Methods. Three hundred and eighty-two treatment naïve HCV genotype 2 or 3 infected patients were included in a phase III, open label, randomized, multicenter, investigator-initiated trial (the NORDynamIC study), in which pretreatment liver biopsies were mandatory. PNPLA3I148M genotyping was performed in a total of 359 Caucasian patients.. Results: In HCV genotype 2 infected patients carrying the PNPLA3 148M allele, there was significantly ...
A variety of molecular typing techniques have been developed to investigate the clonal relationship among bacterial isolates, including those associated with nosocomial infections. In this study, the authors evaluated whole-genome mapping as a tool to investigate the genetic relatedness between Pseu …
Genotype frequency is the proportion or frequency of any particular genotype among the individuals of a population. Genotype frequencies are a function of gene frequencies. Genotype is the sum total of the genetic information (genes) contained in the linkage structures (chromosomes) of the pro- and eukaryotes, as distinguished from their phenotype. The genotype determines not a unique phenotype, but a range of phenotypic capacities referred to as an individuals norm of reaction to the environment (Rieger et al., 1976 ...
For example, there is 70% penetrance if only 700 individuals express red phenotype out of 1,000 HairredHairred individuals. If penetrance of a phenotype is not 100%, then it has reduced penetrance. Mechanisms of reduced penetrance are not always clear. Expressivity is another important concept in describing genotype-phenotype correlation. Expressivity describes the severity of a phenotype among individuals with the same genotype. For example, if a condition has variable expressivity then one individual might have mild symptoms while another might have severe symptoms (although they have the same genotype). If a trait has constant expressivity then individuals with the same genotype will have the same degree of symptoms.. Mechanisms of variable expressivity are not always clear. Although there is typically a clear genotype-phenotype correlation that associates a specific allele with a specific phenotype, this link is frequently muddled. Even individuals with identical genotypes can have different ...
Of the 170 million patients who are chronically infected with HCV worldwide, approximately half have HCV genotypes other than genotype 1, including about one third of patients with HCV in the United States.17 Currently approved regimens of direct-acting antiviral agents are not equally effective across all genotypes, which means that testing to determine genotype and subtype is required before treatment can be initiated.6,7 A single combination regimen that is effective in all patients regardless of HCV genotype would obviate the need for pretreatment testing, which is an obstacle to treatment in resource-limited settings and may limit treatment uptake outside of specialty clinics.18 In this international, randomized, double-blind, placebo-controlled phase 3 study, treatment with sofosbuvir-velpatasvir for 12 weeks resulted in high rates of sustained virologic response in patients with HCV genotype 1, 2, 4, 5, or 6, including those with cirrhosis and those who had received previous treatment and ...
The single-nucleotide polymorphism SLC39A6 rs1050631 is strongly implicated in esophageal squamous cell carcinoma, leading us to question whether it may also play a role in gastric adenocarcima (GA). We genotyped the SLC39A6 rs1050631 in 512 patients who underwent GA resection. All study subjects lived in an area of China with high GA incidence. Genotypes were examined for possible correlation with survival and recurrence. The potential involvement of SLC39A6 in gastric cancer was explored in clinical samples and cell culture studies. Multivariable analysis showed that patients with the CT + TT genotype at SLC39A6 rs1050631 were at greater risk of recurrence (hazard ratio, HR 1.387, p = 0.004) and death (HR 1.429, p = 0.002) than patients with CC genotype. Median recurrence-free and overall survival were significantly shorter in patients with the CT + TT genotype (20, 27 months) than in patients with the CC genotype (36, 43 months, p = 0.001, p | 0.001). Patients with the CT + TT genotype who were male
Supplement The genotype refers to the entire set of genes in a cell, an organism, or an individual. A gene for a particular character or trait may exist in two allelic forms; one is dominant (e.g. A) and the other is recessive (e.g. a). Based on this, there could be three possible genotypes for a particular character. For instance, a genotype of AA delineates homozygous dominance whereas a genotype of Aa is an example of heterozygous dominance. A genotype of aa is an instance of homozygous recessive. The genotype is a major factor that determines the phenotype of an organism. For example, the genotype determines the color of the petal of a pea plant. ...
The shared genotyping facility is expected to increase throughput ten-fold and reduce costs by about 75-80% in comparison to current procedures. Lowering the genotyping cost will enable CGIAR and other public sector breeders to utilize marker-based selection in forward breeding and also change their current breeding procedures to take advantage of low-cost genotyping. It will be then possible to generate several-fold higher numbers of lines and select them with diagnostic markers for key traits before phenotyping, increasing selection intensity for yield and selection accuracy for other traits. This will accelerate genetic gains in CGIAR mandate crops. The genotyping data demand across from all/leading CGIAR Centers can be aggregated, the costs can be brought down in the range of US$ 1-5 per sample (with 10-100 markers). ...
Results. For the CD4 -11743A/C polymorphism, patients with RA demonstrated significantly higher frequency of the C allele (p = 0.048); patients with SLE had significantly higher frequency of the CC genotype (p = 0.026), and lower frequency of the AC genotype (p = 0.013) compared with controls. For the CD4 -10845A/G polymorphism, patients with RA had significantly higher frequencies of the AA genotype (p = 0.047) and the A allele (p = 0.026); patients with SLE had significantly higher frequency of the AA genotype (p = 0.011) and A allele (p = 0.001), and lower frequency of the GG genotype (p = 0.003) compared with controls. A comparison of genotype groups according to different clinical variables revealed the association of the respective polymorphisms with mucosal ulcer lesions among patients with SLE ...
RESULTS: We found that the most prevalent genotype was Apo Eε3/3, followed in order by Apo Eε3/4 and Apo Eε2/2. The estimated ApoE allelic frequencies in individuals with SD were 0.095, 0.560, and 0.345 for ε2, ε3, and ε4, respectively. In controls, the corresponding Apo E allelic frequencies were 0.146, 0.699, and 0.155. The percentage of ε4 allele carriers in SD group was significantly higher than that in control group ( ...
22 Genome-wide association studies of complex traits are often complicated by relatedness 23 among individuals. Ignoring or inappropriately accounting for relatedness often results in 24 inflated type I error rates. Either genotype or pedigree data can be used to estimate relat25 edness for use in mixed-models when undertaking QTL mapping. We performed simulations 26 to investigate methods for controlling type I error and optimizing power considering both 27 full and partial pedigrees and, similarly, both sparse and dense marker coverage; we also ex28 amined real data sets. 1) When marker density was low, estimating relatedness by genotype 29 data alone failed to control the type I error rate; 2) this was resolved by combining both 30 genotype and pedigree data. 3) When sufficiently dense marker data was used to estimate 31 relatedness, type I error was well controlled and power increased; however, 4) this was only 32 true when the relatedness was estimated using genotype data that excluded genotypes on
The sensitivity of genotype-based diagnostics that predict antimicrobial susceptibility is limited by the extent to which they detect genes and alleles that lead to resistance. As novel resistance variants are expected to emerge, such sensitivity is expected to decline unless the new variants are detected and incorporated into the diagnostic. Here, we present a mathematical framework to define how many diagnostic failures may be expected under varying surveillance regimes and thus quantify the surveillance needed to maintain the sensitivity of genotype-based diagnostics. ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
lane 1 represents homozygous CC genotypes, lane 2 and 5 represents heterozygous AC genotypes and lane 3, 4, 6, and 7 represents homozygous AA genotypes of A20C
Recently with the rapid improvements in high-throughout genotyping techniques, researchers are facing the very challenging task of analyzing large-scale genetic associations, especially at the whole-genome level, without an optimal solution. genotype data, it does not require any computationally rigorous phasing program to account for uncertain haplotype phase. Background Currently, with Artesunate the availability of large-scale genotyping technologies, the genotyping cost of genome-wide association (GWA) studies has been largely reduced and a boom of large-scale GWA studies is underway. Nevertheless, the success of most association studies is based on the linkage disequilibrium (LD) between the functional mutations and markers in a local region of the genome. Varieties of statistical methods that rely on LD pattern have been developed to map functional variants (Spielman et al. 1993; Olson et al. 1994; Rannala and Reeve 2001; Ardlie et al. 2002). The most straightforward approach of LD-based ...
Mean age of patients was 78±6.7 years with a baseline VA of 51±17 ETDRS letter scores. Mean change in VA was +6.8±12.3, +5.1±13.4 and 3.3±14.9 letters at 3, 6 and 12 months, respectively. Patients received 4.2±1.1 and 6.4±2.3 injections in the first 6 and over 12 months, respectively. The AA genotype at rs11200638 (HTRA1 promoter SNP) predicted a better outcome of +7 and +9 letters after 6 (p= 0.003) and 12 months (p,0.0001), respectively. Similarly, the CC genotype at rs3793917 (LOC387715/ARMS2) was associated with increased VA outcome of +7 letters after 6 (p=0.006) and 12 months (p=0.001), whereas the TT genotype at rs10490924 (LOC387715/ARMS2) predicted a poorer VA response of -7 and -8 letters at 6 (p=0.004) and 12 months (p=0.001).. ...
8. Subjects must have an eligible CFTR genotype as noted below. If the screening CFTR genotype result is not received before the Run-in Period (Part 2) or randomization (Parts 1 and 3), a previous CFTR genotype laboratory report may be used to establisheligibility. Subjects who have been enrolled and whose screening genotype does not confirm study eligibility must be discontinued from the study ...
A number of factors are associated with an increased risk of developing adult-onset multiple sclerosis (MS), including modulated immune function, vitamin D insufficiency, the human leukocyte antigen (HLA) genotype, and interaction with the Epstein-Barr virus. Interestingly, some of these risk factors are also associated with being obese.. Although the study is limited by using self-reported BMIs at the age of 20 years and non-standarized methods of genotyping, the findings still have impact. Five years ago (2009-2010), 16.9% of children and adolescents in the United States were obese. This may translate into a growing population of people with MS in the future. Although there is no control over genes, there is control over BMI: perhaps a reduction in the number of obese adolescents will contribute to a reduction of the incidence of MS. However, this should be interpreted cautiously: there is only a correlation between obesity and MS, which does not mean causation.. To read more about the study, ...
6.Lab 6 - If youve seen differences in the distribution of phenotypes in Tm4 over-expressing B35 cells versus control B35 cells, describe these differences. Formulate a hypothesis with regards to what changes on the molecular level may have occurred due to the over-expression of Tm4 that lead to morphological changes that you have observed Genotype A corresponded to the tm4 over-expressing B35, while Genotype B corresponded to the wildtype control B35 cells. Between these two genotypes differences in their distribution of phenotypes was observed through total cell counts. In the control B35 cells, the majority of cells were of stumped or prolonged phenotypes, with all other phenotypes,(besides fan phenotype with nearly no cells), receiving an equal distribution of remaining cells. However, changes were seen when observing the phenotypes of the Tm4 over-expressing B35 cells, with the majority of cells falling into prolonged and stringed phenotype groups, followed by the stumped phenotype. The ...
As most commonly used within SNPedia, genotype refers to the pair of SNPs inherited at a given chromosomal position, one inherited from Dad, one inherited from Mom. Example: rs1234(A;C) is how we indicate someone with a (A;C) genotype at snp rs1234. However, this definition of genotype varies a bit from the one intended when it first introduced over 100 years ago [10.1126/science.35.896.340], and even from the most common usage in genetics textbooks. Although genotype can refer to an individuals genetic constitution (as a whole), the most typical usage is to refer to the pair of alleles carried by an individual at a given locus (or gene). Alleles are classically defined by their protein products and mode of inheritance (e.g. dominant, recessive, etc.), but at a molecular level, alleles may also be defined by one or more co-inherited SNPs. See also Magnitude and Repute Notable genotypes ...
As most commonly used within SNPedia, genotype refers to the pair of SNPs inherited at a given chromosomal position, one inherited from Dad, one inherited from Mom. Example: rs1234(A;C) is how we indicate someone with a (A;C) genotype at snp rs1234. However, this definition of genotype varies a bit from the one intended when it first introduced over 100 years ago [10.1126/science.35.896.340], and even from the most common usage in genetics textbooks. Although genotype can refer to an individuals genetic constitution (as a whole), the most typical usage is to refer to the pair of alleles carried by an individual at a given locus (or gene). Alleles are classically defined by their protein products and mode of inheritance (e.g. dominant, recessive, etc.), but at a molecular level, alleles may also be defined by one or more co-inherited SNPs. See also Magnitude and Repute Notable genotypes ...
The impact of the common alleles at structural loci coding for apolipoprotein (apos) A-IV, E, and H on 12 quantitative risk factors for cardiovascular disease (apos A-I, A-II, B, C-II, C-III, and E; total cholesterol; triglycerides; high density lipoprotein cholesterol; systolic blood pressure; diastolic blood pressure; and red blood cell sodium-lithium countertransport) was estimated in 453 unrelated individuals (227 men and 226 women) aged 26-63 years from the Rochester Family Heart Study, who were not using medications affecting lipid levels or blood pressure. Each risk factor was adjusted for concomitants (assay date, age, age, squared, height, weight and smoking status) before the genotypic effects on mean levels and variances were estimated. Allele frequencies were the same in men and women and were similar to those observed in other studies of US Caucasians. There were very different gender-specific estimates of the relative contribution of concomitants, measured genetic effects, and ...
The Transgenic Genotyping Service (TGS) provides genotyping for JAX Mice and assay development. TGS also provides speed congenics & mapping projects as well as SNP genotyping services for JAX researchers.. TGSs mission is to produce accurate genotyping results with the shortest turnaround time as inexpensively as possible for our clients within the Jackson Laboratory. TGS strives to be the most efficient genotyping service available and to provide complete satisfaction for its clients.. ...
Exploring the structure of genomes and analysing their evolution is essential to understand the ecological adaptation of organisms. However, with the large amounts of data being produced by Next Generation Sequencing (NGS), computational challenges arise in terms of storage, search, sharing, analysis, and visualisation. This is particularly true regarding genomic variation studies that are currently lacking scalable and user-friendly data exploration solutions. Here we present Gigwa, a web-based tool which provides an easy and intuitive way to explore large amounts of genotyping data by filtering the latter based not only on variant features, including functional annotations, but also on genotype patterns. The data storage relies on MongoDB, which offers good scalability perspectives. Gigwa can handle multiple databases and may be deployed in either single or multi-user mode. Finally, it provides a wide range of popular export formats. The Gigwa application is suitable to manage large amounts of
ROX (6-carboxy-X-rhodamine) is used as a passive reference dye in ROX-dependent real-time PCR instruments to normalize for variations of fluorescence levels that can arise mainly due to optical path variations among wells. Normalisation of the fluorescence intensity (Rn) is done in real-time PCR software by dividing the emission intensity of the specific signal by the emission intensity of ROX.. ROX does not take part in the PCR reaction and its fluorescence levels are not proportional to the quantity of DNA in each well, so the addition of this fluorophore to a mix provides a constant fluorescent signal during amplification.. Different types of real-time PCR instruments requiring a passive reference standard have different optimal concentrations of ROX, mainly due to the different optical configurations of each system (i.e. the different type of excitation source and optics used).. The addition of either too little or too much ROX would result in a very noisy signal impacting on the results of ...
The notion that there is a one to one mapping from genotype to phenotype was overturned a long time ago. Along with genotype and environment, ‘non-genetic changes’ orchestrated by altered RNA and protein molecules also guide the development of phenotype. The idea that there is a route through which changes in phenotype can lead to changes in genotype impinges on several phenomena of molecular, developmental, evolutionary and applied interest. Phenotypic changes that do not alter the underlying DNA sequence have been studied across model systems (eg: DNA and histone modifications, RNA editing, prion formation) and are known to play an important role in short term adaptation. However, because of their transient nature and unstable inheritance, the role of such changes in long term evolution has remained controversial. I classify and review three ways in which non-genetic changes can influence genotype and impact cellular fitness across generations, with an emphasis on the enticing idea that
We redesigned Phytophthora-ID from the ground up in version 2.0 so it is now faster and more stable. We have also developed a new tool for multilocus genotyping of P. ramorum and P. infestans. We hope you enjoy the current implementation.. The sequence based identification module of Phytophthora-ID was created by the Grünwald lab in collaboration with Everett Hansen and Frank Martin, with funding from the Pacific Southwest Research Station, USDA-ARS and the US Forest Service.. The genotype identification module of Phytophthora-ID was created by the Grünwald lab in collaboration with Howard Judelson, Bill Fry, Chris Smart, and Jean Ristaino, with funding from USDA-NIFA and USDA-ARS.. If you use Phytophthora-ID for species identification please cite the following references:. ...
Various genetic markers such as for example IS-elements DR-elements adjustable number tandem repeats (VNTR) solitary nucleotide polymorphisms (SNPs) in housekeeping genes and additional sets of genes are being utilized for genotyping. of genes of the sort II TA systems from 173 sequenced genomes of was performed. Several genes of type II TA systems had been found to transport SNPs that correlate with particular genotypes. We propose a minimally adequate group of genes of TA systems for parting of strains at nine fundamental genotype as well as for additional department into subtypes. Applying this group of genes we genotyped a series comprising 62 medical isolates of [1] but also people that have revised virulence transmissibility and pathogenicity. Several researches discovered a relationship between genotypes and their virulence and inclination to acquire medication level of resistance [2 3 The genus and strain identification is of great importance for the proper treatment assignment and SMAD2 ...
genotype: the alleles at a particular locus - that is, the genetic makeup (see also Mendelian genetics) phenotype: the characteristics of a particular genotype that can be observed in an organism
In this study, significant differences could be demonstrated in CV mortality between the G/G and the A/G genotypes, with a higher risk in the G/G group. It is interesting to note that in the study population an elderly community-living group of persons were investigated, that is, all those aged 70 to 85 were invited, and almost seven years of follow-up were applied. Even if the median age at inclusion of the participants was high, 77 years, significant differences in mortality could be demonstrated in the G/G genotype.. Also, in the female group compared to the male group, a tendency for a higher point estimate of the cardiovascular risk by having the G/G genotype could be demonstrated. However, the sample size was limited, and the confidence interval was wide, so we interpret the result as indicating that both sexes having the G/G genotype are exposed to a greater cardiovascular risk, and the females might be exposed to the highest risk.. As patients with diagnosed diabetes are exposed to a ...
Eesti Teadusinfosüsteem koondab informatsiooni teadus- ja arendusasutuste, teadlaste, teadusprojektide ning erinevate teadustegevuste tulemuste kohta.
The combined risk genotypes distribution in gastric cancer familial relatives. A. The prevalences of the ITGA5-1160/ ITGB1-1949/ITGB1 + 31804 as T-carrier/A-
The -607CC genotype was less frequent for HAC group (p=0.0501; OR=0.4890; CI=0.2480 to 0.9643), and infected patients (p=0.0232; OR=0.5207; CI=0.3033 to 0.8937) compared to healthy controls. The -607AC genotype was more frequent for HAC group (p=0.0387; OR=1.991; CI=1.043 to 3.801), and infected patients (p=0.0376; OR=1.757; CI=1.047 to 2.948) compared to healthy controls. No significant difference was observed for allelic and genotypic frequencies of the -137C/G among deferments groups. No significant difference was observed for allelic and genotypic frequencies of the -137C/G and -607A/C polymorphisms when correlated with proviral load. ...
Although it has been well established that DNA repair plays critical roles in human carcinogenesis, limited data are available on the association between DNA repair and CaP risk. In this study, we provide direct evidence that an amino acid substitution variant in the ADPRT gene may contribute to decreased cellular repair function and be able to serve as a marker for CaP susceptibility. Intriguingly, both associations follow an allele dosage-dependent manner, the AA genotype is associated with a significantly higher CaP risk and lower enzyme activity, and the VA genotype carriers have a slight but not significantly increased CaP risk and decreased enzyme activity. Because this variant allele is relatively common in the general population (5-33%), our findings have biological and public health significance.. The genotype distribution of our Caucasian control population was comparable with that seen in a previous study of Caucasians (13) . In this study, the ADPRT 762 AA genotype was seen only in ...
Genetic polymorphisms in drug metabolism contribute largely to adverse drug reactions in susceptible individuals due to excess production of reactive metabolites and acti..
There are several genotypes of HCV. Genotype distribution varies by geography. For example, the most common genotype in the US is genotype 1; in Egypt it is genotype 4. All can cause liver...
The present investigation was undertaken to study the genetic polymorphism of the DRB3 exon 2 in 75 crossbred cattle by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. Five genotypes i.e. HaeIII-a, HaeIII-b, HaeIII-e, HaeIII-ab and HaeIII-ae were observed when the 284 bp PCR products were digested with HaeIII restriction enzyme. The corresponding frequencies of these patterns were 0.53, 0.04, 0.01, 0.38 and 0.04, respectively. Digestion with RsaI restriction enzyme resolved 24 different restriction patterns. The frequencies of these patterns ranged from 0.013 (RsaI-f, RsaI-k and RsaI-c/n) to 0.120 (RsaI-n). The results revealed that the crossbred cows belonged to the RsaI patterns namely b, k, l, a/l, d/s, l/n, l/o and m/n, whose corresponding frequencies were 0.027, 0.013, 0.040, 0.027, 0.040, 0.067, 0.027 and 0.067, respectively. Digestion of the 284 bp PCR product of DRB3.2 gene with PstI in the crossbred cattle did not reveal any restriction site. ...
Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis of Three Lipooligosaccharide-Associated Genes of Campylobacter jejuni and Campylobacter coli Isolated From Animal Samples ...
OBJECTIVES--To investigate the possible association between vitamin D receptor genotype and bone mineral density in a large group of postmenopausal twins. DESIGN--Cross sectional twin study. SETTING--Twin population based in Britain. SUBJECTS--95 dizygotic (non-identical) pairs of twins and 87 monozygotic (identical) pairs of twins aged 50-69 years, postmenopausal, and free of diseases affecting bone, recruited from a national register of twins and with a media campaign. MAIN OUTCOME MEASURES--Bone mineral density measured at the hip, lumbar spine, forearm, and for the whole body by dual energy x ray absorptiometry in relation to differences in the vitamin D receptor genotype. RESULTS--At all sites the values of bone density among dizygotic twins were more similar in those of the same vitamin D receptor genotype than in those of differing genotype, and the values in the former were closer to the correlations seen in monozygotic twins. Women with the genotype that made them at risk of osteoporotic
Read Associations between three common single nucleotide polymorphisms (rs266729, rs2241766, and rs1501299) of ADIPOQ and cardiovascular disease: a meta-analysis, Lipids in Health and Disease on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
TY - JOUR. T1 - Angiotensin-converting enzyme genotype and outcome in pediatric IgA nephropathy. AU - Delos Santos, Noel M.. AU - Ault, Bettina H.. AU - Gharavi, Ali G.. AU - Kritchevsky, Stephen B.. AU - Quasney, Michael W.. AU - Jackson, Elizabeth C.. AU - Fisher, Kimberly A.. AU - Woodford, Susan Y.. AU - Mitchell, Bonnie L.. AU - Gaber, Lillian. AU - Arheart, Kristopher L.. AU - Wyatt, Robert J.. PY - 2002/12/1. Y1 - 2002/12/1. N2 - Angiotensin-converting enzyme (ACE) I/D polymorphism has been implicated as a genetic marker for progression of glomerular disease. Studies of ACE genotypes in adults with IgA nephropathy (IgAN) have yielded conflicting results. We performed ACE genotyping on 79 patients with IgAN diagnosed prior to age 18 years who had either progressed to end-stage renal disease (ESRD) or are now more than 5 years post biopsy. Mean follow-up was 14.8 years for those with normal renal function. Forty-three (54.4%) subjects had normal renal function and a normal urinalysis at ...
Genome‐wide association studies have successfullyidentified many novel genetic loci for various human complex diseases and quantitative traits
To assess percentages of hepatitis C virus (HCV) genotypes in infected Lebanese patients referred to St. George Hospital, Beirut, Lebanon, 77 infected cases were studied. Of those, 27 were hemodialysis patients. Genotyping was performed by nested PCR of the HCV core-region with specific primers, followed by DNA enzyme-immunoassay using HCV type and subtype-specific probes. Single genotype infections were detected in 52 patients (67.5%). In these cases, types 1, 2, 3 and 4 were detected in 19.5%, 32.5%, 5.1% and 10.4% of the cases respectively. Twenty-five (32.5%) samples showed mixed genotype infections. Single genotype distribution was significantly different among dialysis and non-dialysis patients. In the dialysis group, genotype 2 was predominant (80%, p , 0.001). In single HCV genotype-infected patients, subtype 1b was frequently detected in nondialysis cases (34.4%) whereas this genotype was found in only 5% of dialysis cases. Genotypes 5 and 6 were not detected in any of the cases ...
Genetic diversity assessment is necessary to help tackle the threats of environmental fluctuations and for the effective exploitation of genetic resources in breeding program. Recent advancement in the field of molecular markers has made the genetic characterization of genotypes rapid, reliable and reproducible. In the present investigation, we have characterized 49 wheat genotypes at molecular level using 52 SSR primers (including Yr specific primers). 27 polymorphic SSR markers were dispersed over the AABBDD wheat genome, a total of 102 alleles were detected with allele range of 1 to 6. Polymorphism information content (PIC) values calculated to assess the informativeness of each marker ranged from 0.11 to 0.95 and there is significant that 5 out of 27 SSR loci, namely Xpsp 3000, Xwgp249, Wmc198, csLV34, Xgwm301 revealed PIC values above 0.70, can be considered highly useful for differentiation of wheat genotypes. The UPGMA cluster tree analysis led to the grouping of 49 wheat genotypes in two major
Gillihan, S. J., Rao, H., Wang, J., Detre, J., Breland, J., … Farah, M. J. (2010). Serotonin transporter genotype modulates amygdala activity during mood recovery. Social Cognitive and Affective Neuroscience, 5, 1-10.. ...
A multilocational evaluation of 20 soybean genotypes was conducted in two distinct locations (Nsukka in Derived Savanna agro-ecology and Jalingo in northern Guinea Savanna) of Nigeria in 2015 and 2016 cropping seasons. The main objective of this study was to assess the genotype-by-environment interaction (G x E) for specific traits such as number of pods, pod weight, seed yield and yield stability. The results revealed highly significant differences among the genotypes and locations for all the traits except for seed yield. Genotype by environment interaction was not significant for all the traits except for days to 50% flowering indicating relative consistency in time of flowering among the genotypes across the locations and year. The genotype, Ashuku produced the highest yield in the two locations. However, the most stable genotypes across the locations were Dadinkowa and Vom while the ideal environments were Jalingo 2016 (ENV2) and Nsukka 2016 (ENV4) which produced 14.0 and 14.5 g, respectively.
Chickpea is the major pulse crop cultivated in Ethiopia. However, its production is constrained due to genotype instability and environmental variability.  This research was carried out to examine the magnitude of environmental effect on yield of chickpea genotypes and to investigate the stability and adaptability of genotypes under different agro-ecologies.  Twelve genotypes evaluated in randomized complete block design with three replications in three locations for two continuative years. Various stability indices used to assess stability and genotype by environment performances. Combined analysis of variance for yield and yield components revealed highly significant (P≤0.01) differences for genotypes, environments and their interaction. Growing years do not show difference. The significant interaction showed genotypes respond differently across environments.  At Guduru, Hareto and Gitilo, top performing genotype in grain yield were genotype 229961 (2.33ton/ha), genotype 225887 (3
Commerce Business Daily has the largest database of fedbizopps, fed biz ops, fed biz opps, and federal business opportunities for contractors.
Peripheral blood (2 ml) was taken from all subjects and genomic DNA was extracted from peripheral blood using the TIANamp Blood DNA kit (Tiangen Biotech, Beijing, China) according to manufacturers instructions. The quality and concentration of extracted DNA was measured in two OD wavelength 260 and 280 nm using NanoDrop (Thermo Scientific, U.S.A.). SNP genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism method. The primers used for the nucleotide extension reaction were AACAAGTAAGAATGAAAAGAGGACATGGT (forward) and CCCCCAATGAGGTCATAGAAGAATC (reverse) for rs2275913 and ACCAAGGCTGCTCTGTTTCT (forward) and GGTAAGGAGTGGCATTTCTA (reverse) for rs763780 polymorphism. For PCR, 25 μl reaction mixture contained as follows: 2.5 μl of 10× reaction buffer (with 1.5 mM MgCl2), 2 μl of deoxynucleotide triphosphate (dNTP; 2.5 mM), 2 μl of each pair primer, 50 ng DNA template, 1 μl of 0.4U Taq polymerase (Applied Biosystems, Evry, France) and 14.5 μl ddH2O. The ...
Wheat is the most important host for cereal cyst nematode, Heterodera filipjevi. The wild relatives of wheat have important sources of resistance genes to cereal nematodes. Phenotypic and genotypic evaluations have important implications for breeding programs, hence in this study information on the reaction of wheat genotypes to H. filipjevi and their genetic relationships are provided. A total of 223 wheat genotypes originating mostly from West Asia and North Africa (WANA countries) were evaluated against the H. filipjevi. Genetic diversity of 188 genotypes were assessed by using a 152 K single nucleotide polymorphism (SNP) chip. Data were analysed using generalized linear model, showed that there are significant differences at P
Background: Interleukin (IL)-23 has an important role in tumor immune regulation. Objective: To investigate the possible association of interleukin-23 receptor (IL23R) gene variants rs1884444, rs10889677 and rs11209026 with development of acute lymphoblastic leukemia (ALL). Methods: The IL23R variants were studied in 164 ALL patients and compared to 175 healthy controls by polymerase chain reaction-restriction fragment length polymorphism. The relationship between these variants and clinical and laboratory features of the patients and response to therapy were evaluated. Results: No significant differences in genotype and allele frequencies existed between patients and controls. The rs1884444TG genotype was significantly lower in patients who relapsed (24.2%) compared to those without relapse (55.9%, p=0.006). Fewer patients who relapsed had evidence of the G allele (P=0.034). The TG genotype was associated with a longer complete remission at1804±116 days compared to other genotypes (|1217 days, p=0.028
To increase tolerance to abiotic stresses in breeding programmes, typically families and collections of genotypes are evaluated in series of trials (environments) representing different levels of stress. The statistical analysis of the data from such trials concentrates on modelling the phenotypic behaviour of the genotypes across the set of environments. This phenotypic behaviour can be modelled in the form of genotype-specific linear and non-linear response curves in relation to environmental characterizations. Non-parallelism of the response curves indicates genotype × environment interaction. Identification of the genetic basis of the parameters determining the response curves will help in the development of breeding programmes for improving abiotic stress tolerance and understanding genotype × environment interaction. In this paper we present two strategies for locating quantitative trait loci for response-curve parameters and estimation of their allele effects. The procedures are ...
TY - JOUR. T1 - Comparison of Abbott RealTime genotype II, GeneMatrix restriction fragment mass polymorphism and Sysmex HISCL HCV Gr assays for hepatitis C virus genotyping. AU - Han, Mi Soon. AU - Park, Yongjung. AU - Kim, Hyonsuk. PY - 2017/7/1. Y1 - 2017/7/1. N2 - Hepatitis C virus (HCV) genotype is a predictive marker for treatment response. We sequentially evaluated the performances of two nucleic acid amplification tests (NAATs) and one serology assay for HCV genotype: Abbott RealTime genotype II (RealTime II), GeneMatrix restriction fragment mass polymorphism (RFMP), and Sysmex HISCL HCV Gr (HISCL Gr). We examined 281 clinical samples with three assays. The accuracy was assessed using the HCV Genotype Performance Panel PHW204 (SeraCare Life Sciences) for two NAATs. Discrepant cases were re-genotyped by the Versant HCV v.2.0 (line probe 2.0) assay. With the RealTime II assay, clinic samples were analyzed as follows: genotypes 1b (43.1%), 2 (40.2%), 1 subtypes other than 1a and 1b (12.5%), ...
1. Angiotensin-converting enzyme (ACE) genotypes in hypertensive patients were studied in order to delineate their cardiovascular risk due to the ACE gene. We hypothesized that the distribution of ACE genotypes may change with age because of the risk of myocardial infarction associated with the homozygous deletional (DD) genotype. 2. A total of 223 subjects were recruited from the Hypertension Outpatient Clinic of the Sai Ying Pun Hospital with consent. They consisted of 75 patients with newly diagnosed or documented hypertension, 46 patients with ischaemic heart disease and 102 normal controls. Genomic DNA was extracted from peripheral leucocytes and amplified by polymerase chain reaction. Insertion (I) or deletion (D) alleles were identified after electrophoresis. The frequencies of ACE genotypes and alleles were measured in three age groups: | 50 years, 50-59 years and | or = 60 years. 3. A significant correlation between ACE genotype and age was found (P = 0.03). The relative frequency of the D
Aim: The current study was conducted to investigate the effect of GSTP1 codon 105 polymorphism, alone and in combination with GSTM1-deletion polymorphism, on erythrocyte GST activity in 196 Han Chinese. Methods: GST activity was measured in healthy Chinese by a spectrophotometric method (n = 196; 101 males and 95 females; age range 21-81 years; median 43.5 years). GSTM1 polymorphisms were analyzed by a PCR-Multiplex procedure, whereas GSTP1 polymorphism was analyzed by PCR-RFLP. Results: The frequency of GSTM1 null genotype was 56.1% and the frequency of I/I, I/V, and V/V genotypes was 60.7%, 35.2% and 4.1%, respectively, in Han Chinese. The mean erythrocyte GST enzyme activity for I/V genotype group(3.53 ± 0.63 U · g-1 Hb) was significantly lower than that for I/I genotypes (4.25 ± 1.07 U · g-1 Hb, P = 0.000), while significantly higher than that for V/V genotypes (2.44 ± O. 67 U · g-1 Hb, P = 0.004). In GSTM1 (-) group, the GST activity of carriers of GSTM1 (-)/ GSTP1 - I/I is ...
Hepatitis C viral infection after injection drug use is very prevalent. The most important genotype causing HCV infection in PWID globally is genotype 1, as is the case in the general population, but also genotype 3 is highly prevalent in PWID. Genotype 4 is most prevalent in Africa, spreading into Europe, whereas genotype 2 and 6 are more located in Asia. The most important difference comparing to the general population are generally lower prevalence of genotype 1b, and higher prevalence of genotype 1a and 3 in PWID. As the genotype nowadays still determines the treatment, and as there is a different genotype distribution than in the general population, it is important to identify the genotype also in PWID ...
INTRODUCTION: Asthma is a common respiratory childhood disease that results from an interaction between genetic, environmental and immunologic factors. The implication of nucleotide-binding and oligomerization domain 1 and 2 (NOD1/CARD4, NOD2/CARD15) was highlighted in many inflammatory diseases.. METHODS: In this case-control study, we analyzed the association of three NOD2 polymorphisms and one NOD1 variant, in 338 Tunisian asthmatic children and 425 healthy Controls, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. We also assessed NOD1 and NOD2 mRNA and protein levels by qRT-PCR and ELISA techniques.. RESULTS: The homozygous AA genotype of rs2075820 was a risk factor for asthma (OR 2.39). The influence of the E266K variant in the presence of the heterozygous AG genotype was higher in male than female groups. The homozygous AA genotype was a risk factor associated with asthma, for patients aged between 6 and 18 years OR 2.39, IC95% (1.04-5.49) p , ...
Of all the lesions, HPV 16 was the most frequent genotype. This finding is in accordance with many other studies carried out worldwide [20]. In our study, this genotype was present in 35.3% of total lesions. However, in a previous study carried in our hospital from 1993 to 2000, the HPV 16 presence in the total number of lesions was somewhat higher than at present (39%) [21]. Also, in a recent study carried in a southern region of Spain from 2006 to 2007, this presence was even lower than ours (21.2%) [17].. As expected, HPV16 presence increased in accordance with the grade of the lesion (15.8% in benign lesions, 26.1% in CIN1 cases, 56.3% in CIN2-3 cases and 71.4% in ICC).. HPV 31 was the second most frequent genotype in CIN1 lesions and in CIN2-3 lesions. In a study carried in an eastern region of Spain, HPV 31 was also the second most frequent genotype in HSIL lesions and the presence found in these (10.8%) was very similar to the presence obtained in our study (10.8%) [19]. Previous ...
Background: Knowledge of HBV genotype is very important for clinical treatment. Studies have suggested possible pathogenic and therapeutic differences among HBV genotypes. The aim of this study was to determine HBV subtypes and genotypes in HBV-infected patients in our region (southeast Brazil) and to correlate results with clinical and histopathological data. Methods: One hundred and thirty-nine HBsAg-positive patients were included in the study. All patients were anti-HCV and anti-HIV negative (64% male; mean age 42 ± 14.5 years; range 7-80 years; 84% Caucasian) and were followed up at the University Hospital. A method for genotyping and subtyping HBV by partial HBsAg gene sequencing with primers common to all known genotypes was used. The viral load was measured by Amplicor Monitor assay (Roche). Results: HBV genotype A was the most prevalent (55%), while genotypes C, D and F were found in 3%, 38% and 4% of HBV-infected patients, respectively. Among the patients infected by genotype A, 18.3% ...
Specific genotypes of hepatitis B virus (HBV) are increasingly recognized for their clinical significance and association with particular viral mutations. Although many HBV genotyping methods exist, there has been no standardized or commercially available method for direct molecular typing of the HBV genome. A newly available line probe assay (INNO-LiPA HBV Genotyping assay; Innogenetics N.V., Ghent, Belgium) that allows the identification of HBV genotypes A to G was assessed by comparison with pre-S1/pre-S2 sequence analysis of the isolates in 188 serum specimens. All seven genotypes were detected by the line probe assay (LiPA), and complete concordance between LiPA and sequence analysis was observed for 152 specimens (81%). LiPA was able to detect 19 mixed genotype infections not detected by amplicon sequencing, which for the most part were confirmed by cloning and sequencing of the pre-S1/pre-S2 amplicon. Four specimens had discrepant results between the two methods, and five specimens had ...
Single nucleotide polymorphism at exon 7 splice acceptor site of OAS1 gene determines response of hepatitis C virus patients to interferon therapy.: Response to
Single nucleotide polymorphism (SNP) genotyping assays normally give rise to certain percents of no-calls; the problem becomes severe when the target organisms, such as cattle, do not have a high resolution genomic sequence. Missing SNP genotypes, when related to target traits, would confound downstream data analyses such as genome-wide association studies (GWAS). Existing methods for recovering the missing values are successful to some extent - either accurate but not fast enough or fast but not accurate enough. To a target missing genotype, we take only the SNP loci within a genetic distance vicinity and only the samples within a similarity vicinity into our local imputation process. For missing genotype imputation, the comparative performance evaluations through extensive simulation studies using real human and cattle genotype datasets demonstrated that our nearest neighbor based local imputation method was one of the most efficient methods, and outperformed existing methods except the time-consuming
Meckes, C., Moyna, N., Tsongalis, G., Miles, M. (2001). Apolipoprotein E Genotype Does Not Affect the Changes in Serum Lipids with Exercise Training. Circulation, 104(17), 343-343 ...
Type: JAX GEMM Strain - Mutant Strain Ty … Type: JAX GEMM Strain - Mutant Strain Type: JAX GEMM Strain - Spontaneous Mutation TJL Mating System: Outcross-Intercross (Female x Male) TJL Breeding Summary: homozygote x B6CBACa-Aw-J/A F1 then obligate heterozygote x heterozygote Species: laboratory mouse Generation: N68F1 (07-NOV-05) Appearance white-bellied agouti, ataxic Related Genotype: Aw-J/? Kcnj6wv/Kncj6wv OR agouti, ataxic Related Genotype: A/A Kcnj6wv/Kncj6wv OR white-bellied agouti, unaffected Related Genotype: Aw-J/? +/? or Aw-J/A Kncj6wv/+ OR agouti, unaffected Related Genotype: A/A +/? or A/A Kncj6wv/+ Strain Description Mice homozygous for the weaver spontaneous mutation (Kcnj6wv) are recognizable in the second postnatal week by their small size, instability of gait, weakness, and hypotonia. Many homozygous mutant mice die at weaning age, but some survive to adulthood, and females may breed. The cerebellum in homozygous mutants is very small, simple, and almost devoid of granule ...
Based on favorable data for 12 weeks of treatment for noncirrhotic patients in the phase 2 SURVEYOR-2 study (100% SVR12 in 34 patients with genotype 4, 5, or 6) (Kwo, 2017b), ENDURANCE-4 enrolled 121 DAA-naive or -experienced (sofosbuvir plus ribavirin ± peginterferon) genotype 4, 5, or 6 patients without cirrhosis to receive 12 weeks of the daily fixed-dose combination of glecaprevir (300 mg)/pibrentasvir (120 mg) administered as three 100 mg/40 mg pills (Asselah, 2018b). Of those enrolled, 86% had fibrosis stage F0 to F1 and 68% were treatment naive. The genotype distribution was 63% genotype 4, 21% genotype 5, and 16% genotype 6. The overall SVR12 rate for the intention-to-treat population was 99% (120/121), including 99% (75/76) for genotype 4, 100% for genotype 5 (26/26), and 100% (19/19) for genotype 6. Genotype 4, 5, and 6 patients were not included in the randomized study to compare an 8-week vs 12-week course for DAA-naive, noncirrhotic patients. However, part 4 of the SURVEYOR-2 study ...
Errors in genotype determination can lead to bias in the estimation of genotype effects and gene-environment interactions and increases in the sample size required for molecular epidemiologic studies. We evaluated the effect of genotype misclassification on odds ratio estimates and sample size requirements for a study of NAT2 acetylation status, smoking, and bladder cancer risk. Errors in the assignment of NAT2 acetylation status by a commonly used 3-single nucleotide polymorphism (SNP) genotyping assay, compared with an 11-SNP assay, were relatively small (sensitivity of 94% and specificity of 100%) and resulted in only slight biases of the interaction parameters. However, use of the 11-SNP assay resulted in a substantial decrease in sample size needs to detect a previously reported NAT2-smoking interaction for bladder cancer: 1,121 cases instead of 1,444 cases, assuming a 1:1 case-control ratio. This example illustrates how reducing genotype misclassification can result in substantial ...
54 apoa5 TaqMan 5-nuclease assay chemistry provides a fast and simple way to get single nucleotide polymorphism (SNP) genotyping results.
683 serpina4 TaqMan 5-nuclease assay chemistry provides a fast and simple way to get single nucleotide polymorphism (SNP) genotyping results.
In this deficiency the genotype is not associated with the phenotype. The presence of certain mutations in genes has no ... There is no strict genotype-phenotype correlation in isolated GKD; it can be either symptomatic or asymptomatic. Symptomatic ... National Library of Medicine (17 December 2012). "Genotype-Phenotype Correlation". Genetics Home Reference. Retrieved 21 ...
... "thrifty genotype" remains as viable as when first advanced...". He went on to advance that the thrifty genotype concept be ... The thrifty genotype hypothesis has been used to explain high, and rapidly escalating, levels of obesity and diabetes among ... "The Thrifty Genotype Revisited." In The Genetics of Diabetes Mellitus, ed. J. Kobberling and R. Tattersall. New York: Academic ... Neel JV (May 1999). "The "thrifty genotype" in 1998". Nutr. Rev. 57 (5 Pt 2): S2-9. doi:10.1111/j.1753-4887.1999.tb01782.x. ...
"The Genotype/Phenotype Distinction". stanford.edu. "The Wikipedia Of Farming Is Here". Popular Science. Harper, Caleb; Siller, ...
Genotype A) ^ ^ (Genotype B) ^ , , , , Environ <------> Other Environ <------> Other extreme extreme extreme extreme The ... But differing genotypes within a single species may also show differing reaction norms relative to a particular phenotypic ... For every genotype, phenotypic trait, and environmental variable, a different reaction norm can exist; in other words, an ... One advantage of plants is that the same genotype, such as a recombinant inbred line (RIL), can be repeatedly evaluated in ...
Dean L (2016). "Diazepam Therapy and CYP2C19 Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds.). Medical Genetics ...
He is best known for coining the terms gene, phenotype and genotype, and for his 1903 "pure line" experiments in genetics. ... He created the terms phenotype and genotype, first using them in his book in German as Elemente der exakten Erblichkeitslehre. ... Roll-Hansen, Nils (1979). "The Genotype Theory of Wilhelm Johannsen and its Relation to Plant Breeding and the Study of ... This led him to coin the terms phenotype and genotype. Johannsen's findings led him to oppose contemporary Darwinists, most ...
Dean L (May 2019). "Deutetrabenazine Therapy and CYP2D6 Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds.). ...
Dean L (September 2019). "Clobazam Therapy and CYP2C19 Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds.). Medical ...
Genotyping these in Helsinki led to a breakthrough; convincing linkage was found to a locus on chromosome 2p which was ... Genotype/phenotype correlations were described. The resulting publication became de la Chapelle's first breakthrough ...
comlaw.gov.au Dean L (2018). "Brivaracetam Therapy and CYP2C19 Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds ... Dean L (2018). "Brivaracetam Therapy and CYP2C19 Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds.). Medical ...
Dean L (2015). "Carbamazepine Therapy and HLA Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds.). Medical Genetics ... September 2013). "Clinical Pharmacogenetics Implementation Consortium guidelines for HLA-B genotype and carbamazepine dosing". ...
Dean L (2012). "Mercaptopurine Therapy and TPMT Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds.). Medical ... March 2011). "Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and ... especially for those with homozygous variant genotypes. Large differences of TPMT and NUDT15 among ethnicities in terms of ...
Genotyping indicated that multiple P. vivax strains were invading the red cells of Duffy-negative people. The authors suggest ... The existence of these genotypes is likely due to evolutionary pressure exerted by parasites of the genus Plasmodium which ... The fitnesses of different genotypes in an African region where there is intense malarial selection were estimated by Anthony ... The Duffy-blood-group genotype, FyFy". N Engl J Med. 295 (6): 302-4. doi:10.1056/NEJM197608052950602. PMID 778616. Lemaitre B, ...
The genotype is Cassinoceras explanator (Whitfield). A second species Cassinoceras grande Ulrich & Foerste is also known from ...
Codner E, Román R (March 2008). "Premature thelarche from phenotype to genotype". Pediatric Endocrinology Reviews. 5 (3): 760-5 ...
Wright visualized a genotype space as a hypercube. No continuous genotype "dimension" is defined. Instead, a network of ... are used to visualize the relationship between genotypes and reproductive success. It is assumed that every genotype has a well ... Genotypes which are similar are said to be "close" to each other, while those that are very different are "far" from each other ... If all genotypes have the same replication rate, on the other hand, a fitness landscape is said to be flat. An evolving ...
... from a normal to cancer genotype; or vice versa; in characterized human cancer cell lines such as HCT116 or Nalm6. There are ...
... genotype (Kabuli or Desi chickpeas), 4. additives, 5. protein concentration, and 6. carbohydrate type and concentration. The ...
Genotyping is also used in prenatal testing for hemolytic disease of the newborn. When a pregnant woman has a blood group ... Genotyping can identify the specific type of weak D antigen, which determines the potential for the person to produce ... Genotyping is preferred to serologic testing for people with sickle cell disease, because it is more accurate for certain ... Genotyping is increasingly used to determine the molecular basis of weak D phenotypes, as this determines whether or not ...
Westhoff, Connie M. (2019). "Blood group genotyping". Blood. 133 (17): 1814-1820. doi:10.1182/blood-2018-11-833954. ISSN 0006- ...
Monozygotic twins always have the same genotype. Normally due to an environmental factor or the deactivation of different X ... "Genotypes favoring elevated IGF and diets including dairy products, especially in areas where growth hormone is given to cattle ...
Indeed, CYP17A1 genotype is associated with polymenorrhea. Regardless of their mechanism, the menstrual disturbances associated ...
Dean L (2017). "Dabrafenib Therapy and BRAF and G6PD Genotype". In Pratt VM, McLeod HL, Rubinstein WS, et al. (eds.). Medical ...
Azaiez H, Yang T, Prasad S, Sorensen JL, Nishimura CJ, Kimberling WJ, Smith RJ (December 2007). "Genotype-phenotype ...
The genotype, R. josephianum also comes from Ontario. Also from the Middle Ordovician of North America is the long, slightly ... The genotype, O. acinaces, is from Middle Silurian of central Europe. The sutures in Oonoceras form lateral lobes. The camerae ... The genotype, L. regulare, comes from Ontario. Romingoceras, also named by Foerste in 1932, differs in having a depressed, ... The genotypes of Oocerina and Paroocerina, respectively O.lentigratum and P. podolskensis, are from the Upper Silurian of ...
... and E genotypes have been seen in Africa prevalently while B and C genotypes are observed in Asia as widespread. Genotypes ... There are two other genotypes I and J but they are not universally accepted as of 2015. The diversity of genotypes is not shown ... and into eight major genotypes (A-H). The genotypes have a distinct geographical distribution and are used in tracing the ... Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment ...
May 2010). "Phenotype and Genotype of Pancreatic Cancer Cell Lines". Pancreas. 39 (4): 425-435. doi:10.1097/MPA. ...
Genotypes 3 and 4 are commons in Asia. Genotype 5 is present in Central and Southern Africa. Genotype 6 can be encountered in ... Finally, genotype 7 has been reported in China. Infection with multiple genotypes is possible. Genotype 5 appears to be basal ... It has been classified into seven genotypes and many subtypes with distinct geographical distributions. Genotypes 1 and 2 are ... Feng Y, Zhao W, Feng Y, Dai J, Li Z, Zhang X, Liu L, Bai J, Zhang H, Lu L, Xia X (2011). Davis T (ed.). "A Novel Genotype of GB ...
The SPRINT-1 trial was a phase-II trial of boceprevir in difficult-to-treat patients with HCV genotype 1. Study results were ... The patients enrolled in the SPRINT-1 study were among the most difficult to treat, and were exclusively those with genotype 1 ... The SPRINT-2 trial was a double-blind study which randomly assigned adults with untreated hepatitis C virus, genotype 1, to one ... "Interim Results from Boceprevir Phase II Study in Genotype 1 Treatment-Naive Hepatitis C Patients Presented At EASL - Forbes. ...
The genotyping of the complete mtDNA in ancient Near Eastern populations would be required to fully answer this question and it ... using integration of genotypes on newly collected largest data set available to date (1,774 samples from 106 Jewish and non- ... each genotyped with >300 K SNPs. Both STRUCTURE and principal component analyses (PCA) showed the largest division/principal ... "Measuring European population stratification with microarray genotype data". American Journal of Human Genetics. 80 (5): 948-56 ...
... genotype is the internal genetic makeup of an organism or cell. The genetic makeup of an organism determines its physical ... The term "genotype" is typically used in reference to a specific characteristic. Essentially, genotype refers to all of the ... The meaning of "genotype" is the internal genetic makeup of an organism or cell. The genetic makeup of an organism determines ...
... The Transgenic Genotyping Service (TGS) provides genotyping for JAX Mice and assay development ... TGSs mission is to produce accurate genotyping results with the shortest turnaround time as inexpensively as possible for our ... TGS strives to be the most efficient genotyping service available and to provide complete satisfaction for its clients. ... TGS also provides speed congenics & mapping projects as well as SNP genotyping services for JAX researchers. ...
Nutrition is known to interact with genotype in human metabolic syndromes, obesity and diabetes, and also in Drosophila ... Dietary Changes and Genotype December 30/Obesity, Fitness & Wellness Week -- ... Dietary Changes and Genotype December 30/Obesity, Fitness & Wellness Week -- "Nutrition is known to interact with genotype in ... may also be affected by genotype," scientists writing in the journal Plos Genetics report. ...
Although genotype can refer to an individuals genetic constitution (as a whole), the most typical usage is to refer to the ... As most commonly used within SNPedia, genotype refers to the pair of SNPs inherited at a given chromosomal position, one ... However, this definition of genotype varies a bit from the one intended when it first introduced over 100 years ago [10.1126/ ... Example: rs1234(A;C) is how we indicate someone with a (A;C) genotype at snp rs1234. ...
Although genotype can refer to an individuals genetic constitution (as a whole), the most typical usage is to refer to the ... one of 2 snps relevant to classifying APOE genotype. rs5082(C;C). 2.5. saturated fat contributes to obesity, but 0.57 % lower ... As most commonly used within SNPedia, genotype refers to the pair of SNPs inherited at a given chromosomal position, one ... However, this definition of genotype varies a bit from the one intended when it first introduced over 100 years ago [10.1126/ ...
What is the difference between genotype and phenotype? and find homework help for other Science questions at eNotes ... Genotype is the genetic makeup while phenotype is the outward physical manifestation of the genotype. Maybe youre looking for ... A phenotype is the result of a particular genotype. Discuss how the genotype affects the... ... Genotype refers to the actual genes that an organism has in its DNA. It includes all of the possible traits, or characteristics ...
Here some info on genotypes and why we need to know the type a person has; What... ... Did you know that you can have more than one genotype, yes it is possible. ... Here some info on genotypes and why we need to know the type a person has;. What does the term genotype mean?. Genotype refers ... Genotype 1 is the most common genotype seen in the United States.. Is it necessary to do genotyping when managing a person with ...
... a genotype of AA delineates homozygous dominance whereas a genotype of Aa is an example of heterozygous dominance. A genotype ... The genotype is a major factor that determines the phenotype of an organism. For example, the genotype determines the color of ... The genotype refers to the entire set of genes in a cell, an organism, or an individual. A gene for a particular character or ... there could be three possible genotypes for a particular character. For instance, ...
MPR.genotyping_0.8.tar.gz Windows binaries: r-devel: MPR.genotyping_0.8.zip, r-release: MPR.genotyping_0.8.zip, r-oldrel: MPR. ... MPR.genotyping: Maximum Parsimony of Recombination to Infer Parental Genotypes. Infer parental genotypes based on low-coverage ... population sequencing data and thus can genotype mapping populations and construct ultra-high density linkage map in a parent- ... https://CRAN.R-project.org/package=MPR.genotyping. to link to this page. ...
A genotype is the collection of genes that all living things, including you and everyone you know, carry. Learn more at ... Genotype vs. Phenotype. Genotype refers to all the genes that an individual carries. Phenotype is the term for all the ... What Is a Genotype?. A genotype is the collection of genes that all living things, including you and everyone you know, carry. ... The genotype corresponding to the phenotype of short coat length would be either LL or Ll, while the genotype for long coat ...
The genetics terms genotype and phenotype are connected but have different definitions. Genotype determines the phenotype of an ... What Is a Genotype? The word genotype comes from the Greek words "genos" which means "birth" and "typos" which means "mark". ... The genotype of the individual determines the phenotype. However, it is not always possible to know the genotype by looking ... A purple-flowered pea plant may have the genotype PP or Pp. A white-flowered pea plant would have the genotype pp. ...
The sensitivity of genotype-based diagnostics that predict antimicrobial susceptibility is limited by the extent to which they ... Hicks AL, Kissler SM, Lipsitch M, Grad YH (2019) Surveillance to maintain the sensitivity of genotype-based antibiotic ... Surveillance to maintain the sensitivity of genotype-based antibiotic resistance diagnostics.pdf (1.546Mb) ... expected under varying surveillance regimes and thus quantify the surveillance needed to maintain the sensitivity of genotype- ...
Often though, genotype is used to refer to a single gene or set of genes, such as the genotype for eye color. The genes take ... Genotyping is the process of elucidating the genotype of an individual with a biological assay. Also known as a genotypic assay ... If each gene still only has two alleles, the genotype for a trait involving 2 would now have nine possible genotypes. For ... Conversely, some phenotypes could be the result of multiple genotypes. The genotype is commonly mixed up with the phenotype ...
When genotyping transgenic organisms, a single genomic region may be all that needs to be examined to determine the genotype. A ... Genotyping is the process of determining differences in the genetic make-up (genotype) of an individual by examining the ... That is, only a small fraction of an individuals genotype is determined, such as with (epi)GBS (Genotyping by sequencing) or ... For example, viruses and bacteria can be genotyped. Genotyping in this context may help in controlling the spreading of ...
Genotyping-by-sequencing (GBS) approaches provide low-cost, high-density genotype information. However, GBS has unique ... Marker Density and Read Depth for Genotyping Populations Using Genotyping-by-Sequencing. Timothy M. Beissinger, Candice N. ... Marker Density and Read Depth for Genotyping Populations Using Genotyping-by-Sequencing. Timothy M. Beissinger, Candice N. ... Marker Density and Read Depth for Genotyping Populations Using Genotyping-by-Sequencing. Timothy M. Beissinger, Candice N. ...
The genotype-phenotype distinction is drawn in genetics. "Genotype" is an organisms full hereditary information, even if not ... The mapping of a set of genotypes to a set of phenotypes is sometimes referred to as the genotype-phenotype map. ... in which case it is not possible to exactly predict the genotype from knowledge of the phenotype (i.e. the genotype-phenotype ... The genotype represents its exact genetic makeup - the particular set of genes it possesses. Two organisms whose genes differ ...
Genotype,, the genetic constitution of an organism. The genotype determines the hereditary potentials and limitations of an ... Genotype, the genetic constitution of an organism. The genotype determines the hereditary potentials and limitations of an ... each, is called the organisms genotype. The genotype is contrasted to the phenotype, which is the organisms outward ... to invent some hypothetical ancestral genotype, such as A. A. b. b. c. c. D. D. E. E. , and an "evolved" derivative, such as a ...
Blood Type Diet What Is The Genotype Diet Genotype Diet Different Diets What Is The Blood Type Diet ... The Genotype approach emphasizes what you CAN eat, not what you cant. The focus is not on self-denial, but self-knowledge. ... I believe the work of figuring out your Genotype is worth it. And this goes back to my first rule of good health: "Knowledge is ... But wait: This article is titled "What is the Genotype Diet?". Let me explain. Peter DAdamo, N.D., (ND stands for " ...
... are the first allele frequency and genotype prevalence estimates of human genetic variants for the entire U.S. population. ... FCGR2A Allele and Genotype Frequencies.  alert icon Archived: This Page Is No Longer Being Updated This web page is archived ...
To find the genotype frequencies we simply count the numbers of individual with each genotype. Thus:. frequency of AA = 3/8 = ... Genotype frequency. Genotype frequency and gene frequency are closely related variables, and both are easy to measure. The ... Each individual has a genotype made up of two genes at the locus and a population can be symbolized like this:. Aa AA aa aa AA ... simplest case is one genetic locus with two alleles (A and a) and three genotypes (AA, Aa, and aa). ...
The word genotype was coined circa,c. 1898 by Wilhelm Ludvig Johannsen in reference to Gregor Mendels work involving pea ... but unknown genotype at a given locus with an organism of recessive genotype at that locus in order to determine the genotype ... The word genotype was coined c. 1898 by Wilhelm Ludvig Johannsen in reference to Gregor Mendels work involving pea plants (see ... Genotype can be difficult to uncover (unless youre really into genome sequencing, that is) because of the fact that multiple ...
Optimizing Low-Cost Genotyping and Imputation Strategies for Genomic Selection in Atlantic Salmon Smaragda Tsairidou, Alastair ... Imputation of Missing Genotypes From Sparse to High Density Using Long-Range Phasing ... Quality Control of Genotypes Using Heritability Estimates of Gene Content at the Marker ... Application of Low Coverage Genotyping by Sequencing in Selectively Bred Arctic Charr (Salvelinus alpinus) Christos ...
Genotype definition, the genetic makeup of an organism or group of organisms with reference to a single trait, set of traits, ... Word Origin and History for genotype Expand. n. "genetic constitution of an individual," 1910, from German Genotypus (Wilhelm ... genotype definition. A combination of alleles situated on corresponding chromosomes that determines a specific trait. ... Corresponding closely in general characters with S. macroceros (Grube), the genotype. Journal of Entomology and Zoology, Vol. ...
Genotype og fenotype beskriver hvilke gener/genvarianter en organisme bærer på (genotype), og hva som kommer til uttrykk ( ... Termene «genotype» og «fenotype» ble først tatt i bruk av Wilhelm Johannsen i 1911. ... Hentet fra «https://no.wikipedia.org/w/index.php?title=Genotype_og_fenotype&oldid=17724490» ...
Find the best clips, watch programmes, catch up on the news, and read the latest Genotype interviews. ...
... namy namy at lovelace.infobiogen.fr Thu Mar 14 10:24:57 EST 1996 *Previous message: REQ: Sacchromyces ...
Our strategy enables immediate intraoperative genotyping and local application of a genotype-specific treatment in surgical ... Genotype-targeted local therapy of glioma. Ganesh M. Shankar, Ameya R. Kirtane, Julie J. Miller, Hormoz Mazdiyasni, Jaimie ... Genotype-targeted local therapy of glioma. Ganesh M. Shankar, Ameya R. Kirtane, Julie J. Miller, Hormoz Mazdiyasni, Jaimie ... Genotype-targeted local therapy of glioma. Ganesh M. Shankar, Ameya R. Kirtane, Julie J. Miller, Hormoz Mazdiyasni, Jaimie ...
... what a genotype test is and what a phenotype test is? I understand that they test for different things. Regards, Rog from UK... ... A genotype is literally based on your HIV virus genetic structure. It is a description of the sequence of amino acids in the ... Genotype tests occassionally will show a mutation that initially is without evidence of any impact on viral loads, but which ... While the genotype and phenotype measure different aspects of resistance, they are providing similar types of information. In ...
My Genotype is 1b with hcv quantitation 847,000. SGOT 44, SGPT 54 and I was also positvie for Hept which is the first time the ... All I know at this point is my Genotype is 1. I dont remember if that is the better of the Genotype as far as a cure rate or ... All I know at this point is my Genotype is 1. I dont remember if that is the better of the Genotype as far as a cure rate or ... My genotype. I got more lab results.. My Genotype is 1b with hcv quantitation 847,000. SGOT 44, SGPT 54 and I was also positvie ...
http://www.cs.mun.ca/~blangdon/gpu_gp_slides/pi2_movie.html Each frame of the animation contains 512x400 = 204800 individual programs. The colour of each pix...
... platform approaches for SNP genotyping, and the analyses of these datasets for genotype-phenotype studies. The workshop will ... SNP Genotyping(6MB) (Debbie Nickerson, Ph.D.). Technology Platforms. Candidate Gene. Whole Genome Data. Quality Control ... SNP Workshop: Bioinformatics & Genotyping. Workshop Overview. January 30-31, 2006. Research Triangle Park, North Carolina. ... This workshop will provide an overview of the latest approaches for identifying and genotyping single nucleotide polymorphisms ...
TaqMan-based genotyping is most appropriate for projects of medium size (100-1000 samples) being genotyped for a small number ... About TaqMan-based SNP Genotyping. Taq DNA polymerases 5-nuclease activity is used in the Taqman assay for SNP genotyping. ... TaqMan SNP Genotyping Assay (PDF). To schedule an appointment or to discuss experimental design, send an email to Debbie Prusak ... The TaqMan service begins with a review of the list of SNPs to be genotyped as not all SNPs can be typed using the TaqMan ...
The Genotype-Tissue Expression (GTEx) project.. GTEx Consortium1.. Collaborators (126). Lonsdale J, Thomas J, Salvatore M, ... Here we describe the Genotype-Tissue Expression (GTEx) project, which will establish a resource database and associated tissue ...
A genotype is the collection of genes that all living things, including you and everyone you know, carry. Learn more at ... What Is a Genotype?. A genotype is the collection of genes that all living things, including you and everyone you know, carry. ... Genotype vs. Phenotype. Genotype refers to all the genes that an individual carries. Phenotype is the term for all the ... The genotype corresponding to the phenotype of short coat length would be either LL or Ll, while the genotype for long coat ...
DID THE BIOSPY NEXT AND GENO TYPE. EARLY STAGE 3 WITH CHIROSSIS AND GENO TYPE 4. FOUND THIS OUT IN NOV OF 03. I WAS SENT TO ... Q GENOTYPE 2, DOES ANYONE ELSE HAVE THIS? by WORRIEDIN2004 11-28-2003....Open this up and look at comment # 2 by INDIANA There ... My mother was diagnosed with Hebitis C genotype 4. Could you give me name of the hospitals in Europe or Paris that treat this ... i have hepc genotype 4 anyone know any good websites with info? ? ? ...
Knowing your genotype can help direct treatment and determine your outlook. ... Genotypes are used to identify particular strains of hepatitis C. ... Genotype 6 is seen in Southeast Asia.. Genotype 1 is the most common HCV genotype in the United States. Its found in nearly 75 ... Genotypes 1, 2, and 3 are found worldwide. Genotype 4 occurs in the Middle East, Egypt, and central Africa. Genotype 5 is ...
This test detects variants in the CYP2C19 gene leading to altered enzyme activity and may require alternative treatments or altered drug dosage of a drug metabolized by CYP2C19 for optimal therapeutic response.
PHENOTYPE AND GENOTYPE Definitions: phenotype is the constellation of observable traits; genotype is the genetic endowment of ... The genome in which a genotype is found can affect the expression of that genotype, and the environment can affect the ... Genotype is also used to refer to the pair of alleles present at a single locus. With alleles A and a there are three ... How do we get from genotype to phenotype? Central dogma: DNA via transcription to RNA via translation to protein; proteins can ...
... however the scope of this resource will be extended to include any available genotype/molecular phenotype datasets. ...
  • What is the difference between genotype and phenotype? (enotes.com)
  • Genotype is the genetic makeup while phenotype is the outward physical manifestation of the genotype. (enotes.com)
  • Whats the difference between a genotype and phenotype? (enotes.com)
  • A phenotype is the result of a particular genotype. (enotes.com)
  • The genotype is a major factor that determines the phenotype of an organism. (biology-online.org)
  • In other words, the genotype refers to the genetic information, while the phenotype refers to the observable characteristics, including traits. (ancestry.co.uk)
  • Phenotype is also influenced by environmental factors, and a single phenotype could be the result of more than one genotype. (ancestry.co.uk)
  • Two such terms that will be used repeatedly are genotype and phenotype . (thoughtco.com)
  • The trait that is shown due to the coding in the genotype is called the phenotype . (thoughtco.com)
  • In pea plants, like in the example above, if the dominant allele for purple flowers is present in the genotype, then the phenotype would be purple. (thoughtco.com)
  • Even if the genotype had one purple color allele and one recessive white color allele, the phenotype would still be a purple flower. (thoughtco.com)
  • The genotype of the individual determines the phenotype. (thoughtco.com)
  • However, it is not always possible to know the genotype by looking only at the phenotype. (thoughtco.com)
  • The notion that there is a one to one mapping from genotype to phenotype was overturned a long time ago. (preprints.org)
  • Along with genotype and environment, 'non-genetic changes' orchestrated by altered RNA and protein molecules also guide the development of phenotype. (preprints.org)
  • The idea that there is a route through which changes in phenotype can lead to changes in genotype impinges on several phenomena of molecular, developmental, evolutionary and applied interest. (preprints.org)
  • Overall, I review evidence which suggests that non-genetic changes can impact phenotype via their influence on the genotype, and thus play a role in evolutionary change. (preprints.org)
  • Genotype is the sum total of the genetic information (genes) contained in the linkage structures (chromosomes) of the pro- and eukaryotes, as distinguished from their phenotype. (dagris.info)
  • The genotype determines not a unique phenotype, but a range of phenotypic capacities referred to as an individual's 'norm of reaction' to the environment (Rieger et al. (dagris.info)
  • Genotype and phenotype are terms that are used to differentiate between the genetic makeup of an individual and which genes are to be expressed respectively. (pediaa.com)
  • The genotype, together with other two factors: epigenetic and environmental factors, determines the phenotype of that particular organism. (pediaa.com)
  • Phenotype depends on the genotype and environmental factors. (pediaa.com)
  • 1) To better understand the relationship between the phenotype and genotype of ALS and related diseases, including PLS, HSP, PMA, and FTD. (miami-als.org)
  • When allele A is dominant over allele A', write out the parental phenotypes and genotypes. (enotes.com)
  • Heterozygous genotypes contain one copy of one allele and one copy of the other. (ancestry.co.uk)
  • Homozygous genotypes have two copies of the same allele. (ancestry.co.uk)
  • The heterozygous genotype for cat coat length is Ll, with one allele (L) coding for a short coat and one allele (l) coding for a long coat. (ancestry.co.uk)
  • Using the purple-flowered pea plant example above, there is no way to know by looking at a single plant whether the genotype is made up of two dominant purple alleles or one dominant purple allele and one recessive white allele. (thoughtco.com)
  • To figure out the true genotype, the family history can be examined or it can be bred in a test cross with a white-flowered plant, and the offspring can show whether or not it had a hidden recessive allele. (thoughtco.com)
  • If the test cross produces any recessive offspring, the genotype of the parental flower would have to be heterozygous or have one dominant and one recessive allele. (thoughtco.com)
  • qPCRBIO Genotyping Mix has been optimised to give tight fluorescence clusters and more accurate allele calling compared to other mixes, even for challenging targets. (pcrbio.com)
  • The likelihood of offspring having a particular genotype is known as the genotype ratio. (ancestry.co.uk)
  • Genotype frequency is the proportion or frequency of any particular genotype among the individuals of a population. (dagris.info)
  • Plasticity in metabolic responses, such as changes in body fat or blood sugar in response to changes in dietary alterations, may also be affected by genotype," scientists writing in the journal Plos Genetics report. (preparedfoods.com)
  • However, this definition of 'genotype' varies a bit from the one intended when it first introduced over 100 years ago [ 10.1126/science.35.896.340 ], and even from the most common usage in genetics textbooks. (snpedia.com)
  • While the entire word "genotype" does not exactly mean "birth mark" as we think of the phrase, it does have to do with the genetics an individual is born with. (thoughtco.com)
  • So, if the only criterion you use in your choice is genetics, then yes, you should not marry somebody with AS genotype. (naija.ng)
  • qPCRBIO Genotyping Mix is designed for fast, accurate and reproducible allelic discrimination for use in TaqMan® and other dual-labelled probe-based genotyping assays. (pcrbio.com)
  • qPCRBIO Genotyping Mix is a kit designed for use in TaqMan® and other dual-labelled probe-based genotyping assays. (pcrbio.com)
  • Genotyping of hepatitis C virus-comparison of three assays. (qxmd.com)
  • Sequencing assays for failed genotyping with the versant hepatitis C virus genotype assay (LiPA), version 2.0. (qxmd.com)
  • Although genotype can refer to an individual's genetic constitution (as a whole), the most typical usage is to refer to the pair of alleles carried by an individual at a given locus (or gene). (snpedia.com)
  • At a given position in the DNA (or genetic locus), the pair of alleles from the two chromosomes makes up the genotype at that position. (ancestry.co.uk)
  • The combination of the two alleles is an organism's genotype. (thoughtco.com)
  • The sensitivity of genotype-based diagnostics that predict antimicrobial susceptibility is limited by the extent to which they detect genes and alleles that lead to resistance. (harvard.edu)
  • In polyploid organisms, the genotype of a particular trait is determined by a combination of alleles. (pediaa.com)
  • As most commonly used within SNPedia, genotype refers to the pair of SNPs inherited at a given chromosomal position, one inherited from Dad, one inherited from Mom. (snpedia.com)
  • The meaning of "genotype" is the internal genetic makeup of an organism or cell. (reference.com)
  • Essentially, genotype refers to all of the genes that an organism carries, regardless of whether those genes are expressed. (reference.com)
  • Genotype refers to the actual genes that an organism has in its DNA. (enotes.com)
  • Genotype refers to the genetic make-up of an organism or a virus. (dailystrength.org)
  • The genotype refers to the entire set of genes in a cell , an organism , or an individual. (biology-online.org)
  • A genotype is the actual genetic composition or makeup of an organism. (thoughtco.com)
  • Genotype is the complete gene set of an organism. (pediaa.com)
  • Genotype is the complete set of genes carried by a particular organism. (pediaa.com)
  • Genotype is one factor that determines the characteristics, appearance and behavior of a particular organism. (pediaa.com)
  • Determining of the genotype of an organism is referred to as genotyping. (pediaa.com)
  • Performance of TRUGENE hepatitis C virus 5' noncoding genotyping kit, a new CLIP sequencing-based assay for hepatitis C virus genotype determination. (qxmd.com)
  • Furthermore, when using combination therapy, the recommended duration of treatment depends on the genotype. (dailystrength.org)
  • The Transgenic Genotyping Service (TGS) provides genotyping for JAX Mice and assay development. (jax.org)
  • HIV Genotype Assay in Chakkarpur, Gurgaon. (practo.com)
  • The newly developed Versant HCV genotype assay (LiPA) 2.0 uses sequence information from both the 5' untranslated region and the core region, allowing distinction between HCV genotype 1 and subtypes c to l of genotype 6 and between subtypes a and b of genotype 1. (qxmd.com)
  • HCV-positive samples were genotyped manually using the Versant HCV genotype assay (LiPA) 2.0 system according to the manufacturer's instructions. (qxmd.com)
  • For the comparison study, Versant HCV genotype assay (LiPA) 1.0 was used. (qxmd.com)
  • In the comparison study, 13 samples that were uninterpretable or incorrectly genotyped with Versant HCV genotype assay (LiPA) 1.0 were correctly genotyped by Versant HCV genotype assay (LiPA) 2.0. (qxmd.com)
  • Versant HCV genotype assay (LiPA) 2.0 is a sensitive, accurate, and reliable assay for HCV genotyping. (qxmd.com)
  • The inclusion of the core region probes in Versant HCV genotype assay (LiPA) 2.0 results in a genotyping success rate higher than that of the current Versant HCV genotype assay (LiPA) 1.0. (qxmd.com)
  • Improvement of hepatitis C virus (HCV) genotype determination with the new version of the INNO-LiPA HCV assay. (qxmd.com)
  • Genotyping hepatitis C viruses from Southeast Asia by a novel line probe assay that simultaneously detects core and 5' untranslated regions. (qxmd.com)
  • Genotyping of hepatitis C virus isolates by a new line probe assay using sequence information from both the 5'untranslated and the core regions. (qxmd.com)
  • Evaluation of a new-generation line-probe assay that detects 5' untranslated and core regions to genotype and subtype hepatitis C virus. (qxmd.com)
  • genotypes do not change during the course of infection. (dailystrength.org)
  • Because of the ineffective immune response described above, prior infection does not protect against reinfection with the same or different genotypes of the virus. (dailystrength.org)
  • Genotype 1 is the most common genotype seen in the United States. (dailystrength.org)
  • Therefore, two individuals carrying similar genotypes can be different in observable characteristics. (pediaa.com)
  • Although phenotypical characteristics are based on underlying genotype, environmental factors can also play a role here. (enotes.com)
  • The genotype determines the hereditary characteristics of an individual. (patientsacademy.eu)
  • Yes, PCR products generated with qPCRBIO Genotyping Mixes have the same characteristics as PCR products generated with wild-type Taq polymerase. (pcrbio.com)
  • We know that certain sections of DNA have sequences that associate with characteristics - and genotyping "cherry picks" those sections. (familyfirsturgentcareconroe.com)
  • Yes, as there are 6 known genotypes and more than 50 subtypes of HCV, and genotype information is helpful in defining the epidemiology of hepatitis C. (dailystrength.org)
  • Patients with genotypes 2 and 3 are almost three times more likely than patients with genotype 1 to respond to therapy with alpha interferon or the combination of alpha interferon and ribavirin. (dailystrength.org)
  • For patients with genotypes 2 and 3, a 24-week course of combination treatment is adequate, whereas for patients with genotype 1, a 48-week course is recommended. (dailystrength.org)
  • For instance, a genotype of AA delineates homozygous dominance whereas a genotype of Aa is an example of heterozygous dominance. (biology-online.org)
  • Genotypes can be described as heterozygous or homozygous. (ancestry.co.uk)
  • A genotype can also refer to a gene or set of genes that leads to a single trait or disease. (ancestry.co.uk)
  • For example, if your MC1R gene leads to you having red hair, then you have the genotype for red hair. (ancestry.co.uk)
  • Genomic DNA was isolated from the peripheral blood lymphocytes and exon 4 of the ApoE gene with polymorphism sites was amplified by PCR and genotypes determined by restriction fragment length polymorphism (RFLP). (minervamedica.it)
  • Genotype frequencies are a function of gene frequencies. (dagris.info)
  • Genotype completely depends on the gene sequences. (pediaa.com)
  • The mix uses antibody-mediated hot start technology to give improved reaction sensitivity and specificity with the benefit of excellent room temperature stability, ideal for high-throughput genotyping studies. (pcrbio.com)
  • Although the study is limited by using self-reported BMIs at the age of 20 years and non-standarized methods of genotyping, the findings still have impact. (erasems.org)
  • Common PCR-based Genotyping Methods for SNP Analysis. (slideserve.com)
  • Genotype can be determined by observing DNA by genotyping methods. (pediaa.com)
  • Clinical evaluation of two methods for genotyping hepatitis C virus based on analysis of the 5' noncoding region. (qxmd.com)
  • RESULTS: We found that the most prevalent genotype was Apo Eε3/3, followed in order by Apo Eε3/4 and Apo Eε2/2. (minervamedica.it)
  • CONCLUSION: We concluded that in the elderly Han Chinese residents of Chongqing aged 60 years and over, Apo Eε3/3 and Apo Eε2/2 were the most and least prevalent genotypes, respectively. (minervamedica.it)
  • If a woman has a family history of breast cancer, genotyping can let us know whether she has the BRCA 1 or BRCA 2 mutations. (familyfirsturgentcareconroe.com)
  • Acute stress modulates genotype effects on amygdala processing in humans. (ox.ac.uk)
  • Here, we tested whether the current environmental context, which affects the acute brain state, modulates genotype effects on brain function in humans. (ox.ac.uk)
  • A genotype of aa is an instance of homozygous recessive. (biology-online.org)
  • There are two homozygous genotypes for cat coat length: LL (homozygous dominant) and ll (homozygous recessive). (ancestry.co.uk)
  • December 30/ Obesity, Fitness & Wellness Week -- "Nutrition is known to interact with genotype in human metabolic syndromes, obesity and diabetes, and also in Drosophila metabolism. (preparedfoods.com)
  • Evaluation of the TRUGENE HCV 5'NC genotyping kit with the new GeneLibrarian module 3.1.2 for genotyping of hepatitis C virus from clinical specimens. (qxmd.com)
  • Most genotypes follow Mendelian inheritance. (pediaa.com)
  • TGS's mission is to produce accurate genotyping results with the shortest turnaround time as inexpensively as possible for our clients within the Jackson Laboratory. (jax.org)
  • Hepatitis C virus (HCV) genotyping is a tool used to optimize antiviral treatment regimens. (qxmd.com)
  • AIM: The aim of the study was to determine the relationship between Apo Eε4 genotype and senile dementia (SD) by analyzing the Apo E allelic frequency distributions among the elderly Han Chinese population. (minervamedica.it)