Buchnera: A genus of gram-negative bacteria which are obligately intracellular endosymbionts of APHIDS. The bacteria are found within specialized cells in the aphid body cavity.Aphids: A family (Aphididae) of small insects, in the suborder Sternorrhyncha, that suck the juices of plants. Important genera include Schizaphis and Myzus. The latter is known to carry more than 100 virus diseases between plants.Symbiosis: The relationship between two different species of organisms that are interdependent; each gains benefits from the other or a relationship between different species where both of the organisms in question benefit from the presence of the other.Genome, Bacterial: The genetic complement of a BACTERIA as represented in its DNA.Genome: The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Gene Transfer Techniques: The introduction of functional (usually cloned) GENES into cells. A variety of techniques and naturally occurring processes are used for the gene transfer such as cell hybridization, LIPOSOMES or microcell-mediated gene transfer, ELECTROPORATION, chromosome-mediated gene transfer, TRANSFECTION, and GENETIC TRANSDUCTION. Gene transfer may result in genetically transformed cells and individual organisms.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Gene Transfer, Horizontal: The naturally occurring transmission of genetic information between organisms, related or unrelated, circumventing parent-to-offspring transmission. Horizontal gene transfer may occur via a variety of naturally occurring processes such as GENETIC CONJUGATION; GENETIC TRANSDUCTION; and TRANSFECTION. It may result in a change of the recipient organism's genetic composition (TRANSFORMATION, GENETIC).Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Selection, Genetic: Differential and non-random reproduction of different genotypes, operating to alter the gene frequencies within a population.Reproduction, Asexual: Reproduction without fusion of two types of cells, mostly found in ALGAE; FUNGI; and PLANTS. Asexual reproduction occurs in several ways, such as budding, fission, or splitting from "parent" cells. Only few groups of ANIMALS reproduce asexually or unisexually (PARTHENOGENESIS).DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Adaptation, Physiological: The non-genetic biological changes of an organism in response to challenges in its ENVIRONMENT.Genetic Fitness: The capability of an organism to survive and reproduce. The phenotypic expression of the genotype in a particular environment determines how genetically fit an organism will be.Riboswitch: Part of a MESSENGER RNA molecule that undergoes a conformation change upon binding a specific metabolite or other small molecule thereby regulating the messenger RNA's transcription, post-transcriptional processing, transport, translation, or stability in response to varying levels of the metabolite or other small molecule.Regulatory Sequences, Ribonucleic Acid: Sequences within RNA that regulate the processing, stability (RNA STABILITY) or translation (TRANSLATION, GENETIC) of RNA.GeorgiaAptamers, Nucleotide: Nucleotide sequences, generated by iterative rounds of SELEX APTAMER TECHNIQUE, that bind to a target molecule specifically and with high affinity.Theophylline: A methyl xanthine derivative from tea with diuretic, smooth muscle relaxant, bronchial dilation, cardiac and central nervous system stimulant activities. Theophylline inhibits the 3',5'-CYCLIC NUCLEOTIDE PHOSPHODIESTERASE that degrades CYCLIC AMP thus potentiates the actions of agents that act through ADENYLYL CYCLASES and cyclic AMP.RNA, Bacterial: Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.Laboratories: Facilities equipped to carry out investigative procedures.Nucleic Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.Genes, Bacterial: The functional hereditary units of BACTERIA.Trichomonas vaginalis: A species of TRICHOMONAS that produces a refractory vaginal discharge in females, as well as bladder and urethral infections in males.Trichomonas Vaginitis: Inflammation of the vagina, marked by a purulent discharge. This disease is caused by the protozoan TRICHOMONAS VAGINALIS.Trichomonas Infections: Infections in birds and mammals produced by various species of Trichomonas.Trichomonas: A genus of parasitic flagellate EUKARYOTES distinguished by the presence of four anterior flagella, an undulating membrane, and a trailing flagellum.Gardnerella vaginalis: A species in the genus GARDNERELLA previously classified as Haemophilus vaginalis. This bacterium, also isolated from the female genital tract of healthy women, is implicated in the cause of bacterial vaginosis (VAGINOSIS, BACTERIAL).Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Antitrichomonal Agents: Agents used to treat trichomonas infections.Fasciitis, Necrotizing: A fulminating bacterial infection of the deep layers of the skin and FASCIA. It can be caused by many different organisms, with STREPTOCOCCUS PYOGENES being the most common.Streptococcus: A genus of gram-positive, coccoid bacteria whose organisms occur in pairs or chains. No endospores are produced. Many species exist as commensals or parasites on man or animals with some being highly pathogenic. A few species are saprophytes and occur in the natural environment.Streptococcus pyogenes: A species of gram-positive, coccoid bacteria isolated from skin lesions, blood, inflammatory exudates, and the upper respiratory tract of humans. It is a group A hemolytic Streptococcus that can cause SCARLET FEVER and RHEUMATIC FEVER.Streptococcus mutans: A polysaccharide-producing species of STREPTOCOCCUS isolated from human dental plaque.Streptococcus pneumoniae: A gram-positive organism found in the upper respiratory tract, inflammatory exudates, and various body fluids of normal and/or diseased humans and, rarely, domestic animals.Streptococcus agalactiae: A bacterium which causes mastitis in cattle and occasionally in man.Streptococcal Infections: Infections with bacteria of the genus STREPTOCOCCUS.Bacterial Infections: Infections by bacteria, general or unspecified.Rupture, Spontaneous: Tear or break of an organ, vessel or other soft part of the body, occurring in the absence of external force.Streptococcus suis: A species of STREPTOCOCCUS isolated from pigs. It is a pathogen of swine but rarely occurs in humans.Pseudogenes: Genes bearing close resemblance to known genes at different loci, but rendered non-functional by additions or deletions in structure that prevent normal transcription or translation. When lacking introns and containing a poly-A segment near the downstream end (as a result of reverse copying from processed nuclear RNA into double-stranded DNA), they are called processed genes.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Peptidyl-Dipeptidase A: A peptidyl-dipeptidase that catalyzes the release of a C-terminal dipeptide, -Xaa-*-Xbb-Xcc, when neither Xaa nor Xbb is Pro. It is a Cl(-)-dependent, zinc glycoprotein that is generally membrane-bound and active at neutral pH. It may also have endopeptidase activity on some substrates. (From Enzyme Nomenclature, 1992) EC 3.4.15.1.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Polymorphism, Genetic: The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.Xanthomonas: A genus in the family XANTHOMONADACEAE whose cells produce a yellow pigment (Gr. xanthos - yellow). It is pathogenic to plants.Oryza sativa: Annual cereal grass of the family POACEAE and its edible starchy grain, rice, which is the staple food of roughly one-half of the world's population.Plant Diseases: Diseases of plants.Aspergillus oryzae: An imperfect fungus present on most agricultural seeds and often responsible for the spoilage of seeds in bulk storage. It is also used in the production of fermented food or drink, especially in Japan.Phytophthora infestans: A species of parasitic OOMYCETES in the family Peronosporaceae that is the causative agent of late blight of potato.Disease Resistance: The capacity of an organism to defend itself against pathological processes or the agents of those processes. This most often involves innate immunity whereby the organism responds to pathogens in a generic way. The term disease resistance is used most frequently when referring to plants.Solanum: A plant genus of the family SOLANACEAE. Members contain SOLANACEOUS ALKALOIDS. Some species in this genus are called deadly nightshade which is also a common name for ATROPA BELLADONNA.Xanthomonas campestris: A species of gram-negative, aerobic bacteria that is pathogenic for plants.Plant Leaves: Expanded structures, usually green, of vascular plants, characteristically consisting of a bladelike expansion attached to a stem, and functioning as the principal organ of photosynthesis and transpiration. (American Heritage Dictionary, 2d ed)Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.

Chemokine mRNA expression in gastric mucosa is associated with Helicobacter pylori cagA positivity and severity of gastritis. (1/25659)

AIM: To investigate the association between the quantity of gastric chemokine mRNA expression, severity of gastritis, and cagA positivity in Helicobacter pylori associated gastritis. METHODS: In 83 dyspeptic patients, antral and corpus biopsies were taken for semiquantitative reverse transcription polymerase chain reaction (RT-PCR) and histological grading of gastritis. Gastritis was evaluated by visual analogue scales. Quantities of chemokine (IL-8, GRO alpha, ENA-78, RANTES, MCP-1) RT-PCR products were compared with G3PDH products. Each sample was also evaluated for the presence of cagA and ureA mRNA by RT-PCR. RESULTS: mRNA expression of all five chemokines was significantly greater in H pylori positive than in H pylori negative mucosa. In H pylori positive patients, in the antrum C-X-C chemokine mRNA expression was significantly greater in cagA positive patients than in cagA negative patients, but there were no significant differences in C-C chemokine mRNA expression. In H pylori positive patients, chemokine mRNA expression in the corpus was less than in the antrum. In contrast to the antrum, only GRO alpha mRNA expression was significantly greater in cagA positive infection. Polymorphonuclear cell infiltration was correlated with C-X-C chemokine mRNA expression. Significant correlations were also found between bacterial density and C-X-C chemokine mRNA expression. CONCLUSIONS: In H pylori infection, C-X-C chemokines may play a primary role in active gastritis. Infection with cagA positive H pylori induces greater gastric chemokine mRNA expression in the antral mucosa, which may be relevant to the increased mucosal damage associated with cagA positive H pylori infection.  (+info)

Evolutionary relationships of pathogenic clones of Vibrio cholerae by sequence analysis of four housekeeping genes. (2/25659)

Studies of the Vibrio cholerae population, using molecular typing techniques, have shown the existence of several pathogenic clones, mainly sixth-pandemic, seventh-pandemic, and U.S. Gulf Coast clones. However, the relationship of the pathogenic clones to environmental V. cholerae isolates remains unclear. A previous study to determine the phylogeny of V. cholerae by sequencing the asd (aspartate semialdehyde dehydrogenase) gene of V. cholerae showed that the sixth-pandemic, seventh-pandemic, and U.S. Gulf Coast clones had very different asd sequences which fell into separate lineages in the V. cholerae population. As gene trees drawn from a single gene may not reflect the true topology of the population, we sequenced the mdh (malate dehydrogenase) and hlyA (hemolysin A) genes from representatives of environmental and clinical isolates of V. cholerae and found that the mdh and hlyA sequences from the three pathogenic clones were identical, except for the previously reported 11-bp deletion in hlyA in the sixth-pandemic clone. Identical sequences were obtained, despite average nucleotide differences in the mdh and hlyA genes of 1.52 and 3.25%, respectively, among all the isolates, suggesting that the three pathogenic clones are closely related. To extend these observations, segments of the recA and dnaE genes were sequenced from a selection of the pathogenic isolates, where the sequences were either identical or substantially different between the clones. The results show that the three pathogenic clones are very closely related and that there has been a high level of recombination in their evolution.  (+info)

A 55-kilodalton immunodominant antigen of Porphyromonas gingivalis W50 has arisen via horizontal gene transfer. (3/25659)

A 55-kDa outer membrane protein of Porphyromonas gingivalis W50 is a significant target of the serum immunoglobulin G antibody response of periodontal disease patients and hence may play an important role in host-bacterium interactions in periodontal disease. The gene encoding the 55-kDa antigen (ragB, for receptor antigen B) was isolated on a 9.5-kb partial Sau3AI fragment of P. gingivalis W50 chromosomal DNA in pUC18 by immunoscreening with a monoclonal antibody to this antigen. The 1.6-kb open reading frame (ORF) encoding RagB was located via subcloning and nested-deletion analysis. Sequence analysis demonstrated the presence of an upstream 3.1-kb ORF (ragA) which is cotranscribed with ragB. A number of genetic characteristics suggest that the ragAB locus was acquired by a horizontal gene transfer event. These include a significantly reduced G+C content relative to that of the P. gingivalis chromosome (42 versus 48%) and the presence of mobility elements flanking this locus in P. gingivalis W50. Furthermore, Southern blotting and PCR analyses showed a restricted distribution of this locus in laboratory and clinical isolates of this bacterium. The association of ragAB+ P. gingivalis with clinical status was examined by PCR analysis of subgingival samples. ragAB+ was not detected in P. gingivalis-positive shallow pockets from periodontal disease patients but was present in 36% of the P. gingivalis-positive samples from deep pockets. These data suggest that the ragAB locus was acquired by certain P. gingivalis strains via horizontal gene transfer and that the acquisition of this locus may facilitate the survival of these strains at sites of periodontal destruction.  (+info)

Cloning and expression of the dnaK gene of Campylobacter jejuni and antigenicity of heat shock protein 70. (4/25659)

Campylobacter jejuni is a leading cause of infectious diarrhea throughout the world. In addition, there is growing evidence that Guillain-Barre syndrome, an inflammatory demyelinating disease of the peripheral nervous system, is frequently preceded by C. jejuni infection. In the present study, the hrcA-grpE-dnaK gene cluster of C. jejuni was cloned and sequenced. The dnaK gene consists of an open reading frame of 1,869 bp and encodes a protein with a high degree of homology to other bacterial 70-kDa heat shock proteins (HSPs). The overall percentages of identity to the HSP70 proteins of Helicobacter pylori, Borrelia burgdorferi, Chlamydia trachomatis, and Bacillus subtilis were calculated to be 78.1, 60.5, 57.2, and 53. 8%, respectively. Regions similar to the Escherichia coli sigma70 promoter consensus sequence and to a cis-acting regulatory element (CIRCE) are located upstream of the hrcA gene. Following heat shock, a rapid increase of dnaK mRNA was detectable, which reached its maximum after 20 to 30 min. A 6-His-tagged recombinant DnaK protein (rCjDnaK-His) was generated in E. coli, after cloning of the dnaK coding region into pET-22b(+), and purified by affinity and gel filtration chromatography. Antibody responses to rCjDnaK-His were significantly elevated, compared to those of healthy individuals, in about one-third of the serum specimens obtained from C. jejuni enteritis patients.  (+info)

Yops of Yersinia enterocolitica inhibit receptor-dependent superoxide anion production by human granulocytes. (5/25659)

The virulence plasmid-borne genes encoding Yersinia adhesin A (YadA) and several Yersinia secreted proteins (Yops) are involved in the inhibition of phagocytosis and killing of Yersinia enterocolitica by human granulocytes. One of these Yops, YopH, dephosphorylates multiple tyrosine-phosphorylated proteins in eukaryotic cells and is involved in the inhibition of phagocytosis of Y. enterocolitica by human granulocytes. We investigated whether antibody- and complement-opsonized plasmid-bearing (pYV+) Y. enterocolitica inhibits O2- production by human granulocytes in response to various stimuli and whether YopH is involved. Granulocytes were preincubated with mutant strains unable to express YadA or to secrete Yops or YopH. O2- production by granulocytes during stimulation was assessed by measuring the reduction of ferricytochrome c. PYV+ Y. enterocolitica inhibited O2- production by granulocytes incubated with opsonized Y. enterocolitica or N-formyl-Met-Leu-Phe (f-MLP). This inhibitory effect mediated by pYV did not affect receptor-independent O2- production by granulocytes in response to phorbol myristate acetate, indicating that NADPH activity remained unaffected after activation of protein kinase C. The inhibition of f-MLP-induced O2- production by granulocytes depends on the secretion of Yops and not on the expression of YadA. Insertional inactivation of the yopH gene abrogated the inhibition of phagocytosis of antibody- and complement-opsonized Y. enterocolitica by human granulocytes but not of the f-MLP-induced O2- production by granulocytes or tyrosine phosphorylation of granulocyte proteins. These findings suggest that the specific targets for YopH are not present in f-MLP receptor-linked signal transduction and that other Yop-mediated mechanisms are involved.  (+info)

Complete nucleotide sequence of the 27-kilobase virulence related locus (vrl) of Dichelobacter nodosus: evidence for extrachromosomal origin. (6/25659)

The vrl locus is preferentially associated with virulent isolates of the ovine footrot pathogen, Dichelobacter nodosus. The complete nucleotide sequence of this 27.1-kb region has now been determined. The data reveal that the locus has a G+C content much higher than the rest of the D. nodosus chromosome and contains 22 open reading frames (ORFs) encoding products including a putative adenine-specific methylase, two potential DEAH ATP-dependent helicases, and two products with sequence similarity to a bacteriophage resistance system. These ORFs are all in the same orientation, and most are either overlapping or separated by only a few nucleotides, suggesting that they comprise an operon and are translationally coupled. Expression vector studies have led to the identification of proteins that correspond to many of these ORFs. These data, in combination with evidence of insertion of vrl into the 3' end of an ssrA gene, are consistent with the hypothesis that the vrl locus was derived from the insertion of a bacteriophage or plasmid into the D. nodosus genome.  (+info)

Genetic characterization of a new type IV-A pilus gene cluster found in both classical and El Tor biotypes of Vibrio cholerae. (7/25659)

The Vibrio cholerae genome contains a 5.4-kb pil gene cluster that resembles the Aeromonas hydrophila tap gene cluster and other type IV-A pilus assembly operons. The region consists of five complete open reading frames designated pilABCD and yacE, based on the nomenclature of related genes from Pseudomonas aeruginosa and Escherichia coli K-12. This cluster is present in both classical and El Tor biotypes, and the pilA and pilD genes are 100% conserved. The pilA gene encodes a putative type IV pilus subunit. However, deletion of pilA had no effect on either colonization of infant mice or adherence to HEp-2 cells, demonstrating that pilA does not encode the primary subunit of a pilus essential for these processes. The pilD gene product is similar to other type IV prepilin peptidases, proteins that process type IV signal sequences. Mutational analysis of the pilD gene showed that pilD is essential for secretion of cholera toxin and hemagglutinin-protease, mannose-sensitive hemagglutination (MSHA), production of toxin-coregulated pili, and colonization of infant mice. Defects in these functions are likely due to the lack of processing of N termini of four Eps secretion proteins, four proteins of the MSHA cluster, and TcpB, all of which contain type IV-A leader sequences. Some pilD mutants also showed reduced adherence to HEp-2 cells, but this defect could not be complemented in trans, indicating that the defect may not be directly due to a loss of pilD. Taken together, these data demonstrate the effectiveness of the V. cholerae genome project for rapid identification and characterization of potential virulence factors.  (+info)

Characterization of Moraxella (Branhamella) catarrhalis lbpB, lbpA, and lactoferrin receptor orf3 isogenic mutants. (8/25659)

Pathogenic members of the family Neisseriaceae produce specific receptors to acquire iron from their host's lactoferrin and transferrin. Recently, putative Moraxella catarrhalis lactoferrin receptor genes and a third open reading frame (lbpB, lbpA, and orf3) were cloned and sequenced. We describe the preliminary characterization of isogenic mutants deficient in LbpB, LbpA, or Orf3 protein.  (+info)

*Inferring horizontal gene transfer

Ochman, H; Lawrence, J. G.; Groisman, E. A. (2000). "Lateral gene transfer and the nature of bacterial innovation". Nature. 405 ... Daubin, V; Lerat, E; Perrière, G (2003). "The source of laterally transferred genes in bacterial genomes". Genome Biology. 4 (9 ... Hao, W; Golding, G. B. (2008). "Uncovering rate variation of lateral gene transfer during bacterial genome evolution". BMC ... Galtier, N (2007). "A model of horizontal gene transfer and the bacterial phylogeny problem". Systematic Biology. 56 (4): 633- ...

*TPP riboswitch

Winkler, W; Nahvi A; Breaker RR (2002). "Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene ... New genes and regulatory mechanisms". J Biol Chem. 277 (50): 48949-48959. doi:10.1074/jbc.M208965200. PMID 12376536. Miranda- ... It serves as a riboswitch that binds directly to thiamine pyrophosphate (TPP) to regulate gene expression through a variety of ... Bocobza, S; Adato A; Mandel T; Shapira M; Nudler E; Aharoni A (2007). "Riboswitch-dependent gene regulation and its evolution ...

*Reproduction

Thus, offspring have a combination of the parents' genes. It is believed that "the masking of deleterious alleles favors the ... The Craig Venter Institute maintains the term "synthetic bacterial cell" but they also clarify "...we do not consider this to ... Organisms that reproduce sexually yield a smaller number of offspring, but the large amount of variation in their genes makes ... Sexual reproduction ensures a mixing of the gene pool of the species. The variations found in offspring of sexual reproduction ...

*Ancestral reconstruction

... it has also been used to test evolutionary mechanisms at the level of bacterial genomes and primate gene sequences. RNA viruses ... Count reconstructs the evolution of the size of gene families. EREM analyses the gain and loss of genetic features encoded by ... Shapiro, B. (2006). "A Phylogenetic Method for Detecting Positive Epistasis in Gene Sequences and Its Application to RNA Virus ... This problem is often approached in a combinatorial framework, by modelling genomes as permutations of genes or homologous ...

*Acyrthosiphon pisum

... of the genome and gene duplication present in more than 2000 gene families. These orphan genes and gene duplications are likely ... A. pisum also hosts a range of facultative bacterial symbionts that can be transmitted maternally and horizontally, and which ... Transporter genes and regulatory genes are also missing from the genome. Such gene loss is typical of an obligate and ... Gene duplication and expansion of gene families - The pea aphid genome presents high levels of gene duplication compared to ...

*Pathogenicity island

Additionally, regulatory genes outside of the PAI may regulate virulence genes in the pathogenicity island. Regulation genes ... They may be located on a bacterial chromosome or may be transferred within a plasmid or can be found in bacteriophage genomes. ... The first combination is that the pathogenicity island contains the genes to regulate the virulence genes encoded on the PAI. ... The second combination is that the pathogenicity island contains the genes to regulate genes located outside of the ...

*Transfer-messenger RNA

In other bacterial species, a permuted ssrA gene produces a two-piece tmRNA in which two separate RNA chains are joined by base ... genes this island has inactivated the native target gene without restoration, yet compensates by carrying its own tmRNA gene. A ... The cyanobacteria provide the most plausible case for evolution of a permuted gene from a standard gene, due to remarkable ... except in Jakoba libera where the gene has reverted to encoding a one-piece tmRNA conformation. Mitochondrial tmRNA genes were ...

*PreQ1 riboswitch

Later on, preQ1 riboswitch was identified as a conserved sequence on the 5' UTR of genes in many gram-positive bacteria and was ... Ligand binding to the transcriptional riboswitch in bacterial causes modification in the structure of riboswitch unit, which ... Reader JS, Metzgar D, Schimmel P, de Crécy-Lagard V (2004). "Identification of four genes necessary for biosynthesis of the ... The PreQ1-I riboswitch is a cis-acting element identified in bacteria which regulates expression of genes involved in ...

*Symbiotic bacteria

In addition, cyanobacteria have been found to possess genes that enable them to undergo nitrogen fixation. This particular ... "Bacterial symbiosis and paratransgenic control of vector-borne Chagas disease". International Journal of Parasitology. 31 (5-6 ... located near hydrothermal vents have a gene that enables them to utilize hydrogen as a source of energy, in preference to ...

*Genome evolution

Gene duplication is the process by which a region of DNA coding for a gene is duplicated. This can occur as the result of an ... Another mechanism of genome evolution is provided by transduction whereby bacteriophages introduce new DNA into a bacterial ... Gene coding regions have been shown to have a higher GC-content and the longer the gene is, the greater the percentage of G and ... Duplicate genes are often immune to the selective pressure under which genes normally exist. As a result, a large number of ...

*History of genetic engineering

"Expression of bacterial genes in plant cells". Proceedings of the National Academy of Sciences of the United States of America ... By removing the genes in the plasmid that caused the tumor and adding in novel genes researchers were able to infect plants ... The ability to partially reduce gene function has allowed the study of genes that are lethal when completely knocked out. Other ... With the introduction of the gene gun in 1987 it became possible to integrate foreign genes into a chloroplast. Genetic ...

*Baum-Welch algorithm

Delcher, Arthur; Bratke, Kirsten A.; Powers, Edwin C.; Salzberg, Steven L. (2007). "Identifying bacterial genes and ... The GLIMMER (Gene Locator and Interpolated Markov ModelER) software was an early gene-finding program used for the ... or multiple genes (or even no gene at all) is present. GENSCAN was shown to exactly predict exon location with 90% accuracy ... locations compared to confirmed genes in prokaryotes. The GENSCAN webserver is a gene locator capable of analyzing eukaryotic ...

*Rhizobium rhizogenes

Bacterial genes may be retained within the plant. The hairy roots are grown in vitro in bioreactors to study their soil ... Under such conditions, certain bacterial genes are turned on leading to the transfer of its tDNA from its root-inducing plasmid ... Intrieri, M. C. & Buiatti, M. (July 2001). "The horizontal transfer of Agrobacterium rhizogenes genes and the evolution of the ... "Agrobacterium rhizogenes T-DNA genes capable of inducing hairy root phenotype". Molecular and General Genetics 209(3):475-480. ...

*MicrobesOnline

Delcher, A. L.; Bratke, K. A.; Powers, E. C.; Salzberg, S. L. (2007). "Identifying bacterial genes and endosymbiont DNA with ... Genes in the session gene cart can be saved to the permanent gene cart which is only available to registered users after ... The first one is the Tree Browser, which draws a species tree or a gene tree for the selected gene and its gene neighbourhood. ... The locus information can be viewed through the "view genes" option, and this gene can be added to the session gene cart, or ...

*Gene density

Bacterial DNA has a gene density on the order of 500-1000 genes/Mb. This is due several factors, including that the fact that ... There are also fewer codons in bacterial genes. C-value enigma "Science Reference: Gene". Science Daily. Retrieved 2013-10-15. ... In genetics, the gene density of an organism's genome is the ratio of the number of genes per number of base pairs, usually ... The human genome has a gene density of 12-15 genes/Mb, while the genome of the C. elegans roundworm is estimated to have 200. ...

*SAM-V riboswitch

Winkler WC, Breaker RR (2005). "Regulation of bacterial gene expression by riboswitches". Annu. Rev. Microbiol. 59: 487-517. ... October 2004). "A glycine-dependent riboswitch that uses cooperative binding to control gene expression". Science. 306 (5694): ...

*Genetically modified crops

It contained three bacterial genes, two CP4 EPSPS genes, and a gene encoding beta-glucuronidase (GUS) from Escherichia coli as ... Inserting a bacterial aryloxyalkanoate dioxygenase gene, aad1 makes the corn resistant to 2,4-D. The USDA had approved maize ... 1983). "Expression of bacterial genes in plant cells" (PDF). Proc. Natl. Acad. Sci. U.S.A. 80 (15): 4803-07. Bibcode:1983PNAS ... Introducing new genes into plants requires a promoter specific to the area where the gene is to be expressed. For instance, to ...

*Tobacco

1983). "Expression of bacterial genes in plant cells" (PDF). Proc. Natl. Acad. Sci. U.S.A. 80: 4803-4807. Bibcode:1983PNAS... ...

*Genetically modified organism

1983). "Expression of bacterial genes in plant cells" (PDF). Proc. Natl. Acad. Sci. USA. 80 (15): 4803-07. Bibcode:1983PNAS... ... Gene therapy, uses genetically modified viruses to deliver genes which can cure disease in humans. Although gene therapy is ... Inserted genes usually come from a different species in a form of horizontal gene-transfer. In nature this can occur when ... This included genes from the toad Xenopus laevis in 1974, creating the first GMO expressing a gene from an organism from ...

*HhMAN1

Because mannanase is not commonly found in similar beetles, and the characteristic of the gene is bacterial, the gene is ... Phillips, Melissa Lee (27 February 2012). "Bacterial gene helps coffee beetle get its fix". Nature. doi:10.1038/nature. ... "Adaptive horizontal transfer of a bacterial gene to an invasive insect pest of coffee". PNAS. 109 (11): 4197-4202. doi:10.1073/ ... HhMAN1 is a gene in the genome of Hypothenemus hampei, a.k.a. Coffee borer beetle, which codes for mannanase, an enzyme used to ...

*T-even bacteriophages

... bacterial genes can be transferred in generalized transduction. Whereas, in specialized transduction, only the genes that are ... Therefore, when these type of phages infect other bacterial cells, the bacterial DNA is inserted inside. Previously mentioned, ... Containing about 160 genes, these virulent viruses are among the largest, most complex viruses that are known and one of the ... Libraries of genes and monoclonal antibodies are maintained in phages. In addition to all this they are responsible for natural ...

*Haemolysin expression modulating protein family

These proteins act as modulators of bacterial gene expression. Members of this family act in conjunction with members of the H- ... identification and effect on conjugation of the rmoA gene of plasmid R100-1". FEMS Microbiol. Lett. 169 (1): 59-66. doi:10.1111 ...

*DNA

Finkel SE, Kolter R (November 2001). "DNA as a nutrient: novel role for bacterial competence gene homologs". Journal of ... A gene is a unit of heredity and is a region of DNA that influences a particular characteristic in an organism. Genes contain ... A gene is a sequence of DNA that contains genetic information and can influence the phenotype of an organism. Within a gene, ... Lorenz MG, Wackernagel W (September 1994). "Bacterial gene transfer by natural genetic transformation in the environment". ...

*Griffith's experiment

Lorenz, M. G.; Wackernagel, W. (1994-09-01). "Bacterial gene transfer by natural genetic transformation in the environment". ... The III-S strain DNA contains the genes that form the smooth protective polysaccharide capsule. Equipped with this gene, the ... Original article and 35th anniversary reprint available.) Daniel Hartl; Elizabeth Jones (2005). Genetics: Analysis of Genes and ...

*GLIMMER

"Exploration and Grading of Possible Genes from 183 Bacterial Strains by a Common Protocol to Identification of New Genes: Gene ... Delcher, A. L.; Bratke, K. A.; Powers, E. C.; Salzberg, S. L. (2007). "Identifying bacterial genes and endosymbiont DNA with ... Sugawara, H.; Abe, T.; Gojobori, T.; Tateno, Y. (2007). "DDBJ working on evaluation and classification of bacterial genes in ... The above example has been taken from the paper 'Identifying bacterial genes and endosymbiont DNA with Glimmer' Ribosome ...

*Phage display

In this technique, a gene encoding a protein of interest is inserted into a phage coat protein gene, causing the phage to " ... Phage eluted in the final step can be used to infect a suitable bacterial host, from which the phagemids can be collected and ... A versatile screening system for selective isolation of genes by specific gene-product/ligand interaction". Eur. J. Biochem. ... The phage gene and insert DNA hybrid is then inserted (a process known as "transduction") into Escherichia coli (E. coli) ...

*Riboswitch

Winkler W, Nahvi A, Breaker RR (2002). "Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression ... Riboswitch candidates are also consistently located in the 5' UTRs of protein-coding genes, and these genes are suggestive of ... The expression platform is what regulates gene expression. Expression platforms typically turn off gene expression in response ... "A conserved RNA structure element involved in the regulation of bacterial riboflavin synthesis genes". Trends Genet. 15 (11): ...
When bacteria acquire antibiotic-resistance genes they become better at surviving in the body, challenging the dogma that resistance comes with a cost
Plasmid pPSU1 from Dr. Song Tans lab contains the inserts 500 bp EcoRV fragment, 1000 bp EcoRV fragment, 1500 bp EcoRV fragment, 2000 bp EcoRV fragment, 500 bp PstI fragment, 700 bp PstI fragment, 800 bp PstI fragment, 900 bp PstI fragment, 1000 bp PstI fragment, and 2000 bp PstI fragment and is published in Sci Rep. 2017 May 26;7(1):2438. doi: 10.1038/s41598-017-02693-1. This plasmid is available through Addgene.
Answer to Antibiotic-resistance genes, as well as other virulence factor genes, are easily passed between bacterial cells through horizontal gene transfer. a. Conduct add
Earlier studies had shown that certain genes conferring resistance to antibiotics can be picked up by microbes in your gut when you are abroad. Stool sa...
Utilizing the bicistronic reporter transposon mini-Tn5 lacZ-tet/1, we have identified lacZ fusions to four Escherichia coli genes/operons that are strongly activated by the accumulation of self-produced extracellular signals. These fusions were designated cma9, cma48, cma113, and cma114 for conditioned medium activated. Each of the cma fusions was expressed in a growth phase-dependent manner, and the presence of conditioned medium from a stationary phase E. coli culture resulted in the premature activation of these fusions in cells at early to mid-logarithmic phase. The cma48 and cma114 fusions were dependent on RpoS for growth phase expression and response to extracellular factors. The extracellular factors that activated the cma9, cma48, and cma114 fusions were produced in both rich complex and defined minimal media. The cma fusions were shown to be within the cysK (cma9), astD (cma48), tnaB (cma113), and gabT (cma114) genes. These genes function in the uptake, synthesis, or degradation of ...
Integrative and conjugative elements (ICEs) are a diverse group of mobile genetic elements found in both Gram-positive and Gram-negative bacteria. ICEs are self-transmissible elements that encode a full complement of machinery for conjugation as well as intricate regulatory systems to control excision from the chromosome and onward conjugative transfer [Wozniak and Waldor, 2010; Burrus,2004]. These multi-talented entities can promote their own mobilization and potentially that of other hitch-hiking genetic elements and thus contribute to horizontal transfer of virulence determinants, antibiotic-resistance genes and other bacterial traits [Hastings. et al., 2004]. ICEs are being identified in increasing numbers as sequenced genome databases expand exponentially [Wozniak, et al., 2010; Ryan, et al., 2009; te Poele, et al., 2008; Burrus et al., 2002]. At present only a few have been classified into ICE families, amongst the best characterized of which is the SXT/R391 family of Vibrio cholerae, ...
A molecular model of carbapenem, an antibiotic often used as a last resort for bacterial infections such as Escherichia coli (E. coli) or Klebsiella pneumoniae. Carbapenems are effective against both Gram-positive and Gram-negative bacteria as well as anaerobes, and are resistant to bacterial enzymes which try to break down antibiotics. However recent strands of carbapenem-resistant bacteria are beginning to emerge, leading to concerns over the possible spread of a mutated antibiotic-resistance gene. Atoms are coloured dark gray (carbon), light gray (hydrogen), red (oxygen) and blue (nitrogen). - Stock Image C027/9314
Stokes, Richard W and Waddell, Simon J (2009) Adjusting to a new home: Mycobacterium tuberculosis gene expression in response to an intracellular lifestyle. Future Microbiology, 4 (10). pp. 1317-1335. ISSN 1746-0921 ...
Transposon insertion in ykyB increases the activation of an artificial ComK feedback loop.Strains PG401 (amyE::PcomG-lacZ-gfp, PcomG-comK, ΔmecA) and PG401-Tn4
Created after reading Costa et al. (2006) J. Bacteriol. 188:1022-1030; updated to include mycobacterial,enzymes after reading Empadinhas et al. (2008) FEMS Microbiol Lett 280:195�202; distantly related to family ...
Predelava avta na plin kvalitetno, hitro in ugodno. Car gas - kjer kakovost in kvaliteta ne trpita na račun ugodne cene same storitve.
e-Dentico - dwumiesięcznik stomatologa praktyka, polsko-angielski poradnik stomatologiczny. MNiSW: 5 pkt, IC: 5,5 pkt., punkty edukacyjne: 30 pkt.
Isopropyl-beta-D-thiogalactopyranoside, Isopropyl-beta-D-thiogalactopyranoside supplier, Isopropyl-beta-D-thiogalactopyranoside distributor, CAS 367-93-1, Isopropyl-beta-D-thiogalactopyranoside manufacturer, Isopropyl-beta-D-thiogalactopyranoside wholesale
To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximately 4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes were predicted to be essential. The vast majority of essential genes were categorized in relatively few domains of cell metabolism, with about half involved in information processing, one-fifth involved in the synthesis of cell envelope and the determination of cell shape and division, and one-tenth related to cell energetics. Only 4% of essential genes encode unknown functions. Most essential genes are present throughout a wide range of Bacteria, and almost 70% can also be found in Archaea and Eucarya. However, essential genes related to cell envelope, shape, division, and respiration tend to be lost from bacteria with small genomes. Unexpectedly, most genes involved in the Embden-Meyerhof-Parnas pathway are
Götting C, Thierbach G, Pühler A, Kalinowski J. Versatile low-copy-number plasmids for temperature-inducible overexpression of bacterial genes in Escherichia coli. BIOTECHNIQUES. 1998;24(3):362 ...
Escherichia Coli news, clinical research studies and treatment articles dealing with e. coli infections for medical professionals to stay updated. Get our FREE app now.
Experts predict that by 2050, antibiotic-resistant bacteria will cause as many deaths as cancer. Now, for the first time, Caltech scientists have created a 3-D image of a molecular structure that many different bacteria use to pump toxins into human cells and spread antibiotic-resistance genes to other bacteria. Understanding the architecture of this structure is a first step toward combating its effects.. The study was conducted in the laboratory of Grant Jensen, professor of biophysics and biology and Howard Hughes Medical Institute Investigator. A paper describing the work first appeared online in the March 23 issue of EMBO Reports.. The researchers looked specifically at Legionella, the bacteria that causes Legionnaires disease, a severe and often lethal form of pneumonia. When Legionella invades a human cell, it wraps itself in a protective vesicle and opens the molecular structure, known as a type IV secretion system. The molecular "machine" sits in the cell membrane of the bacterium and ...
MCR-1 es un mecanismo genético por el cual el gen mcr-1 confiere resistencia a colistina, siendo el primer mecanismo conocido de transmisión relacionada a plasmidio.[1]​[2]​ El mecanismo fue descubierto en una cepa de E.coli (SHP45) en un cerdo de China en noviembre del 2015, hallándose posteriormente en muestras humanas de Malasia, Inglaterra, China, Europa y Estados Unidos.[3]​ MCR-1 es el primer mecanismo de resistencia para colistina de transferencia horizontal mediada por plásmido. NDM-1 Liu, YY; Wang, Y; Walsh, TR; Yi, LX; Zhang, R; Spencer, J; Doi, Y; Tian, G; Dong, B; Huang, X; Yu, LF; Gu, D; Ren, H; Chen, X; Lv, L; He, D; Zhou, H; Liang, Z; Liu, JH; Shen, J (18 de noviembre de 2015). «Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study.». The Lancet. Infectious diseases. PMID 26603172. Reardon, Sara (21 de diciembre de 2015). «Spread of antibiotic-resistance gene does not ...
Birkenbihl, R.P.; Vielmetter, W., 1989: Cosmid derived map of escherichia coli strain bhb2600 in comparison to the map of strain w3110
Saccharopolyspora erythraea ATCC ® 11635™ Designation: M5-12259 TypeStrain=True Application: Produces erythromycin Glycosylation of avermectin Hydroxylation of ivermectin aglycone
ALN_YEAST (P32375 ), PYR1_CAEEL (Q18990 ), PYR1_DICDI (P20054 ), PYR1_DROME (P05990 ), PYR1_HUMAN (P27708 ), PYR1_MESAU (P08955 ), PYR1_MOUSE (B2RQC6 ), PYR1_SQUAC (Q91437 ), PYRC_ACAM1 (B0CF78 ), PYRC_ACIAD (Q6FD29 ), PYRC_ACIB3 (B7GX48 ), PYRC_ACIB5 (B7I9G6 ), PYRC_ACIBC (B2HWF6 ), PYRC_ACIBS (B0VKW9 ), PYRC_ACIBT (A3M3K3 ), PYRC_ACIBY (B0VAC1 ), PYRC_ACISJ (A1WC79 ), PYRC_AGRFC (Q8UI99 ), PYRC_AGRRK (B9J8H5 ), PYRC_AGRVS (B9JQV9 ), PYRC_ALCBS (Q0VNK6 ), PYRC_ALISL (B6ER91 ), PYRC_ALKEH (Q0AB36 ), PYRC_ANAD2 (B8JAE8 ), PYRC_ANADE (Q2IIB0 ), PYRC_ANAPZ (Q2GL89 ), PYRC_ANASK (B4UDQ2 ), PYRC_ANOFW (B7GFA5 ), PYRC_AQUAE (O66990 ), PYRC_ARATH (O04904 ), PYRC_ARCFU (O28034 ), PYRC_AROAE (Q5P6Y5 ), PYRC_AZOSB (A1K3T5 ), PYRC_AZOVD (C1DQV1 ), PYRC_BACAA (C3P658 ), PYRC_BACAC (C3L738 ), PYRC_BACAH (A0RHR0 ), PYRC_BACAN (Q81WF0 ), PYRC_BACC0 (B7JJX5 ), PYRC_BACC1 (Q732I1 ), PYRC_BACC2 (B7IUP8 ), PYRC_BACC3 (C1EPQ2 ), PYRC_BACC4 (B7H6M4 ), PYRC_BACC7 (B7HLM2 ), PYRC_BACCL (P46538 ), PYRC_BACCN (A7GRL3 ), ...
You might think bacteria that invade trees are there to cause certain destruction. But like the helpful bacteria that live within our guts, some microbes help plants thrive. To find out what makes these microbe-plant interactions ...
Gentaur molecular products has all kinds of products like :search , Nacala \ Agarose for ≧1kbp fragment \ 01145-45 for more molecular products just contact us
Mode of transfer of bacterial genes (genome) through a virus. There are two types, general and specialized by lytic and lysognic phages.
AlwaysLearning wrote: Question: An operon contains a repressor, a promoter sequence, an operator and a structural gene. The structural gene is responsible for t
Coloured scanning electron micrograph (SEM) of Streptomyces rimosus, Gram-positive, aerobic, filamentous, rod prokaryote (bacterium). Streptomyces sp. belongs to the Actinomycetes group and are bacteria that share many characteristics with fungi. They grow usually as filaments (chains of cells) and often branch to form a network of filaments (mycelium) in the soil. These soil bacteria are responsible for the musty odour of soil. Streptomyces rimosus is notably the most characterized industrial streptomycete producer of oxytetracycline and other tetracycline antibiotics. Although resistance to these antibiotics has reduced their clinical use in recent years, tetracyclines have an increasing role in the treatment of emerging infections and non-infective diseases. Magnification: x2,400 when shortest axis printed at 25 millimetres. - Stock Image C032/2096
Streptomyces rimosus otcD1 protein: bifunctional cyclase/aromatase from Streptomyces rimosus involved in ring closure of the polyketide backbone of oxytetracycline; amino acid sequence in first source
Although progress in Chlamydia genetics has been rapid, genomic modification has previously been limited to point mutations and group II intron insertions which truncate protein products. The bacterium has thus far been intractable to gene deletion or more-complex genomic integrations such as allelic exchange. Herein, we present a novel suicide vector dependent on inducible expression of a chlamydial gene that renders Chlamydia trachomatis fully genetically tractable and permits rapid reverse genetics by fluorescence-reported allelic exchange mutagenesis (FRAEM). We describe the first available system of targeting chlamydial genes for deletion or allelic exchange as well as curing plasmids from C. trachomatis serovar L2. Furthermore, this approach permits the monitoring of mutagenesis by fluorescence microscopy without disturbing bacterial growth, a significant asset when manipulating obligate intracellular organisms. As proof of principle, trpA was successfully deleted and replaced with a sequence
Sequencing of the complete Bacillus subtilis chromosome revealed the presence of approximately 4100 genes, 1000 of which were previously identified and mapped by classical genetic crosses. Comparison of these experimentally determined positions to th
This chapter provides a broad overview of many applications of plasmids for genetic analysis, primarily in bacteria. Ever since DNA sequencing became accessible to most research laboratories, reverse genetic analysis has become a standard experimental approach to study bacterial gene function. Similar suicide vectors have also been used for nontargeted insertional mutagenesis by cloning random chromosomal DNA fragments into the plasmid. The use of suicide vectors also allows for easy identification of the insertion mutations. Plasmids that utilize different combinations of double-counter selective markers have been used for diverse applications, including the search for extremely rare suppressor mutations of essential Escherichia coli genes, and to improve the efficiency of allelic exchange on bacterial artificial chromosomes (BACs). Although temperature-sensitive vectors represent the majority of conditionally replicating plasmids, other plasmids that exhibit conditional replication have been described
In vivo expression technology (IVET) is a promoter-trap strategy deigned to identify genes whose expression in induced in a specific environment, typically that encountered in a host. Signature-tagged mutagenesis (STM) uses comparative hybridisation to isolate mutants unable to survive specified environmental conditions and has been used to identify genes critical for survival in the host. Both methods have been used to identify virulence genes in S. aureus. The main aim of this project was to find any probable new genes of S. aureus that are essential for biofilm formation and infection mouse model by STM. A library of tagged insertion mutants of S. aureus and a series of selected tags in plasmids of S. aureus strain RN6390 were used. Most of the experiments with both the library and selected tags had problems with cross-hybridisation. All the selected tags were therefore sequenced and 33 tags with less than 50% identity were chosen for future experiments. A library of 825 mutants was made with ...
Gene target information for blaNDM-1 - New Delhi metallo-beta-lactamase-1 (Escherichia coli). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
Wardell, JN, Stocks, SM, Thomas, CR and Bushell, ME (2002) Decreasing the hyphal branching rate of Saccharopolyspora erythraea NRRL 2338 leads to increased resistance to breakage and increased antibiotic production ...
This unit provides a chronological in‐depth description of all protocols needed for quantitative reverse transcription-PCR (Q‐RT‐PCR) analysis of Borrelia burgdorferi gene expression within infected mouse tissues
Bacillus subtilis ATCC ® 82D-5™ Designation: Genomic DNA from Bacillus subtilis strain AMC TypeStrain=False Application:
The dam gene of E. coli can be inactivated by insertion of Tn9 or Mud phage. Strains bearing these mutations are viable indicating that the dam gene product is dispensable.
Cell Wall and CapsuleCapsular and extracellular polysacchridesSerotype determining Capsular polysaccharide biosynthesis in Staphylococcus Capsular polysaccharide synthesis enzyme Cap5K ...
Impact of mutations in individual protease genes/operons on biofilm formation in vitro. The relative capacity to form a biofilm was assessed using a microtiter
MORAN, JAMES PAUL, "POLAR EFFECTS ON THE RATES OF FORMATION AND DIMERIZATION OF FREE RADICALSFROM ETHYL ACETATE" (1963). Doctoral Dissertations. AAI6403549 ...
Gentaur molecular products has all kinds of products like :search , ListBio \ Ultra Pure LPS from Escherichia coli O111 B4 \ 105 for more molecular products just contact us
GeneArt Plasmid Services include flexible offerings covering construction of plasmid vectors customized for your needs, and subcloning of your sequence into any vector, including the Gateway vector system. Concentrate on your research goals and leave your plasmid construction and subcloning work to us.
Full text for this publication is not currently held within this repository. Alternative links are provided below where available. ...
LB broth is used for maintaining and cultivating recombinant strains of Escherichia coli. The ingredients of LB broth are tryptone, yeast extract and Sodium Chloride. We show you how to prepare the LB medium. - LB Medium Preparation - AbVideo™ - Support - Abnova
Description: Alkaline phosphatase isozyme conversion aminopeptidase; generates alkaline phosphatase isozyme 3 subunit lacking the N-terminal ...
tandem repeat of two SDR-like modules resembling a dimer commonly founf in the family; only the second module retains the coenzyme-binding site ...
Sergio wrote: , Have you checked whether the coli is actually harbouring the plasmid? We grow it with antibiotic selection. So it shouldnt grow unless it had the plasmid. , Try a colony miniprep to verify you have enough plasmid before performing the , miniprep, although this technique doesnt work very well with low copy plasmids. What is colony miniprep? Just a direct prep on the colony without inoculation first to liquid media? In that case I really doubt I would get any plasmid since my plasmids are very low-copy. Trond Erik ...
A recombinant plasmid is a special type of DNA that has had a section of foreign DNA added to it. These plasmids are often used to...
Tagging a chromosomal gene - posted in Molecular Cloning: Hi, I wish to tag a chromosomal gene in staphylococcus with GFP, but I dont know of a method that could do this. Any help would be greatly appreciated. Thanks
Bacillus subtilis is a gram positive, sporulating bacteria often utilized in industry as a producer of high quality enzymes and proteins [1].
Scientists have come closer to the understanding of how a E. coli clone described as the most important of its kind to cause human infections, has spread across the world in a very short time.
A newly discovered receptor in a strain of Escherichia coli can be blocked to avert infection, a finding that might aid in developing better therapies to treat bacterial infections resulting in food poisoning, diarrhoea or plague.
We use cookies to enhance your experience on our website. By continuing to use our website, you are agreeing to our use of cookies. You can change your cookie settings at any time.Find out more ...
putative ABC transporter ATP-binding/permease protein [PimA protein] GTGCTGCTATGTCTTCTGCGAATCCATCTGCGGCCGCACCGGCGCTCCGTCGCCCTGCTG GGGCTTTTGCAACTGGTGCAGATCCTGGCCACTTTGGCCCTGCCGACACTGGGCGCCGCG GTCATCGACAACGGCGTGGTCAGGGCCGACAGCGGCTACATCACCCGGACCGGCCTGGCC ATGCTGGCCGTGGCGCTCGTGCAGATCGCGGCGTCCGTGGCCGCGGTGGCGCTGGGCGCC CGTACGGCCATGGCGATGGGCCGCGACCTGCGCTCGGCCGTCTTCCGCCGGGTGCTGGAC TTCTCGGCCCGCGAGGTCGGGCGGTTCGGCACTCCGTCGCTGATGACGCGGACCGTCAAC GATGTGCAGCAGGTGCAGGTGCTGGCCCTGTCCGCGTTCGGCGTCGTCGTGTCGGCGCCC CTGATGTGTCTGGGCAGCATCGCGCTCGCACTCCAGCAGGACGTCCCGCTCTCCCTGCTC CTGGTGGCGCTGATGGTGGCCGTCGGAATGTCCTTCGGCCTCATTCTCGGCCGCACCGAT CCGTTCTACGCCCGTATGCAGAAACAGCTGGACCGCATCAACGGGCTGCTGCGCGAACGC ATTACCGGAGTCCGCGTCGTACGGGCTTTTGTGCGCGACGCCCACGAAGGCGCGAGATTC GGCCGCACCAATTCCGAATTGCGTGACATCTCGCTGCGCGTCGGCCGGCTGCTGGCCACG GTCATCCCCCTGGTGCTGCTGGTCCTCAACGCCTTCATGGCAGCCGTGGTGTGGTTCGGC GCCCACCGCATCGACGCCGGGGCGATGCGGTTCGGTGCGCTCAGCGCGTTTCTGAGCTAC CTGACGCTGATCACGATGTCGGTGGTGATGGTGACCTTCGTGTGCCTGCCGATGCCGCGG ...
Profacgen provides a novel NovEgg Expression technology, an efficient and convenient way to make high fidelity recombinant protein products rapidly and safely.
Important Information about Clavam 625 - an Antibiotic medicine. Why it is prescribed, dosage and possible side-effects of Clavam 625
Actually, only certain types of E. coli are dangerous. The types of E. coli that are harmful are particularly dangerous because...
The following pages link to Inducing Bacillus subtilis with Subtilin: View (previous 50 , next 50) (20 , 50 , 100 , 250 , 500) ...
Cosmid.net - Sonny Twister Time With Sonny (Jul 25, 2014) 106 images totaling 63M Download set with the VG-Ripper MultiHosters.com K2S | RG | TF | UL
Cosmid.net - Mechelle Someones Knocking (Jul 15, 2014) 103 images totaling 74M Download set with the VG-Ripper MultiHosters.com K2S | RG | TF | UL
The fimbrial subunit gene from the benign type BBacteroides nodosus isolate AC/6 was cloned into theSphI site of the multicopy vector plasmid pUC19. FiveEscherichia coli recombinants that were positive in a colony immunoassay were shown, by Western transfer analysis, to produce an immunologically cross-reacting protein of identical molecular size to fimbrial subunits prepared fromB. nodosus AC/6. Restriction endonuclease analysis showed that 4 of the recombinant plasmids carried a 6.7 kbSphI fragment. Recloning experiments showed that the fimbrial subunit gene was located within a 2.5 kbEcoRI-SphI fragment and that there was aPstI site located within the structural gene or its regulatory region. These recombinant clones will prove useful for the construction of a multivalent recombinant vaccine for the control of ovine footrot.. ...
The genomic organization of the chromosomal cps region that is responsible for capsular polysaccharide synthesis in Klebsiella pneumoniae Chedid (O1:K2) was investigated. Deletion analyses and Southern hybridization studies suggested that the central region of the cloned 29-kb BamHI fragment is indispensable for K2 capsular polysaccharide synthesis. The 24,329-bp nucleotide sequence of the Klebsiella cps region was determined and deposited in the EMBL and GenBank databases through DDBJ and assigned accession number D21242. Nineteen possible open reading frames (ORFs) were identified in the sequenced area. Among them, 13 ORFs are very close to each other. Six of the 19 ORFs show considerable nucleotide sequence similarities to Salmonella typhimurium cpsG, cpsB, rfbP, and orf2.8, Escherichia coli gnd, and Haemophilus influenzae bexD, respectively. Moreover, the deduced amino acid sequence of the ORF10 product demonstrated a highly hydrophobic profile and showed putative membrane topology ...
To analyze the overexpression of the Rhizobium meliloti fdxN gene in Escherichia coli, different translational and transcriptional fusions were constructed. The translational signals of R. meliloti fdxN were recognized in E. coli as demonstrated by the use of in-frame lac fusions. Translational fusions consisting of the lacZ or the lpp gene fused in frame to the 3 end of the entire fdxN gene were expressed at high levels in E. coli. In contrast, the wild-type R. meliloti FdxN protein without a C-terminal fusion could only be detected using the very sensitive T7 promoter-polymerase system and not in immunoblots with antibodies against an FdxN-LacZ hybrid protein. Evidently, translational fusions to the 3 end of fdxN had a stabilizing effect on the expression of the fdxN gene. A constitutively expressed transcriptional fdxN fusion, which did not mediate detectable amounts of FdxN protein either in E. coli or in free-living R. meliloti cells, complemented the Fix- phenotype of an R. meliloti ...
Junjua, M., Galia, W., Gaci, N., Uriot, O., Genay, M., Bachmann, H., Kleerebezem, M., Dary, A. and Roussel, Y. (2014), Development of the recombinase-based in vivo expression technology in Streptococcus thermophilus and validation using the lactose operon promoter. Journal of Applied Microbiology, 116: 620-631. doi: 10.1111/jam.12376 ...
Bacterial H antigens are specified by flagellin molecules, which constitute the flagellar filament. Escherichia coli 781-55 and E2987-73 are the type strains for H44 and H55 antigens, respectively. Unlike E. coli K-12, they possess two flagellin genes, fliC and fllA, on their chromosomes. However, they are monophasic, expressing exclusively the fllA genes, which specify the type antigens. In this study, the flagellin genes were cloned from these strains and their structure and expression were analyzed. It was found that the fliC genes encode apparently intact flagellin subunits but possess inefficient sigma28-dependent promoters, which may result in these genes being silent. The chromosomal locations of the fllA genes are approximately, but not exactly, identical with that of the phase-2 flagellin gene, fljB, of diphasic Salmonella strains. However, unlike the Salmonella fljB gene, the invertible H segment and the fljA gene responsible for the control of flagellar phase variation are both absent from
Urinary tract infection (UTI) is the most common form of extraintestinal Escherichia Coli infection (E.coli), and E. coli is the most common cause of UTI.The aim of this paper is to study the uropathogenicity factors for some strains of E.coli involved in the etiology of UTI and the affiliationof urinary E.coli strains to the serogroups involved in the UTI.We studied 208 strains of E. coli from urine samples sterilely collected from patients with clinical suspicion of urinary tract infection.The study was conducted in Emergency County Hospital Craiova between 2012-2014.Out of the 208 strains of E. coli submitted to the study, 60 strains (28.84%) - MRHA with human red cells, 28 strains (13.50%) - MRHA human red cells and blood red cells MSHA with guinea pigs, and 44 strains (21.12%) - MSHA with guinea pig red blood cells; 76 strains (36.54%) - no hemagglutination. Regarding our study, 42,34% of E.coli strains presented human MRHA putting forward their potential to cause pyelonephritits. The 68
Translational coupling in the threonine operon of Escherichia coli K-12.: In an attempt to express the two distal genes of the Escherichia coli threonine operon
Escherichia coli (or simply E. coli) is one of the many groups of bacteria that live in the intestines of healthy humans and most warm-blooded animals. E. coli bacteria help maintain the balance of normal intestinal flora (bacteria) against harmful bacteria and synthesize or produce some vitamins.. However, there are hundreds of types or strains of E. coli bacteria. Different strains of E. coli have different distinguishing characteristics.. A particular strain of E.coli known as E. coli O157:H7 causes a severe intestinal infection in humans. It is the most common strain to cause illness in people. It can be differentiated from other E. coli by the production of a potent toxin that damages the lining of the intestinal wall causing bloody diarrhea. It is also known as enterohemorrhagic E. coli infection.. The Centers for Disease Control and Prevention (CDC) reports about 70,000 cases of this type of E. coli infection occur in the United States each year.. ...
Escherichia coli (or simply E. coli) is one of the many groups of bacteria that live in the intestines of healthy humans and most warm-blooded animals. E. coli bacteria help maintain the balance of normal intestinal flora (bacteria) against harmful bacteria and synthesize or produce some vitamins.. However, there are hundreds of types or strains of E. coli bacteria. Different strains of E. coli have different distinguishing characteristics.. A particular strain of E.coli known as E. coli O157:H7 causes a severe intestinal infection in humans. It is the most common strain to cause illness in people. It can be differentiated from other E. coli by the production of a potent toxin that damages the lining of the intestinal wall causing bloody diarrhea. It is also known as enterohemorrhagic E. coli infection.. The Centers for Disease Control and Prevention (CDC) reports about 70,000 cases of this type of E. coli infection occur in the United States each year.. ...
A fungus living in the soils of Nova Scotia could offer new hope in the pressing battle against drug-resistant germs that kill tens of thousands of people every year, including one considered a serious global threat.. A team of researchers led by McMaster has discovered a fungus-derived molecule, known as AMA, which is able to disarm one of the most dangerous antibiotic-resistance genes: NDM-1 or New Delhi Metallo-beta-Lactamase-1, identified by the World Health Organization as a global public health threat.. "This is public enemy number one," explains Gerry Wright, director of the Michael G. DeGroote Institute for Infectious Disease Research at McMaster University.. "It came out of nowhere, it has spread everywhere and has basically killed our last resource of antibiotics, the last pill on the shelf, used to treat serious infections," he says.. Discovering the properties of the fungus-derived molecule is critical because it can provide a means to target and rapidly block the drug-resistant ...
This protein is a positive regulator for the phosphate regulon. Transcription of this operon is positively regulated by PhoB and PhoR when phosphate is limited.
Whitchurch C.B. and Mattick J.S. (1994) Characterization of a gene, pilU, required for twitching motility but not phage sensitivity in Pseudomonas aeruginosa. Molecular Microbiology, 13 6: 1079-1091. ...
A polymerase chain reaction (PCR) assay with two nested pairs of primers selected from conserved sequences within a 2.3 kb randomly cloned DNA fragment from the Salmonella typhimurium chromosome was developed. The nested PCR assay correctly identifie
To test whether ORF14 is cotranscribed with gumM, we employed a method consisting of the application of lacZtranscriptional fusions combined with plasmid integration (13). A promoterless lacZ-aacC1 interposon (4) was inserted into the unique BamHI site of the SmaI-ClaI fragment (nucleotides 14056 [GenBank accession no. U22511] and 2071 [GenBank accession no.U70053], respectively), which was previously subcloned into pK19mobGII. The hybrid plasmid was transferred from the broad-host-range mobilizing strain E. coli S17-1 (21) to wild-type X. campestris FC2 (14), as described previously (19). Exconjugants were selected in agar medium containing gentamicin, rifampin, and X-gluc. Yellow colonies appeared with a frequency of 10−4 and were sensitive to kanamycin. Correct gene replacement was verified by Southern hybridization. The strain mutated in ORF14 (XcORF14) produced normal amounts of xanthan, as judged by precipitation of the polymer from the broth as previously described (6) (not shown). ...
Rhizobium meliloti VisR protein: global regulator of chemotaxis, flagellar and motility genes; amino acid sequence in first source
BioAssay record AID 519390 submitted by ChEMBL: Antibacterial activity against Escherichia coli K-12 assessed as reduction in microbial viability incubated at 30 mM for 4 hrs under dark condition.
The procedure has been used successfully for isolation of high- and low-copy-number plasmids from various Bacillus subtilis strains. Yield of plasmid DNA was typically 10-20 µg plasmid DNA from 100 ml culture ...
Bekijk Stockfoto van Escherichia Coli Cell With Disrupted Cell Envelope Due To Phage Release After The Phage Replicate Within Host Cells They Must Be Released From The Host Cell This Often Occurs By Lysing The Cell Sem X3500. Ga voor hoogwaardige fotos met een hoge resolutie naar Getty Images.
Escherichia coli (E. coli) is a bacterium that lives in the digestive tracts of healthy people and animals. Most types of E. coli are pretty harmless, but this bacterium should not be taken lightly, as it can cause severe damage to your body
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
A new Michigan State University study has identified a family of genes in cyanobacteria that help control carbon dioxide fixation.
Wang, Hongxia et al "The Histone-Like Nucleoid Structuring Protein (H-NS) Is a Repressor of Vibrio cholerae Exopolysaccharide Biosynthesis (vps) Genes." Applied and Environmental Microbiology 78.7 (2012): 2482-2488. Web. 19 Jan. 2020. ...
UK standards for microbiology investigations ID 22: Identification of vero cytotoxin producing Escherichia coli (VTEC) including E. coli O157.
One hundred and seventy-seven Escherichia colistrains isolated from food, pigs and humans were tested for the production of heat-labile and heat-stable enterotoxin at 4, 22, and 37 °C. Heat-labile...
Rent textbook Escherichia Coli: Pathotypes and Principles of Pathogenesis by Donnenberg, Michael S. - 9780123970480. Price: $115.79
Escherichia coli jedna je od najčešće prisutnih bakterija u krvi bakteremične teladi. U radu su 22 izolata E. coli bila izdvojena iz krvi teško bolesne teladi. Izolati su pripadali serološkoj skupini O. Lančanom reakcijom...
This appears to be one of the earliest papers on transformation of Escherichia coli. If you find an earlier paper, please include it here ...
If you have used this database, please ensure that you acknowledge this most recent Pseudomonas Genome Database publication rather than just the website URL. Thank you!. Winsor GL, Griffiths EJ, Lo R, Dhillon BK, Shay JA, Brinkman FS (2016 ...
Optimisation of Bacillus subtilis for the secretion of heterologous proteins Therapeutic proteins (including those required for experimental purposes and clinical trials) are major products of biomanufacturing processes and considerable time and expense are expended to maximise the yield and quality of proteins produced in heterologous hosts. The production host of choice is the Gram-negative bacterium Escherichia coli for which many strains and expression systems have been developed. However ...
Optimisation of Bacillus subtilis for the secretion of heterologous proteins Therapeutic proteins (including those required for experimental purposes and clinical trials) are major products of biomanufacturing processes and considerable time and expense are expended to maximise the yield and quality of proteins produced in heterologous hosts. The production host of choice is the Gram-negative bacterium Escherichia coli for which many strains and expression systems have been developed. However ...
pgsA mutants are non-motile due to elevated RpoS levels that repress flhDC transcription; pgsA3 multicopy suppressers gadW, metE and nudL(yeaB) act by increasing RpoS levels (Uchiyama, 2010). RflP(YdiV) functions as an anti-FlhD4C2 factor in vitro, binding FlhD4C2 and blocking its activation of the flagellar regulon; RflP(YdiV) is poorly translated explaining why E. coli does not have reduced motility at low nutrient concentrations mediated by RflP(YdiV) and alleviated by fliZ mutation (Wada, 2012). ...
Two hundred fifty-five pigs, weaned at 4 wk of age, were used in an experiment to compare the efficacy of Bacillus subtilis and antibiotics as growth promoters for swine from nursery to finishing. Treatments were a ...
pBluescript II SK(+)???? ۸ 1000Ԫ pBluescript II SK(+)????????ͼ??(Vector map),????????(Sequence) ???? ???????? ??Ϊ ?? ???? ?С? 2961bp ???????ΪM13-F/R pBluescript II SK(+)??
Crystal structure of PBP3 in complex with BAL30072 ((2Z)-2-(2-amino-1,3-thiazol-4-yl)-2-{[(1,5-dihydroxy-4-oxo-1,4-dihydropyridin-2-yl)methoxy]imino}-N-{(2S)-1-hydroxy-3-methyl-3-[(sulfooxy)amino]butan-2-yl}ethanamide ...
View Notes - Molecular I pre-lab from BIOSC 0060 at Pittsburgh. Molecular I Pre-lab 1. What is a plasmid? How is it different from genomic or chromosomal DNA? a. A plasmid is an extra chromosomal DNA
We are always looking for a way to produce things in a less expensive and more environmentally safe way. But how do we approach that when we are producing something we need? Plant pholyphenols specifically pinoslyvin is effective in the treatment of cardiovascular disease, cancers, as well as arthritis. But currently it is really expensive to manufacture. That is where E. Coli comes in. The researchers in this project set out to turn a strain of ...
2000 10 02.344800 23 48 36.00 -01 09 14.3 22.0V 05TN74 645 C~2JxD 2000 10 02.345630 23 48 36.00 -01 09 14.3 21.9V 05TN74 645 C~2JxD 2000 10 02.348117 23 48 36.00 -01 09 14.3 05TN74 645 C~2JxD 2002 10 30.205211 00 01 30.63 +00 04 19.7 22.5V 05TN74 645 C~2JxD 2002 10 30.206040 00 01 30.63 +00 04 19.7 22.1V 05TN74 645 C~2JxD 2002 10 30.208528 00 01 30.64 +00 04 19.7 23.6V 05TN74 645 C~2JxD 2003 09 26.288359 00 11 56.54 +01 07 29.2 22.7V 05TN74 645 C~2JxD 2003 09 26.289188 00 11 56.53 +01 07 29.2 21.9V 05TN74 645 C~2JxD 2003 09 26.291676 00 11 56.54 +01 07 29.2 23.5V 05TN74 645 C~2JxD 2003 10 23.223727 00 09 38.56 +00 52 12.9 05TN74 645 C~1tfA 2003 10 23.224664 00 09 38.55 +00 52 12.9 05TN74 645 C~1tfA 2003 10 23.226690 00 09 38.53 +00 52 12.8 05TN74 645 C~1tfA 2003 11 19.139144 00 07 58.89 +00 41 09.7 22.6V 05TN74 645 C~1tfA 2003 11 19.139977 00 07 58.89 +00 41 09.7 05TN74 645 C~1tfA 2003 11 19.142465 00 07 58.88 +00 41 09.7 05TN74 645 C~1tfA 2005 10 08.04350 00 26 22.33 +02 30 28.3 22.1R 05TN74 ...
TY - JOUR. T1 - Use of transmissible plasmids as cloning vectors in Caulobacter crescentus. AU - Schoenlein, Patricia V. AU - Gallman, Lilly M.. AU - Ely, Bert. PY - 1988/10/30. Y1 - 1988/10/30. N2 - Cloning vectors for studies of Caulobacter crescentus genes should be transferable between Escherichia coli and C. crescentus since a transformation system has not been developed for C. crescentus. We have tested a large number of vectors containing IncP or IncQ replicons and found that many of the vectors containing IncQ replicons, and all but one of the vectors containing IncP replicons, are readily transferred by conjugation into C. crescentus. All of the plasmids tested were maintained in C. crescentus at 1 to 5 copies per cell, but plasmids containing IncP replicons were more stable than plasmids containing IncQ replicons. Further studies with a derivative of the IncQ plasmid R300B showed that when a promoterless kanamycin (Km)-resistance gene (npt2) was inserted into the intercistronic region ...
The activation of additional promoter sites by production of an alternative sigma subunit for RNA polymerase is a common strategy for the coordinate regulation of gene expression. Many alternative sigma factors control genes for specialized, and often narrowly distributed, functions. For example, most of the alternative sigma factors in Bacillus subtilis control genes necessary for endospore formation. In contrast, the B. subtilis sigma D protein controls the expression of genes important for flagellar-based motility and chemotaxis, a form of locomotion very broadly distributed in the eubacteria. A homologous sigma factor, sigma F, controls a similar group of motility genes in the enteric bacteria. The conservation of both promoter specificity and genetic function in these two regulons allowed us to test the ability of a B. subtilis sigma factor to function within an Escherichia coli host. We demonstrate that expression of the B. subtilis sigD gene restores motility to an E. coli strain mutant ...
TY - JOUR. T1 - Characterization of the Escherichia coli O59 and O155 O-antigen gene clusters. T2 - The atypical wzx genes are evolutionary related. AU - Guo, Hongjie. AU - Kong, Qingke. AU - Cheng, Jiansong. AU - Wang, Lei. AU - Feng, Lu. PY - 2005/7/15. Y1 - 2005/7/15. N2 - O-antigens are highly polymorphic. The genes specifically involved in O-antigen synthesis are generally grouped together on the chromosome as a gene cluster. In Escherichia coli, the O-antigen gene clusters are characteristically located between the housekeeping genes galF and gnd. In this study, the O-antigen gene clusters of E. coli O59 and E. coli O155 were sequenced. The former was found to contain genes for GDP-mannose synthesis, glycosyltransferase genes and the O-antigen polymerase gene (wzy), while the latter contained only glycosyltransferase genes and wzy. O unit flippase genes (wzx) were found immediately downstream of the gnd gene, in the region between the gnd and hisI genes in these two strains. This atypical ...
Porphyromonas gingivalis is a highly proteolytic organism which metabolizes small peptides and amino acids. Indirect evidence suggests that the proteases produced by this microorganism constitute an important virulence factor. In this study, a gene bank of P. gingivalis W83 DNA was constructed by cloning 0.5- to 20-kb HindIII-cut DNA fragments into Escherichia coli DH5 alpha by using the plasmid vector pUC19. A clone expressing a protease from P. gingivalis was isolated on LB agar containing 1% skim milk. The clone contained a 3.0-kb insert that coded for a protease with an apparent molecular mass of 64 kDa. Sequencing part of the 3.0-kb DNA fragment revealed an open reading frame encoding a protein of 482 amino acids with a molecular mass of 62.5 kDa. Putative promoter and termination elements flanking the open reading frame were identified. The activity expressed in E. coli was extensively characterized by using various substrates and protease inhibitors, and the results suggest that it is ...

A recently transferred cluster of bacterial genes in Trichomonas vaginalis - lateral gene transfer and the fate of acquired...A recently transferred cluster of bacterial genes in Trichomonas vaginalis - lateral gene transfer and the fate of acquired...

A recently transferred cluster of bacterial genes in Trichomonas vaginalis - lateral gene transfer and the fate of acquired ... surrounded by vertically inherited genes on the chromosome, and phylogenetics shows that a broad collection of bacterial ... they may be acquired in clusters of several genes that are subsequently cleansed of evolutionarily less advantageous genes. ... Some genes have undergone pseudogenization and degradation, indicating that they may not be retained in the future. Functional ...
more infohttp://uu.diva-portal.org/smash/record.jsf?pid=diva2:736621

Dynamics of Xanthomonas oryzae pv. oryzae Populations in Korea and Their Relationship to Known Bacterial Blight Resistance GenesDynamics of Xanthomonas oryzae pv. oryzae Populations in Korea and Their Relationship to Known Bacterial Blight Resistance Genes

oryzae Populations in Korea and Their Relationship to Known Bacterial Blight Resistance Genes ... genes and R-gene combinations against 16 X. oryzae pv. oryzae isolates representing Korean BB pathotypes. The estimated main ... Bacterial leaf blight (BB), caused by the vascular pathogen Xanthomonas oryzae pv. oryzae, has become one of the most ... We conclude that the pyramid line containing genes Xa4, xa5, and Xa21 would be the most promising and valuable genotype for ...
more infohttp://www.apsnet.org/publications/phytopathology/2006/August/Pages/96_8_867.aspx

Visualization of bacterial genes in action.  - PubMed - NCBIVisualization of bacterial genes in action. - PubMed - NCBI

Visualization of bacterial genes in action.. Miller OL Jr, Hamkalo BA, Thomas CA Jr. ... The morphology of active structural and putative ribosomal RNA genes was observed by electron microscopy after lysis of fragile ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/4915822

Regulation of Bacterial Gene Expression | SpringerLinkRegulation of Bacterial Gene Expression | SpringerLink

The bacterium Escherichia colicarries approximately 3000 genes, but this total repertoire... ... Reznikoff W.S. (1989) Regulation of Bacterial Gene Expression. In: Poindexter J.S., Leadbetter E.R. (eds) Bacteria in Nature. ... Belfort, M., 1980, The cll-independent expression of the phage λ intgene in RNase III-defective E. coli, Gene 11: 149 - 155. ... It presents the cell with the signals that ultimately lead to gene regulation-the turning on or off of gene expression. ...
more infohttps://link.springer.com/chapter/10.1007/978-1-4613-0803-4_6

Bacterial genes boost current in human cellsBacterial genes boost current in human cells

... 19.10.2016. Borrowing and tweaking bacterial genes to Enhance electrical activity ... Further reports about: , bacterial genes , cardiac , electrical signals , gene therapy , human cells , sodium , sodium channels ... bacterial genes »cardiac »electrical signals »gene therapy »human cells »sodium »sodium channels ... The researchers then delivered three genes to the electrically inactive cells: one bacterial gene for a sodium ion channel and ...
more infohttp://www.innovations-report.com/html/reports/life-sciences/bacterial-genes-boost-current-in-human-cells.html

Patterns of bacterial gene movement.  - PubMed - NCBIPatterns of bacterial gene movement. - PubMed - NCBI

Lateral gene transfer has emerged as an important force in bacterial evolution. A substantial number of genes can be inserted ... Patterns of bacterial gene movement.. Hao W1, Golding GB.. Author information. 1. Department of Biology, McMaster University, ... In this study, we looked for atypical occurrence of genes among related organisms to detect laterally transferred genes. We ... For each group we use a 16s rRNA phylogeny and a comparison of protein similarity to map gene insertions/deletions onto their ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/15115802?dopt=Abstract

Bacterial genes boost current in human cells | EurekAlert! Science NewsBacterial genes boost current in human cells | EurekAlert! Science News

Researchers have harvested genes from bacteria that, with a few tweaks, can create and enhance electrical signaling in cultured ... Bacterial genes boost current in human cells Borrowing and tweaking bacterial genes to Enhance electrical activity might treat ... The researchers then delivered three genes to the electrically inactive cells: one bacterial gene for a sodium ion channel and ... Bacterial genes boost current in human cells. Duke University. Journal. Nature Communications. Funder. American Heart ...
more infohttps://www.eurekalert.org/pub_releases/2016-10/du-bgb101816.php

Phys.org - bacterial genePhys.org - bacterial gene

Analysis reveals key gene for bacterial infection. To successfully infect their hosts, bacteria need to evade the host immune ... Analyses of two bacterial strains in the Red Sea show they are enriched with gene clusters with potential to activate the ... Key gene find could enable development of disease-resistant crops. Discovery of a gene that helps plants control their response ... Research identifies mechanism that helps plants fight bacterial infection. A team led by a plant pathologist at the University ...
more infohttps://phys.org/tags/bacterial+gene/

Bacterial genes tell the tale of an outbreaks evolutionBacterial genes tell the tale of an outbreak's evolution

Bacterial genes tell the tale of an outbreaks evolution. 14.11.2011. Researchers at Harvard Medical School and Childrens ... "Parallel bacterial evolution within multiple patients identifies candidate pathogenicity genes," by Lieberman et al Harvard ... bacterial pathogens »genetic changes »health services »human body »immune system »specific gene »test tube ... bacterial pathogens , genetic changes , health services , human body , immune system , specific gene , test tube ...
more infohttps://www.innovations-report.com/html/reports/life-sciences/bacterial-genes-tale-outbreak-039-s-evolution-185696.html

Replacement and amplification of bacterial genes with sequences altered in vitro | PNASReplacement and amplification of bacterial genes with sequences altered in vitro | PNAS

Replacement and amplification of bacterial genes with sequences altered in vitro. N I Gutterson and D E Koshland Jr ... Replacement and amplification of bacterial genes with sequences altered in vitro Message Subject (Your Name) has sent you a ... Using the method, we have constructed two chromosomal deletions in the chemotaxis gene region of S. typhimurium. In addition, ... the two most widely studied bacterial species. ... Replacement and amplification of bacterial genes with sequences ...
more infohttps://www.pnas.org/content/80/16/4894?ijkey=a967d175961a510fd856bcdfb9c118779ac545af&keytype2=tf_ipsecsha

A selective force favoring increased G+C content in bacterial genes | PNASA selective force favoring increased G+C content in bacterial genes | PNAS

Because bacterial genomes have high gene content, forces that operate on the base composition of individual genes could help ... because bacterial genomes are composed primarily of protein-coding genes (14), a selective force that acts on each gene to ... C composition of the expressed GFP gene and bacterial generation time, with strains expressing genes of higher G+C contents ... A selective force favoring increased G+C content in bacterial genes Message Subject (Your Name) has sent you a message from ...
more infohttps://www.pnas.org/content/109/36/14504?ijkey=1526aeb7ccbe77e86b62ef3db9fa7a046cf844b9&keytype2=tf_ipsecsha

Tracking bacterial gene expression with firefly luciferase | Mar 2008 | BioPhotonicsTracking bacterial gene expression with firefly luciferase | Mar 2008 | BioPhotonics

Because gene expression within a cell population fluctuates randomly, investigators must monitor individual cells if they want ... Tracking bacterial gene expression with firefly luciferase. BioPhotonics. Mar 2008 Hank Hogan ... Yeung used the chemiluminescence technique to perform quantitative studies of gene expression in two bacterial lines. They ... The pores in bacterial cell walls are too small for the charged luciferin molecules to fit through. The pores can be enlarged ...
more infohttps://www.photonics.com/Articles/Tracking_bacterial_gene_expression_with_firefly/a32728

Tracking bacterial gene expression with firefly luciferase | Mar 2008 | BioPhotonicsTracking bacterial gene expression with firefly luciferase | Mar 2008 | BioPhotonics

Because gene expression within a cell population fluctuates randomly, investigators must monitor individual cells if they want ... Tracking bacterial gene expression with firefly luciferase. BioPhotonics. Mar 2008 Hank Hogan ... Yeung used the chemiluminescence technique to perform quantitative studies of gene expression in two bacterial lines. They ... The pores in bacterial cell walls are too small for the charged luciferin molecules to fit through. The pores can be enlarged ...
more infohttps://www.photonics.com/Article.aspx?AID=32728

Evolutionary Optimization of Sequence Kernels for Detection of Bacterial Gene Starts | SpringerLinkEvolutionary Optimization of Sequence Kernels for Detection of Bacterial Gene Starts | SpringerLink

Evolutionary Optimization of Sequence Kernels for Detection of Bacterial Gene Starts. In: Kollias S., Stafylopatis A., Duch W ... local models: SVM, TSVM, and SVMT for gene expression classification problems. In: International Joint Conference on Neural ...
more infohttps://link.springer.com/chapter/10.1007%2F11840930_86

ASMscience | Phage and Bacterial GeneASMscience | Phage and Bacterial Gene

Over time many of the concepts and techniques from the Phage course were integrated into the Bacterial Genetics course until ... Since its inception, the Phage course and subsequently the Advanced Bacterial Genetics course have trained many of the leaders ... In 1950 Milislav Demerec began an offshoot of the Phage course that emphasized bacterial genetics. When both were consecutively ... and many students took the two courses sequentially to obtain training in both phage and bacterial genetics. ...
more infohttp://www.asmscience.org/content/book/10.1128/9781555816810.ch03

UT scientists identify bacterial genes that could lessen severity of malariaUT scientists identify bacterial genes that could lessen severity of malaria

... have identified a set of bacterial genes that may help them find ways to lessen the severity of the disease malaria. ... Stough analyzed hundreds of genes and eventually found that 32 bacterial genes and 38 mice genes have the characteristics--or ... UT scientists identify bacterial genes that could lessen severity of malaria. October 26, 2016. KNOXVILLE--Researchers at the ... have identified a set of bacterial genes that may help them find ways to lessen the severity of the disease malaria.. Their ...
more infohttps://www.brightsurf.com/news/article/102616412890/ut-scientists-identify-bacterial-genes-that-could-lessen-severity-of-malaria.html

Noise in bacterial gene expression | Biochemical Society TransactionsNoise in bacterial gene expression | Biochemical Society Transactions

Noise in bacterial gene expression. Christoph Engl. Biochemical Society Transactions Dec 21, 2018, 47 (1) 209-217; DOI: 10.1042 ... Noise in bacterial gene expression Message Subject (Your Name) has forwarded a page to you from Biochemical Society ... Single-cell and single-molecule studies demonstrated that noise within gene expression is influenced by a combination of both ... The expression level of a gene can fluctuate significantly between individuals within a population of genetically identical ...
more infohttp://www.biochemsoctrans.org/content/47/1/209

Need Help: Bacterial gene deletion- sacB sucrose resistance - Molecular Biology - BioForumNeed Help: Bacterial gene deletion- sacB sucrose resistance - Molecular Biology - BioForum

Bacterial gene deletion- sacB sucrose resistance - posted in Molecular Biology: Hi All, I have a problem regarding selecting ... a counterselectable gene promotes the death of the microorganisms harboring it. Hence, transformants which have integrated a ... The gene youre working with is a gene required for the bacterium to live under any condition, not simply a virulence gene ... has no sacB gene in it). I check for the gene knockout in centrimide+kan+amp plate with PAO1 using the gene inserted suicide ...
more infohttp://www.protocol-online.org/forums/topic/9924-need-help-bacterial-gene-deletion-sacb-sucrose-resistance/

UT Scientists Identify Bacterial Genes That Could Reduce Severity of Malaria | Infection Control TodayUT Scientists Identify Bacterial Genes That Could Reduce Severity of Malaria | Infection Control Today

... researchers have identified a set of bacterial genes that may help them find ways to lessen the severity of the disease malaria ... Stough analyzed hundreds of genes and eventually found that 32 bacterial genes and 38 mice genes have the characteristics-or ... University of Tennessee (UT) researchers have identified a set of bacterial genes that may help them find ways to lessen the ... "Were pretty excited because it means there is a limited number of genes to work with," Wilhelm said. That discovery will make ...
more infohttps://www.infectioncontroltoday.com/infectious-diseases-conditions/ut-scientists-identify-bacterial-genes-could-reduce-severity-malaria

Genetically engineered light sensors for control of bacterial gene expressionGenetically engineered light sensors for control of bacterial gene expression

... Camsund, Daniel Uppsala University, Disciplinary ... Parts for controlling gene expression are of special importance in living systems, and specifically promoters are needed for ... Implementation of advanced gene regulatory circuits will require orthogonal transcriptional systems that can be simultaneously ... Herein, we review engineered light-sensor systems with potential for in vivo regulation of gene expression in bacteria, and ...
more infohttp://uu.diva-portal.org/smash/record.jsf?pid=diva2:433907

RNAlater Preserves Bacterial Gene Expression Profiles for Array Analysis | Thermo Fisher Scientific - SARNAlater Preserves Bacterial Gene Expression Profiles for Array Analysis | Thermo Fisher Scientific - SA

RNAlater Preserves Bacterial Gene Expression Profiles for Array Analysis › * RNAlater® Solution Around the World , FACS Into ... RNAlater™ is Effective at Preserving Bacterial RNA for Gene Expression Profiling With Arrays ... Optimized Biopsy Preservation for Clinical Gene Expression and Profiling › * Optimized Gene Expression Analysis from FFPE ... Figure 1. Bacterial RNA Stability. (A) Total RNA isolated from B. subtilis and processed immediately. The ratio of 23S:16S rRNA ...
more infohttps://www.thermofisher.com/sa/en/home/references/ambion-tech-support/rna-isolation/tech-notes/rnalater-preserves-bacterial-gene-expression-profiles-for-array-.html

Regulation of Bacterial Gene Expression by Transcription Attenuation | Microbiology and Molecular Biology ReviewsRegulation of Bacterial Gene Expression by Transcription Attenuation | Microbiology and Molecular Biology Reviews

Regulation of Bacterial Gene Expression by Transcription Attenuation Message Subject (Your Name) has forwarded a page to you ... Regulation of Bacterial Gene Expression by Transcription Attenuation. Charles L. Turnbough, Jr. ... Generally, in these mechanisms, a transcription terminator is located between a promoter and a downstream gene(s), and the ... A wide variety of mechanisms that control gene expression in bacteria are based on conditional transcription termination. ...
more infohttps://mmbr.asm.org/content/83/3/e00019-19

Reservoir of Bacterial Exotoxin Genes in the EnvironmentReservoir of Bacterial Exotoxin Genes in the Environment

This is the first report of an environmental reservoir of a bacterial exotoxin gene in an atypical host. Screening bacterial ... such as exotoxin genes, the phage could facilitate the transfer of these genes to nontoxigenic bacterial hosts, thereby ... the phage can integrate into the bacterial genome and the bacterial host can utilize certain genes the phage carries in its ... Reservoir of Bacterial Exotoxin Genes in the Environment. Veronica Casas, Joseph Magbanua, Gerico Sobrepeña, Scott T. Kelley, ...
more infohttps://www.hindawi.com/journals/ijmicro/2010/754368/

Bacterial Polysaccharide Gene DatabaseBacterial Polysaccharide Gene Database

Accessing the Bacterial Polysaccharide Gene Database (BPGD). From here you can specify a search of the Bacterial Polysaccharide ... Gene Database. The results of the search will be returned as a "hit list". From the hit list you follow links to look at ...
more infohttp://sydney.edu.au/science/molecular_bioscience/BPGD/

Bacterial Polysaccharide Gene DatabaseBacterial Polysaccharide Gene Database

Accessing the Bacterial Polysaccharide Gene Database (BPGD). From here you can specify a search of the Bacterial Polysaccharide ... Gene Database. The results of the search will be returned as a "hit list". From the hit list you follow links to look at ...
more infohttp://sydney.edu.au/science/molecular_bioscience/BPGD/default.htm
  • It presents the cell with the signals that ultimately lead to gene regulation-the turning on or off of gene expression. (springer.com)
  • Further investigation is necessary that takes into account the detailed knowledge of gene regulation gained from biochemical studies. (biochemsoctrans.org)
  • Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. (embopress.org)
  • We thereby uncover two principles of joint regulation: (i) specific regulation by repression dominates the transcriptional response during metabolic steady states, largely repressing the biosynthesis genes even when biosynthesis is required and (ii) global regulation sets the maximum promoter activity that is exploited during the transition between steady states. (embopress.org)
  • An experimental‐computational approach is applied to dissect the contribution of specific transcription factor‐mediated versus global growth‐dependent regulation to bacterial gene expression, and obtain a quantitative understanding of dynamic adaptations in arginine biosynthesis of E. coli . (embopress.org)
  • We show that growth rate can be used to predict the unregulated expression baseline of a gene, since growth rate dependence of global regulation occurs both in steady state and during transient changes in growth rate. (embopress.org)
  • We obtain a quantitative understanding of both specific and global regulation in arginine biosynthesis, as demonstrated by accurate model‐based predictions of complex transient geneexpression responses to simultaneous perturbation in growth rate and arginine availability. (embopress.org)
  • A new study reveals that the multipotent stromal cells (MSCs) of persons with diabetes have diminished capacity to fight off bacterial infection, providing new understanding into the basis of diabetes-associated immune dysfunction. (phys.org)
  • A team led by a plant pathologist at the University of California, Riverside, has identified a regulatory, genetic mechanism in plants that could help fight bacterial infection. (phys.org)
  • Discovery of a gene that helps plants control their response to disease could aid efforts to develop crops that are resistant to infection, research suggests. (phys.org)
  • Researchers at Harvard Medical School and Children's Hospital Boston have retraced the evolution of an unusual bacterial infection as it spread among cystic fibrosis patients by sequencing scores of samples collected during the outbreak, since contained. (innovations-report.com)
  • Cystic fibrosis (CF) is a hereditary disease that renders the lungs susceptible to bacterial infection. (innovations-report.com)
  • The group where the gene for Toll2 was switched off, survived the bacterial infection," says Wiersinga. (infectioncontroltoday.com)
  • Because a microbe's ability to survive killing by phagocytes correlates with its ability to cause disease ( 2 , 3 ), the identification of genes that are preferentially transcribed in the intracellular environment of the host is central to our understanding of how pathogenic organisms mount a successful infection. (sciencemag.org)
  • A ) A library of S. typhimurium-bearing plasmids with random DNA fragments inserted upstream of a promoterless gfp gene ( 39 ) was used to infect a monolayer of RAW 264.7 macrophage-like cells at a multiplicity of infection (MOI) of 5:1. (sciencemag.org)
  • A substantial number of genes can be inserted into or deleted from genomes through the process of lateral transfer. (nih.gov)
  • We have analyzed 50 bacterial complete genomes from nine groups. (nih.gov)
  • Because bacterial genomes have high gene content, forces that operate on the base composition of individual genes could help shape the overall genomic base composition. (pnas.org)
  • Bacterial genomes are highly variable in their overall base compositions, with sequenced genomes ranging from 13% to 75% G+C ( 1 , 2 ). (pnas.org)
  • These studies revealed that mutation is universally biased toward A+T, suggesting selection as an agent that maintains the contemporary base compositions in bacterial genomes ( 11 ⇓ - 13 ). (pnas.org)
  • However, because bacterial genomes are composed primarily of protein-coding genes ( 14 ), a selective force that acts on each gene to increase its G+C content can cumulatively influence the overall genomic base composition. (pnas.org)
  • Similar results were obtained when arrays were probed with RNA prepared from B. subtilis cells that were stored in RNA later for one week at 4°C. RNA later is thus an ideal solution for maintaining the expression profile of bacterial mRNA when immediate RNA isolation is not possible or practical. (thermofisher.com)
  • I know that counterselectable markers are often instrumental for the construction of mutants when under appropriate growth conditions, a counterselectable gene promotes the death of the microorganisms harboring it. (protocol-online.org)
  • The developed technology should enable monitoring of genes of many microorganisms of environmental significance and will form the foundation of a novel environmental sensing technology for accurate measurements of classes of contaminants and environmental conditions. (stanford.edu)
  • Recently, however, studies based on the comparative analyses of gene sequences have challenged the notion that base composition is driven solely by mutational biases. (pnas.org)
  • 1984. Experiments with Gene Fusions. (asmscience.org)
  • Cells infected with a fluorescent bacterium were readily distinguished from uninfected cells or cells infected with S. typhimurium -bearing unproductive gfp gene fusions. (sciencemag.org)
  • The researchers then delivered three genes to the electrically inactive cells: one bacterial gene for a sodium ion channel and two supporting genes encoding a potassium channel and connexin-43, a protein that helps shuttle electrical signals between cells. (innovations-report.com)
  • KNOXVILLE--Researchers at the University of Tennessee, Knoxville, have identified a set of bacterial genes that may help them find ways to lessen the severity of the disease malaria. (brightsurf.com)
  • The researchers are seeking to develop a system for monitoring bacterial gene expression in response to signals from the natural environment using a blend of membrane diffusion cell, genomics and optical detection technologies. (stanford.edu)
  • About 50% of these clones will have replaced the original wild type gene with a mutated one and at the same time got rid of the suicide plasmid backbone from the chromosme. (protocol-online.org)
  • Parts for controlling gene expression are of special importance in living systems, and specifically promoters are needed for enabling and simplifying rational design. (diva-portal.org)
  • The pores in bacterial cell walls are too small for the charged luciferin molecules to fit through. (photonics.com)
  • Using the method, we have constructed two chromosomal deletions in the chemotaxis gene region of S. typhimurium. (pnas.org)
  • Along with graduate student Yun Zhang and professor of veterinary medicine Gregory J. Phillips, Yeung used the chemiluminescence technique to perform quantitative studies of gene expression in two bacterial lines. (photonics.com)
  • Light of different wavelengths can serve as a transient, noninvasive means of regulating gene expression for biotechnological purposes. (diva-portal.org)
  • Approximately a third to a half of all S. typhimurium that were recovered after one enrichment cycle contained a gfp gene fusion with host cell-dependent activity. (sciencemag.org)
  • The problem is i am using a suicide vector pFS100 a derivative of pGP704 carrying a 'pir' dependent origin of replication from plasmid R6K and gene encoding resistance to ampicillin and kanamycin but no sacB gene marker in it. (protocol-online.org)
  • We present a model‐based approach to quantitatively dissect simultaneous contributions from specific transcription factors and the global growth status to bacterial gene expression, based on parameter inference from GFP‐based promoter activity measurements. (embopress.org)
  • I check for the gene knockout in 'centrimide+kan+amp' plate with PAO1 using the gene inserted suicide vector pFS100 and get no growth (showing the gene is essential) whereas the control plate without antibiotic markers show growth. (protocol-online.org)
  • Firefly luciferase is much brighter than the bacterial luciferase sometimes used for chemiluminescence studies. (photonics.com)
  • Single-cell and single-molecule studies demonstrated that noise within gene expression is influenced by a combination of both intrinsic and extrinsic factors. (biochemsoctrans.org)
  • The results reveal that there is poor correlation of genes inserted, deleted, and duplicated with evolutionary branch length. (nih.gov)
  • In a gene pool, purifying selection weeds out those harmful changes even as positive selection spreads helpful ones. (innovations-report.com)