A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.
A publication issued at stated, more or less regular, intervals.
"The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.
The premier bibliographic database of the NATIONAL LIBRARY OF MEDICINE. MEDLINE® (MEDLARS Online) is the primary subset of PUBMED and can be searched on NLM's Web site in PubMed or the NLM Gateway. MEDLINE references are indexed with MEDICAL SUBJECT HEADINGS (MeSH).
Publications in any medium issued in successive parts bearing numerical or chronological designations and intended to be continued indefinitely. (ALA Glossary of Library and Information Science, 1983, p203)
All of the divisions of the natural sciences dealing with the various aspects of the phenomena of life and vital processes. The concept includes anatomy and physiology, biochemistry and biophysics, and the biology of animals, plants, and microorganisms. It should be differentiated from BIOLOGY, one of its subdivisions, concerned specifically with the origin and life processes of living organisms.
Genes bearing close resemblance to known genes at different loci, but rendered non-functional by additions or deletions in structure that prevent normal transcription or translation. When lacking introns and containing a poly-A segment near the downstream end (as a result of reverse copying from processed nuclear RNA into double-stranded DNA), they are called processed genes.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The genetic complement of a BACTERIA as represented in its DNA.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
A peptidyl-dipeptidase that catalyzes the release of a C-terminal dipeptide, -Xaa-*-Xbb-Xcc, when neither Xaa nor Xbb is Pro. It is a Cl(-)-dependent, zinc glycoprotein that is generally membrane-bound and active at neutral pH. It may also have endopeptidase activity on some substrates. (From Enzyme Nomenclature, 1992) EC 3.4.15.1.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
A gram-positive organism found in the upper respiratory tract, inflammatory exudates, and various body fluids of normal and/or diseased humans and, rarely, domestic animals.
Infections by bacteria, general or unspecified.
Substances that reduce the growth or reproduction of BACTERIA.
A genus of gram-positive, coccoid bacteria whose organisms occur in pairs or chains. No endospores are produced. Many species exist as commensals or parasites on man or animals with some being highly pathogenic. A few species are saprophytes and occur in the natural environment.
The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.
One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.
Infections with bacteria of the species STREPTOCOCCUS PNEUMONIAE.
Polysaccharides found in bacteria and in capsules thereof.
A dysgammaglobulinemia characterized by a deficiency of IMMUNOGLOBULIN G.
An envelope of loose gel surrounding a bacterial cell which is associated with the virulence of pathogenic bacteria. Some capsules have a well-defined border, whereas others form a slime layer that trails off into the medium. Most capsules consist of relatively simple polysaccharides but there are some bacteria whose capsules are made of polypeptides.
Databases devoted to knowledge about specific genes and gene products.
A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.
Immunoglobulins produced in a response to BACTERIAL ANTIGENS.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
Elements of limited time intervals, contributing to particular results or situations.
The relationships of groups of organisms as reflected by their genetic makeup.
The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.

Chemokine mRNA expression in gastric mucosa is associated with Helicobacter pylori cagA positivity and severity of gastritis. (1/25659)

AIM: To investigate the association between the quantity of gastric chemokine mRNA expression, severity of gastritis, and cagA positivity in Helicobacter pylori associated gastritis. METHODS: In 83 dyspeptic patients, antral and corpus biopsies were taken for semiquantitative reverse transcription polymerase chain reaction (RT-PCR) and histological grading of gastritis. Gastritis was evaluated by visual analogue scales. Quantities of chemokine (IL-8, GRO alpha, ENA-78, RANTES, MCP-1) RT-PCR products were compared with G3PDH products. Each sample was also evaluated for the presence of cagA and ureA mRNA by RT-PCR. RESULTS: mRNA expression of all five chemokines was significantly greater in H pylori positive than in H pylori negative mucosa. In H pylori positive patients, in the antrum C-X-C chemokine mRNA expression was significantly greater in cagA positive patients than in cagA negative patients, but there were no significant differences in C-C chemokine mRNA expression. In H pylori positive patients, chemokine mRNA expression in the corpus was less than in the antrum. In contrast to the antrum, only GRO alpha mRNA expression was significantly greater in cagA positive infection. Polymorphonuclear cell infiltration was correlated with C-X-C chemokine mRNA expression. Significant correlations were also found between bacterial density and C-X-C chemokine mRNA expression. CONCLUSIONS: In H pylori infection, C-X-C chemokines may play a primary role in active gastritis. Infection with cagA positive H pylori induces greater gastric chemokine mRNA expression in the antral mucosa, which may be relevant to the increased mucosal damage associated with cagA positive H pylori infection.  (+info)

Evolutionary relationships of pathogenic clones of Vibrio cholerae by sequence analysis of four housekeeping genes. (2/25659)

Studies of the Vibrio cholerae population, using molecular typing techniques, have shown the existence of several pathogenic clones, mainly sixth-pandemic, seventh-pandemic, and U.S. Gulf Coast clones. However, the relationship of the pathogenic clones to environmental V. cholerae isolates remains unclear. A previous study to determine the phylogeny of V. cholerae by sequencing the asd (aspartate semialdehyde dehydrogenase) gene of V. cholerae showed that the sixth-pandemic, seventh-pandemic, and U.S. Gulf Coast clones had very different asd sequences which fell into separate lineages in the V. cholerae population. As gene trees drawn from a single gene may not reflect the true topology of the population, we sequenced the mdh (malate dehydrogenase) and hlyA (hemolysin A) genes from representatives of environmental and clinical isolates of V. cholerae and found that the mdh and hlyA sequences from the three pathogenic clones were identical, except for the previously reported 11-bp deletion in hlyA in the sixth-pandemic clone. Identical sequences were obtained, despite average nucleotide differences in the mdh and hlyA genes of 1.52 and 3.25%, respectively, among all the isolates, suggesting that the three pathogenic clones are closely related. To extend these observations, segments of the recA and dnaE genes were sequenced from a selection of the pathogenic isolates, where the sequences were either identical or substantially different between the clones. The results show that the three pathogenic clones are very closely related and that there has been a high level of recombination in their evolution.  (+info)

A 55-kilodalton immunodominant antigen of Porphyromonas gingivalis W50 has arisen via horizontal gene transfer. (3/25659)

A 55-kDa outer membrane protein of Porphyromonas gingivalis W50 is a significant target of the serum immunoglobulin G antibody response of periodontal disease patients and hence may play an important role in host-bacterium interactions in periodontal disease. The gene encoding the 55-kDa antigen (ragB, for receptor antigen B) was isolated on a 9.5-kb partial Sau3AI fragment of P. gingivalis W50 chromosomal DNA in pUC18 by immunoscreening with a monoclonal antibody to this antigen. The 1.6-kb open reading frame (ORF) encoding RagB was located via subcloning and nested-deletion analysis. Sequence analysis demonstrated the presence of an upstream 3.1-kb ORF (ragA) which is cotranscribed with ragB. A number of genetic characteristics suggest that the ragAB locus was acquired by a horizontal gene transfer event. These include a significantly reduced G+C content relative to that of the P. gingivalis chromosome (42 versus 48%) and the presence of mobility elements flanking this locus in P. gingivalis W50. Furthermore, Southern blotting and PCR analyses showed a restricted distribution of this locus in laboratory and clinical isolates of this bacterium. The association of ragAB+ P. gingivalis with clinical status was examined by PCR analysis of subgingival samples. ragAB+ was not detected in P. gingivalis-positive shallow pockets from periodontal disease patients but was present in 36% of the P. gingivalis-positive samples from deep pockets. These data suggest that the ragAB locus was acquired by certain P. gingivalis strains via horizontal gene transfer and that the acquisition of this locus may facilitate the survival of these strains at sites of periodontal destruction.  (+info)

Cloning and expression of the dnaK gene of Campylobacter jejuni and antigenicity of heat shock protein 70. (4/25659)

Campylobacter jejuni is a leading cause of infectious diarrhea throughout the world. In addition, there is growing evidence that Guillain-Barre syndrome, an inflammatory demyelinating disease of the peripheral nervous system, is frequently preceded by C. jejuni infection. In the present study, the hrcA-grpE-dnaK gene cluster of C. jejuni was cloned and sequenced. The dnaK gene consists of an open reading frame of 1,869 bp and encodes a protein with a high degree of homology to other bacterial 70-kDa heat shock proteins (HSPs). The overall percentages of identity to the HSP70 proteins of Helicobacter pylori, Borrelia burgdorferi, Chlamydia trachomatis, and Bacillus subtilis were calculated to be 78.1, 60.5, 57.2, and 53. 8%, respectively. Regions similar to the Escherichia coli sigma70 promoter consensus sequence and to a cis-acting regulatory element (CIRCE) are located upstream of the hrcA gene. Following heat shock, a rapid increase of dnaK mRNA was detectable, which reached its maximum after 20 to 30 min. A 6-His-tagged recombinant DnaK protein (rCjDnaK-His) was generated in E. coli, after cloning of the dnaK coding region into pET-22b(+), and purified by affinity and gel filtration chromatography. Antibody responses to rCjDnaK-His were significantly elevated, compared to those of healthy individuals, in about one-third of the serum specimens obtained from C. jejuni enteritis patients.  (+info)

Yops of Yersinia enterocolitica inhibit receptor-dependent superoxide anion production by human granulocytes. (5/25659)

The virulence plasmid-borne genes encoding Yersinia adhesin A (YadA) and several Yersinia secreted proteins (Yops) are involved in the inhibition of phagocytosis and killing of Yersinia enterocolitica by human granulocytes. One of these Yops, YopH, dephosphorylates multiple tyrosine-phosphorylated proteins in eukaryotic cells and is involved in the inhibition of phagocytosis of Y. enterocolitica by human granulocytes. We investigated whether antibody- and complement-opsonized plasmid-bearing (pYV+) Y. enterocolitica inhibits O2- production by human granulocytes in response to various stimuli and whether YopH is involved. Granulocytes were preincubated with mutant strains unable to express YadA or to secrete Yops or YopH. O2- production by granulocytes during stimulation was assessed by measuring the reduction of ferricytochrome c. PYV+ Y. enterocolitica inhibited O2- production by granulocytes incubated with opsonized Y. enterocolitica or N-formyl-Met-Leu-Phe (f-MLP). This inhibitory effect mediated by pYV did not affect receptor-independent O2- production by granulocytes in response to phorbol myristate acetate, indicating that NADPH activity remained unaffected after activation of protein kinase C. The inhibition of f-MLP-induced O2- production by granulocytes depends on the secretion of Yops and not on the expression of YadA. Insertional inactivation of the yopH gene abrogated the inhibition of phagocytosis of antibody- and complement-opsonized Y. enterocolitica by human granulocytes but not of the f-MLP-induced O2- production by granulocytes or tyrosine phosphorylation of granulocyte proteins. These findings suggest that the specific targets for YopH are not present in f-MLP receptor-linked signal transduction and that other Yop-mediated mechanisms are involved.  (+info)

Complete nucleotide sequence of the 27-kilobase virulence related locus (vrl) of Dichelobacter nodosus: evidence for extrachromosomal origin. (6/25659)

The vrl locus is preferentially associated with virulent isolates of the ovine footrot pathogen, Dichelobacter nodosus. The complete nucleotide sequence of this 27.1-kb region has now been determined. The data reveal that the locus has a G+C content much higher than the rest of the D. nodosus chromosome and contains 22 open reading frames (ORFs) encoding products including a putative adenine-specific methylase, two potential DEAH ATP-dependent helicases, and two products with sequence similarity to a bacteriophage resistance system. These ORFs are all in the same orientation, and most are either overlapping or separated by only a few nucleotides, suggesting that they comprise an operon and are translationally coupled. Expression vector studies have led to the identification of proteins that correspond to many of these ORFs. These data, in combination with evidence of insertion of vrl into the 3' end of an ssrA gene, are consistent with the hypothesis that the vrl locus was derived from the insertion of a bacteriophage or plasmid into the D. nodosus genome.  (+info)

Genetic characterization of a new type IV-A pilus gene cluster found in both classical and El Tor biotypes of Vibrio cholerae. (7/25659)

The Vibrio cholerae genome contains a 5.4-kb pil gene cluster that resembles the Aeromonas hydrophila tap gene cluster and other type IV-A pilus assembly operons. The region consists of five complete open reading frames designated pilABCD and yacE, based on the nomenclature of related genes from Pseudomonas aeruginosa and Escherichia coli K-12. This cluster is present in both classical and El Tor biotypes, and the pilA and pilD genes are 100% conserved. The pilA gene encodes a putative type IV pilus subunit. However, deletion of pilA had no effect on either colonization of infant mice or adherence to HEp-2 cells, demonstrating that pilA does not encode the primary subunit of a pilus essential for these processes. The pilD gene product is similar to other type IV prepilin peptidases, proteins that process type IV signal sequences. Mutational analysis of the pilD gene showed that pilD is essential for secretion of cholera toxin and hemagglutinin-protease, mannose-sensitive hemagglutination (MSHA), production of toxin-coregulated pili, and colonization of infant mice. Defects in these functions are likely due to the lack of processing of N termini of four Eps secretion proteins, four proteins of the MSHA cluster, and TcpB, all of which contain type IV-A leader sequences. Some pilD mutants also showed reduced adherence to HEp-2 cells, but this defect could not be complemented in trans, indicating that the defect may not be directly due to a loss of pilD. Taken together, these data demonstrate the effectiveness of the V. cholerae genome project for rapid identification and characterization of potential virulence factors.  (+info)

Characterization of Moraxella (Branhamella) catarrhalis lbpB, lbpA, and lactoferrin receptor orf3 isogenic mutants. (8/25659)

Pathogenic members of the family Neisseriaceae produce specific receptors to acquire iron from their host's lactoferrin and transferrin. Recently, putative Moraxella catarrhalis lactoferrin receptor genes and a third open reading frame (lbpB, lbpA, and orf3) were cloned and sequenced. We describe the preliminary characterization of isogenic mutants deficient in LbpB, LbpA, or Orf3 protein.  (+info)

When bacteria acquire antibiotic-resistance genes they become better at surviving in the body, challenging the dogma that resistance comes with a cost
Plasmid pPSU1 from Dr. Song Tans lab contains the inserts 500 bp EcoRV fragment, 1000 bp EcoRV fragment, 1500 bp EcoRV fragment, 2000 bp EcoRV fragment, 500 bp PstI fragment, 700 bp PstI fragment, 800 bp PstI fragment, 900 bp PstI fragment, 1000 bp PstI fragment, and 2000 bp PstI fragment and is published in Sci Rep. 2017 May 26;7(1):2438. doi: 10.1038/s41598-017-02693-1. This plasmid is available through Addgene.
Megger PVK330 Photovoltaic Kit includes PVM210 Irradiance Meter & DCM340 600 A AC / DC Clamp Multimeter which speeds the measurement of array stings without the need for disconnection. It can also measure DC voltages to 600 V.
It would be best to cast a wide net including all plant, animal and bacterial genes. The hits of a rat protein against a bacterial protein are probably a cause of this, it isnt impossible for a rat to have a sequence similar to a bacterial one. The reason youre getting hits against bacteria is because youve only included bacteria (and a very small number at that) in your database. BLAST is finding the best possible hit for your sequence, which happens to place a rat gene against a bacterial gene.. This is going to very strongly bias your results, just because youre interested in a specific set of species, doesnt mean that you can ignore everything else. A good scientist finds the best possible explanation given all possible explanations, not the best one given what he or she is interested in. This approach is massively inappropriate, as you can see, limiting your species is drastically biasing your results. Contigs from massively distant species could be seen as hits because BLAST is only ...
Fingerprint Dive into the research topics of Identification of a Mycobacterium tuberculosis gene that enhances mycobacterial survival in macrophages. Together they form a unique fingerprint. ...
Swimming and chemotaxis in the photosynthetic bacterium R. sphaeroides have been intensively studied. Although analysis of the complete genome sequence of this bacterium revealed the presence of two flagellar systems, previous motility screening and phenotypic analyses of strains generated by random or directed mutagenesis allowed characterization of only genes that belong to the fla1 flagellar system. In this work we describe swimming of R. sphaeroides mediated by flagella synthesized by the genes of the second flagellar system (fla2) of this bacterium.. Detection of fla2-dependent swimming required an initial incubation for 1 week. After this, swimming of purified cells was observed after 3 days of incubation. This suggests that the swimming cells accumulated a mutation. The identity of the gene or genes responsible for this phenotypic change is unknown. Nevertheless, since no expression of the flgE2 gene was detected before selection of the SP18 fla2+ strain, we hypothesized that the mutation ...
Earlier studies had shown that certain genes conferring resistance to antibiotics can be picked up by microbes in your gut when you are abroad. Stool sa...
Braibant M, Lefèvre P, de Wit L, Ooms J, Peirs P, Huygen K, Wattiez R, Content J. Identification of a second Mycobacterium tuberculosis gene cluster encoding proteins of an ABC phosphate transporter. FEBS Lett. 394,206-12,1996. Braibant M, Lefèvre P, de Wit L, Peirs P, Ooms J, Huygen K, (...)
091775 - Caracterizaci n microbiol gica de polen comercial. Reporte Preliminar | Veterinaria.org . La primera comunidad veterinaria de habla hispana con presencia en Espa a y Am rica del Sur.
Utilizing the bicistronic reporter transposon mini-Tn5 lacZ-tet/1, we have identified lacZ fusions to four Escherichia coli genes/operons that are strongly activated by the accumulation of self-produced extracellular signals. These fusions were designated cma9, cma48, cma113, and cma114 for conditioned medium activated. Each of the cma fusions was expressed in a growth phase-dependent manner, and the presence of conditioned medium from a stationary phase E. coli culture resulted in the premature activation of these fusions in cells at early to mid-logarithmic phase. The cma48 and cma114 fusions were dependent on RpoS for growth phase expression and response to extracellular factors. The extracellular factors that activated the cma9, cma48, and cma114 fusions were produced in both rich complex and defined minimal media. The cma fusions were shown to be within the cysK (cma9), astD (cma48), tnaB (cma113), and gabT (cma114) genes. These genes function in the uptake, synthesis, or degradation of ...
Integrative and conjugative elements (ICEs) are a diverse group of mobile genetic elements found in both Gram-positive and Gram-negative bacteria. ICEs are self-transmissible elements that encode a full complement of machinery for conjugation as well as intricate regulatory systems to control excision from the chromosome and onward conjugative transfer [Wozniak and Waldor, 2010; Burrus,2004]. These multi-talented entities can promote their own mobilization and potentially that of other hitch-hiking genetic elements and thus contribute to horizontal transfer of virulence determinants, antibiotic-resistance genes and other bacterial traits [Hastings. et al., 2004]. ICEs are being identified in increasing numbers as sequenced genome databases expand exponentially [Wozniak, et al., 2010; Ryan, et al., 2009; te Poele, et al., 2008; Burrus et al., 2002]. At present only a few have been classified into ICE families, amongst the best characterized of which is the SXT/R391 family of Vibrio cholerae, ...
Many bacteria carry extra DNA molecules beyond their chromosome, so-called plasmids. While plasmids are apriori costly to the cell, they ...
Stokes, Richard W and Waddell, Simon J (2009) Adjusting to a new home: Mycobacterium tuberculosis gene expression in response to an intracellular lifestyle. Future Microbiology, 4 (10). pp. 1317-1335. ISSN 1746-0921 ...
Watch Konomi Kohara Movies, Featured movies and series of Konomi Kohara. Watch Konomi Kohara introduction and new movie works on Yesflicks.com
Transposon insertion in ykyB increases the activation of an artificial ComK feedback loop.Strains PG401 (amyE::PcomG-lacZ-gfp, PcomG-comK, ΔmecA) and PG401-Tn4
Steinrück M. The Influence of Sequence Context on the Evolution of Bacterial Gene Expression. IST Austria; 2018. doi:10.15479/AT:ISTA:th1059 ...
Predelava avta na plin kvalitetno, hitro in ugodno. Car gas - kjer kakovost in kvaliteta ne trpita na račun ugodne cene same storitve.
e-Dentico - dwumiesięcznik stomatologa praktyka, polsko-angielski poradnik stomatologiczny. MNiSW: 5 pkt, IC: 5,5 pkt., punkty edukacyjne: 30 pkt.
Police video Testifyng before a House subcomittee yesterday, the head of the Drug Enforcement Administration warned that marijuana legalization is
TY - JOUR. T1 - A complete view of the genetic diversity of the Escherichia coli O-antigen biosynthesis gene cluster. AU - Iguchi, Atsushi. AU - Iyoda, Sunao. AU - Kikuchi, Taisei. AU - Ogura, Yoshitoshi. AU - Katsura, Keisuke. AU - Ohnishi, Makoto. AU - Hayashi, Tetsuya. AU - Thomson, Nicholas R.. PY - 2015/1/1. Y1 - 2015/1/1. N2 - The O antigen constitutes the outermost part of the lipopolysaccharide layer in Gram-negative bacteria. The chemical composition and structure of the O antigen show high levels of variation even within a single species revealing itself as serological diversity. Here, we present a complete sequence set for the O-antigen biosynthesis gene clusters (O-AGCs) from all 184 recognized Escherichia coli O serogroups. By comparing these sequences, we identified 161 well-defined O-AGCs. Based on the wzx/wzy or wzm/wzt gene sequences, in addition to 145 singletons, 37 serogroups were placed into 16 groups. Furthermore, phylogenetic analysis of all the E. coli O-serogroup ...
Isopropyl-beta-D-thiogalactopyranoside, Isopropyl-beta-D-thiogalactopyranoside supplier, Isopropyl-beta-D-thiogalactopyranoside distributor, CAS 367-93-1, Isopropyl-beta-D-thiogalactopyranoside manufacturer, Isopropyl-beta-D-thiogalactopyranoside wholesale
To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximately 4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes were predicted to be essential. The vast majority of essential genes were categorized in relatively few domains of cell metabolism, with about half involved in information processing, one-fifth involved in the synthesis of cell envelope and the determination of cell shape and division, and one-tenth related to cell energetics. Only 4% of essential genes encode unknown functions. Most essential genes are present throughout a wide range of Bacteria, and almost 70% can also be found in Archaea and Eucarya. However, essential genes related to cell envelope, shape, division, and respiration tend to be lost from bacteria with small genomes. Unexpectedly, most genes involved in the Embden-Meyerhof-Parnas pathway are
Götting C, Thierbach G, Pühler A, Kalinowski J. Versatile low-copy-number plasmids for temperature-inducible overexpression of bacterial genes in Escherichia coli. BIOTECHNIQUES. 1998;24(3):362 ...
Escherichia Coli news, clinical research studies and treatment articles dealing with e. coli infections for medical professionals to stay updated. Get our FREE app now.
As bacteria worldwide acquire resistance to the drugs meant to kill them, public health experts have stepped up surveillance of antibiotic resistance in human pathogens. Now a grassroots network of scientists is taking aim at what they see as the root of the problem: resistance genes in harmless bacteria that live in humans, animals, plants, even soil and water. By keeping tabs on when and where specific antibiotic-resistance genes appear, the group hopes to predict-and one day help block-the spread of resistance.. Efforts to track resistance in clinical pathogens have too narrow a focus, argues Abigail Salyers, a microbiologist at the University of Illinois, Urbana-Champaign, who helped organize a meeting in Boston last week to plot the new strategy. She explains that antibiotic resistance can hide undetected in harmless bacteria well before it shows up in patients. Clinical isolates are the tip of the iceberg compared to whats out there in the environment, agrees microbiologist Stuart ...
Experts predict that by 2050, antibiotic-resistant bacteria will cause as many deaths as cancer. Now, for the first time, Caltech scientists have created a 3-D image of a molecular structure that many different bacteria use to pump toxins into human cells and spread antibiotic-resistance genes to other bacteria. Understanding the architecture of this structure is a first step toward combating its effects.. The study was conducted in the laboratory of Grant Jensen, professor of biophysics and biology and Howard Hughes Medical Institute Investigator. A paper describing the work first appeared online in the March 23 issue of EMBO Reports.. The researchers looked specifically at Legionella, the bacteria that causes Legionnaires disease, a severe and often lethal form of pneumonia. When Legionella invades a human cell, it wraps itself in a protective vesicle and opens the molecular structure, known as a type IV secretion system. The molecular machine sits in the cell membrane of the bacterium and ...
The clinical trials tested more than 1,000 clinical isolates at four participating clinical sites: The Johns Hopkins University School of Medicine; Wadsworth Center, New York State Department of Health; University Hospitals Cleveland Medical Center; and IHMA, Inc. The company has completed the majority of analytical testing activities including reproducibility studies and DNA sequencing of over 1,000 isolates to support the planned 510(k) submission.. We are pleased to have completed the isolate clinical trials as an important milestone toward submission for FDA clearance of our Acuitas AMR Gene Panel u5.47 product. We are encouraged by the preliminary results, and look forward to continuing the process toward submission, as we seek clearance for use of our technology throughout the U.S. said Evan Jones, CEO, OpGen, Inc.. The Acuitas AMR Gene Panel u5.47 is a new molecular test developed by OpGen designed to detect five key pathogens and 47 antibiotic-resistance genes semi-quantitatively in ...
Birkenbihl, R.P.; Vielmetter, W., 1989: Cosmid derived map of escherichia coli strain bhb2600 in comparison to the map of strain w3110
Purchase Recombinant Saccharopolyspora erythraea Alanine--tRNA ligase(alaS) ,partial. It is produced in Yeast. High purity. Good price.
De Gentaur Oxford expressie Technologies afzonderlijke Eia Tool validatred met die in biologische monsters te onderscheiden, zoals celmedium dat verschilt. Bij de producent Oxford expressie Technologies met Genprice aanvoernummer 514 voor protocolspecificaties. The Oxford expressie Technologies Laboratoria in gb. Gentaur levert de Oxford uitdrukking Technologies test volgende dag in je Labo. De Oxford expression Technologies produkten worden het snelst en goedkoopst geleverd door Gentaur Bvba te Kampenhout voor Belgie en Gentaur BV te Eersel voor Nederland. Indien u Oxford expression Technologies kits bestelt voor vrijdag 14 uur worden die reeds de dinsdag erop in uw laboratorium afgeleverd in een koelpaket van Gentaur.. ...
Methylocella silvestris, an alphaproteobacterium isolated from a forest soil, can grow on trimethylamine N‐oxide (TMAO) as a sole nitrogen source; however, the molecular and biochemical mechanisms underpinning its growth remain unknown. Marker‐exchange mutagenesis enabled the identification of several genes involved in TMAO metabolism, including Msil_3606, a permease of the amino acids‐polyamine ...
ALN_YEAST (P32375 ), PYR1_CAEEL (Q18990 ), PYR1_DICDI (P20054 ), PYR1_DROME (P05990 ), PYR1_HUMAN (P27708 ), PYR1_MESAU (P08955 ), PYR1_MOUSE (B2RQC6 ), PYR1_SQUAC (Q91437 ), PYRC_ACAM1 (B0CF78 ), PYRC_ACIAD (Q6FD29 ), PYRC_ACIB3 (B7GX48 ), PYRC_ACIB5 (B7I9G6 ), PYRC_ACIBC (B2HWF6 ), PYRC_ACIBS (B0VKW9 ), PYRC_ACIBT (A3M3K3 ), PYRC_ACIBY (B0VAC1 ), PYRC_ACISJ (A1WC79 ), PYRC_AGRFC (Q8UI99 ), PYRC_AGRRK (B9J8H5 ), PYRC_AGRVS (B9JQV9 ), PYRC_ALCBS (Q0VNK6 ), PYRC_ALISL (B6ER91 ), PYRC_ALKEH (Q0AB36 ), PYRC_ANAD2 (B8JAE8 ), PYRC_ANADE (Q2IIB0 ), PYRC_ANAPZ (Q2GL89 ), PYRC_ANASK (B4UDQ2 ), PYRC_ANOFW (B7GFA5 ), PYRC_AQUAE (O66990 ), PYRC_ARATH (O04904 ), PYRC_ARCFU (O28034 ), PYRC_AROAE (Q5P6Y5 ), PYRC_AZOSB (A1K3T5 ), PYRC_AZOVD (C1DQV1 ), PYRC_BACAA (C3P658 ), PYRC_BACAC (C3L738 ), PYRC_BACAH (A0RHR0 ), PYRC_BACAN (Q81WF0 ), PYRC_BACC0 (B7JJX5 ), PYRC_BACC1 (Q732I1 ), PYRC_BACC2 (B7IUP8 ), PYRC_BACC3 (C1EPQ2 ), PYRC_BACC4 (B7H6M4 ), PYRC_BACC7 (B7HLM2 ), PYRC_BACCL (P46538 ), PYRC_BACCN (A7GRL3 ), ...
Gentaur molecular products has all kinds of products like :search , Nacala \ Agarose for ≧1kbp fragment \ 01145-45 for more molecular products just contact us
Romeo, T., M. Gong 1993. Genetic and physical mapping of the regulatory gene csrA on the Escherichia coli K-12 chromosome. J.Bacteriol. 175:5740- ...
Breastfeeding gives babies the best start in life. It has important health benefits and contains the necessary nutrients to help the neurological, immunological and cognitive growth of your child. However natural breastfeeding may not be possible always. Thats why Medela, after conducting extensive research into the process of breastfeeding has developed products that are as close to natural breastfeeding as possible. Their research has taken them from understanding the anatomy of the lactating breast to the mechanism of removal by the baby. Their double and single pumping breastpumps, 2 phase expression technology and innovative feeding solutions like Calma have supported many mothers through the difficult breastfeeding times.. What is a 2-phase Expression Technology ...
Mode of transfer of bacterial genes (genome) through a virus. There are two types, general and specialized by lytic and lysognic phages.
AlwaysLearning wrote: Question: An operon contains a repressor, a promoter sequence, an operator and a structural gene. The structural gene is responsible for t
நோய்க்கடத்தலை தடுப்பதற்கு, ஒவ்வொரு நோயையும் உருவாக்கும் உயிரினம் பற்றி, நோயின் இயல்புபற்றி, நோய் கடத்தப்படும் முறைபற்றி அறிந்திருத்தல் அவசியமாகும். அறிந்துகொள்ள வேண்டிய முக்கியமான இயல்புகளாவன, நோய்க்காரணியின் நோய்த்தொற்று வீரியம் (virulence), நோய்ப் பாதிப்புக்கு உட்பட்டிருப்பவர் செல்லும் தூரம், நோய்த் தொற்றின் நிலை என்பனவாகும். உதாரணமாக எய்ட்சு எனப்படும் மனித ...
TY - JOUR. T1 - Nucleotide sequence and analysis of the phoB-rrnE-groESL region of the Bacillus subtilis chromosome. AU - Sadaie, Yoshito. AU - Yata, Katsunori. AU - Fujita, Masaya. AU - Sagai, Hitoshi. AU - Itaya, Mitsuhiro. AU - Kasahara, Yasuhiro. AU - Ogasawara, Naotake. PY - 1997/6. Y1 - 1997/6. N2 - A 36 kb sequence of the phoB-rrnE-groESL region of the Bacillus subtilis chromosome at around 55°has been determined. The sequenced region contains 36 ORFs including the phoB and groESL genes, and the whole rrnE operon. The phoB gene is transcribed in the direction opposite to that of chromosome replication, while most ORFs, including groESL and the rrnE operon, are transcribed in the same direction. Two newly identified tRNA genes upstream of the rrnE operon were those for Arg-tRNA and Gly-tRNA. The sequenced region contains an operon consisting of genes for degradation and uptake of mannan. The rrnE operon and its downstream ORFs are well conserved among Mycoplasma genitalium, Haemophilus ...
Coloured scanning electron micrograph (SEM) of Streptomyces rimosus, Gram-positive, aerobic, filamentous, rod prokaryote (bacterium). Streptomyces sp. belongs to the Actinomycetes group and are bacteria that share many characteristics with fungi. They grow usually as filaments (chains of cells) and often branch to form a network of filaments (mycelium) in the soil. These soil bacteria are responsible for the musty odour of soil. Streptomyces rimosus is notably the most characterized industrial streptomycete producer of oxytetracycline and other tetracycline antibiotics. Although resistance to these antibiotics has reduced their clinical use in recent years, tetracyclines have an increasing role in the treatment of emerging infections and non-infective diseases. Magnification: x2,400 when shortest axis printed at 25 millimetres. - Stock Image C032/2096
Streptomyces rimosus otcD1 protein: bifunctional cyclase/aromatase from Streptomyces rimosus involved in ring closure of the polyketide backbone of oxytetracycline; amino acid sequence in first source
Although progress in Chlamydia genetics has been rapid, genomic modification has previously been limited to point mutations and group II intron insertions which truncate protein products. The bacterium has thus far been intractable to gene deletion or more-complex genomic integrations such as allelic exchange. Herein, we present a novel suicide vector dependent on inducible expression of a chlamydial gene that renders Chlamydia trachomatis fully genetically tractable and permits rapid reverse genetics by fluorescence-reported allelic exchange mutagenesis (FRAEM). We describe the first available system of targeting chlamydial genes for deletion or allelic exchange as well as curing plasmids from C. trachomatis serovar L2. Furthermore, this approach permits the monitoring of mutagenesis by fluorescence microscopy without disturbing bacterial growth, a significant asset when manipulating obligate intracellular organisms. As proof of principle, trpA was successfully deleted and replaced with a sequence
Sequencing of the complete Bacillus subtilis chromosome revealed the presence of approximately 4100 genes, 1000 of which were previously identified and mapped by classical genetic crosses. Comparison of these experimentally determined positions to th
This chapter provides a broad overview of many applications of plasmids for genetic analysis, primarily in bacteria. Ever since DNA sequencing became accessible to most research laboratories, reverse genetic analysis has become a standard experimental approach to study bacterial gene function. Similar suicide vectors have also been used for nontargeted insertional mutagenesis by cloning random chromosomal DNA fragments into the plasmid. The use of suicide vectors also allows for easy identification of the insertion mutations. Plasmids that utilize different combinations of double-counter selective markers have been used for diverse applications, including the search for extremely rare suppressor mutations of essential Escherichia coli genes, and to improve the efficiency of allelic exchange on bacterial artificial chromosomes (BACs). Although temperature-sensitive vectors represent the majority of conditionally replicating plasmids, other plasmids that exhibit conditional replication have been described
We have cloned the chromosomal hemolysin determinants from Escherichia coli strains belonging to the four O-serotypes 04, 06, 018, and 075, The hemolysin-producing clones were isolated from gene banks of these strains which were constructed by inserting partial Sau3A fragments of chromosomal DNA into the cosmid pJC74. The hemolytic cosmid clones were relatively stable. The inserts were further sub cloned either as Sail fragments in pACYC184 or as BamHI-SaLI fragments in a recombinant plasmid (pANN202) containing cistron C (hlye) of the plasmid-encoded hemolysin determinant. Detailed restriction maps of each of these determinants were constructed, and it was found that, despite sharing overall homology, the determinants exhibited minor specific differences in their structure, These appeared to be restricted to cistron A (hlyA), which is the structural gene for hemolysin. In the gene banks of two of these hemolytic strains, we could also identify clones which carried the genetic determinants for ...
In vivo expression technology (IVET) is a promoter-trap strategy deigned to identify genes whose expression in induced in a specific environment, typically that encountered in a host. Signature-tagged mutagenesis (STM) uses comparative hybridisation to isolate mutants unable to survive specified environmental conditions and has been used to identify genes critical for survival in the host. Both methods have been used to identify virulence genes in S. aureus. The main aim of this project was to find any probable new genes of S. aureus that are essential for biofilm formation and infection mouse model by STM. A library of tagged insertion mutants of S. aureus and a series of selected tags in plasmids of S. aureus strain RN6390 were used. Most of the experiments with both the library and selected tags had problems with cross-hybridisation. All the selected tags were therefore sequenced and 33 tags with less than 50% identity were chosen for future experiments. A library of 825 mutants was made with ...
Gene target information for blaNDM-1 - New Delhi metallo-beta-lactamase-1 (Escherichia coli). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
Wardell, JN, Stocks, SM, Thomas, CR and Bushell, ME (2002) Decreasing the hyphal branching rate of Saccharopolyspora erythraea NRRL 2338 leads to increased resistance to breakage and increased antibiotic production ...
This unit provides a chronological in‐depth description of all protocols needed for quantitative reverse transcription-PCR (Q‐RT‐PCR) analysis of Borrelia burgdorferi gene expression within infected mouse tissues
The dam gene of E. coli can be inactivated by insertion of Tn9 or Mud phage. Strains bearing these mutations are viable indicating that the dam gene product is dispensable.
Cell Wall and CapsuleCapsular and extracellular polysacchridesSerotype determining Capsular polysaccharide biosynthesis in Staphylococcus Capsular polysaccharide synthesis enzyme Cap5K ...
The results of comparing a large and diverse E. coli dataset support the theory that reliable and good resolution phylogenies can be inferred from the core-genome. The results further suggest that the resolution at the isolate level may, subsequently be improved by targeting more variable genes. The …
Impact of mutations in individual protease genes/operons on biofilm formation in vitro. The relative capacity to form a biofilm was assessed using a microtiter
MORAN, JAMES PAUL, POLAR EFFECTS ON THE RATES OF FORMATION AND DIMERIZATION OF FREE RADICALSFROM ETHYL ACETATE (1963). Doctoral Dissertations. AAI6403549 ...
Gentaur molecular products has all kinds of products like :search , ListBio \ Ultra Pure LPS from Escherichia coli O111 B4 \ 105 for more molecular products just contact us
Escherichia coli (E. coli) O157, sometimes called VTEC, is a bacterial infection that can cause severe stomach pain , bloody diarrhoea and kidney failure.
Citation Gómez-Mejia A, Gámez G, Hirschmann S, Kluger V, Rath H, Böhm S, Voss F, Kakar N, Petruschka L, Völker U, Brückner R, Mäder U, Hammerschmidt S. 2018. Pneumococcal metabolic adaptation and colonization are regulated by the two-component regulatory system 08. mSphere 3:e00165-18. https://doi.org/10.1128/mSphere.00165-18. ...
Full text for this publication is not currently held within this repository. Alternative links are provided below where available. ...
LB broth is used for maintaining and cultivating recombinant strains of Escherichia coli. The ingredients of LB broth are tryptone, yeast extract and Sodium Chloride. We show you how to prepare the LB medium. - LB Medium Preparation - AbVideo™ - Support - Abnova
Description: Alkaline phosphatase isozyme conversion aminopeptidase; generates alkaline phosphatase isozyme 3 subunit lacking the N-terminal ...
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
Staphylococcus aureus; strain: USA300_FPR3757; locus tag: SAUSA300_1852 (SAUSA300_RS10120); product: putative ABC transporter ATP-binding protein
Bacillus subtilis is a gram positive, sporulating bacteria often utilized in industry as a producer of high quality enzymes and proteins [1].
Scientists have come closer to the understanding of how a E. coli clone described as the most important of its kind to cause human infections, has spread across the world in a very short time.
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
A newly discovered receptor in a strain of Escherichia coli can be blocked to avert infection, a finding that might aid in developing better therapies to treat bacterial infections resulting in food poisoning, diarrhoea or plague.
We use cookies to enhance your experience on our website. By continuing to use our website, you are agreeing to our use of cookies. You can change your cookie settings at any time.Find out more ...
The properties of this strain that contribute to its usefulness as a cloning strain are described below. The genotypes underlying these properties appear in parentheses.
putative ABC transporter ATP-binding/permease protein [PimA protein] GTGCTGCTATGTCTTCTGCGAATCCATCTGCGGCCGCACCGGCGCTCCGTCGCCCTGCTG GGGCTTTTGCAACTGGTGCAGATCCTGGCCACTTTGGCCCTGCCGACACTGGGCGCCGCG GTCATCGACAACGGCGTGGTCAGGGCCGACAGCGGCTACATCACCCGGACCGGCCTGGCC ATGCTGGCCGTGGCGCTCGTGCAGATCGCGGCGTCCGTGGCCGCGGTGGCGCTGGGCGCC CGTACGGCCATGGCGATGGGCCGCGACCTGCGCTCGGCCGTCTTCCGCCGGGTGCTGGAC TTCTCGGCCCGCGAGGTCGGGCGGTTCGGCACTCCGTCGCTGATGACGCGGACCGTCAAC GATGTGCAGCAGGTGCAGGTGCTGGCCCTGTCCGCGTTCGGCGTCGTCGTGTCGGCGCCC CTGATGTGTCTGGGCAGCATCGCGCTCGCACTCCAGCAGGACGTCCCGCTCTCCCTGCTC CTGGTGGCGCTGATGGTGGCCGTCGGAATGTCCTTCGGCCTCATTCTCGGCCGCACCGAT CCGTTCTACGCCCGTATGCAGAAACAGCTGGACCGCATCAACGGGCTGCTGCGCGAACGC ATTACCGGAGTCCGCGTCGTACGGGCTTTTGTGCGCGACGCCCACGAAGGCGCGAGATTC GGCCGCACCAATTCCGAATTGCGTGACATCTCGCTGCGCGTCGGCCGGCTGCTGGCCACG GTCATCCCCCTGGTGCTGCTGGTCCTCAACGCCTTCATGGCAGCCGTGGTGTGGTTCGGC GCCCACCGCATCGACGCCGGGGCGATGCGGTTCGGTGCGCTCAGCGCGTTTCTGAGCTAC CTGACGCTGATCACGATGTCGGTGGTGATGGTGACCTTCGTGTGCCTGCCGATGCCGCGG ...
Profacgen provides a novel NovEgg Expression technology, an efficient and convenient way to make high fidelity recombinant protein products rapidly and safely.
Important Information about Clavam 625 - an Antibiotic medicine. Why it is prescribed, dosage and possible side-effects of Clavam 625
Actually, only certain types of E. coli are dangerous. The types of E. coli that are harmful are particularly dangerous because...
The following pages link to Inducing Bacillus subtilis with Subtilin: View (previous 50 , next 50) (20 , 50 , 100 , 250 , 500) ...
Cosmid.net - Sonny Twister Time With Sonny (Jul 25, 2014) 106 images totaling 63M Download set with the VG-Ripper MultiHosters.com K2S | RG | TF | UL
Cosmid.net - Mechelle Someones Knocking (Jul 15, 2014) 103 images totaling 74M Download set with the VG-Ripper MultiHosters.com K2S | RG | TF | UL
come-up, holding and cooling. We hypothesize that slow heating rate during come-up stage, as practiced ... objectives of this study are to understand how different heating rates during come-up stage could affect (1) ... heat-stress-response and virulence genes. Compared to fast heating rate, slow rate caused higher expression of heat .... ...
Tekne alım-satım süreçleriyle ilgili aklınızdaki tüm soruları gidermeyi planlıyoruz, sizin aklınız hobilerinizle açılacağınız limanlarda olsun.
コジマ公式通販の【コジマネット】。人気 防災保温シート(1400×2100mm) の ELPA 防災保温シート(1400×2100mm) RHS‐01 のお取り扱いページです。最短翌日お届け、全品代引き手数料無料!
Our study does not provide evidence that the effect of resuscitation with albumin compared with saline in the intensive care unit is different in patients with different baseline serum albumin concentrations. Nor does it provide evidence to support the suggestion that albumin increases the risk of mortality in patients with hypoalbuminaemia. When the odds ratios for death was compared in patients with a baseline serum albumin concentration of 25 g/l or less or of more than 25 g/l we found only limited evidence that treatment effects were different and this only after correction for other baseline risk factors. When we considered the effect of baseline serum albumin concentration as a continuous variable across the spectrum of albumin concentrations, baseline concentration had no impact on the treatment effect even after correction for other baseline risk factors. Taken together these results suggest that albumin and saline produce similar treatment effects across the range of albumin ...
Aglutinare - Dictionar termeni medicali - Reactie specifica de aparare a organismului, caracterizat prin adunarea in mici gramezi a globulelor rosii, bacteriilor sau altor elemente, in prezenta anticorpilor corespunzatori
tRNA genes[edit]. Organisms vary in the number of tRNA genes in their genome. For example, the nematode worm C. elegans, a ... "Tertiary structure of bacterial selenocysteine tRNA". Nucleic Acids Research. 41 (13): 6729-38. doi:10.1093/nar/gkt321. PMC ... These genes are found on all chromosomes, except the 22 and Y chromosome. High clustering on 6p is observed (140 tRNA genes), ... As with all eukaryotes, there are 22 mitochondrial tRNA genes[30] in humans. Mutations in some of these genes have been ...
"Large variations in bacterial ribosomal RNA genes". Molecular Biology and Evolution. 29 (10): 2937-48. doi:10.1093/molbev/ ... Gene content and protein synthesis. The chloroplast genome most commonly includes around 100 genes[24][44] that code for a ... 4.4 Gene content and protein synthesis *4.4.1 Chloroplast genome reduction and gene transfer ... Chloroplasts may contain 60-100 genes whereas cyanobacteria often have more than 1500 genes in their genome.[81] Recently, a ...
Bacterial genes may be retained within the plant. The hairy roots are grown in vitro in bioreactors to study their soil ... Under such conditions, certain bacterial genes are turned on leading to the transfer of its tDNA from its root-inducing plasmid ... Intrieri, M. C. & Buiatti, M. (July 2001). "The horizontal transfer of Agrobacterium rhizogenes genes and the evolution of the ... "Agrobacterium rhizogenes T-DNA genes capable of inducing hairy root phenotype". Molecular and General Genetics 209(3):475-480. ...
"Systematic chromosomal deletion of bacterial ribosomal protein genes". J. Mol. Biol. 413 (4): 751-61. doi:10.1016/j.jmb.2011.09 ... an Updated Database of Essential Genes". Gene Essentiality. Methods in Molecular Biology. 1279. pp. 219-33. doi:10.1007/978-1- ... Taken together with previous results, 22 of the 54 E. coli ribosomal protein genes can be individually deleted from the genome. ... Gao, F; Luo, H; Zhang, C. T.; Zhang, R (2015). "Gene Essentiality Analysis Based on DEG 10, ...
To clone a gene fragment into a vector, both plasmid DNA and gene insert are typically cut with the same restriction enzymes, ... Smith HO, Nathans D (Dec 1973). "Letter: A suggested nomenclature for bacterial host modification and restriction systems and ... Wayengera M (2003). "HIV and Gene Therapy: The proposed [R-M enzymatic] model for a gene therapy against HIV". Makerere Med J. ... They are used to assist insertion of genes into plasmid vectors during gene cloning and protein production experiments. For ...
Gene Cassettes[edit]. Main article: Gene cassette. Additionally, an integron will usually contain one or more gene cassettes ... Mazel, D. "Integrons: agents of bacterial evolution". Nature Reviews Microbiology. 4 (8): 608-620. doi:10.1038/nrmicro1462.. ... The gene cassettes may encode genes for antibiotic resistance, although most genes in integrons are uncharacterized. An attC ... Hall, RM; Collis, CM (1995). "Mobile gene cassettes and integrons: Capture and spread of genes by site-specific recombination ...
Kuehn MJ, Kesty NC (November 2005). "Bacterial outer membrane vesicles and the host-pathogen interaction". Genes & Development ... of a bacterial cell to its exterior. Secretion is a very important mechanism in bacterial functioning and operation in their ... The Type VI secretion system gene clusters contain from 15 to more than 20 genes, two of which, Hcp and VgrG, have been shown ... 2009). Bacterial Secreted Proteins: Secretory Mechanisms and Role in Pathogenesis. Caister Academic Press. ISBN 978-1-904455-42 ...
... s may also mediate bacterial escape from host cells. Regulation of gene expression[edit]. The regulation of gene ... "Iron and bacterial virulence". Indian J Med Microbiol. 24 (3): 163-4. PMID 16912433 ...
"Evolutionary relationships of bacterial and archaeal glutamine synthetase genes". J. Mol. Evol. 38 (6): 566-76. doi:10.1007/ ... Research on E. coli revealed that GS is regulated through gene expression. The gene that encodes the GS subunit is designated ... The cytosolic GS gene translation is regulated by its 5' untranslated region (UTR), while its 3' UTR plays role in transcript ... "Evolution of the glutamine synthetase gene, one of the oldest existing and functioning genes". Proc. Natl. Acad. Sci. U.S.A ...
It contained three bacterial genes, two CP4 EPSPS genes, and a gene encoding beta-glucuronidase (GUS) from Escherichia coli as ... This CP4 EPSPS gene was cloned and transfected into soybeans.. The plasmid used to move the gene into soybeans was PV-GMGTO4. ... Introducing new genes into plants requires a promoter specific to the area where the gene is to be expressed. For instance, to ... "Expression of bacterial genes in plant cells" (PDF). Proc. Natl. Acad. Sci. U.S.A. 80 (15): 4803-07. Bibcode:1983PNAS...80.4803 ...
Kuehn, M. J.; Kesty, N. C. (2005). "Bacterial outer membrane vesicles and the host-pathogen interaction". Genes & Development. ... Schematic drawing of bacterial conjugation. 1- Donor cell produces pilus. 2- Pilus attaches to recipient cell, bringing the two ... Salyers, A. A. & Whitt, D. D. (2002). Bacterial Pathogenesis: A Molecular Approach, 2nd ed., Washington, D.C.: ASM Press. ISBN ... Transferred genes enter the plant cell nucleus and effectively transform the plant cells into factories for the production of ...
Over-expression of the Ras2 gene increases lifespan in yeast by 30%.[87] A yeast mutant lacking the genes SCH9 and RAS1 has ... Some evidence is provided by oxygen-deprived bacterial cultures.[98]. *The theory would explain why the autosomal dominant ... Such a genetic effect is called the antagonistic pleiotropy effect when referring to a gene (pleiotropy signifying the gene has ... methylation of gene promoter regions or alterations of the DNA scaffolding which regulate gene expression), can cause abnormal ...
"Expression of bacterial genes in plant cells" (PDF). Proc. Natl. Acad. Sci. USA. 80 (15): 4803-4807. Bibcode:1983PNAS...80.4803 ... Human gene therapy. Gene therapy,[110] uses genetically modified viruses to deliver genes that can cure disease in humans. ... firing small particles from a gene gun.[2][3][4]. Other methods exploit natural forms of gene transfer, such as the ability of ... Inserted genes usually come from a different species in a form of horizontal gene-transfer. In nature this can occur when ...
... viable daughter cells to be produced would require an extra replication of the intact RNA gene homologous to any RNA gene that ... Nudler E, Mironov AS (Jan 2004). "The riboswitch control of bacterial metabolism". Trends in Biochemical Sciences. 29 (1): 11-7 ... If at least one damage-free copy of each RNA gene is present in the transient diploid, viable progeny can be formed. For two, ... Tucker BJ, Breaker RR (Jun 2005). "Riboswitches as versatile gene control elements". Current Opinion in Structural Biology. 15 ...
"Epigenetic gene regulation in the bacterial world". Microbiol. Mol. Biol. Rev. 70 (3): 830-56. PMC 1594586 . PMID 16959970. doi ... Morris KL (2008). "Epigenetic Regulation of Gene Expression". RNA and the Regulation of Gene Expression: A Hidden Layer of ... They control gene expression including virulence genes in pathogens and are viewed as new targets in the fight against drug- ... There are several layers of regulation of gene expression. One way that genes are regulated is through the remodeling of ...
Young, JM (2001). "Implications of alternative classifications and horizontal gene transfer for bacterial taxonomy". Int. J. ... Analysis of their 16S rRNA gene sequences suggests that they are a deeply branching lineage that does not belong to the main ... Hansmann, S; Martin W (2000). "Phylogeny of 33 ribosomal and six other proteins encoded in an ancient gene cluster that is ... Euzeby, JP (1997). "List of Bacterial Names with Standing in Nomenclature: a folder available on the Internet". Int. J. Syst. ...
... gene. Recently, NOS activity has been demonstrated in several bacterial species, including notorious pathogens Bacillus ... The gene coding for eNOS is located on Chromosome 7. A constitutive Ca2+ dependent NOS provides a basal release of NO. eNOS is ... The gene coding for nNOS is located on Chromosome 12. Neuronal NOS also performs a role in cell communication and is associated ... The gene coding for iNOS is located on Chromosome 17. While evidence for 'baseline' iNOS expression has been elusive, IRF1 and ...
Such genes include mei-41, mei-9, hdm, spnA, and brca2.[5] This large group of conserved genes between processes supports the ... Links to bacterial transformation[edit]. The process of bacterial transformation also shares many similarities with chromosomal ... The linked frequency of crossing over between two gene loci (markers) is the crossing-over value . For fixed set of genetic and ... Bacterial transformation itself has been linked to DNA repair many times.[5] The second theory comes from the idea that meiosis ...
"Genes & Development. 11 (15): 1912-24. doi:10.1101/gad.11.15.1912. PMC 316416. PMID 9271115.. ... Other NAD-dependent enzymes include bacterial DNA ligases, which join two DNA ends by using NAD+ as a substrate to donate an ... Wilkinson A, Day J, Bowater R (2001). "Bacterial DNA ligases". Mol. Microbiol. 40 (6): 1241-8. doi:10.1046/j.1365-2958.2001. ... An example of a NAD-binding bacterial enzyme involved in amino acid metabolism that does not have Rossmann fold: .[42] ...
Gene. A segment of DNA. Genes are like sentences made of the "letters" of the nucleotide alphabet, between them genes direct ... Genetic engineering: Bacterial arsenal to combat chewing insects GMO Safety, Jul 2010 ... Genes are copied[edit]. Main article: DNA replication. Genes are copied each time a cell divides into two new cells. The ... Genes make proteins[edit]. Main article: Genetic code. The function of genes is to provide the information needed to make ...
The quick drainage reduces the filtration of nutrients out of the water and into the soil.[107] The distribution of bacterial ... Agricultural contamination impacts antibiotic resistance gene abundances in river bed sediment temporally by Rachelle E. ... contamination in private wells has been mapped.[108] Some bacteria found in surface water have genes for antibiotic resistance ...
"Genetics of Bacterial Alginate: Alginate Genes Distribution, Organization and Biosynthesis in Bacteria". Current Genomics. 8 ... This chromosome is a circular DNA molecule which contains 5,342,073 nucleotide pairs and 5,043 genes, of which 4,988 encode ... Synthesis of nitrogenase is controlled by the nif genes.[49] Nitrogen fixation is regulated by the enhancer protein NifA and ... "Azotobacter vinelandii NIFL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation genes via a redox- ...
"Toxin Gene Expression by Shiga Toxin-producing Escherichia coli: The Role of Antibiotics and the Bacterial SOS Response" ... although it may be used against any susceptible aerobic bacterial species.[7] It may also be used to treat and prevent ... Trimethoprim's affinity for bacterial dihydrofolate reductase is several thousand times greater than its affinity for human ... THF is an essential precursor in the thymidine synthesis pathway and interference with this pathway inhibits bacterial DNA ...
Mann, Nicholas H.; Cook, Annabel; Millard, Andrew; Bailey, Shaun; Clokie, Martha (2003). "Bacterial photosynthesis genes in a ... Methods and Protocols Phages in nature Marine cyanophages and light Bacterial photosynthesis genes in a virus Clokie is ... They are at risk from Flacherie, a bacterial disease that is caused by larvae eating infected leaves. Alongside working on silk ... These phages disable the Salmonella bacterial disease that infects pigs and can be added to pig feed. Her publications include ...
Bacterial transposons of this type belong to the Tn family. When the transposable elements lack additional genes, they are ... "Gene group: Transposable element derived genes". HUGO Gene Nomenclature Committee. Retrieved 4 March 2019.. ... Because interspersed repeats block gene conversion, they protect novel gene sequences from being overwritten by similar gene ... In some cases the insertion of a TE into a gene can disrupt that gene's function in a reversible manner where transposase- ...
Narberhaus F (2010). "Translational control of bacterial heat shock and virulence genes by temperature-sensing mRNAs". RNA ... Gata4 is an essential gene responsible for cardiac morphogenesis. It also regulates the gene expression of hspb7 and hspb12. ... Some bacterial heat shock proteins are upregulated via a mechanism involving RNA thermometers such as the FourU thermometer, ... Expression of the hspb4 gene, which codes for alpha crystallin, increases considerably in the lens in response to heat shock.[ ...
Bacterial transposons of this type belong to the Tn family. When the transposable elements lack additional genes, they are ... Because interspersed repeats block gene conversion, they protect novel gene sequences from being overwritten by similar gene ... Sometimes the insertion of a TE into a gene can disrupt that gene's function in a reversible manner, in a process called ... These contain integrase, which can integrate gene cassettes. There are over 40 antibiotic resistance genes identified on ...
"Phylogenetic construction of 17 bacterial phyla by new method and carefully selected orthologs". Gene. 429 (1-2): 59-64. doi ... Gene transfer and genetic exchange[edit]. Sulfolobus solfataricus and Sulfolobus acidocaldarius are hyperthermophilic archaea. ... For example, the GC-content levels in the coding regions of some signature genes were consistently identified as correlated ... 10.1016/j.gene.2008.10.006. PMC 2648810. PMID 19000750.. *^ Stetter, K. (2006). "History of discovery of the first ...
"Bacterial gene transfer by natural genetic transformation in the environment". Microbiological Reviews. 58 (3): 563-602. doi: ... A gene is a unit of heredity and is a region of DNA that influences a particular characteristic in an organism. Genes contain ... A gene is a sequence of DNA that contains genetic information and can influence the phenotype of an organism. Within a gene, ... Genes and genomes. Further information: Cell nucleus, Chromatin, Chromosome, Gene, and Noncoding DNA ...
... is a protein which is a bacterial relative of the intermediate filaments found in eukaryotic cells. Just as tubulins ... Kollmar, M (29 May 2015). "Polyphyly of nuclear lamin genes indicates an early eukaryotic origin of the metazoan-type ... Esue O, Rupprecht L, Sun SX, Wirtz D (January 2010). "Dynamics of the bacterial intermediate filament crescentin in vitro and ... Ausmees N, Kuhn JR, Jacobs-Wagner C (December 2003). "The bacterial cytoskeleton: an intermediate filament-like function in ...
Secondary bile acids result from bacterial actions in the colon. In humans, taurocholic acid and glycocholic acid (derivatives ... also known by its gene name NR1H4.[15][16][17] Another bile acid receptor is the cell membrane receptor known as G protein- ... September 1980). "Effect of high-fat, high-beef diet and of mode of cooking of beef in the diet on fecal bacterial enzymes and ... "Conjugated bile acid-activated S1P receptor 2 is a key regulator of sphingosine kinase 2 and hepatic gene expression" ...
It has a core set of 1553 genes, plus 154 genes in its virulome, which contribute to virulence and 176 genes that maintain a ... Natural bacterial transformation involves the transfer of DNA from one bacterium to another through the surrounding medium. ... For instance, the Xisco gene was recently described as a biomarker for PCR-based detection of S. pneumoniae and differentiation ... In S. pneumoniae, at least 23 genes are required for transformation. For a bacterium to bind, take up, and recombine exogenous ...
... encoded by the L gene, partially uncoats the nucleocapsid and transcribes the genes into positive-strand mRNAs, which are then ... balance as well as treating any bacterial infections that may develop.[33] Dialysis may be needed for kidney failure, and ... Ebolaviruses contain single-stranded, non-infectious RNA genomes.[46] Ebolavirus genomes contain seven genes including 3'-UTR- ... This triggers the expression of interferon-stimulated genes, which code for proteins with antiviral properties.[51] EBOV's V24 ...
They are labelled "Type I" if the defective gene is for an enzyme involved in the assembly or transfer of the Glc3Man9GlcNAc2- ... Lizak C, Gerber S, Numao S, Aebi M, Locher KP (June 2011). "X-ray structure of a bacterial oligosaccharyltransferase". Nature. ...
"Protein structures forming the shell of primitive bacterial organelles.". Science 309 (5736): 936-8. Bibcode 2005Sci...309.. ...
... compact genomes and genes of bacterial origin". BMC Genomics. 16 (1): 204. doi:10.1186/s12864-015-1418-3. PMC 4487195. PMID ... Gene content and protein synthesisEdit. The chloroplast genome most commonly includes around 100 genes[7][10] which code for a ... 3 Gene content and protein synthesis *3.1 Chloroplast genome reduction and gene transfer ... Chloroplasts may contain 60-100 genes whereas cyanobacteria often have more than 1500 genes in their genome.[27] Contrarily, ...
These gene candidates include certain variations in tumor necrosis factor-alpha (TNF-alpha), IL-1 alpha, and CYP1A1 genes, ... The anaerobic bacterial species Cutibacterium acnes (formerly Propionibacterium acnes) contributes to the development of acne, ... Genes[edit]. Acne appears to be strongly inherited; genetics explain 81% of the variation in the population.[15] Studies ... These reinforced the idea amongst dermatologists that bacterial growth on the skin plays an important role in causing acne.[179 ...
The bacterial cell's control system has a hierarchical organization.[16] The signaling and the control subsystem interfaces ... The Caulobacter CB15 genome has 4,016,942 base pairs in a single circular chromosome encoding 3,767 genes.[7] The genome ... Generally, the bacterial species that divides fastest will be most effective at exploiting resources and effectively occupying ... Ausmees, Nora; Kuhn, Jeffrey R.; Jacobs-Wagner, Christine (December 2003). "The bacterial cytoskeleton: an intermediate ...
"DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes. 15 (4): 173-183. doi:10.1093/ ... The government started hailing the use of enamel tanks as easy to clean, lasting forever, and being devoid of bacterial ...
In 2000, the concentration of pro-vitamin A was increased by adding a bacterial gene encoding phytoene desaturase, although the ... by adding antisense genes to silence the native gene or by adding extra copies of the native gene.[45][46] ... "Expression of a synthesized gene encoding cationic peptide cecropin B in transgenic tomato plants protects against bacterial ... has been introduced into tomato plants and in vivo studies show significant resistance to bacterial wilt and bacterial spot.[27 ...
According to this model, new genes are created by non-adaptive processes, such as by random gene duplication. These novel ... "Being Pathogenic, Plastic, and Sexual while Living with a Nearly Minimal Bacterial Genome". PLoS Genet. 3 (5): e75. doi ... All changes in the gene frequencies of populations--and quite often in the traits those genes influence--are by definition ... how new alternative spliced isoforms of genes arise, how gene scrambling in ciliates evolved, and how pervasive pan-RNA editing ...
Smallest angiosperm genomes found in Lentibulariaceae, with chromosomes of bacterial size. Plant Biology. 8: 770-777. ... 1976). "Complete nucleotide-sequence of bacteriophage MS2-RNA - primary and secondary structure of replicase gene". Nature. 260 ... This includes both the genes and the non-coding sequences of the DNA. Professor Hans Winkler coined the term in 1920.[1] ...
RNA probes can be designed for any gene or any sequence within a gene for visualization of mRNA,[3][4][5] lncRNA[6][7][8] and ... Bacterial FISH probes are often primers for the 16s rRNA region. FISH is widely used in the field of microbial ecology, to ... The technology has potential applications in cancer diagnosis,[14] neuroscience, gene expression analysis,[15] and companion ... MA-FISH is applied for detecting the HER2 gene in breast cancer tissues.[16] ...
Abel-Santos, E (editor) (2012). Bacterial Spores: Current Research and Applications. Caister Academic Press. ISBN 978-1-908230- ... These studies have contributed much to our understanding of the regulation of gene expression, transcription factors, and the ... Further information: Bacterial morphological plasticity. Under conditions of starvation, especially the lack of carbon and ... While the rest of a bacterial cell may stain, the endospore is left colourless. To combat this, a special stain technique ...
Non-coding RNA or "RNA genes". These are a broad class of genes that encode RNA which is not translated into protein. The most ... All are similar and related to each other and to bacterial RNAP:. *RNA polymerase I synthesizes a pre-rRNA which will form the ... However, since the late 1990s, many new RNA genes have been found, and thus RNA genes may play a much more significant role ... Genes, factors and transcriptional specificity". Eur J Biochem. 212 (1): 1-11. doi:10.1111/j.1432-1033.1993.tb17626.x. PMID ...
There are indications that benzo[a]pyrene diol epoxide specifically targets the protective p53 gene.[25] This gene is a ... Therefore, macrophage membranes become susceptibile to bacterial infections.[11] Reproductive system[edit]. In experiments with ... in DNA located upstream of certain genes. This process increases transcription of certain genes, notably CYP1A1, followed by ... pyrene confers enhanced susceptibility to bacterial infection". Environ Research. 146: 173-84. doi:10.1016/j.envres.2015.12.027 ...
Some degree of gene flow is normal, and preserves constellations of genes and genotypes.[118][119] An example of this is the ... Diseases may also be vectored by invasive insects such as the Asian citrus psyllid and the bacterial disease citrus greening.[ ... Citrus greening is a bacterial disease vectored by the invasive Asian citrus psyllid (ACP). Because of the impacts of this ... Hybrids resulting from invasive species interbreeding with native species can incorporate their genotypes into the gene pool ...
... is a eukaryotic gene. The enzyme encoded by this gene is a member of the RAD51 protein family which assists in repair of ... RAD51 family members are homologous to the bacterial RecA, Archaeal RadA and yeast Rad51.[5][6] The protein is highly conserved ... Many cancers have epigenetic deficiencies in various DNA repair genes (see Frequencies of epimutations in DNA repair genes in ... Gene ontology. Molecular function. • nucleotide binding. • DNA binding. • DNA-dependent ATPase activity. • recombinase activity ...
As an example of the relationship between the IMP (in this case the bacterial phototrapping pigment, bacteriorhodopsin) and the ... Search integral membrane proteins in the PDB (based on gene ontology classification) ...
Mcintosh, M (19 October 2004). "Curdlan and other bacterial (1→3)-β-D-glucans". Applied Microbiology and Biotechnology. 68 (2 ... The process leading to β-1,6 linkages is poorly understood: although genes important in the process have been identified, not ... This fermentation impacts the expression of many genes within the large intestine,[15] which further affects digestive function ...
Mutation in the CACNA1C gene, the single-nucleotide polymorphism located in the third intron of the Cav1.2 gene,[18] are ... "Entrez Gene: voltage-dependent, L type, alpha 1C subunit".. *^ Narayanan D, Xi Q, Pfeffer LM, Jaggar JH (Sep 2010). " ... Gene ontology. Molecular function. • calcium channel activity. • metal ion binding. • voltage-gated ion channel activity. • ion ... Click on genes, proteins and metabolites below to link to respective Wikipedia articles. [§ 1] ...
Ng SY; Chaban B; Jarrell KF (2006). "Archaeal flagella, bacterial flagella and type IV pili: a comparison of genes and ... Asexual reproduction, horizontal gene transfer. Asexual reproduction, horizontal gene transfer. Sexual and asexual reproduction ... since most archaeal genes lack introns, although there are many introns in their transfer RNA and ribosomal RNA genes,[146] and ... "Evolutionary relationships of bacterial and archaeal glutamine synthetase genes". Journal of Molecular Evolution. 38 (6): 566- ...
de Kloet, RS; de Kloet SR (2005). "The evolution of the spindlin gene in birds: Sequence analysis of an intron of the spindlin ... "Colourful parrot feathers resist bacterial degradation". Biology Letters. 7 (2): 214-216. doi:10.1098/rsbl.2010.0716. PMC ... W and Z gene reveals four major divisions of the Psittaciformes". Molecular Phylogenetics and Evolution. 36 (3): 706-721. doi: ...
... is a sequence of DNA found in the core promoter region of genes in archaea and eukaryotes.[2] The bacterial homolog of the TATA ... "Gene. 389 (1): 52-65. doi:10.1016/j.gene.2006.09.029. PMC 1955227. PMID 17123746.. ... and viral genes.[8][2] The TATA box was found in protein coding genes transcribed by RNA polymerase II.[2] ... of genes have promoter regions containing the TATA box.[13] Genes containing the TATA-box tend to be involved in stress- ...
Mayer, Gene. Immunology - Chapter One: Innate (non-specific) Immunity. Microbiology and Immunology On-Line Textbook. USC School ... Ernst J. D. and Stendahl O., (editors), Phagocytosis of Bacteria and Bacterial Pathogenicity, Cambridge University Press, 2006 ... Soehnlein O, Kenne E, Rotzius P, Eriksson EE, Lindbom L. Neutrophil secretion products regulate anti-bacterial activity in ... Neutrophil primary granule proteins HBP and HNP1-3 boost bacterial phagocytosis by human and murine macrophages. J. Clin. ...
Watson JD, Baker TA, Bell SP, Gann A, Levine M, Oosick R (2008). Molecular Biology of the Gene. San Francisco: Pearson/Benjamin ...
Gene ontology. Molecular function. • amyloid-beta binding. • signal transducer activity. • Wnt-protein binding. • protein ... cellular response to molecule of bacterial origin. • positive regulation of interferon-gamma production. • embryonic axis ... Frizzled-5 is a protein that in humans is encoded by the FZD5 gene.[5][6][7] ... Saitoh T, Hirai M, Katoh M (Jun 2001). "Molecular cloning and characterization of human Frizzled-5 gene on chromosome 2q33.3- ...
"The Size, Shape, And Arrangement of Bacterial Cells". classes.midlandstech.edu. Archived from the original on 9 August 2016. ... Transcription and mRNA splicing - Gene expression.. Notable cell biologistsEdit. *Jean Baptiste Carnoy ...
Reproduction and gene transfer[change , change source]. A bacterium reproduces (creates more bacteria) by dividing in half and ... Bacterial evolution. Microbiological reviews 51 (2): 221-71. [1]. *↑ Holland L. (1990). "Woese, Carl in the forefront of ... Bacterial cells do not have a nucleus, and most have no organelles with membranes around them. Most have a cell wall. They do ... The complete DNA sequence is known for many bacterial strains.. Shape[change , change source]. Bacteria vary widely in size and ...
The bacterial and fungal cultures found in the fermenting piles were found to vary widely from factory to factory throughout ... It is apparent that this species does not have the gene sequence for coding ochratoxin and thus pu'er tea should be considered ... Tian, Jianqing; Zhu, Zixiang; Wu, Bing; Wang, Lin; Liu, Xingzhong (2013-08-19). "Bacterial and fungal communities in Pu'er tea ... bacterial, or autooxidation influences. Pu'er flavors can change dramatically over the course of the aging process, resulting ...
Visualization of bacterial genes in action.. Miller OL Jr, Hamkalo BA, Thomas CA Jr. ... The morphology of active structural and putative ribosomal RNA genes was observed by electron microscopy after lysis of fragile ...
... have been infected with transducing bacteriophage that harbours either wild type or defective transferase gene. Infection only ... MERRIL, C., GEIER, M. & PETRICCIANI, J. Bacterial Virus Gene Expression in Human Cells. Nature 233, 398-400 (1971). https://doi ... have been infected with transducing bacteriophage that harbours either wild type or defective transferase gene. Infection only ...
Identifying bacterial genes and endosymbiont DNA with Glimmer.. Delcher AL1, Bratke KA, Powers EC, Salzberg SL. ... The Glimmer gene-finding software has been successfully used for finding genes in bacteria, archaea and viruses representing ... This ORF contains the fructose bis-P aldolase gene in Escherichia coli (EG14062) and the current Ecogene verified start site is ... as measured by comparisons to known and well-curated genes. We show that our interpolated Markov model (IMM) DNA discriminator ...
Genes for GSI have been found only in bacteria... ... GSIII genes have been found in only a few bacterial species. ... We suspect that the similarity of GSI-α genes from Euryarchaeota and several bacterial species does not reflect a common ... Genes for GSI have been found only in bacteria (eubacteria) and archaea (archaebacteria), while GSII genes only occur in ... Cyanobacterial genes lack adenylylation regulation of GS and may have secondarily lost it. The GSI gene of Sulfolobus ...
Researchers have harvested genes from bacteria that, with a few tweaks, can create and enhance electrical signaling in cultured ... Bacterial genes boost current in human cells Borrowing and tweaking bacterial genes to Enhance electrical activity might treat ... The researchers then delivered three genes to the electrically inactive cells: one bacterial gene for a sodium ion channel and ... Bacterial genes boost current in human cells. Duke University. Journal. Nature Communications. Funder. American Heart ...
This is the first report of an environmental reservoir of a bacterial exotoxin gene in an atypical host. Screening bacterial ... gene is present in an alternative bacterial host, providing the first evidence for an environmental pool of exotoxin genes in ... When a phage transfers virulence genes to an avirulent bacterium, the bacterium can acquire the ability to cause disease. It is ... enterotoxin A gene (,i,sea,/i,). 16S DNA sequence comparisons and growth studies identified the environmental isolate as a ...
We identify 152 gene exchange networks containing 22,963 bacterial genomes. Analysis of ARG-surrounding sequences identify ... genes encoding putative mobilisation elements such as transposases and integrases that may be involved in gene transfer between ... Our approach may potentially enable better risk assessment of future resistance gene dissemination. Antibiotic resistance ... we set out to determine predictive features of ARG transfer among bacterial clades. We use a statistical framework to identify ...
Gene truncation or gene pseudogenization also plays an important role in shaping bacterial genome content. Truncated genes ... Hao, W., and G. B. Golding, 2008a High rates of lateral gene transfer are not due to false diagnosis of gene absence. Gene 421: ... In addition to the two states, "p" for gene presence and "a" for gene absence, a new state "f" for fragment (truncated genes) ... Since the rates of gene insertions are high (Hao and Golding 2006) and genes with high duplicability are more prone to gene ...
The bacterium Escherichia colicarries approximately 3000 genes, but this total repertoire... ... Reznikoff W.S. (1989) Regulation of Bacterial Gene Expression. In: Poindexter J.S., Leadbetter E.R. (eds) Bacteria in Nature. ... Belfort, M., 1980, The cll-independent expression of the phage λ intgene in RNase III-defective E. coli, Gene 11: 149 - 155. ... It presents the cell with the signals that ultimately lead to gene regulation-the turning on or off of gene expression. ...
... 19.10.2016. Borrowing and tweaking bacterial genes to Enhance electrical activity ... Further reports about: , bacterial genes , cardiac , electrical signals , gene therapy , human cells , sodium , sodium channels ... bacterial genes »cardiac »electrical signals »gene therapy »human cells »sodium »sodium channels ... The researchers then delivered three genes to the electrically inactive cells: one bacterial gene for a sodium ion channel and ...
First, the genes arose via a horizontal gene transfer from a eukaryote, and second, that the bacterial tubulins are ancestral ... Here we report the presence of two tubulin-like genes [bacterial tubulin a (btuba) and bacterial tubulin b (btubb)] in bacteria ... The second hypothesis, that the bacterial tubulin genes are ancestral to eukaryotic tubulin genes, could be explained in terms ... Gene Expression and Organization.. The organization and expression of the P. dejongeii tubulin genes was investigated via gene ...
Replacement and amplification of bacterial genes with sequences altered in vitro. N I Gutterson and D E Koshland Jr ... Replacement and amplification of bacterial genes with sequences altered in vitro Message Subject (Your Name) has sent you a ... Using the method, we have constructed two chromosomal deletions in the chemotaxis gene region of S. typhimurium. In addition, ... the two most widely studied bacterial species. ... Replacement and amplification of bacterial genes with sequences ...
Bacterial gene swapping sparks disease outbreaks. University of Liverpool. Journal. Nature Communications. Keywords. * ... bacterial-gene-swapping-shown-to-spark-disease-outbreaks/. Related Journal Article. http://dx.. doi.. org/. 10.. 1038/. s41467- ... Bird genes are multitaskers, say scientists University of Sheffield * Cocaine addiction: Impact of genetic mutations elucidated ... Known as horizontal gene transfer, this phenomenon is understood to have played a role in developing the global antimicrobial ...
Gene behavior distinguishes viral from bacterial infections. New approach could gauge response to flu vaccine. ... CASING A CULPRIT Certain gene behavior changes in people can reveal whether an infection is caused by a virus, such as the H1N1 ... An infection changes the behavior of the afflicted persons genes, and that host response differs depending on whether bacteria ... A recount of human genes ups the number to at least 46,831 ... A recount of human genes ups the number to at least 46,831 ...
Bacterial genes tell the tale of an outbreaks evolution. 14.11.2011. Researchers at Harvard Medical School and Childrens ... "Parallel bacterial evolution within multiple patients identifies candidate pathogenicity genes," by Lieberman et al Harvard ... bacterial pathogens »genetic changes »health services »human body »immune system »specific gene »test tube ... bacterial pathogens , genetic changes , health services , human body , immune system , specific gene , test tube ...
An important gene in bacterial infection has been discovered by researchers at Osaka University use molecular-level analyses of ... The team used molecular evolutionary analysis of gene sequences to identify a gene that has been largely prevented from ... reflecting how tolerant to mutation each gene is," Shigetada Kawabata says. "We found that, in the gene cbpJ, over 13% of ... Quiz on Bacterial Infections. Bacteria the tiny single-celled organisms are responsible for a range of infections. Bacteria can ...
Accessing the Bacterial Polysaccharide Gene Database (BPGD). From here you can specify a search of the Bacterial Polysaccharide ... Gene Database. The results of the search will be returned as a "hit list". From the hit list you follow links to look at ...
Because gene expression within a cell population fluctuates randomly, investigators must monitor individual cells if they want ... Tracking bacterial gene expression with firefly luciferase. BioPhotonics. Mar 2008 Hank Hogan ... Yeung used the chemiluminescence technique to perform quantitative studies of gene expression in two bacterial lines. They ... The pores in bacterial cell walls are too small for the charged luciferin molecules to fit through. The pores can be enlarged ...
... Phytochemistry. Oct-Nov 2009;70(15-16):1812-21. doi: ... In this review we present the generation of a glycosyltransferase gene toolbox which contains more than 70 bacterial ...
Such bacterial modulation of host gene expression may be essential to sustain asymptomatic bacterial carriage by ensuring that ... Bacterial control of host gene expression through RNA polymerase II. Nataliya Lutay,1 Ines Ambite,1 Jenny Grönberg Hernandez,1 ... Gene expression in human uroepithelial cells infected with E. coli 83972 or CFT073. (A) Heatmap of genes sorted according to ... Statistics. For gene expression analysis, genes with empirical Bayes-adjusted P values less than 0.05 and log2 fold changes ...
Bacterial" by people in Harvard Catalyst Profiles by year, and whether "Genes, Bacterial" was a major or minor topic of these ... "Genes, Bacterial" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical Subject ... Below are the most recent publications written about "Genes, Bacterial" by people in Profiles. ... Below are MeSH descriptors whose meaning is more general than "Genes, Bacterial". ...
Analysis reveals key gene for bacterial infection. To successfully infect their hosts, bacteria need to evade the host immune ... Analyses of two bacterial strains in the Red Sea show they are enriched with gene clusters with potential to activate the ... Key gene find could enable development of disease-resistant crops. Discovery of a gene that helps plants control their response ... Research identifies mechanism that helps plants fight bacterial infection. A team led by a plant pathologist at the University ...
Simultaneous identification of bacterial virulence genes by negative selection. By M Hensel, JE Shea, C Gleeson, MD Jones, E ... Simultaneous identification of bacterial virulence genes by negative selection. By M Hensel, JE Shea, C Gleeson, MD Jones, E ... Simultaneous identification of bacterial virulence genes by negative selection Message Subject. (Your Name) has forwarded a ... system that uses transposons carrying unique DNA sequence tags was developed for the isolation of bacterial virulence genes. ...
The locations of bacterial colonies chosen for identification were labeled, and a small number of cells were directly added as ... To validate the process on microbes collected from and cultured aboard the ISS, bacterial cells were selected from a NASA ... Return of the contact slide to the ground allowed for standard laboratory processing for bacterial identification. The ... "Off Earth Identification of Bacterial Populations Using 16S rDNA Nanopore Sequencing." Genes 11, no. 1: 76. ...
Genes, an international, peer-reviewed Open Access journal. ... There were 42 bacterial phyla from 153 families detected in the ... Special Issue "Bacterial Genetics and Ecology Inspire the Biotechnology of an Evolving Global Economy". *Print Special Issue ... Genes 2012, 3(1), 1-18; doi:10.3390/genes3010001. Received: 2 November 2011 / Revised: 22 November 2011 / Accepted: 28 November ... Genes 2011, 2(4), 853-868; doi:10.3390/genes2040853. Received: 16 August 2011 / Revised: 23 September 2011 / Accepted: 20 ...
In addition, we discuss the temporal constraints in the evolution of bacterial genomes, considering bacterial evolution from ... gene acquisition and gene loss may have when bacteria colonize different habitats that present characteristic ecological ... the present article we review the differential contribution to the evolution of bacterial genomes that processes such as gene ... suggested that gene duplication and ulterior diversification of paralog genes play a much less important role in bacterial gene ...
... using bacterial gene frequencies. This method provides a test of neutrality for bacterial genes assayed using SSCP that is ... First, gene frequencies in a bacterial population most accurately reflect the relative abundance of bacterial strains existing ... It is therefore neither necessary nor proper to estimate bacterial gene frequencies from, for example, the number of gene ... Methods for Estimating Gene Frequencies and Detecting Selection in Bacterial Populations. Bruce Rannala, Wei-Gang Qiu and ...
Publications about Experts and Doctors on bacterial genes in Japan ... Identification of ecoRIM gene promoters and their upstream negative regulators in the ecoRIR gene. Gene. 2007;400:140-9 pubmed ... Gene. 1997;199:19-23 pubmed ..This mutant was found to be actively motile, suggesting that this gene is unlikely to be involved ... Gene. 1994;151:181-3 pubmed ..2-kb region which contains the gyrB gene, encoding the beta-subunit of gyrase from Mycoplasma ...
Direct Amplification of rRNA Genes in Diagnosis of Bacterial Infections. Kaisu Rantakokko-Jalava, Simo Nikkari, Jari Jalava, ... Direct Amplification of rRNA Genes in Diagnosis of Bacterial Infections. Kaisu Rantakokko-Jalava, Simo Nikkari, Jari Jalava, ... Direct Amplification of rRNA Genes in Diagnosis of Bacterial Infections. Kaisu Rantakokko-Jalava, Simo Nikkari, Jari Jalava, ... A broad-range bacterial PCR targeting rRNA genes (rDNAs) was used to directly analyze 536 clinical samples obtained from 459 ...
The method is based on the conditional replication of derivatives of the lactococcal plasmid pWV01, which lacks the repA gene ... A general system is described that facilitates gene replacements such that the recombinant strains are not labelled with ... A general system for generating unlabelled gene replacements in bacterial chromosomes Mol Gen Genet. 1996 Nov 27;253(1-2):217- ... The results indicate that the method should be applicable to any non-essential gene in numerous bacterial species. ...
  • We identify 152 gene exchange networks containing 22,963 bacterial genomes. (nature.com)
  • Analysis of ARG-surrounding sequences identify genes encoding putative mobilisation elements such as transposases and integrases that may be involved in gene transfer between genomes. (nature.com)
  • Mapping recent gene transfers across ~2700 genomes found overlapping ecological habitats to be a major factor in shaping HGT among microbes 12 . (nature.com)
  • Analysis of mobile ARGs and their neighbouring mobilisation elements across 23,425 genomes found that phylogeny is another major variable shaping networks for resistance gene transfer 13 . (nature.com)
  • Bacterial genomes are known to harbor pseudogenes. (genetics.org)
  • For instance, in plant mitochondrial genomes, which have an α-proteobacterial ancestry, most, if not all, of the laterally transferred genes are pseudogenes ( R ichardson and P almer 2007 ). (genetics.org)
  • and most of them are transient in bacterial genomes ( L erat and O chman 2005 ). (genetics.org)
  • reported that genomes with truncated homologs might erroneously lead to false inferences of "gene gain" rather than multiple instances of "gene loss. (genetics.org)
  • The team set out to sequence the genomes of 112 B. dolosa isolates taken from 14 of the infected patients, mapping genetic changes over time to reveal both the route of the infection's spread and which genes faced the greatest selective pressure - in other words, how the bacteria evolved when challenged by human defenses and medical treatment. (innovations-report.com)
  • In the present article we review the differential contribution to the evolution of bacterial genomes that processes such as gene modification, gene acquisition and gene loss may have when bacteria colonize different habitats that present characteristic ecological features. (mdpi.com)
  • In addition, we discuss the temporal constraints in the evolution of bacterial genomes, considering bacterial evolution from the perspective of processes of short-sighted evolution and punctual acquisition of evolutionary novelties followed by long stasis periods. (mdpi.com)
  • Inadvertently incorporated into the genomes of their edited mouse cells they found DNA from the E.coli genome (a bacterium) and from the cow genome, along with goat DNA.The researchers traced this adventitious presence to contaminants of standard components of the gene-editing process, such as cell culture media. (biofuelsdigest.com)
  • The correct taxonomic assignment of bacterial genomes is a primary and challenging task. (biomedcentral.com)
  • In this study, we have proposed a comprehensive method which uses the taxon-specific genes for the correct taxonomic assignment of existing and new bacterial genomes. (biomedcentral.com)
  • The taxon-specific genes identified at each taxonomic rank have been successfully used for the taxonomic classification of 2,342 genomes present in the NCBI genomes, 36 newly sequenced genomes, and 17 genomes for which the complete taxonomy is not yet known. (biomedcentral.com)
  • This approach has been implemented for the development of a tool 'Microtaxi' which can be used for the taxonomic assignment of complete bacterial genomes. (biomedcentral.com)
  • The taxon-specific gene based approach provides an alternate valuable methodology to carry out the taxonomic classification of newly sequenced or existing bacterial genomes. (biomedcentral.com)
  • However, genomes harbor two very different categories of genes: those genes present in a majority of organisms - persistent genes - and those present in very few organisms - rare genes. (biomedcentral.com)
  • We show that two classes of genes are significantly clustered in bacterial genomes: the highly persistent and the rare genes. (biomedcentral.com)
  • Yet, genes persistently present in bacterial genomes are also clustered and we try to understand why. (biomedcentral.com)
  • We show that the strong selective pressure acting on the function of persistent genes, in a permanent state of flux of genes in bacterial genomes, maintaining their size fairly constant, that drives persistent genes clustering. (biomedcentral.com)
  • The availability of a rapidly increasing number of completely sequenced bacterial genomes makes it possible to explore gene order conservation in related and distant species. (biomedcentral.com)
  • Hypotheses accounting for the clustering of genes in genomes basically break into three main categories. (biomedcentral.com)
  • It mainly concerned developing a program that reads in the sequences of all genes present on a specified set of bacterial genomes and then creates clusters of related genes. (sharcnet.ca)
  • The broadened scope of sequenced bacterial genomes to include also free-living and environmental species provided a larger sample to analyze the bacterial SET domain genes. (unl.edu)
  • Trying to reconstruct the core of the protein-coding gene set for a hypothetical minimal bacterial cell, we have performed a computational comparative analysis of eight bacterial genomes. (asm.org)
  • The available data from several systematic experimental approaches to define all the essential genes in some completely sequenced bacterial genomes were also considered, and a reconstruction of a minimal metabolic machinery necessary to sustain life was carried out. (asm.org)
  • Comparative genomics shows that most bacterial proteins are highly conserved in evolution, allowing predictions to be made about the functions of most products of uncharacterized genomes based on model organisms, such as Escherichia coli and Bacillus subtilis (gram-positive and gram-negative bacteria, respectively), for which abundant high-quality genetic and biochemical information has been obtained in the past. (asm.org)
  • Although bacterial genomes differ vastly in their sizes and gene repertoires, no matter how small, they must contain all the information to allow the cell to perform many essential (housekeeping) functions that give the cell the ability to maintain metabolic homeostasis, reproduce, and evolve, the three main properties of living cells ( 53 ). (asm.org)
  • Reconstruction of the minimal gene set can take advantage of the increasing knowledge of completely characterized genomes. (asm.org)
  • We analyze hundreds of bacterial genomes and find that the coding sequences of highly expressed genes systematically contain fewer SD sequences than expected, yielding a robust correlation between the normalized occurrence of SD sites and protein abundances across a range of bacterial taxa. (g3journal.org)
  • Among the latter, virulence genes and genes encoding the bacterial cell wall elements have been prone to serial gene deletions, as evidenced in insect endosymbiont genomes sequenced so far ( 1 , 15 , 34 ). (pubmedcentralcanada.ca)
  • They speculated that bacterial effector proteins transferred to target cells via Type VI secretion systems might be especially effectively maintained in eukaryotic genomes. (evmedreview.com)
  • ARG-ANNOT (Antibiotic Resistance Gene-ANNOTation) is a new bioinformatic tool that was created to detect existing and putative new antibiotic resistance (AR) genes in bacterial genomes. (asm.org)
  • Finally, the analysis of 178 Acinetobacter baumannii and 20 Staphylococcus aureus genomes allowed the detection of a significantly higher number of AR genes than the Resfinder gene analyzer and 11 point mutations in target genes known to be associated with AR. (asm.org)
  • We have created a concise database for BLAST using a Bio-Edit interface that can detect AR genetic determinants in bacterial genomes and can rapidly and easily discover putative new AR genetic determinants. (asm.org)
  • Next-generation sequencing technologies have greatly reduced the cost for sequencing bacterial genomes and metagenomes and have increased the likelihood of rapid whole-bacterial-genome sequencing in clinical microbiology laboratories ( 1 ). (asm.org)
  • An exponential increase in genome releases has occurred as more and more bacterial genomes are sequenced in a short time span. (asm.org)
  • Moreover, because released sequences are not always complete sequences (for both bacterial genomes and metagenomes), sequence analysis and annotation should be performed on contigs or short sequences to detect putative functions, especially for AR genes. (asm.org)
  • Background: Lateral Gene Transfer (LGT) has recently gained recognition as an important contributor to some eukaryote proteomes, but the mechanisms of acquisition and fixation in eukaryotic genomes are still uncertain. (diva-portal.org)
  • Despite a remarkable success in the computational prediction of genes in Bacteria and Archaea, a lack of comprehensive understanding of prokaryotic gene structures prevents from further elucidation of differences among genomes. (biomedcentral.com)
  • It continues to be interesting to develop new ab initio algorithms which not only accurately predict genes, but also facilitate comparative studies of prokaryotic genomes. (biomedcentral.com)
  • In particular, MED 2.0 is shown to reveal divergent translation initiation mechanisms in archaeal genomes while making a more accurate prediction of TISs compared to the existing gene finders and the current GenBank annotation. (biomedcentral.com)
  • The final result of conjugation, transduction, and/or transformation is the production of genetic recombinants, individuals that carry not only the genes they inherited from their parent cells but also the genes introduced to their genomes by conjugation, transduction, and/or transformation. (wikipedia.org)
  • The Glimmer gene-finding software has been successfully used for finding genes in bacteria, archaea and viruses representing hundreds of species. (nih.gov)
  • The new methods dramatically reduce the rate of false-positive predictions, while maintaining Glimmer's 99% sensitivity rate at detecting genes in most species, and they find substantially more correct start sites, as measured by comparisons to known and well-curated genes. (nih.gov)
  • GSIII genes have been found in only a few bacterial species. (springer.com)
  • In order to study the evolution of GS, we cloned and sequenced GSI genes from two divergent archaeal species: the extreme thermophile Pyrococcus furiosus and the extreme halophile Haloferax volcanii . (springer.com)
  • We suspect that the similarity of GSI-α genes from Euryarchaeota and several bacterial species does not reflect a common phylogeny but rather lateral transmission between archaea and bacteria. (springer.com)
  • There's a large pool of bacterial species whose sodium channels might have slightly different electrical characteristics to draw from," said Nguyen. (eurekalert.org)
  • This method is of general use since there are a number of suitable vectors and polA strains are available in both Escherichia coli and Salmonella typhimurium, the two most widely studied bacterial species. (pnas.org)
  • Methods of allele frequency analysis developed for use in studies of animal and plant populations are, in principle, applicable to bacterial species as well. (genetics.org)
  • Using molecular typing methods it is now also possible to survey the genetic variation of a bacterial species in its natural environment. (genetics.org)
  • The results indicate that the method should be applicable to any non-essential gene in numerous bacterial species. (nih.gov)
  • RESULTS: In this paper, we present a versatile tool to extract all syntenies from multiple bacterial species based on a clear-cut and very flexible definition of the synteny blocks that allows for gene quorum, partial gene correspondence, gaps, and a partial or total conservation of the gene order. (inria.fr)
  • The discovery suggests not only that edited organisms may acquire random foreign DNA, but that present methods of gene-editing can transmit genetic elements, viruses, and other pathogenic agents between species. (biofuelsdigest.com)
  • Horizontal gene transfer in bacteria can occur between organisms of the same or different species via one of three mechanisms: conjugation, transduction, or transformation ( 7 ). (asm.org)
  • Natural competence and transformation have not been observed to occur in many bacterial species, including Escherichia coli . (asm.org)
  • More than 700 types of bacterial species have been detected in the oral cavity, and some have been identified to play a significant role in the development of oral disease. (clinicaltrials.gov)
  • The MocR regulators are widespread among eubacteria [ 2 , 4 ] and can occur within different species as single orthologous or multiple paralogous genes. (hindawi.com)
  • To demonstrate the effectiveness of RNA later at preserving RNA in intact bacteria, samples from five bacterial species, Escherichia coli, Pseudomonas aeruginosa, Campylobacter fetus, Bacillus subtilis and Staphylococcus aureus, were suspended in RNAlater and incubated at 25°C or 4°C for up to one week. (thermofisher.com)
  • The spread of antimicrobial resistance, both within bacteria species and between species, is greatly accelerated by the process of horizontal gene-transfer. (europa.eu)
  • However, studies examining the effect of macrolactin on both the soil bacterial community and the intrinsic bacterial species that harbor genes responsible for the production of this antibiotic have not been conducted so far. (frontiersin.org)
  • Moreover, the populations of the intrinsic bacterial species which harbor genes responsible for macrolactin production were inhibited when the external source antibiotic was applied. (frontiersin.org)
  • Agrobacterium tumefaciens , which causes tumorigenic diseases in many plant species, requires a Ca 2+ -dependent adhesin ( 35 ), a repertoire of proteins encoded by att genes ( 22 , 23 ), exo- and capsular polysaccharides ( 30 ), and cellulose fibrils ( 21 , 22 ) to attach to roots. (asm.org)
  • Several computational approaches have been proposed for the taxonomic assignment of bacterial species. (biomedcentral.com)
  • Mapping Heat Resistance in Yeasts In a proof-of-concept study, researchers demonstrated that a new genetic mapping strategy called RH-Seq can identify genes that promote heat resistance in the yeast Saccharomyces cerevisiae, allowing this species to grow better than its closest relative S. paradoxus at high temperatures. (doe.gov)
  • First Monoploid Reference Sequence of Sugarcane For the highly polyploid sugarcane, an international team of researchers has successfully assembled a first monoploid reference sequence using a targeted approach that focused on the gene rich part of the genome by harnessing information from a sequenced related species - sorghum. (doe.gov)
  • Complete genome sequences are becoming available for a large number of diverse bacterial species. (asm.org)
  • Of the four tae genes found in bacterial species, three have been transferred to one or another eukaryotic genome. (evmedreview.com)
  • Third, the authors acquired evidence for expression of the dae genes in a species of ameba. (evmedreview.com)
  • They also found previously published evidence for dae gene expression in a species of lancelet, a small marine organism. (evmedreview.com)
  • Fourth, several examples of eukaryotic Dae proteins from tick, ameba, and lancelet species were tested for the ability to enzymatically degrade peptidoglycan, a major component in bacterial cell walls. (evmedreview.com)
  • did not find any evidence for transfer of bacterial housekeeping amidases to eukaryotic species. (evmedreview.com)
  • Conjugative plasmids are the principal genetic elements mediating the horizontal transfer of genes, both within and between bacterial species. (whiterose.ac.uk)
  • In some species, plasmids are unstable and likely to be lost through purifying selection, but when alternative hosts are available, interspecific plasmid transfer could counteract this and maintain access to plasmid-borne genes. (whiterose.ac.uk)
  • Interspecific transfer allows plasmid survival in host species unable to sustain the plasmid in monoculture, promoting community-wide access to the plasmid-borne accessory gene pool and thus potentiating future evolvability. (whiterose.ac.uk)
  • The ability to undergo natural transformation is present in at least 67 bacterial species. (wikipedia.org)
  • Natural transformation is common among pathogenic bacterial species. (wikipedia.org)
  • Numerous sRNAs have been identified using both computational analysis and laboratory-based techniques such as Northern blotting, microarrays and RNA-Seq in a number of bacterial species including Escherichia coli, the model pathogen Salmonella, the nitrogen-fixing alphaproteobacterium Sinorhizobium meliloti, marine cyanobacteria, Francisella tularensis (the causative agent of tularaemia), Streptococcus pyogenes, the pathogen Staphylococcus aureus, and the plant pathogen Xanthomonas oryzae pathovar oryzae. (wikipedia.org)
  • When a phage transfers virulence genes to an avirulent bacterium, the bacterium can acquire the ability to cause disease. (hindawi.com)
  • These virulence genes are responsible for many of the symptoms associated with the human disease [ 1 - 3 ]. (hindawi.com)
  • If a phage encodes virulence genes, such as exotoxin genes, the phage could facilitate the transfer of these genes to nontoxigenic bacterial hosts, thereby increasing the exotoxin gene pool. (hindawi.com)
  • An environmental reservoir of toxin genes would provide novel virulence genes, and the genetic exchange between phage and novel bacterial hosts, could provide the mechanism for evolution of novel human pathogens. (hindawi.com)
  • An insertional mutagenesis system that uses transposons carrying unique DNA sequence tags was developed for the isolation of bacterial virulence genes. (sciencemag.org)
  • This approach resulted in the identification of new virulence genes, some of which are related to, but functionally distinct from, the inv/spa family of S. typhimurium. (sciencemag.org)
  • Mutations in all ivi (in vivo-induced) genes that were tested conferred a defect in virulence. (sciencemag.org)
  • Horizontal gene-transfer is a mechanism by which bacteria incorporate genetic elements obtained from other organisms into their own chromosome, and plays a major role in spreading virulence genes and antimicrobial-resistance genes. (europa.eu)
  • Understanding the mechanism by which NAPs silence the expression of genetic material may facilitate the development of medication with the specific aim of repressing or reverting antimicrobial resistance and virulence gene expression in bacteria. (europa.eu)
  • However, many E . coli strains that severely infected the mouse models were missing these virulence genes, and some of these strains outcompeted those with high numbers of the genes. (broadinstitute.org)
  • These results reveal that S. enterica genes important for virulence in animal systems are also required for colonization of plants, a secondary host that can serve as a vector of S. enterica from animal to animal. (asm.org)
  • Bacterial attachment to plants has predominantly been studied for its role in virulence of plant pathogens. (asm.org)
  • Identifying a novel mechanism, here we demonstrate that bacteria use the universal communication molecule AI-2 to induce virulence genes and transfer them via phage release. (uni-muenchen.de)
  • Both AI-2 and ciprofloxacin lead to phage release, indicating that conditions in the gastrointestinal tract of hospitalized patients treated with antibiotics might lead to distribution of virulence genes to apathogenic enterococci and possibly also to other commensals or even to beneficial probiotic strains. (uni-muenchen.de)
  • The mechanisms used by bacterial pathogens to regulate the expression of their genes, especially their virulence genes, have been the subject of intense investigation for several decades. (clinsci.org)
  • Themes that have emerged include the importance of horizontal gene transfer to the evolution of pathogens, the need to impose regulatory discipline upon these imported genes and the important roles played by factors normally associated with the organization of genome architecture as regulatory principles in the control of virulence gene expression. (clinsci.org)
  • Together with the previously described high induction level of endosymbiont virulence genes at the nymphal phase (C. Dale, G. R. Plague, B. Wang, H. Ochman, and N. A. Moran, Proc. (pubmedcentralcanada.ca)
  • 12397-12402, 2002), these findings indicate that insect mutualistic relationships evolve through an interplay between bacterial virulence and host immune defense and that the host immunity engages the PGRP gene family in that interplay. (pubmedcentralcanada.ca)
  • Information on resistance genes can be found in the virulence section of an annotated genome or can be extracted manually from the generated Excel file using specific key words. (asm.org)
  • In this review, we focus our attention on the roles of DNA methylation in regulating bacterial gene expression and virulence. (asm.org)
  • These methylases participate in cellular regulatory events, including those that control bacterial virulence, which are the primary focus of this review. (asm.org)
  • Bacterial sRNAs affect how genes are expressed within bacterial cells via interaction with mRNA or protein, and thus can affect a variety of bacterial functions like metabolism, virulence, environmental stress response, and structure. (wikipedia.org)
  • The S. solfataricus GSI gene has a shorter GSI-β-type insertion, but like GSI-a-type genes, lacks conserved sequences about the adenylylation site. (springer.com)
  • Behrmann I, Hillemann D, Pühler A, Strauch E, Wohlleben W (1990) Overexpression of a Streptomyces viridochromogenes gene ( glnII ) encoding a glutamine synthetase similar to those of eucaryotes confers resistance against the antibiotic phosphinothricyl-alanylalanine. (springer.com)
  • Antibiotic resistance spreads among bacteria through horizontal transfer of antibiotic resistance genes (ARGs). (nature.com)
  • Indeed, ARGs in human pathogens are vastly outnumbered by the quantity of genes in environmental microbiomes that can confer antibiotic resistance in pathogens. (nature.com)
  • The findings found that English epidemics of these typically-rare pathogens were associated with resistance to the antibiotic azithromycin, and that many of the co-circulating Shigella strains carried the azithromycin resistance genes on the same plasmid. (eurekalert.org)
  • The HMS professor of systems biology studies bacterial evolution, exploring such questions as how antibiotic resistance arises. (innovations-report.com)
  • Clinically relevant mutations in core metabolic genes confer antibiotic resistance. (harvard.edu)
  • Mobilizable antibiotic resistance genes are present in dust microbial communities. (harvard.edu)
  • Both feral and domestic goats carried antibiotic resistance genes tet (O) and tet (W), but domestic goats additionally carried tet (Q). Diet, host genetics and antibiotic exposure are likely determinant factors in shaping the intestinal microbiota and may explain the differences observed between feral and domestic goats fecal microbiota. (mdpi.com)
  • A general system is described that facilitates gene replacements such that the recombinant strains are not labelled with antibiotic resistance genes. (nih.gov)
  • The introduction of effluent derived antibiotic resistance genes (ARGs) into aquatic environments is of concern in the spreading of genetic risk. (frontiersin.org)
  • Antibiotic resistance genes (ARGs) are found not only in the clinical but also the natural environment, which can eventually produce antibiotic resistant bacteria (ARB). (frontiersin.org)
  • Enteric (intestinal) bacteria in particular, have been identified as a reservoir for antibiotic resistant genes. (europa.eu)
  • I check for the gene knockout in 'centrimide+kan+amp' plate with PAO1 using the gene inserted suicide vector pFS100 and get no growth (showing the gene is essential) whereas the control plate without antibiotic markers show growth. (protocol-online.org)
  • After building a database that includes 1,689 antibiotic resistance genes, the software was tested in a blind manner using 100 random sequences selected from the database to verify that the sensitivity and specificity were at 100% even when partial sequences were queried. (asm.org)
  • RAST also provides little information about antibiotic resistance (AR) genes. (asm.org)
  • In contrast, bacteria also import genes in a process called homologous recombination, first discovered by the observation of mosaic genes at loci encoding antibiotic resistance. (wikipedia.org)
  • It is important to understand the role played by the phage that carry these genes in the evolution of pathogens. (hindawi.com)
  • Exotoxins are secreted polypeptides produced by certain bacterial pathogens. (hindawi.com)
  • Horizontal gene transfer between the phage and the bacterium can result in the rapid evolution of new pathogens and may have serious implications in public health [ 12 ]. (hindawi.com)
  • Horizontal gene transfer (HGT) has led to the evolution of resistant pathogens such as methicillin-resistant Staphylococcus aureus , extended spectrum β-lactamase-producing Enterobacteria, and vancomycin-resistant Enterococci 2 . (nature.com)
  • The ongoing acquisition of ARGs by human pathogens fuels interest in methods to predict dissemination of resistance genes. (nature.com)
  • Dr Kate Baker, from the University's Institute of Integrative Biology, said: "Through this study we've been able to show that horizontal gene transfer can rapidly facilitate new epidemics of important pathogens. (eurekalert.org)
  • Particularly relevant in this respect are the studies on the evolution of bacterial pathogens that produce long-lasting chronic infections. (mdpi.com)
  • Macrolactin produced by many soil microbes has been shown to be an efficient antibacterial agent against many bacterial pathogens. (frontiersin.org)
  • However, only one study has begun to address the fundamental questions of what allows animal bacterial pathogens to associate with plants initially and how they remain attached ( 14 ). (asm.org)
  • Using this approach, the team was able to broaden the recognition ability of a sensor protein that normally detects the bacterial pathogen Pseudomonas syringae to detect two different viral pathogens, turnip mosaic virus and tobacco etch virus, expanding the disease resistance of the plant. (isaaa.org)
  • Our approach may potentially enable better risk assessment of future resistance gene dissemination. (nature.com)
  • Strategies to identify candidates for future clinically relevant resistance genes include ranking ARGs based on the spectrum or clinical use of the antibiotics against, which they confer resistance or the presence of nearby mobilisation elements 17 . (nature.com)
  • Known as 'horizontal gene transfer', this phenomenon is understood to have played a role in developing the global antimicrobial resistance (AMR) crisis. (eurekalert.org)
  • The finding provides a novel target for drugs that could minimize the incidence of bacterial resistance. (medindia.net)
  • Novel Plasmid-Mediated tet(X5) Gene Conferring Resistance to Tigecycline, Eravacycline, and Omadacycline in a Clinical Acinetobacter baumannii Isolate. (harvard.edu)
  • In this study, we compared the structure of the fecal microbiota between feral and domestic goats using the G2 PhyloChip and assessed the presence of five tetracycline resistance genes [ tet (M), tet (S), tet (O), tet (Q) and tet (W)] by PCR. (mdpi.com)
  • Importantly, the results also show how the prohibition of the use of antibiotics as growth promotants in Denmark and France seems to have reduced the load of antibiotics resistance genes in the French and Danish pigs, but still, pigs in these countries harbour genes conferring resistance to a large number of antibiotics. (phys.org)
  • Near-isogenic lines of upland cotton ( Gossypium hirsutum ) carrying single, race-specific genes B 4 , B In , and b 7 for resistance to bacterial blight were used to develop a pyramid of lines with all possible combinations of two and three genes to learn whether the pyramid could achieve broad and high resistance approaching that of L. A. Brinkerhoff's exceptional line Im216. (apsnet.org)
  • malvacearum carrying single avirulence ( avr ) genes were used to identify plants carrying specific resistance ( B ) genes. (apsnet.org)
  • It was predicted that lines carrying two or three B genes would also exhibit higher resistance to race 1, which possesses many avr genes. (apsnet.org)
  • This study showed the prevalence of sulfonamide and tetracycline resistance genes, sul1, sul2, sul3 , and tet (M), in the total bacterial assemblage and colony forming bacterial assemblage in river and estuarine water and sewage treatment plants (STP) in South Africa. (frontiersin.org)
  • The rise of bacterial resistance to antimicrobial medication is a growing concern and each year an increasing number of hospitals report encountering bacteria resistant to all known antibiotics. (europa.eu)
  • The problem is i am using a suicide vector pFS100 a derivative of pGP704 carrying a 'pir' dependent origin of replication from plasmid R6K and gene encoding resistance to ampicillin and kanamycin but no sacB gene marker in it. (protocol-online.org)
  • However, the discovery in the 1970s of spiroplasmas, very small, thermostable, wall-less, helical-fibrillar bacteria that pass through 0.2-μm bacterial filters and show remarkable resistance to many common biocides including heat ( 47 ), provided a possible bacterial candidate for the infectious agent of TSEs. (asm.org)
  • Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom. (sigmaaldrich.com)
  • The prevalences of three sulfonamide resistance genes, sul1, sul2, and sul3 and sulfachloropyridazine (SCP) resistance were determined in bacteria isolated from manured agricultural clay soils and slurry samples in the United Kingdom over a 2-year period. (sigmaaldrich.com)
  • Indiana University scientists led by Roger Innes have modified a plant gene that normally fights bacterial infection to confer resistance to a virus. (isaaa.org)
  • Our data show that this novel, horizontally gene transferred copper resistance locus is associated with the SCCmec elements of USA300. (findaphd.com)
  • These genes are additional to existing core genome copper resistance mechanisms, and are not found in typical S. aureus lineages, but are increasingly identified in emerging pathogenic isolates. (findaphd.com)
  • Our hypothesis is that acquisition of copper hyper-resistance via horizontal gene transfer plays a crucial role in the emergence of S. aureus strains, and potentially other pathogenic bacteria, with increased infectivity conferred through their improved resistance to the copper-dependent killing mechanisms of the host's immune cells. (findaphd.com)
  • Multiple genes for heavy metal resistance have been identified in L. monocytogenes. (findaphd.com)
  • 2018 A horizontally gene transferred copper resistance locus confers hyper-resistance to antibacterial copper toxicity and enables survival of community acquired methicillin resistant Staphylococcus aureus USA300 in macrophages. (findaphd.com)
  • Bacterial superintegrons, a source of new genes with adaptive functions Ilyina, T. 2006-11-07 00:00:00 Data on the structural organization of the platform of integrons, gene cassettes, and integrons with integrated cassettes of genes encoding drug resistance are briefly summarized. (deepdyve.com)
  • Data obtained during recent years about superintegrons or chromosomal integrons, characteristics of their organization, the presence of genes with known adaptive and unidentified functions in them, as well as data on the differences between superintegrons and previously described multiple resistance integrons, are considered in more detail. (deepdyve.com)
  • Data on the structural organization of the platform of integrons, gene cassettes, and integrons with integrated cassettes of genes encoding drug resistance are briefly summarized. (deepdyve.com)
  • CRISPR-Cas9 gene drives to eradicate antimicrobial resistance from bacterial communities. (findaphd.com)
  • The most important resistance mechanisms are carried on plasmids, which are mobile DNA elements that can spread by horizontal gene transfer within bacterial populations. (findaphd.com)
  • This project "CRISPR-Cas9 gene drives to eradicate antimicrobial resistance from bacterial communities" will develop a recently discovered bacterial immune system called CRISPR-Cas to target and destroy mobile bacterial resistance plasmids. (findaphd.com)
  • A set of resistance-gene analog (RGA) sequences identified 121 RGA-containing BAC clones representing 20 different regions of the genome with an average of 6.1 clones per locus. (arizona.edu)
  • For example, bacterial recombination has been shown to promote the transfer of multi drug resistance genes via homologous recombination that goes beyond levels purely obtained by mutation. (wikipedia.org)
  • It presents the cell with the signals that ultimately lead to gene regulation-the turning on or off of gene expression. (springer.com)
  • In this study, we investigated the organization and expression of these genes and conducted a comparative analysis of the bacterial and eukaryotic protein sequences, focusing on their phylogeny and 3D structures. (pnas.org)
  • Because gene expression within a cell population fluctuates randomly, investigators must monitor individual cells if they want to follow the activity as genes switch on and off. (photonics.com)
  • Along with graduate student Yun Zhang and professor of veterinary medicine Gregory J. Phillips, Yeung used the chemiluminescence technique to perform quantitative studies of gene expression in two bacterial lines. (photonics.com)
  • Okada M, Matsuzaki H, Shibuya I, Matsumoto K. Cloning, sequencing, and expression in Escherichia coli of the Bacillus subtilis gene for phosphatidylserine synthase. (labome.org)
  • These regulators are involved in the expression of genes taking part in several metabolic pathways directly or indirectly connected to PLP chemistry, many of which are still uncharacterized. (hindawi.com)
  • To determine if storage of bacteria in RNA later affects gene expression patterns, we compared the expression profile obtained with RNA isolated from B. subtilis that had been stored overnight in RNA later at 25°C (Figure 2A) with the profile from RNA prepared from freshly harvested B. subtilis (Figure 2B). (thermofisher.com)
  • A comparison of these replicate arrays demonstrates that RNA later is extremely effective at preserving gene expression profiles in bacteria. (thermofisher.com)
  • Similar results were obtained when arrays were probed with RNA prepared from B. subtilis cells that were stored in RNA later for one week at 4°C. RNA later is thus an ideal solution for maintaining the expression profile of bacterial mRNA when immediate RNA isolation is not possible or practical. (thermofisher.com)
  • The expression level of a gene can fluctuate significantly between individuals within a population of genetically identical cells. (biochemsoctrans.org)
  • Noise is hence a genome-wide phenomenon that arises from the stochastic nature of the biochemical reactions that take place during gene expression and the relatively low abundance of the molecules involved. (biochemsoctrans.org)
  • Single-cell and single-molecule studies demonstrated that noise within gene expression is influenced by a combination of both intrinsic and extrinsic factors. (biochemsoctrans.org)
  • Gene Expression: 1. (biochemsoctrans.org)
  • In the search for a defining feature of the Escherichia coli that cause urinary tract infections, comparative transcriptomics and infection models show that infection depends on both the host environment and gene expression levels in the bacteria. (broadinstitute.org)
  • Further comparative genomic and transcriptomic analyses showed infection severity correlated with the expression levels of certain genes shared by nearly all E . coli , including genes involved in motility and nutrient utilization. (broadinstitute.org)
  • According to the researchers, sequence variations that affect gene expression, rather than protein-coding potential, appear to be key drivers of urovirulence. (broadinstitute.org)
  • But Storch and his colleagues at the university's Genome Institute and the Genome Technology Access Center wanted to know whether a test called a gene expression microarray could identify patterns of gene activity in white blood cells that could discriminate children with viral infections from those with bacterial infections. (healthcanal.com)
  • Using microarray technology, the researchers could easily distinguish bacterial infections from viral infections based on distinctive patterns of gene expression. (healthcanal.com)
  • That's really important for clinicians because if they see a pattern of gene expression that indicates a viral infection, they could feel comfortable not prescribing antibiotics," Storch added. (healthcanal.com)
  • Light of different wavelengths can serve as a transient, noninvasive means of regulating gene expression for biotechnological purposes. (diva-portal.org)
  • Fully genetically encoded light sensors take advantage of the favorable characteristics of light, do not need the supplementation of any chemical inducers or co-factors, and have been demonstrated to control gene expression in Escherichia coli. (diva-portal.org)
  • Herein, we review engineered light-sensor systems with potential for in vivo regulation of gene expression in bacteria, and highlight different means of extending the range of available light input and transcriptional output signals. (diva-portal.org)
  • Furthermore, we discuss advances in multiplexing different light sensors for achieving multichromatic control of gene expression and indicate developments that could facilitate the construction of efficient systems for light-regulated, multistate control of gene expression. (diva-portal.org)
  • Parts for controlling gene expression are of special importance in living systems, and specifically promoters are needed for enabling and simplifying rational design. (diva-portal.org)
  • In the second part of this research, gene expression during the growth of L. lactis MG1363 was monitored using DNA microarrays. (rug.nl)
  • A wide variety of mechanisms that control gene expression in bacteria are based on conditional transcription termination. (asm.org)
  • Flagellin activates proinflammatory gene expression in intestinal epithelia. (jimmunol.org)
  • Pathogenic Salmonella , but not commensal Escherichia coli , translocate flagellin across epithelia, thus activating epithelial proinflammatory gene expression. (jimmunol.org)
  • Investigating how epithelia detect flagellin revealed that cell surface expression of Toll-like receptor 5 (TLR5) conferred NF-κB gene expression in response to flagellin. (jimmunol.org)
  • Many of these microbes release molecules such as LPS, which has the potential of inducing proinflammatory gene expression if internal access to the host is gained. (jimmunol.org)
  • In contrast, the more recently recognized proinflammatory bacterial product (or pathogen-associated molecular pattern) flagellin is a potent activator of intestinal epithelial proinflammatory gene expression ( 3 , 5 , 6 ). (jimmunol.org)
  • 8 ) recently screened bacterial products for ability to activate TLR5 and found that flagellin could activate NF-κB-mediated gene expression in TLR5-transfected cells. (jimmunol.org)
  • The alkane hydroxylase ( alkB ) gene of Pseudomonas putida GPo1 was constructed in a pCom8 expression vector, and the pCom8-GPo1 alkB plasmid was transformed into Escherichia coli DH5α. (scielo.br)
  • The results suggested that the expression of the GPo1 gene in E. coli DH5α could enhance the function of diesel oil degradation by the bacterial consortium. (scielo.br)
  • Our study reveals that membrane vesicles from pathogenic and commensal bacteria have a global impact on the gene expression of colon-carcinoma cells. (uio.no)
  • The changes in gene expression correlate positively with both epigenetic changes and chromatin accessibility of promoters at transcription start sites of genes induced by both types of membrane vesicles. (uio.no)
  • Moreover, we have demonstrated that membrane vesicles obtained only from V. cholerae induced the expression of genes associated with epithelial cell differentiation. (uio.no)
  • The use of antisense RNA is limited to the genes for which an adequate expression of the inhibitory RNA can be obtained in the organism under study. (asm.org)
  • Addgene: Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. (addgene.org)
  • Furthermore, BGC representation and expression is linked to the abundance of particular oral bacterial taxa in health versus dental caries and periodontitis. (jcvi.org)
  • Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. (embopress.org)
  • Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. (embopress.org)
  • An experimental‐computational approach is applied to dissect the contribution of specific transcription factor‐mediated versus global growth‐dependent regulation to bacterial gene expression, and obtain a quantitative understanding of dynamic adaptations in arginine biosynthesis of E. coli . (embopress.org)
  • We present a model‐based approach to quantitatively dissect simultaneous contributions from specific transcription factors and the global growth status to bacterial gene expression, based on parameter inference from GFP‐based promoter activity measurements. (embopress.org)
  • We show that growth rate can be used to predict the unregulated expression baseline of a gene, since growth rate dependence of global regulation occurs both in steady state and during transient changes in growth rate. (embopress.org)
  • We obtain a quantitative understanding of both specific and global regulation in arginine biosynthesis, as demonstrated by accurate model‐based predictions of complex transient gene‐expression responses to simultaneous perturbation in growth rate and arginine availability. (embopress.org)
  • Whole genome sequencing projects, together with more targeted studies, have identified hundreds of DNA-binding proteins that contribute to the patterns of gene expression observed during infection as well as providing important insights into the nature of the gene products whose expression is being controlled by these proteins. (clinsci.org)
  • Of key importance, the authors show that decreasing expression of the dae2 gene in I. scapularis ticks is associated with higher loads of B. burgdorferi , suggesting, in conjunction with other evidence, that the Dae2 protein is used by the tick to control the load of spirochetes. (evmedreview.com)
  • The pattern of expression of the two genes was similar, with higher expression in leaves, rachises, and flowers and lower transcript levels in roots and siliques. (plantcell.org)
  • The researchers are seeking to develop a system for monitoring bacterial gene expression in response to signals from the natural environment using a blend of membrane diffusion cell, genomics and optical detection technologies. (stanford.edu)
  • Gene expression of the triggering receptor on myeloid cells ( TREM)-1 and G-coupled-protein receptor kinase ( GRK )-2 in PMNs isolated from patients was analysed to identify genes correlated with the severity of pathophysiological conditions. (medsci.org)
  • The gene expression levels of TREM1 in PMNs isolated from patients with bacterial infections may be used as a surrogate biomarker for determining the severity. (medsci.org)
  • MicF in E. coli was found to regulate the expression of a key structural gene that makes up the outer membrane of the E. coli cell. (wikipedia.org)
  • Alternately, sRNAs may interact with mRNA targets and regulate gene expression by binding to complementary mRNA and blocking translation, or by unmasking or blocking the ribosome-binding site. (wikipedia.org)
  • The morphology of active structural and putative ribosomal RNA genes was observed by electron microscopy after lysis of fragile Escherichia coli cells. (nih.gov)
  • This ORF contains the fructose bis-P aldolase gene in Escherichia coli (EG14062) and the current Ecogene verified start site is at position 1050, near the peak score. (nih.gov)
  • The bacterium Escherichia coli carries approximately 3000 genes, but this total repertoire describes its potential properties and, in reality, only a small subset of this genetic information is expressed at any given moment. (springer.com)
  • Kohno K, Wada M, Kano Y, Imamoto F. Promoters and autogenous control of the Escherichia coli hupA and hupB genes. (labome.org)
  • Shiozawa T, Ueguchi C, Mizuno T. The rpoD gene functions as a multicopy suppressor for mutations in the chaperones, CbpA, DnaJ and DnaK, in Escherichia coli. (labome.org)
  • Many exotoxin genes are carried on mobile genetic elements, including bacterial viruses (bacteriophage or phage). (hindawi.com)
  • As highly mobile genetic elements, phage can readily move between different environments, and are generally more resistant to environmental stress than their bacterial counterparts [ 4 - 11 ]. (hindawi.com)
  • Mobile genetic elements (MGEs) such as transposons and genes that encode enzymes that facilitate them such as integrases or recombinases often facilitate the initial mobilisation. (nature.com)
  • A team led by a plant pathologist at the University of California, Riverside, has identified a regulatory, genetic mechanism in plants that could help fight bacterial infection. (phys.org)
  • Recent breakthroughs in molecular technology, most significantly the polymerase chain reaction (PCR) and in situ hybridization, have allowed the detection of genetic variation in bacterial communities without prior cultivation. (genetics.org)
  • A genetic system was devised that positively selects for bacterial genes that are specifically induced when bacteria infect their host. (sciencemag.org)
  • This genetic system was designed to be of general use in a wide variety of bacterial-host systems and has several applications in both vaccine and antimicrobial drug development. (sciencemag.org)
  • A new discovery by researchers at Columbia University Vagelos College of Physicians and Surgeons could fix one of the major shortcomings of current gene-editing tools, including CRISPR, and offer a powerful new approach for genetic engineering and gene therapy. (biotechnews.com.au)
  • This makes gene editing difficult or impossible in some cell types, and severely constrains researchers' ability to introduce precise genetic modifications in a safe manner. (biotechnews.com.au)
  • This transposon has co-opted the bacterium's CRISPR-Cas system, normally used to thwart mobile genetic elements, to insert itself into different regions of the bacterial genome. (biotechnews.com.au)
  • Insights into Functional Diversity in Neurospora This proposal investigates the genetic bases of fungal thermophily, biomass-degradation, and fungal-bacterial interactions in Sordariales, an order of biomass-degrading fungi frequently encountered in compost and encompassing one of the few groups of thermophilic fungi. (doe.gov)
  • The presence of Supressor of variegation-Enhanser of zeste-Trithorax ( SET ) domain genes in bacteria is a current paradigm for lateral genetic exchange between eukaryotes and prokaryotes. (unl.edu)
  • The proposed minimal genome contains 206 protein-coding genes with all the genetic information necessary for self-maintenance and reproduction in the presence of a full complement of essential nutrients and in the absence of environmental stress. (asm.org)
  • Horizontal gene transfer rapidly changes bacterial genetic repertoire and contributes to bacterial evolution. (illinois.edu)
  • Bacterial recombination is a type of genetic recombination in bacteria characterized by DNA transfer from one organism called donor to another organism as recipient. (wikipedia.org)
  • Today, genetic exchange, or gene transfer is viewed as a major driving force in the evolution of prokaryotes. (wikipedia.org)
  • The cells undergo horizontal gene transfer in which the genetic material is transferred. (wikipedia.org)
  • Cis-acting sRNAs interact with genes encoded on the same genetic locus as the sRNA. (wikipedia.org)
  • With the pathogen Salmonella typhimurium, the genes identified by this selection show a marked induction in bacteria recovered from mouse spleen. (sciencemag.org)
  • I am trying to knockout a gene which is essential for growth of the pathogen Pseudomonas aeruginosa PAO1 (has no sacB gene in it). (protocol-online.org)
  • In some cases, the DNA repair capability provided by recombination during transformation facilitates survival of the infecting bacterial pathogen. (wikipedia.org)
  • Phylogenetic analyses indicate that the Prosthecobacter tubulins are quite divergent and do not support recent horizontal transfer of the genes from a eukaryote. (pnas.org)
  • Origin of the Bacterial SET Domain Genes: Vertical or Horizontal? (unl.edu)
  • Natural transformation, one mechanism of horizontal gene transfer, is defined as the process by which bacterial cells successfully take up and incorporate extracellular DNA. (illinois.edu)
  • The transfer of amidase-encoding genes from bacteria to eukaryotic organisms is not the first instance of such trans-kingdom horizontal gene transfer (HGT). (evmedreview.com)
  • Horizontal gene transfer is a fundamental process in bacterial evolution that can accelerate adaptation via the sharing of genes between lineages. (whiterose.ac.uk)
  • Researchers at Harvard Medical School and Children's Hospital Boston have retraced the evolution of an unusual bacterial infection as it spread among cystic fibrosis patients by sequencing scores of samples collected during the outbreak, since contained. (innovations-report.com)
  • Cystic fibrosis (CF) is a hereditary disease that renders the lungs susceptible to bacterial infection. (innovations-report.com)
  • An important gene in bacterial infection has been discovered by researchers at Osaka University use molecular-level analyses of evolution. (medindia.net)
  • Over the course of evolution, hosts--such as humans--develop increasingly sophisticated defenses against bacterial infection, while bacteria in turn develop new strategies to overcome these defenses in a biological arms race. (medindia.net)
  • The team used molecular evolutionary analysis of gene sequences to identify a gene that has been largely prevented from mutating into other variant forms, suggesting that it is essential for the infection and/or reproduction of this bacterium. (medindia.net)
  • Impetigo is a contagious bacterial skin infection mostly affecting children and is characterized by blister-like sores that could form pus and later scabs. (medindia.net)
  • A new study reveals that the multipotent stromal cells (MSCs) of persons with diabetes have diminished capacity to fight off bacterial infection, providing new understanding into the basis of diabetes-associated immune dysfunction. (phys.org)
  • Discovery of a gene that helps plants control their response to disease could aid efforts to develop crops that are resistant to infection, research suggests. (phys.org)
  • In this study, a maximum-likelihood estimator (MLE) of bacterial allele frequencies designed for use with presence-absence data is derived using an explicit stochastic model of the host infection (or bacterial sampling) process. (genetics.org)
  • The group where the gene for Toll2 was switched off, survived the bacterial infection," says Wiersinga. (infectioncontroltoday.com)
  • Because the concentration of scrapie infectivity was at a known high level, it is very unlikely that a bacterial infection at the same concentration could have escaped detection. (asm.org)
  • To better understand UTIs and potentially offer new therapeutic strategies, a team of researchers analyzed 43 strains of E . coli sampled from 14 women with recurrent UTIs, and found that infection depends on both individual host susceptibility and how the bacteria express their genes. (broadinstitute.org)
  • The very active genes tell us that an infection is making a patient sick, while quiet genes tell us either there's no infection or maybe a bacterium or virus is there, but it's not causing fever or illness. (healthcanal.com)
  • The Staphylococcus enterotoxin A ( sea ) gene carried by virulent strains of S. aureus is encoded by multiple phages, including ϕ 11, ϕ 12, ϕ 13, 80 α , and 42D [ 18 - 21 ]. (hindawi.com)
  • Bacterial Strains and Culture. (pnas.org)
  • Among the characterized genes were strains with insertions in the intergenic region between agfB , the surface-exposed aggregative fimbria (curli) nucleator, and agfD , a transcriptional regulator of the LuxR superfamily, and rpoS , the stationary-phase sigma factor. (asm.org)
  • The intent of the present study was to identify genes required for attachment of S. enterica serovar Newport to plant tissue. (asm.org)
  • One of the ways John Roth influenced many scientists was through teaching the Cold Spring Harbor Advanced Bacterial Genetics course. (asmscience.org)
  • Since its inception, the Phage course and subsequently the Advanced Bacterial Genetics course have trained many of the leaders in these fields. (asmscience.org)
  • In 1950 Milislav Demerec began an offshoot of the Phage course that emphasized bacterial genetics. (asmscience.org)
  • When both were consecutively taught, the Bacterial Genetics course immediately followed the Phage course, and many students took the two courses sequentially to obtain training in both phage and bacterial genetics. (asmscience.org)
  • Over time many of the concepts and techniques from the Phage course were integrated into the Bacterial Genetics course until the two courses merged into a single course in 1971. (asmscience.org)
  • A lab manual was published, which emphasized how genetics can be used to study pathogenic bacteria, a growing field with a dramatic need for researchers trained in bacterial genetics. (asmscience.org)
  • In Maloy S, Hughes K, Casadesús J (ed), The Lure of Bacterial Genetics . (asmscience.org)
  • 1980. Advanced Bacterial Genetics. (asmscience.org)
  • However, the dynamics of AMR transfer through bacterial populations and its direct impact on human disease is poorly understood. (eurekalert.org)
  • In a growth chamber, bacterial populations attained by race 1 in and on leaves of the pyramid lines decreased significantly with increasing number of B genes in only one of four experiments. (apsnet.org)
  • The older lines, Im216 and AcHR, exhibited considerably lower bacterial populations than any of the one-, two-, or three- B -gene lines. (apsnet.org)
  • Studies that provide evidence for translocations of gene cassettes from stationary chromosomal integrons into integrons associated with mobile elements resulting in gene flows in natural bacterial populations, which favors their survival and adaptation to changing environment, are also reviewed. (deepdyve.com)
  • First, the student will use mathematical modelling to generate predictions when mobile CRISPR-Cas9 can remove AMR genes from bacterial populations. (findaphd.com)
  • Gene clustering plays an important role in the organization of the bacterial chromosome and several mechanisms have been proposed to explain its extent. (biomedcentral.com)
  • During this process, genes within batches coding for coupled functions will have a higher chance of increasing the organism fitness, and thus their own, than uncoupled genes, which would require pre-existence of the interacting partners in the chromosome. (biomedcentral.com)
  • Examples : Integration of bacteriophage DNA into host bacterial chromosome Immunoglobulin and T Cell Receptor genes DNA rearrangements via Transposition involves the movement of sequences throughout the genome and has no requirement for sequence homology. (coursehero.com)
  • A previously defined norm for LGTs in microbial eukaryotes states that the majority are genes involved in metabolism, the LGTs are typically localized one by one, surrounded by vertically inherited genes on the chromosome, and phylogenetics shows that a broad collection of bacterial lineages have contributed to the transferome. (diva-portal.org)
  • To develop the resources for positional cloning and structural genomic analyses in barley, we constructed a bacterial artificial chromosome (BAC) library for the cultivar Morex using the cloning enzyme HindIII. (arizona.edu)
  • Genes for GSI have been found only in bacteria (eubacteria) and archaea (archaebacteria), while GSII genes only occur in eukaryotes and a few soil-dwelling bacteria. (springer.com)
  • By phylogenetic analysis, examination of individual chromosomal regions for signs of insertion, and evaluating the chromosomal versus SET domain genes' GC contents, we provide evidence that SET domain genes have existed in the bacterial domain of life independently of eukaryotes. (unl.edu)
  • The eukaryotes cited above all have "domesticated amidase effectors" ( dae ) genes, all of which are extremely similar to one of the four extant bacterial tae genes. (evmedreview.com)
  • Homologs of these E. coli genes are present in many members of the γ subclass of Proteobacteria , suggesting that the mechanisms for consumption of DNA may have been widely conserved during evolution. (asm.org)
  • Previous studies of UPEC have identified genes believed to give E . coli a potent ability to colonize the bladder. (broadinstitute.org)
  • The culture of the recombinant (pCom8-GPo1 alkB/E. coli DH5α) with the oil biodegradation bacterial consortium increased the degradation ratio of diesel oil at 24 h from 31% to 50%, and the facilitation rates were increased as the proportion of pCom8-GPo1 alkB / E. coli DH5α to the consortium increased. (scielo.br)
  • Since a Dae2 mutant without amidase activity was not lytic against permeabilized E. coli and Bacillus subtilis (for which peptidoglycan is accessible on the cell surface even without permeabilization), the authors concluded that Dae2 is effective as an anti-bacterial agent by virtue of amidase activity. (evmedreview.com)
  • The RpoS gene in E. coli encodes sigma 38, a sigma factor which regulates stress response and acts as a transcriptional regulator for many genes involved in cell adaptation. (wikipedia.org)
  • The mutated gene showed high homology with a putative competence gene in H. influenzae . (asm.org)
  • One exception is ERS (for e thylene r esponse s ensor), a member of the Arabidopsis ETR gene family, which is comprised solely of a histidine kinase and a putative ethylene binding domain. (plantcell.org)
  • On the basis of these observations, we searched the partially sequenced genome of a free-living member of the Verrucomicrobia, Prosthecobacter dejongeii , for genes homologous to those for tubulin. (pnas.org)
  • The MocR bacterial transcriptional regulators are characterized by an N-terminal domain, 60 residues long on average, possessing the winged-helix-turn-helix (wHTH) architecture responsible for DNA recognition and binding, linked to a large C-terminal domain (350 residues on average) that is homologous to fold type-I pyridoxal 5′-phosphate (PLP) dependent enzymes like aspartate aminotransferase (AAT). (hindawi.com)
  • A bioinformatics analysis is here reported that studied the features of a distinct group of MocR regulators predicted to be functionally linked to a family of homologous genes coding for integral membrane proteins of unknown function. (hindawi.com)
  • After 70 PCR cycles, nearly all samples yielded amplified products which were homologous to various bacterial 16S rRNA gene sequences, including those of frequent environmental contaminants. (asm.org)
  • The discovery of homologous recombination has made an impact on the understanding of bacterial evolution. (wikipedia.org)
  • The members of the GntR family of bacterial transcriptional regulators are characterized by the presence of two domains [ 1 ]. (hindawi.com)
  • Implementation of advanced gene regulatory circuits will require orthogonal transcriptional systems that can be simultaneously controlled and that can produce several different control states. (diva-portal.org)
  • We thereby uncover two principles of joint regulation: (i) specific regulation by repression dominates the transcriptional response during metabolic steady states, largely repressing the biosynthesis genes even when biosynthesis is required and (ii) global regulation sets the maximum promoter activity that is exploited during the transition between steady states. (embopress.org)
  • A joint Bayesian analysis enabled clustering of genes into patterns of shared transcriptional response across treatments. (g3journal.org)
  • Pathways such as mTOR signaling, EIF2 signaling, IL-8 signaling, and Tec Kinase signaling were enriched among genes with opposite transcriptional responses to 1,25D and LPS, respectively, highlighting the important roles of these pathways in mediating the immunomodulatory activity of 1,25D. (g3journal.org)
  • Furthermore, a subset of genes with evidence of interethnic differences in transcriptional response was also identified, suggesting that in addition to the well-established interethnic variation in circulating levels of vitamin D, the intensity of transcriptional response to 1,25D and LPS also varies between ethnic groups. (g3journal.org)
  • In this study, we focused on characterizing the transcriptional response to 1,25D in primary monocytes in the presence or absence of a proinflammatory stimulus, bacterial lipopolysaccharide (LPS). (g3journal.org)
  • Gene truncation or gene pseudogenization also plays an important role in shaping bacterial genome content. (genetics.org)
  • In this work, reported in the journal Communications Biology, the team focused on genes encoding proteins called choline-binding proteins (CBPs), which are present on the bacterial cell surface and interact with the host's immune system. (medindia.net)
  • These findings suggest that the signals for the actions of HU proteins are located in the DNA regions upstream from the sites near the 5' extremities of the coding regions of the hupB and hupA genes. (labome.org)
  • To protect themselves from foreign (Xenogeneic) DNA, bacteria have developed an immune system based on proteins that bind to the bacterial DNA, the nucleoid: nucleoid associated proteins (NAPs). (europa.eu)
  • Because a major function of SET domain proteins is the chemical modification of chromatin and bacteria do not have chromatin, there is no apparent functional requirement for the existence of bacterial SET domain genes. (unl.edu)
  • If the proteins Dae lacked such secretion signals, it might be more plausible to argue that the genes may have bacterial origins but were not functional in their new eukaryotic hosts. (evmedreview.com)
  • Flagellin, the structural component of bacterial flagella, is secreted by pathogenic and commensal bacteria. (jimmunol.org)
  • Consequently, their finding in only a small fraction of pathogenic and symbiotic bacteria was taken as evidence that bacteria have obtained the SET domain genes from their hosts. (unl.edu)
  • Initial finding of SET domain genes in predominantly pathogenic and symbiotic bacteria resulted, most probably, from a biased sample. (unl.edu)
  • Gene Atlases of Grass-Microbe Interactions This proposal seeks to build comprehensive gene atlas maps for diverse bioenergy grass-microbe interactions, including pathogenic and beneficial interactions in two grass models, Brachypodium and Setaria. (doe.gov)
  • These studies provide a fundamental understanding of the mechanisms and networks driving ARG dissemination including some of the barriers to gene dissemination. (nature.com)
  • Therefore, studies on bacterial evolution are of increasing interest to understand the basic mechanisms of evolution. (mdpi.com)
  • We've defined one of the first genes and mechanisms through which mycobacteria form biofilms," said Hatfull. (bio-medicine.org)
  • Generally, in these mechanisms, a transcription terminator is located between a promoter and a downstream gene(s), and the efficiency of the terminator is controlled by a regulatory effector that can be a metabolite, protein, or RNA. (asm.org)
  • However, the controversies raised about the validity of each of these mechanisms remind us that the cause of this gene organization remains an open question. (biomedcentral.com)
  • Bacterial sRNAs have a wide variety of regulatory mechanisms. (wikipedia.org)
  • Arai H, Igarashi Y, Kodama T. The structural genes for nitric oxide reductase from Pseudomonas aeruginosa. (labome.org)
  • The best current tool, built with components from one kind of bacterial CRISPR-Cas system, cuts both strands of the DNA molecule at a specific sequence, like adding a paragraph break to a block of text. (biotechnews.com.au)
  • To find new gene-editing tools, Sternberg and three graduate students looked to bacteria to find variations of well-studied CRISPR-Cas systems with unusual properties that would reveal new tool capabilities. (biotechnews.com.au)
  • However, a lateral transfer of SET domain genes may have occurred between some bacteria and a family of Archaea. (unl.edu)
  • Although not a primary purpose, the model incorporating truncated genes could be potentially used for phylogeny reconstruction using gene family content. (genetics.org)
  • Human fibroblasts, from a patient with congenital lack of α- D -galactose-1-phosphate uridyl transferase activity, have been infected with transducing bacteriophage that harbours either wild type or defective transferase gene. (nature.com)
  • Transduction is associated with viral-mediated vectors transferring DNA material from one bacterium to another within the genome.Bacterial DNA is placed into the bacteriophage genome via bacterial transduction. (wikipedia.org)
  • Bozouklian H, Elmerich C (1986) Nucleotide sequence of the AzospirMum brasilense Sp7 glutamine synthetase structural gene. (springer.com)
  • One isolate was confirmed positive for the sea gene, and the sequence of the sea gene was determined. (hindawi.com)
  • p>This section provides information about the protein and gene name(s) and synonym(s) and about the organism that is the source of the protein sequence. (uniprot.org)
  • section indicates the name(s) of the gene(s) that code for the protein sequence(s) described in the entry. (uniprot.org)
  • Once the 16S rRNA gene sequence is determined it can be used as definitive comparative feature. (biomedcentral.com)
  • Their new technology, called INTEGRATE, harnesses bacterial jumping genes to reliably insert any DNA sequence into the genome without cutting DNA. (biotechnews.com.au)
  • The researchers harnessed this discovery to create a gene-editing tool that can be programed to insert any DNA sequence into any site in a bacterial genome. (biotechnews.com.au)
  • And by replacing the transposon sequence with other DNA payloads, they could insert sequences up to 10,000 bases long into a bacterial genome. (biotechnews.com.au)
  • Previous research identified the Shine-Dalgarno (SD) sequence as a modulator of translation initiation in bacterial genes, while codon usage biases are frequently implicated as a primary determinant of elongation rate variation. (g3journal.org)
  • Among these architectural elements is the structure of DNA itself, its variable nature at a topological rather than just at a base-sequence level and its ability to play an active (as well as a passive) part in the gene regulation process. (clinsci.org)
  • Notably, BLAST analysis results obtained using the rmtF gene sequence (a new aminoglycoside-modifying enzyme gene sequence that is not included in the database) as a query revealed that the tool was able to link this sequence to short sequences (17 to 40 bp) found in other genes of the rmt family with significant E values. (asm.org)
  • A second Arabidopsis gene with a sequence highly similar to IBC6 was identified. (plantcell.org)
  • Sequence analysis revealed that IBC6 and IBC7 are similar to the receiver domain of bacterial two-component response regulators. (plantcell.org)
  • The first two algorithms employ an inhomogeneous Markov model for short DNA segments ( i.e. k -tuples), from which an estimate of the likelihood for the segment to belong to a protein coding sequence is derived after a training with existing gene data. (biomedcentral.com)
  • Benachenhou-Lahfa N, Forterre P, Labedan B (1993) Evolution of glutamate dehydrogenase genes: evidence for paralogous protein families and unusual branching patterns of the archaebacteria in the universal tree of life. (springer.com)
  • The researchers then delivered three genes to the electrically inactive cells: one bacterial gene for a sodium ion channel and two supporting genes encoding a potassium channel and connexin-43, a protein that helps shuttle electrical signals between cells. (eurekalert.org)
  • At present, the leading candidate for an evolutionary precursor of tubulin in the bacterial/archaeal domains is the cell division protein, FtsZ. (pnas.org)
  • The method is based on the conditional replication of derivatives of the lactococcal plasmid pWV01, which lacks the repA gene encoding the replication initiation protein. (nih.gov)
  • Wiersinga and the Laboratory for Experimental Internal Medicine discovered which gene-protein combination renders the lethal bacteria B. pseudomallei harmless. (infectioncontroltoday.com)
  • reported that overexpression of SlNRC4a in N. benthamiana enhances ROS production elicited by the bacterial flagellin peptide flg22 and the fungal protein ethylene-inducing xylanase (EIX). (plantphysiol.org)
  • In recent years, several research groups have tried to define the essential set of survival protein-encoding genes in bacteria by different experimental and computational methods (reviewed in references 22 , 24 , 38 , and 79 ). (asm.org)
  • We further show that depletion of SD sequences within ribosomal protein genes is correlated with organismal growth rates, supporting the hypothesis of strong selection against the presence of these sequences in coding regions and suggesting their association with translation efficiency in bacteria. (g3journal.org)
  • One possibility is that the phage can replicate itself using phage and host factors, resulting in lysis of the bacterial host and release of new phage (the lytic lifestyle). (hindawi.com)
  • Alternatively, the phage can integrate into the bacterial genome and the bacterial host can utilize certain genes the phage carries in its genome for its own benefit (the lysogenic lifestyle) [ 13 ]. (hindawi.com)
  • To explore this hypothesis, we cultured environmental bacteria and screened them for a phage-encoded exotoxin gene. (hindawi.com)
  • In this study, we describe the isolation of bacteria from environmental ambient air and the screening of the isolates for the phage-encoded sea gene using an exotoxin-specific colony PCR assay. (hindawi.com)
  • This is the first report of an alternative bacterial host from the environment that carries a phage-encoded exotoxin gene that is commonly associated with a different bacterial host. (hindawi.com)
  • The fact that the cbpJ gene is under strict negative selective pressure makes it a particularly attractive target for drugs, as this pressure would limit the likelihood of drug-resistant mutants emerging. (medindia.net)
  • The tags from a mixed population of bacterial mutants representing the inoculum and bacteria recovered from infected hosts were detected by amplification, radiolabeling, and hybridization analysis. (sciencemag.org)
  • I know that counterselectable markers are often instrumental for the construction of mutants when under appropriate growth conditions, a counterselectable gene promotes the death of the microorganisms harboring it. (protocol-online.org)
  • Sixty-five percentage of these mutants had insertions in uncharacterized genes. (asm.org)
  • At present, the described molecular approach proved superior to bacterial culture in two clinical situations: infections caused by bacteria with unusual growth requirements and specimens taken during antimicrobial treatment of the patient. (asm.org)
  • The addition of 1,25D during stimulation with LPS induced significant upregulation of genes in the antimicrobial and autophagy pathways, and downregulation of proinflammatory response genes compared to LPS treatment alone. (g3journal.org)
  • Phylogenetic analysis showed that bacterial family 18 chitinases can be clustered in three subfamilies which have diverged at an early stage of bacterial chitinase evolution. (portlandpress.com)
  • In insects, endosymbionts are maternally inherited, and early insect embryogenesis is marked by bacterial invasion and the subsequent differentiation of specialized host cells, called bacteriocytes, that often form an organ called the bacteriome ( 4 , 18 ). (pubmedcentralcanada.ca)
  • Recently, it has been suggested that several lateral gene transfers of archaeal GSI genes to bacteria may have occurred. (springer.com)
  • Truncated genes could also arise from small-scale lateral gene transfer events. (genetics.org)
  • Pseudogenes could also result from the degradation of transferred genes and might even be acquired directly via lateral gene transfer. (genetics.org)
  • Due to evolutionary constraints associated with a strictly intracellular life style and maternal inheritance of the symbionts, selection pressure favors, during the host-symbiont coevolution, deletions of bacterial genes encoding redundant metabolic pathways with the host ( 34 ), DNA recombinational repair genes ( 11 ), and genes becoming "unnecessary" to the new association. (pubmedcentralcanada.ca)
  • This is the first report of an environmental reservoir of a bacterial exotoxin gene in an atypical host. (hindawi.com)
  • In conclusion, urban river and estuarine water and STP effluent in the Durban area were highly contaminated with ARGs, and the yet-to-be cultured bacterial community may act as a non-visible ARG reservoir in certain situations. (frontiersin.org)
  • Researchers have developed a way to use firefly luciferase - which is much brighter than bacterial luciferase - as a chemiluminescent reporter in bacteria. (photonics.com)
  • An international consortium of researchers from INRA (France), University of Copenhagen and SEGES (Denmark), BGI-Shenzhen (China) and NIFES (Norway) has now established the first catalogue of bacterial genes in the gut of pigs. (phys.org)
  • In total the researchers identified 7.7 million genes and identified a large number of known and unknown bacteria. (phys.org)
  • In Japan, Jonathan Latham reports that researchers have discovered that standard methods of animal and plant gene-editing introduce DNA from unexpected sources . (biofuelsdigest.com)
  • KNOXVILLE--Researchers at the University of Tennessee, Knoxville, have identified a set of bacterial genes that may help them find ways to lessen the severity of the disease malaria. (brightsurf.com)
  • HHMI researchers have identified a gene. (bio-medicine.org)
  • HHMI researchers have identified a gene that enables mycobacteria--the cause of tuberculosis and leprosy--to form biofilms. (bio-medicine.org)
  • Now, researchers at Washington University School of Medicine in St. Louis report that they can distinguish between viral and bacterial infections in children with fever by profiling the activity of genes in a blood sample. (healthcanal.com)
  • Using microarray technology, researchers can distinguish between viral and bacterial infections in children with fever by profiling the activity of genes in a blood sample. (healthcanal.com)
  • Furthermore, their acquisition represented an important step in the evolution of eukaryotic cells by facilitating the engulfment of bacterial endosymbionts, which later became chloroplasts and mitochondria ( 3 ). (pnas.org)
  • Intracellular symbiosis (endosymbiosis) with gram-negative bacteria is common in insects, yet little is known about how the host immune system perceives the endosymbionts and controls their growth and invasion without complete bacterial clearance. (pubmedcentralcanada.ca)
  • The pores in bacterial cell walls are too small for the charged luciferin molecules to fit through. (photonics.com)
  • Yong Wang, assistant professor of physics, and graduate student Asmaa Sadoon have been studying how molecules travel through bacterial cytoplasm in order to understand more about how these tiny organisms function. (phys.org)
  • The subsequent development of strategies to analyze rRNA molecules and rRNA genes (rDNA) obtained from the environment provided a culture-independent means to examine the immense diversity of microorganisms inhabiting the natural world ( 3 , 14 , 21 , 29 ). (asm.org)
  • Toll-like receptors (TLR) 4 are an evolutionarily conserved family of receptors that function in innate immunity via recognition of conserved patterns in bacterial molecules (for review, see Ref. 7 ). (jimmunol.org)
  • Recent bioinformatic studies, exploring the biosynthetic gene clusters (BGCs) which produce many small molecules, have highlighted the incredible biochemical potential of the signaling molecules encoded by the human microbiome. (jcvi.org)
  • Bacterially produced small molecules, often encoded by BGCs, are the primary communication media of bacterial communities and play a crucial, yet largely unknown, role in the transition from health to dysbiosis. (jcvi.org)
  • Type VI secretion amidase effector (Tae) molecules (encoded by tae genes) can kill rival bacteria by degrading their cells walls when delivered into those competing cells. (evmedreview.com)
  • also argue that in order to be effective in killing most bacteria in vivo , secretion of Dae2 would need to be accompanied by secretion of molecules that can cause breaches in the bacterial outer membrane thereby allowing the Dae2 molecules access to the peptidoglycan in the cell wall. (evmedreview.com)
  • Applying this technique, I can systematically characterize the effect that NAPs have on the transcription of specific DNA sequences, under a variety of local conditions to further our understanding of how Xenogeneic gene silencing occurs. (europa.eu)
  • Addgene: Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. (addgene.org)
  • Real-time reverse transcription-PCR quantification of the wPGRP gene transcript performed at different points in insect development has shown a high steady-state level in the bacteria-bearing organ (the bacteriome) of larvae and a high level of wPGRP up-regulation in the symbiotic nymphal phase. (pubmedcentralcanada.ca)
  • In addition to the receiver domain, Skn7 also contains a DNA binding and transcription activation domain, which is analogous to that found in most bacterial response regulators. (plantcell.org)
  • The direction of transcription is represented by arrows, and gene names are indicated. (asm.org)
  • The active form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25D), plays an important immunomodulatory role, regulating transcription of genes in the innate and adaptive immune system. (g3journal.org)
  • In contrast, there have been no conclusive reports of these cytoskeletal elements in the bacterial or archaeal domains. (pnas.org)
  • A reference gene catalogue of the pig gut microbiome, Nature Microbiology (2016). (phys.org)
  • PCR amplification of 16S rRNA genes, or "ribotyping," is a powerful method for detecting and identifying microbial agents in environmental and clinical specimens. (asm.org)
  • The results of this study suggested that a bactericide from a microbial source could decrease the diversity of the soil bacterial community and change the bacterial community structure. (frontiersin.org)
  • The student will test these predictions by examining the effectiveness of CRISPR-Cas9 delivery vehicles to target plasmid-encoded AMR genes in a microbial community. (findaphd.com)
  • Scientists have identified USP18, a double agent in the immune system that makes people vulnerable to bacterial infections. (medindia.net)
  • While more work is needed, the study's results support the notion that analyzing the activity of the body's genes in response to childhood infections could help to identify the cause of illness and ensure that children get the right treatment. (healthcanal.com)
  • Some of these kids have serious bacterial infections that can be life threatening, but the largest number have viral infections. (healthcanal.com)
  • Twenty-two of the children were known to have viral infections based on previous extensive genomic testing that is not yet practical to use in a clinic setting, and eight others children had bacterial infections. (healthcanal.com)
  • Generally, the counts are elevated for bacterial infections and either low or normal for viral infections. (healthcanal.com)
  • A lot of patients with viral infections had elevated white-blood cell counts so doctors thought they had bacterial infections and prescribed antibiotics, which in fact were not necessary. (healthcanal.com)
  • During bacterial infections, activated polymorphonuclear leukocytes (PMNs) cause inflammation and organ dysfunction in severely ill patients. (medsci.org)
  • TREM1 mRNA levels were inversely correlated with the severity of pathophysiological conditions in acute bacterial infections. (medsci.org)
  • Analysis using the new model not only provides more accurate estimates on gene gains/losses (or insertions/deletions), but also reduces any concern of a systematic bias from applying simplified models to bacterial genome evolution. (genetics.org)
  • This will not only yield more accurate estimates of the rates of gene insertions/deletions, but also provide a quantitative view of the effect of truncated genes on rate estimation, which has been understudied in bacterial genome evolution. (genetics.org)
  • Maximum-likelihood estimates (MLEs) of the new model reveal fast rates of gene insertions/deletions on recent branches, suggesting a fast turnover of many recently transferred genes. (genetics.org)
  • Using the method, we have constructed two chromosomal deletions in the chemotaxis gene region of S. typhimurium. (pnas.org)
  • The model describes how clusters are created via the gene flux that continuously introduces new genes while deleting others. (biomedcentral.com)
  • Identification of the Bacterial Biosynthetic Gene Clusters of the Oral Microbiome Illuminates the Unexplored Social Language of Bacteria during Health and Disease. (jcvi.org)
  • Identification of the Bacterial Biosynthetic Gene Clusters of the Oral Microbiome Illuminates. (jcvi.org)
  • Conclusions: We conclude that, although the majority of eukaryote LGTs are single gene occurrences, they may be acquired in clusters of several genes that are subsequently cleansed of evolutionarily less advantageous genes. (diva-portal.org)
  • The btuba and btubb genes are arranged as adjacent loci within the genome along with a kinesin light chain gene homolog. (pnas.org)
  • Conversely, trans-encoded sRNAs interact with genes on separate loci. (wikipedia.org)
  • The locations of bacterial colonies chosen for identification were labeled, and a small number of cells were directly added as input into the sequencing workflow. (mdpi.com)
  • Return of the contact slide to the ground allowed for standard laboratory processing for bacterial identification. (mdpi.com)
  • Here we describe oligonucleotide fingerprinting of rRNA genes (OFRG), a method that permits identification of arrayed rRNA genes (rDNA) through a series of hybridization experiments using small DNA probes. (asm.org)
  • Organization of the chromosomal region containing the genes responsible for the synthesis and export of type I O-PS in B. pseudomallei . (asm.org)
  • Reports of microtubule-like structures in bacterial ectosymbionts ("epixenosomes") of ciliates in the genus Euplotidium present the most compelling structural evidence yet for the existence of tubulin-containing elements in bacteria. (pnas.org)
  • Sugino H, Sasaki M, Azakami H, Yamashita M, Murooka Y. A monoamine-regulated Klebsiella aerogenes operon containing the monoamine oxidase structural gene (maoA) and the maoC gene. (labome.org)
  • It is now known that most bacterial sRNAs are encoded by free-standing genes located in the intergenic regions (IGR) between two known genes. (wikipedia.org)
  • I'm currently using a pGP704 derivative containing sacB to do some bacterial mutagenesis. (protocol-online.org)
  • Transposon mutagenesis might overestimate the set by misclassification of nonessential genes that slow growth without arresting it but can also miss essential genes that tolerate transposon insertions. (asm.org)
  • The coded panel was searched for bacterial 16S rRNA gene sequences, using primers selective for spiroplasma sequences, primers selective for mollicutes in general, and universal bacterial primers. (asm.org)
  • A broad-range bacterial PCR targeting rRNA genes (rDNAs) was used to directly analyze 536 clinical samples obtained from 459 hospitalized patients during a 4-year study period. (asm.org)
  • We propose a model accounting specifically for such clustering, and show that indispensability in a genome with frequent gene deletion and insertion leads to the transient clustering of these genes. (biomedcentral.com)