A family of GLYCOSYLPHOSPHATIDYLINOSITOL-anchored, cell-surface heparan sulfate proteoglycans that may play a role in CELL GROWTH PROCESSES and CELL DIFFERENTIATION by modulating ligand-receptor interactions.
Ubiquitous macromolecules associated with the cell surface and extracellular matrix of a wide range of cells of vertebrate and invertebrate tissues. They are essential cofactors in cell-matrix adhesion processes, in cell-cell recognition systems, and in receptor-growth factor interactions. (From Cancer Metastasis Rev 1996; 15(2): 177-86; Hepatology 1996; 24(3): 524-32)
A family of transmembrane glycoproteins that contain a short cytoplasmic domain, a single-span transmembrane domain, and an extracellular domain with heparin sulfate and CHONDROITIN SULFATE chains. Syndecans interact with a variety of heparin-binding INTERCELLULAR SIGNALING PEPTIDES AND PROTEINS and may play a role in modulating cellular signaling during EMBRYONIC DEVELOPMENT, tumorigenesis, and angiogenesis.
Glycoproteins which have a very high polysaccharide content.
A syndecan that interacts with EXTRACELLULAR MATRIX PROTEINS and plays a role CELL PROLIFERATION and CELL MIGRATION.
Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.
Compounds containing carbohydrate or glycosyl groups linked to phosphatidylinositols. They anchor GPI-LINKED PROTEINS or polysaccharides to cell membranes.
A heteropolysaccharide that is similar in structure to HEPARIN. It accumulates in individuals with MUCOPOLYSACCHARIDOSIS.
A family of intercellular signaling proteins that play and important role in regulating the development of many TISSUES and organs. Their name derives from the observation of a hedgehog-like appearance in DROSOPHILA embryos with genetic mutations that block their action.
Glycoproteins found on the membrane or surface of cells.
A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.
A species of fruit fly much used in genetics because of the large size of its chromosomes.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Antibodies produced by a single clone of cells.
A genus in the family ORTHOMYXOVIRIDAE causing influenza and other diseases in humans and animals. It contains many strains as well as antigenic subtypes of the integral membrane proteins hemagglutinin (HEMAGGLUTININS) and NEURAMINIDASE. The type species is INFLUENZA A VIRUS.
Immunoglobulin molecules having a specific amino acid sequence by virtue of which they interact only with the ANTIGEN (or a very similar shape) that induced their synthesis in cells of the lymphoid series (especially PLASMA CELLS).
Proteins prepared by recombinant DNA technology.
The property of antibodies which enables them to react with some ANTIGENIC DETERMINANTS and not with others. Specificity is dependent on chemical composition, physical forces, and molecular structure at the binding site.
Univalent antigen-binding fragments composed of one entire IMMUNOGLOBULIN LIGHT CHAIN and the amino terminal end of one of the IMMUNOGLOBULIN HEAVY CHAINS from the hinge region, linked to each other by disulfide bonds. Fab contains the IMMUNOGLOBULIN VARIABLE REGIONS, which are part of the antigen-binding site, and the first IMMUNOGLOBULIN CONSTANT REGIONS. This fragment can be obtained by digestion of immunoglobulins with the proteolytic enzyme PAPAIN.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
Immunoglobulins produced in response to VIRAL ANTIGENS.
Immunoglobulins produced in a response to BACTERIAL ANTIGENS.
Software used to locate data or information stored in machine-readable form locally or at a distance such as an INTERNET site.
Databases devoted to knowledge about specific genes and gene products.
The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.
A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.
NATIONAL LIBRARY OF MEDICINE service for health professionals and consumers. It links extensive information from the National Institutes of Health and other reviewed sources of information on specific diseases and conditions.
Neuroglial cells of the peripheral nervous system which form the insulating myelin sheaths of peripheral axons.
Heteropolysaccharides which contain an N-acetylated hexosamine in a characteristic repeating disaccharide unit. The repeating structure of each disaccharide involves alternate 1,4- and 1,3-linkages consisting of either N-acetylglucosamine or N-acetylgalactosamine.
The condition of accelerated and excessive GROWTH in children or adolescents who are exposed to excess HUMAN GROWTH HORMONE before the closure of EPIPHYSES. It is usually caused by somatotroph hyperplasia or a GROWTH HORMONE-SECRETING PITUITARY ADENOMA. These patients are of abnormally tall stature, more than 3 standard deviations above normal mean height for age.
A syndrome of multiple defects characterized primarily by umbilical hernia (HERNIA, UMBILICAL); MACROGLOSSIA; and GIGANTISM; and secondarily by visceromegaly; HYPOGLYCEMIA; and ear abnormalities.
A characteristic symptom complex.
The presence of an excessively large tongue, which may be congenital or may develop as a result of a tumor or edema due to obstruction of lymphatic vessels, or it may occur in association with hyperpituitarism or acromegaly. It also may be associated with malocclusion because of pressure of the tongue on the teeth. (From Jablonski, Dictionary of Dentistry, 1992)
The profession of writing. Also the identity of the writer as the creator of a literary production.
Collections of facts, assumptions, beliefs, and heuristics that are used in combination with databases to achieve desired results, such as a diagnosis, an interpretation, or a solution to a problem (From McGraw Hill Dictionary of Scientific and Technical Terms, 6th ed).
The guidelines and policy statements set forth by the editor(s) or editorial board of a publication.
Intentional falsification of scientific data by presentation of fraudulent or incomplete or uncorroborated findings as scientific fact.
"The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.
Relatively undifferentiated cells that retain the ability to divide and proliferate throughout postnatal life to provide progenitor cells that can differentiate into specialized cells.
Cells derived from the BLASTOCYST INNER CELL MASS which forms before implantation in the uterine wall. They retain the ability to divide, proliferate and provide progenitor cells that can differentiate into specialized cells.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.
Cells that can give rise to cells of the three different GERM LAYERS.
Progenitor cells from which all blood cells derive.
The transfer of STEM CELLS from one individual to another within the same species (TRANSPLANTATION, HOMOLOGOUS) or between species (XENOTRANSPLANTATION), or transfer within the same individual (TRANSPLANTATION, AUTOLOGOUS). The source and location of the stem cells determines their potency or pluripotency to differentiate into various cell types.
A carcinoma derived from stratified SQUAMOUS EPITHELIAL CELLS. It may also occur in sites where glandular or columnar epithelium is normally present. (From Stedman, 25th ed)
Tumors or cancer of the LUNG.
Either of the pair of organs occupying the cavity of the thorax that effect the aeration of the blood.
A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
"Entrez Gene: GPC3 glypican 3". Abdulhady, H; El-Sobky, TA; Elsayed, NS; Sakr, HM (11 June 2018). "Clinical and imaging features ... "Mutation analysis of the tumor suppressor PTEN and the glypican 3 (GPC3) gene in patients diagnosed with Proteus syndrome". Am ... identified an activating mutation in AKT1 kinase in a mosaic state gene. Previous research had suggested the condition linked ... which codes for glypican 3 and may play a role in regulating cell division and growth regulation. Macrodystrophia lipomatosa ...
Slit homolog 2 protein is a protein that in humans is encoded by the SLIT2 gene. SLIT2 has been shown to interact with Glypican ... "Entrez Gene: SLIT2 slit homolog 2 (Drosophila)". Ronca, F; Andersen J S; Paech V; Margolis R U (August 2001). "Characterization ... 2003). "Conserved modularity and potential for alternate splicing in mouse and human Slit genes". Int. J. Dev. Biol. 46 (4): ... 2002). "SLIT2, a human homologue of the Drosophila Slit2 gene, has tumor suppressor activity and is frequently inactivated in ...
Putative microRNA host gene 1 protein is a protein that in humans is encoded by the MIR17HG gene. GRCh38: Ensembl release 89: ... "Role for amplification and expression of glypican-5 in rhabdomyosarcoma". Cancer Res. 67 (1): 57-65. doi:10.1158/0008-5472.CAN- ... "Entrez Gene: MIRH1 microRNA host gene (non-protein coding) 1". Christian SL, McDonough J, Liu Cy CY, et al. (2002). "An ... "Identification and characterization of a novel gene, C13orf25, as a target for 13q31-q32 amplification in malignant lymphoma". ...
The mutations causing this syndrome have been mapped to the glypican 4 (GPC4) gene. This gene is located on the long arm of ... When a female carries a mutated gene on one of her two copies of the X chromosome, there is a 50% chance of passing the ... This is not definitive, however, and no specific gene has been named. The syndrome is strongly believed to be inherited in an X ... Nasodigitoacoustic syndrome is thought to be caused by a mutation in a gene on the X chromosome. A 2007 study concluded, based ...
"Entrez Gene: MicroRNA 1271". Retrieved 2017-02-19. Maurel M, Jalvy S, Ladeiro Y, Combe C, Vachet L, Sagliocco F, Bioulac-Sage P ... "A functional screening identifies five microRNAs controlling glypican-3: role of miR-1271 down-regulation in hepatocellular ... MicroRNA 1271 is a microRNA that in humans is encoded by the MIR1271 gene. microRNAs (miRNAs) are short (20-24 nt) non-coding ... RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the ...
Human FAT1 was found to bind glypican-3 (GPC3) and regulate cell migration in liver cancer cells. The human FAT1 cadherin gene ... Protocadherin FAT1 is a protein that in humans is encoded by the FAT1 gene. This gene is an ortholog of the Drosophila fat gene ... The gene product is a member of the cadherin superfamily, a group of integral membrane proteins characterized by the presence ... This gene is expressed at high levels in a number of fetal epithelia. Transcript variants derived from alternative splicing and ...
A possible association with deletion of the gene GPC1, which encodes a glypican 1-a heparan sulfate proteoglycan, has been ... This gene is located on the long arm of chromosome 2 (2q37) and is involved in the regulation of inflammation and the Hedgehog ... An association between biliary atresia and the ADD3 gene was first detected in Chinese populations through a genome-wide ... Syndromic biliary atresia (e.g. Biliary Atresia Splenic Malformation (BASM)) has been associated with certain genes (e.g. ...
... one cause of SGBS type I is a mutation of the glypican-3 gene (GPC3) on the X chromosome locus q26.1. This particular gene is ... "Mutational analysis of the GPC3/GPC4 glypican gene cluster on Xq26 in patients with Simpson-Golabi-Behmel syndrome: ... There are two types of SGBS, each found on a different gene: SGBS is also considered to be an overgrowth syndrome (OGS). OGS is ... It has been suggested that SGBS type II may be caused by duplication of the GPC4 gene, which helps to regulate cell division ...
This gene is a member of the WNT gene family. It encodes a protein showing 99% and 91% amino acid identity to the mouse and ... Capurro MI, Shi W, Sandal S, Filmus J (December 2005). "Processing by convertases is not required for glypican-3-induced ... Protein Wnt-7b is a protein that in humans is encoded by the WNT7B gene. The WNT gene family consists of structurally related ... "Entrez Gene: WNT7B wingless-type MMTV integration site family, member 7B". Yu J, Carroll TJ, Rajagopal J, Kobayashi A, Ren Q, ...
Greenspan has worked on genes and gene products important to vertebrate development and human disease. He has particularly ... chains of type V collagen regulate breast tumour growth via glypican-1-mediated effects. Nature Comm 8, doi:10.1038/ncomms14351 ... A collaborative study with a group at Jefferson Medical College showed mutations in the COL7A1 gene, for type VII collagen, to ... His research has mainly focused on genes encoding proteins of the extracellular space and possible links between defects in ...
So CCDS's gene number prediction represents a lower bound on the total number of human protein-coding genes. The following is a ... Glypican 5: encoding protein Glypican-5 HTR2A: 5-HT2A receptor INTS6: encoding protein Integrator complex subunit 6 GPALPP1: ... Researchers have not determined which other genes are located in the deleted region, but a loss of several genes is likely ... Pertea M, Salzberg SL (2010). "Between a chicken and a grape: estimating the number of human genes". Genome Biol. 11 (5): 206. ...
... so we can define it as a glypican. For its normal biosynthesis it requires sugarless (sgl), a gene that encodes an enzyme which ... Dally's gene was located in the chromosome 3, concretely in the region 3L 8820605-8884292. The mutation of Dally is a ... Dally (division abnormally delayed) is the name of a gene that encodes a HS-modified-protein found in the fruit fly (Drosophila ... Uniprot KB, Nakato H; Tracy A; Selleck SB (1995). "The division abnormally delayed (dally) gene: a putative integral membrane ...
In addition, the microRNA-17-92a-1 cluster host gene and the glypican 6 gene in the 13q31.3 region, as well as EFNB2 and the ... The authors were able to show that the gene encoding ephrin B2 (EFNB2) located in the 13q33.3-q34 region, and the gene coding ... Other genes in the potentially affected region include NUFIP1, HTR2A, PDCH8, and PCDH17. In males with 13q deletion syndrome, ... Because of the rarity of the disease in addition to the variations in the disease, the specific genes that cause this disease ...
... the University of Wales Dictionary of the Welsh language Gene Polisseni Center, a college ice hockey arena on the campus of the ... a sialoglycoprotein Glypican, a proteoglycan GPC Biotech, a German biopharmaceutical company General People's Congress ( ...
This gene is a member of the WNT gene family. It encodes a protein showing 96% amino acid identity to mouse Wnt3A protein, and ... Capurro MI, Shi W, Sandal S, Filmus J (2006). "Processing by convertases is not required for glypican-3-induced stimulation of ... Protein Wnt-3a is a protein that in humans is encoded by the WNT3A gene. The WNT gene family consists of structurally related ... This gene is clustered with WNT14 gene, another family member, in chromosome 1q42 region. GRCh38: Ensembl release 89: ...
Some suggest that this implies that these glypicans arose because of a gene duplication event. The gene for GPC1 is found on ... while glypican-3 is overexpressed in liver cancers. Glypican-2 is overexpressed in neuroblastoma. Mutations in this gene have ... Six glypicans have been identified in mammals, and are referred to as GPC1 through GPC6. In Drosophila two glypicans have been ... One additional glypican has been identified in C. elegans. Glypicans seem to play a vital role in developmental morphogenesis, ...
Glypican-6 is a protein that in humans is encoded by the GPC6 gene. The glypicans comprise a family of ... "Entrez Gene: GPC6 glypican 6". Gerhard DS, Wagner L, Feingold EA, et al. (2004). "The status, quality, and expansion of the NIH ... Paine-Saunders S, Viviano BL, Saunders S (Aug 1999). "GPC6, a novel member of the glypican gene family, encodes a product ... GPC6 human gene location in the UCSC Genome Browser. GPC6 human gene details in the UCSC Genome Browser. v t e. ...
... the gene for human K-glypican, flanks GPC3 on xq26: deletion of the GPC3-GPC4 gene cluster in one family with Simpson-Golabi- ... "Glypican 3 and glypican 4 are juxtaposed in Xq26.1". Gene. 225 (1-2): 9-16. doi:10.1016/S0378-1119(98)00549-6. PMID 9931407. ... The GPC4 gene is adjacent to the 3' end of GPC3 and may also play a role in Simpson-Golabi-Behmel syndrome. Glypican GRCh38: ... Glypican-4 is a protein that in humans is encoded by the GPC4 gene. Cell surface heparan sulfate proteoglycans are composed of ...
Glypican-1 is a protein that in humans is encoded by the GPC1 gene. Cell surface heparan sulfate proteoglycans are composed of ... "Entrez Gene: GPC1 glypican 1". Ronca F, Andersen JS, Paech V, Margolis RU (August 2001). "Characterization of Slit protein ... Vermeesch JR, Mertens G, David G, Marynen P (Jul 1995). "Assignment of the human glypican gene (GPC1) to 2q35-q37 by ... and in more recent overviews of potential markers for pancreatic cancer, Glypican 1 is not mentioned. Glypican GRCh38: Ensembl ...
... (GPC2), also known cerebroglycan, is a protein which in humans is encoded by the GPC2 gene. Cerebroglycan is a ... "Entrez Gene: GPC2 glypican 2". Ivins JK, Litwack ED, Kumbasar A, Stipp CS, Lander AD (April 1997). "Cerebroglycan, a ... Li N, Fu H, Hewitt SM, Dimitrov DS, Ho M (August 2017). "Therapeutically targeting glypican-2 via single-domain antibody-based ... Glypican GRCh38: Ensembl release 89: ENSG00000213420 - Ensembl, May 2017 GRCm38: Ensembl release 89: ENSMUSG00000029510 - ...
Glypican-3 is a protein that, in humans, is encoded by the GPC3 gene. The GPC3 gene is located on human X chromosome (Xq26) ... "Entrez Gene: GPC3 glypican 3". Jakubovic BD, Jothy S (April 2007). "Glypican-3: from the mutations of Simpson-Golabi-Behmel ... December 1998). "Glypican 3 and glypican 4 are juxtaposed in Xq26.1". Gene. 225 (1-2): 9-16. doi:10.1016/S0378-1119(98)00549-6 ... the gene for human K-glypican, flanks GPC3 on xq26: deletion of the GPC3-GPC4 gene cluster in one family with Simpson-Golabi- ...
"Entrez Gene: GPC5 glypican 5". De Cat B, David G (2001). "Developmental roles of the glypicans". Semin. Cell Dev. Biol. 12 (2 ... Glypican-5 is a protein that in humans is encoded by the GPC5 gene. Cell surface heparan sulfate proteoglycans are composed of ... a new member of the glypican gene family". Genomics. 40 (1): 24-30. doi:10.1006/geno.1996.4518. PMID 9070915. " ... Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the ...
Deletion of the gene in Caecam1-/- mice results in a reduction of the abnormal vascularization seen in cancer and lowered ... Gigantism is believed to be caused, in some cases, by a loss of function of the Glypican 3 co-receptor. Carcinoembryonic ... Many co-receptor-related disorders occur due to mutations in the receptor's coding gene. LRP5 (low-density lipoprotein receptor ... nitric oxide production, suggesting a therapeutic possibility through targeting of this gene. The neuropilin co-receptor family ...
"Entrez Gene: SLIT1 slit homolog 1 (Drosophila)". Nakajima D, Okazaki N, Yamakawa H, Kikuno R, Ohara O, Nagase T (June 2002). " ... "Mammalian homologues of the Drosophila slit protein are ligands of the heparan sulfate proteoglycan glypican-1 in brain". The ... Slit homolog 1 protein is a protein that in humans is encoded by the SLIT1 gene. GRCh38: Ensembl release 89: ENSG00000187122 - ... "Construction of expression-ready cDNA clones for KIAA genes: manual curation of 330 KIAA cDNA clones". DNA Research. 9 (3): 99- ...
Genes activated by Dpp signaling include optomotor blind (omb) and spalt, and activity of these genes are often used as ... Crickmore MA, Mann RS (January 2007). "Hox control of morphogen mobility and organ development through regulation of glypican ... Activated Mad is able to bind to DNA and act as a transcription factor to affect the expression of different genes in response ... Another gene with a more complicated regulatory interaction with Dpp is brinker. Brinker is a transcription factor that ...
"Entrez Gene: VCAN versican". Iozzo RV, Naso MF, Cannizzaro LA, Wasmuth JJ, McPherson JD (1992). "Mapping of the versican ... cell adhesion molecules and members of the syndecan and glypican proteoglycan families. Versican's C-terminal domain interacts ... It is encoded by the VCAN gene. Versican is a large chondroitin sulfate proteoglycan with an apparent molecular mass of more ... There is a single versican gene, however alternative splicing of its mRNA produces 4 distinct versican isoforms that differ in ...
... , often abbreviated CK20, is a protein that in humans is encoded by the KRT20 gene. Keratin 20 is a type I ... 2009). "Frequent expression of glypican-3 in Merkel cell carcinoma: an immunohistochemical study of 55 cases". Appl. ... Ye X, Li Y, Hou G, Liu Z, Chen T (May 2002). "[Significance of cytokeratin gene (CK-20 mRNA) expression in metastatic lymph ... Moll R, Zimbelmann R, Goldschmidt MD, Keith M, Laufer J, Kasper M, Koch PJ, Franke WW (June 1993). "The human gene encoding ...
Gene therapy Cell therapy Fox M (July 12, 2017). "New Gene Therapy for Cancer Offers Hope to Those With No Options Left". NBC ... Li N, Fu H, Hewitt SM, Dimitrov DS, Ho M (August 2017). "Therapeutically targeting glypican-2 via single-domain antibody-based ... The new gene editing tool CRISPR/Cas9 has recently been used instead of retroviral vectors to integrate the CAR gene into ... Suicide genes: Genetically modified T cells are engineered to include one or more genes that can induce apoptosis when ...
2001). "Cell surface glypicans are low-affinity endostatin receptors" (PDF). Mol. Cell. 7 (4): 811-22. doi:10.1016/S1097-2765( ... Yin, G; Liu, W.; An, P.; Li, P.; Ding, I.; Planelles, V.; Schwarz, E.M.; Min, W. (2002). "Endostatin gene transfer inhibits ... Endostatin blocks pro-angiogenic gene expression controlled by c-Jun N terminal kinase (JNK) by interfering with TNFα ... These studies have estimated that endostatin may significantly affect 12% of genes used by human endothelial cells. Although ...
Continued research led to the discovery of further int1-related genes; however, because those genes were not identified in the ... Gao W, Tang Z, Zhang YF, Feng M, Qian M, Dimitrov DS, Ho M (March 2015). "Immunotoxin targeting glypican-3 regresses liver ... January 1991). "A new nomenclature for int-1 and related genes: the Wnt gene family". Cell. 64 (2): 231. doi:10.1016/0092-8674( ... During myogenesis, Wnt uses PA and CREB to activate MyoD and Myf5 genes. Wnt also acts in conjunction with Ryk and Src to allow ...
This article on a gene on human chromosome 21 is a stub. You can help Wikipedia by expanding it.. *v ... "Cell surface glypicans are low-affinity endostatin receptors" (PDF). Mol. Cell. 7 (4): 811-22. doi:10.1016/S1097-2765(01)00225 ... Gene ontology. Molecular function. • structural molecule activity. • metal ion binding. • GO:0001948 protein binding. • ... Collagen alpha-1(XVIII) chain is a protein that in humans is encoded by the COL18A1 gene.[5] ...
They contain no functional p53, a potent tumor suppressor gene, and are highly sensitive to mitogenic stimuli. In xenografts, ... "High-affinity monoclonal antibodies to cell surface tumor antigen glypican-3 generated through a combination of peptide ...
This is carried out by one or more related enzymes whose genes are members of the exostoses (EXT) gene family of tumour ... Glypican-3 (GPC3) interacts with both Wnt and Frizzled to form a complex and triggers downstream signaling. It has been ... Mutations at the EXT1-3 gene loci in humans lead to an inability of cells to produce HS and to the development of the disease ... It has been demonstrated that 3-O-sulfation can enhance the binding of Wnt to the glypican and may play a role in regulating ...
Wang C, Gao W, Feng M, Pastan I, Ho M (May 2017). "Construction of an immunotoxin, HN3-mPE24, targeting glypican-3 for liver ... The process is similar, comprising gene libraries from immunized or naïve donors and display techniques for identification of ... Gao W, Tang Z, Zhang YF, Feng M, Qian M, Dimitrov DS, Ho M (March 2015). "Immunotoxin targeting glypican-3 regresses liver ... Li N, Fu H, Hewitt SM, Dimitrov DS, Ho M (August 2017). "Therapeutically targeting glypican-2 via single-domain antibody-based ...
MSLN human gene location in the UCSC Genome Browser. MSLN human gene details in the UCSC Genome Browser. Overview of all the ... Ho M (October 2011). "Advances in liver cancer antibody therapies: a focus on glypican-3 and mesothelin". BioDrugs. 25 (5): 275 ... Mesothelin, also known as MSLN, is a protein that in humans is encoded by the MSLN gene. Mesothelin is a 40 kDa protein that is ... Subsequent cloning studies showed that the mesothelin gene encodes a precursor protein that is processed to yield mesothelin ...
... or glypican. Sulfation of heparan sulfate GAGs helps give diversity to cell surface proteins and provides them with a unique ... cloning and expression of two distinct human chondroitin 4-O-sulfotransferases that belong to the HNK-1 sulfotransferase gene ...
Kondo H, Abe K, Emori Y, Arai S (January 1991). "Gene organization of oryzacystatin-II, a new cystatin superfamily member of ... "Development of an Affimer-antibody combined immunological diagnosis kit for glypican-3". Scientific Reports. 7 (1): 9608. doi: ...
Two α-fucosyltransferase genes, FUT4 and FUT6, both belonging to GT37 family, encode enzymes which add α-1,2-fucose residues to ... Filmus, Jorge; Capurro, Mariana; Rast, Jonathan (2008). "Glypicans". Genome Biology. 9 (5): 224. doi:10.1186/gb-2008-9-5-224. ... A GT31 Clade 10 gene, KNS4/UPEX1, encodes a β-1,3-GalT capable of synthesizing β-1,3-Gal linkages found in type II AGs present ... The Arabinogalactan Protein Gene Family as a Test Case". Plant Physiology. 129 (4): 1448-1463. doi:10.1104/pp.003459. ISSN 0032 ...
IPR001863 Glypican. IPR031181 Glypican-2. IPR019803 Glypican_CS. PANTHERi. PTHR10822 PTHR10822, 1 hit. PTHR10822:SF24 ... Belongs to the glypican family.Curated. Keywords - Domaini. Signal. Phylogenomic databases. evolutionary genealogy of genes: ... Gene expression databases. Bgee dataBase for Gene Expression Evolution. More...Bgeei. ENSG00000213420 Expressed in 174 organ(s ... based on gene identifiers from Ensembl, EnsemblGenomes and model organism databases.,p>,a href=/help/gene_centric_isoform_ ...
The Gpc4 gene is conserved in human, chimpanzee, Rhesus monkey, dog, cow, mouse, chicken, zebrafish, fruit fly, mosquito, C. ... Glypican-4 is an FGF2-binding heparan sulfate proteoglycan expressed in neural precursor cells. [Dev Dyn. 2000] Glypican-4 is ... Expression of glypican-4 in haematopoietic-progenitor and bone-marrow-stromal cells. [Biochem J. 1999] Expression of glypican-4 ... PREDICTED: glypican-4 isoform X1 [Rattus norvegicus] PREDICTED: glypican-4 isoform X1 [Rattus norvegicus]. gi,564400809,ref,XP_ ...
... the gene for human K-glypican, flanks GPC3 on xq26: deletion of the GPC3-GPC4 gene cluster in one family with Simpson-Golabi- ... "Glypican 3 and glypican 4 are juxtaposed in Xq26.1". Gene. 225 (1-2): 9-16. doi:10.1016/S0378-1119(98)00549-6. PMID 9931407. ... The GPC4 gene is adjacent to the 3 end of GPC3 and may also play a role in Simpson-Golabi-Behmel syndrome. Glypican GRCh38: ... Glypican-4 is a protein that in humans is encoded by the GPC4 gene. Cell surface heparan sulfate proteoglycans are composed of ...
Glypican-1 is a protein that in humans is encoded by the GPC1 gene. Cell surface heparan sulfate proteoglycans are composed of ... "Entrez Gene: GPC1 glypican 1". Ronca F, Andersen JS, Paech V, Margolis RU (August 2001). "Characterization of Slit protein ... Vermeesch JR, Mertens G, David G, Marynen P (Jul 1995). "Assignment of the human glypican gene (GPC1) to 2q35-q37 by ... and in more recent overviews of potential markers for pancreatic cancer, Glypican 1 is not mentioned. Glypican GRCh38: Ensembl ...
Gene ID. 2719 (GPC3), 14734 (Gpc3), 25236. Ncbi ID. NP_004475, 9606, NP_002297, NP_004475.1, NP_057906.2, NM_016697, NM_012774 ... Background of Glypican-3 / GPC3 antibody. Kit Component:. - KN307156G1, Gpc3 gRNA vector 1 in pCas-Guide vector. - KN307156G2, ... Western Blot of HepG2 cell lysate with anti-Glypican-3 Antibody Cat.-No AM12128PU (Clone SP86).. *AM12128PU-N ... Flow cytometric analysis of rabbit anti-Glypican-3 (SP86) antibody in HEPG2 (green) compare to negative control of rabbit IgG ( ...
... spontaneous mutations in the human and induced deletions in the mouse glypican-3 (Gpc3) gene result in severe ma … ... Glypicans represent a family of six cell surface heparan sulfate proteoglycans in vertebrates. Although no specific in vivo ... This previously unknown link between glypican-3 and BMP4 function provides evidence of a role for glypicans in vertebrate limb ... spontaneous mutations in the human and induced deletions in the mouse glypican-3 (Gpc3) gene result in severe malformations and ...
Mapping of the rat glypican genes. par Szpirer, Claude ;Szpirer, Josiane ;Riviere, Michèle ;Vanvooren, P.;Veugelers, M.;David, ... par Buchholz, R.R. , Worden, Helen H.M. , Park, Mijeong , Francis, Gene G.L. , Deeter, Merritt , Edwards, David D.P. , Emmons, ...
Rabbit recombinant monoclonal Glypican 3 antibody [SP86] validated for IHC and tested in Human. Immunogen corresponding to ... Entrez Gene: 2719 Human. *Omim: 300037 Human. *SwissProt: P51654 Human. *Unigene: 644108 Human ... Anti-Glypican 3 antibody [SP86], prediluted. See all Glypican 3 primary antibodies. ... Prediluted ab95364 staining Glypican 3 in formalin-fixed, paraffin-embedded Human liver cancer tissue by Immunohistochemistry. ...
Rabbit polyclonal Glypican 1/ GPC1 antibody validated for WB, IHC, ICC/IF and tested in Human. Immunogen corresponding to ... Entrez Gene: 2817 Human. *Entrez Gene: 14733 Mouse. *Entrez Gene: 58920 Rat ... Anti-Glypican 1/ GPC1 antibody images. * Immunocytochemistry/ Immunofluorescence-Glypican 1/ GPC1 antibody(ab73979) ... Anti-Glypican 1/ GPC1 antibody. See all Glypican 1/ GPC1 primary antibodies. ...
GPC6 gene. glypican 6. Enable Javascript to view the expand/collapse boxes.. Open All Close All ... From NCBI Gene:. The glypicans comprise a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans, and ... The glypican encoded by this gene is a putative cell surface coreceptor for growth factors, extracellular matrix proteins, ... Mutations in this gene are associated with omodysplasia 1. [provided by RefSeq, Nov 2016] ...
Glypican 4, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene ... No data available for DME Specific Peptides for GPC4 Gene Domains & Families for GPC4 Gene Gene Families for GPC4 Gene. HGNC:. ... Publications for GPC4 Gene * GPC4, the gene for human K-glypican, flanks GPC3 on xq26: deletion of the GPC3-GPC4 gene cluster ... Aliases for GPC4 Gene Aliases for GPC4 Gene. * Glypican 4 2 3 5 ... Protein Domains for GPC4 Gene. InterPro:. * Glypican * Glypican ...
GPC1 gene. glypican 1. Enable Javascript to view the expand/collapse boxes.. Open All Close All ... From NCBI Gene:. Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with ... Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the ...
Glypican 4, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene ... Evolution for GPC4 Gene. ENSEMBL:. Gene Tree for GPC4 (if available). TreeFam:. Gene Tree for GPC4 (if available). Aminode:. ... GPC4, the gene for human K-glypican, flanks GPC3 on xq26: deletion of the GPC3-GPC4 gene cluster in one family with Simpson- ... GeneCards Summary for GPC4 Gene GPC4 (Glypican 4) is a Protein Coding gene. Diseases associated with GPC4 include Keipert ...
Occasionally, these deletions also include the glypican-4 gene (GPC4). Glypicans are heparan sulfate proteoglycans which have a ... Occasionally, these deletions also include the glypican-4 gene (GPC4). Glypicans are heparan sulfate proteoglycans which have a ... Deletions and translocations involving the glypican-3 gene (GPC3) have been shown to be associated with SGBS. ... Deletions and translocations involving the glypican-3 gene (GPC3) have been shown to be associated with SGBS. ...
Characterization of glypican-5 and chromosomal localization of human GPC5, a new member of the glypican gene family. Veugelers ... Characterization of glypican-5 and chromosomal localization of human GPC5, a new member of the glypican gene family [24]. ... GPC6, a novel member of the glypican gene family, encodes a product structurally related to GPC4 and is colocalized with GPC5 ... Mutations in GPC3, a glypican gene, cause the Simpson-Golabi-Behmel overgrowth syndrome. Pilia, G., Hughes-Benzie, R.M., ...
Invitrogen Anti-Glypican 1 Polyclonal, Catalog # PA5-86043. Tested in Western Blot (WB), Immunofluorescence (IF), ... Protein Aliases: glypican proteoglycan 1; Glypican-1; Secreted glypican-1 Gene Aliases: glypican; GPC1 ... Cite Glypican 1 Polyclonal Antibody. The following antibody was used in this experiment: Glypican 1 Polyclonal Antibody from ... Immunocytochemical analysis of Glypican 1 in PANC-1 cells using a Glypican 1 Polyclonal antibody (Product # PA5-86043) as seen ...
Compare and order Glypican 3 ELISA Kits. View citations, images, detection ranges, sensitivity, prices and more. Recommended ... Glypican 3 ELISA Kit. 54 products by 14 suppliers: Blue Gene , Elabscience , Abbexa , USBio , CUSABIO , EIAab , Wuhan Fine ... Protein level used designations for Glypican 3 glypican 3 , glypican-3-like , glypican proteoglycan 3 , glypican-3 , heparan ... Search Glypican 3 ELISA Kits for other reactivities: Dog (Canine),. Rabbit,. Guinea Pig,. Pig (Porcine),. Goat,. Chicken,. ...
Anti-Glypican-3 (GPC3) (Hepatocellular Carcinoma Marker) Antibody, Recombinant Mouse Monoclonal Antibody validated in IHC-P, IF ... Gene ID 2719. Other Names DGSX; Glypican proteoglycan 3; GPC3; GTR2-2; Heparan sulphate proteoglycan; Intestinal protein OCI-5 ... Anti-Glypican-3 (GPC3) (Hepatocellular Carcinoma Marker) Antibody is for research use only and not for use in diagnostic or ... Glypican-3 (GPC3) is a glycosylphospatidyl inositol-anchored membrane protein, which may also be found in a secreted form. Anti ...
... induction of a mouse patched gene by Hedgehog. Genes Dev. 10,301 -312. ... On the receiving cells, glypicans may present Hh to Ptc, which then mediates the internalization of Hh. Glypican mutant cells ... 1C) resembling those of mutants of the segment polarity genes hh (Fig. 1B) and wg (data not shown). In dly embryos, both En ... Mechanism(s) of Glypican-mediated Hh movement. Recent biochemical studies from vertebrate cells have shown that Shh-Np is ...
Gene Expression Profiling * Gene Expression Regulation, Neoplastic * Glypicans / metabolism* * Heparan Sulfate Proteoglycans / ... The cell surface proteins Glypicans act as gatekeepers of environmental signals to modulate their perception by target cells. ...
Analysis of the transcription of the genes responsible for the production of chondroitin sulfate showed a decline in the ... Glypican-5 appeared overexpressed in high-grade tumors with epithelial differentiation, and not in those that displayed a ... Glypican-5 appeared overexpressed in high-grade tumors with epithelial differentiation, and not in those that displayed a ... Whilst elevated glypican-1 expression has been documented in different tumours, the down-regulation in high grade tumors ...
GPC3: glypican 3. *GPHN: gephyrin. *GPI: glucose-6-phosphate isomerase. *GPR101: G protein-coupled receptor 101 ... Explore the normal functions of human genes and the health implications of genetic changes. ... URL of this page: https://medlineplus.gov/genetics/gene-g/ Genes: G. ...
This protein is one of several glypicans in humans, each of which consists of a core protein attached to long sugar molecules ... Learn about this gene and related health conditions. ... gene provides instructions for making a protein called glypican ... The GPC3 gene provides instructions for making a protein called glypican 3. This protein is one of several glypicans in humans ... Mutations in the GPC3 gene prevent glypican 3 from inhibiting the hedgehog signaling pathway. The resulting overactivity of ...
Rabbit Polyclonal Glypican 5 antibody [N2C3]. Validated in WB. Tested in Human., Find more about GeneTex products - ... glypican 5 Cellular Localization Cell membrane; Lipid-anchor , GPI-anchor; Extracellular side , Secreted glypican-5: Secreted ... Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the ... There are currently no reviews for Glypican 5 antibody [N2C3] (GTX104125). Be the first to share your experience with this ...
McGuire, S. E., Mao, Z. and Davis, R. L. (2004). Spatiotemporal gene expression targeting with the TARGET and gene-switch ... The glypicans Dally and Dlp in Wg gradient formation. One important finding in this work is that the glypicans Dally and Dlp ... Thus, as in the case of Hh and Dpp (Belenkaya et al., 2004; Han et al., 2004b), the glypican members Dally and Dlp, rather than ... Han, C., Belenkaya, T. Y., Wang, B. and Lin, X. (2004b). Drosophila glypicans control the cell-to-cell movement of Hedgehog by ...
Gene polymorphism rs1048369 of glypican-4 (GPC4) gene has been reported to be significantly different between Epstein-Barr ... The Glypican-4 Gene Polymorphism rs1048369 and Susceptibility to Epstein-Barr Virus-Positive and -Negative Nasopharyngeal ... The GPC4 gene polymorphism rs1048369 was detected in 143 cases of EBV-positive NPC and in 19 cases of EBV-negative NPC using ... The GPC4 gene polymorphism is associated with susceptibility to EBV-positive NPC. The CC genotype of GPC4 may represent a risk ...
Mutations in GPC3, a glypican gene, cause the Simpson-Golabi-Behmel overgrowth syndrome ... Glypican-3 promotes cell proliferation and tumorigenesis through up-regulation of β-catenin expression in lung squamous cell ... Glypican-3 (GPC3) is a cell surface proteoglycan anchored by glycosyl-phosphatidylinositol, which was first discovered in ... Differential expression of glypican-3 (GPC3) in lung squamous cell carcinoma and lung adenocarcinoma and its clinical ...
Glypican-3 Monoclonal Mouse Antibody (GPC3/863 + 1G12) Glypican-3 (GPC3) is an integral membrane protein that is mutated in the ... Glypican-3 (GPC3) is an integral membrane protein that is mutated in the Simpson-Golabi-Behmel syndrome (SGBS). SGBS is ... Glypican-3, a novel prognostic marker of hepatocellular cancer is related with postoperative metastasis and recurrence in ... Glypican-3 as a potential differential diagnosis marker for hepatocellular carcinoma: a tissue microarray-based study. Acta ...
Reporter Gene Assays. Chloride, pH, Zinc & Other Indicators. Enzyme Substrates. Flow Cytometry Accessory Products ... DGSX; Glypican proteoglycan 3; GPC3; GTR2-2; Heparan sulphate proteoglycan; Intestinal protein OCI-5; MXR7; OCI-5; SDYS; ... Expression and clinicopathologic significance of glypican 3 in hepatocellular carcinoma. Ann. Diagn. Pathol. 15: 162-169 ... A recombinant fragment containing amino acids 511-580 of human glypican-3 ...
Glypican-3 Hepatitis B XAntigen HER-2/neu Inhibitor of Differentiation and DNA Binding Protein LKB1 Gene Metastatic Tumor ... K-ras Gene Maspin Metastasis-Associated Gene 1 Microvascular Density Mucins Neurokinin-1 Receptor Nuclear Factor Kappa B ... 10 The Role of p53 and p73 Genes in Tumor Formation Gene Architecture of the p53 Family TP63 and TP73 Play Important Roles in ... Gene Expression Analysis by High-Density Oligonucleotide Array Procedure for Gene Selection. Statistical Analysis Results and ...
  • The GPC4 gene is adjacent to the 3' end of GPC3 and may also play a role in Simpson-Golabi-Behmel syndrome. (wikipedia.org)
  • Although no specific in vivo functions have thus far been described for these proteoglycans, spontaneous mutations in the human and induced deletions in the mouse glypican-3 (Gpc3) gene result in severe malformations and both pre- and postnatal overgrowth, known clinically as the Simpson-Golabi-Behmel syndrome (SGBS). (nih.gov)
  • Mice carrying mutant alleles of Gpc3 created by either targeted gene disruption or gene trapping display a wide range of phenotypes associated with SGBS including renal cystic dysplasia, ventral wall defects, and skeletal abnormalities that are consistent with the pattern of Gpc3 expression in the mouse embryo. (nih.gov)
  • Deletions and translocations involving the glypican-3 gene ( GPC3 ) have been shown to be associated with SGBS. (oup.com)
  • We have examined the mutational status of the GPC3 and GPC4 genes in one patient with Perlman. (oup.com)
  • We have examined the mutational status of the GPC3 and GPC4 genes in one patient with Perlman syndrome, three patients with overgrowth without syndrome diagnosis, ten unrelated SGBS-patients and 11 BWS patients. (oup.com)
  • The GPC3 gene provides instructions for making a protein called glypican 3. (medlineplus.gov)
  • More than 50 mutations in the GPC3 gene have been identified in people with Simpson-Golabi-Behmel syndrome. (medlineplus.gov)
  • Most of the mutations that cause Simpson-Golabi-Behmel syndrome delete part or all of the GPC3 gene, which prevents cells from producing functional glypican 3. (medlineplus.gov)
  • Mutations in the GPC3 gene prevent glypican 3 from inhibiting the hedgehog signaling pathway. (medlineplus.gov)
  • As a cell surface proteoglycan anchored by glycosyl-phosphatidylinositol, Glypican-3 (GPC3) is reported to be highly expressed in hepatocellular carcinoma (HCC) and to promote cell proliferation and tumorigenesis through activating Wnt/β-catenin signalling. (portlandpress.com)
  • Glypican-3 (GPC3) is an integral membrane protein that is mutated in the Simpson-Golabi-Behmel syndrome (SGBS). (biotium.com)
  • The mature form of human GPC3 has a protein core consisting of seven disulfide bonds that are highly conserved in the glypican family. (biomedcentral.com)
  • Glypican-3 (GPC3), an oncofetal proteoglycan anchored to the cell membrane, is normally detected in the fetal liver but not in the healthy adult liver. (wiley.com)
  • However, in HCC patients, GPC3 is overexpressed at both the gene and protein levels, and its expression predicts a poor prognosis. (wiley.com)
  • Glypican-3 (GPC3) gene, located in the Xq26 region, has lately emerged as being potentially implicated in hepatocellular carcinogenesis. (cdc.gov)
  • Moreover, GPC3 gene and protein expression levels were significantly higher in CC/C than in GG/G genotype carriers in males and females. (cdc.gov)
  • Gene and protein expression levels of GPC3 among the three studied groups ( A and B ), among the genotypes within each group ( C and D ) and among males and females within each group ( E and F ). Protein expression level is expressed as mean ± SD. (cdc.gov)
  • Gene expression level is expressed as ΔCt mean ± SD, where ΔCt = Ct value of GPC3 - Ct value of β-actin, higher gene expression is equivalent to a smaller ΔCt value. (cdc.gov)
  • Deletions in the heparan sulphate proteoglycan encoding glypican 3 (GPC3) gene have recently been documented in several Simpson-Golabi-Behmel syndrome (SGBS) families. (bmj.com)
  • We report here a 13 base pair deletion which causes a frameshift and premature termination of the GPC3 gene in the Dutch-Canadian SGBS family in whom the trait was originally mapped. (bmj.com)
  • Recently, a membrane associated heparan sulphate proteoglycan, glypican 3 (GPC3), has been identified as the SGBS gene. (bmj.com)
  • 3 GPC3 is a member of the glypican related integral membrane proteoglycans (GRIPS) which are linked to the cell surface via glycosyl phosphatidylinositol and modulate the interaction between growth factors and receptors. (bmj.com)
  • Deletions in the GPC3 gene have been found in a number of SGBS kindreds supplying strong evidence that such mutations are responsible for SGBS. (bmj.com)
  • PCR amplification of exon 2 of the GPC3 gene was performed using the oligonucleotide primers EX2 A (5′ gtttgccctgtttgccatg 3′) and EX2 B (5′ caaataatgatgccactaagc 3′) producing a 329 bp fragment in normal subjects. (bmj.com)
  • Background Glypican-3 (GPC3), a membrane-bound heparan sulphate proteoglycan, may play a role in promoting cancer cell growth and differentiation. (bmj.com)
  • However, it was shown that the glypican-3 (GPC3)-encoding gene is mutated in patients with Simpson-Golabi-Behmel syndrome, an X-linked disorder characterised by prenatal and postnatal overgrowth and a varying range of dysmorphisms. (bmj.com)
  • In addition, a gene reporter assay employing OT/OF plasmids confirmed the canonical Wnt pathway inhibition induced by GPC3. (aacrjournals.org)
  • LiCl treatment increases 10-fold the phosphorylation of GSK3B, as compared to LM3-GPC3 cells treated with NaCl, and induces an enhance of about 50% of the canonical Wnt transcriptional activity (gene reporter assay). (aacrjournals.org)
  • Glypican‑3 (GPC3) is a cell membrane glycoprotein that regulates cell growth and proliferation. (spandidos-publications.com)
  • The glypican-3 (GPC3) protein has emerged as a novel, promising target for cancer immunotherapy ( 1 ). (spandidos-publications.com)
  • GPC3 is a member of the membrane-bound heparan sulphate proteoglycan (glypican) family ( 2 ). (spandidos-publications.com)
  • We generated antibodies (HN3 and YP7) that bind glypican-3 (GPC3) on liver cancer cells. (cancer.gov)
  • Future investigative studies are recommended to define genotype-phenotype correlation and understand the GPC3/GPC4 gene‐product mechanism. (els.net)
  • Point mutations or microdeletions in GPC3 or duplication of GPC4 result in a premature termination codon and will be translated to a truncated protein or nonfunctional glypican‐3 or glypican‐4 protein. (els.net)
  • The cDNA and protein structure of the GPC3 gene and coding region. (els.net)
  • Ratbi I, Elalaoui SC, Moizard MP, Raynaud M and Sefiani A (2010) Novel nonsense mutation of GPC3 gene in a patient with Simpson‐Golabi‐Behmel syndrome. (els.net)
  • Glypican-3 (GPC3) is a cell surface proteoglycan anchored by glycosyl-phosphatidylinositol, which was first discovered in patients with Simpson-Golabi-Behmel syndrome [ 8 ]. (bioscirep.org)
  • Glypican-3(GPC3) has been implicated in tumor development and progression for several years. (biomedcentral.com)
  • Glypican-3 (GPC3), a member of the glypican family of heparan-sulfate proteoglycans (HSPGs), is bound to the plasma membrane through a glycosyl phosphatidylinositol (GPI) anchor. (biomedcentral.com)
  • Currently, some molecular biomarkers, such as α-fetoprotein (AFP), glypican 3 (GPC3), glutamine synthetase, (GS) and heat-shock protein 70 (HSP70), are available for HCC diagnosis in clinical practice, but the sensitivity and specificity are not satisfactory Therefore, the discovery of an objective molecular biomarker that would help to standardize histologic diagnosis of early-stage HCC and lead to appropriate treatment is eagerly anticipated. (bmbreports.org)
  • Glypican-3 (GPC3) is an oncogene, frequently upregulated in liver malignancies such as hepatocellular carcinoma (HCC) and hepatoblastoma and constitutes a potential molecular target for therapy in liver cancer. (oncotarget.com)
  • Glypican-1 is a protein that in humans is encoded by the GPC1 gene. (wikipedia.org)
  • Six glypicans have been identified in mammals (GPC1-GPC6), and two in Drosophila . (bmj.com)
  • Glypican-1 (GPC1), a cell-surface heparan sulfate proteoglycan, promotes the pathogenesis of many human cancers. (springer.com)
  • Most recently, a possible association with the gene GPC1, which encodes a glypican 1-a heparan sulfate proteoglycan, has been reported. (sages.org)
  • Orthologous to human GPC1 (glypican 1). (zfin.org)
  • Glypicans represent a family of six cell surface heparan sulfate proteoglycans in vertebrates. (nih.gov)
  • The glypicans comprise a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans, and they have been implicated in the control of cell growth and cell division. (nih.gov)
  • Glypicans are heparan sulfate proteoglycans which have a role in the control of cell growth and cell division. (oup.com)
  • LON-2 is a conserved member of the glypican family of heparan sulfate proteoglycans, a family with several members known to regulate growth-factor signaling in many organisms. (nih.gov)
  • Glypicans are a family of heparan sulphate proteoglycans that are linked to the exocytoplasmic surface of the plasma membrane through a glycosylphosphatidylinositol anchor. (bmj.com)
  • The main interest of the Topczewski laboratory is the developmental role of heparan sulfate proteoglycans from the glypican family. (luriechildrens.org)
  • The most down regulated gene is Glypican 4, a member of heparane sulfate proteoglycans. (ahajournals.org)
  • Serine protease with a variety of targets, including extracellular matrix proteins and proteoglycans such as biglycan, syndecan-4 and glypican-4. (xenbase.org)
  • p>This section provides information about the protein and gene name(s) and synonym(s) and about the organism that is the source of the protein sequence. (uniprot.org)
  • See the other reference sequence protein isoform for the Gpc4 gene (NP_001014130.1). (nih.gov)
  • Glypican-4 is a protein that in humans is encoded by the GPC4 gene. (wikipedia.org)
  • Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. (wikipedia.org)
  • GPC4 (Glypican 4) is a Protein Coding gene. (genecards.org)
  • One frameshift, three nonsense, and one splice mutation predict a loss-of-function of the glypican-3 protein. (oup.com)
  • Recombinant protein encompassing a sequence within the center region of human Glypican 5. (genetex.com)
  • This protein is one of several glypicans in humans, each of which consists of a core protein attached to long sugar molecules called heparan sulfate chains. (medlineplus.gov)
  • Researchers believe that in some cell types, glypican 3 may act as a tumor suppressor, which is a protein that prevents cells from growing and dividing in an uncontrolled way to form a cancerous tumor. (medlineplus.gov)
  • Other mutations insert or delete a small amount of genetic material in the gene, or change one or a few protein building blocks (amino acids) in glypican 3. (medlineplus.gov)
  • Here, we systematically analyzed the roles of glypicans Dally and Dally-like protein (Dlp), the Wg receptors Frizzled (Fz) and Fz2, and the Wg co-receptor Arrow (Arr) in Wg gradient formation in the wing disc. (biologists.org)
  • Despite the variation in RNA splice products of the Cmdsx gene, only four protein isoforms are predicted. (biomedcentral.com)
  • Generation of a biological association network evidenced several genes, such as connective tissue growth factor (Ctgf), tissue inhibitor of metalloproteinase 1 (Timp1), galanin (Gal), synaptotagmin 1 (Syt1), growth factor receptor bound protein 2 (Grb2), actin gamma 2 (Actg2) and smooth muscle alpha actin (Acta2), as highly interconnected nodes of the resulting network. (biomedcentral.com)
  • The glypican‐3 protein mediates embryonic and cell‐specific tissue formation and development by regulating growth factors. (els.net)
  • The protein encoded by this gene belongs to the MYST family of histone acetyl transferases (HATs) and was originally isolated as an HIV-1 TAT-interactive protein. (cancerindex.org)
  • What does this gene/protein do? (cancerindex.org)
  • What pathways are this gene/protein implicaed in? (cancerindex.org)
  • Null mutations in rsfA have different effects on the expression of sigma(F)-dependent genes, suggesting that the RsfA protein is a regulator of transcription that fine-tunes gene expression in the prespore. (labome.org)
  • In addition to the association of mutations in the gene and the abnormally low levels of this protein in human cases, knock out mutants in zebra fish develop similar lesions in the liver. (sages.org)
  • This set of genes included molecules involved in cell cycle and apoptosis regulation, epithelial-mesenchymal transition (EMT), signal transduction, nucleic acid binding and transcription, protein synthesis and degradation, metabolism, and a specific group of melanoma- and neural-related proteins. (aacrjournals.org)
  • Human liver cancer stained with anti-Glypican-3 Antibody Cat. (acris-antibodies.com)
  • Western Blot of HepG2 cell lysate with anti-Glypican-3 Antibody Cat. (acris-antibodies.com)
  • Flow Cytometric analysis of Rabbit anti-Glypican-3 Antibody Cat. (acris-antibodies.com)
  • Formalin-Fixed, Paraffin-Embedded Human hepatocellular carcinoma stained with Glypican-3 antibody Cat. (acris-antibodies.com)
  • The following antibody was used in this experiment: Glypican 1 Polyclonal Antibody from Thermo Fisher Scientific, catalog # PA5-86043, RRID AB_2802844. (thermofisher.com)
  • There are currently no references for Glypican 5 antibody [N2C3] (GTX104125) . (genetex.com)
  • Glypican 4 Monoclonal antibody specifically detects Glypican 4 in Human samples. (fishersci.com)
  • Dr. Ho's laboratory develops new antibody engineering technologies and applies them to advance the development of antibody therapeutics with a focus on glypicans as a new family of tumor antigens. (cancer.gov)
  • Mouse Anti Human Glypican-4 GPC4 antibody storage GENTAUR recommends for long therm storage to freeze at -24 C. For short time storage up to 30 days we suggest fridge storage at 1 to 10 C. Prevent multiple freeze taw cycles of Mouse Anti Human Glypican-4 GPC4. (antibody-antibodies.com)
  • See reference mRNA sequence for the Gpc4 gene (XM_006257580.3). (nih.gov)
  • Occasionally, these deletions also include the glypican-4 gene ( GPC4 ). (oup.com)
  • We found three single nucleotide polymorphisms in the GPC4 gene but no evidence for loss-of-function mutations in GPC4 associated with SGBS. (oup.com)
  • Gene polymorphism rs1048369 of glypican-4 (GPC4) gene has been reported to be significantly different between Epstein-Barr virus (EBV)-associated gastric carcinoma (GC) and EBV-negative GC. (cdc.gov)
  • The GPC4 gene polymorphism rs1048369 was detected in 143 cases of EBV-positive NPC and in 19 cases of EBV-negative NPC using polymerase chain reaction. (cdc.gov)
  • Between EBV-negative NPC cases and healthy individuals, there was no significant difference in GPC4 gene polymorphism in both genotypic and allelic frequencies. (cdc.gov)
  • The GPC4 gene polymorphism is associated with susceptibility to EBV-positive NPC. (cdc.gov)
  • Here we demonstrate that while vang-like 2 (vangl2), wnt11 and scribbled (scrib) mutants have severe craniofacial morphogenesis defects they do not display the chondrocyte stacking and intercalation problems seen in glypican 4 (gpc4) and wnt5b mutants. (zfin.org)
  • Mouse Anti Human Glypican-4 GPC4 Human samples 80 % of the research is conducted on human samples. (antibody-antibodies.com)
  • GENTAUR suppliers human normal cells, cell lines, RNA extracts and lots of antibodies and ELISA kits to Human proteins as well as Mouse Anti Human Glypican-4 GPC4. (antibody-antibodies.com)
  • The glypican encoded by this gene is a putative cell surface coreceptor for growth factors, extracellular matrix proteins, proteases and anti-proteases. (nih.gov)
  • The cell surface proteins Glypicans act as gatekeepers of environmental signals to modulate their perception by target cells. (nih.gov)
  • Glypicans are anchored to the outer cell membrane, where they interact with a variety of other proteins outside the cell. (medlineplus.gov)
  • Several studies have found that glypican 3 interacts with other proteins at the surface of cells to restrain cell proliferation. (medlineplus.gov)
  • Research suggests that in certain types of cells, such as cells in the liver, glypican 3 may interact with proteins called growth factors to promote cell growth and cell division. (medlineplus.gov)
  • Genetic and functional studies showed that glypicans regulate the signalling activity of various morphogens, including Wnts, hedgehogs, bone morphogenic proteins and fibroblast growth factors. (bmj.com)
  • Food components play a role in influencing, either directly or indirectly (through hormonal regulation), the expression of genes encoding for proteins involved in energy metabolism, cell differentiation and growth and immune responses. (biomedcentral.com)
  • In particular, Dr. Ho works towards understanding the biology of cancers driven by cell surface proteins, such as glypicans (e.g. (cancer.gov)
  • Smith M, Dawson S, Latchman D. The Brn-3a transcription factor induces neuronal process outgrowth and the coordinate expression of genes encoding synaptic proteins. (labome.org)
  • The development of high-throughput screening techniques in genomics and proteomics has enabled the analysis of the expression of multiple genes and proteins in large series of tumor samples ( 1 ) and may contribute to the resolution of some specific issues of clinical relevance, such as identifying the steps for melanoma progression and metastasis. (aacrjournals.org)
  • Previous studies in Drosophila have implicated glypicans in the signaling of decapentaplegic, a BMP homolog. (nih.gov)
  • We show that Dally and Dally-like (Dly), two Drosophila glypican members of the heparan sulphate proteoglycan (HSPG) family, are the substrates of Ttv and are essential for Hh movement. (biologists.org)
  • LON-2 is functionally conserved because the Drosophila glypican gene dally rescues the lon-2(lf) body-size defect. (nih.gov)
  • We have previously reported that Dally, one of the glypican members in Drosophila , is required in the niche for the maintenance of germline stem cells (GSCs) via short-range BMP signaling in ovary. (biologists.org)
  • Combining yeast and fruit fly genetics, we illustrate that Dally is under the transcriptional control of Notch signaling via the transcription factor Su(H). Further, we assayed human glypicans and disease-associated variants in Drosophila ovary, which can serve as an effective system to evaluate the structure-function relationship of human homologs. (biologists.org)
  • Mutations in this gene are associated with omodysplasia 1. (nih.gov)
  • Mutations in the glypican genes are associated with human syndromes resulting in skeleton dysplasias and frequently in mental retardation. (luriechildrens.org)
  • Mutations in the glypican 4 gene result in defects in cell migration during gastrulation ( Topczewski J et al . (luriechildrens.org)
  • Current strategies depend on modelling progression as the balanced outcome of mutations in, and expression of, tumour suppressor genes and oncogenes. (cancerindex.org)
  • They also found recurrent mutations in several genes whose mechanisms in prostate cancer development are not yet well understood, as well as thousands of individual, or 'personal,' mutations unique to individual tumors. (fredhutch.org)
  • In addition, mutations in the human Jagged1 gene, which are responsible for Alagille syndrome, have been found in a few cases of BA. (sages.org)
  • Dr. Lin has identified and characterized two mutations, sugarless and sulfateless, which occur in the genes that encode essential enzymes for the biosynthesis of heparin/heparin sulfate glycosaminoglycan (HSPG). (cincinnatichildrens.org)
  • This is the first report of a glypican directly interacting with a growth-factor pathway in C. elegans and provides a mechanistic model for glypican regulation of growth-factor pathways. (nih.gov)
  • Glypican-1 controls brain size through regulation of fibroblast growth factor signaling in early neurogenesis. (springer.com)
  • However, the effects of microRNA-1303 (miR-1303) on gastric cancer (GC) cells and the upstream regulation of GC-associated claudin-18 gene (CLDN18) remain unclear. (springer.com)
  • Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans . (springer.com)
  • microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. (cancerindex.org)
  • The gene signature of imatinib-response in GISTs showed alterations of cell cycle control as well as up-regulation of genes involved in muscle differentiation and function. (aacrjournals.org)
  • It is involved in the regulation of the hedgehog gene and inflammation. (sages.org)
  • F. Deuel, where he studied the transcriptional regulation of platelet-derived growth factor A-chain gene. (cincinnatichildrens.org)
  • Song HH, Filmus J. The role of glypicans in mammalian development. (springer.com)
  • We are particularly interested in the role of Glypicans in the control of skeleton formation and patterning of the nervous system. (luriechildrens.org)
  • However, the role of glypicans in cancer pathogenesis is poorly understood. (cancer.gov)
  • Song H and Filmus J (2002) The role of glypicans in mammalian development. (els.net)
  • Synthetic peptide derived from the C terminal of Human Glypican 3. (abcam.com)
  • Prediluted ab95364 staining Glypican 3 in formalin-fixed, paraffin-embedded Human liver cancer tissue by Immunohistochemistry. (abcam.com)
  • Explore the normal functions of human genes and the health implications of genetic changes. (medlineplus.gov)
  • 2016. Allelic imbalance of multiple sclerosis susceptibility genes IKZF3 and IQGAP1 in human peripheral blood. (uib.no)
  • Polymorphisms of Interleukins, Glypican, and Human Leukocyte Antigen Genes and Treatment Response in Multiple Sclerosis. (clinicaltrials.gov)
  • Genetic: Polymorphism of Interleukins, Glypican, and Human Leukocyte Antigen Genes. (clinicaltrials.gov)
  • Multiple Sclerosis Risk Conferred by Single Nucleotide Polymorphisms (SNPs) of Interleukins, Glypican, and Human Leukocyte Antigen Genes. (clinicaltrials.gov)
  • Detects human Glypican 4 in direct ELISAs. (fishersci.com)
  • Chamorro-Jorganes A, Araldi E, Rotllan N, Cirera-Salinas D, Suarez Y. Autoregulation of glypican-1 by intronic microRNA-149 fine tunes the angiogenic response to FGF2 in human endothelial cells. (springer.com)
  • Glypican-1 is frequently overexpressed in human gliomas and enhances FGF-2 signaling in glioma cells. (springer.com)
  • Our long-term goal is the identification of signaling pathways that will suggest novel candidate genes involved in human congenital abnormalities and diseases. (luriechildrens.org)
  • E-Cadherin gene promoter hypermethylation in primary human gastric carcinomas. (springer.com)
  • Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. (springer.com)
  • Embryonal Sarcoma, also known as undifferentiated sarcoma , is related to undifferentiated embryonal sarcoma of the liver and fibrous histiocytoma , and has symptoms including fever An important gene associated with Embryonal Sarcoma is SERPINA3 (Serpin Family A Member 3), and among its related pathways/superpathways are Endometrial cancer and PI3K-Akt signaling pathway . (malacards.org)
  • Glypicans are important modulators of signal transduction pathways in development and disease. (cancer.gov)
  • An important gene associated with Ovarian Primitive Germ Cell Tumor is AFP (Alpha Fetoprotein), and among its related pathways/superpathways are Wnt / Hedgehog / Notch and Cardiac Progenitor Differentiation . (malacards.org)
  • Specifically, glypican 3 blocks (inhibits) a developmental pathway called the hedgehog signaling pathway. (medlineplus.gov)
  • We investigate functions of Glypicans in the Wnt signaling pathway, controlling cell fate proliferation and behavior. (luriechildrens.org)
  • 2012). Normal signaling of the separate Wnt signaling pathway, Wnt-PCP, requires activity of Glypican 4. (luriechildrens.org)
  • 8). The Jagged1 gene encodes a ligand in the Notch signaling pathway, which is critical in the determination of cell fate during development and may also alter production of inflammatory cytokines. (sages.org)
  • These include four syndecans, six glypicans, and one each of perlecan, agrin, and the hybrid HSPG/collagen type XVIII. (jci.org)
  • Dr. Lin further demonstrated that glypican members of HSPG play key roles in Wg signaling and the formation of Wg morphogen gradient. (cincinnatichildrens.org)
  • This gene encodes an enzyme with hydroxypyruvate reductase, glyoxylate reductase, and D-glycerate dehydrogenase enzymatic activities. (creative-biolabs.com)
  • Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. (springer.com)
  • and GPC6, a gene that encodes glypican-6, which regulates cell growth and division. (fredhutch.org)
  • We strongly encourage the development of nomenclature schemes using a "stem" (or "root") symbol for members of a gene family or grouping, with a hierarchical numbering system to distinguish the individual members. (genenames.org)
  • To avoid confusion, the HGNC approved stem symbols are highlighted in bold (within red brackets) and the approved HGNC Gene Family groups without a common "stem" symbol are also highlighted in bold , both are linked to the Nomenclature Database . (genenames.org)
  • We identified a total of 16 alternative splice variants of the Cmdsx gene that code for up to 14 separate exons. (biomedcentral.com)
  • The syndrome is caused by pathogenic variants in the glypican-3 gene ( GPCFF3 -Gene) on chromosome X. It is inherited in an X-chromosomal recessive manner [ 5 ]. (mdpi.com)
  • Treatment outcome of chronic low back pain and radiographic lumbar disc degeneration are associated with inflammatory and matrix degrading gene variants: a prospective genetic association study. (oslo-universitetssykehus.no)
  • Genetic studies in NTDs have focused mainly on folate-related genes and identified a few significant associations between variants in these genes and an increased risk for NTDs. (jove.com)
  • Alternative splicing of this gene results in multiple transcript variants. (cancerindex.org)
  • Most studies in MS have focused on the identification of pharmacogenetic markers, using either the candidate-gene approach, which requires prior knowledge of the genetic marker and its role in the target disease, or genome-wide association, which examines multiple genetic variants, typically single nucleotide polymorphisms (SNPs). (hindawi.com)
  • These results indicate that rare NSCL/P risk variants can be found in members of the gene regulatory network governing periderm differentiation. (labome.org)
  • First, overexpression of Fz2 in the wing disc stabilizes Wg and expands the range of Wg-target gene expression. (biologists.org)
  • Overexpression of glypican-1 implicates poor prognosis and their chemoresistance in oesophageal squamous cell carcinoma. (springer.com)
  • Ultrastructurally, a subset of tumors showed a smooth muscle phenotype, which correlated with overexpression of genes involved in muscle differentiation and function. (aacrjournals.org)
  • Notably, we demonstrated that aberrant SF3B4 overexpression altered the progress of splicing progress of the tumor suppressor gene, kruppel like factor 4 ( KLF4 ), and resulted in non-functional skipped exon transcripts. (bmbreports.org)
  • This previously unknown link between glypican-3 and BMP4 function provides evidence of a role for glypicans in vertebrate limb patterning and skeletal development and suggests a mechanism for the skeletal defects seen in SGBS. (nih.gov)
  • Extracellular glypicans play pivotal roles in organogenesis, stem cell maintenance and cancer development. (biologists.org)
  • Global gene expression profiling was performed for 4 normal (control) livers as well as 8 background liver and 7 HCC from 3 patients with hereditary haemochromatosis (HH) undergoing surgery. (pubmedcentralcanada.ca)
  • The present study aims to take advantage of the systems biology approach on genome wide gene expression profiling datasets to identify the potential biomarkers involved at stage I, stage II, stage III, and stage IV as well as in the integrated group. (nature.com)
  • Moreover, miR-4510 up-regulated the expression of several tumor suppressor genes while reducing the expression of other pro-oncogenes. (oncotarget.com)
  • a href='/help/gene_ontology' target='_top'>More. (uniprot.org)
  • Gene Ontology (GO) annotations related to this gene include heparan sulfate proteoglycan binding . (genecards.org)
  • We might expect a repertoire of differentially expressed genes defining the metastatic phenotype for primary CMM cases. (aacrjournals.org)
  • The analysis of gene expression profiles to identify differentially expressed genes (DEGs) was performed after preprocessing and normalization of data. (nature.com)
  • J:112804 Calmont A, Wandzioch E, Tremblay KD, Minowada G, Kaestner KH, Martin GR, Zaret KS, An FGF response pathway that mediates hepatic gene induction in embryonic endoderm cells. (jax.org)
  • Glypican 5 appeared overexpressed in high-grade tumors with epithelial differentiation, and not in those that displayed a neuroendocrine phenotype. (frontiersin.org)
  • Thus, Brn-3a appears to play a critical role in the specification of the mature neuronal phenotype, acting by stimulating the expression of genes whose products are required for process outgrowth and synapse formation. (labome.org)
  • Our results suggest that EMT-related genes contribute to the promotion of the metastatic phenotype in primary CMM by supporting specific adhesive, invasive, and migratory properties. (aacrjournals.org)
  • Analysis of the transcription of the genes responsible for the production of CS showed a decline in the expression of some genes in poorly differentiated compared to well-differentiated tumors. (frontiersin.org)
  • Whilst elevated glypican 1 expression has been documented in different tumors, the downregulation in high-grade tumors observed in this work suggests that this proteoglycan could be involved in cancer development in a more complex and context-dependent manner than previously thought. (frontiersin.org)
  • GPC2 silencing inactivates Wnt/β-catenin signaling and reduces the expression of the target gene N-Myc, an oncogenic driver of neuroblastoma tumorigenesis. (cancer.gov)
  • However, the growth phenotypes associated with different levels of glypican are not consistent in development or tumorigenesis. (biologists.org)
  • This contributes to liver tumorigenesis via transcriptional inactivation of p27 Kip1 and simultaneous activation of Slug genes. (bmbreports.org)
  • Gene-specific PCR primers for the unbiased preamplification of small quantities of cDNA for subsequent use in downstream gene expression analysis. (bio-rad.com)
  • To understand the mechanisms of CMM metastasis and identify potential predictive markers, we analyzed gene-expression profiles of 34 vertical growth phase melanoma cases using cDNA microarrays. (aacrjournals.org)
  • rs2267531, a promoter SNP within glypican-3 gene in the X chromosome, is associated with hepatocellular carcinoma in Egyptians. (cdc.gov)
  • Increasing evidence has identified that low expression of tumour suppressor genes and/or hyper-activation of oncogenes obviously accelerates the occurrence and development of lung SCC [ 4-7 ]. (portlandpress.com)
  • Five distinct classes of cell surface and pericellular HSPGs (Figure 1 ), representing the products of only 13 genes, probably account for at least 95% of the heparan sulfate of mammalian cell surfaces, basement membranes, and ECMs, while the remainder consists of several "part-time" HSPGs, such as betaglycan, CD44/epican, and testican. (jci.org)
  • A comparison of six mammalian glypican members. (els.net)
  • We propose that glypicans transfer Hh along the cell membrane to pattern a field of cells. (biologists.org)
  • In contrast, normal neuroendocrine cells were positive for glypican 1, displaying intense staining in cytoplasm and membrane. (frontiersin.org)
  • The cell-associated HSPGs include four integral membrane syndecans and six glycosyl-phosphatidylinositol-anchored (GPI-anchored) glypicans. (jci.org)
  • Furthermore, the identified genes were validated not only by using several classification models but also through screening the experimental literature reports on the target genes. (nature.com)
  • 1994) Gene for Simpson‐Golabi‐Behmel syndrome is linked to HPRT in Xq26 in two European families. (els.net)
  • Increased beta-catenin mRNA levels and mutational alterations of the APC and beta-catenin gene are present in intestinal-type gastric cancer. (springer.com)
  • Only few genes have been confidently identified to be involved in the Follicular (FO) and Marginal Zone (MZ) B cell differentiation, migration, and retention in the periphery. (bionity.com)
  • But, the multidimensional interaction of tumor, tumor associated antigen (TAA) and normal tissue exacerbates the uncontrolled outcome of T cells gene therapy. (jcancer.org)
  • Adoptive T cell therapy, Tumor immunotherapy, Gene-engineered T cell, Tumor associated antigen, Viral vectors and non-viral vectors. (jcancer.org)