Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in plants.
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.
Small double-stranded, non-protein coding RNAs, 21-25 nucleotides in length generated from single-stranded microRNA gene transcripts by the same RIBONUCLEASE III, Dicer, that produces small interfering RNAs (RNA, SMALL INTERFERING). They become part of the RNA-INDUCED SILENCING COMPLEX and repress the translation (TRANSLATION, GENETIC) of target RNA by binding to homologous 3'UTR region as an imperfect match. The small temporal RNAs (stRNAs), let-7 and lin-4, from C. elegans, are the first 2 miRNAs discovered, and are from a class of miRNAs involved in developmental timing.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
RNA which does not code for protein but has some enzymatic, structural or regulatory function. Although ribosomal RNA (RNA, RIBOSOMAL) and transfer RNA (RNA, TRANSFER) are also untranslated RNAs they are not included in this scope.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.
The material of CHROMOSOMES. It is a complex of DNA; HISTONES; and nonhistone proteins (CHROMOSOMAL PROTEINS, NON-HISTONE) found within the nucleus of a cell.
The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in archaea.
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in fungi.
A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
The pattern of GENE EXPRESSION at the level of genetic transcription in a specific organism or under specific circumstances in specific cells.
The extent to which an RNA molecule retains its structural integrity and resists degradation by RNASE, and base-catalyzed HYDROLYSIS, under changing in vivo or in vitro conditions.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.
Established cell cultures that have the potential to propagate indefinitely.
Interacting DNA-encoded regulatory subsystems in the GENOME that coordinate input from activator and repressor TRANSCRIPTION FACTORS during development, cell differentiation, or in response to environmental cues. The networks function to ultimately specify expression of particular sets of GENES for specific conditions, times, or locations.
A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
The sequence at the 3' end of messenger RNA that does not code for product. This region contains transcription and translation regulating sequences.
A multistage process that includes cloning, physical mapping, subcloning, sequencing, and information analysis of an RNA SEQUENCE.
The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.
A genetic process by which the adult organism is realized via mechanisms that lead to the restriction in the possible fates of cells, eventually leading to their differentiated state. Mechanisms involved cause heritable changes to cells without changes to DNA sequence such as DNA METHYLATION; HISTONE modification; DNA REPLICATION TIMING; NUCLEOSOME positioning; and heterochromatization which result in selective gene expression or repression.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.
A cell line derived from cultured tumor cells.
A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.
Small chromosomal proteins (approx 12-20 kD) possessing an open, unfolded structure and attached to the DNA in cell nuclei by ionic linkages. Classification into the various types (designated histone I, histone II, etc.) is based on the relative amounts of arginine and lysine in each.
Addition of methyl groups to DNA. DNA methyltransferases (DNA methylases) perform this reaction using S-ADENOSYLMETHIONINE as the methyl group donor.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in leukemia.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Sequential operating programs and data which instruct the functioning of a digital computer.
A set of statistical methods used to group variables or observations into strongly inter-related subgroups. In epidemiology, it may be used to analyze a closely grouped series of events or cases of disease or other health-related phenomenon with well-defined distribution patterns in relation to time or place or both.
Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.
The simultaneous analysis, on a microchip, of multiple samples or targets arranged in an array format.
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Processes that stimulate the GENETIC TRANSCRIPTION of a gene or set of genes.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
A technique that localizes specific nucleic acid sequences within intact chromosomes, eukaryotic cells, or bacterial cells through the use of specific nucleic acid-labeled probes.
Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
Methods used for detecting the amplified DNA products from the polymerase chain reaction as they accumulate instead of at the end of the reaction.
Elements of limited time intervals, contributing to particular results or situations.
A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.
Enzymes that oxidize certain LUMINESCENT AGENTS to emit light (PHYSICAL LUMINESCENCE). The luciferases from different organisms have evolved differently so have different structures and substrates.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Proteins encoded by homeobox genes (GENES, HOMEOBOX) that exhibit structural similarity to certain prokaryotic and eukaryotic DNA-binding proteins. Homeodomain proteins are involved in the control of gene expression during morphogenesis and development (GENE EXPRESSION REGULATION, DEVELOPMENTAL).
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
Characteristic restricted to a particular organ of the body, such as a cell type, metabolic response or expression of a particular protein or antigen.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Databases devoted to knowledge about specific genes and gene products.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
The statistical reproducibility of measurements (often in a clinical context), including the testing of instrumentation or techniques to obtain reproducible results. The concept includes reproducibility of physiological measurements, which may be used to develop rules to assess probability or prognosis, or response to a stimulus; reproducibility of occurrence of a condition; and reproducibility of experimental results.
DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.
Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.
A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Nucleic acid sequences involved in regulating the expression of genes.
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
Interruption or suppression of the expression of a gene at transcriptional or translational levels.
Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter.
Partial cDNA (DNA, COMPLEMENTARY) sequences that are unique to the cDNAs from which they were derived.
Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions.
A technique for identifying specific DNA sequences that are bound, in vivo, to proteins of interest. It involves formaldehyde fixation of CHROMATIN to crosslink the DNA-BINDING PROTEINS to the DNA. After shearing the DNA into small fragments, specific DNA-protein complexes are isolated by immunoprecipitation with protein-specific ANTIBODIES. Then, the DNA isolated from the complex can be identified by PCR amplification and sequencing.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.
A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.
Proteins found in any species of bacterium.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.
The functional hereditary units of PLANTS.
Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.
The systematic study of the complete DNA sequences (GENOME) of organisms.
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
A group of enzymes that catalyzes the hydrolysis of terminal, non-reducing beta-D-galactose residues in beta-galactosides. Deficiency of beta-Galactosidase A1 may cause GANGLIOSIDOSIS, GM1.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
An enzyme that catalyzes the acetylation of chloramphenicol to yield chloramphenicol 3-acetate. Since chloramphenicol 3-acetate does not bind to bacterial ribosomes and is not an inhibitor of peptidyltransferase, the enzyme is responsible for the naturally occurring chloramphenicol resistance in bacteria. The enzyme, for which variants are known, is found in both gram-negative and gram-positive bacteria. EC 2.3.1.28.
Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.
Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.
The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.
Genes that are introduced into an organism using GENE TRANSFER TECHNIQUES.
Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.
An electrophoretic technique for assaying the binding of one compound to another. Typically one compound is labeled to follow its mobility during electrophoresis. If the labeled compound is bound by the other compound, then the mobility of the labeled compound through the electrophoretic medium will be retarded.
Genes that show rapid and transient expression in the absence of de novo protein synthesis. The term was originally used exclusively for viral genes where immediate-early referred to transcription immediately following virus integration into the host cell. It is also used to describe cellular genes which are expressed immediately after resting cells are stimulated by extracellular signals such as growth factors and neurotransmitters.
Transport proteins that carry specific substances in the blood or across cell membranes.
Proteins that are coded by immediate-early genes, in the absence of de novo protein synthesis. The term was originally used exclusively for viral regulatory proteins that were synthesized just after viral integration into the host cell. It is also used to describe cellular proteins which are synthesized immediately after the resting cell is stimulated by extracellular signals.
Proteins whose abnormal expression (gain or loss) are associated with the development, growth, or progression of NEOPLASMS. Some neoplasm proteins are tumor antigens (ANTIGENS, NEOPLASM), i.e. they induce an immune reaction to their tumor. Many neoplasm proteins have been characterized and are used as tumor markers (BIOMARKERS, TUMOR) when they are detectable in cells and body fluids as monitors for the presence or growth of tumors. Abnormal expression of ONCOGENE PROTEINS is involved in neoplastic transformation, whereas the loss of expression of TUMOR SUPPRESSOR PROTEINS is involved with the loss of growth control and progression of the neoplasm.
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
The performance of dissections with the aid of a microscope.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
RNA present in neoplastic tissue.
Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.
Non-antibody proteins secreted by inflammatory leukocytes and some non-leukocytic cells, that act as intercellular mediators. They differ from classical hormones in that they are produced by a number of tissue or cell types rather than by specialized glands. They generally act locally in a paracrine or autocrine rather than endocrine manner.
The relationship between the dose of an administered drug and the response of the organism to the drug.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
The genetic unit consisting of three structural genes, an operator and a regulatory gene. The regulatory gene controls the synthesis of the three structural genes: BETA-GALACTOSIDASE and beta-galactoside permease (involved with the metabolism of lactose), and beta-thiogalactoside acetyltransferase.
A strain of albino rat developed at the Wistar Institute that has spread widely at other institutions. This has markedly diluted the original strain.
Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Ribonucleic acid in plants having regulatory and catalytic roles as well as involvement in protein synthesis.
Serum glycoprotein produced by activated MACROPHAGES and other mammalian MONONUCLEAR LEUKOCYTES. It has necrotizing activity against tumor cell lines and increases ability to reject tumor transplants. Also known as TNF-alpha, it is only 30% homologous to TNF-beta (LYMPHOTOXIN), but they share TNF RECEPTORS.
Formation of an acetyl derivative. (Stedman, 25th ed)
The entity of a developing mammal (MAMMALS), generally from the cleavage of a ZYGOTE to the end of embryonic differentiation of basic structures. For the human embryo, this represents the first two months of intrauterine development preceding the stages of the FETUS.
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
Proteins that originate from plants species belonging to the genus ARABIDOPSIS. The most intensely studied species of Arabidopsis, Arabidopsis thaliana, is commonly used in laboratory experiments.
Proteins prepared by recombinant DNA technology.
The introduction of functional (usually cloned) GENES into cells. A variety of techniques and naturally occurring processes are used for the gene transfer such as cell hybridization, LIPOSOMES or microcell-mediated gene transfer, ELECTROPORATION, chromosome-mediated gene transfer, TRANSFECTION, and GENETIC TRANSDUCTION. Gene transfer may result in genetically transformed cells and individual organisms.
Tumors or cancer of the human BREAST.
The unfavorable effect of environmental factors (stressors) on the physiological functions of an organism. Prolonged unresolved physiological stress can affect HOMEOSTASIS of the organism, and may lead to damaging or pathological conditions.
Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.
The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.
A species of fruit fly much used in genetics because of the large size of its chromosomes.
Intracellular receptors that can be found in the cytoplasm or in the nucleus. They bind to extracellular signaling molecules that migrate through or are transported across the CELL MEMBRANE. Many members of this class of receptors occur in the cytoplasm and are transported to the CELL NUCLEUS upon ligand-binding where they signal via DNA-binding and transcription regulation. Also included in this category are receptors found on INTRACELLULAR MEMBRANES that act via mechanisms similar to CELL SURFACE RECEPTORS.
Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.
Any method used for determining the location of and relative distances between genes on a chromosome.
Mathematical procedure that transforms a number of possibly correlated variables into a smaller number of uncorrelated variables called principal components.
A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.
The developmental entity of a fertilized egg (ZYGOTE) in animal species other than MAMMALS. For chickens, use CHICK EMBRYO.
Promoter-specific RNA polymerase II transcription factor that binds to the GC box, one of the upstream promoter elements, in mammalian cells. The binding of Sp1 is necessary for the initiation of transcription in the promoters of a variety of cellular and viral GENES.
The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.
An anti-inflammatory 9-fluoro-glucocorticoid.
Cellular DNA-binding proteins encoded by the c-fos genes (GENES, FOS). They are involved in growth-related transcriptional control. c-fos combines with c-jun (PROTO-ONCOGENE PROTEINS C-JUN) to form a c-fos/c-jun heterodimer (TRANSCRIPTION FACTOR AP-1) that binds to the TRE (TPA-responsive element) in promoters of certain genes.
Deacetylases that remove N-acetyl groups from amino side chains of the amino acids of HISTONES. The enzyme family can be divided into at least three structurally-defined subclasses. Class I and class II deacetylases utilize a zinc-dependent mechanism. The sirtuin histone deacetylases belong to class III and are NAD-dependent enzymes.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Addition of methyl groups. In histo-chemistry methylation is used to esterify carboxyl groups and remove sulfate groups by treating tissue sections with hot methanol in the presence of hydrochloric acid. (From Stedman, 25th ed)
The functional hereditary units of BACTERIA.
Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.
Molecular products metabolized and secreted by neoplastic tissue and characterized biochemically in cells or body fluids. They are indicators of tumor stage and grade as well as useful for monitoring responses to treatment and predicting recurrence. Many chemical groups are represented including hormones, antigens, amino and nucleic acids, enzymes, polyamines, and specific cell membrane proteins and lipids.
A subtype of striated muscle, attached by TENDONS to the SKELETON. Skeletal muscles are innervated and their movement can be consciously controlled. They are also called voluntary muscles.
A pathological process characterized by injury or destruction of tissues caused by a variety of cytologic and chemical reactions. It is usually manifested by typical signs of pain, heat, redness, swelling, and loss of function.
A factor synthesized in a wide variety of tissues. It acts synergistically with TGF-alpha in inducing phenotypic transformation and can also act as a negative autocrine growth factor. TGF-beta has a potential role in embryonal development, cellular differentiation, hormone secretion, and immune function. TGF-beta is found mostly as homodimer forms of separate gene products TGF-beta1, TGF-beta2 or TGF-beta3. Heterodimers composed of TGF-beta1 and 2 (TGF-beta1.2) or of TGF-beta2 and 3 (TGF-beta2.3) have been isolated. The TGF-beta proteins are synthesized as precursor proteins.
The artificial induction of GENE SILENCING by the use of RNA INTERFERENCE to reduce the expression of a specific gene. It includes the use of DOUBLE-STRANDED RNA, such as SMALL INTERFERING RNA and RNA containing HAIRPIN LOOP SEQUENCE, and ANTI-SENSE OLIGONUCLEOTIDES.
The rate dynamics in chemical or physical systems.
A family of DNA-binding transcription factors that contain a basic HELIX-LOOP-HELIX MOTIF.
An exotic species of the family CYPRINIDAE, originally from Asia, that has been introduced in North America. They are used in embryological studies and to study the effects of certain chemicals on development.
The relatively long-lived phagocytic cell of mammalian tissues that are derived from blood MONOCYTES. Main types are PERITONEAL MACROPHAGES; ALVEOLAR MACROPHAGES; HISTIOCYTES; KUPFFER CELLS of the liver; and OSTEOCLASTS. They may further differentiate within chronic inflammatory lesions to EPITHELIOID CELLS or may fuse to form FOREIGN BODY GIANT CELLS or LANGHANS GIANT CELLS. (from The Dictionary of Cell Biology, Lackie and Dow, 3rd ed.)
The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.
Genes whose abnormal expression, or MUTATION are associated with the development, growth, or progression of NEOPLASMS.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
A multiprotein complex composed of the products of c-jun and c-fos proto-oncogenes. These proteins must dimerize in order to bind to the AP-1 recognition site, also known as the TPA-responsive element (TRE). AP-1 controls both basal and inducible transcription of several genes.
Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.
Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.
Proteins found in any species of virus.
The functional hereditary units of INSECTS.
The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.
The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.
Nucleotide sequences of a gene that are involved in the regulation of GENETIC TRANSCRIPTION.
ANIMALS whose GENOME has been altered by GENETIC ENGINEERING, or their offspring.
Retrovirus-associated DNA sequences (fos) originally isolated from the Finkel-Biskis-Jinkins (FBJ-MSV) and Finkel-Biskis-Reilly (FBR-MSV) murine sarcoma viruses. The proto-oncogene protein c-fos codes for a nuclear protein which is involved in growth-related transcriptional control. The insertion of c-fos into FBJ-MSV or FBR-MSV induces osteogenic sarcomas in mice. The human c-fos gene is located at 14q21-31 on the long arm of chromosome 14.
PLANTS, or their progeny, whose GENOME has been altered by GENETIC ENGINEERING.
Genes that encode highly conserved TRANSCRIPTION FACTORS that control positional identity of cells (BODY PATTERNING) and MORPHOGENESIS throughout development. Their sequences contain a 180 nucleotide sequence designated the homeobox, so called because mutations of these genes often results in homeotic transformations, in which one body structure replaces another. The proteins encoded by homeobox genes are called HOMEODOMAIN PROTEINS.
Techniques and strategies which include the use of coding sequences and other conventional or radical means to transform or modify cells for the purpose of treating or reversing disease conditions.
The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.
The developmental history of specific differentiated cell types as traced back to the original STEM CELLS in the embryo.
Refers to animals in the period of time just after birth.
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
Morphological and physiological development of EMBRYOS.
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.

Cooperative binding of heat shock factor to the yeast HSP82 promoter in vivo and in vitro. (1/8596)

Previous work has shown that heat shock factor (HSF) plays a central role in remodeling the chromatin structure of the yeast HSP82 promoter via constitutive interactions with its high-affinity binding site, heat shock element 1 (HSE1). The HSF-HSE1 interaction is also critical for stimulating both basal (noninduced) and induced transcription. By contrast, the function of the adjacent, inducibly occupied HSE2 and -3 is unknown. In this study, we examined the consequences of mutations in HSE1, HSE2, and HSE3 on HSF binding and transactivation. We provide evidence that in vivo, HSF binds to these three sites cooperatively. This cooperativity is seen both before and after heat shock, is required for full inducibility, and can be recapitulated in vitro on both linear and supercoiled templates. Quantitative in vitro footprinting reveals that occupancy of HSE2 and -3 by Saccharomyces cerevisiae HSF (ScHSF) is enhanced approximately 100-fold through cooperative interactions with the HSF-HSE1 complex. HSE1 point mutants, whose basal transcription is virtually abolished, are functionally compensated by cooperative interactions with HSE2 and -3 following heat shock, resulting in robust inducibility. Using a competition binding assay, we show that the affinity of recombinant HSF for the full-length HSP82 promoter is reduced nearly an order of magnitude by a single-point mutation within HSE1, paralleling the effect of these mutations on noninduced transcript levels. We propose that the remodeled chromatin phenotype previously shown for HSE1 point mutants (and lost in HSE1 deletion mutants) stems from the retention of productive, cooperative interactions between HSF and its target binding sites.  (+info)

Correlation between protein and mRNA abundance in yeast. (2/8596)

We have determined the relationship between mRNA and protein expression levels for selected genes expressed in the yeast Saccharomyces cerevisiae growing at mid-log phase. The proteins contained in total yeast cell lysate were separated by high-resolution two-dimensional (2D) gel electrophoresis. Over 150 protein spots were excised and identified by capillary liquid chromatography-tandem mass spectrometry (LC-MS/MS). Protein spots were quantified by metabolic labeling and scintillation counting. Corresponding mRNA levels were calculated from serial analysis of gene expression (SAGE) frequency tables (V. E. Velculescu, L. Zhang, W. Zhou, J. Vogelstein, M. A. Basrai, D. E. Bassett, Jr., P. Hieter, B. Vogelstein, and K. W. Kinzler, Cell 88:243-251, 1997). We found that the correlation between mRNA and protein levels was insufficient to predict protein expression levels from quantitative mRNA data. Indeed, for some genes, while the mRNA levels were of the same value the protein levels varied by more than 20-fold. Conversely, invariant steady-state levels of certain proteins were observed with respective mRNA transcript levels that varied by as much as 30-fold. Another interesting observation is that codon bias is not a predictor of either protein or mRNA levels. Our results clearly delineate the technical boundaries of current approaches for quantitative analysis of protein expression and reveal that simple deduction from mRNA transcript analysis is insufficient.  (+info)

Nrg1 is a transcriptional repressor for glucose repression of STA1 gene expression in Saccharomyces cerevisiae. (3/8596)

Expression of genes encoding starch-degrading enzymes is regulated by glucose repression in the yeast Saccharomyces cerevisiae. We have identified a transcriptional repressor, Nrg1, in a genetic screen designed to reveal negative factors involved in the expression of STA1, which encodes a glucoamylase. The NRG1 gene encodes a 25-kDa C2H2 zinc finger protein which specifically binds to two regions in the upstream activation sequence of the STA1 gene, as judged by gel retardation and DNase I footprinting analyses. Disruption of the NRG1 gene causes a fivefold increase in the level of the STA1 transcript in the presence of glucose. The expression of NRG1 itself is inhibited in the absence of glucose. DNA-bound LexA-Nrg1 represses transcription of a target gene 10.7-fold in a glucose-dependent manner, and this repression is abolished in both ssn6 and tup1 mutants. Two-hybrid and glutathione S-transferase pull-down experiments show an interaction of Nrg1 with Ssn6 both in vivo and in vitro. These findings indicate that Nrg1 acts as a DNA-binding repressor and mediates glucose repression of the STA1 gene expression by recruiting the Ssn6-Tup1 complex.  (+info)

SWM1, a developmentally regulated gene, is required for spore wall assembly in Saccharomyces cerevisiae. (4/8596)

Meiosis in Saccharomyces cerevisiae is followed by encapsulation of haploid nuclei within multilayered spore walls. Formation of this spore-specific wall requires the coordinated activity of enzymes involved in the biosynthesis of its components. Completion of late events in the sporulation program, leading to spore wall formation, requires the SWM1 gene. SWM1 is expressed at low levels during vegetative growth but its transcription is strongly induced under sporulating conditions, with kinetics similar to those of middle sporulation-specific genes. Homozygous swm1Delta diploids proceed normally through both meiotic divisions but fail to produce mature asci. Consistent with this finding, swm1Delta mutant asci display enhanced sensitivity to enzymatic digestion and heat shock. Deletion of SWM1 specifically affects the expression of mid-late and late sporulation-specific genes. All of the phenotypes observed are similar to those found for the deletion of SPS1 or SMK1, two putative components of a sporulation-specific MAP kinase cascade. However, epistasis analyses indicate that Swm1p does not form part of the Sps1p-Smk1p-MAP kinase pathway. We propose that Swm1p, a nuclear protein, would participate in a different signal transduction pathway that is also required for the coordination of the biochemical and morphological events occurring during the last phase of the sporulation program.  (+info)

The yeast ser/thr phosphatases sit4 and ppz1 play opposite roles in regulation of the cell cycle. (5/8596)

Yeast cells overexpressing the Ser/Thr protein phosphatase Ppz1 display a slow-growth phenotype. These cells recover slowly from alpha-factor or nutrient depletion-induced G1 arrest, showing a considerable delay in bud emergence as well as in the expression of the G1 cyclins Cln2 and Clb5. Therefore, an excess of the Ppz1 phosphatase interferes with the normal transition from G1 to S phase. The growth defect is rescued by overexpression of the HAL3/SIS2 gene, encoding a negative regulator of Ppz1. High-copy-number expression of HAL3/SIS2 has been reported to improve cell growth and to increase expression of G1 cyclins in sit4 phosphatase mutants. We show here that the described effects of HAL3/SIS2 on sit4 mutants are fully mediated by the Ppz1 phosphatase. The growth defect caused by overexpression of PPZ1 is intensified in strains with low G1 cyclin levels (such as bck2Delta or cln3Delta mutants), whereas mutation of PPZ1 rescues the synthetic lethal phenotype of sit4 cln3 mutants. These results reveal a role for Ppz1 as a regulatory component of the yeast cell cycle, reinforce the notion that Hal3/Sis2 serves as a negative modulator of the biological functions of Ppz1, and indicate that the Sit4 and Ppz1 Ser/Thr phosphatases play opposite roles in control of the G1/S transition.  (+info)

Functional expression of the plant alternative oxidase affects growth of the yeast Schizosaccharomyces pombe. (6/8596)

We have investigated the extent to which functional expression of the plant alternative oxidase (from Sauromatum guttatum) in Schizosaccharomyces pombe affects yeast growth. When cells are cultured on glycerol, the maximum specific growth rate is decreased from 0.13 to 0.11 h-1 while growth yield is lowered by 20% (from 1. 14 x 10(8) to 9.12 x 10(7) cells ml-1). Kinetic studies suggest that the effect on growth is mitochondrial in origin. In isolated mitochondria we found that the alternative oxidase actively competes with the cytochrome pathway for reducing equivalents and contributes up to 24% to the overall respiratory activity. Metabolic control analysis reveals that the alternative oxidase exerts a considerable degree of control (22%) on total electron flux. Furthermore, the negative control exerted by the alternative oxidase on the flux ratio of electrons through the cytochrome and alternative pathways is comparable with the positive control exerted on this flux-ratio by the cytochrome pathway. To our knowledge, this is the first paper to report a phenotypic effect because of plant alternative oxidase expression. We suggest that the effect on growth is the result of high engagement of the non-protonmotive alternative oxidase in yeast respiration that, consequently, lowers the efficiency of energy conservation and hence growth.  (+info)

The genes for the Golgi apparatus N-acetylglucosaminyltransferase and the UDP-N-acetylglucosamine transporter are contiguous in Kluyveromyces lactis. (7/8596)

The mannan chains of Kluyveromyces lactis mannoproteins are similar to those of Saccharomyces cerevisiae except that they lack mannose phosphate and have terminal alpha(1-->2)-linked N-acetylglucosamine. Previously, Smith et al. (Smith, W. L. Nakajima, T., and Ballou, C. E. (1975) J. Biol. Chem. 250, 3426-3435) characterized two mutants, mnn2-1 and mnn2-2, which lacked terminal N-acetylglucosamine in their mannoproteins. The former mutant lacks the Golgi N-acetylglucosaminyltransferase activity, whereas the latter one was recently found to be deficient in the Golgi UDP-GlcNAc transporter activity. Analysis of extensive crossings between the two mutants led Ballou and co-workers (reference cited above) to conclude that these genes were allelic or tightly linked. We have now cloned the gene encoding the K. lactis Golgi membrane N-acetylglucosaminyltransferase by complementation of the mnn2-1 mutation and named it GNT1. The mnn2-1 mutant was transformed with a 9.5-kilobase (kb) genomic fragment previously shown to contain the gene encoding the UDP-GlcNAc transporter; transformants were isolated, and phenotypic correction was monitored after cell surface labeling with fluorescein isothiocyanate-conjugated Griffonia simplicifolia II lectin, which binds terminal N-acetylglucosamine, and a fluorescence-activated cell sorter. The above 9.5-kb DNA fragment restored the wild-type lectin binding phenotype of the transferase mutant; further subcloning of this fragment yielded a smaller one containing an opening reading frame of 1,383 bases encoding a protein of 460 amino acids with an estimated molecular mass of 53 kDa, which also restored the wild-type phenotype. Transformants had also regained the ability to transfer N-acetylglucosamine to 3-0-alpha-D-mannopyranosyl-D-mannopyranoside. The gene encoding the above transferase was found to be approximately 1 kb upstream from the previously characterized MNN2 gene encoding the UDP-GlcNAc Golgi transporter. Each gene can be transcribed independently by their own promoter. To our knowledge this is the first demonstration of two Golgi apparatus functionally related genes being contiguous in a genome.  (+info)

A phosphonate-induced gene which promotes Penicillium-mediated bioconversion of cis-propenylphosphonic acid to fosfomycin. (8/8596)

Penicillium decumbens is able to epoxidize cis-propenylphosphonic acid (cPA) to produce the antibiotic fosfomycin [FOM; also referred to as phosphonomycin and (-)-cis-1,2-epoxypropylphosphonic acid], a bioconversion of considerable commercial significance. We sought to improve the efficiency of the process by overexpression of the genes involved. A conventional approach of isolating the presumed epoxidase and its corresponding gene was not possible since cPA epoxidation could not be achieved with protein extracts. As an alternative approach, proteins induced by cPA were detected by two-dimensional gel electrophoresis. The observation that a 31-kDa protein (EpoA) was both cPA induced and overaccumulated in a strain which more efficiently converted cPA suggested that it might take part in the bioconversion. EpoA was purified, its amino acid sequence was partially determined, and the corresponding gene was isolated from cosmid and cDNA libraries with oligonucleotide probes. The DNA sequence for this gene (epoA) contained two introns and an open reading frame encoding a peptide of 277 amino acids having some similarity to oxygenases. When the gene was subcloned into P. decumbens, a fourfold increase in epoxidation activity was achieved. epoA-disruption mutants which were obtained by homologous recombination could not convert cPA to FOM. To investigate the regulation of the epoA promoter, the bialaphos resistance gene (bar, encoding phosphinothricin acetyltransferase) was used to replace the epoA-coding region. In P. decumbens, expression of the bar reporter gene was induced by cPA, FOM, and phosphorous acid but not by phosphoric acid.  (+info)

Spletni strežnik Apache, velikokrat samo Apache, je spletni strežnik, ki igra ključno vlogo pri širjenju spleta. Bil je prva alternativa Netscapeovemu spletnemu strežniku, trenutno znanemu kot spletni strežnik Sun Java System. Od aprila 1996 je Apache najbolj popularen HTTP strežnik na celem spletu. Od oktobra 2007 pa je bilo na Apachijevem strežniku postavljenih približno 48 % vseh spletnih strani. Uporablja ga 73,09%[1] vseh registriranih slovenskih domen. Ime »Apache« je bilo izbrano iz dveh razlogov: ...
Na tej točki, bi morali biti sposobni narediti večino dnevnih opravil zaradi katerih boste uporabljali Git. Vendar, da naredite kakršno koli sodelovanje v Git-u, boste potrebovali imeti oddaljeni Git repozitiorij. Čeprav lahko tehnično porinete spremembe v in potegnete spremembe iz posameznih repozitorijev, se to ne svetuje, ker lahko precej enostavno zamešate, na čemer se dela, če niste pazljivi. Poleg tega želite, da vaši sodelavci lahko dostopajo do repozitorija tudi če je vaš računalnik offline - imeti bolj zanesljiv skupni repozitorij je pogostokrat uporabno. Zato je željena metoda za sodelovanje z nekom nastaviti vmesni repozitorij, do katerega imata oba dostop ter porinete in potegnete iz njega.. Poganjanje Git strežnika je precej enostavno. Prvo izberete, katere protokole želite, da z njimi strežnik komunicira. Prva sekcija tega poglavja bo pokrila protokole, ki so na voljo ter prednosti in slabosti vsakega. Naslednja sekcija bo razložila nekatere tipične nastavitve z ...
On Sunday, August 24th at 3:20 am, a very large (6.0) earthquake struck the Napa Valley of California with most of the damage occurring in the old, historic part of town. I am heartbroken to see the images of some of my favorite buildings red tagged and literally shaken off their foundations with roofs collapsed, walls crumbled and windows blown out. My facebook feed is filled with photos of my friends homes and businesses and wineries in shambles. Picture the interior of your house. Now imagine someone picking it up, shaking it like mad, and then setting it back down. Everything fallen off the walls, dropped out of cupboards, broken glass and plates and heirlooms everywhere. No power...gas off because of the potential for leaks, no running water. That was downtown Napa this weekend. But Napans are strong and resilient. My heart was full hearing all the stories of neighbors helping neighbors. I am so happy to report that Napa Farmhouse 1885 is doing just fine...so, if you want to help, visit ...
TY - JOUR. T1 - High-resolution timing of cell cycle-regulated gene expression. AU - Rowicka-Kudlicka, Malgorzata. AU - Kudlicki, Andrzej. AU - Tu, Benjamin P.. AU - Otwinowski, Zbyszek. PY - 2007/10/23. Y1 - 2007/10/23. N2 - The eukaryotic cell division cycle depends on an intricate sequence of transcriptional events. Using an algorithm based on maximum-entropy deconvolution, and expression data from a highly synchronized yeast culture, we have timed the peaks of expression of transcriptionally regulated cell cycle genes to an accuracy of 2 min (≈1% of the cell cycle time). The set of 1,129 cell cycle-regulated genes was identified by a comprehensive analysis encompassing all available cell cycle yeast data sets. Our results reveal distinct subphases of the cell cycle undetectable by morphological observation, as well as the precise timeline of macromolecular complex assembly during key cell cycle events.. AB - The eukaryotic cell division cycle depends on an intricate sequence of ...
During the cell division cycle of the yeast Saccharomyces cerevisiae, the G1-to-S transition depends upon the activation of two transcription factors (SBF and MBF), which are responsible for the cell cycle-regulated expression of more than 200 genes. Bck2 becomes essential in the absence of Cln3, the most upstream activator of this transcriptional program. Here we have used a genome-wide approach to elucidate the targets of Bck2. Our data indicate that Bck2 activates a selection of cell cycle-regulated genes from all cell cycle stages. In contrast, Cln3 activates only G1/S phase genes. Furthermore, Bck2 activates many genes independently of Swi6, the common component of SBF and MBF. Comparison of Bck2 targets with those of other transcription factors suggests that, in addition to SBF and MBF, Bck2 may elicit gene expression via Ste12 and Mcm1. We propose that Bck2 activates its targets by a mechanism fundamentally different from that of Cln3, and that it may be a necessary cofactor for the full ...
Antibody-mediated defense against pathogens typically requires complex interactions between antibodies and other constituents of the humoral and cellular immune systems. However, recent evidence indicates that some antibodies alone can inhibit pathogen function in the absence of complement, phagocytes, or NK cells. In this issue of the JCI, McClelland et al. have begun to elucidate the molecular bases by which antibodies alone can impact pathogen growth and metabolism. They show that mAbs specific for the polysaccharide capsule of the human pathogenic fungus Cryptococcus neoformans elicit diverse effects on fungal gene expression, lipid biosynthesis, susceptibility to amphotericin B, cellular metabolism, and protein phosphorylation. These data suggest that pathogens have the capacity to generate broad metabolic responses as a result of surface binding by pathogen-specific antibodies, effects that may hold therapeutic promise. ...
Antibody-mediated defense against pathogens typically requires complex interactions between antibodies and other constituents of the humoral and cellular immune systems. However, recent evidence indicates that some antibodies alone can inhibit pathogen function in the absence of complement, phagocytes, or NK cells. In this issue of the JCI, McClelland et al. have begun to elucidate the molecular bases by which antibodies alone can impact pathogen growth and metabolism. They show that mAbs specific for the polysaccharide capsule of the human pathogenic fungus Cryptococcus neoformans elicit diverse effects on fungal gene expression, lipid biosynthesis, susceptibility to amphotericin B, cellular metabolism, and protein phosphorylation. These data suggest that pathogens have the capacity to generate broad metabolic responses as a result of surface binding by pathogen-specific antibodies, effects that may hold therapeutic promise. ...
At intermediate intensities, stress induces oscillations in the nucleocytoplasmic shuttling of the transcription factor Msn2 in budding yeast. Activation by stress results in a reversible translocation of Msn2 from the cytoplasm to the nucleus. This translocation is negatively controlled by the cAMP …
As a public service, the genomic sequence data and preliminary annotations for various fungal species are being made available before scientific publication by the Genozymes for Bioproducts and Bioprocesses Development Project which is funded primarily by Genome Canada. This website is being hosted and the data maintained at the Centre for Structural and Functional Genomics at Concordia University (Montreal, Quebec, Canada).. While early data release should aid scientific research and development, these pre-publication data are preliminary and may contain errors. The Genozymes for Bioproducts and Bioprocesses Development Project reserves the exclusive right to publish the genome annotation data, initial analyses on fungal gene expression under different growth conditions by means of transcriptomic and proteomic data analyses, comparative genomics analysis of these data with other fungal sequence data, and analyses of these data for distribution of protein domains and metabolic pathways.. By ...
Thank you for sharing this Eukaryotic Cell article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
Cell fate can be determined by asymmetric segregation of gene expression regulators. In the budding yeast Saccharomyces cerevisiae, the transcription factor Ace2 accumulates specifically in the daughter cell nucleus, where it drives transcription of genes that are not expressed in the mother cell. T …
BioAssay record AID 460553 submitted by ChEMBL: Antiaging effect in Saccharomyces cerevisiae K6001 expressing uth1 mutant assessed as extension of replicative life span after 2 days.
A.4 Naider, F., Son, C. A., Sargsyan, H., and Becker, J. M., Biochemical and mutagenic analysis of a G protein-coupled receptor: Photocrosslinking of the tridecapeptide alpha-Factor into Ste2p of Saccharomyces cerevisiae reveals contact points between the peptide and its receptor binding site. 3rd International Peptide Symposium/28th European Peptide Symposium, (2004), p.93-95 ...
HapX positively regulates the levels of the CIR1 and RIM101 transcripts.Quantification of HAPX, CIR1 and RIM101 transcripts by quantitative RT-PCR in WT, hapXΔ
Hardcorescenen i Umeå har ett världsomspännande rykte och är en viktig del av svensk musikhistoria. Med tonvikt på Umeå och 1990-tal presenteras här Sveriges största samling av hardcorematerial ...
Hardcorescenen i Umeå har ett världsomspännande rykte och är en viktig del av svensk musikhistoria. Med tonvikt på Umeå och 1990-tal presenteras här Sveriges största samling av hardcorematerial ...
Preva*lence (?), n. [L. praevalentia: cf. F. prevalence. See Prevail.] The quality or condition of being prevalent; superior stre...
One of the most crucial tasks for a cell to ensure its long term survival is preserving the integrity of its genetic heritage via maintenance of DNA structure and sequence. While the DNA damage response in the yeast Saccharomyces cerevisiae, a model eukaryotic organism, has been extensively studied, much remains to be elucidated about how the organism senses and responds to different types and doses of DNA damage. We have measured the global transcriptional response of S. cerevisiae to multiple doses of two representative DNA damaging agents, methyl methanesulfonate (MMS) and gamma radiation. Hierarchical clustering of genes with a statistically significant change in transcription illustrated the differences in the cellular responses to MMS and gamma radiation. Overall, MMS produced a larger transcriptional response than gamma radiation, and many of the genes modulated in response to MMS are involved in protein and translational regulation. Several clusters of coregulated genes whose responses varied
AbstractProtein-metabolite interactions are of crucial importance for all cellular processes but remain understudied. Here, we applied a biochemical approach named PROMIS, to address the complexity of the protein-small molecule interactome in the model yeast Saccharomyces cerevisiae. By doing so, we provide a unique dataset, which can be queried for interactions between 74 small molecules and 3982 proteins using a user-friendly interface available at https://promis.mpimp-golm.mpg.de/yeastpmi/. By interpolating PROMIS with the list of predicted protein-metabolite interactions, we provided experimental validation for 225 binding events. Remarkably, of the 74 small molecules co-eluting with proteins, 36 were proteogenic dipeptides. Targeted analysis of a representative dipeptide, Ser-Leu, revealed numerous protein interactors comprising chaperones, proteasomal subunits, and metabolic enzymes. We could further demonstrate that Ser-Leu binding increases activity of a glycolytic enzyme ...
A central theme in biology is to understand how different signaling outputs can be accomplished by changes to signal transduction pathways. Here, we examined epigenetic differences between two cell states in the human fungal pathogen Candida albicans. We show that cells in the white state are sterile due to multiple bottlenecks in MAPK signaling relative to mating-competent opaque cells. Alleviation of these bottlenecks by reverse engineering effectively converts sterile white cells into sexually competent cells. These results have broad implications for understanding how epigenetic changes can impact MAPK expression and signaling output, including events associated with tumorigenesis. We also propose a model for how the white-opaque switch gained control of sexual reproduction in Candida during evolution.. ...
The last several years have been witness to significant developments in understanding transcriptional regulation of the yeast phospholipid structural genes. The response of most phospholipid structural genes to inositol is now understood on a mechanistic level. The roles of specific activators and repressors are also well established. The knowledge of specific regulatory factors that bind the promoters of phospholipid structural genes serves as a foundation for understanding the role of chromatin modification complexes. Collectively, these findings present a complex picture for transcriptional regulation of the phospholipid biosynthetic genes. The INO1 gene is an ideal example of the complexity of transcriptional control and continues to serve as a model for studying transcription in general. Furthermore, transcription of the regulatory genes is also subject to complex and essential regulation. In addition, databases resulting from a plethora of genome-wide studies have identified regulatory ...
Characterization of a glucose-repressed pyruvate kinase (Pyk2p) in Saccharomyces cerevisiae that is catalytically insensitive to fructose-1,6-bisphosphate ...
Saccharomyces cerevisiae sudah sejak lama digunakan sebagai starter fermentasi pembuatan roti dan minuman beralkohol. Dalam buku ini, Saccharomyces crervisiae dimanfaatkan sebagai agensia modifikasi dalam pengolahan pangan, kemampuan S. cerevisiae dalam merombak komponen pangan, produk metabolit yang dihasilkan oleh S. cerevisiae, modifikasi terhadap perubahan sifat beberapa produk pangan oleh S. cerevisiae seperti tapioka, tempe, dan modifikasi fermentasi kakao. Pengertian dasar mengenai khamir perlu dipahami oleh mahasiswa yang khususnya mempelajari mikrobiologi pangan, mikrobiologi industri dan teknologi pangan. S.cerevisiae adalah khamir ...
P. T. Spellman and G. Sherlock and M. Q. Zhang and V. R. Iyer and K. Anders and M. B. Eisen and P. O. Brown and D. Botstein and B. Futcher. Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Mol Biol Cell. 9(12):3273-97, 1998 ...
TY - JOUR. T1 - The transcriptional response to alkaline pH in Saccharomyces cerevisiae: Evidence for calcium-mediated signalling. AU - Serrano, Raquel. AU - Ruiz, Amparo. AU - Bernal, Dolores. AU - Chambers, James R.. AU - Ariño, Joaquín. PY - 2002/12/1. Y1 - 2002/12/1. N2 - The short-time transcriptional response of yeast cells to a mild increase in external pH (7.6) has been investigated using DNA microarrays. A total of 150 genes increased their mRNA level at least twofold within 45 min. Alkalinization resulted in the repression of 232 genes. The response of four upregulated genes, ENA1 (encoding a Na+-ATPase also induced by saline stress) and PHO84, PHO89 and PHO12 (encoding genes upregulated by phosphate starvation), was characterized further. The alkaline response of ENA1 was not affected by mutation of relevant genes involved in osmotic or oxidative signalling, but was decreased in calcineurin and rim101 mutants. Mapping of the ENA1 promoter revealed two pH-responsive regions. The ...
TY - JOUR. T1 - Heterogeneity of stress gene expression and stress resistance among individual cells of Saccharomyces cerevisiae. AU - Attfield, Paul V. AU - Choi, Hung-Yoon. AU - Veal, Duncan A. AU - Bell, Phillip. PY - 2001. Y1 - 2001. U2 - 10.1046/j.1365-2958.2001.02444.x. DO - 10.1046/j.1365-2958.2001.02444.x. M3 - Article. VL - 40. SP - 1000. EP - 1008. JO - Molecular Microbiology. JF - Molecular Microbiology. SN - 0950-382X. IS - 4. ER - ...
Luzarowski, M.; Vicente, R.; Kiselev, A.; Wagner, M.; Schlossarek, D.; Erban, A.; de Souza, L. P.; Childs, D.; Wojciechowska, I.; Luzarowska, U. et al.; Gorka, M.; Sokolowska, E.; Kosmacz, M.; Moreno, J.C.; Brzezinska, A.; Vegesna, B.; Kopka, J.; Fernie, A. R.; Willmitzer, L.; Ewald, J. C.; Skirycz, A.: Global mapping of protein-metabolite interactions in Saccharomyces cerevisiae reveals that Ser-Leu dipeptide regulates phosphoglycerate kinase activity. Communications Biology 4 (1), 181 (2021 ...
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
The Genetics Society of America (GSA), founded in 1931, is the professional membership organization for scientific researchers and educators in the field of genetics. Our members work to advance knowledge in the basic mechanisms of inheritance, from the molecular to the population level.. Online ISSN: 1943-2631. ...
indicator (fura-2) loaded and synaptic responses (population spike and EPSP) were recorded simultaneously from the CA1 region in rat hippocampal slices superfused with deoxygenated Krebs solution with or without glucose depletion at 36~37℃. When slices were exposed to hypoxia with glucose depletion, synaptic responses disappeared in 2 min. The synaptic responses reappeared transiently in 7~8 min during exposure in a majority of slices. [Ca ...
ISW1-N小鼠多克隆抗体(ab43434)可与酿酒酵母样本反应并经WB, IP, ICC/IF实验严格验证。中国75%以上现货,所有产品提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
NOLDEX Szervező és Szolgáltató ZRt., Üzleti folyamatok újraszervezése (BPR), SAP rendszerbevezetés, Egyedi szoftver fejlesztés
China Wholesale Animal Additive Yeast Saccharomyces Cerevisiae with High-Quality, Leading Wholesale Animal Additive Yeast Saccharomyces Cerevisiae Manufacturers & Suppliers, find Wholesale Animal Additive Yeast Saccharomyces Cerevisiae Factory & Exporters.
Author summary Genetically identical cells, even when they are exposed to the same environmental conditions, display incredible diversity. Gene expression noise is attributed to be a key source of this phenotypic diversity. Transcriptional dynamics is a dominant source of expression noise. Although scores of theoretical and experimental studies have explored how noise is regulated at the level of transcription, most of them focus on the gene specific, cis regulatory elements, such as the number of transcription factor (TF) binding sites, their binding strength, etc. However, how the global properties of transcription, such as the limited availability of TFs impact noise in gene expression remains rather elusive. Here we build a theoretical model that incorporates the effect of limiting TF pool on gene expression noise. We find that competition between genes for TFs leads to enhanced variability in mRNA copy number across an isogenic population. Moreover, for gene copies sharing TFs with other competitor
TY - BOOK. T1 - Environmental Stress Responses and Biological Interactions Investigated in the Drosophila Model System. AU - Ørsted, Michael. N1 - PhD supervisor: Professor Torsten Nygaard Kristensen, Department of Chemistry and Bioscience Aalborg University, Denmark. PY - 2017. Y1 - 2017. N2 - When organisms are faced with changes in their environment, they are forced to respond, if they are to maintain optimal function. Especially ectotherms must deal with environmental changes in e.g. temperature on a regular basis, and thus their survival and reproductive success depend on their ability to respond on a behavioral, physiological, morphological and/or evolutionary level according to the environmental cues.At the same time, if populations are small and fragmented, and have limited gene flow, environmental change and environmental stress might interact with intrinsic genetic stress such as inbreeding and genetic drift, which can exacerbate the effects of one or more environmental stresses. ...
Evolution of multigene families are considered in the review on the example of the PHO gene family encoding the structure of acid phosphatases in the yeast Saccharomyces cerevisiae. Analysis of the...
TY - JOUR. T1 - Dynamic Effects Related to Steady-State Multiplicity in Continous Saccharomyces Cerevisiae Cultivations. AU - Lei, Frede. AU - Olsson, Lisbeth. AU - Jørgensen, Sten Bay. PY - 2004. Y1 - 2004. N2 - The behavioral differences between chemostat and productostat cultivation of aerobic glucose-limited Saccharomyces cerevisiae were investigated. Three types of experiments were conducted: a chemostat, where the dilution rate was shifted up or down in stepwise manner; and a productostat, with either stepwise changed or a rampwise increased ethanol setpoint, i.e., an accelero-productostat. The transient responses from chemostat and productostat experiments were interpreted using a simple metabolic flux model. In a productostat it was possible to obtain oxido-reductive steady states at dilution rates far below D-crit due to a strong repression of the respiratory system. However, these steady states could not be obtained in a chemostat, since a dilution rate shift-down from an ...
Saccharomyces cerevisiae ATCC ® 201390D-5™ Designation: Genomic DNA from Saccharomyces cerevisiae Strain BY4743 (ATCC ® 201390™) Application:
Saccharomyces cerevisiae ATCC ® 201389D-5™ Designation: Genomic DNA from Saccharomyces cerevisiae Strain BY4742 (ATCC ® 201389™) Application:
TY - THES. T1 - Lipid transport to the plasma membrane of the yeast Saccharomyces cerevisiae. AU - Pichler, Harald. PY - 2000. Y1 - 2000. M3 - Doctoral Thesis. ER - ...
MOTIZUKI, M., MITSUI, K., ENDO, Y. and TSURUGI, K. (1986), Detection and partial characterization of the chromatin-associated proteases of yeast Saccharomyces cerevisiae. European Journal of Biochemistry, 158: 345-350. doi: 10.1111/j.1432-1033.1986.tb09757.x ...
Yeast Saccharomyces cerevisiae in vivo Prp8 splicing assay(A) Schematic representation of the two-step splicing pathway (SS, splice site; BS, branch site). Brie
TY - CHAP. T1 - Lipids and membranes in Saccharomyces cerevisiae.. AU - Schweizer, Michael. PY - 1999. Y1 - 1999. M3 - Chapter. SP - 79. EP - 155. BT - In The Metabolism & Molecular Physiology of Saccharomyces cerevisiae. Eds. J R Dickinson & M Schweizer. Taylor & Francis, London. ER - ...
Saccharomyces cerevisiae ATCC ® 9763D-5™ Designation: Genomic DNA from Saccharomyces cerevisiae NRRL Y-567 (ATCC ® 9763™) Application: Food testing
RAJVI ENTERPRISE- We are leading manufacturer,Supplier and exporter of Saccharomyces Cerevisiae from Gujarat, India. Buy highest quality of products from us at affordable price.
1P-022 Saccharomyces cerevisiaeの糖代謝における転写制御ネットワークの予測(遺伝子工学,一般講演)1P-022 Saccharomyces cerevisiaeの糖代謝における転写制御ネットワークの予測(遺伝子工学,一般講演)AN10549378 ...
For more than five decades S. cerevisiae has been studied as a model organism to better understand aging and has contributed to the identification of more mammalian genes affecting aging than any other model organism.[34] Some of the topics studied using yeast are calorie restriction, as well as in genes and cellular pathways involved in senescence. The two most common methods of measuring aging in yeast are Replicative Life Span (RLS), which measures the number of times a cell divides, and Chronological Life Span (CLS), which measures how long a cell can survive in a non-dividing stasis state.[34] Limiting the amount of glucose or amino acids in the growth medium has been shown to increase RLS and CLS in yeast as well as other organisms.[35] At first, this was thought to increase RLS by up-regulating the sir2 enzyme, however it was later discovered that this effect is independent of sir2. Over-expression of the genes sir2 and fob1 has been shown to increase RLS by preventing the accumulation of ...
The Saccharomyces Cerevisiae Morphological Database(SCMD) is a collection of micrographs of budding yeast mutants. Micorgraphs of mutants with altered cell morphology were taken at Ohya Group, University of Tokyo, from a set of the haploid MATa deleted strains obtained from EUROSCARF. From the micrographs, disruptant cells are automatically extracted by our novel cell-image processing software developed at Morishita Group, University of Tokyo. Heterozygous essential gene deletion set, DAmP collection set, natural yeast strain set and others were analyzed by this software. ...
Domain architecture and assignment details (superfamily, family, region, evalue) for YLR216C from Saccharomyces cerevisiae CLIB215. Plus protein sequence and external database links.
Domain architecture and assignment details (superfamily, family, region, evalue) for YLR216C from Saccharomyces cerevisiae JAY291. Plus protein sequence and external database links.
Domain architecture and assignment details (superfamily, family, region, evalue) for YLR222C from Saccharomyces cerevisiae SGD. Plus protein sequence and external database links.
Tetes tebu merupakan limbah pengolahan gula yang mengandung gula cukup tinggi sehingga sangat potensial dimanfaatkan sebagai media fermentasi. Fermentasi tetes tebu untuk menghasilkan bioetanol menjadi salah satu upaya megurangi jumlah limbah dan memenuhi kebutuhan Bahan Bakar Minyak (BBM) yang semakin meningkat. Tujuan dari penelitian ini adalah untuk mengetahui pengaruh pH dan lama fermentasi terhadap produksi bioetanol dari tetes tebu (molase) dengan cara fermentasi menggunakan Saccharomyces cerevisiae. Penelitian ini meliputi proses fermentasi dan pemisahan bioetanol dari media fermentasi. Proses fermentasi dilakukan dengan variasi pH 4, 4,5, dan 5, sedangkan variasi lama fermentasi dilakukan selama 3, 4, 5, dan 6 hari. Bioetanol hasil fermentasi dipisahkan dari media fermentasi dengan metode destilasi fraksinasi dan untuk mengukur kadar bioetanol digunakan metode kromatografi gas. Data yang diperoleh pada setiap perlakuan dianalisis menggunakan analisis varians (ANOVA) dan dilanjutkan ...
Saccharomyces cerevisiae Y12 - Organisms are classified by taxonomy into specified groups such as the multicellular animals, plants, and fungi; or unicellular microorganisms such as a protists, bacteria, and archaea.
Gene target information for PRB1 - proteinase B (Saccharomyces cerevisiae S288C). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
The following pages link to Saccharomyces cerevisiae: Displayed 2 items. View (previous 250 , next 250) (20 , 50 , 100 , 250 , 500) ...
EC number: 283-294-5 , CAS number: 84604-16-0 Extractives and their physically modified derivatives such as tinctures, concretes, absolutes, essential oils, oleoresins, terpenes, terpene-free fractions, distillates, residues, etc., obtained from Saccharomyces cerevisiae, Saccharomycelaceae. ...
EC number: 283-294-5 , CAS number: 84604-16-0 Extractives and their physically modified derivatives such as tinctures, concretes, absolutes, essential oils, oleoresins, terpenes, terpene-free fractions, distillates, residues, etc., obtained from Saccharomyces cerevisiae, Saccharomycelaceae. ...
EC number: 283-294-5 , CAS number: 84604-16-0 Extractives and their physically modified derivatives such as tinctures, concretes, absolutes, essential oils, oleoresins, terpenes, terpene-free fractions, distillates, residues, etc., obtained from Saccharomyces cerevisiae, Saccharomycelaceae. ...
Pl ss baba mikr b form ban, alkalmas mint sz rakoztat aj nd k, vagy mint tan t eszk z sz l knek s tan roknak. Az leszt gomba vagy s r leszt (Saccharomyces cerevisiae) a sarjadz - vagy leszt gomb k egy fajt ja. A korai id k ta ez a legfontosabb leszt faj - a keny rs t sn l s s rf z sn l haszn lj k. Els k nt a sz l h j n izol lt k (a s t t sz n gy m lcs k mint a...
Author: Stagge, F.; Genre: Thesis; Published in Print: 2010; Title: Etablierung neuartiger Fluoreszenzmarkierungen in der Bäckerhefe Saccharomyces cerevisiae für die hochauflösende Mikroskopie mitochondrialer Proteine.
Please enjoy this information on EpiCor made available through the generosity of Embrias adoption. Information on EpiCor, yeast fermentate, Saccharomyces cerevisiae.
Shop Transcriptional regulator of filamentous growth ELISA Kit, Recombinant Protein and Transcriptional regulator of filamentous growth Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Conidiation in the filamentous ascomycete Aspergillus nidulans requires activation of brlA, a well-characterized transcriptional regulator of genes that are induced specifically during asexual develop
A BioProject is a collection of biological data related to a single initiative, originating from a single organization or from a consortium. A BioProject record provides users a single place to find links to the diverse data types generated for that project
tgctgcttgtgccgcaagggacgcagacgttgaaaaagctgctctaaaaatgtttactga ttattgcagcggtaataaggaagccatcccagcattgattaaaccaattgtatttaacac tgtggcaagagttggtggtgcagaaaactatgaaaaagtttacaaaatctacttagatcc aatctctaacgatgaaaaattagccgcattaagatctttaggcagatttaaagaacctaa attattagaaagaaccttaggatatttgtttgatggcactgtcttaaaccaagacattta tattccaatgcaaggaatgagagctcatcaagaaggtgtagaggctttgtggaattgggt taaaaagaactgggacgaactcgtaaagagactacctcctggtctttcaatgctaggctc cgtcgtcacattaggtacctctggctttacatcaatgcaaaaaatagatgagattaagaa attctttgccactaaatccacgaaaggtttcgatcaaagtttggctcaatcactggacac tattacttcgaaagcgcagtggggttaacagagaccgtgatgtcgtcaacaagtatttga aggaaaatggttactattaagaaaaaatctcttttctagccattttgcctttttatatag tcaagtatctatatgtgacaaatacttcttctaagcttggccttctgataggcttagctt gcagtggttgcaaacatacataaatcaacaaaaaagtacggcttaaaattttggtattca tttatttcaacccgtgcacactggaaataaatctgtacataacagcatattttgtttttg aaaaaatttctgtgttcctccgatgtgggaagaattttaggatcggctaaatttcgtaaa gtatcagtaacttggtatctctgtataagcggagtctaatttcgataacaagcaacttca ...
Powered by Pure, Scopus & Elsevier Fingerprint Engine™ © 2020 Elsevier B.V. We use cookies to help provide and enhance our service and tailor content. By continuing you agree to the use of cookies. Log in to Pure. ...
Riles, L., Dutchik, J.E., Baktha, A., McCauley, B.K., Thayer, E.C., Leckie, M.P., Braden, V.V., Depke, J.E., Olson, M.V. (1993) Physical maps of the six smallest chromosomes of Saccharomyces cerevisiae at a resolution of 2.6 kilobase pairs. Genetics 134(1):81-150. PMID:8514151 ...
"Regulation of fungal gene expression via short open reading frames in the mRNA 5'untranslated region". Molecular Microbiology. ... Since the regulation of gene expression is critical in the proper function of cells, this is an area of study that needs to be ... However, it is now known that the untranslated region of mRNA is involved in many regulatory aspects of gene expression in ... Jin, H; Zhao, Q; Gonzalez; de Valdivia, EI; Ardell, DH; Stenström, M; Isaksson, LA (April 2006). "Influences on gene expression ...
5'UTR Eukaryotic translation Leaky scanning Vilela C, McCarthy JE (August 2003). "Regulation of fungal gene expression via ... uORFs can regulate eukaryotic gene expression. Translation of the uORF typically inhibits downstream expression of the primary ... Approximately 50% of human genes contain uORFs in their 5'UTR, and when present, these cause reductions in protein expression. ... uORFs are called leader peptides and were originally discovered on the basis of their impact on the regulation of genes ...
... there is also environmental regulation of AK-HSD gene expression. Light exposure has been demonstrated to increase expression ... Bareich DC, Nazi I, Wright GD (October 2003). "Simultaneous In Vitro Assay of the First Four Enzymes in the Fungal Aspartate ... "Expression of an Aspartate Kinase Homoserine Dehydrogenase Gene IS Subject to Specific Spatial and Temporal Regulation in ... Zhu-Shimoni JX, Galili G (March 1998). "Expression of an Arabidopsis Aspartate Kinase/Homoserine Dehydrogenase Gene Is ...
Colocation for redox regulation of gene expression» Proceedings of the National Academy of Sciences: 201500012 doi:10.1073/pnas ... Ingelesez) «A new fungal phylum, the Glomeromycota: phylogeny and evolution» Mycological Research (12): 1413-1421 2001-12-01 ... Evidence That Plant-Like Genes in Chlamydia Species Reflect an Ancestral Relationship between Chlamydiaceae, Cyanobacteria, and ...
... gene expression regulation, fungal MeSH G05.315.370 - gene expression regulation, neoplastic MeSH G05.315.370.500 - gene ... gene expression regulation, plant MeSH G05.315.385 - gene expression regulation, viral MeSH G05.315.410 - gene silencing MeSH ... gene amplification MeSH G05.315.290 - gene expression regulation, archaeal MeSH G05.315.300 - gene expression regulation, ... gene expression regulation, developmental MeSH G05.315.320 - gene expression regulation, enzymologic MeSH G05.315.320.200 - ...
... in Sickness and in Health and Charles Dorman DNA Topology and the Global Regulation of Bacterial Virulence Gene Expression 1995 ... 1976 Graham Gooday Biosynthesis of the Fungal Wall - Mechanisms and Implications 1977 Peter Newell Cellular Communication ... James McGeoch Structural Analysis of Animal Virus Genomes 1981 Dave Sherratt The Maintenance and Propagation of Plasmid Genes ... L Smith Vaccinia Virus Glycoproteins and Immune Evasion 1993 Neil Gow Directional Growth and Guidance Systems of Fungal ...
Regulation of gene expression[edit]. The regulation of gene expression of hemolysins (such as streptolysin S) is a system ... Vesper SJ, Vesper MJ (2004). Possible role of fungal hemolysins in sick building syndrome. Adv. Appl. Microbiol. Advances in ... The regulation of the production of hemolysin in S.aureus(expression of hemolysin) is now possible due to in-vitro mutations ... "Regulation of hemolysin expression and virulence of Staphylococcus aureus by a serine/threonine kinase and phosphatase". PLOS ...
"Coordinated and independent functions of velvet-complex genes in fungal development and virulence of the fungal cereal pathogen ... Martín, JF (May 2017). "Key role of LaeA and velvet complex proteins on expression of β-lactam and PR-toxin genes in ... Penicillium chrysogenum: cross-talk regulation of secondary metabolite pathways". Journal of Industrial Microbiology & ... Some fungal infections that are present in humans and sometimes plants have been traced down to certain velvet complex elements ...
"Expression of the Candida albicans Morphogenesis Regulator Gene CZF1 and Its Regulation by Efg1p and Czf1p". Eukaryotic Cell. ... "Fighting Fungal Infections with Less Collateral Damage". Tufts Now. 2019-01-09. Retrieved 2019-12-20. "How a common fungus ... She showed that these mutants were defective in the gene SecB and went on to study the mechanism of action of this protein; ... She showed that the CZF1 gene is a regulator of the filamentation response, and that Mkc1 and Cek1 (MAP kinases) are activated ...
Deng, M.; Lancto, C. A.; Abrahamsen, M. S. (2004). "Cryptosporidium parvum regulation of human epithelial cell gene expression ... Sebghati TS, Engle JT, Goldman WE (November 2000). "Intracellular parasitism by Histoplasma capsulatum: fungal virulence and ...
ISBN 978-0-521-30899-1. Peñalva MA, Arst HN (September 2002). "Regulation of gene expression by ambient pH in filamentous fungi ... Fungal Divers. 2015, 73, 1-72. Debbab, A.; Aly, A.H.; Proksch, P. Mangrove derived fungal endophytes-a chemical and biological ... When a fungal propagule lands on a suitable piece of wood, it will grow if no other fungi are present. If the wood is already ... Characterization of fungal biodiversity and communities associated with the reef macroalga Sargassum ilicifolium reveals fungal ...
Micro RNAs are involved in regulating the expression of many proteins. Med1 is targeted by miR-1, which is important in gene ... There are three fungal-specific components, referred to as Med2, Med3 and Med5. The subunits form at least three structurally ... Björklund S, Gustafsson CM (May 2005). "The yeast Mediator complex and its regulation". Trends in Biochemical Sciences. 30 (5 ... These stable associations have also been shown to regulate gene expression in vivo, and are prevented by mutations in MED12 ...
Secondary metabolites in fungal development[edit]. The transcription factor LaeA regulates the expression of several genes ... "Regulation of Sterol Biosynthesis in the Human Fungal Pathogen Aspergillus fumigatus: Opportunities for Therapeutic Development ... Transcriptional regulation of gliotoxin[edit]. LaeA and GliZ are transcription factors known to regulate the production of ... Targeted mutation of the ftrA gene did not induce a decrease in virulence in the murine model of A. fumigatus invasion. In ...
Deng, M.; Lancto, C. A.; Abrahamsen, M. S. (2004). "Cryptosporidium parvum regulation of human epithelial cell gene expression ... Sebghati TS, Engle JT, Goldman WE (November 2000). "Intracellular parasitism by Histoplasma capsulatum: fungal virulence and ... Salmonella Typhi Brucella Legionella Mycobacterium Nocardia Neisseria Rhodococcus equi Yersinia Staphylococcus aureus Fungal ...
Enzymes Involved in Biosynthesis (in order of activity) GliZ: transcription factor that regulates expression of gli gene ... Exposure to fungal species that secrete gliotoxin is common because airborne Aspergillus fungal spores are ubiquitous in many ... Regulation of Biosynthesis Some gliotoxin molecules are not secreted by GliA and remain in the cell. This intracellular ... the enzymes needed for gliotoxin biosynthesis are encoded in 13 genes within the gli gene cluster. When this gene cluster is ...
Hilbert, J. L.; Martin, F. (1988). "Regulation of gene expression in ectomycorrhizas". New Phytologist. 110 (3): 339-346. doi: ... Some fungal genes appear to be expressed before plant contact, suggesting that signals in the soil may induce important fungal ... Production of the fungal mantle involves the upregulation of genes responsible for translation and cell growth, as well as ... Both partners (plant and fungus) must follow a precise sequence of gene expression for this to be successful. There is evidence ...
Gene Structure and Expression. 1352 (1): 73-84. doi:10.1016/S0167-4781(96)00238-2. PMID 9177485. Pang, Yan-Wei; Zhang, Ling- ... One such case is of an Eosinophilic fungal rhinosinusitis in an immunocompromised male. Endoscopic sinus surgery was required ... "The regulation of the vanadium chloroperoxidase from Curvularia inaequalis". Biochimica et Biophysica Acta (BBA) - ... Posteraro, B.; Posteraro, E.; Sorda, M.; Torelli, R.; De Corso, E. (2010). "Eosinophilic fungal rhinosinusitis due to the ...
Morris KL (2008). "Epigenetic Regulation of Gene Expression". RNA and the Regulation of Gene Expression: A Hidden Layer of ... For more details on this topic, see Fungal prions.. Prions are infectious forms of proteins. In general, proteins fold into ... There are several layers of regulation of gene expression. One way that genes are regulated is through the remodeling of ... They control gene expression including virulence genes in pathogens and are viewed as new targets in the fight against drug- ...
Morris KL (2008). "Epigenetic Regulation of Gene Expression". RNA and the Regulation of Gene Expression: A Hidden Layer of ... Further information: Fungal prions. Prions are infectious forms of proteins. In general, proteins fold into discrete units that ... There are several layers of regulation of gene expression. One way that genes are regulated is through the remodeling of ... They control gene expression including virulence genes in pathogens and are viewed as new targets in the fight against drug- ...
"Transcriptional regulation by the numbers: applications". Current Opinion in Genetics & Development. Chromosomes and expression ... "Transcriptional Rewiring of Fungal Galactose-Metabolism Circuitry". Current Biology. 17 (12): 1007-1013. doi:10.1016/j.cub. ... They also use inputs such as trans and cis sequence regulators of genes, and outputs such as gene expression level. Depending ... They are functional clusters of genes that impact each other's expression through inducible transcription factors and cis- ...
... stimulus-induced gene expression, and cell-type regulation are common to Dictyostelium and metazoans. For further detail see ... Though they are Protista and in no way fungal, they traditionally are known as "slime molds". They are present in most ...
... ylation of histone proteins in nuclear chromatin plays a role in chromatin stability and gene expression. The US National ... that compact and order nuclear DNA into structural units called nucleosomes and play a role in gene regulation. Biotinylation ... including increased susceptibility to bacterial and fungal infections. Low serum and urine biotin are not sensitive indicators ... Satiaputra J, Shearwin KE, Booker GW, Polyak SW (March 2016). "Mechanisms of biotin-regulated gene expression in microbes". ...
Protein Crystal Growth-Single Locker Thermal Enclosure System-Regulation of Gene Expression (PCG-STES-RGE) Protein Crystal ... Fungal Pathogenesis, Tumorigenesis, and Effects of Host Immunity in Space (FIT) Mice Drawer System (MDS) Rodent Research ... Gene expression of p53-regulated Genes in Mammalian Cultured Cells after Exposure to Space Environment (Rad Gene) Detection of ... Gene Expression of p53-Regulated Genes in Mammalian Cultured Cells After Exposure to Space Environment (LOH-RadGene) Effects of ...
Ngo P, Ozga JA, Reinecke DM (July 2002). "Specificity of auxin regulation of gibberellin 20-oxidase gene expression in pea ... cDNA isolation, characterization, and bacterial expression of a bifunctional diterpene cyclase in fungal gibberellin ... "Phytochrome regulation and differential expression of gibberellin 3beta-hydroxylase genes in germinating Arabidopsis seeds". ... genes coding for GA 20-oxidase and GA 3-oxidase) and the SLENDER1 gene (a GA signal transduction gene) are found in growing ...
Regulation of gene expression)等真核生物遺傳學與細胞生物學的基礎研究。近年來有更多真菌被當成醫學、植物病理與工業研究的模式生物,例如人類的病原菌白色念珠菌[250]、植物病原菌稻熱病菌[251]與工業上常用來大量生產真核生物 ... doi:10.1016/j.gene.2006.02.023.. *^ Liu YJ, Hodson MC, Hall BD. Loss of the flagellum happened only once in the fungal lineage ... Regulation of nitrogen metabolism and
Some new therapeutic approaches target the regulation of TNF-an expression. Rether et al. used a cell-based screening system to ... found that oxaspirodion derived from C. subspirale inhibited the expression of a TNF-a-driven luciferase reporter gene. The NF- ... "Fungal Metabolites with Anticancer Activity". Natural Product Reports. 31 (5): 617-27. doi:10.1039/c3np70078j. PMID 24651312. ... C. subspirale produces the mycotoxin, oxaspirodion, which inhibits inducible TNF-a expression and inhibits the activation of ...
... elements in gene promoters.[17] Type I IFNs can induce expression of genes with either ISRE or GAS elements, but gene induction ... IFNs belonging to all three classes are important for fighting viral infections and for the regulation of the immune system. ... recent information demonstrates the importance of Type III IFNs in some types of virus or fungal infections.[8][9][10] ... Gene cloning also confirmed that IFN-α was encoded by a family of many related genes.[59] The type II IFN (IFN-γ) gene was also ...
"Coregulated expression of loline alkaloid-biosynthesis genes in Neotyphodium uncinatum cultures". Fungal Genetics and Biology. ... doi:10.1016/S0031-9422(96)00535-3. Zhang, DX; Nagabhyru, P; Schardl CL (2009). "Regulation of a chemical defense against ... of selected LOL genes by RNA interference and gene knockout have directly confirmed the involvement of two of the LOL genes in ... methyl jasmonate-which commonly signals predation by insects-decreases expression of the genes for the lolines. The factors ...
Ozsarac N, Straffon MJ, Dalton HE, Dawes IW (March 1997). "Regulation of gene expression during meiosis in Saccharomyces ... Heterokaryon Incompatibility (HI) has been likened to a fungal immune system; it is a non-self recognition mechanism that is ... Ndt80 stimulates the expression of the gene that encodes polo-like kinase, Plk. This protein is activated in late pachytene and ... Dementhon K, Iyer G, Glass NL (December 2006). "VIB-1 is required for expression of genes necessary for programmed cell death ...
... expression is restricted to cells of the immune system, with highest abundance on mature B cells, and lower expression is ... Leukocyte antigen CD37 is a protein that in humans is encoded by the CD37 gene. The protein encoded by this gene is a member of ... Tetraspanins mediate signal transduction events that play a role in the regulation of immune responses, cell development, ... "The tetraspanin protein CD37 regulates IgA responses and anti-fungal immunity". PLOS Pathogens. 5 (3): e1000338. doi:10.1371/ ...
Regulation of gene expression. *Gene regulatory network. *Developmental-genetic toolkit. *Evolutionary developmental biology ... The studies on fungal evolutionary genomics will further elucidate the earliest stages of divergence as a result of gene flow, ... Such a gene that exhibits multiple phenotypic expression is called a pleiotropic gene . Therefore mutation in a pleiotropic ... One basic model of pleiotropy's origin describes a single gene locus to the expression of a certain trait. The locus affects ...
Riboswitches have been found to act as regulators of gene expression, particularly in bacteria, but also in plants and archaea ... Such enzyme targeting is also responsible for gene down regulation though RNA interference (RNAi), where an enzyme-associated ... RNA thermometers regulate gene expression in response to temperature changes.[44] Support and difficulties[edit]. The RNA world ... viable daughter cells to be produced would require an extra replication of the intact RNA gene homologous to any RNA gene that ...
The first step of gene expression, in which a particular segment of DNA is copied into RNA by the enzyme RNA polymerase. Both ... A membrane-bound organelle which is present in all plant and fungal cells and some protist, animal, and bacterial cells.. ... The study of populations of organisms, especially the regulation of population size, life history traits such as clutch size, ... gene pool. A set of all genes, or genetic information, in any population, usually of a particular species.. generation. genetic ...
Many species will spread out their wings and expose them to direct sunlight and this too is thought to help in reducing fungal ... For females, possible benefits of extra-pair copulation include getting better genes for her offspring and insuring against the ... Kokko, H; Harris, M; Wanless, S (2004). "Competition for breeding sites and site-dependent population regulation in a highly ... due largely to the homozygous expression of deleterious recessive alleles.[217] Cross-fertilisation between unrelated ...
"Coregulated expression of loline alkaloid-biosynthesis genes in Neotyphodium uncinatum cultures". Fungal Genetics and Biology. ... suggests regulation of in planta loline distributions, providing greater protection of newly grown or embryonic tissues against ... of selected LOL genes by RNA interference and gene knockout have directly confirmed the involvement of two of the LOL genes in ... is regulated by the expression of loline genes.[20]. Biosynthesis[edit]. The lolines are structurally similar to pyrrolizidine ...
Brigelius-Flohé R, Davies KJ (July 2007). "Is vitamin E an antioxidant, a regulator of signal transduction and gene expression ... inflammatory enzyme activity or gene regulation.[16][17] Although dietary antioxidants have been investigated for potential ... Antioxidants are an especially important class of preservatives as, unlike bacterial or fungal spoilage, oxidation reactions ... gene structures, evolution, and expression". Free Radical Biology & Medicine. 33 (3): 337-49. doi:10.1016/S0891-5849(02)00905-X ...
the ability to perform genomic and gene expression analyses of single cells and of entire microbial communities in the ... In mutualistic situations the plant often exchanges hexose sugars for inorganic phosphate from the fungal symbiont. It is ... "Regulation of inflammation by microbiota interactions with the host". Nature Immunology. 18 (8): 851-860. doi:10.1038/ni.3780 ... Metatranscriptomics studies have been performed to study the gene expression of microbial communities through methods such as ...
RegulationEdit. In vertebrates, melatonin secretion is regulated by activation of the beta-1 adrenergic receptor by ... Lincoln GA, Andersson H, Loudon A (October 2003). "Clock genes in calendar cells as the basis of annual timekeeping in mammals ... It is synthesized in plants when they are exposed to both biological stresses, for example, fungal infection, and nonbiological ... melatonin promotes the expression of antioxidant enzymes such as superoxide dismutase, glutathione peroxidase, glutathione ...
positive regulation of Wnt signaling pathway. • positive regulation of gene expression. • cellular response to lipoteichoic ... As a membrane surface receptor, TLR2 recognizes many bacterial, fungal, viral, and certain endogenous substances. In general, ... positive regulation of interleukin-8 production. • positive regulation of interleukin-6 production. • positive regulation of ... positive regulation of chemokine production. • positive regulation of NF-kappaB import into nucleus. • innate immune system. • ...
Gene expression in prokaryotes is influenced by an RNA-based system similar in some respects to RNAi. Here, RNA-encoding genes ... of Arabidopsis was shown to be involved in the regulation of several genes that control plant shape.[97] In plants, the ... gene in Aspergillus flavus decreases fungal growth and aflatoxin production in maize kernels". Planta. 247 (6): 1465-1473. doi: ... "Inhibition of gene expression in plant cells by expression of antisense RNA". Proceedings of the National Academy of Sciences ...
Type A HATs are located in the nucleus and are involved in the regulation of gene expression through acetylation of nucleosomal ... Rtt109 is a fungal-specific HAT that requires association with histone chaperone proteins for activity.[6] The HAT activities ... In general, histone acetylation increases gene expression.. In general, histone acetylation is linked to transcriptional ... doi:10.1016/j.gene.2005.09.010. PMID 16289629.. *^ Liu X, Wang L, Zhao K, Thompson PR, Hwang Y, Marmorstein R, Cole PA ( ...
Smith, Gene Allan. 2013. The Slave's Gamble. MacMillan. Page 55. *^ McNeur, Catherine (1 October 2011). "Review of The Ink of ... Practice regulation and Health risk certification[edit]. Tattooing is regulated in many countries because of the associated ... Pang, Joey (2008) "Tattoo Art Expressions". *Raviv, Shaun (2006) "Marked for Life: Jews and Tattoos" (Moment Magazine; June ... fungal infections, some forms of hepatitis, herpes simplex virus, HIV, staph, tetanus, and tuberculosis.[109] ...
Regulation of gene expression)等真核生物遺傳學與細胞生物學的基礎研究。近年來有更多真菌被當成醫學、植物病理與工業研究的模式生物,例如人類的病原菌白色念珠菌[250]、植物病原菌稻熱病菌[251]與工業上常用來大量生產真核生物 ... doi:10.1016/j.gene.2006.02.023.. *^ Liu YJ, Hodson MC, Hall BD. Loss of the flagellum happened only once in the fungal lineage ... Regulation of nitrogen metabolism and
... alters the expression of genes involved in smooth muscle cell contraction, migration and differentiation, and inhibits platelet ... "Regulation of hypoxic pulmonary vasoconstriction: basic mechanisms". The European Respiratory Journal. 32 (6): 1639-51. doi ... Mutations in several genes have been associated with this condition[24][25] these include bone morphogenetic protein receptor ... Reynolds, PN (February 2011). "Gene therapy for pulmonary hypertension: prospects and challenges". Expert Opinion on Biological ...
If the relevant gene is present, every time this process runs, the quantity of the target gene will be doubled.[19] After this ... producing an expression profile, which is capable of differentiating specific bacterial strains after being compared to known ... Progress has been slow due to a range of reasons including cost and regulation.[31] ... DNA microarrays and chips use the binding of complementary DNA to a target gene or nucleic acid sequence.[9] The benefit of ...
... is utilised by the bacteria to achieve regulation of gene expression. In bacteria, the principal function of regulatory ... The photosynthetic cyanobacterium Hyella caespitosa (round shapes) with fungal hyphae (translucent threads) in the lichen ... Kumamoto, C.A.; Vinces, M.D. (2005). "Contributions of hyphae and hypha-co-regulated genes to Candida albicans virulence". Cell ... However, many bacterial species can transfer DNA between individual cells by a horizontal gene transfer process referred to as ...
Smith, Gene Allan. 2013. The Slave's Gamble. MacMillan. Page 55. *^ McNeur, Catherine (1 October 2011). "Review of The Ink of ... The regulations were added to Osaka's ethical codes, and employees with tattoos were encouraged to have them removed. This was ... Pang, Joey (2008) "Tattoo Art Expressions". *Raviv, Shaun (2006) "Marked for Life: Jews and Tattoos" (Moment Magazine; June ... fungal infections, some forms of hepatitis, herpes simplex virus, HIV, staph, tetanus, and tuberculosis.[91] ...
cellular response to molecule of fungal origin. • positive regulation of type I hypersensitivity. • B cell affinity maturation ... More reference expression data. Gene ontology. Molecular function. • metal ion binding. • nucleotide binding. • lipid binding. ... The Btk gene is located on the X chromosome (Xq21.3-q22).[5] At least 400 mutations of the BTK gene have been identified. ... regulation of B cell cytokine production. • regulation of B cell apoptotic process. • phosphorylation. • histamine secretion by ...
Caterpillars are also affected by a range of bacterial, viral and fungal diseases, and only a small percentage of the butterfly ... Several boundaries seen in the adult colour pattern are marked by changes in the expression of particular transcription factors ... Brakefield, P. M.; Kesbeke, F.; Koch, P. B. (December 1998). "The Regulation of Phenotypic Plasticity of Eyespots in the ... "Phylogeny of Bicyclus (Lepidoptera: Nymphalidae) Inferred from COI, COII, and EF-1 Alpha Gene Sequences". Molecular ...
Regulation[edit]. Paralogs are often regulated differently, e.g. by having different tissue-specific expression patterns (see ... As an example, in the LCA, one gene (gene A) may get duplicated to make a separate similar gene (gene B), those two genes will ... "OrthoDB v9.1: cataloging evolutionary and functional annotations for animal, fungal, plant, archaeal, bacterial and viral ... 12 and 17 containing Hox gene clusters, collagen genes, keratin genes and other duplicated genes,[30] regions of human ...
Regulation of gene expression. *Gene regulatory network. *Developmental-genetic toolkit. *Evolutionary developmental biology ... even though it is a form of horizontal gene transfer. However, it does support the "selfish gene" part theory, since the gene ... Because sex combines genes from two individuals, sexually reproducing populations can more easily combine advantageous genes ... nuclear meiotic drivers and selfish cytoplasmic genes.[5] Meiotic driver is defined as genes that distort meiosis to produce ...
The vestigial gene acts to regulate the expression of the wing imaginal discs in the embryo and acts with other genes to ... and fungal infection. Upon infection, pro-Spatzle will be cleaved by the protease SPE (Spatzle processing enzyme) to become ... "Hierarchical chemosensory regulation of male-male social interactions in Drosophila". Nature Neuroscience. 14 (6): 757-62. doi ... The y gene is an ideal gene to study as it is visibly clear when an organisim has this gene, making it easier to understand the ...
GPCR regulation is additionally mediated by gene transcription factors. These factors can increase or decrease gene ... Penela P, Ribas C, Mayor F (November 2003). "Mechanisms of regulation of the expression and function of G protein-coupled ... Class D (or 4) (Fungal mating pheromone receptors). *Class E (or 5) (Cyclic AMP receptors) ... It can also regulate specific gene expression, cellular secretion, and membrane permeability. The protein enzyme contains two ...
... revealed a downgrade in the expression level of both of the genes. Down regulation of such genes has caused Drosophila to ... "Gene group: Transposable element derived genes". HUGO Gene Nomenclature Committee. Retrieved 4 March 2019.. ... Because interspersed repeats block gene conversion, they protect novel gene sequences from being overwritten by similar gene ... transposable elements can be relocated adjacent to their targeted genes, and control the expression levels of the gene, ...
TAIR and NASC: curated sources for diverse genetic and molecular biology information, links to gene expression databases etc. ... Many model systems have been developed to better understand interactions between plants and bacterial, fungal, oomycete, viral ... A. thaliana has been instrumental in dissecting these pathways to better understand the regulation of immune responses, the ... by plant resistance genes (R-genes), often described as a gene-for-gene relationship. This recognition may occur directly or ...
In Familial Mediterranean fever (FMF), a mutation in the pyrin (or marenostrin) gene, which is expressed mainly in neutrophil ... Functional heterogeneity of human neutrophils and their role in peripheral blood leukocyte quantity regulation (PhD). Donetsk ... and downregulating cytokine expression by inhibiting nuclear translocation of NF-κB.[43] ... "Phagocytosis by human neutrophils is stimulated by a unique fungal cell wall component". Cell Host & Microbe. 2 (1): 55-67. ...
Genetic expression of these transcripts were either upregulated or downregulated depending on genes when comparing them to ... Viral and fungal combination[edit]. A University of Montana and Montana State University team of scientists headed by Jerry ... Re-Regulation of Pesticides. PBS. Archived 12 December 2012 at the Wayback Machine. ... "Diet-dependent gene expression in honey bees: honey vs. sucrose or high fructose corn syrup". Scientific Reports. 4: 5726. ...
Controlled Expression of the Dominant Flocculation Genes FLO1, FLO5, and FLO11 in Saccharomyces cerevisiae Patrick Govender, ... Saline-Dependent Regulation of Manganese Peroxidase Genes in the Hypersaline-Tolerant White Rot Fungus Phlebia sp. Strain MG-60 ... Differential Regulation and Posttranslational Processing of the Class II Hydrophobin Genes from the Biocontrol Fungus Hypocrea ... Transcriptional Regulation of xyr1, Encoding the Main Regulator of the Xylanolytic and Cellulolytic Enzyme System in Hypocrea ...
The retrograde response, which signals mitochondrial dysfunction resulting in changes in nuclear gene expression, extends yeast ... The heat shock factor (HSF), a protein evolutionarily conserved from yeasts to human, regulates the expression of a set of ... At present, these Ecl1 family genes, which are extenders of chronological lifespan, have been identified only in fungi groups. ... Anti-aging effects of phloridzin, an apple polyphenol, on yeast via the SOD and Sir2 genes. ...
Search results: catch_all_subjects_mt:(Gene Expression Regulation, Fungal). Searching as Anonymous (not verified). No items ...
We also found that gene expression in the B.g. triticale hybrid is mostly conserved with the parent-of-origin, but some genes ... We also found that gene expression in the B.g. triticale hybrid is mostly conserved with the parent-of-origin, but some genes ... Finally, we identified 11 unambiguous cases of effector genes with hybrid-specific, non parent-of-origin gene expression, and ... Finally, we identified 11 unambiguous cases of effector genes with hybrid-specific, non parent-of-origin gene expression, and ...
We thank the Gene Technology Lab at Texas A&M and the Fungal Genetic Stock Center. This research was funded by National Science ... Expression of conidiation-associated genes. Gene expression values relative to the lowest expression value across the time ... Thus, we examined tissue specificity as well as temporal control of gene expression during development. Gene expression ... The reduction in glycolytic gene expression exhibited in 12T, combined with elevated expression of genes for gluconeogenesis, ...
Gene Expression Regulation * Genes, Fungal* * Mitosis* * Phenotype * Saccharomyces cerevisiae / cytology* * Schizosaccharomyces ... The wee1+ activity is counteracted in S. cerevisiae by the gene product of MIH1, a newly identified gene capable of encoding a ... Expression of wee1+ in a mih1- strain prevents the initiation of mitosis. These data indicate that important features of the ... We have found that the protein kinase encoded by the mitotic inhibitor gene wee1+ of fission yeast, which acts to delay mitosis ...
Genes of 15 AAPs were overexpressed in different strains, and the ability to take up one or more of the 20 common L-alpha-amino ... Fungal Proteins* * Gene Expression Regulation, Enzymologic * Gene Expression Regulation, Fungal * Intracellular Signaling ... Substrate specificity and gene expression of the amino-acid permeases in Saccharomyces cerevisiae Curr Genet. 1999 Dec;36(6): ... Genes of 15 AAPs were overexpressed in different strains, and the ability to take up one or more of the 20 common L-alpha-amino ...
Regulation and differential expression of the hydrophobin gene VDH1" [Fungal Genet. Biol. 45 (2008) 1525-1532]. In: Fungal ... Regulation and differential expression of the hydrophobin gene VDH1" [Fungal Genet. Biol. 45 (2008) 1525-1532]. Fungal Genetics ... Regulation and differential expression of the hydrophobin gene VDH1" [Fungal Genet. Biol. 45 (2008) 1525-1532]. Fungal Genetics ... Regulation and differential expression of the hydrophobin gene VDH1" [Fungal Genet. Biol. 45 (2008) 1525-1532], Fungal ...
title = "Hosts innate immune response to fungal and bacterial agents in vitro: Up-regulation of interleukin-15 gene expression ... Hosts innate immune response to fungal and bacterial agents in vitro: Up-regulation of interleukin-15 gene expression ... Hosts innate immune response to fungal and bacterial agents in vitro : Up-regulation of interleukin-15 gene expression ... Hosts innate immune response to fungal and bacterial agents in vitro : Up-regulation of interleukin-15 gene expression ...
Gene expression and Regulation. 3) Filamentous fungi as cell factories. 4) System for homologous and/or heterologous expression ... Advances in the Regulation and Production of Fungal Enzymes by Transcriptomics, Proteomics and Recombinant Strains Design. ... In this Research Topic, manuscripts related to "Advances in the regulation and production of fungal enzymes by transcriptomics ... 5) Carbohydrate-Active Enzymes expression, regulation and production. 6) Synthetic Biology. Keywords: Carbohydrate-active ...
Scientists uncover unique set of genes that play a role in muscle cellular gene regulation York University scientists have ... Starving the fungus could help fight drug-resistant fungal infections How do you fight a fungal infection that is becoming ... Gene Expression News and Research. RSS Gene Expression is the process by which a gene gets turned on in a cell to make RNA and ... Gene expression may be measured by looking at the RNA, or the protein made from the RNA, or what the protein does in a cell. ...
2000 pH regulation of gene expression in fungi. Fungal Genet. Biol. 29: 61-71. ... 2002 Regulation of gene expression by ambient pH in filamentous fungi and yeasts. Microbiol. Mol. Biol. Rev. 66: 426-446. ... One newly identified gene, MDS3, is required for expression in alkaline media of two filamentation-associated genes, HWP1 and ... 1993 Identification of functionally related genes that stimulate early meiotic gene expression in yeast. Genetics 133: 67-77. ...
Additional Keywords : Gene Expression Regulation. [+] Probiotic lactobacilli increases the effectivenesss of anti-fungal ... A compound found in tea tree oil has significant anti-fungal activity against Candida albicans, and particularly the azole- ...
Gene Expression Profiling / methods*. Gene Expression Regulation, Fungal. Genes, Mating Type, Fungal / genetics. Genetic ... Three genes were up-regulated that are likely involved in the regulation of the plasma membrane and fungal cell wall, and thus ... Supplemental). Genes that are strong candidates for differential expression between axenic culture and host infection. Genes ... Differential gene expression. Differential counts of reads mapping to A. apis gene models between culture types, with positive ...
Fungal Genetics and Biology Volume 55, 2013; pp. 22-31.. *. Regulation of Gene Expression during the Onset of Ligninolytic ... it would be useful to monitor changes in fungal gene expression during the onset of ligninolysis on a natural substrate. We ... Genome, Pleurotus ostreatus, Ligninolytic peroxidase genes, Heterologous expression, Crystal structure, Catalytic properties, ... Organization and differential regulation of a cluster of lignin peroxidase genes of Phanerochaete chrysosporium. The lignin ...
... but little is known about the polymorphisms that affect gene regulation. We analyzed regulatory variation in a cross between ... Natural genetic variation can cause significant differences in gene expression, ... Gene Expression Regulation, Fungal* * Genetic Linkage * Genetic Variation* * Molecular Sequence Data * Multigene Family ... Clustering and linkage analysis defined groups of coregulated genes and the loci involved in their regulation. Most expression ...
Gene Expression Regulation, Fungal. Genes, Fungal. Magnetic Resonance Spectroscopy. Mass Spectrometry. Mycelium / genetics. ... 17790214 - New ways to study developmental genes in spore-forming bacteria.. 12725934 - Stable integration and expression of ... Genes for the biosynthesis of 1,3-diaminopropane have been identified in the P. chrysogenum genome.. ... penicillin in Penicillium chrysogenum is an excellent model for studying the molecular mechanisms of control of gene expression ...
Post-transcriptional regulation of gene expression by upstream open reading frames. Audrey Atkin. 3:20. Evolution of Fungal ... Effectors of Fusarium oxysporum: identification, function, evolution and regulation of gene expression. Martijn Rep. 5:20. ... Regulation of microtubule-based transport. Samara Reck-Peterson. Long-distance endosome trafficking drives fungal effector ... Fungal Volatiles: Critical Signals for Fungal Interactions Co-chairs: Joan Bennett and Seogchan Kang. 3:00. Volatile Organic ...
DNA, Fungal Fungal Proteins Gene Expression Regulation, Fungal Indoleacetic Acids Membrane Transport Proteins Molecular ... These changes are blocked in cgopt1-silenced mutants, suggesting that this protein is involved in regulation of fungal response ... Expression of CgOPT1 in mycelia was low, and was enhanced by external application of IAA. cgopt1-silenced mutants produced less ... The corresponding gene showed similarity to oligopeptide transporters of the OPT family and was therefore named CgOPT1. ...
DNA, Fungal DNA-Binding Proteins Gene Expression Regulation, Fungal Genes, Fungal Macromolecular Substances Meiosis Molecular ... Here we show that control of gene expression during pre-meiotic S-phase in the fission yeast Schizosaccharomyces pombe is ... Several genes, including rec8+, rec11+, cdc18+, and cdc22+, which contain MCB motifs in their promoter regions, are found to be ... DSC1-MCB regulation of meiotic transcription in Schizosaccharomyces pombe. Molecular genetics and genomics : MGG. 2004 Feb;271( ...
Fungal Proteins/metabolism; Gene Expression Regulation, Fungal; Methyl Methanesulfonate; Promoter Regions, Genetic; Protein ... As systematic functional validation, we identified interactions for which the target changed expression in wild-type cells in ... MeSH Terms: DNA Damage*; DNA Repair/genetics; DNA Repair/physiology; DNA, Fungal; ...
pH regulation of gene expression in fungi. Fungal Genet. Biol. 29:61-71. ... Gene expression analysis.To identify possible Rim101p target genes, we performed genomewide expression analysis. Wild-type and ... Regulation of gene expression by ambient pH in filamentous fungi and yeasts. Microbiol. Mol. Biol. Rev. 66:426-446. ... To determine whether Nrg1p governs expression of additional alkaline pH-induced genes, we also examined expression of a zps1( ...
MicroRNA-mediated regulation of gene expression in the response of rice plants to fungal elicitors. ... Small RNA profiling reveals regulation of Arabidopsis miR168 and heterochromatic siRNA415 in response to fungal elicitors. ... The Arabidopsis miR396 mediates pathogen-associated molecular pattern-triggered immune responses against fungal pathogens. ... The MicroRNA miR773 Is Involved in the Arabidopsis Immune Response to Fungal Pathogens. ...
Soden DM, Dobson ADW (2001) Differential regulation of laccase gene expression in Pleurotus sajor-caju. Microbiology-Sgm 147: ... geldanus: regulation of pellets morphology through manipulation of broth viscosity. Appl Microbiol Biotechnol 68:305-310Google ... Baldrian P (2006) Fungal laccases-occurrence and properties. FEMS Microbiol Rev 30:215-242Google Scholar ... Papagianni M (2004) Fungal morphology and metabolite production in submerged mycelial processes. Biotechnol Adv 22:189-259 ...
Fungal and Parasitic Infections. Differential Regulation of β-Defensin Gene Expression during Cryptosporidium parvum Infection ... Differential Regulation of β-Defensin Gene Expression during Cryptosporidium parvum Infection. Tarek K. Zaalouk, Mona Bajaj- ... Differential Regulation of β-Defensin Gene Expression during Cryptosporidium parvum Infection. Tarek K. Zaalouk, Mona Bajaj- ... Regulation of human β-defensin gene expression in HT29 cells during C. parvum infection. (a) RT-PCR analysis showing that C. ...
Gene Expression; Gene Expression Regulation, Plant; Hordeum/genetics/microbiology/physiology/ultrastructure; Host-Pathogen ... Autophagy; Caspase 3/genetics/metabolism; Cell Death; Disease Resistance; Fungal Proteins/genetics/metabolism; Gene Expression ... Gene Expression Regulation, Plant; Hordeum/genetics/microbiology/physiology/ultrastructure; Host-Pathogen Interactions; ... Similarly, Ustilago mutants being deleted for pep1, a gene encoding a secreted effector, are blocked upon host penetra... » ...
However, the regulation of pectinase gene expression is still poorly understood. For an optimal utilization of plant biomass ... Fungal enzyme sets for plant polysaccharide degradation journal, July 2011 * van den Brink, Joost; de Vries, Ronald P. ... However, the regulation of pectinase gene expression is still poorly understood. For an optimal utilization of plant biomass ... 09 BIOMASS FUELS; pectin degradation; l-rhamnose catabolism; d-galacturonic acid catabolism; gene regulation; Zn2Cys6 ...
pH regulation of gene expression in fungi. Fungal Genet. Biol. 29:61-71. ... Regulation of gene expression by ambient pH in filamentous fungi and yeasts. Microbiol. Mol. Biol. Rev. 66:426-446. ... The pH of the host niche controls gene expression in and virulence of Candida albicans. Infect. Immun. 66:3317-3325. ... At alkaline pHs, the 74-kDa form is seen, which governs alkaline pH-specific changes in gene expression. At acidic pHs, the 65- ...
Fungal cell walls are medically important since they represent a drug target site for antifungal medication. So far there is no ... PolyP, depending on its location, has diverse roles ranging from phosphate storage in cytosol to regulation of gene expression ... Fungal cell walls are medically important since they represent a drug target site for antifungal medication. So far there is no ... Noothalapati, H., Sasaki, T., Kaino, T. et al. Label-free Chemical Imaging of Fungal Spore Walls by Raman Microscopy and ...
Host Gene Expression Response to Fungal Infection. Gordon D. Brown, University of Aberdeen, UK Immunity to Fungal Infections, ... Evolution of Gene Regulation in Fungi. Aaron P. Mitchell, Carnegie Mellon University, USA Portrait of Candida albicans ... Using a Gene Deletion Collection to Understand how Cryptococcus neoformans Causes Disease and Responds to Chemicals. ... Boron-based Agents for Fungal and Protozoan Infections. Xuewen Pan, Baylor College of Medicine, USA Short Talk: Novel ...
  • The heat shock factor (HSF), a protein evolutionarily conserved from yeasts to human, regulates the expression of a set of proteins called heat shock proteins (HSPs), many of which function as molecular chaperones. (isharonline.org)
  • Not surprisingly, genes encoding transcription factors, cell wall remodeling proteins, and proteins involved in signal transduction were differentially regulated during asexual development. (genetics.org)
  • Many strategies have been studied in order to improve heterologous production of proteins by filamentous fungi, including the deletion of genes that encode for proteases, the deletion of lectin-like ER-Golgi cargo receptors and the co-expression of specific chaperones. (frontiersin.org)
  • It has been shown that the main bottleneck in the production of heterologous proteins is not caused by the low expression of the target gene. (frontiersin.org)
  • However, the understanding of complex interactions of important proteins and genes, as well as how they are regulated is more promising. (frontiersin.org)
  • Gene Expression is the process by which a gene gets turned on in a cell to make RNA and proteins. (news-medical.net)
  • Several gene products required for PacC and Rim101p cleavage are homologous to one another and include the S. cerevisiae calpain-like protease Rim13p (also called Cpl1p), the protease scaffold Rim20p, the putative transmembrane proteins Rim9p and Rim21p, and Rim8p, of unknown biochemical function ( 5 , 15 , 26 , 52 ). (asm.org)
  • In the present paper we show that H. jecorina RUT C30 lacks an 85 kb genomic fragment, and consequently misses additional 29 genes comprising transcription factors, enzymes of the primary metabolism and transport proteins. (nih.gov)
  • Marschall R, Tudzynski P (2016) BcIqg1, a fungal IQGAP homolog, interacts with NADPH oxidase, MAP kinase and Calcium signaling proteins, and regulates virulence and development in B. cinerea . (uni-muenster.de)
  • The most frequent change was downregulation of genes predicted to encode membrane-bound proteins. (mdpi.com)
  • The deduced product of FCC1 is similar to C-type cyclins, a class of proteins involved in the transcriptional activation or repression of genes associated with stress responses and development ( 4 , 14 , 15 ). (asm.org)
  • With "compartment" we always denote spatial subcellular structures, while "module" applies to functionally related genes and proteins. (mcponline.org)
  • We demonstrate that the quality of protein-mRNA correlations varies among different cellular compartments and functional modules, and we quantify the contribution of post-transcriptional steps, including protein turnover, to the observed expression regulation of proteins. (mcponline.org)
  • Recently, a number of TFs have been identified as binding partners of the JAZ proteins with a variety of different roles in regulating JA -associated gene expression (for review, see Kazan and Manners, 2012 ). (plantphysiol.org)
  • Several genes encoding proteins involved in iron acquisition, including several members of the ferric reductase family, are repressed in iron-replete conditions by Sfu1 ( 34 ). (asm.org)
  • The MicroRNA miR773 Is Involved in the Arabidopsis Immune Response to Fungal Pathogens. (nih.gov)
  • The Arabidopsis miR396 mediates pathogen-associated molecular pattern-triggered immune responses against fungal pathogens. (nih.gov)
  • The expression of hBD-1 and another antimicrobial peptide, LL-37, was shown to be markedly reduced during Shigella infection, highlighting a potential novel immune evasion mechanism that may facilitate increased persistence of pathogens at mucosal surfaces ( 13 ). (asm.org)
  • Belmondo S, Marschall R, Tudzynski P, Artuso E, Prandi C, Lanfranco L (2016) Identification of genes involved in fungal responses to strigolactones using mutants from fungal pathogens. (uni-muenster.de)
  • Overall the book provides essential reading covering the recent advances, utilising molecular biology approaches, to further our understanding of fungal pathogens of humans. (caister.com)
  • This new volume on the current research on fungal pathogens is a valuable resource for both scientists and clinicians. (caister.com)
  • Fungal pathogens have to adapt to changing environments as infection develops in the host. (caister.com)
  • Here, we review the current gene expression technologies that have been applied to study fungal pathogens and summarise the transcriptional responses of a number of pathogenic fungi to different pathogenesis-related conditions such as interactions with macrophages, changing pH and temperature, morphogenesis and exposure to antifungal drugs or reactive nitrogen species. (caister.com)
  • This chapter examines how cell identity influences mating-type determination, particularly in fungal pathogens. (asmscience.org)
  • It concludes with a short description of the influence of cell identity on the behaviors of several other plant and human fungal pathogens and how cell identity in fungi is evolving to encompass a more diverse array of fungal behaviors. (asmscience.org)
  • The group investigates the cellular and molecular basis of the infection of plants by Phytophthora and fungal pathogens, employing a fully integrated approach that uses the latest techniques in molecular genetics, genomics, cell biology and microscopy. (edu.au)
  • Gan, P. H. P., Dodds, P.N. and Hardham, A.R. (2012) Plant infection by biotrophic fungal and oomycete pathogens. (edu.au)
  • In: Plant Fungal pathogens: Methods and Protocols. (edu.au)
  • Studies of the yeast Saccharomyces cerevisiae reveal four processes determining life span: metabolism, stress resistance, chromatin-dependent gene regulation, and genome stability. (isharonline.org)
  • We identified 2641 genes that were differentially expressed during development, which represents ∼25% of the predicted genes in the genome of this model fungus. (genetics.org)
  • K asuga and G lass (2008) tracked gene expression across defined sections from a growing colony that also exhibited asexual development using the same full genome microarray used in this study. (genetics.org)
  • The genetic manipulation of individual genes and changes in the genome seems not to be the best alternative to overcome the main bottlenecks in heterologous protein secretion. (frontiersin.org)
  • Our goals were to further annotate the A. apis reference genome and to identify genes that are candidates for being differentially expressed during host infection versus axenic culture. (biomedsearch.com)
  • CONCLUSIONS: This comprehensive transcriptome analysis substantially enhances our understanding of the A. apis genome and its expression during infection of honey bee larvae. (biomedsearch.com)
  • The biosynthesis of penicillin in Penicillium chrysogenum is an excellent model for studying the molecular mechanisms of control of gene expression due to a good knowledge of the biochemistry and molecular genetics of β-lactam antibiotics and to the availability of its genome sequence and proteome. (biomedsearch.com)
  • Genes for the biosynthesis of 1,3-diaminopropane have been identified in the P. chrysogenum genome. (biomedsearch.com)
  • The Hypocrea jecorina (Trichoderma reesei) hypercellulolytic mutant RUT C30 lacks a 85 kb (29 gene-encoding) region of the wild-type genome. (nih.gov)
  • A BLAST search of the H. jecorina genome sequence database with the cloned cre1 gene identified it to be located on scaffold 2: 786955-789433 (ID 120117), and thus distant from the locus of the lesion which was identified in this paper. (nih.gov)
  • Fungal genetics and genome evolution. (bio.net)
  • Genome assemblies and gene annotations are available via the URL links listed in Supplementary Table 2 . (nature.com)
  • Much of the focus of post-genome science is now switching from simply cataloguing genes and gene products, to the greater challenge of understanding how they interact and regulate one another. (pubmedcentralcanada.ca)
  • Regulatory networks underlying mycorrhizal development delineated by genome-wide expression profiling and functional analysis of the transcription factor repertoire of the plant symbiotic fungus Laccaria bicolor. (inra.fr)
  • Chromatin immunoprecipitation experiments revealed that class II TGA factors TGA2, TGA5, and/or TGA6 are needed to recruit SCL14 to promoters of selected SCL14 target genes identified by whole-genome transcript profiling experiments. (plantcell.org)
  • Here we analyzed global regulation during different stress conditions in fission yeast, Schizosaccharomyces pombe, combining dynamic genome-wide data on mRNA, translation, and protein profiles. (ucl.ac.uk)
  • The whole genome sequence studies reveals high quality information about genes and canonical pathways involved in the lignin and other cell wall components degradation. (ijbs.com)
  • Pest resistance was associated with individual candidate genes as well as with trans-regulatory hotspots along the spruce genome. (biomedcentral.com)
  • A second, homologous protein, Gis2, was identified in the genome of C. neoformans and also bound the 3′-UTR probe, and deletion of both genes resulted in loss of binding in cell extracts. (asm.org)
  • However, one can parse the effects of mating type from those of ploidy by constructing isogenic sets of yeast strains that vary only in their ploidy, and then subjecting these strains to whole-genome expression analysis. (sciencemag.org)
  • We have also identified new genes required for pH-dependent filamentation, a trait previously associated with virulence. (genetics.org)
  • We manually annotated genes with homologs in other fungal genomes that have known relevance to fungal virulence and life history. (biomedsearch.com)
  • An extracellularly-produced peptide acts intracellularly to program fungal virulence. (genetics-gsa.org)
  • Hinsch J, Galuszka P, Tudzynski P (2016) Functional characterization of the first filamentous fungal tRNA-IPT and its role in virulence of C. purpurea . (uni-muenster.de)
  • B) Various endogenous and exogenous triggers induce the SOS response, resulting in drug resistance, tolerance, persistence in host, virulence-factor synthesis, and dissemination of both resistance and virulence factor genes. (prolekare.cz)
  • Barbara studies the roles of mitochondria and metabolic reprogramming in fungal virulence. (edu.au)
  • Bella studies a regulator of gene expression in Candida virulence. (edu.au)
  • Sharon is interested in signalling pathways that control fungal virulence. (edu.au)
  • Many of these genes are homologous to nonessential Saccharomyces cerevisiae genes, and some have no S. cerevisiae homolog. (genetics.org)
  • In the yeast Saccharomyces cerevisiae , extracellular pH governs expression of genes specifying ion pumps and transporters that promote adaptation to changes in pH ( 4 , 18 , 26 , 45 ). (asm.org)
  • An initial study on N. crassa 's utilization of cellulose yielded promising candidate genes that were subsequently used in engineering strategies for improved cellulosic biofuel production in Saccharomyces cerevisiae ( 19 ) and contributed insights into a role for polysaccharide monooxygenases in cellulose deconstruction ( 20 , 21 ). (pnas.org)
  • Results We observed that fungal microbiota is skewed in IBD, with an increased Basidiomycota/Ascomycota ratio, a decreased proportion of Saccharomyces cerevisiae and an increased proportion of Candida albicans compared with HS. (bmj.com)
  • A single uORF with an evolutionarily conserved peptide sequence is found upstream of the structural genes for the small subunit of arginine-specific carbamoyl phosphate synthetase from Neurospora crassa, Magnaporthe grisea, Trichoderma virens, Aspergillus nidulans and Saccharomyces cerevisiae. (aspergillus.org.uk)
  • Comparison with the meiotic program of the distantly related Saccharomyces cerevisiae reveals an unexpectedly small shared meiotic transcriptome, suggesting that the transcriptional regulation of meiosis evolved independently in both species. (ucl.ac.uk)
  • Microarray-based gene expression analysis identified genes showing ploidy-dependent expression in isogenic Saccharomyces cerevisiae strains that varied in ploidy from haploid to tetraploid. (sciencemag.org)
  • Epigenetic and transcriptional control in coordination of fungal development and secondary metabolism. (genetics-gsa.org)
  • Fine scale evolution of fungal secondary metabolism. (genetics-gsa.org)
  • Other prototypical members of the group of transcription factors activated by proteolytic processing are the immune and inflammatory response regulator NF-κB ( 23 , 58 ), the Drosophila melanogaster cubitus interruptus (Ci) zinc finger factor (the transducer of the hedgehog signal) ( 29 , 53 ), and the sterol regulatory element-binding protein (SREBP), which switches on genes for cholesterol biosynthesis and fat metabolism ( 5 , 6 ). (asm.org)
  • The focus of this review is to provide an overview of the research establishing this connection, and this review covers the progress made to date in elucidating relationships between natural product metabolism and fungal development. (asm.org)
  • We show a highly significant enrichment in specific GO functional classes for genes that are translationally up- and down-regulated under given stresses (e.g. carbohydrate metabolism is up-regulated under amino acid starvation). (pubmedcentralcanada.ca)
  • These TFs resemble known fungal regulators involved in the control of fungal invasive growth, fungal cell wall integrity, carbon and nitrogen metabolism, invasive stress response and fruiting-body development. (inra.fr)
  • Methods: The present review examines published data from both in vitro and in vivo studies reporting effects of nutrients and byproducts of microbial metabolism on the expression of antimicrobial peptide genes in order to highlight an emerging appreciation for the role of dietary compounds in modulating the innate immune response. (oregonstate.edu)
  • Results: Vitamins A and D, dietary histone deacetylases and byproducts of intestinal microbial metabolism (butyrate and secondary bile acids) have been found to regulate the expression of AMPs in humans. (oregonstate.edu)
  • In addition, byproducts ofgut microbe metabolism could be important for communicating with intestinal epithelial and immune cells, thus affecting the expression of AMPs. (oregonstate.edu)
  • Transcript contigs, protein sequences from multiple fungal species, and ab initio gene predictions were included as evidence sources in the Maker gene prediction pipeline, resulting in 6,992 consensus gene models. (biomedsearch.com)
  • We profiled the alkaloids and sequenced the genomes of 10 epichloae, three ergot fungi (Claviceps species), a morning-glory symbiont (Periglandula ipomoeae), and a bamboo pathogen (Aciculosporium take), and compared the gene clusters for four classes of alkaloids. (nih.gov)
  • Our survey also revealed that fungi lack canonical gene-body methylation, which distinguishes fungal epigenomes from certain insect and plant species. (nature.com)
  • However, some fungal species possess independently derived clusters of contiguous 5mC encompassing many genes. (nature.com)
  • some fungal species also grow as single cells . (wikidoc.org)
  • Many fungal species have long been used as a direct source of food, such as mushrooms and truffles and in fermentation of various food products, such as wine , beer , and soy sauce . (wikidoc.org)
  • Based on observations of the ratio of the number of fungal species to the number of plant species in some environments, the fungal kingdom has been estimated to contain about 1.5 million species. (wikidoc.org)
  • [4] Around 70,000 fungal species have been formally described by taxonomists, but the true dimension of fungal diversity is still unknown. (wikidoc.org)
  • yeasts are required for fermentation of beer , wine [9] and bread , some other fungal species are used in the production of soy sauce and tempeh . (wikidoc.org)
  • The SOS response regulates DNA repair and damage tolerance genes in many bacterial species. (prolekare.cz)
  • Much of this work is carried out in the species Candida albicans, the most prevalent fungal pathogen of humans. (ucmerced.edu)
  • The lab is also beginning to study interspecies interactions between different fungal and bacterial species. (ucmerced.edu)
  • Open access articles that are associated with the species Oryza sativa and mention the gene name MIR396e . (mirbase.org)
  • A combination of process engineering and random mutagenesis of fungal species has greatly improved hydrolytic enzyme production from industrial strains ( 3 ). (pnas.org)
  • Although xlnR/xyr1 homologs are important for hemicellulase induction in Fusarium species and in Neurospora crassa , they do not play a significant role in cellulase gene expression ( 12 ⇓ - 14 ). (pnas.org)
  • Some common responses emerge when different fungal species are subjected to the same stresses but there are interesting differences too, reflecting the different survival strategies that have emerged in divergent fungal species as they have evolved. (caister.com)
  • Earlier studies convey that several fungal species like Trichoderma reesei, Phanerochaete chrysosporium, Fomitopsis palustris, Orpinomyces sp etc, were found to degrade cellulose by inhabiting the gastrointestinal tracts of several ruminating animals [ 11 , 12 ]. (ijbs.com)
  • Our results showed that specific genes within the phenylpropanoid pathway have been duplicated and diversified in the conifer in a process fundamentally different from short-lived angiosperm species. (biomedcentral.com)
  • At present, these Ecl1 family genes, which are extenders of chronological lifespan, have been identified only in fungi groups. (isharonline.org)
  • To this purpose, we determined the laccase gene expression, laccase activity, and protein profile of lichen-forming fungi supported to RBBR dye. (springer.com)
  • However, poxa1b gene expression was lowest in lichen-forming fungi biomass supplemented with RBBR dye. (springer.com)
  • This study has revealed the influence of RBBR dye on laccase activity levels and the determination of gene expression levels in lichen-forming fungi. (springer.com)
  • In this review, we describe secondary metabolites produced by fungi that act as sporogenic factors to influence fungal development, are required for spore viability, or are produced at a time in the life cycle that coincides with development. (asm.org)
  • PACC genes encode the major transcriptional regulators of several pH-responsive pathways in other filamentous fungi. (asm.org)
  • The pH-regulatory system in filamentous fungi is best described in Aspergillus nidulans , in which PacC is a transcriptional activator of alkaline-expressed genes and a repressor of acid-expressed genes. (asm.org)
  • The fungal hypha is an emergent cell type that is the characteristic growth form of most members of Kingdom Fungi. (tamu.edu)
  • The size and shape of spores and colonies of filamentous fungi are the important factors in fungal identification. (hindawi.com)
  • Recognizing the benefits that society could reap from research in fungal biology, Texas A&M University is committed to supporting the Program for the Biology of Filamentous Fungi (PBOFF). (tamu.edu)
  • Regulation of gene expression by ambient pH in filamentous fungi and yeasts. (nih.gov)
  • The most extensive work on cellulase gene transcription in filamentous fungi has been done in Aspergillus niger and Hypocrea jecorina ( Trichoderma reesei ) ( 3 , 7 ). (pnas.org)
  • These findings suggest that a complex network of transcriptional activators is required for cellulase and hemicellulase gene induction and secretion in filamentous fungi. (pnas.org)
  • Provided herein are fungi, such as Aspergillus niger, having a dolichyl-P-Man:Man(5)GlcNAc(2)-PP-dolichyl mannosyltransferase (Alg3) gene genetic inactivation, increased expression of a loss of aflR expression A (Lae), or both. (osti.gov)
  • Transcriptome analysis of the honey bee fungal pathogen, Ascosphaera apis: implications for host pathogenesis. (biomedsearch.com)
  • Taken together, this work demonstrates that zebrafish can be a useful host model to study C. albicans pathogenesis, and it highlights the advantages of using the zebrafish model in future invasive fungal research. (zfin.org)
  • Although some data suggest a role of the fungal microbiota in IBD pathogenesis, the available data are scarce. (bmj.com)
  • The fungal microbiota has been poorly studied despite several clues of its role in IBD pathogenesis. (bmj.com)
  • Fungal Genetics and Biology , 47 (6). (elsevier.com)
  • differential regulation in lignocellulose medium and effect of temperature and pH," Fungal Genetics and Biology , vol. 72, pp. 150-161, 2014. (hindawi.com)
  • Fungal Genetics and Biology 47, 663-671. (edu.au)
  • Natural genetic variation can cause significant differences in gene expression, but little is known about the polymorphisms that affect gene regulation. (nih.gov)
  • To date this and an additional frame-shift mutation in the glycoprotein-processing beta-glucosidase II encoding gene are the only known genetic differences in strain RUT C30. (nih.gov)
  • Formal genetic model of pH regulation in A. nidulans . (nih.gov)
  • These observations suggest genetic variants can decrease mRNA expression levels by increasing usage of intronic PAS. (elifesciences.org)
  • Thus, our work demonstrates that APA links genetic variation to variation in gene expression, protein expression, and disease risk, and reveals uncharted modes of genetic regulation. (elifesciences.org)
  • a gene identified by genetic interaction as a component of the regulatory network that includes the CreB deubiquitination enzyme. (fgsc.net)
  • The second section addresses molecular biology of bacteria, including DNA replication, transcription and translation, regulation of gene expression, genomics, and bacterial viruses. (umich.edu)
  • A compound found in tea tree oil has significant anti-fungal activity against Candida albicans, and particularly the azole-resistant forms. (greenmedinfo.com)
  • Function and regulation of the Candida glabrata Pdr1 transcription factor. (genetics-gsa.org)
  • Topics include: gene expression and regulation, heterozygosity in Candida , molecular diagnosis, regulation of the host-fungal interaction, the development of anti-fungals, signal transduction, and mechanisms of multi-drug resistance. (caister.com)
  • We study the clinically important fungal pathogen Candida albicans , which affects a large proportion of the population by causing both superficial and invasive infections. (edu.au)
  • Diagnosis and treatment of fungal infections remains very challenging, and life-threatening infections with Candida can have an astonishing mortality of 40% even with treatment. (edu.au)
  • Fungal determinants and host cell death signals in fatal Candida infections . (edu.au)
  • Manipulation of macrophage biology by the intracellular fungal pathogen Histoplasma capsulatum . (genetics-gsa.org)
  • Fungal Biology and Biotechnology 3:2 doi: 10.1186/s40694-016-0020-z . (uni-muenster.de)
  • The primary role of the program is to provide a unique environment for graduate training in fungal biology. (tamu.edu)
  • Yet a detailed understanding of how even the simplest cell controls its gene complement remains elusive, though great strides are being made in the field of systems biology. (pubmedcentralcanada.ca)
  • The course is designed to expose students to fundamental areas of plant and fungal biology. (umn.edu)
  • Students will gain an understanding of the diverse approaches being used to address fundamental questions in plant and fungal biology. (umn.edu)
  • Fungal Biology 116: 1013-1023. (edu.au)
  • Projects are available in the areas of host-pathogen interactions and gene regulation. (edu.au)
  • Jiyoti works on the gene expression control mechanisms that regulate host-pathogen interactions and infection. (edu.au)
  • Greenbaum and coworkers ( 7 ) discuss three potential reasons for the lack of a perfect correlation between mRNA and protein levels: i) translational regulation, ii) difference of in vivo protein half-lives, and iii) the significant amount of experimental error including differences with respect to the experimental conditions. (mcponline.org)
  • In this article, we explore the premise that protein levels are mainly determined by the corresponding mRNA levels, and we show to what extent translational regulation and selective degradation obliterate a perfect correlation between mRNA and protein abundance. (mcponline.org)
  • However, it is now known that the untranslated region of mRNA is involved in many regulatory aspects of gene expression in eukaryotic organisms. (wikipedia.org)
  • The 5′ leader of the bZIP11 mRNA harbors several upstream open reading frames (uORFs), of which the second uORF is well conserved among bZIP11 homologous genes. (plantphysiol.org)
  • Regulation can occur at several levels, from mRNA synthesis to the control of protein activity. (plantphysiol.org)
  • We also identified 24 apaQTLs associated with protein levels, but not mRNA expression. (elifesciences.org)
  • These effects of dykellic acid are time- and dose-dependent, and correlate with decreased MMP-9 promoter activity and mRNA expression. (aacrjournals.org)
  • However, approximately 200 genes each under oxidative and heat stress conditions showed discordant regulation with respect to mRNA and translation profiles, with genes and patterns of regulation being stress-specific. (ucl.ac.uk)
  • Overall changes in relative protein expression correlated better with changes in mRNA expression than with changes in translational efficiency. (ucl.ac.uk)
  • mRNA cap regulation in mammalian cell function and fate. (dundee.ac.uk)
  • Arg-specific ribosome stalling is proposed to result in Arg-specific negative regulation because such ribosomes would block ribosomal scanning from the 5'-end of the mRNA and therefore block trailing ribosomes from translating ARG2. (aspergillus.org.uk)
  • Using oligonucleotide-probe microarrays ( 5 ), we monitored the mRNA levels of all yeast genes in our strain set during exponential growth ( 6 ). (sciencemag.org)
  • and that both pathways govern pH-dependent expression of filamentation genes. (genetics.org)
  • Discovery of fungal secondary metabolic pathways from large-scale genomic and transcriptome information. (genetics-gsa.org)
  • Mehari Z, Pilati S, Sonego P, Malacarne G, Vrhovsek U, Engelen K, Tudzynski P, Zottini M, Baraldi E, Moser C (2017) Molecular analysis of the early interaction between the grapevine flower and Botrytis cinerea reveals that the prompt activation of specific pathways in the host leads to fungal quiescence. (uni-muenster.de)
  • Among the annotated sequences, only 5928 were annotated with 34 gene ontology (GO) functional categories, and 12,778 sequences were mapped to 165 pathways by searching against the Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) database. (biomedcentral.com)
  • Expression of MMPs is regulated by cytokines and signal transduction pathways, including those activated by phorbol myristate acetate. (aacrjournals.org)
  • Biosynthesis occurs through a limited number of metabolic pathways (Figure 1A ), however, the extreme structural diversity of compounds found so far (Figure 1B ) is due to biosynthetic enzymes that belong to multi-member gene families. (biomedcentral.com)
  • Fungal and plant gene expression in the Tulasnella calospora-Serapias vomeracea symbiosis provides clues about nitrogen pathways in orchid mycorrhizas. (escholarship.org)
  • The resulting product (248 to 250 residues) ( 41 ) is fully competent in transcriptional regulation through 5′-GCCARG-3′ sites ( 20 ) in the promoters of both alkaline (activated by PacC) ( 17 ) and acidic (repressed by PacC) ( 16 ) genes. (asm.org)
  • This analysis helps to understand the cell's strategy to use transcriptional and post-transcriptional regulation mechanisms for managing protein levels. (mcponline.org)
  • Understanding post-transcriptional regulation is crucial for correctly interpreting gene expression data. (mcponline.org)
  • Our focus lies on post-transcriptional regulation of protein amounts measured under standard log-growth conditions. (mcponline.org)
  • Collectively, our results indicate that yTAF(II)145 and other TFIID components have a specialized role in transcriptional regulation of cell cycle progression and growth control. (umassmed.edu)
  • Phot in C . reinhardtii also functions in transcriptional regulation [ 13 ] and in the control of phototaxis that desensitizes the eyespot when blue light intensities increase [ 14 ]. (mdpi.com)
  • The conditioned broth induced penicillin biosynthesis and transcription of the pcbAB, pcbC, and penDE genes when added at inoculation time, but its effect was smaller if added at 12 h and it had no effect when added at 24 h, as shown by Northern analysis and lacZ reporter studies. (biomedsearch.com)
  • Loline alkaloid biosynthesis loci (LOL) in epichloae and the homologous loci in other Clavicipitaceae.LOL genes are indicated by single letters, whereby F = lolF, C = lolC, and so forth. (nih.gov)
  • Transcription of FUM1 , a gene involved in fumonisin biosynthesis, was correlated with fumonisin production. (asm.org)
  • FUM1 (previously designated FUM5 ), the gene encoding a polyketide synthase involved at an early step in the formation of fumonisins, and a cluster of 14 genes adjacent to FUM1 are coordinately expressed during fumonisin biosynthesis ( 25 ). (asm.org)
  • FCC1 also affects the regulation of fumonisin biosynthesis ( 31 ). (asm.org)
  • 10. Busch, S., Bode, H.B., Brakhage, A.A. & Braus, G.H. 2003 Impact of the cross-pathway control of the regulation of lysine and penicillin biosynthesis in Aspergillus nidulans . (fgsc.net)
  • 15. Caruso, M.L., Litzka, O., Martic, G., Lottspeich, F. & Brakhage, A.A. 2002 Novel basic-region helix-loop-helix transcription factor (AnBH1) of Aspergillus nidulans counteracts the CCAAT-binding complex AnCF in the promoter of a penicillin biosynthesis gene. (fgsc.net)
  • Novel fungal transcriptional activators, Cmr1p of Colletotrichum lagenarium and pig1p of Magnaporthe grisea, contain Cys2His2 zinc finger and Zn(II)2Cys6 binuclear cluster DNA-binding motifs and regulate transcription of melanin biosynthesis genes in. (labome.org)
  • The gis2 Δ mutant and gis2 Δ znf9 Δ double mutant exhibited sensitivity to cobalt chloride, fluconazole, and oxidative stress, and although transcriptional induction of ERG25 was similar to that of the wild type, analysis of sterol content revealed repressed levels of sterols in the gis2 Δ and gis2 Δ znf9 Δ double mutant, suggesting a role in translational regulation of sterol biosynthesis. (asm.org)
  • We have found that the protein kinase encoded by the mitotic inhibitor gene wee1+ of fission yeast, which acts to delay mitosis, is able also to delay the initiation of mitosis when expressed in S. cerevisiae. (nih.gov)
  • The wee1+ activity is counteracted in S. cerevisiae by the gene product of MIH1, a newly identified gene capable of encoding a protein of MW 54,000, which is a structural and functional homolog of the cdc25+ mitotic inducer of fission yeast. (nih.gov)
  • Traven A , Sopta M: Functional characterization of the fungal specific protein Taf14 in S. cerevisiae and C. albicans . (edu.au)
  • Heterologous production of fungal ligninolytic cocktails is challenging due to the low yields of catalytically active lignin modifying peroxidases. (escholarship.org)
  • Light regulation controls asexual and sexual development in Aspergillus nidulans . (genetics-gsa.org)
  • The best-understood eukaryotic pH response pathway acts through the zinc-finger transcription factor PacC of Aspergillus nidulans , which activates alkaline pH-induced genes directly. (asm.org)
  • The possibility that these gene products act in a pH response pathway came from the finding that the Aspergillus nidulans pH response regulator PacC is a homolog of Rim101p ( 46 ). (asm.org)
  • pH regulation of gene expression in the mold Aspergillus nidulans is one such example. (asm.org)
  • In Aspergillus nidulans , a strain carrying a deletion of the clr-2 homolog ( clrB ) failed to induce cellulase gene expression and lacked cellulolytic activity on Avicel. (pnas.org)
  • 3. Arst, H.N. & Peñalva, M.A. 2003pH regulation in Aspergillus and parallels with higher eukaryotic regulatory systems. (fgsc.net)
  • These differential transcript ends-referred to as differential ends in this article-may thus have a role in posttranscriptional regulation of gene expression. (g3journal.org)
  • The fungal pathogen Cryptococcus neoformans employs posttranscriptional regulation of gene expression as part of the transcriptome reprogramming that accompanies cellular stress ( 1 - 3 ). (asm.org)
  • Developmental and physiological processes in organisms depend on regulation of gene expression. (plantphysiol.org)
  • These studies revealed that all four GS genes are differentially regulated in each organ of the plant, in a developmental manner, and identified new regulatory controls, which appear to be specific to certain metabolic contexts. (biomedcentral.com)
  • Orchids are highly dependent on their mycorrhizal fungal partners for nutrient supply, especially during early developmental stages. (escholarship.org)
  • We then developed methods for direct identification of genes and regulatory motifs. (nih.gov)
  • We also asked whether particular classes of genes were more likely to contain trans-regulatory polymorphisms. (nih.gov)
  • Notably, transcription factors showed no enrichment, and trans-regulatory variation seems to be broadly dispersed across classes of genes with different molecular functions. (nih.gov)
  • Here, the key regulatory zinc finger protein PacC activates alkaline genes and represses acidic genes according to the needs imposed by ambient pH, thereby providing the organism with one prerequisite for growing in environments as acidic as pH 2.5 or as alkaline as pH 10.5 ( 7 , 59 ). (asm.org)
  • None of the genes in the fumonisin biosynthetic gene cluster has a clear regulatory function. (asm.org)
  • The potential applied importance of this regulatory system lies in its key role in fungal pathogenicity of animals and plants and in its control of fungal production of toxins, antibiotics, and secreted enzymes. (nih.gov)
  • The regulation of transcription has been most intensively studied and involves a plethora of transcription factors that operate through several regulatory mechanisms. (plantphysiol.org)
  • The regulatory uORF motif is present in bZip-encoding genes from plants, but is absent from the genomes of other organisms. (plantphysiol.org)
  • Despite the central role of ferric reductases in iron acquisition and mobilization, relatively little is known about the regulatory networks that govern ferric reductase gene expression in C. albicans . (asm.org)
  • We have identified a CCAAT motif as the critical regulatory sequence for chelator-mediated induction and have found that the CCAAT binding factor (CBF) is essential for FRP1 expression in iron-limited environments. (asm.org)
  • Despite the fact that iron acquisition is essential for survival of C. albicans in the host, little is known about the regulatory control of genes involved in iron acquisition in this important opportunistic pathogen. (asm.org)
  • To identify new regulatory mechanisms controlling GS activity, we performed a detailed expression analysis of the entire GS gene family of M. truncatula in the major organs of the plant, over a time course of nodule or seed development and during a diurnal cycle. (biomedcentral.com)
  • BACKGROUND: Gene expression is controlled globally and at multiple levels in response to environmental stress, but the relationships among these dynamic regulatory changes are not clear. (ucl.ac.uk)
  • Biochimica et Biophysica Acta - Gene Regulatory Mechanisms. (dundee.ac.uk)
  • In a /α diploid cells, α2 continues to repress a -specific genes, but it also interacts with a 1 to form a transcriptional regulatory complex that represses haploid-specific genes (hsg), including α1. (asmscience.org)
  • We identified eight regulatory genomic regions with extensive overlap of quantitative trait loci from susceptibility and growth phenotypes (pQTLs) and expression QTL (eQTL) hotspots. (biomedcentral.com)
  • 2. We study gene-regulatory programs that control microbial pathogenicity. (edu.au)
  • The Nia1nit2 mutant with defects in genes encoding the nitrate reductase and regulatory protein NIT2 respectively was found to exhibit normal chemotaxis to nitrite. (mdpi.com)
  • In fungal fermentation, inoculation could be performed using either a culture in the form of vegetative cells or spores suspension. (hindawi.com)
  • We find that two Atf-like transcription factors are essential for the expression of late genes and formation of spores, and identify dozens of potential Atf target genes. (ucl.ac.uk)
  • Expression of wee1+ in a mih1- strain prevents the initiation of mitosis. (nih.gov)
  • Here we have demonstrated the differential regulation of two ferric reductases, FRE2 and FRP1 , in response to distinct iron-limited environments. (asm.org)
  • Among the genes differentially expressed in aerial tissues the majority were unclassified and tended to be unique to ascomycete genomes. (genetics.org)
  • The generation of thousands of fungal genomes is leading to a better understanding of genes and genomic organization within the kingdom. (nature.com)
  • Stajich, J. E. Fungal genomes and insights into the evolution of the kingdom. (nature.com)
  • Here we have re-examined these gene sets, considering the role of UTR sequences in the translational responses of these genes using recent large-scale datasets which define 5' and 3' transcriptional ends for many yeast genes. (pubmedcentralcanada.ca)
  • However, since uORFs are relatively rare (only ~13% of yeast genes have them) there remain many unanswered questions as to how UTR elements can direct translational control of many hundreds of genes under stress. (pubmedcentralcanada.ca)
  • Consistent with previous studies, we find that the majority of yeast genes are expressed under one or more different conditions. (g3journal.org)
  • TFIID comprises the TATA box-binding protein and a set of highly conserved associated factors (TAF(II)s). yTAF(II)145, the core subunit of the yeast TAF(II) complex, is dispensable for transcription of most yeast genes but specifically required for progression through G1/S. Here we show that transcription of G1 and certain B-type cyclin genes is dependent upon yTAF(II)145. (umassmed.edu)
  • Madhu studies innate immune interactions of fungal pathogenicity. (edu.au)
  • Inside the zebrafish, we monitored the progression of the C. albicans yeast-to-hyphae transition by tracking morphogenesis, and we monitored the corresponding gene-expression dynamics of the pathogen and the early host immune response. (zfin.org)
  • Based on these findings we propose that effectors play an important role in host adaptation that is mechanistically based on Avr-Resistance gene-Svr interactions. (frontiersin.org)
  • As systematic functional validation, we identified interactions for which the target changed expression in wild-type cells in response to MMS but was nonresponsive in cells lacking the TF. (nih.gov)
  • Analysis of gene expression can provide valuable information to aid our understanding of how the fungus responds to a variety of specific interactions with the host. (caister.com)
  • The lignin peroxidases (LiPs), manganese peroxidases (MnPs), and closely related enzymes of white rot basidiomycetes are likely contributors to fungal ligninolysis. (usda.gov)
  • In nature, fungal cellulases act within a complex repertoire of enzymes to synergistically deconstruct plant cell wall polysaccharides ( 1 , 2 ) ( Fig. S1 ) and industrial production of fungal cellulases is expected to play a major role in next-generation biofuel production ( 1 ). (pnas.org)
  • Medicago truncatula provides an excellent model system to study GS, as it contain a very simple GS gene family comprising only four expressed genes, MtGS1a and MtGS1b encoding cytosolic polypeptides, and MtGS2a and MtGS2b encoding plastid-located enzymes. (biomedcentral.com)
  • Inhibitors against Fungal Cell Wall Remodeling Enzymes. (dundee.ac.uk)
  • Most of the genes encoding lignin modifying enzymes (laccases and peroxidases) categorised as highly or moderately expressed on wood were expressed similarly on aromatic compounds. (escholarship.org)
  • The expression of polysaccharide degrading enzymes was lower on aromatic compounds compared to wood, demonstrating that the induction of lignin modifying enzymes became more specific. (escholarship.org)
  • By comparing proteomic and enzymatic profiles, we show evidence for the induced expression of enzymes and PULs in cells grown on mannan polysaccharides compared with cells grown on glucose. (megazyme.com)
  • Much of this research has exploited advances in array-based technologies to characterise how gene expression levels change during the cell cycle or in response to stresses or environmental changes [ 1 , 2 ], allowing transcriptional factors to be mapped to the genes they regulate [ 3 , 4 ]. (pubmedcentralcanada.ca)
  • uORFs can regulate eukaryotic gene expression. (wikipedia.org)
  • However, it is currently not known mechanistically how MED25 functions to regulate JA -responsive gene expression. (plantphysiol.org)
  • One target of Can_miR_06 is the growth -regulating factor gene (Os04g51190), which is also target ed by miR396 [35], indicating that multiple miRNAs may regulate the same gene family. (mirbase.org)
  • In this review, we introduce physiological and molecular features of the neoblast, and discuss how germline genes regulate planarian neoblasts and what differences exist between neoblasts and germline cells. (labome.org)
  • In particular, SNPs within two different CCoAOMT loci regulate phenotypic variation from a common set of 24 genes and three resistance traits. (biomedcentral.com)
  • Identification of conserved and novel features of the alkaline response pathway in the fungal pathogen Cryptococcus neoformans . (genetics-gsa.org)
  • Saline-Dependent Regulation of Manganese Peroxidase Genes in the Hypersaline-Tolerant White Rot Fungus Phlebia sp. (asm.org)
  • For those obtained from optimal laccase genes expression profiles, we modified different RNA extraction protocols to obtain high quality and quantity RNA to be used in downstream applications in lichen-forming fungus. (springer.com)
  • Neubauer L*, Dopstadt J*, Humpf HU, Tudzynski P (2016) Identification and charcterization of the ergochrome gene cluster in the plant pathogenic fungus C. purpurea . (uni-muenster.de)
  • Mixtures of aromatic compounds induce ligninolytic gene expression in the wood-rotting fungus Dichomitus squalens. (escholarship.org)
  • Our findings stand in contrast to the well-characterized function of PacC as a direct activator of alkaline pH-induced genes yet explain many aspects of Rim101p and PacC function in other organisms. (asm.org)
  • At alkaline ambient pH, a signal transmitted to PacC by the orphan pal gene signal transduction pathway ( 13 , 14 , 37 , 43 , 44 ) results in a conformational change leading to an open conformation in which PacC is accessible to a processing protease ( 18 , 41 , 47 ). (asm.org)
  • We cloned a PACC -like gene ( PAC1 ) from F. verticillioides . (asm.org)
  • PACC mutants that constitutively express an active PacC protein have the same phenotype as the wild type grown under alkaline conditions regardless of the external pH by activating alkaline-expressed genes. (asm.org)
  • The active form of PacC is a transcriptional repressor of acid-expressed genes, such as pacA and gabA , and a transcriptional activator of alkaline-expressed genes, such as ipnA, prtA , and palD . (nih.gov)
  • Mutations inactivating pacC ( pacC − or pacC +/− ) or the pal signaling pathway lead to absence of expression of alkaline genes and derepression of acidic genes, which results in acidity mimicry. (nih.gov)
  • Gain-of-function pacC c mutations bypassing the pal signaling pathway (i.e., leading to active PacC at any ambient pH) result in permanent activation of alkaline genes and superrepression of acidic genes, which leads to alkalinity mimicry. (nih.gov)
  • A hipótese deste trabalho foi verificar se há influência do pH e da fonte nutricional na modulação da expressão de genes de T. rubrum que codificam proteínas envolvidas nos processos de autofagia (atg8 e atg15), adesão celular (sowgp) e de alguns fatores de transcrição (pacC, bZIP/cys-3 e nuc-1), e se estes processos estão relacionados à patogenicidade deste dermatófito. (usp.br)
  • A variação transcricional do gene pacC em resposta às diferentes fontes nutricionais sugere que sua expressão depende das condições nutricionais encontradas por esse fungo, sendo o pH uma resposta secundária. (usp.br)
  • Nossos resultados sugerem ainda que a via de autofagia seja importante para o desenvolvimento e sobrevivência de T. rubrum nestes substratos, e que o FT PacC atue regulando um dos pontos deste processo, visto que o gene atg15 apresenta um perfil semelhante de expressão ao gene pacC, e o gene atg8 tem perfil antagônico de expressão nas linhagens H6 e pacC-1, nas condições avaliadas neste trabalho. (usp.br)
  • These transitions, which involve profound, symbiosis-associated metabolic changes, also entail a substantial transcriptome reprogramming with coordinated waves of differentially expressed genes. (inra.fr)
  • Regulation of transcriptome, translation, and proteome in response to environmental stress in fission yeast. (ucl.ac.uk)
  • On the basis of the distribution of functional annotations of 1102 of these genes, we identified gene expression patterns that define key physiological events during conidial development. (genetics.org)
  • Functional categories of interest included genes involved in mating-type specification, intracellular signal transduction, and stress response. (biomedsearch.com)
  • Positional cloning and functional assays showed that polymorphisms in GPA1 and AMN1 affect expression of genes involved in pheromone response and daughter cell separation, respectively. (nih.gov)
  • Yeast uORFs are more highly conserved than has been suggested, lending further weight to their significance as functional elements involved in gene regulation. (pubmedcentralcanada.ca)
  • Functional CLR-1 was necessary for expression of clr-2 and efficient cellobiose utilization. (pnas.org)
  • Deletion of LANA SIM led to functional loss of both LANA-mediated viral episome maintenance and lytic gene silencing. (prolekare.cz)
  • Recent studies show a positive correlation between expression of MMP-9 and tumor metastasis for colorectal cancer and for several types of epithelial cancer (7 , 8) , thus suggesting an important functional role for these proteinases in the metastasis process. (aacrjournals.org)
  • In such gene families, environmental stimuli may have an important effect on the evolutionary fate of duplicated genes, and different expression patterns may indicate functional diversification. (biomedcentral.com)
  • ER stress activates a conserved signaling pathway called unfolded protein response (UPR) and ER-associated protein degradation (ERAD), which upregulates genes responsible for restoring protein folding homeostasis in the cell and degrades misfolded protein in the cytosol by the ubiquitin-proteasome system. (frontiersin.org)
  • The response of C. albicans to the extracellular pH is controlled by a conserved fungal pH response pathway that is governed by the zinc finger transcription factor Rim101p (also previously called Prr2p and Hrm101p) ( 6 , 33 , 34 , 41 ). (asm.org)
  • Subsequently, we examined the up-regulation or uniquely expressed genes following amended medium treatment, which were also expressed on the enrichment pathway, and found that most of them participated in mediating oxidative stress homeostasis. (biomedcentral.com)
  • And suppressing of osa- miR396 (MIM396) up-regulated many auxin synthesis and response genes (YUCCA, ARFs and GH3), revealing OsGRF6 is a positive regulator of auxin signalling pathway [38]. (mirbase.org)
  • Similarly, the increased complexity by which higher eukaryotes can control and manage the levels of their gene products has been suggested to underlie complexity in higher organisms - a compelling argument when the small difference between the numbers of genes in humans and the fly is considered. (pubmedcentralcanada.ca)
  • Upstream open reading frames cause widespread reduction of protein expression and are polymorphic among humans" (PDF). (wikipedia.org)
  • Strains containing deletions of several differentially expressed genes encoding transcription factors exhibited asexual development-associated phenotypes. (genetics.org)
  • This observation prompted us to characterize a deletion of the gene encoding a high-affinity cAMP phosphodiesterase (NCU00478). (genetics.org)
  • As the reason for this gene deletion in RUT C30 is unknown, we wondered whether it would be topologically related to the cre1.1 mutation. (nih.gov)
  • We have shown earlier that exposure of human peripheral blood mononuclear cells (PBMC) to viruses results in rapid up-regulation of NK cell activity via interleukin-15 (IL-15) induction, and that this mechanism curtails viral infection in vitro. (dasmaninstitute.org)
  • How do you fight a fungal infection that is becoming increasingly resistant to medicine? (news-medical.net)
  • Using human and murine models of infection, we demonstrated that C. parvum infection differentially regulates β-defensin gene expression. (asm.org)
  • Infection of the human colonic HT29 cell line with the parasite resulted in differential effects on various members of the defensin gene family. (asm.org)
  • These findings demonstrate that C. parvum infection of enterocytes may affect the expression of various defensins in different ways and suggest that the overall outcome of the effect of antimicrobial peptides on early survival of the parasite may be complex. (asm.org)
  • Human β-defensin-1 (hBD-1) is constitutively expressed by epithelial cells, whereas expression of hBD-2, -3, and -4 is induced by infection and inflammation ( 10 , 16 , 25 , 30 ). (asm.org)
  • From a pathological perspective, cell wall acts as the first line of defense against the host in the event of fungal infection. (nature.com)
  • During latent infection, only a few genes are expressed [3] . (prolekare.cz)
  • Modulating the endogenous expression of AMPs offers potential therapeutic treatments for infection and disease. (oregonstate.edu)
  • Animal and human clinical studies with butyrate indicate that increasing expression of AMPs in the colon protects against infection. (oregonstate.edu)
  • Blackman L.M. and Hardham, A.R. (2008) Regulation of catalase activity and gene expression during Phytophthora nicotianae development and infection of tobacco. (edu.au)
  • We analyzed gene expression in three B.g. tritici isolates, two B.g. secalis isolates and two B.g. triticale isolates and identified a core set of putative effector genes that are highly expressed in all formae speciales . (frontiersin.org)
  • Finally, we identified 11 unambiguous cases of putative effector genes with hybrid-specific, non-parent of origin gene expression, and we propose that they are possible determinants of host specialization in triticale mildew. (frontiersin.org)
  • We curated the L. bicolor gene models coding for transcription factors and assessed their expression and regulation in Poplar and Douglas fir ectomycorrhizae. (inra.fr)
  • To understand how these treatments affect expression of genes involved in aflatoxin production and development, we carried out expressed sequence tag (EST)-based microarray assays to identify genes in treated clones that are differentially expressed compared to the wild-type. (mdpi.com)
  • the "cydAB" genes encode a cyanide-resistant, low-affinity oxidase that is not of the cytochrome bd-type. (surrey.ac.uk)
  • Design Bacterial and fungal composition of the faecal microbiota of 235 patients with IBD and 38 healthy subjects (HS) was determined using 16S and ITS2 sequencing, respectively. (bmj.com)
  • Bacterial and fungal taxa associated with clinical parameters were identified using multivariate association with linear models. (bmj.com)
  • Correlation between bacterial and fungal microbiota was investigated using Spearman's test and distance correlation. (bmj.com)
  • The concomitant analysis of bacterial and fungal microbiota showed a dense and homogenous correlation network in HS but a dramatically unbalanced network in IBD, suggesting the existence of disease-specific inter-kingdom alterations. (bmj.com)
  • A full understanding of cell responses to external stimuli includes both transcription and translation regulation ( 6 , 9 , 10 ). (mcponline.org)
  • Hardham, A.R., Takemoto, D. and White, R.G. (2008) Rapid and dynamic subcellular reorganization following mechanical stimulation of Arabidopsis epidermal cells mimics responses to fungal and oomycete attack. (edu.au)
  • One newly identified gene, MDS3 , is required for expression in alkaline media of two filamentation-associated genes, HWP1 and ECE1 , but is not required for expression of other pH-response genes. (genetics.org)
  • The Rim101p repression target Nrg1p is in turn required for repression of two alkaline pH-inducible genes, including the Na + pump gene ENA1 , which is required for ion tolerance. (asm.org)
  • In addition, rim101Δ mutants have reduced expression of several alkaline pH-induced genes ( 26 ). (asm.org)
  • At alkaline pHs, Rim101p is processed through removal of a C-terminal glutamate-aspartate-rich domain to an active short form that governs changes in gene expression ( 11 , 18 - 20 , 28 , 39 ). (asm.org)
  • A mutant of F. verticillioides with a disrupted PAC1 gene had severely impaired growth at alkaline pH. (asm.org)
  • We have previously presented polysomal gradient and array-based evidence that translational control is widespread in a significant number of genes when yeast cells are exposed to a range of stresses. (pubmedcentralcanada.ca)
  • However, they have distinct compositional biases consistent with their putative role in translational control and are more common in genes which are apparently translationally up-regulated. (pubmedcentralcanada.ca)
  • Regulation of gene expression through translational control is common in many organisms. (plantphysiol.org)
  • Translational control of gene expression. (aspergillus.org.uk)
  • Moreover, transcript end diversity has important biological implications for the regulation of gene expression. (g3journal.org)
  • Here we show that hundreds of genes are regulated in successive waves of transcription that correlate with major biological events of meiosis and sporulation. (ucl.ac.uk)
  • The fungal family Clavicipitaceae includes plant symbionts and parasites that produce several psychoactive and bioprotective alkaloids. (nih.gov)
  • The plant signaling molecule salicylic acid (SA) and/or xenobiotic chemicals like the auxin mimic 2,4-D induce transcriptional activation of defense- and stress-related genes that contain activation sequence-1 ( as-1 )-like cis -elements in their promoters. (plantcell.org)
  • Chitinophaga pinensis belongs to a bacterial genus which is prominent in microbial communities in agricultural and forest environments, where plant and fungal biomass is intensively degraded. (megazyme.com)
  • Small RNA profiling reveals regulation of Arabidopsis miR168 and heterochromatic siRNA415 in response to fungal elicitors. (nih.gov)
  • The PHYTOCHROME AND FLOWERING TIME1 gene encoding the MEDIATOR25 (MED25) subunit of the eukaryotic Mediator complex is a positive regulator of jasmonate ( JA )-responsive gene expression in Arabidopsis ( Arabidopsis thaliana ). (plantphysiol.org)
  • However, it has been largely impossible to identify genes through an initial screen of gene disruption mutants. (genetics.org)
  • Similarly, Ustilago mutants being deleted for pep1, a gene encoding a secreted effector, are blocked upon host penetration. (tum.de)
  • Although it was once thought that natural products were essential for sporulation, there are many examples of fungal strains that still sporulate but are deficient in secondary metabolite production, for example, Penicillium urticae patulin mutants ( 103 ) and A. nidulans sterigmatocystin mutants ( 106 ). (asm.org)
  • mig1 mutants display 20-fold lower SUC2 expression than ssn6 mutants. (thebiogrid.org)
  • We report that mig1 partially restores SUC2 expression in mutants lacking the SNF1 protein kinase and show that mig1 is allelic to ssn1, a mutation selected as a suppressor of snf1. (thebiogrid.org)
  • Finally, the regulated SUC2 expression observed in snf1 mig1 mutants indicates that signals regarding glucose availability can be transmitted independently of the SNF1 protein kinase. (thebiogrid.org)
  • The signature of repressed genes overlapped significantly with those of cell separation mutants sep10 and sep15. (ucl.ac.uk)
  • Also, cmr1Delta mutants do not express the melanin biosynthetic structural genes SCD1 and THR1 during mycelial melanization, although the expression of these two genes was not affected during appressorial melanization. (labome.org)
  • The use of microparticles in fungal cultures is also a strategy to increase process productivity and reproducibility by controlling fungal morphology. (springer.com)
  • Impairment of the TFIIH-associated CDK-activating kinase selectively affects cell cycle-regulated gene expression in fission yeast. (ucl.ac.uk)
  • When Lrp production is increased in a given medium, expression of its target genes is also increased. (microbiologyresearch.org)
  • However, when the medium is changed from glucose to acetate, the response of the target genes is governed by many factors. (microbiologyresearch.org)
  • Anastasi A, Spina F, Romagnolo A, Tigini V, Prigioni V, Varese GC (2012) Integrated fungal biomass and activated sludge treatment for wastewater bioremediation. (springer.com)
  • This strain has been reported to contain a truncated carbon catabolite repressor gene cre1 and is consequently carbon catabolite derepressed. (nih.gov)
  • A) During normal growth the LexA transcriptional repressor downregulates the SOS response genes. (prolekare.cz)
  • Members of the ferric reductase gene family have also been shown to be negatively regulated by the Tup1 general repressor in C. albicans ( 6 , 30 ). (asm.org)
  • The evolution of secondary metabolite degradation by specialization of gene clusters. (genetics-gsa.org)
  • Clusters of neighboring genes (mostly close to telomeres) are co-expressed early in the process, which reflects a more global control of these genes. (ucl.ac.uk)
  • We describe here a gene disruption screen in C. albicans . (genetics.org)
  • These studies provide key insights into the regulation of ferric reductase gene expression in the fungal pathogen C. albicans . (asm.org)
  • The commensally colonized tissue could then be monitored to detect the natural fluctuations in C. albicans gene expression in the oral cavity. (asmscience.org)

No images available that match "gene expression regulation fungal"