Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in plants.
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.
Small double-stranded, non-protein coding RNAs, 21-25 nucleotides in length generated from single-stranded microRNA gene transcripts by the same RIBONUCLEASE III, Dicer, that produces small interfering RNAs (RNA, SMALL INTERFERING). They become part of the RNA-INDUCED SILENCING COMPLEX and repress the translation (TRANSLATION, GENETIC) of target RNA by binding to homologous 3'UTR region as an imperfect match. The small temporal RNAs (stRNAs), let-7 and lin-4, from C. elegans, are the first 2 miRNAs discovered, and are from a class of miRNAs involved in developmental timing.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
RNA which does not code for protein but has some enzymatic, structural or regulatory function. Although ribosomal RNA (RNA, RIBOSOMAL) and transfer RNA (RNA, TRANSFER) are also untranslated RNAs they are not included in this scope.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.
The material of CHROMOSOMES. It is a complex of DNA; HISTONES; and nonhistone proteins (CHROMOSOMAL PROTEINS, NON-HISTONE) found within the nucleus of a cell.
The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in archaea.
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in fungi.
A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
The pattern of GENE EXPRESSION at the level of genetic transcription in a specific organism or under specific circumstances in specific cells.
The extent to which an RNA molecule retains its structural integrity and resists degradation by RNASE, and base-catalyzed HYDROLYSIS, under changing in vivo or in vitro conditions.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.
Established cell cultures that have the potential to propagate indefinitely.
Interacting DNA-encoded regulatory subsystems in the GENOME that coordinate input from activator and repressor TRANSCRIPTION FACTORS during development, cell differentiation, or in response to environmental cues. The networks function to ultimately specify expression of particular sets of GENES for specific conditions, times, or locations.
A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
The sequence at the 3' end of messenger RNA that does not code for product. This region contains transcription and translation regulating sequences.
A multistage process that includes cloning, physical mapping, subcloning, sequencing, and information analysis of an RNA SEQUENCE.
The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.
A genetic process by which the adult organism is realized via mechanisms that lead to the restriction in the possible fates of cells, eventually leading to their differentiated state. Mechanisms involved cause heritable changes to cells without changes to DNA sequence such as DNA METHYLATION; HISTONE modification; DNA REPLICATION TIMING; NUCLEOSOME positioning; and heterochromatization which result in selective gene expression or repression.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.
A cell line derived from cultured tumor cells.
A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.
Small chromosomal proteins (approx 12-20 kD) possessing an open, unfolded structure and attached to the DNA in cell nuclei by ionic linkages. Classification into the various types (designated histone I, histone II, etc.) is based on the relative amounts of arginine and lysine in each.
Addition of methyl groups to DNA. DNA methyltransferases (DNA methylases) perform this reaction using S-ADENOSYLMETHIONINE as the methyl group donor.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in leukemia.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Sequential operating programs and data which instruct the functioning of a digital computer.
A set of statistical methods used to group variables or observations into strongly inter-related subgroups. In epidemiology, it may be used to analyze a closely grouped series of events or cases of disease or other health-related phenomenon with well-defined distribution patterns in relation to time or place or both.
Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.
The simultaneous analysis, on a microchip, of multiple samples or targets arranged in an array format.
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Processes that stimulate the GENETIC TRANSCRIPTION of a gene or set of genes.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
A technique that localizes specific nucleic acid sequences within intact chromosomes, eukaryotic cells, or bacterial cells through the use of specific nucleic acid-labeled probes.
Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
Methods used for detecting the amplified DNA products from the polymerase chain reaction as they accumulate instead of at the end of the reaction.
Elements of limited time intervals, contributing to particular results or situations.
A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.
Enzymes that oxidize certain LUMINESCENT AGENTS to emit light (PHYSICAL LUMINESCENCE). The luciferases from different organisms have evolved differently so have different structures and substrates.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Proteins encoded by homeobox genes (GENES, HOMEOBOX) that exhibit structural similarity to certain prokaryotic and eukaryotic DNA-binding proteins. Homeodomain proteins are involved in the control of gene expression during morphogenesis and development (GENE EXPRESSION REGULATION, DEVELOPMENTAL).
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
Characteristic restricted to a particular organ of the body, such as a cell type, metabolic response or expression of a particular protein or antigen.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Databases devoted to knowledge about specific genes and gene products.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
The statistical reproducibility of measurements (often in a clinical context), including the testing of instrumentation or techniques to obtain reproducible results. The concept includes reproducibility of physiological measurements, which may be used to develop rules to assess probability or prognosis, or response to a stimulus; reproducibility of occurrence of a condition; and reproducibility of experimental results.
DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.
Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.
A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Nucleic acid sequences involved in regulating the expression of genes.
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
Interruption or suppression of the expression of a gene at transcriptional or translational levels.
Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter.
Partial cDNA (DNA, COMPLEMENTARY) sequences that are unique to the cDNAs from which they were derived.
Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions.
A technique for identifying specific DNA sequences that are bound, in vivo, to proteins of interest. It involves formaldehyde fixation of CHROMATIN to crosslink the DNA-BINDING PROTEINS to the DNA. After shearing the DNA into small fragments, specific DNA-protein complexes are isolated by immunoprecipitation with protein-specific ANTIBODIES. Then, the DNA isolated from the complex can be identified by PCR amplification and sequencing.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.
A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.
Proteins found in any species of bacterium.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.
The functional hereditary units of PLANTS.
Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.
The systematic study of the complete DNA sequences (GENOME) of organisms.
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
A group of enzymes that catalyzes the hydrolysis of terminal, non-reducing beta-D-galactose residues in beta-galactosides. Deficiency of beta-Galactosidase A1 may cause GANGLIOSIDOSIS, GM1.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
An enzyme that catalyzes the acetylation of chloramphenicol to yield chloramphenicol 3-acetate. Since chloramphenicol 3-acetate does not bind to bacterial ribosomes and is not an inhibitor of peptidyltransferase, the enzyme is responsible for the naturally occurring chloramphenicol resistance in bacteria. The enzyme, for which variants are known, is found in both gram-negative and gram-positive bacteria. EC 2.3.1.28.
Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.
Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.
The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.
Genes that are introduced into an organism using GENE TRANSFER TECHNIQUES.
Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.
An electrophoretic technique for assaying the binding of one compound to another. Typically one compound is labeled to follow its mobility during electrophoresis. If the labeled compound is bound by the other compound, then the mobility of the labeled compound through the electrophoretic medium will be retarded.
Genes that show rapid and transient expression in the absence of de novo protein synthesis. The term was originally used exclusively for viral genes where immediate-early referred to transcription immediately following virus integration into the host cell. It is also used to describe cellular genes which are expressed immediately after resting cells are stimulated by extracellular signals such as growth factors and neurotransmitters.
Transport proteins that carry specific substances in the blood or across cell membranes.
Proteins that are coded by immediate-early genes, in the absence of de novo protein synthesis. The term was originally used exclusively for viral regulatory proteins that were synthesized just after viral integration into the host cell. It is also used to describe cellular proteins which are synthesized immediately after the resting cell is stimulated by extracellular signals.
Proteins whose abnormal expression (gain or loss) are associated with the development, growth, or progression of NEOPLASMS. Some neoplasm proteins are tumor antigens (ANTIGENS, NEOPLASM), i.e. they induce an immune reaction to their tumor. Many neoplasm proteins have been characterized and are used as tumor markers (BIOMARKERS, TUMOR) when they are detectable in cells and body fluids as monitors for the presence or growth of tumors. Abnormal expression of ONCOGENE PROTEINS is involved in neoplastic transformation, whereas the loss of expression of TUMOR SUPPRESSOR PROTEINS is involved with the loss of growth control and progression of the neoplasm.
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
The performance of dissections with the aid of a microscope.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
RNA present in neoplastic tissue.
Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.
Non-antibody proteins secreted by inflammatory leukocytes and some non-leukocytic cells, that act as intercellular mediators. They differ from classical hormones in that they are produced by a number of tissue or cell types rather than by specialized glands. They generally act locally in a paracrine or autocrine rather than endocrine manner.
The relationship between the dose of an administered drug and the response of the organism to the drug.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
The genetic unit consisting of three structural genes, an operator and a regulatory gene. The regulatory gene controls the synthesis of the three structural genes: BETA-GALACTOSIDASE and beta-galactoside permease (involved with the metabolism of lactose), and beta-thiogalactoside acetyltransferase.
A strain of albino rat developed at the Wistar Institute that has spread widely at other institutions. This has markedly diluted the original strain.
Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Ribonucleic acid in plants having regulatory and catalytic roles as well as involvement in protein synthesis.
Serum glycoprotein produced by activated MACROPHAGES and other mammalian MONONUCLEAR LEUKOCYTES. It has necrotizing activity against tumor cell lines and increases ability to reject tumor transplants. Also known as TNF-alpha, it is only 30% homologous to TNF-beta (LYMPHOTOXIN), but they share TNF RECEPTORS.
Formation of an acetyl derivative. (Stedman, 25th ed)
The entity of a developing mammal (MAMMALS), generally from the cleavage of a ZYGOTE to the end of embryonic differentiation of basic structures. For the human embryo, this represents the first two months of intrauterine development preceding the stages of the FETUS.
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
Proteins that originate from plants species belonging to the genus ARABIDOPSIS. The most intensely studied species of Arabidopsis, Arabidopsis thaliana, is commonly used in laboratory experiments.
Proteins prepared by recombinant DNA technology.
The introduction of functional (usually cloned) GENES into cells. A variety of techniques and naturally occurring processes are used for the gene transfer such as cell hybridization, LIPOSOMES or microcell-mediated gene transfer, ELECTROPORATION, chromosome-mediated gene transfer, TRANSFECTION, and GENETIC TRANSDUCTION. Gene transfer may result in genetically transformed cells and individual organisms.
Tumors or cancer of the human BREAST.
The unfavorable effect of environmental factors (stressors) on the physiological functions of an organism. Prolonged unresolved physiological stress can affect HOMEOSTASIS of the organism, and may lead to damaging or pathological conditions.
Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.
The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.
A species of fruit fly much used in genetics because of the large size of its chromosomes.
Intracellular receptors that can be found in the cytoplasm or in the nucleus. They bind to extracellular signaling molecules that migrate through or are transported across the CELL MEMBRANE. Many members of this class of receptors occur in the cytoplasm and are transported to the CELL NUCLEUS upon ligand-binding where they signal via DNA-binding and transcription regulation. Also included in this category are receptors found on INTRACELLULAR MEMBRANES that act via mechanisms similar to CELL SURFACE RECEPTORS.
Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.
Any method used for determining the location of and relative distances between genes on a chromosome.
Mathematical procedure that transforms a number of possibly correlated variables into a smaller number of uncorrelated variables called principal components.
A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.
The developmental entity of a fertilized egg (ZYGOTE) in animal species other than MAMMALS. For chickens, use CHICK EMBRYO.
Promoter-specific RNA polymerase II transcription factor that binds to the GC box, one of the upstream promoter elements, in mammalian cells. The binding of Sp1 is necessary for the initiation of transcription in the promoters of a variety of cellular and viral GENES.
The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.
An anti-inflammatory 9-fluoro-glucocorticoid.
Cellular DNA-binding proteins encoded by the c-fos genes (GENES, FOS). They are involved in growth-related transcriptional control. c-fos combines with c-jun (PROTO-ONCOGENE PROTEINS C-JUN) to form a c-fos/c-jun heterodimer (TRANSCRIPTION FACTOR AP-1) that binds to the TRE (TPA-responsive element) in promoters of certain genes.
Deacetylases that remove N-acetyl groups from amino side chains of the amino acids of HISTONES. The enzyme family can be divided into at least three structurally-defined subclasses. Class I and class II deacetylases utilize a zinc-dependent mechanism. The sirtuin histone deacetylases belong to class III and are NAD-dependent enzymes.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Addition of methyl groups. In histo-chemistry methylation is used to esterify carboxyl groups and remove sulfate groups by treating tissue sections with hot methanol in the presence of hydrochloric acid. (From Stedman, 25th ed)
The functional hereditary units of BACTERIA.
Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.
Molecular products metabolized and secreted by neoplastic tissue and characterized biochemically in cells or body fluids. They are indicators of tumor stage and grade as well as useful for monitoring responses to treatment and predicting recurrence. Many chemical groups are represented including hormones, antigens, amino and nucleic acids, enzymes, polyamines, and specific cell membrane proteins and lipids.
A subtype of striated muscle, attached by TENDONS to the SKELETON. Skeletal muscles are innervated and their movement can be consciously controlled. They are also called voluntary muscles.
A pathological process characterized by injury or destruction of tissues caused by a variety of cytologic and chemical reactions. It is usually manifested by typical signs of pain, heat, redness, swelling, and loss of function.
A genus of nematode intestinal parasites that consists of several species. A. duodenale is the common hookworm in humans. A. braziliense, A. ceylonicum, and A. caninum occur primarily in cats and dogs, but all have been known to occur in humans.
The artificial induction of GENE SILENCING by the use of RNA INTERFERENCE to reduce the expression of a specific gene. It includes the use of DOUBLE-STRANDED RNA, such as SMALL INTERFERING RNA and RNA containing HAIRPIN LOOP SEQUENCE, and ANTI-SENSE OLIGONUCLEOTIDES.
The rate dynamics in chemical or physical systems.
A family of DNA-binding transcription factors that contain a basic HELIX-LOOP-HELIX MOTIF.
An exotic species of the family CYPRINIDAE, originally from Asia, that has been introduced in North America. They are used in embryological studies and to study the effects of certain chemicals on development.
The relatively long-lived phagocytic cell of mammalian tissues that are derived from blood MONOCYTES. Main types are PERITONEAL MACROPHAGES; ALVEOLAR MACROPHAGES; HISTIOCYTES; KUPFFER CELLS of the liver; and OSTEOCLASTS. They may further differentiate within chronic inflammatory lesions to EPITHELIOID CELLS or may fuse to form FOREIGN BODY GIANT CELLS or LANGHANS GIANT CELLS. (from The Dictionary of Cell Biology, Lackie and Dow, 3rd ed.)
The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.
Genes whose abnormal expression, or MUTATION are associated with the development, growth, or progression of NEOPLASMS.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
A multiprotein complex composed of the products of c-jun and c-fos proto-oncogenes. These proteins must dimerize in order to bind to the AP-1 recognition site, also known as the TPA-responsive element (TRE). AP-1 controls both basal and inducible transcription of several genes.
Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.
Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.
Proteins found in any species of virus.
The functional hereditary units of INSECTS.
The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.
The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.
Nucleotide sequences of a gene that are involved in the regulation of GENETIC TRANSCRIPTION.
ANIMALS whose GENOME has been altered by GENETIC ENGINEERING, or their offspring.
Retrovirus-associated DNA sequences (fos) originally isolated from the Finkel-Biskis-Jinkins (FBJ-MSV) and Finkel-Biskis-Reilly (FBR-MSV) murine sarcoma viruses. The proto-oncogene protein c-fos codes for a nuclear protein which is involved in growth-related transcriptional control. The insertion of c-fos into FBJ-MSV or FBR-MSV induces osteogenic sarcomas in mice. The human c-fos gene is located at 14q21-31 on the long arm of chromosome 14.
PLANTS, or their progeny, whose GENOME has been altered by GENETIC ENGINEERING.
Genes that encode highly conserved TRANSCRIPTION FACTORS that control positional identity of cells (BODY PATTERNING) and MORPHOGENESIS throughout development. Their sequences contain a 180 nucleotide sequence designated the homeobox, so called because mutations of these genes often results in homeotic transformations, in which one body structure replaces another. The proteins encoded by homeobox genes are called HOMEODOMAIN PROTEINS.
Techniques and strategies which include the use of coding sequences and other conventional or radical means to transform or modify cells for the purpose of treating or reversing disease conditions.
The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.
The developmental history of specific differentiated cell types as traced back to the original STEM CELLS in the embryo.
Refers to animals in the period of time just after birth.
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
Morphological and physiological development of EMBRYOS.
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.

In vivo and in vitro processing of the Bacillus subtilis transcript coding for glutamyl-tRNA synthetase, serine acetyltransferase, and cysteinyl-tRNA synthetase. (1/19133)

In Bacillus subtilis, the adjacent genes gltX, cysE, and cysS encoding respectively glutamyl-tRNA synthetase, serine acetyl-transferase, and cysteinyl-tRNA synthetase, are transcribed as an operon but a gltX probe reveals only the presence of a monocistronic gltX mRNA (Gagnon et al., 1994, J Biol Chem 269:7473-7482). The transcript of the gltX-cysE intergenic region contains putative alternative secondary structures forming a p-independent terminator or an antiterminator, and a conserved sequence (T-box) found in the leader of most aminoacyl-tRNA synthetase and many amino acid biosynthesis genes in B. subtilis and in other Gram-positive eubacteria. The transcription of these genes is initiated 45 nt upstream from the first codon of gltX and is under the control of a sigmaA-type promoter. Analysis of the in vivo transcript of this operon revealed a cleavage site immediately downstream from the p-independent terminator structure. In vitro transcription analysis, using RNA polymerases from Escherichia coli, B. subtilis, and that encoded by the T7 phage, in the presence of various RNase inhibitors, shows the same cleavage. This processing generates mRNAs whose 5'-end half-lives differ by a factor of 2 in rich medium, and leaves putative secondary structures at the 3' end of the gltX transcript and at the 5' end of the cysE/S mRNA, which may be involved in the stabilization of these mRNAs. By its mechanism and its position, this cleavage differs from that of the other known transcripts encoding aminoacyl-tRNA synthetases in B. subtilis.  (+info)

In vitro study of two dominant inhibitory GTPase mutants of Escherichia coli translation initiation factor IF2. Direct evidence that GTP hydrolysis is necessary for factor recycling. (2/19133)

We have recently shown that the Escherichia coli initiation factor 2 (IF2) G-domain mutants V400G and H448E do not support cell survival and have a strong negative effect on growth even in the presence of wild-type IF2. We have isolated both mutant proteins and performed an in vitro study of their main functions. The affinity of both mutant proteins for GTP is almost unchanged compared with wild-type IF2. However, the uncoupled GTPase activity of the V400G and H448E mutants is severely impaired, the Vmax values being 11- and 40-fold lower, respectively. Both mutant forms promoted fMet-tRNAfMet binding to 70 S ribosomes with similar efficiencies and were as sensitive to competitive inhibition by GDP as wild-type IF2. Formation of the first peptide bond, as measured by the puromycin reaction, was completely inhibited in the presence of the H448E mutant but still significant in the case of the V400G mutant. Sucrose density gradient centrifugation revealed that, in contrast to wild-type IF2, both mutant proteins stay blocked on the ribosome after formation of the 70 S initiation complex. This probably explains their dominant negative effect in vivo. Our results underline the importance of GTP hydrolysis for the recycling of IF2.  (+info)

Transient gene asymmetry during sporulation and establishment of cell specificity in Bacillus subtilis. (3/19133)

Sporulation in Bacillus subtilis is initiated by an asymmetric division generating two cells of different size and fate. During a short interval, the smaller forespore harbors only 30% of the chromosome until the remaining part is translocated across the septum. We demonstrate that moving the gene for sigmaF, the forespore-specific transcription factor, in the trapped region of the chromosome is sufficient to produce spores in the absence of the essential activators SpoIIAA and SpoIIE. We propose that transient genetic asymmetry is the device that releases SpoIIE phosphatase activity in the forespore and establishes cell specificity.  (+info)

Transcription of the stationary-phase-associated hspX gene of Mycobacterium tuberculosis is inversely related to synthesis of the 16-kilodalton protein. (4/19133)

The 16-kDa protein, an alpha-crystallin homologue, is one of the most abundant proteins in stationary-phase Mycobacterium tuberculosis. Here, transcription and translation of the hspX gene, which encodes the 16-kDa protein, have been investigated by Northern blotting analysis, primer extension, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis with a microaerophilic stationary-phase model. Two transcripts of about 2.5 and 1.1 kb were demonstrated by Northern blot analysis and hybridized to the hspX gene probe. Primer extension analysis revealed that the transcription start site is located 33 nucleotides upstream of the hspX gene start codon. The cellular level of the hspX mRNA was maximum in log-phase bacilli and was markedly reduced after 20 days in unagitated culture, when the organisms had entered the stationary phase. A third transcript of 0.5 kb was detected 0.6 kb downstream of the hspX gene; this transcript has a transcriptional pattern completely different from that of the 1.1- and 2.5-kb products, suggesting that there may be another gene in this region. In contrast to the high level of hspX mRNA in log-phase bacilli, 16-kDa protein synthesis was low in log-phase bacteria and rose to its maximum after 20 days. In both log-phase and stationary-phase bacteria the mRNA was unstable, with a half-life of 2 min, which indicated that the transcript stability was growth rate independent and not a general means for controlling the gene expression. However, the cellular content of 16-kDa protein, while low in log-phase bacteria, rose to a maximum at 10 days and remained at this high level for up to 50 days, which indicates that this protein is a stable molecule with a low turnover rate. These data suggest that the regulation of hspX expression during entry into and maintenance of stationary phase involves translation initiation efficiency and protein stability as potential mechanisms.  (+info)

Identification and characterization of SirA, an iron-regulated protein from Staphylococcus aureus. (5/19133)

The acquisition of iron by pathogenic bacteria is often a crucial step in establishing infection. To accomplish this, many bacteria, including Staphylococcus aureus, produce low-molecular-weight iron-chelating siderophores. However, the secretion and transport of these molecules in gram-positive organisms are poorly understood. The sequence, organization, and regulation of genes involved in siderophore transport are conserved among gram-negative bacteria. We used this information to identify a putative siderophore transport locus from an S. aureus genomic sequence database. This locus contains three predicted open reading frames with a high degree of homology to genes involved in siderophore uptake in several bacterial species, in particular the cbr locus of the plant pathogen Erwinia chrysanthemi. The first gene in the locus, which we have designated sir for staphylococcal iron regulated, encodes a putative lipoprotein with a molecular mass of 37 kDa. The open reading frame is preceded by a 19-bp region of dyad symmetry with homology for operator sequences controlling iron-regulated expression of genes in other bacteria. Fur titration experiments indicate that this region of dyad symmetry is sufficient for Fur-dependent regulation in Escherichia coli. The expression of this gene was repressed, in a dose-dependent manner, by the addition of iron to the S. aureus culture medium. sir-encoded proteins may be involved in iron acquisition in vivo and therefore may be targets for antimicrobial agents.  (+info)

Nitrate-dependent regulation of acetate biosynthesis and nitrate respiration by Clostridium thermoaceticum. (6/19133)

Nitrate has been shown to shunt the electron flow in Clostridium thermoaceticum from CO2 to nitrate, but it did not influence the levels of enzymes involved in the Wood-Ljungdahl pathway (J. M. Frostl, C. Seifritz, and H. L. Drake, J. Bacteriol. 178:4597-4603, 1996). Here we show that under some growth conditions, nitrate does in fact repress proteins involved in the Wood-Ljungdahl pathway. The CO oxidation activity in crude extracts of nitrate (30 mM)-supplemented cultures was fivefold less than that of nitrate-free cultures, while the H2 oxidation activity was six- to sevenfold lower. The decrease in CO oxidation activity paralleled a decrease in CO dehydrogenase (CODH) protein level, as confirmed by Western blot analysis. Protein levels of CODH in nitrate-supplemented cultures were 50% lower than those in nitrate-free cultures. Western blots analyses showed that nitrate also decreased the levels of the corrinoid iron-sulfur protein (60%) and methyltransferase (70%). Surprisingly, the decrease in activity and protein levels upon nitrate supplementation was observed only when cultures were continuously sparged. Northern blot analysis indicates that the regulation of the proteins involved in the Wood-Ljungdahl pathway by nitrate is at the transcriptional level. At least a 10-fold decrease in levels of cytochrome b was observed with nitrate supplementation whether the cultures were sparged or stoppered. We also detected nitrate-inducible nitrate reductase activity (2 to 39 nmol min-1 mg-1) in crude extracts of C. thermoaceticum. Our results indicate that nitrate coordinately represses genes encoding enzymes and electron transport proteins in the Wood-Ljungdahl pathway and activates transcription of nitrate respiratory proteins. CO2 also appears to induce expression of the Wood-Ljungdahl pathway genes and repress nitrate reductase activity.  (+info)

Environmental signals modulate ToxT-dependent virulence factor expression in Vibrio cholerae. (7/19133)

The regulatory protein ToxT directly activates the transcription of virulence factors in Vibrio cholerae, including cholera toxin (CT) and the toxin-coregulated pilus (TCP). Specific environmental signals stimulate virulence factor expression by inducing the transcription of toxT. We demonstrate that transcriptional activation by the ToxT protein is also modulated by environmental signals. ToxT expressed from an inducible promoter activated high-level expression of CT and TCP in V. cholerae at 30 degrees C, but expression of CT and TCP was significantly decreased or abolished by the addition of 0.4% bile to the medium and/or an increase of the temperature to 37 degrees C. Also, expression of six ToxT-dependent TnphoA fusions was modulated by temperature and bile. Measurement of ToxT-dependent transcription of genes encoding CT and TCP by ctxAp- and tcpAp-luciferase fusions confirmed that negative regulation by 37 degrees C or bile occurs at the transcriptional level in V. cholerae. Interestingly, ToxT-dependent transcription of these same promoters in Salmonella typhimurium was relatively insensitive to regulation by temperature or bile. These data are consistent with ToxT transcriptional activity being modulated by environmental signals in V. cholerae and demonstrate an additional level of complexity governing the expression of virulence factors in this pathogen. We propose that negative regulation of ToxT-dependent transcription by environmental signals prevents the incorrect temporal and spatial expression of virulence factors during cholera pathogenesis.  (+info)

Role of ribosome release in regulation of tna operon expression in Escherichia coli. (8/19133)

Expression of the degradative tryptophanase (tna) operon of Escherichia coli is regulated by catabolite repression and tryptophan-induced transcription antitermination. In cultures growing in the absence of added tryptophan, transcription of the structural genes of the tna operon is limited by Rho-dependent transcription termination in the leader region of the operon. Tryptophan induction prevents this Rho-dependent termination, and requires in-frame translation of a 24-residue leader peptide coding region, tnaC, that contains a single, crucial, Trp codon. Studies with a lacZ reporter construct lacking the spacer region between tnaC and the first major structural gene, tnaA, suggested that tryptophan induction might involve cis action by the TnaC leader peptide on the ribosome translating the tnaC coding region. The leader peptide was hypothesized to inhibit ribosome release at the tnaC stop codon, thereby blocking Rho's access to the transcript. Regulatory studies with deletion constructs of the tna operon of Proteus vulgaris supported this interpretation. In the present study the putative role of the tnaC stop codon in tna operon regulation in E. coli was examined further by replacing the natural tnaC stop codon, UGA, with UAG or UAA in a tnaC-stop codon-tnaA'-'lacZ reporter construct. Basal level expression was reduced to 20 and 50% when the UGA stop codon was replaced by UAG or UAA, respectively, consistent with the finding that in E. coli translation terminates more efficiently at UAG and UAA than at UGA. Tryptophan induction was observed in strains with any of the stop codons. However, when UAG or UAA replaced UGA, the induced level of expression was also reduced to 15 and 50% of that obtained with UGA as the tnaC stop codon, respectively. Introduction of a mutant allele encoding a temperature-sensitive release factor 1, prfA1, increased basal level expression 60-fold when the tnaC stop codon was UAG and 3-fold when this stop codon was UAA; basal level expression was reduced by 50% in the construct with the natural stop codon, UGA. In strains with any of the three stop codons and the prfA1 mutation, the induced levels of tna operon expression were virtually identical. The effects of tnaC stop codon identity on expression were also examined in the absence of Rho action, using tnaC-stop codon-'lacZ constructs that lack the tnaC-tnaA spacer region. Expression was low in the absence of tnaC stop codon suppression. In most cases, tryptophan addition resulted in about 50% inhibition of expression when UGA was replaced by UAG or UAA and the appropriate suppressor was present. Introduction of the prfA1 mutant allele increased expression of the suppressed construct with the UAG stop codon; tryptophan addition also resulted in ca. 50% inhibition. These findings provide additional evidence implicating the behavior of the ribosome translating tnaC in the regulation of tna operon expression.  (+info)

Two-component signal transduction systems enable bacteria to sense, respond, and adapt to changes in their environment or in their intracellular state. Each two-component system consists of a sensor protein-histidine kinase (HK) and a response regulator (RR). In the prototypical two-component pathway, the sensor HK phosphorylates its own conserved His residue in response to a signal(s) in the environment. Subsequently, the phosphoryl group of HK is transferred onto a specific Asp residue on the RR. The activated RR can then effect changes in cellular physiology, often by regulating gene expression. Two-component pathways thus often enable cells to sense and respond to stimuli by inducing changes in transcription ...
Two-component signal transduction systems enable bacteria to sense, respond, and adapt to changes in their environment or in their intracellular state. Each two-component system consists of a sensor protein-histidine kinase (HK) and a response regulator (RR). In the prototypical two-component pathway, the sensor HK phosphorylates its own conserved His residue in response to a signal(s) in the environment. Subsequently, the phosphoryl group of HK is transferred onto a specific Asp residue on the RR. The activated RR can then effect changes in cellular physiology, often by regulating gene expression. Two-component pathways thus often enable cells to sense and respond to stimuli by inducing changes in transcription ...
The relative representation of each mutant was determined by calculating the fold change (sequence reads/insertion in cholesterol divided by sequence reads/insertion in glycerol) for each gene. Statistical significance was determined by t-test. Each insertion site in each replicate sample was treated as a separate data point. The hyperbola used for defining genes specifically required for growth in cholesterol was defined by the formula, y = 3.8/x+0.7. Genes above this line are annotated as required for growth on cholesterol. - Griffin JE, Gawronski JD, Dejesus MA, Ioerger TR, Akerley BJ, Sassetti CM, High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. PLoS Pathog (2011) 7(9). ...
Zhu J, Miller MB, Vance RE, Dziejman M, Bassler BL, Mekalanos JJ. Quorum-sensing regulators control virulence gene expression in Vibrio cholerae. Proc Natl Acad Sci U S A. 2002 ;99(5):3129-34. ...
Citation Gómez-Mejia A, Gámez G, Hirschmann S, Kluger V, Rath H, Böhm S, Voss F, Kakar N, Petruschka L, Völker U, Brückner R, Mäder U, Hammerschmidt S. 2018. Pneumococcal metabolic adaptation and colonization are regulated by the two-component regulatory system 08. mSphere 3:e00165-18. https://doi.org/10.1128/mSphere.00165-18. ...
E coli rssB protein: negative regulator of sigma(S) factor, Rpos; isolated from E. coli; this two-component response regulator affects sigma S-dependent proteins; it is implicated in the control of protein stability; has been sequenced; homologous proteins, namely, Mvia and Hnr found in other bacteria
We use cookies to enhance your experience on our website. By continuing to use our website, you are agreeing to our use of cookies. You can change your cookie settings at any time.Find out more ...
Sindromul hiperactivitate/deficit de atenție (ADHD) este o afecțiune neuropsihiatrică frecvent întâlnită la vârsta pediatrică. La școlari, frecvența ADHD este de 4-12% (Brown 2001, Faraone 2003), dar sindromul poate afecta copiii de toate vârstele și manifestările pot persista până la vârsta adultă.
Signal transductionRegulatory functionsDNA interactionsphosphonate utilization transcriptional regulator PhnR (TIGR03337; HMM-score: 32.5) ...
E. Bouffartigues, I. Si Hadj Mohand, R. Duchesne, O. Maillot, N. Orange, et al.. Insight into the mechanism controlling the activity of the extracytoplasmic function sigma factor SigX in Pseudomonas aeruginosa. XIeme Congrès de la SFM, 2015, PARIS, France. ⟨hal-02386341⟩ ...
H-NS family proteins are nucleoid-associated proteins that form oligomers on DNA and function as global regulators. They are found in both bacterial chromosomes and plasmids, and were suggested to be candidate effectors of the interaction between them. TurA and TurB are the predominantly expressed H-NS family proteins encoded on the chromosome of Pseudomonas putida KT2440, while Pmr is encoded on the carbazole-degradative incompatibility group P-7 plasmid pCAR1. Previous transcriptome analyses suggested that they function cooperatively, but play different roles in the global transcriptional network. In addition to differences in protein interaction and DNA-binding functions, cell expression levels are important in clarifying the detailed underlying mechanisms. Here, we determined the precise protein amounts of TurA, TurB, and Pmr in KT2440 in the presence and absence of pCAR1. The intracellular amounts of TurA and TurB in KT2440 and KT2440(pCAR1) were determined by quantitative western blot analysis
Two-component signal transduction systems (TCSs) play fundamental roles in bacterial survival and pathogenesis and have been proposed as targets for the development of novel classes of antibiotics. A new coupled assay was developed and applied to analyse the kinetic mechanisms of three new kinds of inhibitors of TCS function. The assay exploits the biochemical properties of the cognate HpkA-DrrA histidine kinase-response regulator pair from Thermotoga maritima and allows multiple turnovers of HpkA, linear formation of phosphorylated DrrA, and Michaelis-Menten analysis of inhibitors. The assay was validated in several ways, including confirmation of competitive inhibition by adenosine 5′-β,γ-imidotriphosphate (AMP-PNP). The coupled assay, autophosphorylation and chemical cross-linking were used to determine the mechanisms by which several compounds inhibit TCS function. A cyanoacetoacetamide showed non-competitive inhibition with respect to ATP concentration in the coupled assay. The
The general stress response comprises approximately 200 genes and is driven by the alternative sigma factor SigB. Besides the process of sporulation with approximately 500 involved gene products under initial control of Spo0A are the two most significant and extensive cellular responses that can be observed in B. subtilis. The general stress response provides vegetative growing as well as non-growing and non-sporulating cells with a comprehensive cross-protective and preventive multiple stress resistance to various hostile environmental conditions. In contrast, the endospore is the most resistant but also dormant cell type produced by B. subtilis. The scope of this study was the identification of regulatory cascades driven by the general stress response sigma factor SigB to further elucidate the structure and function of the general stress regulon itself and to uncover potential intersections between the SigB response and other major developmental programs in the regulatory network of B. ...
The gram-negative bacterial envelope is a complex extracytoplasmic compartment responsible for numerous cellular processes. Among its most important functions is its service as the protective layer separating the cytoplasmic space from the ever-changing external environment. To adapt to the diverse conditions encountered both in the environment and within the mammalian host, Escherichia coli and Salmonella species have evolved six independent envelope stress response systems . This review reviews the sE response, the CpxAR and BaeSR two-component systems (TCS) , the phage shock protein response, and the Rcs phosphorelay system. These five signal transduction pathways represent the most studied of the six known stress responses. The signal for adhesion to abiotic surfaces enters the pathway through the novel outer membrane lipoprotein NlpE, and activation on entry into the exponential phase of growth occurs independently of CpxA . Adhesion could disrupt NlpE causing unfolding of its unstable N-terminal
Fingerprint Dive into the research topics of Mycobacterium tuberculosis ECF sigma factor sigC is required for lethality in mice and for the conditional expression of a defined gene set. Together they form a unique fingerprint. ...
Shop Leucine-responsive regulatory protein ELISA Kit, Recombinant Protein and Leucine-responsive regulatory protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Although Escherichia coli is generally considered to be predominantly a commensal of the gastrointestinal tract, a number of recent studies suggest that it is also capable of long-term survival and growth in environments outside the host. As the extraintestinal physical and chemical conditions are often different from those within the host, it is possible that distinct genetic adaptations may be required to enable this transition. Several studies have shown a trade-off between growth and stress resistance in nutrient-poor environments, with lesions in the rpoS locus, which encodes the stress sigma factor RpoS (σS). In this study, we investigated a unique collection of long-term soil-persistent E. coli isolates to determine whether the RpoS-controlled general stress response is altered during adaptation to a nutrient-poor extraintestinal environment. The sequence of the rpoS locus was found to be highly conserved in these isolates, and no nonsense or frameshift mutations were detected. Known ...
Member of the two-component regulatory system PhoP/PhoQ which regulates the expression of genes involved in virulence, adaptation to acidic and low Mg(2+) environments and resistance to host defense antimicrobial peptides. Essential for intramacrophage survival of S.typhimurium. In low periplasmic Mg(2+), PhoQ phosphorylates PhoP, resulting in the expression of PhoP-activated genes (PAG) and repression of PhoP-repressed genes (PRG). In high periplasmic Mg(2+), PhoQ dephosphorylates phospho-PhoP, resulting in the repression of PAG and may lead to expression of some PRG. Essential for transcription of spiC inside macrophages by controlling the expression of the two-component regulatory system SsrB/SpiR (SsrA) and Pir at transcriptional and post-transcriptional levels respectively. Promotes expression of the two-component regulatory system PmrA/PmrB via activation of pmrD gene. Is required to attenuate bacterial growth within fibroblast cells and to enhance bacterial resistance to bile in intestinal cells.
CategoryTree ,Parents= * 3. [[Information processing]] ** 3.4. [[Regulation of gene expression]] ,Neighbours= * 3.4.1. [[Sigma factors and their control]] * 3.4.2. [[Transcription factors and their control]] * 3.4.3. [[Trigger enzymes]] * 3.4.4. [[RNA binding regulators]] * 3.4.5. [[Regulators of core metabolism]] * 3.4.6. [[Transition state regulators]] * 3.4.7. [[Phosphorelay]] * 3.4.8. [[Quorum sensing]] * 3.4.9. [[Other regulators]] ,Related= none ,}} == Genes in this functional category == * [[abh]] * [[abrB]] * [[salA]] * [[scoC]] * [[sinI]] * [[sinR]] * [[slrA]] * [[slrR]] =Back to [[categories ...
This unit provides a chronological in‐depth description of all protocols needed for quantitative reverse transcription-PCR (Q‐RT‐PCR) analysis of Borrelia burgdorferi gene expression within infected mouse tissues
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The two-component signal transduction system (TCS) BarA/UvrY activates transcription of CsrB and CsrC noncoding RNAs, which act by sequestering the RNA-binding global regulatory protein CsrA. Here, we show that the metabolic end products formate and acetate provide a physiological stimulus for this TCS and thus link posttranscriptional regulation by the Csr system to the metabolic state of the cell. ...
An adaptive response to environmental stimuli is essential for life. The most widespread response mechanism involves the transfer of a phosphoryl group amongst the proteins in a signalling process. Two-component signal transduction systems are the chief signalling devices in bacteria and archaea. Actually, they are found in all life domains, although not in animals. A single bacteria can contain tens to hundreds of two-component systems controlling vital processes such as metabolism, development, motility, response to stress or virulence. These systems offer enormous possibilities for the development of new antimicrobials because they play a paramount role in bacterial physiology and in virulence processes, allowing adaptation of a parasite to its human host, or even triggering resistance to known antibiotics.. Although there are numerous variations in the details, two components systems obey the same basic pattern. The prototype consists of two proteins. One of them is a homodimeric membrane ...
GT:ID BAD55842.1 GT:GENE BAD55842.1 GT:PRODUCT putative two-component system response regulator GT:DATABASE GIB00210CH01 GT:ORG nfar0 GB:ACCESSION GIB00210CH01 GB:LOCATION 1103586..1104263 GB:FROM 1103586 GB:TO 1104263 GB:DIRECTION + GB:PRODUCT putative two-component system response regulator GB:PROTEIN_ID BAD55842.1 LENGTH 225 SQ:AASEQ MTAVLLAEDDEAIAAPLSRALGREGYTVTVESFGPAVLRRALEGNHDLLILDLGLPGMDGLEVCRQVRARGADLAVLMLTARTDEVDFVVGLDAGADDYVGKPFRLAELLARVRALLRRSGIGDEAVEVGGIRLEPAARRVLVNGVEVGLANKEYELLKVLIDRAGQVVPRETILREVWGDAELRGSKTLDMHMSWLRRKIGDEGPMAERRIVTVRGVGFRLNTD GT:EXON 1,1-225:0, BL:SWS:NREP 1 BL:SWS:REP 1-,222,REGX3_MYCTU,4e-41,41.4,220/227, SEG 105-,119,rlaellarvrallrr, BL:PDB:NREP 1 BL:PDB:REP 2-,222,2oqrA,5e-41,41.1,219/226, RP:PDB:NREP 1 RP:PDB:REP 1-,219,3c3wB,1e-22,25.4,205/210, RP:PFM:NREP 2 RP:PFM:REP 4-,104,PF00072,4e-15,43.6,101/111,Response_reg, RP:PFM:REP 145-,222,PF00486,2e-11,53.2,77/77,Trans_reg_C, HM:PFM:NREP 2 HM:PFM:REP 4-,114,PF00072,8.6e-28,36.9,111/112,Response_reg, HM:PFM:REP ...
GT:ID BAD55509.1 GT:GENE BAD55509.1 GT:PRODUCT putative two-component system response regulator GT:DATABASE GIB00210CH01 GT:ORG nfar0 GB:ACCESSION GIB00210CH01 GB:LOCATION complement(685615..686331) GB:FROM 685615 GB:TO 686331 GB:DIRECTION - GB:PRODUCT putative two-component system response regulator GB:PROTEIN_ID BAD55509.1 LENGTH 238 SQ:AASEQ MGGVSTSPTPTVLVVDDDEDVLASVERGLRLSGFHVLVARDGAAALRSVNADCPDAVVLDMNMPVLDGAGVVTALRALGNDVPICVLSARASVDDRISGLESGADDYLVKPFVLAELVARIKALLRRRTDAPAAAATPGAITVGPLEVDEAGYRALLHGREIELTKREFELLSTLARNAGVVLSRERLLELVWGYDFAADTNVVDVFVGYLRRKLEADGTPRLLHTIRGVGFVLRAPK GT:EXON 1,1-238:0, BL:SWS:NREP 1 BL:SWS:REP 27-,235,PRRA_MYCTU,5e-65,65.2,207/233, SEG 4-,26,vstsptptvlvvdddedvlasve, SEG 123-,140,allrrrtdapaaaatpga, SEG 181-,192,vvlsrerllelv, BL:PDB:NREP 1 BL:PDB:REP 27-,235,1ys6B,2e-65,65.2,207/227, RP:PDB:NREP 1 RP:PDB:REP 27-,231,3c3wB,2e-24,20.9,187/210, RP:PFM:NREP 2 RP:PFM:REP 33-,122,PF00072,6e-17,45.6,90/111,Response_reg, RP:PFM:REP ...
Escherichia coli is transformed from a commensal organism into a pathogen by acquisition of genetic elements called pathogenicity islands (PAIs). Katsowich et al. investigated how the PAI virulence genes of enteropathogenic E. coli (EPEC) respond when the bacterium attaches to a host gut cell. EPEC first sticks to the host by means of pili and then uses a PAI-encoded type 3 secretion system (T3SS) to inject multiple effectors into the host cell. But not all virulence mediators are injected. For example, CesT, a bacterial chaperone, delivers virulence effectors into the T3SS apparatus. Then, within the bacterial cytoplasm, it interacts with a gene repressor called CsrA, which reprograms bacterial gene expression to help the bacteria to adapt to epithelial cell-associated life.. Science, this issue p. 735 ...
Reliable identification of targets of bacterial regulators is necessary to understand bacterial gene expression regulation. These targets are commonly predicted by searching for high-scoring binding sites in the upstream genomic regions, which typically leads to a large number of false positives. In contrast to the common approach, here we propose a novel concept, where overrepresentation of the scoring distribution that corresponds to the entire searched region is assessed, as opposed to predicting individual binding sites. We explore two implementations of this concept, based on Kolmogorov-Smirnov (KS) and Anderson-Darling (AD) tests, which both provide straightforward P value estimates for predicted targets. This approach is implemented for pleiotropic bacterial regulators, including σ70 (bacterial housekeeping σ factor) target predictions, which is a classical bioinformatics problem characterized by low specificity. We show that KS based approach is both faster and more accurate, departing from
complex with c-di-GMP. C-di-GMP binds to the protein as an intercalated dimer, displacing the C-terminal 310 helix found in the apo form. The N-terminal part of ...
There could be an interesting connection here with another resent paper where in yeast it was shown that the cost of GFP is dramatically different for stable and denaturation-prone variants (for brilliant discussion of this paper see this post in It Takes 30). Is GFP equally stable in E. coli during the early and late exponential phase? Could it be that the effects observed here are reflecting mere change in GFP stability? Intracellular conditions do change in E. coli under different conditions, so it is possible that GFP is not always equally stable, and this may affect its physiological cost. Surprisingly, another report claims that in E. coli aggregated and soluble LacZ have very similar cost, which to some extent dispels my worries about GFP stability and cost ...
Steinrück M. The Influence of Sequence Context on the Evolution of Bacterial Gene Expression. IST Austria; 2018. doi:10.15479/AT:ISTA:th1059 ...
De Gentaur Oxford expressie Technologies afzonderlijke Eia Tool validatred met die in biologische monsters te onderscheiden, zoals celmedium dat verschilt. Bij de producent Oxford expressie Technologies met Genprice aanvoernummer 514 voor protocolspecificaties. The Oxford expressie Technologies Laboratoria in gb. Gentaur levert de Oxford uitdrukking Technologies test volgende dag in je Labo. De Oxford expression Technologies produkten worden het snelst en goedkoopst geleverd door Gentaur Bvba te Kampenhout voor Belgie en Gentaur BV te Eersel voor Nederland. Indien u Oxford expression Technologies kits bestelt voor vrijdag 14 uur worden die reeds de dinsdag erop in uw laboratorium afgeleverd in een koelpaket van Gentaur.. ...
Wilson, Philip, Welsh Assembly Government (Wales), corp creator. (2011) A rapid evidence assessment : investigating the drop in attainment during the transition phase with a particular focus on child poverty. ...
Getting a woman to spread her legs for you depends on your ability to smoothly navigate her through the 4 transition phases of seduction. Lets hammer out the first 2.
Transcription initiation is a critical step in bacterial gene regulation and is often controlled by transcription regulators. The alternate sigma factor (sigma54) is one such regulator that facilitates activator-dependent ...
Barrett, J. F., Goldschmidt, R. M., Lawrence, L. E., Foleno, B., Chen, R., Demers, J. P., Johnson, S., Kanojia, R., Fernandez, J., Bernstein, J., Licata, L., Donetz, A., et al. Antibacterial agents that inhibit two-component signal transduction systems Proceedings of the National Academy of Sciences of the United States of America 1998 95:5317-5322 DOI:10.1073/pnas.95.9.5317 PMID:9560273 ...
During infection, senses and responds to stress; such responses may be modulated by MisRS (NGO0177 and NGO0176), a two-component system that is a homolog of CpxRA. In , CpxRA senses and responds to envelope stress; CpxA is a sensor kinase/phosphatase for CpxR, a response regulator. When a mutant is grown in medium containing glucose, CpxR is phosphorylated by acetyl phosphate but cannot be dephosphorylated, resulting in constitutive activation. Kandler and coworkers (J. L. Kandler, C. L. Holley, J. L. Reimche, V. Dhulipala, J. T. Balthazar, A. Muszynski, R. W. Carlson, and W. M. Shafer, Antimicrob Agents Chemother 60:4690-4700, 2016, https://doi.org/10.1128/AAC.00823-16) showed that MisR (CpxR) is required for the maintenance of membrane integrity and resistance to antimicrobial peptides, suggesting a role in gonococcal survival Here, we evaluated the contributions of MisR and MisS (CpxA) to gonococcal infection in a murine model of cervicovaginal colonization and identified MisR-regulated genes ...
4IHT: The DNA-binding domain of BenM reveals the structural basis for the recognition of a T-N11-A sequence motif by LysR-type transcriptional regulators.
Degree of conservation of fungal oxidative stress regulators. (A) Orthologues of S. cerevisiae oxidative stress regulators in the fungi analysed. As before, the
Event SWPAs Pumping Systems & Controls Training. The pinnacle of SWPA’s Training and Educational programs is our Semi -Annual Pumping Systems Training ...
A magnetic carrier and a two-component developer are provided which have remedied blank areas, fog after leaving, carrier sticking during running, and image density variations before and after runnin
A 4-man rap group from Finland. Enjoying a a fairly big cult following despite being officially formed as late as fall 2000. Members: Davo MC, producer,...
31 May 2018 marked the end of the final transition phase for registration of substances in the low-tonnage bands under REACH. Kerstin Heitmann from UMCO says what do companies need to consider.
Låt de första träffarna vara på neutral mark. Om du känner dig osäker ta det säkra före det osäkra. För mer råd och tips ring 031-7740067
Linda Sara 1994 Dvdrip. Linda Sara 1994 Dvdrip Related Tags: Linda Sara 1994 Dvdrip 80453122e1 21 HOT! foto memek anak smp umur 15 tahun ms office 2003 free...
MetabolismFatty acid and phospholipid metabolismBiosynthesisfatty acid metabolism transcriptional regulator FadR (TIGR02812; HMM-score: 17.4) ...
Motivated by recent experimental advances, we study two-component spin-orbit coupled ultracold bosonic atoms in two dimensions on a square optical lattice. Using a Bose-Hubbard model with spin-conserving and non-spin-conserving ...
transcriptional regulator [Snora] GTGTGCCGTCCGCGTGACCACCGGGCGTCGGTGCAGGTGGTCACGCCTGGCGCAAGTTCG AAGGAAAAACGGGAGGAAGACTTGGAATTTCGACTGCTGGGTCCGGTTGAAATACTCTGG CAGGGGCGCAACATCATGCCGACGGCTCCCAAGCCGCGGCAGGTCATATCCCTTCTGATG CTCCGTCACAACACAGTCGTGCAGGCTGCGGAGCTGATCGACGAATTATGGCCGGAGCTG CCGCCGCCGAGCGCGATCACCACCCTCCAGACCTACATCTACAAATTCCGGAAGATTCTC ATGAAGCAGGGGGCCGATGATCTTCTGCGTACCCAGCCGGGCGGATACATCCTGACGATC CCGCCCTCCACCGTCGACGTCAACCGGTTCGAACGGGACGCCGACGACGGGCAGGAACTG CTGCAGCGCGGTGACGCCGCCGGCGGGACGAAGCTCGGCCACGCCCTGGCCCTGTGGCGG GGCCCAGCACTGGCCGATGTCGTCGCCAGCGGACGCCTGTTCTCGTACGTCACGCGGCTG GAGGAGCTGCGGTTTCGCATCCTCGAACTGCGCATCGAGGCGGACCTCGCGACCGGGCGG CACCGGGAACTCGTGAGCGAGCTGAAATCGCTGGTACTGGCACACCCCCTCCACGAGCAC CTGCACGGGCTGCTGATGCTGGCCCTGCACCGGTCGGGGCGGCCCCACGAGGCGTTGGAG GTCTACCGGAGCGTACGCCACAAGATGATCGAGGACCTCGCCCTGGAACCCGCCCAGGAC TTCGCCACTTTGCACCACACCCTGCTGTCCGACTCCCCGCCCGAGGCACCCGAACCCCTC TGGCCGGCACAGCACCTGACGACCAAGCAGCCGGAACGCGTCACCATCGCCCGCGAACCA GCCCCGGACACCGCCCCCAGCCCGCTGGCCAGACCGGCCCAATTGCCCGCCGACATCGTG ...
The cell envelope of bacteria is of pivotal importance for growth and survival, and hence it is often the target of antimicrobial compounds. One of the main components involved in CESRs are extracytoplasmic function (ECF) [sigma] factors. The genome of B. subtilis encodes for seven ECF [sigma] factors, [sigma]M, [sigma]W, [sigma]X, [sigma]Y, [sigma]V, [sigma]Z and [sigma]YlaC. Several studies have been conducted to understand the role that these ECF [sigma] factors play in CESR in B. subtilis, one of the challenges found is that they display significant redundancy within their regulons. In this study, we have performed an in depth analysis of one of the ECF [sigma] factors of B. subtilis, [sigma]V, which had been previously uncharacterized. We have described the regulon of [sigma]V, the role that it plays in lysozyme resistance, and provided evidence for a novel promoter element important for [sigma]V recognition. Additionally, we have studied the role that [sigma]M plays in moenomycin ...
The bacterial cell envelope is the first and major line of defence against threats from the environment. It is an essential and vulnerable structure that gives the cell its shape and counteracts the high internal osmotic pressure. It also provides an important sensory interface and molecular sieve, mediating both information flow and controlled transport of solutes. The cell envelope is also the target for numerous antibiotics. Therefore, the monitoring and maintaining of cell envelope integrity in the presence of envelope perturbating agents and conditions is crucial for survival. In Bacillus subtilis a complex regulatory network, consisting of 7 signal transducing systems, orchestrates the cell envelope stress response. Two forms of regulatory systems can be found: ECF-sigma factors and two component systems (TCS). One of these TCS is the LiaRS system that responds to cell wall antibiotics that interfere with the undecaprenol cycle and to perturbation of the cytoplasmic me! mbrane. It is ...
Streptococcus pneumoniae is an important human pathogen in all age groups worldwide that causes a variety of diseases, ranging from life threatening septicaemia and meningitis to less severe sinusitis and otitis media. The factors that determine the virulence of S. pneumoniae are very complex but a key aspect of the organisms disease causing potential is the ability of the bacteria to regulate virulence factor expression and activity. In this study two main approaches were taken to investigate virulence gene expression in S. pneumoniae. Firstly, the feasibility of Recombinase based In vivo Expression Technology, RIVET, for use in S. pneumoniae to study gene expression in vitro, and then in vivo was assessed. However, the system was found to be unsuitable for use in this study. Secondly, the requirement for and the role of virulence gene regulators identified by Signature Tagged Mutagenesis were investigated. The requirement for different virulence gene regulators varied according to the murine ...
Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion ...
The molecular determinants necessary and sufficient for recognition of its specific DNA target are contained in the C-domain (H-NSctd) of nucleoid-associated protein H-NS. H-NSctd protects from DNaseI cleavage a few short DNA segments of the H-NS-sensitive hns promoter whose sequences closely match the recently identified H-NS consensus motif (tCGt/aTa/tAATT) and, ... read more alone or fused to the protein oligomerization domain of phage λ CI repressor, inhibits transcription from the hns promoter in vitro and in vivo. The importance of H-NS oligomerization is indicated by the fact that with an extended hns promoter construct (400 bp), which allows protein oligomerization, DNA binding and transcriptional repression are highly and almost equally efficient with native H-NS and H-NSctd::λCI and much less effective with the monomeric H-NSctd. With a shorter (110 bp) construct, which does not sustain extensive protein oligomerization, transcriptional repression is less effective, but native H-NS, ...
In this study, we demonstrated that a mutant strain lacking a functional slyA gene in D. dadantii 3937 had pleiotropic effects: (i) diminished virulence in potato tubers; (ii) decreased survival ability in its host, potato; (iii) increased sensitivity to the CAMP polymyxin B, sodium hypochlorite, and oxidative stress; (iv) reduced exopolysaccharide production; (v) inability to form pellicles; and (vi) failure of hyperinduction of pectate lyase production while normal levels of polygalacturonases, cellulases, and proteases were observed. Changes in these phenotypes in the ΔslyA mutant were restored by introducing the slyA homologue of D. dadantii 3937 on a multicopy vector, pGEM-T Easy [ΔslyA(pSlyA)]. Thus, SlyA is a global transcriptional regulator involved in the regulation of the synthesis of a large group of virulence-associated factors in D. dadantii 3937.. SlyA was originally identified as an S. enterica serovar Typhimurium gene product by screening for cytolysin on blood agar plates and ...
HilA activates the expression of Salmonella enterica serovar Typhimurium invasion genes. To learn more about regulation of hilA, we isolated Tn5 mutants exhibiting reduced hilA and/or invasion gene expression. In addition to expected mutations, we identified Tn5 insertions in pstS, fadD, flhD, flhC, and fliA. Analysis of the pstS mutant indicates that hilA and invasion genes are repressed by the response regulator PhoB in the absence of the Pst high-affinity inorganic phosphate uptake system. This system is required for negative control of the PhoR-PhoB two-component regulatory system, suggesting that hilA expression may be repressed by PhoRPhoB under low extracellular inorganic phosphate conditions. FadD is required for uptake and degradation of long-chain fatty acids, and our analysis of the fadD mutant indicates that hilA is regulated by a FadDdependent, FadR-independent mechanism. Thus, fatty acid derivatives may act as intracellular signals to regulate hilA expression. flhDC and fliA encode
Sensor kinases play a key role in sensing and responding to environmental and physiological signals in bacteria. In this study we characterized a previously unknown orphan hybrid sensor kinase from Pseudomonas putida, which is conserved in several Pseudomonads. Inactivation of the gene coding for this sensor kinase, which we have named HskA, modified the expression of at least 85 genes in cells growing in a complete medium. HskA showed a strong influence on the composition of the electron transport chain. In cells growing exponentially in a complete medium, the absence of HskA led to a significant reduction in the expression of the genes coding for the bc1 complex and for the CIO and Cbb3-1 terminal oxidases. In stationary phase cells, however, lack of HskA caused a higher expression of the Cyo terminal oxidase and a lower expression of the Aa3 terminal oxidase. The HskA polypeptide shows two PAS (signal-sensing) domains, a transmitter domain containing the invariant phosphorylatable histidine ...
The LysR-family regulator MexT modulates the expression of the MexEF-OprN efflux system in the human pathogen Pseudomonas aeruginosa. Recently, we demonstrated that MexT regulates certain virulence phenotypes, including the type-three secretion system and early attachment independent of its role in regulating MexEF-OprN. In this study, transcriptome profiling was utilized to investigate the global nature of MexT regulation in P. aeruginosa PAO1 and an isogenic mexEF mutant. Twelve genes of unknown function were highly induced by overexpressing MexT independent of MexEF-OprN. A well-conserved DNA motif was identified in the upstream regulatory region of nine of these genes and upstream of mexE. Reporter fusion analysis demonstrated that the expression of the genes was significantly induced by MexT in P. aeruginosa and a heterogenous Escherichia coli strain and that the conserved sequence was required for this induction. The conserved DNA motif was further characterized as the MexT binding site by ...
SlyA is a member of the MarR family of bacterial transcriptional regulators. Previously, SlyA has been shown to directly regulate only two operons in Escherichia coli K-12 MG1655, fimB and hlyE (clyA). In both cases, SlyA activates gene expression by antagonizing repression by the nucleoid-associated protein H-NS. Here, the transcript profiles of aerobic glucose-limited steady-state chemostat cultures of E. coli K-12 MG1655, slyA mutant and slyA over-expression strains are reported. The transcript profile of the slyA mutant was not significantly different from that of the parent; however, that of the slyA expression strain was significantly different from that of the vector control. Transcripts representing 27 operons were increased in abundance, whereas 3 were decreased. Of the 30 differentially regulated operons, 24 have previously been associated with sites of H-NS binding, suggesting that antagonism of H-NS repression is a common feature of SlyA-mediated transcription regulation. Direct binding of
Bibliographic details on RegulonDB (version 5.0): Escherichia coli K-12 transcriptional regulatory network, operon organization, and growth conditions.
An anti-sigma factor for extracytoplasmic function (ECF) sigma factor SigK. ECF sigma factors are held in an inactive form by an anti-sigma factor until released by regulated intramembrane proteolysis (RIP). RIP occurs when an extracytoplasmic signal triggers a concerted proteolytic cascade to transmit information and elicit cellular responses. The membrane-spanning regulatory substrate protein is first cut extracytoplasmically (site-1 protease, S1P), then within the membrane itself (site-2 protease, S2P, Rip1), while cytoplasmic proteases finish degrading the regulatory protein, liberating the sigma factor.
Soil-dwelling Streptomyces bacteria such as S.coelicolor have to constantly adapt to the nitrogen (N) availability in their habitat. Thus, strict transcriptional and post-translational control of the N-assimilation is fundamental for survival of this species. GlnR is a global response regulator that controls transcription of the genes related to the N-assimilation in S. coelicolor and other members of the Actinomycetales. GlnR represents an atypical orphan response regulator that is not activated by the phosphorylation of the conserved aspartate residue (Asp 50). We have applied transcriptional analysis, LC-MS/MS analysis and electrophoretic mobility shift assays (EMSAs) to understand the regulation of GlnR in S. coelicolor M145. The expression of glnR and GlnR-target genes was revisited under four different N-defined conditions and a complex N-rich condition. Although, the expression of selected GlnR-target genes was strongly responsive to changing N-concentrations, the glnR expression itself ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Although proteins fulfil most of the requirements that biology has for structural and functional components such as enzymes and receptors, RNA can also serve in these capacities. For example, RNA has sufficient structural plasticity to form ribozyme1,2 and receptor3,4 elements that exhibit considerable enzymatic power and binding specificity. Moreover, these activities can be combined to create allosteric ribozymes5,6 that are modulated by effector molecules. It has also been proposed7,8,9,10,11,12 that certain messenger RNAs might use allosteric mechanisms to mediate regulatory responses depending on specific metabolites. We report here that mRNAs encoding enzymes involved in thiamine (vitamin B1) biosynthesis in Escherichia coli can bind thiamine or its pyrophosphate derivative without the need for protein cofactors. The mRNA-effector complex adopts a distinct structure that sequesters the ribosome-binding site and leads to a reduction in gene expression. This metabolite-sensing regulatory system
CsgD, the master regulator of biofilm formation, activates the synthesis of curli fimbriae and extracellular polysaccharides in Escherichia coli. To obtain insights into its regulatory role, we have identified a total of 20 novel regulation target genes on the E. coli genome by using chromatin immunoprecipitation (ChIP)-on-chip analysis with a high-density DNA microarray. By DNase I footprinting, the consensus CsgD-binding sequence predicted from a total of 18 target sites was found to include AAAAGNG(N(2))AAAWW. After a promoter-lacZ fusion assay, the CsgD targets were classified into two groups: group I genes, such as fliE and yhbT, are repressed by CsgD, while group II genes, including yccT and adrA, are activated by CsgD. The fliE and fliEFGH operons for flagellum formation are directly repressed by CsgD, while CsgD activates the adrA gene, which encodes an enzyme for synthesis of cyclic di-GMP, a bacterial second messenger, which in turn inhibits flagellum production and rotation. Taking these
This chapter summarizes studies that led to identification and characterization of the Cpx envelope stress response and highlights recent work that hints at a diverse range of Cpx-influenced cellular phenotypes. Silverman and colleagues provided the kernels for our current understanding of the Cpx envelope stress response. The Cpx envelope stress response is regulated by a typical two-component regulatory system. In addition to functioning as an activator and a repressor, a new role for CpxR~P in transcription has recently been put forth, that of potentiator. Researchers have shown by microarray analysis of biofilm and planktonic populations of cells that the Cpx-regulated genes cpxP and spy were highly up-regulated in biofilms and that cpxP and cpxR mutants formed biofilms with reduced mass and substrate coverage. It has been shown that CpxR homologues in Legionella pneumophila and Yersinia enterocolitica are likely involved in transcription of the icm-dot genes encoding the type IV secretion system
Bacillus subtilis is the best-characterized member of the Gram-positive bacteria. Its genome of 4,214,810 base pairs comprises 4,100 protein-coding genes. Of these protein-coding genes, 53% are represented once, while a quarter of the genome corresponds to several gene families that have been greatl …
Two-component signal transduction systems that respond to the presence of inducer peptide pheromones are known to regulate a variety of processes: bacteriocin production, competence for transformation, biofilm formation, and virulence (30). The results presented here and those from previous studies (14, 15) show that S. mutans uses one and the same TCSTS to control at least three of these at first sight unrelated processes. Mutants in comA, comC, and comDE are competence deficient (14), form biofilms that are different from those formed by wild-type strains (15), and do not produce bacteriocins (this study; 32, 36).. Unlike competence, which exhibits an optimum during a short interval of the exponential phase (data not shown) (19, 23), expression of nlmAB′-lacZ was lowest in this period but reached a maximum in the stationary phase. Since both activities are controlled by the same regulatory system, the question arises as to how this differential regulation is established. The key to the ...
Isopropyl-beta-D-thiogalactopyranoside, Isopropyl-beta-D-thiogalactopyranoside supplier, Isopropyl-beta-D-thiogalactopyranoside distributor, CAS 367-93-1, Isopropyl-beta-D-thiogalactopyranoside manufacturer, Isopropyl-beta-D-thiogalactopyranoside wholesale
Plans for a Transition Phase, which would help ensure a seamless transition from UN Environments environmental assessment to the clean-up of oil contamination, were presented to a meeting of the Presidential Implementation Committee in Abuja in February 2011. The United Nations prepared a Transition Phase proposal at the request of the Presidential Implementation Committee. The Transition Phase would include steps such as preparing clean-up plans and detailed designs; the preparation of bidding documents; seeking agreement between key partners on legal and financial matters; and consultations with key stakeholders. The proposal also recommended to identify the sites for potential treatment centres in Ogoniland, design monitoring programmes and regimes, and develop laboratory procedures and protocols. In 2018, building on its 2011 environmental assessment of Ogoniland, UN Environment began a new project that aims to strengthen the Hydrocarbon Pollution Remediation Project (HYPREP) and its
Bacillus subtilis uses two-component signal transduction systems to sense intra- and extracellular stimuli to adapt to fluctuating environmental situations. Regulator aspartate phosphatases (Raps) have important roles in these processes, as they can dephosphorylate certain response-regulators, and are themselves subject to cell-density-controlled inhibition by secreted Phr (phosphate regulator) peptides. Eleven chromosomal genes encode this family of phosphatases, but in addition, certain strains contain endogenous plasmids with genes for homologous Rap-Phr systems. Plasmid pTA1060 encodes Rap60 and its antagonistic signalling molecule Phr60. Strikingly, expression of Rap60 in B. subtilis 168 strongly repressed the production of proteolytic enzymes. In fact, the transcription of the aprE gene, encoding a major extracellular protease, was shown to be decreased upon Rap60 expression, whereas this effect could be antagonized by the extracellular addition of synthetic Phr60 pentapeptide. Finally,
ID A0A0H2ZLT6_PSEAB Unreviewed; 210 AA. AC A0A0H2ZLT6; DT 16-SEP-2015, integrated into UniProtKB/TrEMBL. DT 16-SEP-2015, sequence version 1. DT 30-AUG-2017, entry version 17. DE SubName: Full=Putative two-component response regulator {ECO:0000313,EMBL:ABJ15565.1}; GN Name=uhpA {ECO:0000313,EMBL:ABJ15565.1}; GN OrderedLocusNames=PA14_07840 {ECO:0000313,EMBL:ABJ15565.1}; OS Pseudomonas aeruginosa (strain UCBPP-PA14). OC Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; OC Pseudomonadaceae; Pseudomonas. OX NCBI_TaxID=208963 {ECO:0000313,EMBL:ABJ15565.1, ECO:0000313,Proteomes:UP000000653}; RN [1] {ECO:0000313,EMBL:ABJ15565.1, ECO:0000313,Proteomes:UP000000653} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=UCBPP-PA14 {ECO:0000313,EMBL:ABJ15565.1, RC ECO:0000313,Proteomes:UP000000653}; RX PubMed=17038190; DOI=10.1186/gb-2006-7-10-r90; RA Lee D.G., Urbach J.M., Wu G., Liberati N.T., Feinbaum R.L., Miyata S., RA Diggins L.T., He J., Saucier M., Deziel E., Friedman L., Li L., ...
Negative regulation of germination-arrest factor production in Pseudomonas fluorescens WH6 by a putative extracytoplasmic function sigma factor ...
Shop Flagella synthesis protein ELISA Kit, Recombinant Protein and Flagella synthesis protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
A number of bacteria and some plants produce large quantities of indole, which is widespread in animal intestinal tracts and in the rhizosphere. Although it ha...
The Pm promoter of the TOL plasmid of Pseudomonas putida is expressed at high level along the growth curve. This transcription is dependent on the positive regulator XylS activated by 3-methylbenzoate. The sigma factor sigma 38 is required for expression in early stationary phase and thereafter. To …
Vern Schramm, Ph.D.Most antibiotics initially work extremely well, killing more than 99.9% of microbes they target. But through mutation and the selection pressure exerted by the antibiotic, a few bacterial cells inevitably manage to survive, repopulate the bacterial community, and flourish as antibiotic-resistant strains.. Vern L. Schramm, Ph.D., professor and Ruth Merns Chair of Biochemistry at Einstein and senior author of the paper, hypothesized that antibiotics that could reduce the infective functions of bacteria, but not kill them, would minimize the risk that resistance would later develop. Dr. Schramms collaborators at Industrial Research Ltd. earlier reported transition state analogues of an enzyme that interferes with quorum sensing - the process by which bacteria communicate with each other by producing and detecting signaling molecules known as autoinducers. These autoinducers coordinate bacterial gene expression and regulate processes - including virulence - that benefit the ...
TY - CHAP. T1 - Regulation systems of toxin expression. AU - Locht, Camille. AU - Lereclus, Didier. AU - Rood, Julian Ian. AU - Fournier, Benedicte. PY - 2006. Y1 - 2006. M3 - Chapter (Book). SN - 0120884453. SP - 64. EP - 82. BT - The Comprehensive Sourcebook of Bacterial Protein Toxins. A2 - Alouf, J. A2 - Popoff, M R. PB - Academic Press. CY - USA. ER - ...
1) Kunst F, et al. (1997) The complete genome sequence of the gram-positive bacterium Bacillus subtilis.. Nature 390(6657):249-56 PubMed: 9384377 ...
Exposure to environmental insults generally occurs at low levels, making it challenging to measure bacterial responses to such interactions. Additionally, microbial behaviour and phenotype varies in differing bacterial types or growth phases, likely giving rise to growth- or species-specific responses to environmen
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
Type-III secretion systems (T3SSs) are responsible for the biosynthesis of flagella, and the interaction of many animal and plant pathogens with eukaryotic cells. T3SSs consist of multiple proteins which assemble to form an apparatus capable of exporting proteins through both membranes of Gram-negative bacteria in one step. Proteins conserved amongst T3SSS can be used for analysis of these systems using computational homology searching. By using tools including BLAST and HMMER in conjunction phylogenetic analysis this thesis examines the range of T3SSs, both in terms of the proteins they contain, and also the bacteria which contain them. In silico analysis of several of the conserved components of T3SSs shows similarities between them and other secretion systems, as well as components of ATPases. Use of conserved components allows for identification of T3SS loci in diverse bacteria, in order to assess in the different proteins used by different T3SSs, and to see where, in evolutionary space, ...
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.. Re use and mixing of content policy- We follow Creative Commons Licence Policy. We follow CC BY. Please refer below for all details. https://creativecommons.org/licenses/. CC BY. This license lets others distribute, remix, adapt, and build upon our work, even commercially, as long as they credit us for the original creation.. ...
Impact of mutations in individual protease genes/operons on biofilm formation in vitro. The relative capacity to form a biofilm was assessed using a microtiter
Many bacteria, including V. fischeri, recognize and respond to their environments using two-component regulatory systems (Fig. 2A, reviewed in Stock et al.
LB broth is used for maintaining and cultivating recombinant strains of Escherichia coli. The ingredients of LB broth are tryptone, yeast extract and Sodium Chloride. We show you how to prepare the LB medium. - LB Medium Preparation - AbVideo™ - Support - Abnova
Fullscreen (supported by IE11, latest versions of Firefox, Chrome, Safari (not including iOS Safari), Edge, Chrome for Android, Samsung Internet) ...
... s may also mediate bacterial escape from host cells. Regulation of gene expression[edit]. The regulation of gene ... The regulation of the production of hemolysin in S.aureus(expression of hemolysin) is now possible due to in-vitro mutations ... "Regulation of hemolysin expression and virulence of Staphylococcus aureus by a serine/threonine kinase and phosphatase". PLOS ... "α-Hemolysin pore formation into a supported phospholipid bilayer using cell-free expression". Biochim. Biophys. Acta. 1808 (1 ...
Winkler WC, Breaker RR (2005). "Regulation of bacterial gene expression by riboswitches". Annu. Rev. Microbiol. 59: 487-517. ... October 2004). "A glycine-dependent riboswitch that uses cooperative binding to control gene expression". Science. 306 (5694): ... This regulation controls parts of the sulfur metabolism of marine bacteria. The crystal structure of the riboswitch has been ...
Turnbough, C. L. (2019). "Regulation of Bacterial Gene Expression by Transcription Attenuation". Microbiology and Molecular ... and was the first evidence that gene expression regulation mechanisms can be overlapping or redundant. "Polarity" is a gene ... Transcription-translation coupling is a mechanism of gene expression regulation in which synthesis of an mRNA (transcription) ... Luzzati, D. (1970). "Regulation of lambda exonuclease synthesis: role of the N gene product and lambda repressor". Journal of ...
Working under Ira Pastan, he researched the regulation of bacterial gene expression by cyclic AMP. In 1970, he began ... Jacks, T.; Varmus, H.E. (1985). "Expression of the Rous sarcoma virus pol gene by ribosomal frameshifting". Science. 230 (4731 ... Their best-known accomplishment was the identification of a cellular gene (c-src) that gave rise to the v-src oncogene of Rous ... Stehelin, D.; Varmus, H. E.; Bishop, J. M.; Vogt, P. K. (1976-03-11). "DNA related to the transforming gene(s) of avian sarcoma ...
Deng, M.; Lancto, C. A.; Abrahamsen, M. S. (2004). "Cryptosporidium parvum regulation of human epithelial cell gene expression ... "Host Proteasomal Degradation Generates Amino Acids Essential for Intracellular Bacterial Growth". Science. 334 (6062): 1553-7. ... "Obligate intracellular bacterial parasites of acanthamoebae related to Chlamydia spp". Applied and Environmental Microbiology ...
Morris KL (2008). "Epigenetic Regulation of Gene Expression". RNA and the Regulation of Gene Expression: A Hidden Layer of ... "Epigenetic gene regulation in the bacterial world". Microbiol. Mol. Biol. Rev. 70 (3): 830-56. PMC 1594586 . PMID 16959970. doi ... There are several layers of regulation of gene expression. One way that genes are regulated is through the remodeling of ... They control gene expression including virulence genes in pathogens and are viewed as new targets in the fight against drug- ...
... down-regulation or inactivation of neighboring gene expression. Therefore, the reduction or complete elimination of extraneous ... A typical bacterial replicon may consist of a number of elements, such as the gene for plasmid-specific replication initiation ... and are usually used when studying the functionality of a solo gene or when the gene is toxic. Also connected with the gene ... These include a gene that confers resistance to particular antibiotics (ampicillin is most frequently used for bacterial ...
Regulation of gene expression Repressor Transcription factor Bacterial transcription Eukaryotic transcription Ma, Jun (2011). " ... that increases transcription of a gene or set of genes. Activators are considered to have positive control over gene expression ... In eukaryotes, genes tend to be transcribed individually, and each gene is controlled by its own regulatory sequences. ... The breakdown of maltose in Escherichia coli is controlled by gene activation. The genes that code for the enzymes responsible ...
Bassler, Bonnie L (1999). "How bacteria talk to each other: regulation of gene expression by quorum sensing". Current Opinion ... that quorum sensing genes tend to control the expression of a wide array of genes scattered throughout the bacterial chromosome ... Another form of gene regulation that allows the bacteria to rapidly adapt to surrounding changes is through environmental ... As one example, quorum sensing (QS) enables bacteria to restrict the expression of specific genes to the high cell densities at ...
... regulation of Yersinia enterocolitica gene expression and coordinate reciprocal expression of flagellar and virulence genes. ... Promotional page for "Bacterial Flagella: A Paradigm for Design" Archived 2005-11-03 at the Wayback Machine, Scott A. Minnich, ... in bacterial flagella as evidence of intelligent design. Minnich testified in favor of the defendants in Kitzmiller v. Dover ... accessed 22 October 2006 Background to "Evolution in (Brownian) space: a model for the origin of the bacterial flagellum", N. J ...
Deng, M.; Lancto, C. A.; Abrahamsen, M. S. (2004). "Cryptosporidium parvum regulation of human epithelial cell gene expression ... Amann R, Springer N, Schönhuber W, Ludwig W, Schmid EN, Müller KD, Michel R (January 1997). "Obligate intracellular bacterial ... Bacterial examples include: Bartonella henselae Francisella tularensis Listeria monocytogenes Salmonella Typhi Brucella ... "Host Proteasomal Degradation Generates Amino Acids Essential for Intracellular Bacterial Growth". Science. 334 (6062): 1553-7. ...
... was found to have retinol functionality through retinol-like regulation of gene expression. In 2018, a randomized, ... Bakuchiol possesses antioxidant, anti-inflammatory and anti-bacterial properties. Bakuchiol isolated from P. corylifolia has ... Chaudhuri RK, Bojanowski K (2014). "Bakuchiol: a retinol-like functional compound revealed by gene expression profiling and ...
Morris KL (2008). "Epigenetic Regulation of Gene Expression". RNA and the Regulation of Gene Expression: A Hidden Layer of ... Casadesús J, Low D (September 2006). "Epigenetic gene regulation in the bacterial world". Microbiology and Molecular Biology ... There are several layers of regulation of gene expression. One way that genes are regulated is through the remodeling of ... October 2019). "Metabolic regulation of gene expression by histone lactylation". Nature. 574 (7779): 575-580. Bibcode:2019Natur ...
These enzymes have a regulatory role in gene expression and cell cycle regulation. EcoDam from E. coli and CcrM from ... They are found in the three existing types of bacterial restriction-modification systems (in type I system the A-Mtase is the ... "DNMT1". Gene Symbol Report. HUGO Gene Nomenclature Committee. Retrieved 2012-09-27. "DNMT3A". Gene Symbol Report. HUGO Gene ... The loss of DNMT3L leads to bi-allelic expression of genes normally not expressed by the maternal allele. DNMT3L interacts with ...
"Regulation of gene expression via the core promoter and the basal transcriptional machinery". Developmental Biology. 339 (2): ... BacterialEdit. In bacteria, the promoter contains two short sequence elements approximately 10 (Pribnow Box) and 35 nucleotides ... ends of the genes in a bidirectional gene pair.[14] A "bidirectional gene pair" refers to two adjacent genes coded on opposite ... Altered expressions of microRNAs also silence or activate many genes in progression to cancer (see microRNAs in cancer). ...
Tomilin N. V. (2008). "Regulation of mammalian gene expression by retroelements and non-coding tandem repeats". BioEssays. 30 ( ... on the expression of many genes.[22][33] Length changes in bacterial SSRs can affect fimbriae formation in Haemophilus ... It is probable that short sequence repeats in those locations are also involved in the regulation of gene expression.[42] ... Effects on gene regulation[edit]. Length changes of microsatellites within promoters and other cis-regulatory regions can ...
... bacterial biofilm formation and virulence gene expression, heat and osmotic stress regulation and responses, sporulation, ... It is suggested that cyclic di-AMP is involved in the regulation of cell lysis. Studies have shown that bacterial mutant ... Regulation of c-di-AMP is critical because high c-di-AMP levels lead to abnormal physiology, growth defects, and reduced ... Cell regulation. 30: 22-29. doi:10.1016/j.mib.2015.12.007. PMC 4821758. PMID 26773214. Gundlach J, Mehne FM, Herzberg C, Kampf ...
Biology portal Bacterial transcription Regulation of gene expression RNA polymerase Transcriptional regulation Transcription ... a key component in the regulation of gene expression". Genes & Development. 16 (20): 2583-92. doi:10.1101/gad.1026202. PMID ... This allows for the temporal regulation of gene expression through the sequestration of the RNA in the nucleus, and allows for ... The poly-T termination signal pauses Pol III The regulation of gene expression in eukaryotes is achieved through the ...
... gene expression regulation, archaeal MeSH G05.315.300 - gene expression regulation, bacterial MeSH G05.315.310 - gene ... gene expression regulation, leukemic MeSH G05.315.375 - gene expression regulation, plant MeSH G05.315.385 - gene expression ... gene expression regulation, fungal MeSH G05.315.370 - gene expression regulation, neoplastic MeSH G05.315.370.500 - ... expression regulation, developmental MeSH G05.315.320 - gene expression regulation, enzymologic MeSH G05.315.320.200 - enzyme ...
... in Sickness and in Health and Charles Dorman DNA Topology and the Global Regulation of Bacterial Virulence Gene Expression 1995 ... Structural Analysis of Animal Virus Genomes 1981 Dave Sherratt The Maintenance and Propagation of Plasmid Genes in Bacterial ... access in Asia 2018 Sarah Coulthurst type VI secretion system-mediated bacterial warfare 2019 Peter Fineran bacterial innate ... From the lab to the clinic and back again 2016 David Grainger The unexpected complexity of bacterial genomes 2017 Stephen Baker ...
Jun-ichiro Inoue) Laboratory of Gene Expression and Regulation (Prof. Nobuaki Yoshida) Laboratory of Genome Database (Prof. ... Haruo Saito) Division of Bacterial Infection (Prof. Chihiro Sasakawa) Division of Virology (Prof. Yoshihiro Kawaoka ) ... Yasushi Kawaguchi) Department of Infectious Disease Control (Division of Bacterial Infection) (Associate Prof. Ichiro Nakagawa ...
Campbell and research associates also studied regulation and expression of E coli genes linked to the lambda insertion location ... The 1940s produced the first pictures of bacterial viruses using electron microscopy produced the first photos of bacterial ... the regulation and expression of genetic material, and the mechanism of integration and excision of genetic material into ... including the biotin (bio) and galactose (gal) genes. Early studies on bacterial viruses began after the discovery by Twort and ...
It was shown that RpsF leader regulates gene expression in response to the S6:S18 complex, contributing to the regulation of ... Fu Y, Deiorio-Haggar K, Soo MW, Meyer MM (February 2014). "Bacterial RNA motif in the 5' UTR of rpsF interacts with an S6:S18 ... RpsF leader is a conserved RNA structure, widely distributed to many bacterial species. It precedes the operon containing rpsF ...
... the up-regulation of pro-inflammatory gene expression prepares the body to better deal with bodily injury and bacterial ... This process of translation, or "turning on" of a gene to its final gene products is termed gene expression. Genetic expression ... on the expression of individual genes, or more commonly, clusters of many genes (i.e. gene profiles, or gene programs). In the ... Concurrently, the down-regulation of anti-viral gene expression leaves the individual more vulnerable to viral infection such ...
"A physiological role for DNA supercoiling in the osmotic regulation of gene expression in S. Typhimurium and E. Coli". Cell. 52 ... "A bacterial antibiotic-resistance gene that complements the human multidrug-resistance P-glycoprotein gene". Nature. 391 (6664 ... "DNA supercoiling and environmental regulation of virulence gene expression in Shigella flexneri". Nature. 344 (6268): 789-792. ... Newbury, S. F.; Smith, N. H.; Higgins, C. F. (1987). "Differential mRNA stability controls relative gene expression within a ...
Dorman, Charles J; Deighan, Padraig (2003-04-01). "Regulation of gene expression by histone-like proteins in bacteria". Current ... Dillon SC, Dorman CJ (March 2010). "Bacterial nucleoid-associated proteins, nucleoid structure and gene expression". Nature ... including the regulation of gene expression by histone-like nucleoid-structuring protein, H-NS. H-NS is about 15.6 kDa and ... "An African swine fever virus gene with similarity to bacterial DNA binding proteins, bacterial integration host factors, and ...
Another study showed that patterns of DNA methylation, which are a known regulation mechanism for gene expression, differ in ... "Dynamics of Genome Rearrangement in Bacterial Populations". PLOS Genetics. 4 (7): e1000128. doi:10.1371/journal.pgen.1000128. ... Paralogous sequences are separated by gene cloning (gene duplication): if a particular gene in the genome is copied, then the ... A public collection of case studies and demonstrations is growing, ranging from whole genome comparisons to gene expression ...
Global regulation of gene expression and chromosomal topologyEdit. In eukaryotes, about 10-20% of the genes are rhythmically ... Bacterial circadian rhythm. (Redirected from Bacterial circadian rhythms). Bacterial circadian rhythms, like other circadian ... Circadian orchestration of gene expression in cyanobacteria. Genes Dev. 9, 1469-1478. ... No significant similarity was found among the kai genes and any other previously reported genes in eukaryotes, but there are ...
Gene Structure and Expression. 1625 (3): 305-8. doi:10.1016/s0167-4781(03)00017-4. PMID 12591618. Choi SK, Matsuda S, Hoshino T ... Linden H (September 1999). "Carotenoid hydroxylase from Haematococcus pluvialis: cDNA sequence, regulation and functional ... Peng X, Misawa N (October 2006). "Characterization of bacterial beta-carotene 3,3'-hydroxylases, CrtZ, and P450 in astaxanthin ... Gene Structure and Expression. 1446 (3): 203-12. doi:10.1016/s0167-4781(99)00088-3. PMID 10524195. Zhu C, Yamamura S, Nishihara ...
The bacterium Escherichia colicarries approximately 3000 genes, but this total repertoire... ... Reznikoff W.S. (1989) Regulation of Bacterial Gene Expression. In: Poindexter J.S., Leadbetter E.R. (eds) Bacteria in Nature. ... It presents the cell with the signals that ultimately lead to gene regulation-the turning on or off of gene expression. ... Zieg, J., Hilmen, M., and Simon, M., 1978a, Regulation of gene expression by site-specific inversion, Cell 15: 237-244.Google ...
Regulation of Bacterial Gene Expression by Transcription Attenuation Message Subject (Your Name) has forwarded a page to you ... Regulation of Bacterial Gene Expression by Transcription Attenuation. Charles L. Turnbough, Jr. ... A wide variety of mechanisms that control gene expression in bacteria are based on conditional transcription termination. ... Generally, in these mechanisms, a transcription terminator is located between a promoter and a downstream gene(s), and the ...
A model for specific and global regulation of bacterial gene expression. Here, we present a model of bacterial gene expression ... Sasson V, Shachrai I, Bren A, Dekel E, Alon U (2012) Mode of regulation and the insulation of bacterial gene expression. Mol ... Dissecting specific and global transcriptional regulation of bacterial gene expression. Luca Gerosa, Karl Kochanowski, Matthias ... approach to include global expression machinery regulation in the analysis and simulation of bacterial gene expression. This is ...
Notify me of updates to Gene Regulation and Expression of Chemokines in Response to Bacterial Enterotoxins pp. 89-110. ... Gene Regulation and Expression of Chemokines in Response to Bacterial Enterotoxins pp. 89-110. $100.00 ... This chapter will focus on the impact of bacterial enterotoxins on the gene regulation and expression of chemokines in ... Bacterial enterotoxins are proteins released by specific bacterial organisms in the intestine and are chromosomally encoded ...
Publications] Kado,C.I.: Bacterial Conjugation. Plenum Press, (1992). *. Description. 「研究成果報告書概要(和文)」より ... Gene expression. Research Abstract. The organization and the structure of the genes encoding phenylalanine ammonia-lyase (PAL) ... Cis-element responsible for these regulations exists between -340--140 of PSPAL1.. 2. Analysis of CHS gene. The structure and ... Publications] Yamada,T.et al.: Organ-specific expression and suppression of pea phenylanine ammonialyase genes by a plasma ...
... physiology and regulation of gene expression. J Bacteriol 182(11):3072-3080CrossRefGoogle Scholar ... Intestinal lactase as an autologous β-galactosidase reporter gene for in vivo gene expression studies. Hum Gene Ther 20(1):21- ... Identified bacterial strains belonged to the genus Bacillus and Staphylococcus and majority of the isolates were Bacillus ... Results show that the number of bacterial count in Nutrient agar and Starch casein agar was 14-20 and 10-16 CFU/g, respectively ...
Gene Expression Regulation, Bacterial * Gene Expression Regulation, Viral * Genes, Bacterial * Genes, Viral ... THe genetic determinants mediating expression of enterotoxin A (entA) and staphylokinase (sak) were cloned from the DNA of the ... triple-converting phage and expression of the cloned determinants detected in Escherichia coli and S. aureus. The entA and sak ...
These findings will help in understanding regulation of B. cenocepacia biofi … ... Genes and novel regulatory RNAs putatively involved in B. cenocepacia biofilm formation were identified. ... Gene Expression Regulation, Bacterial * Genome, Bacterial* * Humans * Transcription Initiation Site* Substances * Anti- ... For 64 genes a start codon alternative to the annotated one was proposed. Substantial antisense transcription for 105 genes and ...
title = "Hosts innate immune response to fungal and bacterial agents in vitro: Up-regulation of interleukin-15 gene expression ... Hosts innate immune response to fungal and bacterial agents in vitro: Up-regulation of interleukin-15 gene expression ... Hosts innate immune response to fungal and bacterial agents in vitro : Up-regulation of interleukin-15 gene expression ... Hosts innate immune response to fungal and bacterial agents in vitro : Up-regulation of interleukin-15 gene expression ...
Molecular process of regulation and expression of candidate genes involved in prebiotic fibre utilization in Lactobacillus ... Molecular process of regulation and expression of candidate genes involved in prebiotic fibre utilization in Lactobacillus ... Molecular process of regulation and expression of candidate genes involved in prebiotic fibre utilization in Lactobacillus ... the molecular processes and regulation of candidate genes involved in fibre utilisation need to be explored. ...
Global regulation of gene expression and chromosomal topologyEdit. In eukaryotes, about 10-20% of the genes are rhythmically ... Bacterial circadian rhythm. (Redirected from Bacterial circadian rhythms). Bacterial circadian rhythms, like other circadian ... Circadian orchestration of gene expression in cyanobacteria. Genes Dev. 9, 1469-1478. ... No significant similarity was found among the kai genes and any other previously reported genes in eukaryotes, but there are ...
The bacterial SOS DNA repair system (35). DNA damage is sensed by RecA, which induces autocleavage of the repressor LexA. LexA ... Assigning numbers to the arrows: Parameterizing a gene regulation network by using accurate expression kinetics. Michal Ronen, ... Assigning numbers to the arrows: Parameterizing a gene regulation network by using accurate expression kinetics ... Assigning numbers to the arrows: Parameterizing a gene regulation network by using accurate expression kinetics ...
Hemolysins may also mediate bacterial escape from host cells. Regulation of gene expression[edit]. The regulation of gene ... The regulation of the production of hemolysin in S.aureus(expression of hemolysin) is now possible due to in-vitro mutations ... "Regulation of hemolysin expression and virulence of Staphylococcus aureus by a serine/threonine kinase and phosphatase". PLOS ... "α-Hemolysin pore formation into a supported phospholipid bilayer using cell-free expression". Biochim. Biophys. Acta. 1808 (1 ...
2005) Regulation of bacterial gene expression by riboswitches. Annu Rev Microbiol 59:487-517. ... 2002) Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression. Nature 419:952-956. ... Model for posttranscriptional control of gene expression in the eut locus of E. faecalis. A subset of genes present in the eut ... expression of the eut operon is affected by a global regulator of invasion genes (CsrA) (7). In E. faecalis, expression of ...
... suggesting that there is possible negative control of the dps gene by CsgD. Dps is a bacterial ferritin that is important for ... GENE REGULATION. Gene Expression Regulation by the Curli Activator CsgD Protein: Modulation of Cellulose Biosynthesis and ... Gene Expression Regulation by the Curli Activator CsgD Protein: Modulation of Cellulose Biosynthesis and Control of Negative ... Gene Expression Regulation by the Curli Activator CsgD Protein: Modulation of Cellulose Biosynthesis and Control of Negative ...
Bacterial Gene Expression Regulation. *Antigenic Variation of bacterial Outer Membrane Proteins. AMC themes * Amsterdam ... We are particularly interested in the bacterial stress response and its regulation by small RNAs (ribo-regulation) in ... The research on Bacterial Meningitis benefits strongly from the Netherlands Reference Laboratory for Bacterial Meningitis ( ... The NRLBM gives access to a collection of over 10,000 bacterial isolates form patients and carriers and of human clinical ...
Plasmids and bacterial strains.Plasmids and strains used in this work are listed in Table 1. A 5.3-kb SmaI fragment from pIZ600 ... GENE REGULATION. Regulation of Tetralin Biodegradation and Identification of Genes Essential for Expression of thn Operons. O. ... Identification of genes required for thn gene expression.Previous DNA sequencing identified structural thn genes encoding ... Regulation of Tetralin Biodegradation and Identification of Genes Essential for Expression of thn Operons ...
Pharmacological Actions : Anti-Bacterial Agents. Additional Keywords : Gene Expression Regulation. [+] Crude extracts and ... Diseases : Bacterial Vaginosis, Clostridium Infections, Dengue Fever, Hepatitis B , Hepatitis C, HIV Infections, Influenza, ... Diseases : Bacterial Infections and Mycoses, Upper Respiratory Infections, Urinary Tract Infections. Pharmacological Actions : ... Diseases : Bacterial Infections: Resistance/Biofilm Formation, Urinary Tract Infections. Additional Keywords : Superiority of ...
Pharmacological Actions : Anti-Bacterial Agents. Additional Keywords : Gene Expression Regulation. [+] Cranberry, bilberry and ... Pharmacological Actions : Antiproliferative , Autophagy Up-regulation, Cytotoxic. Additional Keywords : Dose Response, Plant ... Diseases : Bacterial Infections: Resistance/Biofilm Formation, Staphylococcus aureus: Methicillin-resistant (MRSA). ... Cranberry has significant bacterial anti-adhesion activity against uropathogenic Escherica coli. Jan 01, 2010. ...
... including toxin gene expression. The best characterized prokaryotic sRNAs regulate gene expression by base pairing with mRNA ... collected information about all three types of small prokaryotic RNAs in the context of the regulation of toxin gene expression ... and found to play an important role in the regulation of many processes, ... This article belongs to the Section Bacterial Toxins) Full-Text , PDF [530 KB, uploaded 30 May 2017] , Figure ...
Gene regulation in Prokaryotes, Replication control, Regulation of Bacterial Gene Expression, Global Regulatory Networks ... by Keyword: Regulation of Bacterial Gene Expression. By year:[ 2021 , 2020 , 2019 , 2018 , 2017 , 2016 , 2015 , 2014 , 2013 , ... are not able to achieve a better understanding of the mechanistic processes underlying bacterial gene expression. It is, then, ... to continue gaining insight into the basic mechanisms by which bacterial cells regulate the expression of their genes. That is ...
Gene Expression Regulation, Enzymologic. Genes, Bacterial*. Melanoma / drug therapy, enzymology*, genetics. Mice. N-Glycosyl ... we obtained clones expressing the mRNA of the bacterial tag gene coding for N3-methyladenine-DNA glycosylase I (Gly I), which ... These results suggest that the increased expression of N3-methyladenine-DNA glycosylase is not necessarily a crucial mechanism ... 2542089 - Production of pro-opiomelanocortin (pomc) by a vaccinia virus transient expression syst.... 3401619 - Biosynthesis of ...
... contain 150-fold more genes respect to humans, therefore providing us with novel functions (Qin et al., 2010). Increasing ... Interplays between gut microbiota and gene expression regulation by miRNAs ... Hooper, L. V., and Gordon, J. I. (2001). Commensal host-bacterial relationships in the gut. Science 292, 1115-1118. ... 2012). Analysis of gut microbial regulation of host gene expression along the length of the gut and regulation of gut microbial ...
... gene regulation, especially in relation to expression of virulence factors; stress responses; invasion and intracellular ... Molecular analysis of bacterial virulence factors. In silico analysis of gene sequences and sequence manipulation. ... gene regulation, especially in relation to expression of virulence factors; stress responses; invasion and intracellular ... Gene expression in vivo. Tutorial. Critical thinking and analysis of primary research papers related to lecture materia, ...
Environmental regulation of Salmonella pathogenicity island 2 gene expression. Molecular Microbiology 31, no. 6:1759-1773. ... Space flight alters bacterial gene expression and virulence and reveals a role for global regulator Hfq. Proceedings of the ... Genes lost and genes found: Evolution of bacterial pathogenesis and symbiosis. Science 292, no. 5519:1096-1098. ... SPI1 has genes necessary for invasion of host cells, SPI2 has genes necessary for survival in macrophages, and SPI3 has genes ...
To elucidate the regulation of global gene expression more generally, translational regulation was compared to transcriptional ... We show that the contribution of translational regulation to the control of gene expression is significant in the stress ... Post-transcriptional regulation is important to the understanding of gene expression control. ... The remaining genes exhibited antagonistic regulations of the two markers of translation. Ribosome occupancy increased ...
Small RNA Regulation of Gene Expression in Bacteria. Jennifer A. Doudna, HHMI/University of California, Berkeley, USA Molecular ... Interactions in CRISPR-Mediated Bacterial Immunity. Jin-Wu Nam, Hanyang University, South Korea Short Talk: Long Non-Coding ... It has become apparent that RNA plays a major, but still largely unexplored, role in the regulation of gene expression. It is ... Transcriptional Regulation of Human Type I IFN Genes Yunsun Nam, University of Texas Southwestern Medical Center, USA ...
The Regulation of Gene Expression in the Context... New York University * Alexander Y. Rudensky, PhD Investigator Biology of ... Bacterial Strategies for Infection and Survival The University of Texas Southwestern Medical Center ...
Gene Expression Regulation. Gene Knockdown Techniques. Gram-Negative Bacterial Infections / immunology, microbiology. Humans. ... The microarray assay indicates that transcripts of genes with functions related to immunity and reduction-oxidation (redox) ... 21796346 - Multi-drug-resistant gram-negative bacterial infection in surgical patients hospitalize.... 2387976 - Experimental ... which is essential in mediating the expression of antioxidants to counterbalance oxidative stress. This immune pathway also is ...
regulation of bacterial virulence gene expression. *modeling cholera infection and host responses in Drosophila ... Host responses to viral infection and (retro)transposon activity, Small RNA mediated gene regulation ... Investigation targets viral, bacterial, fungal, and parasitic pathogens of major significance in community acquired infections ... Impact of diarrheal pathogens on host metabolism and development; Vaccines and therapeutics for bacterial infection ...
  • A wide variety of mechanisms that control gene expression in bacteria are based on conditional transcription termination. (asm.org)
  • Enterotoxins produced from those bacteria up-regulate the expression of CXC and CC chemokines. (novapublishers.org)
  • In these bacteria , three key proteins whose structures have been determined can form a molecular clockwork that orchestrates global gene expression. (wikipedia.org)
  • Non-coding small RNAs (sRNAs) have been identified in the wide range of bacteria (also pathogenic species) and found to play an important role in the regulation of many processes, including toxin gene expression. (mdpi.com)
  • The majority of the newly acquired resistances are horizontally spread among bacteria of the same or different species by processes of lateral (horizontal) gene transfer, so that discovery of new antibiotics is not the definitive solution to fighting infectious diseases. (ibecbarcelona.eu)
  • Genomic islands (GEIs), specifically pathogenicity islands (PAIs), typically harbor the genes necessary for the pathogenic mechanisms of bacteria and are thought to be important determinants of pathogenicity. (answersingenesis.org)
  • These islands are gained through horizontal gene transfer (HGT) from other bacteria. (answersingenesis.org)
  • The stress response in bacteria involves the multistage control of gene expression but is not entirely understood. (biomedcentral.com)
  • To identify the translational response of bacteria in stress conditions and assess its contribution to the regulation of gene expression, the translational states of all mRNAs were compared under optimal growth condition and during nutrient (isoleucine) starvation. (biomedcentral.com)
  • the translational response in bacteria to stress and its relative contribution to the regulation of gene expression are still to be determined. (biomedcentral.com)
  • How many genes do bacteria and animals have? (brainscape.com)
  • Transcription, translation and the regulation of gene expression in bacteria. (edu.au)
  • Regulation of heat-shock genes in bacteria: from signal sensing to gene expression output. (semanticscholar.org)
  • In bacteria, specific sensory biomolecules sense temperature fluctuations and transduce intercellular signals that coordinate gene expression outputs. (semanticscholar.org)
  • In this review, we discuss examples of regulated RNA decay in Gram-positive bacteria that are necessary for proper gene function. (pubmedcentralcanada.ca)
  • Upon further investigation, it was discovered that the amino acid composition of HU resembles that of eukaryotic histones, thus prompting further research into the exact function of bacterial DNA binding proteins and discoveries of other related proteins in bacteria. (wikipedia.org)
  • Currently, many more functions of bacteria DNA binding proteins have been discovered, including the regulation of gene expression by histone-like nucleoid-structuring protein, H-NS. (wikipedia.org)
  • H-NS is about 15.6 kDa and assists in the regulation of bacterial transcription in bacteria by repressing and activating certain genes. (wikipedia.org)
  • Explore the structure of bacterial cell walls and how Gram staining can help differentiate between types of bacteria. (study.com)
  • Understand the bacterial structure that allows certain bacteria to lie dormant for extended periods. (study.com)
  • This regulation controls parts of the sulfur metabolism of marine bacteria. (wikipedia.org)
  • The Saper lab studies the molecular mechanisms of how pathogenic bacteria produce and secrete a large capsule polysaccharide that enhances bacterial virulence. (umich.edu)
  • Strategies for isolation of in vivo expressed genes from bacteria. (semanticscholar.org)
  • We are currently using bacterial genetics to study how the bacteria sense and respond to alterations in redox. (berkeley.edu)
  • An extra layer of complexity in the regulation of gene expression in bacteria is now apparent through previously unanticipated roles of noncoding and antisense RNAs. (biomedcentral.com)
  • Bacteria have selected mechanisms to express only the appropriate subset of genes conferring a growth or survival advantage in a given situation ( 10 ). (asm.org)
  • Contemporary research has found that many species of streptococci and other Gram positive bacteria have evolved similar peptide pheromone quorum-sensing systems that probably help them adapt to and survive host-imposed fluctuations in their local environment and coincidently regulate the expression of virulence factors that promote their pathogenicity. (jci.org)
  • The second section addresses molecular biology of bacteria, including DNA replication, transcription and translation, regulation of gene expression, genomics, and bacterial viruses. (umich.edu)
  • Miranda-Rios, J., Navarro, M. and Soberon, M. (2001) A conserved RNA structure (thi box) is involved in regulation of thiamin biosynthetic gene expression in bacteria. (springer.com)
  • Many of the behaviors mediated by quorum sensing are critical for bacterial colonization or infection, and autoinducer-2 has been proposed as a universal interspecies signaling molecule that allows multispecies colonies of bacteria, e.g., biofilms or dental plaque, to behave as pseudomulticellular organisms. (rti.org)
  • Bacterial enterotoxins are proteins released by specific bacterial organisms in the intestine and are chromosomally encoded exotoxins. (novapublishers.org)
  • The cspA and fecR genes, encoding regulatory proteins responding to cold shock and to iron, respectively, and yoaD , encoding a putative negative regulator of cellulose biosynthesis, were found to be some of the novel CsgD-regulated genes. (asm.org)
  • This response has been associated with the modulation of gene-specific mRNA translation efficiency to maintain and even increase the recruitment of ribosomes to mRNAs encoding proteins with functions essential for responding to stress. (biomedcentral.com)
  • Structural genes encode proteins needed for cellular processes such as metabolism, biosynthesis, structure, hormone, etc. (coursehero.com)
  • In molecular biology, bacterial DNA binding proteins are a family of small, usually basic proteins of about 90 residues that bind DNA and are known as histone-like proteins. (wikipedia.org)
  • Since bacterial binding proteins have a diversity of functions, it has been difficult to develop a common function for all of them. (wikipedia.org)
  • in these processes, bacterial DNA binding proteins have an architectural role, maintaining structural integrity as transcription, recombination, replication, or any other DNA-dependent process proceeds. (wikipedia.org)
  • Initially, bacterial DNA binding proteins were thought to help stabilize bacterial DNA. (wikipedia.org)
  • The central dogma of molecular biology, as enunciated by Crick (1958) , specified the instruction manual, DNA (encoding genes), and that genes were transcribed into RNA to ultimately produce the basic operational elements of cellular biology, proteins, whose interactions, through many levels of complexity, result in functioning living cells. (royalsocietypublishing.org)
  • We propose that other RRM proteins could act as metabolite sensors to couple gene expression changes to physiological state. (elifesciences.org)
  • In the present study, which uses mice with genetic deletions of the proteins of NF-kappaB complex, we provide data demonstrating that increased expression of the p50 subunit of NF-kappaB directly results in the downregulation of LPS-induced TNF production. (jci.org)
  • Gene expression can be controlled through the action of repressor proteins that attach to silencer regions of the DNA. (wikipedia.org)
  • This course provides an introduction to the structure of the gene and the relationship between genes and proteins with an in depth discussion of the processes of replication, transcription, translation, regulation of gene expression, mutation and DNA repair and recombination. (uoguelph.ca)
  • Indeed, the two-component system BvrR/BvrS controls cell invasion, intracellular survival, and expression of two outer membrane proteins ( 25 , 58 ). (asm.org)
  • These proteins activate a cellular signal cascade, which leads to differences in gene expressions. (nature.com)
  • Focusing on the expression of these proteins might present a strategy of cells to adapt to microgravity conditions. (nature.com)
  • As a microbiology major, you will learn how microbial genes, proteins, and processes are being exploited in the exciting field of biotechnology to help cure diseases, generate alternative fuels, produce new antibiotics, and recover valuable metals from ores. (osumicrobiology.org)
  • This pattern concerned genes involved in growth-related functions such as translation, transcription, and the metabolism of fatty acids, phospholipids and bases, contributing to the slowdown of growth. (biomedcentral.com)
  • Thus, we have defined regulatory, transport, and catabolic genes and a cis-acting regulatory sequence that form a conserved module required for myo-inositol metabolism in select alpha-proteobacteria. (nih.gov)
  • Gene expression and metabolism are coupled at numerous levels. (elifesciences.org)
  • Structure and mechanisms of radical and redox-active enzymes, the chemical biology of B12 trafficking, regulation of human sulfur metabolism, biochemistry of B-vitamin associated human metabolic diseases, redox communication between glial, neural, dendritic and T cells in immune and neuro-immune function. (umich.edu)
  • We have three new projects that relate bacterial metabolism to host innate immunity. (berkeley.edu)
  • bacterial and eukaryal cell structure and function, and bacterial nutrition, cultivation, and carbon and energy metabolism. (umich.edu)
  • An introduction to cell structure and synthesis of cell components is provided, followed by detailed discussions of genetics, metabolism, growth, and regulation for anyone wishing to understand the mechanisms underlying cell survival and growth. (mexmat.ru)
  • Focus then switches to gene expression in prokaryotes and eukaryotes before the genetics of cancer integrates central human molecular genetic concepts. (edu.au)
  • Watch bacterial biology video lessons and learn about bacterial structure, processes, genetics, and more. (study.com)
  • This course will develop an understanding of the fundamental concepts in genetics, including patterns of inheritance, allelic variation, gene interaction, linkage, gene mapping and changes in chromosome structure and number. (uoguelph.ca)
  • The course includes discussion of the genetic basis of human individual differences, gene frequencies in human populations, human behavioral genetics, human cytogenetics, biochemical genetics and developmental genetics, medical genetics and other aspects of human heredity. (uoguelph.ca)
  • Fundamental aspects of genetics including the chromosomal basis of inheritance, cytogenetics, genes in populations and quantitative traits will be introduced. (uoguelph.ca)
  • Additional topics include extranuclear inheritance, human genetics and bacterial genetics. (uoguelph.ca)
  • The course in Prokaryotic Molecular Microbiology aims at giving you a deeper knowledge in bacterial genetics and cell biology. (gu.se)
  • Generally, in these mechanisms, a transcription terminator is located between a promoter and a downstream gene(s), and the efficiency of the terminator is controlled by a regulatory effector that can be a metabolite, protein, or RNA. (asm.org)
  • The most common type of regulation involving conditional termination is transcription attenuation, in which the primary regulatory target is an essential element of a single terminator. (asm.org)
  • An experimental‐computational approach is applied to dissect the contribution of specific transcription factor‐mediated versus global growth‐dependent regulation to bacterial gene expression, and obtain a quantitative understanding of dynamic adaptations in arginine biosynthesis of E. coli . (embopress.org)
  • We present a model‐based approach to quantitatively dissect simultaneous contributions from specific transcription factors and the global growth status to bacterial gene expression, based on parameter inference from GFP‐based promoter activity measurements. (embopress.org)
  • Transcription start sites were annotated and further analysed according to their position relative to annotated genes. (nih.gov)
  • Four thousand ten transcription start sites were mapped over the whole B. cenocepacia genome and the primary transcription start site of 2089 genes expressed in B. cenocepacia biofilms were defined. (nih.gov)
  • Substantial antisense transcription for 105 genes and two novel protein coding sequences were identified. (nih.gov)
  • Present approach for assigning effective kinetic parameters to E. coli transcription regulation networks. (pnas.org)
  • Transcriptional regulation networks are usually represented by arrow diagrams, where the arrows represent interactions between transcription factors and DNA regulatory sites. (pnas.org)
  • In each plasmid a different promoter controls the transcription rate of the same reporter gene, gfp , and thus rate of transcript production from the promoter is proportional to the rate of GFP accumulation. (pnas.org)
  • Our data suggests that EutV is likely to affect downstream gene expression by interacting with conserved transcription termination signals located within the eut locus. (pnas.org)
  • Gene expression appears to be directed by overlapping posttranscriptional regulatory mechanisms, each responding to a particular metabolic signal, conceptually akin to regulation by multiple DNA-binding transcription factors. (pnas.org)
  • Expression of these genes in Salmonella is positively regulated by a DNA-binding transcription factor, EutR, encoded within the eut operon and active in the presence of AdoCbl and ethanolamine ( 5 , 14 ). (pnas.org)
  • Constitutive expression of the CsgD protein results in altered transcription patterns for at least 24 novel genes, in addition to the previously identified CsgD-dependent genes. (asm.org)
  • Expression of both curli and cellulose depends on the CsgD protein, a putative transcription regulator of the LuxR family, which activates transcription of the csgBAC operon ( 2 ), which encodes curli structural subunits, and transcription of the adrA gene, a positive effector of cellulose biosynthesis ( 45 ). (asm.org)
  • In addition to csgBAC activation by CsgD, production of curli is subject to complex regulation, which affects both the csgDEFG operon (encoding the CsgD transcription regulator and the CsgEFG curli-specific transport system) and the csgBAC operon (encoding curli structural subunits) ( 8 , 20 , 22 , 53 ). (asm.org)
  • Expression analysis indicated that the transcription of both genes is induced in similar ways by the presence of tetralin. (asm.org)
  • Contributing to the interest of the present topic is the fact that modulation of gene activity involves the sensing of intra- and inter-cellular conditions, DNA binding and DNA dynamics, and interaction with the replication/transcription machinery of the cell. (ibecbarcelona.eu)
  • Post-transcriptional regulation is complex and not systematically co-directional with transcription regulation. (biomedcentral.com)
  • However, unlike all other such genes, metabolite binding to the glmS UTR does not induce transcription termination or translational regulation but induces autocatalytic cleavage at a 5'-proximal site, leaving a downstream fragment with a 5'-hydroxyl end [ 6 ]. (pubmedcentralcanada.ca)
  • However, NMR studies show that in the DNA-bound state, two domains tumble separately and an REC-DBD interaction is transiently populated in solution.Reporter gene analyses of PmrA variants with altered interface residues suggest that the interface is not crucial for supporting gene expression.We propose that REC-DBD interdomain dynamics and the DBD-DBD interface help PmrA interact with RNA polymerase holoenzyme to activate downstream gene transcription. (nih.gov)
  • We propose that REC-DBD interdomain dynamics and the DBD-DBD interface help PmrA interact with RNA polymerase holoenzyme to activate downstream gene transcription. (nih.gov)
  • (a) Regulation by cis -encoded RNA, subdivided into signal-mediated folding or unfolding of the translation initiation region (top) or transcription termination/antitermination (bottom). (biomedcentral.com)
  • The expression of many bacterial genes is regulated at the initiation of transcription by regulators which, in response to specific environmental and/or cellular signals, bind at the promoter of target genes to activate or repress them ( 23 ). (asm.org)
  • Macrophage activation by bacterial LPS leads to induction of a complex inflammatory gene program dependent on numerous transcription factor families. (jimmunol.org)
  • Rb keeps genes responsive to the E2F transcription factors inactive during G 1 , so that the phosphorylation of Rb results in activation of genes under E2F control and hence in S-phase entry ( 10 , 57 , 58 ). (asm.org)
  • By applying our approach to arginine biosynthesis, we obtain a quantitative understanding of both specific and global regulation that allows accurate prediction of the temporal response to simultaneous perturbations in arginine availability and growth rate. (embopress.org)
  • We thereby uncover two principles of joint regulation: (i) specific regulation by repression dominates the transcriptional response during metabolic steady states, largely repressing the biosynthesis genes even when biosynthesis is required and (ii) global regulation sets the maximum promoter activity that is exploited during the transition between steady states. (embopress.org)
  • We obtain a quantitative understanding of both specific and global regulation in arginine biosynthesis, as demonstrated by accurate model‐based predictions of complex transient gene‐expression responses to simultaneous perturbation in growth rate and arginine availability. (embopress.org)
  • We uncover two principles of joint regulation of the arginine biosynthesis pathway: (i) specific regulation by repression dominates in steady metabolic states and (ii) global regulation sets the maximal expression reachable during transition between steady metabolic states. (embopress.org)
  • Our results indicate that CsgD can modulate cellulose biosynthesis through activation of the yoaD gene. (asm.org)
  • Expression of curli is linked to cellulose biosynthesis, which leads to the production of an extracellular matrix and results in tight cell-cell and cell-surface interactions and in the so-called rdar morphotype in Salmonella ( 45 , 57 , 58 ). (asm.org)
  • Ribosome occupancy increased significantly for all the genes involved in the biosynthesis of isoleucine, although their ribosome density had decreased. (biomedcentral.com)
  • 2) Humans possess a particular type of T-cell (gamma delta T- cell) that is activated by an intermediate of bacterial isoprenoid biosynthesis. (berkeley.edu)
  • 2004) TT2, TT8, and TTG1 synergistically specify the expression of BANYULS and proanthocyanidin biosynthesis in Arabidopsis thaliana . (springer.com)
  • B. cenocepacia harbours a large, multi-replicon genome with a high GC-content, the reference genome of strain J2315 includes 7374 annotated genes. (nih.gov)
  • To analyze expression of both operons under different growth conditions, transcriptional and translational gene fusions of the first genes of each operon to lacZ have been constructed in plasmids unable to replicate in Sphingomonas and integrated by recombination into the genome of strain TFA. (asm.org)
  • There have been few genome-wide studies of translation regulation in microorganisms. (biomedcentral.com)
  • Describe the major organisation and expression features of the human genome. (edu.au)
  • Applying comprehensive forward and reverse genetic methods and genome-wide transcriptional analysis, we (1) confirmed the presence of genes involved in catabolism of the abundant environmental sugar myo-inositol, (2) defined an operon encoding an ABC-family myo-inositol transmembrane transporter, and (3) identified a novel myo-inositol regulator protein and cis-acting regulatory motif that control expression of genes in this metabolic module. (nih.gov)
  • Design and synthesis of a minimal bacterial genome. (jcvi.org)
  • The Mycoplasma fermentans prophage phiMFV1: genome organization, mobility and variable expression of an encoded surface protein. (jcvi.org)
  • Hamilton Smith, M.D. is a professor emeritus at the J. Craig Venter Institute and former director of the Synthetic Biology and Bioenergy Group that created the first synthetic cell in 2010 and designed and synthesized the first minimal bacterial genome in 2016. (jcvi.org)
  • Polar Effects of Transposon Insertion into a Minimal Bacterial Genome. (jcvi.org)
  • Direct transfer of a Mycoplasma mycoides genome to yeast is enhanced by removal of the mycoides glycerol uptake factor gene glpF. (jcvi.org)
  • Explore the size and shape of the bacterial genome and how it's different from other DNA. (study.com)
  • [2] Epigenetics often refers to changes in a chromosome that affect gene activity and expression , but can also be used to describe any heritable phenotypic change that does not derive from a modification of the genome , such as prions . (wikipedia.org)
  • the other those encoded in trans from their target gene, which are often located at completely unrelated positions on the genome, such as the canonical small RNAs (sRNA). (biomedcentral.com)
  • The availability of complete bacterial genome sequences has opened up doors to the development of new strategies to study the biology of microorganisms ( 59 ). (asm.org)
  • This increasing mobility results in broader and quicker dissemination of bacterial pathogens and in rapid spread of antibiotic resistance. (ibecbarcelona.eu)
  • There is an absolute need of finding novel alternatives to the "classical" approach to treat infections by bacterial pathogens, and these new ways must include the exploration and introduction of novel antibacterials, the development of alternative strategies, and the finding of novel bacterial targets. (ibecbarcelona.eu)
  • Bacterial pathogens of global and medical significance that will be highlighted in detail include: Streptococcus pneumonia, Salmonella sp. (edu.au)
  • To gain an understanding of the molecular mechanisms that underpin the pathogenesis and control of bacterial, virus, and parasite infections, and the interaction of microbial pathogens with the immune system. (edu.au)
  • Investigation targets viral, bacterial, fungal, and parasitic pathogens of major significance in community acquired infections in the United States, in infections of immunocompromised hosts, and in global public health. (childrenshospital.org)
  • In particular, it seeks to address those adaptive responses in foodborne bacterial pathogens that influence pathogenicity and survival in the food chain. (surrey.ac.uk)
  • The bacterium Escherichia coli carries approximately 3000 genes, but this total repertoire describes its potential properties and, in reality, only a small subset of this genetic information is expressed at any given moment. (springer.com)
  • THe genetic determinants mediating expression of enterotoxin A (entA) and staphylokinase (sak) were cloned from the DNA of the triple-converting phage and expression of the cloned determinants detected in Escherichia coli and S. aureus. (nih.gov)
  • However, despite a possible role for the eut locus in bacterial pathogenesis, studies of the mechanisms for genetic regulation of these genes are just beginning ( 10 ). (pnas.org)
  • Genetic and computational identification of a conserved bacterial metabolic module. (nih.gov)
  • The description of genes required for high-pressure growth is now remarkably small but is likely to be greatly expanded as a result of ongoing genetic and genomic studies. (asmscience.org)
  • Assignment of genetic functions to unknown genes in the minimal cell by computational, biochemical and genetic methods. (jcvi.org)
  • [5] instead, non-genetic factors cause the organism's genes to behave (or "express themselves") differently. (wikipedia.org)
  • In this study, we searched for causal genetic variants that underlie the Zfp30 eQTL to gain a better understanding of this candidate repressor's regulation. (g3journal.org)
  • Its competitiveness for this ecological niche may also relate to cell density-dependent regulation of its acid tolerance response (ATR), natural genetic competence, and bacteriocin activity. (jci.org)
  • In practice this involves understanding how genetic and developmental networks operate when there is allelic variation in their genes. (duke.edu)
  • By co-transfecting NIH3T3 murine fibroblast and murine B78 H1 melanoma cells with pSG5tag and pSV2neo, we obtained clones expressing the mRNA of the bacterial tag gene coding for N3-methyladenine-DNA glycosylase I (Gly I), which specifically repairs N3-methyladenine. (biomedsearch.com)
  • To elucidate the regulation of global gene expression more generally, translational regulation was compared to transcriptional regulation under isoleucine starvation and to other post-transcriptional regulations related to mRNA degradation and mRNA dilution by growth. (biomedcentral.com)
  • Translational regulation appeared to accentuate the effects of transcriptional changes for down-regulated growth-related functions under isoleucine starvation although mRNA stabilization and lower dilution by growth counterbalanced this effect. (biomedcentral.com)
  • Topics covered are the organization of model system genomes, gene expression profiling at the mRNA and protein levels, microarrays, analyses of interactions, genomic and proteomic databases. (mcmaster.ca)
  • The B. subtilis glmS gene provides a prime illustration of gene expression control via regulated mRNA decay. (pubmedcentralcanada.ca)
  • It was known that binding of GlcN6P to the 5' UTR of glmS mRNA results in decreased gene expression, thus putting glmS in the category of riboswitch genes [ 5 ]. (pubmedcentralcanada.ca)
  • As such, regulation of an RppH-like activity, and subsequent RNase J1 5' exonuclease activity, could be a mechanism by which mRNA half-life is controlled, similar to the regulation of the decapping step in eukaryotes [ 10 - 12 ]. (pubmedcentralcanada.ca)
  • Protein kinase activity of CycD2- and CycD3-containing cyclin-dependent kinases is consistent with the observed regulation of their mRNA levels. (asm.org)
  • RpoS was shown to regulate VanT expression post-transcriptionally by promoting vanT mRNA stability. (diva-portal.org)
  • Mapping bacterial genomes. (edu.au)
  • Dr. Kim Wise joined the JCVI Synthetic Biology and Bioenergy team in 2012 as a Senior Scientist, where he has pursued strategies to minimize and reconstruct synthetic bacterial genomes based on a naturally-occurring mycoplasmal prototype lacking a cell wall. (jcvi.org)
  • Some major topics covered are: regulation of gene expression, analysis of bacterial and phage genomes, plasmids, transposable elements, and mutation studies. (uoguelph.ca)
  • However, to better understand the mechanisms of prebiotic fibre utilisation by L. plantarum in the gastro-intestinal tract, the molecular processes and regulation of candidate genes involved in fibre utilisation need to be explored. (wur.nl)
  • It is, then, imperative to continue gaining insight into the basic mechanisms by which bacterial cells regulate the expression of their genes. (ibecbarcelona.eu)
  • However, little is known about the molecular mechanisms of such modulations and the host post-transcriptional gene expression regulation by microRNAs. (frontiersin.org)
  • The lecture program is complemented by tutorials, which extend skills in exploring and critically assessing the scientific literature, and practicals which develop advanced experimental skills for the study of bacterial pathogenic mechanisms. (edu.au)
  • I propose that bacterial pathogenicity is the result of multiple events in any given bacterium (vs. singular events) that occurred after the Fall and that no intentional pathogenic mechanisms exist. (answersingenesis.org)
  • Regulation of bacterial gene expression at the post-transcriptional level has emerged as a major control mechanism, although not yet as well recognized as the mechanisms of control at the transcriptional level. (pubmedcentralcanada.ca)
  • Discovery of new ribonuclease activities in B. subtilis and other Gram-positive species, especially the dual-functioning RNase J1, which specifies both an endonuclease activity and the long-sought bacterial 5'-to-3' exoribonuclease activity, has led to the recognition of intriguing mechanisms of gene regulation at the level of RNA decay. (pubmedcentralcanada.ca)
  • The remaining 'non-coding' portion, initially labelled as 'junk DNA', is responsible for regulation of the coding sequence and self-regulation via a list of mechanisms that continues to grow each year. (royalsocietypublishing.org)
  • Other mechanisms involve allosteric regulation of molecular function, including protein-protein and protein-DNA interactions. (umich.edu)
  • The goal of all of these studies is to understand the principles of coordinated molecular regulation at a biochemical level and to demonstrate the importance of these biochemical regulatory mechanisms in a cellular context. (umich.edu)
  • Molecular studies of the function of the mammalian retina, including analysis of the mechanisms controlling signal transduction and tissue-specific gene expression in the retinal pigment epithelium. (umich.edu)
  • Examples of mechanisms that produce such changes are DNA methylation and histone modification , each of which alters how genes are expressed without altering the underlying DNA sequence. (wikipedia.org)
  • These mechanisms can yield heterogeneity in the methylomes of descendants from a single cell and can cause differential regulation of multiple genes, termed a phase-variable regulon (a.k.a. phasevarion) 20 . (nature.com)
  • Further work is necessary to elucidate the mechanisms of these complex interactions that shift bacterial species. (asm.org)
  • The molecular nature of the gene and general mechanisms of gene and general mechanisms of gene expression will be introduced but not covered in detail. (uoguelph.ca)
  • In the laboratory of Dr. Eric Sibley, this research is focused on defining the mechanisms regulating expression of intestine-specific genes, including the gene associated with lactose intolerance. (stanford.edu)
  • Here, we develop an experimental‐computational approach to dissect specific and global regulation in the bacterium Escherichia coli . (embopress.org)
  • Bacterial isolate HNS60 isolated from Hentak and identified as Bacillus subtilis was shown to possess high antimicrobial activity against Staphylococcus aureus , Escherichia coli and Pseudomonas aeruginosa . (springer.com)
  • Correspondingly, several bacterial species found within the GI tract encode the machinery necessary for ethanolamine catabolism, including, but not limited to, E. faecalis , Streptococcus sanguinis , Escherichia coli , and Salmonella , Listeria , and Clostridium species. (pnas.org)
  • Curli fibers, encoded by the csgBAC genes, promote biofilm formation in Escherichia coli and other enterobacteria. (asm.org)
  • However, curli are an important virulence factor in some Salmonella and pathogenic Escherichia coli strains, in which temperature-dependent regulation can be bypassed and curli expression can also take place at 37°C ( 3 , 4 , 37 , 38 ). (asm.org)
  • A cranberry extract could decrease bacterial adhesion of Escherichia coli. (greenmedinfo.com)
  • Growth rate regulation of 4.5 S RNA and M1 RNA the catalytic subunit of Escherichia coli RNase P. (diva-portal.org)
  • Global regulation of gene expression in Escherichia coli. (semanticscholar.org)
  • Mutations in the Escherichia coli ribosomal protein L22 selectively suppress the expression of a secreted bacterial virulence factor. (semanticscholar.org)
  • Genes and novel regulatory RNAs putatively involved in B. cenocepacia biofilm formation were identified. (nih.gov)
  • In this work, we describe a unique series of posttranscriptional regulatory strategies that influence expression of ethanolamine utilization genes ( eut ) in Enterococcus , Clostridium , and Listeria species. (pnas.org)
  • Together, these results suggest an intricate and carefully coordinated interplay of multiple regulatory strategies for control of ethanolamine utilization genes. (pnas.org)
  • In E. faecalis , expression of genes in the eut locus is also influenced by the Fsr global virulence regulatory system ( 8 ), and a transposon insertion in this region attenuated killing of Caenorhabditis elegans ( 9 ). (pnas.org)
  • However, mutations either in the specific promoters ( 44 , 52 ) or in global regulatory genes, such as hns ( 2 ) or ompR ( 53 ), can restore the expression of curli-encoding genes. (asm.org)
  • Intriguingly, ThnY has a regulatory role, since it is also strictly required for expression of the thn operons. (asm.org)
  • Given the similarity of ThnY to reductases and the possibility of its being present in the two redox states, it is tempting to speculate that ThnY is a regulatory component connecting expression of the thn operons to the physiological status of the cell. (asm.org)
  • Recent studies have begun to integrate acyl-HSL quorum sensing into global regulatory networks and establish its role in developing and maintaining the structure of bacterial communities. (nih.gov)
  • Although the chromosomal organization of genes in this functional module varied between species, the upstream regions of genes in this aligned network were enriched for the same palindromic cis-regulatory motif identified experimentally in C. crescentus. (nih.gov)
  • Molecular basis of Mycoplasma surface antigenic variation: a novel set of divergent genes undergo spontaneous mutation of periodic coding regions and 5' regulatory sequences. (jcvi.org)
  • Regulatory genes called small RNAs (sRNAs) are known to play critical roles in cellular responses to changing environments. (aps.org)
  • Both processes frequently involve regulation of gene expression by small regulatory RNAs (sRNAs). (uni-muenchen.de)
  • Our study adds the SOS regulon to the growing list of global regulatory circuits controlled by sRNA genes. (diva-portal.org)
  • Two recent papers from Pascale Cossart and colleagues [ 6 , 7 ] present a comprehensive microarray analysis of the trans-criptome of Listeria monocytogenes in different conditions, uncovering an unsuspected variety of regulatory roles for noncoding RNAs in controlling changes in gene expression that characterize the transition from saprophytic to pathogenic lifestyle. (biomedcentral.com)
  • PmrA, an OmpR/PhoB family response regulator, manages genes for antibiotic resistance. (nih.gov)
  • Therefore, a new study examines whether certain gene expression can reduce antibiotic resistance and improve strategies in developing new antibiotics. (medindia.net)
  • Beyond its role in host defense, bacterial DNA methylation also plays important roles in the regulation of gene expression, virulence and antibiotic resistance. (nature.com)
  • Eukaryotic genes are transcribed individually but what are operons? (brainscape.com)
  • We will examine both prokaryotic and eukaryotic cell biology, as well as molecular regulation and infectious disease progression. (le.ac.uk)
  • HU is a small (10 kDa) bacterial histone-like protein that resembles the eukaryotic Histone H2B. (wikipedia.org)
  • We are particularly interested in the bacterial stress response and its regulation by small RNAs (ribo-regulation) in conjunction with alternative sigma factors like sigmaE. (amc.nl)
  • In this work we have collected information about all three types of small prokaryotic RNAs in the context of the regulation of toxin gene expression. (mdpi.com)
  • MicroRNAs (miRNAs) are short (~22 nt) non-coding RNAs that control gene expression by base pairing with 3′-untraslated regions (3′UTRs) of their regulated transcripts. (frontiersin.org)
  • It is becoming increasingly evident that longer forms of non-protein-coding RNAs (ncRNAs) are involved directly in regulating gene expression and epigenetic states. (keystonesymposia.org)
  • For several bacterial sRNAs, regulation is effected by coupled stoichiometric degradation with messenger RNAs (mRNAs). (aps.org)
  • Diese beiden Prozesse beinhalten häufig die Regulation der Genexpression durch kleine regulatorische RNAs (sRNAs). (uni-muenchen.de)
  • The roles of genes and inheritance in the biology of humans and the organisms with which we interact. (uoguelph.ca)
  • Members of the bacterial genus Streptococcus are responsible for causing a wide variety of infections in humans. (jci.org)
  • Reactive oxygen species elevation is linked to the activation of the Toll pathway, which is essential in mediating the expression of antioxidants to counterbalance oxidative stress. (biomedsearch.com)
  • Multinuclear NMR spectroscopy and imaging of intact biological systems, with an emphasis in experimental neuro-oncology, oxidative stress, and gene therapy. (umich.edu)
  • Post-transcriptional regulation is important to the understanding of gene expression control. (biomedcentral.com)
  • In eukaryotes, different modes of post-transcriptional regulation at the level of the RNA itself (i.e., not translational regulation) can occur. (pubmedcentralcanada.ca)
  • Schematic representation of the different modes of action of transcriptional regulation by noncoding RNA. (biomedcentral.com)
  • In particular, Dr. Dozois is interested in the identification and characterisation of bacterial genes that are expressed in vivo during infection of the host and the discovery of new microbial systems that contribute to pathogenesis. (inrs.ca)
  • A total of 46 morphologically different bacterial strains were identified and assigned under the phylum Firmicutes. (springer.com)
  • In contrast, curli operons are cryptic in a large number of both clinical and environmental E. coli isolates, as well as in laboratory strains, despite the presence of functional csg genes. (asm.org)
  • A few bacterial strains which are able to aerobically grow on tetralin as the only carbon and energy source have been isolated ( 44 ). (asm.org)
  • HPLC chromatograms of supernatants of M145 and the quadruply deleted mutant M1146, and of the same strains containing the congocidine gene cluster (indicated as '+pCGC002') after growth in liquid GYM medium. (nih.gov)
  • Consequently, when combined with liquid chromatography and mass spectrometry, these engineered strains are likely to markedly facilitate the discovery of new compounds from heterologously expressed gene clusters. (nih.gov)
  • Using seven bacterial strains, we show that SMALR yields significantly improved resolution and reveals distinct types of epigenetic heterogeneity. (nature.com)
  • For example, expression of the CXC chemokines, including IL-8 and growth-related oncogene (GRO)-, and the CC chemokines, including monocyte chemoattractant protein (MCP)-1, increases during the relatively early period after stimulation with C. difficile enterotoxin (toxin A) and B. fragilis enterotoxin. (novapublishers.org)
  • In contrast, expression of neutrophil activating protein-78 (ENA-78) is delayed. (novapublishers.org)
  • The product of the CsgD-dependent adrA gene is a member of the GGDEF protein family ( 16 , 50 ). (asm.org)
  • Multi-stage regulation at transcriptional and post-transcriptional levels contributes to reprogramming protein synthesis. (biomedcentral.com)
  • The evaluation of the mitochondrial membrane depolarization, residual proteasome and mitochondrial enzymatic activities, colony-forming capabilities, and changes in protein expression profiles in A549 and H1299 cells under a combined therapeutic regimen gave results consistent with our hypothesis. (mdpi.com)
  • Chlamydial GroEL autoregulates its own expression through direct interactions with the HrcA repressor protein. (semanticscholar.org)
  • Global transcriptome analyses revealed that both sRNAs act together to control outer membrane protein expression, and to maintain envelope homeostasis under membrane damaging conditions. (uni-muenchen.de)
  • Using a mouse ( Mus musculus ) model of asthma applied to the Collaborative Cross population, we previously identified a lung gene expression quantitative trait locus (eQTL) for Zinc finger protein 30 ( Zfp30 ) that was also a QTL for neutrophil recruitment and the hallmark neutrophil chemokine CXCL1. (g3journal.org)
  • Likewise, the expression of the gene Zinc finger protein 30 ( Zfp30 ) was also regulated by this locus [ i.e. , is an expression quantitative trait locus (eQTL)], and Zfp30 expression was strongly correlated with CXCL1 and neutrophil counts (Supplemental Material, Figure S1 ). (g3journal.org)
  • a technique that allows explicit sequestration of a metabolite, protein or RNA by the ectopic expression of genes encoding antibodies or antibody fragments. (springer.com)
  • The topics covered in the course include regulation of gene expression, bacterial growth and division, DNA repair and protein homeostasis. (gu.se)
  • Decreased Ikaros expression in Ikzf1 +/− mice and human cells dampens these Ikaros-enhanced inflammatory responses, highlighting the importance of quantitative control of Ikaros protein level for its activator function. (jimmunol.org)
  • the quorum sensing phosphorelay protein VanU and the response regulator VanO had antagonistic roles in the regulation of vanT expression. (diva-portal.org)
  • DSBs trigger transient transcriptional silencing in the vicinity of transcriptionally active genes through multilayered processes instigated by Ataxia telangiectasia mutated (ATM), DNA-dependent protein kinase (DNA-PK), and poly-(ADP-ribose) polymerase 1 (PARP1). (medworm.com)
  • The tetralin biodegradation genes of Sphingomonas macrogolitabida strain TFA are clustered in two closely linked and divergent operons. (asm.org)
  • Gene expression in both operons is also subjected to overimposed catabolic repression. (asm.org)
  • ThnR is similar to LysR-type regulators, and mutational analysis indicated that ThnR is strictly required for expression of the thn operons. (asm.org)
  • The genes coding for these enzymes have also been identified and shown to cluster together in two closely linked operons, which are divergently transcribed ( 26 , 37 ) (Fig. 1 ). (asm.org)
  • Schematic representation of the two divergent strain TFA operons, which bear tetralin biodegradation genes. (asm.org)
  • Explore how operons, or clusters of genes, function within the bacterial cell. (study.com)
  • However, all these approaches will result in a stalemate if we, researchers, are not able to achieve a better understanding of the mechanistic processes underlying bacterial gene expression. (ibecbarcelona.eu)
  • Depending upon the bacterial species, the physiological processes regulated by quorum sensing are extremely diverse, ranging from bioluminescence to swarming motility. (nih.gov)
  • Characteristic features of inflammatory signals are the chemokine expression, leading to the migration of inflammatory cells into intestinal mucosa. (novapublishers.org)
  • This chapter will focus on the impact of bacterial enterotoxins on the gene regulation and expression of chemokines in intestinal epithelial cells. (novapublishers.org)
  • Cytological studies showed that plants with Lux or GUS gene connected to 35S promoter as a control exhibited the distinctive GUS atibity in the cells possibly carrying the chimeric DNA, however those with PAL promoter did not exhibit GUS or Lux activities even by the treatment with fungal elicitor. (nii.ac.jp)
  • We have shown earlier that exposure of human peripheral blood mononuclear cells (PBMC) to viruses results in rapid up-regulation of NK cell activity via interleukin-15 (IL-15) induction, and that this mechanism curtails viral infection in vitro. (dasmaninstitute.org)
  • Inspired by the research of the aforementioned pioneers, the cyanobacterium Synechococcus elongatus was genetically transformed with a luciferase reporter that allowed rhythmic gene expression to be assayed non-invasively as rhythmically "glowing" cells. (wikipedia.org)
  • Both the host diet and cells within the intestine (bacterial and epithelial) are thought to provide a rich ethanolamine source ( 5 ). (pnas.org)
  • These results suggest that the increased expression of N3-methyladenine-DNA glycosylase is not necessarily a crucial mechanism for the resistance of cells to alkylating agents. (biomedsearch.com)
  • This suggests that protists use arsenic to poison bacterial cells in the phagosome, similar to their use of copper. (nih.gov)
  • Tuning Gene Activity by Inducible and Targeted Regulation of Gene Expression in Minimal Bacterial Cells. (jcvi.org)
  • Learn about the different shapes and arrangements of bacterial cells. (study.com)
  • Understand this method of direct gene transfer between bacterial cells. (study.com)
  • Learn about how bacterial cells live in an oxygen-rich environment. (study.com)
  • Recognition of bacterial endotoxin (LPS) elicits multiple host responses, including activation of cells of the innate immune system. (jci.org)
  • Transcriptome analyses revealed that VadR regulates a large gene cluster responsible for synthesis of the biofilm matrix, and biofilm formation was inhibited in cells overexpressing vadR. (uni-muenchen.de)
  • In other words, as a single fertilized egg cell - the zygote - continues to divide , the resulting daughter cells change into all the different cell types in an organism, including neurons , muscle cells , epithelium , endothelium of blood vessels , etc., by activating some genes while inhibiting the expression of others. (wikipedia.org)
  • Bacterial cells in a clonal population can generate epigenetic heterogeneity to increase population-level phenotypic plasticity. (nature.com)
  • We are currently studying the regulation of LLO synthesis and the cell biology of its trafficking in cells. (berkeley.edu)
  • This requires the bacterium to switch genes on and off as it traverses different environments, ranging from a saprophytic lifestyle to the gut lumen after ingestion to invasion of epithelial cells and intracellular survival. (biomedcentral.com)
  • Research in the division also includes projects investigating fatty liver disease and obesity in pediatric patients, intestinal bacterial overgrowth in chronically acid-suppressed patients with cystic fibrosis, and targeted gene transfer to intestinal stem cells. (stanford.edu)
  • Interestingly, VanT expression was induced by the alternative sigma factor RpoS as the cells entered stationary phase. (diva-portal.org)
  • Antibiotics used in treating bacterial infections become ineffective. (medindia.net)
  • Antibiotics are used in the treatment of bacterial infections. (medindia.net)
  • This has arisen, in part, because of the estimate by the Centers for Disease Control and Prevention that 65% of human bacterial infections involve biofilms. (jci.org)
  • Quorum sensing is an example of community behavior prevalent among diverse bacterial species. (nih.gov)
  • We have established that a TPP-sensing riboswitch is present in the 3′ untranslated region (UTR) of the thiamin biosynthetic gene THIC of all plant species examined. (plantcell.org)
  • By contrast, the expression platforms for riboswitches can vary considerably among species or even among multiple representatives of a riboswitch class in a single organism. (plantcell.org)
  • Herein, we report that TPP riboswitches are present in a variety of plant species where they reside in the 3′ untranslated regions (UTRs) of THIC genes. (plantcell.org)
  • Consequently, we implemented the Graemlin multiple-network alignment algorithm to generate cross-species predictions of genes involved in myo-inositol transport and catabolism in other alpha-proteobacteria. (nih.gov)
  • Moreover, this study describes a forward validation of gene-network alignment, and illustrates a strategy for reliably transferring pathway-level annotation across bacterial species. (nih.gov)
  • We characterized colonization by these four bacterial species, determined species-specific interactions, and estimated the effects of host factors on bacterial colonization among COPD patients. (asm.org)
  • Importantly, we have also found these genes in 100s of other bacterial species including members of the intestinal microbiota. (berkeley.edu)
  • Further, the discoveries achieved in the bacterial world have been of ample use in eukaryotes. (ibecbarcelona.eu)
  • Regulation of gene expression in eukaryotes. (edu.au)
  • These findings highlight the importance of metabolite sensing by riboswitches in plants and further reveal the significance of alternative 3′ end processing as a mechanism of gene control in eukaryotes. (plantcell.org)
  • Bacterial pure cultures were isolated using serially diluted samples and were further identified by conventional biochemical tests and Sanger sequencing of 16s rRNA gene. (springer.com)
  • Biochemical aspects of the bacterial response to heat shock. (umich.edu)
  • In Salmonella typhimurium , expression of the eut operon is affected by a global regulator of invasion genes (CsrA) ( 7 ). (pnas.org)
  • The LiMuR also allows simple screenings to identify regulators of a particular gene or operon. (asm.org)
  • As a first example, we analyzed the expression of the virB operon in the LiMuR mutants. (asm.org)
  • For Listeria monocytogenes , the genes of the ethanolamine utilization ( eut ) locus exhibit increased expression inside the host cell, and loss of one of the key enzymes, EutB, causes a defect in intracellular growth ( 6 ). (pnas.org)
  • Here we show that treatment of mice with agonistic anti-CD40 mAb (anti-CD40) induced up-regulation of intracellular TLR9 in Mφ and primed them to respond to CpG-containing oligodeoxynucleotides (CpG), resulting in synergistic activation. (jimmunol.org)
  • Specifically, the lab works on Listeria monocytogenes , a facultative intracellular food-borne bacterial pathogen that is an outstanding model system with which to dissect basic aspects of host-pathogen interactions. (berkeley.edu)
  • Specifically, the lab is focused on the interaction of the facultative intracellular bacterial pathogen Listeria monocytogenes and its mammalian host. (berkeley.edu)
  • We have experimentally and computationally defined a set of genes that form a conserved metabolic module in the alpha-proteobacterium Caulobacter crescentus and used this module to illustrate a schema for the propagation of pathway-level annotation across bacterial genera. (nih.gov)
  • Primary sequence comparison was not sufficient to confidently extend annotation of all components of this novel metabolic module to related bacterial genera. (nih.gov)
  • The organization and the structure of the genes encoding phenylalanine ammonia-lyase (PAL) and chalcone synthase (CHS) were determined and the effects of elicitor and suppressor produced by a pea pathogen, Mycosphaerella pinodes, were examined by transforming a chimeric DNA containing the PAL- and CHS-promoter fragments connected to a reporter gene into tobacco or pea plant with particle gun, Agrobacterium-mediated transformation, or electroporation. (nii.ac.jp)
  • Because iron acquisition is critical for growth of a pathogen in a host, we studied the regulation of the ferric reductase and ferrous uptake system of this organism. (asm.org)
  • Vibrio anguillarum is a bacterial pathogen that causes terminal hemorrhagic septicaemia in marine fish. (diva-portal.org)
  • Bacterial colonization and infection by H. influenzae , M. catarrhalis , and S. pneumoniae typically occur earlier in the course of COPD, while acquisition of P. aeruginosa is more prevalent in advanced disease ( 6 ). (asm.org)
  • VanT repressed an EPS locus that plays a critical role in bacterial colonization of the fish integument and virulence. (diva-portal.org)
  • A flurry of research over the past decade has led to significant understanding of many aspects of quorum sensing including the synthesis of acyl-HSLs, the receptors that recognize the acyl-HSL signal and transduce this information to the level of gene expression, and the interaction of these receptors with the transcriptional machinery. (nih.gov)
  • In addition, the positive effect of CsgD on biofilm formation might be enhanced by repression of the fecR gene. (asm.org)
  • These results indicate that IL-15 is also involved in the innate immune response against fungal and bacterial agents. (dasmaninstitute.org)
  • Examples are the prfA thermo-sensor of L. monocytogenes [ 10 ], which is involved in controlling virulence genes, or the cyclic-di-GMP-sensing riboswitch of Vibrio cholerae [ 11 ], which controls biofilm formation, cell differentiation, and virulence gene expression. (biomedcentral.com)
  • Within the research in Molecular Biology, one important field along the years has been the analyses on how prokaryotes regulate the expression of their genes and what the consequences of these activities are. (ibecbarcelona.eu)
  • These findings will help in understanding regulation of B. cenocepacia biofilm formation. (nih.gov)
  • In this study, we investigated the effects of CsgD expression from a weak constitutive promoter in the biofilm formation-deficient PHL565 strain of E. coli . (asm.org)
  • Furthermore, V. cholerae employs quorum sensing systems to synchronize group behaviors, such as biofilm formation and virulence gene expression. (uni-muenchen.de)
  • We analyzed bacterial interactions using generalized linear mixed models after controlling for clinical and demographic variables. (asm.org)
  • Two additional genes named thnR and thnY have been identified downstream of thnCA3A4 genes. (asm.org)
  • How this results in depression of gene expression was shown recently by Winkler and colleagues to be due to RNase J1-mediated degradation of the downstream cleavage product ( Fig. 1A ) [ 7 ]. (pubmedcentralcanada.ca)
  • In this article, we focus on regulated RNA decay in the control of gene expression in Gram-positive organisms, with a focus on Bacillus subtilis . (pubmedcentralcanada.ca)
  • We describe four examples of this type of regulation from the model Gram-positive organism, Bacillus subtilis , and also cite examples from other Gram-positive organisms. (pubmedcentralcanada.ca)
  • Evolution forced complex organisms to develop systems for fluid regulation, gravity sensing, spatial orientation and locomotion. (nature.com)
  • the structure, organization, and expression of genes - to the analysis of whole organisms - biodegradation and biotransformation - will demonstrate the importance of microorganisms in the environment. (osumicrobiology.org)
  • Individuals prescribed an antibiotic in primary care for a respiratory or urinary infection develop bacterial resistance to that antibiotic. (greenmedinfo.com)
  • Bacterial resistance to arsenic protects against protist killing. (nih.gov)
  • In response to copper and arsenic poisoning by protists, there is selection for acquisition of arsenic and copper resistance genes in the bacterial prey to avoid killing. (nih.gov)
  • In agreement with this hypothesis, both copper and arsenic resistance determinants are widespread in many bacterial taxa and environments, and they are often found together on plasmids. (nih.gov)
  • Finally, we pinpoint regulation of crvA by VadR to be critical to mediate resistance to cell wall damage. (uni-muenchen.de)
  • We demonstrate that riboswitch-mediated regulation of alternative 3′ end processing is critical for TPP-dependent feedback control of THIC expression. (plantcell.org)
  • Specifically, TPP binding by the riboswitch prevents removal of intron sequences carrying upstream open reading frames (ORFs) that preclude expression of the main ORF. (plantcell.org)
  • Formation of THIC transcripts with alternative 3′ UTR lengths is dependent on riboswitch function and mediates feedback regulation of THIC expression in response to changes in cellular TPP levels. (plantcell.org)
  • The second signal, typically provided by bacterial derivatives or TNF-α ( 5 , 10 , 11 ), then activates the spectrum of biological responses attributable to effector Mφ. (jimmunol.org)
  • In the absence of Ikaros, a constitutively open chromatin state was coincident with dysregulation of LPS-induced chromatin remodeling, gene expression, and cytokine responses. (jimmunol.org)
  • By using fluorescent promoter reporters, we show that global regulation is growth rate dependent not only during steady state but also during dynamic changes in growth rate and can be quantified through two promoter‐specific parameters. (embopress.org)
  • Chimeric DNA containing PAL promoter fragment connected to luciferase gene (lux), beta-glucuronidase (GUS) or chloramphenicol acetyltransferase (CAT) gene as a reporter were constructed. (nii.ac.jp)
  • Furthermore, the sequentially deleted promoter fragment of PSPAL1 connected to a plant expression vector containing the reporter gene (CAT) was introduced into pea protoplasts by electroporation, and induction by elicitor and suppression by orthovanadate was examined. (nii.ac.jp)
  • Transient expression of phenylalanine ammonia-lyase promoter in electroporated pea protoplasts. (nii.ac.jp)
  • Analyses of the vadR promoter revealed that vadR expression is activated in response to cell wall damage by the VxrAB two component system. (uni-muenchen.de)
  • Regulation of gene expression by cell-to-cell communication: acyl-homoserine lactone quorum sensing. (nih.gov)
  • Expression of the fourth sRNA analyzed in this study, VqmR, is controlled by quorum sensing system, involving the autoinducer DPO. (uni-muenchen.de)
  • The V. harveyi-like quorum sensing systems were shown to limit rather than induce vanT expression throughout growth in V. anguillarum. (diva-portal.org)
  • Unlike other members of the luxR family, vanT was expressed at low cell density and no significant induction due to quorum sensing regulation was seen. (diva-portal.org)
  • Quorum Sensing is a type of bacterial cell-to-cell signaling that allows for cell density dependent regulation of gene expression. (rti.org)
  • These changes mean that Musashi-1 is no longer able to regulate the genes that control cell proliferation. (elifesciences.org)
  • This signalling system allows a bacterial population to co-ordinately regulate functions according to their cell number in a defined environment. (diva-portal.org)
  • As bacterial growth progresses towards the stationary phase, signalling molecules accumulate in the growth medium and, above a certain threshold level, regulate the expression of genes involved in diverse functions. (diva-portal.org)
  • Regulation of an essential innate immune response by the p50 subunit of NF-kappaB. (jci.org)
  • Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. (embopress.org)
  • We show that growth rate can be used to predict the unregulated expression baseline of a gene, since growth rate dependence of global regulation occurs both in steady state and during transient changes in growth rate. (embopress.org)
  • however, csgBAC expression remains dependent on temperature and the growth medium. (asm.org)
  • A concentration of tetralin higher than 100 μM inhibits bacterial growth ( 44 ). (asm.org)
  • A markerless point mutation introduced in the start codon by two-step en passant Red mutagenesis abrogated ORF9 expression and resulted in a dramatic growth defect that was not observed in a revertant virus. (asm.org)
  • The essential nature of ORF9 for VZV replication was ultimately confirmed by restoration of the growth of the ORF9 -deficient mutant virus using trans -complementation via baculovirus-mediated gene transfer. (asm.org)
  • The model consists of a system of four ordinary differential equations (ODEs), which govern the temporal dependence of the bacterial life cycle (the lag, exponential growth, stationary, and death phases, respectively). (scribd.com)
  • The structure and the organization of three major CHS genes were determined from 38 CHS-cDNAs prepared from elicitor treated pea epicotyl tissues. (nii.ac.jp)
  • Genomic organization of the C. crescentus myo -inositol module and regulation of gene expression by myo -inositol and glucose. (nih.gov)
  • Designer diatom episomes delivered by bacterial conjugation. (jcvi.org)
  • It presents the cell with the signals that ultimately lead to gene regulation-the turning on or off of gene expression. (springer.com)
  • It was based on the assumption that a bacterial cell is equivalent to a sexually reproducing multicellular organism. (wikipedia.org)
  • Consistent with the predicted functional role, increased expression of the yoaD gene negatively affects cell aggregation, while yoaD inactivation results in stimulation of cell aggregation and leads to increased cellulose production. (asm.org)
  • The SOS regulon includes genes whose products repair DNA damage as well as prevent cell division. (asmscience.org)
  • Expression of both sRNAs is activated under high cell density conditions or by treatment with membrane damaging agents. (uni-muenchen.de)
  • However, existing SMRT sequencing-based methods for studying bacterial methylomes rely on a population-level consensus that lacks the single-cell resolution required to observe epigenetic heterogeneity. (nature.com)
  • In reporter gene assays in vitro , these haplotypes recapitulated the three previously identified in vivo expression patterns. (g3journal.org)
  • The results revealed complex translational regulation of this pathway, essential to cope with isoleucine starvation. (biomedcentral.com)
  • We show that the contribution of translational regulation to the control of gene expression is significant in the stress response. (biomedcentral.com)
  • Riboswitches are metabolite-sensing gene control elements typically located in the noncoding portions of mRNAs. (plantcell.org)
  • Thus, glmS gene expression is regulated by a combination of metabolite-mediated ribozyme cleavage and exonucleolytic degradation. (pubmedcentralcanada.ca)
  • Engineering Streptomyces coelicolor for heterologous expression of secondary metabolite gene clusters. (nih.gov)
  • This technique is used in plants for the analysis of gene function and has been adapted for high-throughput functional genomics. (springer.com)
  • Chapter 16 - Chapter 16 Control of Gene Expression in. (coursehero.com)
  • In most instances, riboswitches can be divided into aptamer and expression platform regions that represent two functionally distinct but usually physically overlapping domains responsible for ligand binding and gene control, respectively. (plantcell.org)
  • The early phase of RNA production may help to control the regulation of bacterial gene expression. (medindia.net)
  • It has been postulated that epigenetic control of gene expression mediated by phase variation (epigenetic control of a single gene) or phasevarions (multiple genes regulated simultaneously) allows an essentially clonal population to adopt multiple distinct phenotypes 26 . (nature.com)
  • The LiMuR is a resource that will provide straightforward identification of regulators involved in the control of genes of interest. (asm.org)
  • Stormo, G.D. and Ji, Y. (2001) Do mRNAs act as direct sensors of small molecules to control their expression? (springer.com)
  • The microarray assay indicates that transcripts of genes with functions related to immunity and reduction-oxidation (redox) reactions are up-regulated in Ae. (biomedsearch.com)
  • SMALR is a powerful new tool that enables de novo detection of epigenetic heterogeneity and empowers investigation of its functions in bacterial populations. (nature.com)
  • All of the genes for this catabolic pathway are present in the C. crescentus myo -inositol catabolic locus diagrammed in , except the gene iolJ . (nih.gov)
  • Most recently, we identified an 8-gene locus that encodes a flavin-based extracellular electron transport system that makes L. monocytogenes electrogenic. (berkeley.edu)