Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Deletion of sequences of nucleic acids from the genetic material of an individual.
The proportion of one particular in the total of all ALLELES for one genetic locus in a breeding POPULATION.
The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.
Actual loss of portion of a chromosome.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
An individual in which both alleles at a given locus are identical.
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
An individual having different alleles at one or more loci regarding a specific character.
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
Any method used for determining the location of and relative distances between genes on a chromosome.
Biochemical identification of mutational changes in a nucleotide sequence.
Recombinases that insert exogenous DNA into the host genome. Examples include proteins encoded by the POL GENE of RETROVIRIDAE and also by temperate BACTERIOPHAGES, the best known being BACTERIOPHAGE LAMBDA.
The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.
A latent susceptibility to disease at the genetic level, which may be activated under certain conditions.
A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.
A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
The genetic constitution of individuals with respect to one member of a pair of allelic genes, or sets of genes that are closely linked and tend to be inherited together such as those of the MAJOR HISTOCOMPATIBILITY COMPLEX.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Genotypic differences observed among individuals in a population.
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
A phenotypically recognizable genetic trait which can be used to identify a genetic locus, a linkage group, or a recombination event.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Techniques to alter a gene sequence that result in an inactivated gene, or one in which the expression can be inactivated at a chosen time during development to study the loss of function of a gene.
A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.
The functional hereditary units of FUNGI.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.
The integration of exogenous DNA into the genome of an organism at sites where its expression can be suitably controlled. This integration occurs as a result of homologous recombination.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
A type of IN SITU HYBRIDIZATION in which target sequences are stained with fluorescent dye so their location and size can be determined using fluorescence microscopy. This staining is sufficiently distinct that the hybridization signal can be seen both in metaphase spreads and in interphase nuclei.
Proteins found in any species of bacterium.
The number of copies of a given gene present in the cell of an organism. An increase in gene dosage (by GENE DUPLICATION for example) can result in higher levels of gene product formation. GENE DOSAGE COMPENSATION mechanisms result in adjustments to the level GENE EXPRESSION when there are changes or differences in gene dosage.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
Those genes found in an organism which are necessary for its viability and normal function.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A variety of simple repeat sequences that are distributed throughout the GENOME. They are characterized by a short repeat unit of 2-8 basepairs that is repeated up to 100 times. They are also known as short tandem repeats (STRs).
Established cell cultures that have the potential to propagate indefinitely.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in fungi.
Genes whose loss of function or gain of function MUTATION leads to the death of the carrier prior to maturity. They may be essential genes (GENES, ESSENTIAL) required for viability, or genes which cause a block of function of an essential gene at a time when the essential gene function is required for viability.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
Proteins found in any species of fungus.
Deliberate breeding of two different individuals that results in offspring that carry part of the genetic material of each parent. The parent organisms must be genetically compatible and may be from different varieties or closely related species.
The chromosomal constitution of cells, in which each type of CHROMOSOME is represented once. Symbol: N.
The functional hereditary units of BACTERIA.
A characteristic symptom complex.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
The complete gene complement contained in a set of chromosomes in a fungus.
A type of mutation in which a number of NUCLEOTIDES deleted from or inserted into a protein coding sequence is not divisible by three, thereby causing an alteration in the READING FRAMES of the entire coding sequence downstream of the mutation. These mutations may be induced by certain types of MUTAGENS or may occur spontaneously.
Processes occurring in various organisms by which new genes are copied. Gene duplication may result in a MULTIGENE FAMILY; supergenes or PSEUDOGENES.
A copy number variation that results in reduced GENE DOSAGE due to any loss-of-function mutation. The loss of heterozygosity is associated with abnormal phenotypes or diseased states because the remaining gene is insufficient.
Identification of genetic carriers for a given trait.
A specific pair of GROUP C CHROMSOMES of the human chromosome classification.
Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.
The co-inheritance of two or more non-allelic GENES due to their being located more or less closely on the same CHROMOSOME.
Variation in a population's DNA sequence that is detected by determining alterations in the conformation of denatured DNA fragments. Denatured DNA fragments are allowed to renature under conditions that prevent the formation of double-stranded DNA and allow secondary structure to form in single stranded fragments. These fragments are then run through polyacrylamide gels to detect variations in the secondary structure that is manifested as an alteration in migration through the gels.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Hemoglobins characterized by structural alterations within the molecule. The alteration can be either absence, addition or substitution of one or more amino acids in the globin part of the molecule at selected positions in the polypeptide chains.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Directed modification of the gene complement of a living organism by such techniques as altering the DNA, substituting genetic material by means of a virus, transplanting whole nuclei, transplanting cell hybrids, etc.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
A specific pair of GROUP E CHROMOSOMES of the human chromosome classification.
A transferase that catalyzes the addition of aliphatic, aromatic, or heterocyclic FREE RADICALS as well as EPOXIDES and arene oxides to GLUTATHIONE. Addition takes place at the SULFUR. It also catalyzes the reduction of polyol nitrate by glutathione to polyol and nitrite.
A hereditary disorder characterized by reduced or absent DELTA-GLOBIN thus effecting the level of HEMOGLOBIN A2, a minor component of adult hemoglobin monitored in the diagnosis of BETA-THALASSEMIA.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
A muscle protein localized in surface membranes which is the product of the Duchenne/Becker muscular dystrophy gene. Individuals with Duchenne muscular dystrophy usually lack dystrophin completely while those with Becker muscular dystrophy have dystrophin of an altered size. It shares features with other cytoskeletal proteins such as SPECTRIN and alpha-actinin but the precise function of dystrophin is not clear. One possible role might be to preserve the integrity and alignment of the plasma membrane to the myofibrils during muscle contraction and relaxation. MW 400 kDa.
An adrenal microsomal cytochrome P450 enzyme that catalyzes the 21-hydroxylation of steroids in the presence of molecular oxygen and NADPH-FERRIHEMOPROTEIN REDUCTASE. This enzyme, encoded by CYP21 gene, converts progesterones to precursors of adrenal steroid hormones (CORTICOSTERONE; HYDROCORTISONE). Defects in CYP21 cause congenital adrenal hyperplasia (ADRENAL HYPERPLASIA, CONGENITAL).
Subnormal intellectual functioning which originates during the developmental period. This has multiple potential etiologies, including genetic defects and perinatal insults. Intelligence quotient (IQ) scores are commonly used to determine whether an individual has an intellectual disability. IQ scores between 70 and 79 are in the borderline range. Scores below 67 are in the disabled range. (from Joynt, Clinical Neurology, 1992, Ch55, p28)
The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.
The ordered rearrangement of gene regions by DNA recombination such as that which occurs normally during development.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Transport proteins that carry specific substances in the blood or across cell membranes.
Specific regions that are mapped within a GENOME. Genetic loci are usually identified with a shorthand notation that indicates the chromosome number and the position of a specific band along the P or Q arm of the chromosome where they are found. For example the locus 6p21 is found within band 21 of the P-arm of CHROMOSOME 6. Many well known genetic loci are also known by common names that are associated with a genetic function or HEREDITARY DISEASE.
A heterogeneous group of inherited MYOPATHIES, characterized by wasting and weakness of the SKELETAL MUSCLE. They are categorized by the sites of MUSCLE WEAKNESS; AGE OF ONSET; and INHERITANCE PATTERNS.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
A method for comparing two sets of chromosomal DNA by analyzing differences in the copy number and location of specific sequences. It is used to look for large sequence changes such as deletions, duplications, amplifications, or translocations.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Mice bearing mutant genes which are phenotypically expressed in the animals.
Genes that influence the PHENOTYPE both in the homozygous and the heterozygous state.
Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.
Members of the alpha-globin family. In humans, they are encoded in a gene cluster on CHROMOSOME 16. They include zeta-globin and alpha-globin. There are also pseudogenes of zeta (theta-zeta) and alpha (theta-alpha) in the cluster. Adult HEMOGLOBIN is comprised of 2 alpha-globin chains and 2 beta-globin chains.
The loss of one allele at a specific locus, caused by a deletion mutation; or loss of a chromosome from a chromosome pair, resulting in abnormal HEMIZYGOSITY. It is detected when heterozygous markers for a locus appear monomorphic because one of the ALLELES was deleted.
Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
Detection of a MUTATION; GENOTYPE; KARYOTYPE; or specific ALLELES associated with genetic traits, heritable diseases, or predisposition to a disease, or that may lead to the disease in descendants. It includes prenatal genetic testing.
The female sex chromosome, being the differential sex chromosome carried by half the male gametes and all female gametes in human and other male-heterogametic species.
Methods and techniques used to genetically modify cells' biosynthetic product output and develop conditions for growing the cells as BIOREACTORS.
Complex sets of enzymatic reactions connected to each other via their product and substrate metabolites.
Nonrandom association of linked genes. This is the tendency of the alleles of two separate but already linked loci to be found together more frequently than would be expected by chance alone.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Differential and non-random reproduction of different genotypes, operating to alter the gene frequencies within a population.
Removal, via CELL DEATH, of immature lymphocytes that interact with antigens during maturation. For T-lymphocytes this occurs in the thymus and ensures that mature T-lymphocytes are self tolerant. B-lymphocytes may also undergo clonal deletion.
Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Individuals whose ancestral origins are in the southeastern and eastern areas of the Asian continent.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
A specific pair of GROUP G CHROMOSOMES of the human chromosome classification.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Abnormal number or structure of chromosomes. Chromosome aberrations may result in CHROMOSOME DISORDERS.
Chromosomal, biochemical, intracellular, and other methods used in the study of genetics.
The relationships of groups of organisms as reflected by their genetic makeup.
DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.
Mapping of the KARYOTYPE of a cell.
Deoxyribonucleic acid that makes up the genetic material of fungi.
A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)
An inhibitor of apoptosis protein that was initially identified during analysis of CHROMOSOME DELETIONS associated with SPINAL MUSCULAR ATROPHY. Naip contains a nucleotide binding oligomerization domain and a carboxy-terminal LEUCINE rich repeat.
A product of the p16 tumor suppressor gene (GENES, P16). It is also called INK4 or INK4A because it is the prototype member of the INK4 CYCLIN-DEPENDENT KINASE INHIBITORS. This protein is produced from the alpha mRNA transcript of the p16 gene. The other gene product, produced from the alternatively spliced beta transcript, is TUMOR SUPPRESSOR PROTEIN P14ARF. Both p16 gene products have tumor suppressor functions.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Genes that inhibit expression of the tumorigenic phenotype. They are normally involved in holding cellular growth in check. When tumor suppressor genes are inactivated or lost, a barrier to normal proliferation is removed and unregulated growth is possible.
A subdiscipline of genetics which deals with the genetic mechanisms and processes of microorganisms.
A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.
The occurrence in an individual of two or more cell populations of different chromosomal constitutions, derived from a single ZYGOTE, as opposed to CHIMERISM in which the different cell populations are derived from more than one zygote.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
A discipline concerned with studying biological phenomena in terms of the chemical and physical interactions of molecules.
A group of hereditary hemolytic anemias in which there is decreased synthesis of one or more hemoglobin polypeptide chains. There are several genetic types with clinical pictures ranging from barely detectable hematologic abnormality to severe and fatal anemia.
Congenital absence of or defects in structures of the eye; may also be hereditary.
A disorder characterized by reduced synthesis of the alpha chains of hemoglobin. The severity of this condition can vary from mild anemia to death, depending on the number of genes deleted.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
The entity of a developing mammal (MAMMALS), generally from the cleavage of a ZYGOTE to the end of embryonic differentiation of basic structures. For the human embryo, this represents the first two months of intrauterine development preceding the stages of the FETUS.
DNA present in neoplastic tissue.
Proteins found in any species of virus.
A form of gene interaction whereby the expression of one gene interferes with or masks the expression of a different gene or genes. Genes whose expression interferes with or masks the effects of other genes are said to be epistatic to the effected genes. Genes whose expression is affected (blocked or masked) are hypostatic to the interfering genes.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
A subtype of HLA-DRB beta chains that includes over one hundred allele variants. The HLA-DRB1 subtype is associated with several of the HLA-DR SEROLOGICAL SUBTYPES.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
Clinical conditions caused by an abnormal chromosome constitution in which there is extra or missing chromosome material (either a whole chromosome or a chromosome segment). (from Thompson et al., Genetics in Medicine, 5th ed, p429)
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
A species of halophilic archaea found in the Dead Sea.
An abnormal hemoglobin composed of four beta chains. It is caused by the reduced synthesis of the alpha chain. This abnormality results in ALPHA-THALASSEMIA.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
An INK4 cyclin-dependent kinase inhibitor containing four ANKYRIN-LIKE REPEATS. INK4B is often inactivated by deletions, mutations, or hypermethylation in HEMATOLOGIC NEOPLASMS.
Elements of limited time intervals, contributing to particular results or situations.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.
A specific pair of human chromosomes in group A (CHROMOSOMES, HUMAN, 1-3) of the human chromosome classification.
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
Enzyme systems containing a single subunit and requiring only magnesium for endonucleolytic activity. The corresponding modification methylases are separate enzymes. The systems recognize specific short DNA sequences and cleave either within, or at a short specific distance from, the recognition sequence to give specific double-stranded fragments with terminal 5'-phosphates. Enzymes from different microorganisms with the same specificity are called isoschizomers. EC 3.1.21.4.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
The analysis of a sequence such as a region of a chromosome, a haplotype, a gene, or an allele for its involvement in controlling the phenotype of a specific trait, metabolic pathway, or disease.
The discipline studying genetic composition of populations and effects of factors such as GENETIC SELECTION, population size, MUTATION, migration, and GENETIC DRIFT on the frequencies of various GENOTYPES and PHENOTYPES using a variety of GENETIC TECHNIQUES.
The functional hereditary units of VIRUSES.
Stretches of genomic DNA that exist in different multiples between individuals. Many copy number variations have been associated with susceptibility or resistance to disease.
The sequential location of genes on a chromosome.
Mutation process that restores the wild-type PHENOTYPE in an organism possessing a mutationally altered GENOTYPE. The second "suppressor" mutation may be on a different gene, on the same gene but located at a distance from the site of the primary mutation, or in extrachromosomal genes (EXTRACHROMOSOMAL INHERITANCE).
Proteins prepared by recombinant DNA technology.
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.
Proteins that are normally involved in holding cellular growth in check. Deficiencies or abnormalities in these proteins may lead to unregulated cell growth and tumor development.
A disorder caused by hemizygous microdeletion of about 28 genes on chromosome 7q11.23, including the ELASTIN gene. Clinical manifestations include SUPRAVALVULAR AORTIC STENOSIS; MENTAL RETARDATION; elfin facies; impaired visuospatial constructive abilities; and transient HYPERCALCEMIA in infancy. The condition affects both sexes, with onset at birth or in early infancy.
Genes that influence the PHENOTYPE only in the homozygous state.
Proteins obtained from ESCHERICHIA COLI.
Condition with a variable constellation of phenotypes due to deletion polymorphisms at chromosome location 22q11. It encompasses several syndromes with overlapping abnormalities including the DIGEORGE SYNDROME, VELOCARDIOFACIAL SYNDROME, and CONOTRUNCAL AMOMALY FACE SYNDROME. In addition, variable developmental problems and schizoid features are also associated with this syndrome. (From BMC Med Genet. 2009 Feb 25;10:16) Not all deletions at 22q11 result in the 22q11deletion syndrome.
The genetic complement of a BACTERIA as represented in its DNA.
An X-linked recessive muscle disease caused by an inability to synthesize DYSTROPHIN, which is involved with maintaining the integrity of the sarcolemma. Muscle fibers undergo a process that features degeneration and regeneration. Clinical manifestations include proximal weakness in the first few years of life, pseudohypertrophy, cardiomyopathy (see MYOCARDIAL DISEASES), and an increased incidence of impaired mentation. Becker muscular dystrophy is a closely related condition featuring a later onset of disease (usually adolescence) and a slowly progressive course. (Adams et al., Principles of Neurology, 6th ed, p1415)
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.
Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.
A mutation named with the blend of insertion and deletion. It refers to a length difference between two ALLELES where it is unknowable if the difference was originally caused by a SEQUENCE INSERTION or by a SEQUENCE DELETION. If the number of nucleotides in the insertion/deletion is not divisible by three, and it occurs in a protein coding region, it is also a FRAMESHIFT MUTATION.
Sets of enzymatic reactions occurring in organisms and that form biochemicals by making new covalent bonds.
Genes that are introduced into an organism using GENE TRANSFER TECHNIQUES.
Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.
Any detectable and heritable alteration in the lineage of germ cells. Mutations in these cells (i.e., "generative" cells ancestral to the gametes) are transmitted to progeny while those in somatic cells are not.
DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.
Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.
A group of inherited disorders of the ADRENAL GLANDS, caused by enzyme defects in the synthesis of cortisol (HYDROCORTISONE) and/or ALDOSTERONE leading to accumulation of precursors for ANDROGENS. Depending on the hormone imbalance, congenital adrenal hyperplasia can be classified as salt-wasting, hypertensive, virilizing, or feminizing. Defects in STEROID 21-HYDROXYLASE; STEROID 11-BETA-HYDROXYLASE; STEROID 17-ALPHA-HYDROXYLASE; 3-beta-hydroxysteroid dehydrogenase (3-HYDROXYSTEROID DEHYDROGENASES); TESTOSTERONE 5-ALPHA-REDUCTASE; or steroidogenic acute regulatory protein; among others, underlie these disorders.
Congenital syndrome characterized by a wide spectrum of characteristics including the absence of the THYMUS and PARATHYROID GLANDS resulting in T-cell immunodeficiency, HYPOCALCEMIA, defects in the outflow tract of the heart, and craniofacial anomalies.
Reproductive bodies produced by fungi.
Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.
Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.
It is a deletion/insertion polymorphism (DIP). The 9-repeat and the 10-repeat are the most common alleles. "Rs28363170 RefSNP ... In genetics, rs28363170 (DAT1-VNTR) is a genetic variation at SLC6A3, the gene that encodes the dopamine transporter. It is ... A. Sano; K. Kondoh; Y. Kakimoto (May 1993). "A 40-nucleotide repeat polymorphism in the human dopamine transporter gene". Human ...
... is a 27 base-pair deletion of the Anti-Mullerian Type 2 Receptor gene. The 27-base-pair deletion that occurs PMDS is in exon 10 ... on one allele. PMDS is inherited in an autosomal recessive manner. The male individuals inherit mutated copies of the X ... Mutation in AMH gene (PMDS Type 1) or AMHR2 gene (PMDS Type 2) are the primary causes of PMDS. AMH, or sometimes referred to as ... "A 27 base-pair deletion of the anti-müllerian type II receptor gene is the most common cause of the persistent müllerian duct ...
Sequencing of the agouti signalling peptide in the agouti gene coding region revealed a 2-base pair deletion in black domestic ... Ten unrelated melanistic jaguars were either homozygous or heterozygous for this allele. A 24-base pair deletion causes the ... These data suggest the near fixation of the dark allele in the region. The expected time to fixation of this recessive allele ... Melanistic animals were found to carry at least one copy of a mutant MC1R sequence allele, bearing a 15-base pair inframe ...
... beta-thalassemia alleles can be created by many different mutations including both deletion and non-deletion forms. Patient may ... A sickle allele is always the same mutation of the beta-globin gene (glutamic acid to valine at amino acid six). In contrast, ... CS1 maint: discouraged parameter (link) Ashley-Koch, A; Yang, Q; Olney, R. S. (2000). "Sickle hemoglobin (HbS) allele and ... CS1 maint: discouraged parameter (link) Ashley-Koch, A; Yang, Q; Olney, R. S. (2000). "Sickle hemoglobin (HbS) allele and ...
There are two wild-type alleles of this gene-a high-expressivity allele and a low-expressivity allele. When the mutant gene is ... of 28 genes led by the deletion of ~1.6 Mb. These dosage-sensitive genes are vital for human language and constructive ... allele over variant alleles, where the phenotypic identity of genotypes heterozygous and homozygous for the allele defines it ... A haploinsufficient gene is described as needing both alleles to be functional in order to express the wild type. One can not ...
Key: In the following sections, alleles are referred to as +=wildtype, m=mutant, Df=gene deletion, Dp=gene duplication. ... Hypermorphic alleles are gain of function alleles. A hypermorph can result from an increase in gene dose (a gene duplication), ... The phenotype of a hypomorph is more severe in trans to a deletion allele than when homozygous. m/DF > m/m Hypomorphs are ... Muller's classification of mutant alleles Muller, H. J. 1932. Further studies on the nature and causes of gene mutations. ...
Insertion/deletion is an intronic polymorphism of LRPAP gene, Influencing DD genotype and D allele for the synthesis of LRPAP ... Also insertion allele being larger than deletion allele makes possible in detecting difference by gel electrophoresis. ... The studies suggested that DD genotype and *D allele of LRPAP gene showed increased frequency for degenerative dementias on ... Pandey P, Pradhan S, Mittal B (2008). "LRP-associated protein gene (LRPAP1) and susceptibility to degenerative dementia". Genes ...
In addition, a homozygous deletion of both OCA2 and HERC2 genes was recently reported as presenting with severe developmental ... The ancestral allele is linked to darker pigmentation and dominant over the lighter pigment recessive allele. The rs12913832 ... HERC2, previously referred to as the rjs gene locus, was first identified in 1990 as the gene responsible for two phenotypes in ... The full HERC2 gene is located at 15q13, encoded by 93 exons and its transcription is under the control of a CpG rich promoter ...
Humans with a deletion in one allele of the GAP43 gene fail to form telencephalic commissures and are intellectually disabled. ... "Entrez Gene: GAP43 growth associated protein 43". Benowitz LI, Routtenberg A (Feb 1997). "GAP-43: an intrinsic determinant of ... Genuardi M, Calvieri F, Tozzi C, Coslovi R, Neri G (Oct 1994). "A new case of interstitial deletion of chromosome 3q, del(3q)( ... Nielander HB, De Groen PC, Eggen BJ, Schrama LH, Gispen WH, Schotman P (Sep 1993). "Structure of the human gene for the neural ...
"Characterization of a deletion allele of a sorghum Myb gene yellow seed1 showing loss of 3-deoxyflavonoids". Plant Science. 169 ... The p1 gene encodes an Myb-homologous transcriptional activator of genes required for biosynthesis of red phlobaphene pigments ... gene which encodes an R2R3 myb-like transcriptional activator of the A1 gene encoding for the dihydroflavonol 4-reductase ( ... homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene ...
Susceptibility to P. rettgeri is strongly tied to an allele of the antimicrobial peptide gene Diptericin. The fly's defence ... Meanwhile deletion of multiple other antimicrobial peptides has no effect on P. rettgeri virulence. Yet defence against the ... against P. rettgeri seems to rely almost exclusively on Diptericin, as deletion of Diptericin leads to complete mortality. ...
It is caused by a deletion or mutation of the maternal allele for the ubiquitin protein ligase E3A. UBE3A is expressed in most ... However, in neurons only the maternal copy of the gene is expressed. UBE3A is located on chromosome 15 and the paternal copy ... Treatment involves unsilencing the paternal allele allowing the normal paternal UBE3A allele to be transcribed. UBE3A, in ... The maternal copy control center of the gene is methylated, suppressing transcription in the antisense direction while the ...
This locus consists of 8-10 protein-coding genes, specifically expressed from the maternal allele (including the KCNQ1 gene), ... The deletion of KCNQ1OT1 in males can result in a removal of the repressor in six cis genes. Offspring from the males that had ... KCNQ1OT1 is a paternally expressed allele and KCNQ1 is a maternally expressed allele. KCNQ1OT1 is a nuclear, 91 kb transcript, ... and the paternally expressed non-coding RNA gene KCNQ1OT1. KCNQ1OT1 and KCNQ1 are imprinted genes and are part of an imprinting ...
... deletion in both alleles. Researchers have since reported more efficient Cre-Lox conditional gene mutagenesis in the developing ... "Deletion of a DNA polymerase beta gene segment in T cells using cell type-specific gene targeting". Science. 265 (5168): 103-6 ... Placing Lox sequences appropriately allows genes to be activated, repressed, or exchanged for other genes. At a DNA level many ... "T-cell-specific deletion of a polypeptide N-acetylgalactosaminyl-transferase gene by site-directed recombination". Proceedings ...
"Genetic Restriction of HIV-1 Infection and Progression to AIDS by a Deletion Allele of the CKR5 Structural Gene". Science. 273 ... describing over 30 AIDS restriction genes and also applying these gene discovery strategies to chronic infectious human ... In 1982, O'Brien's team at the NIH published a comprehensive gene map of domestic cat as cover article in Science and compared ... In 1996 O'Brien's team described he first human gene to influence HIV-1 infection and AIDS progression, CCR5-Δ32, using ...
Sep 1996). "Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene. ... CCR5-Δ32 (or CCR5-D32 or CCR5 delta 32) is an allele of CCR5. CCR5 Δ32 is a 32-base-pair deletion that introduces a premature ... Lucotte G (2001). "Distribution of the CCR5 gene 32-basepair deletion in West Europe. A hypothesis about the possible ... A study measuring allele frequencies in 18 European populations found a North-to-South gradient, with the highest allele ...
Altered alleles often occur among children with reading and writing difficulties. The gene appears to have a strong linkage ... But this is controverse since a recent study proposed that there is a "low likelihood of a direct deletion effect on reading ... Doublecortin domain-containing protein 2 is a protein that in humans is encoded by the DCDC2 gene. This gene encodes a protein ... "Entrez Gene: DCDC2 doublecortin domain containing 2". Lind PA, Luciano M, Wright MJ, Montgomery GW, Martin NG, Bates TC (June ...
Melanism in the jaguar is caused by deletions in the melanocortin 1 receptor gene and inherited through a dominant allele. In ... Yu, L. & Zhang, Y. P. (2005). "Phylogenetic studies of pantherine cats (Felidae) based on multiple genes, with novel ... Genes & Genetic Systems. 81 (2): 115-127. doi:10.1266/ggs.81.115. PMID 16755135. Kitchener, A. C.; Breitenmoser-Würsten, C.; ... but no evidence for subspecific differentiation.DNA analysis of 84 jaguar samples from South America revealed that the gene ...
... a common null allele of the ILT6 gene results from a 6.7-kbp deletion". European Journal of Immunology. 30 (12): 3655-62. doi: ... "Entrez Gene: LILRA3 leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3". Jones DC, Kosmoliaptsis ... The function of LILRA3 is currently unknown; however, it is highly homologous to other LILR genes, and can bind human leukocyte ... Torkar M, Haude A, Milne S, Beck S, Trowsdale J, Wilson MJ (December 2000). "Arrangement of the ILT gene cluster: ...
Melanism in the jaguar is caused by deletions in the melanocortin 1 receptor gene and conferred by a dominant allele. There is ... Melanism is caused by a recessive allele in the leopard, and by a dominant allele in the jaguar. In 1788, Jean-Claude ... Melanism in the leopard is conferred by a recessive allele. It is thought that melanism confers a selective advantage under ...
Boddu J, Svabek C, Ibraheem F, Jones AD, Chopra S (2005). "Characterization of a deletion allele of a sorghum Myb gene yellow ... while another gene (Suppressor of Pericarp Pigmentation 1 or SPP1) acts as a suppressor.[14] The maize P gene encodes a Myb ... "Entrez Gene: v-myb myeloblastosis viral oncogene homolog (avian)".. *^ Vargova K, Curik N, Burda P, Basova P, Kulvait V, ... Myb proto-oncogene protein also known as transcriptional activator Myb is a protein that in humans is encoded by the MYB gene.[ ...
LOH occurs when one allele of a gene is mutated in a deleterious way and the normally-functioning allele is lost. LOH occurs ... Other chip-based methods such as comparative genomic hybridization can detect genomic gains or deletions leading to LOH. SNP ... If the mother's allele is missing and the child has two copies of the father's mutant allele, disease can occur. ... If a person has one mutated and dysfunctional copy of a tumor suppressor gene and his second, functional copy of the gene gets ...
The rest of the mutated alleles come from nonsense, missense, splice-site mutations, and other possible insertion and deletion ... Individuals with mutated SFTPC genes tend to manifest lung diseases in late childhood or adulthood. Mutated alleles are ... together with small insertions or deletions along the carboxyl terminal of SFTPC. Mutations in SFTPC gene are thought to ... these proteins are encoded by SFTPB and SFTPC genes on chromosomes 2 and 8 respectively. Thus, mutations on these genes produce ...
The most common cause of Hb Bart's is the inheritance of a deletion allele in that lacks functional α-globin genes from both ... and splicing of the hemoglobin β gene and gene product. Individuals with one gene mutation (heterozygocity) are considered to ... The genes that encode for the alpha chains are located on chromosome 16, while the genes that encode for non-alpha chains are ... Single α-globin gene carriers usually have no profound fatigue or anemia because they have a compensating increase in the ...
The mouse homolog to the Jrk mutant is the ClockΔ19 mutant that possesses a deletion in exon 19 of the Clock gene. This ... Clock mutant organisms can either possess a null mutation or an antimorphic allele at the Clock locus that codes for an ... BMAL1 Period gene Suprachiasmatic nucleus Timeless gene Pdf Cycle gene GRCh38: Ensembl release 89: ENSG00000134852 - Ensembl, ... Nascent research in the expression of circadian genes in adipose tissue suggests that suppression of the CLOCK gene may ...
... the deletion of a 32-bp segment results in a nonfunctional receptor, thus preventing HIV entry; two copies of this gene provide ... This allele is found in around 10% of Europeans but is rare in Africans and Asians. Multiple studies of HIV-infected persons ... "Gene Variation May Raise Risk of H.I.V., Study Finds" from The New York Times, 2008. ... They first reviewed the role of genes in encoding chemokine receptors (CCR5 and CCR2) and chemokines (SDF-1). While CCR5 has ...
The resistance gene RYMV1 was identified as an eIF(iso)4G gene. Four rymv1 resistance alleles have been characterized, one in O ... Resistance of rymv1-3 is caused by a deletion of codons 322-324 in the same domain of eIF(iso)4G. Resistant and tolerant ...
... increasing the dosage of the genes located within them. Deletions of large chromosomal regions, leading to loss of the genes ... are characterized by altered gene products that acts with decreased gene expression compared to the wild type allele. Usually, ... Mutations in genes can have no effect, alter the product of a gene, or prevent the gene from functioning properly or completely ... Most genes belong to larger gene families of shared ancestry, detectable by their sequence homology. Novel genes are produced ...
Variant alleles involved deletions (one or two) or additions (one, two, or three) of Sp1 motifs to the five tandem motifs ... The gene promoter region of ALOX5 contains 8 GC boxes but lacks TATA boxes or CAT boxes and thus resembles the gene promoters ... Alox5 gene knockout mice exhibit an increase in the lung tumor volume and liver metastasis of Lewis lung carcinoma cells that ... The ALOX5 gene, which occupies 71.9 kilobase pairs (kb) on chromosome 10 (all other human lipoxygenases are clustered together ...
"Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene". Science. 273 ... Stem cell based gene therapy[edit]. In the past 7 years, scientists have been using different approaches of stem cell based ... Lunzen, J.; Fehse, B.; Hauber, J. (2011). "Gene Therapy Strategies: Can We Eradicate HIV?". Current HIV/AIDS Reports. 8 (2): 78 ... As of April 2013, two primary approaches are being pursued in the search for a HIV cure: The first is gene therapy that aims to ...
Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men. The Suita Study ... Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men ... Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men ... Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men ...
2017) Micropublication: biology "Novel deletion alleles of a C. elegans gene Y48E1C.1, named as tm5468, tm5625 and ...." ... 2017) Micropublication: biology "Novel deletion alleles of a C. elegans gene Y48E1C.1, named as tm5468, tm5625 and ...." ... 2017) Micropublication: biology "Novel deletion alleles of a C. elegans gene Y48E1C.1, named as tm5468, tm5625 and ...." ... Start here to access encyclopedic information about the worm genome and its genes, proteins, and other encoded features… Find ...
... and eyes is common in PWS and was suggested previously to be associated with the 15q11-q13 deletion. The P gene, located in ... usually results from a paternal deletion of 15q11-q13 or maternal disomy for chromosome 15. Reduced pigmentation of skin, hair ... Thus, our results indicate that hypopigmentation is likely the result of deletion of the P gene in the context of PWS but do ... and eyes is common in PWS and was suggested previously to be associated with the 15q11-q13 deletion. The P gene, located in ...
Genetic Restriction of HIV-1 Infection and Progression to AIDS by a Deletion Allele of the CKR5 Structural Gene ... Genetic Restriction of HIV-1 Infection and Progression to AIDS by a Deletion Allele of the CKR5 Structural Gene ... Genetic Restriction of HIV-1 Infection and Progression to AIDS by a Deletion Allele of the CKR5 Structural Gene ... Genetic Restriction of HIV-1 Infection and Progression to AIDS by a Deletion Allele of the CKR5 Structural Gene ...
Deletion of one allele of the Pex11β gene slightly increased the abundance of peroxisomes, whereas the deletion of both alleles ... In Pex11β-deficient mice, we observed that the deletion of a single allele of the Pex11β gene (Pex11β+/− heterozygous mice) ... Deletion of a single allele of the Pex11β gene is sufficient to cause oxidative stress, delayed differentiation and neuronal ... Deletion of a single allele of the Pex11β gene is sufficient to cause oxidative stress, delayed differentiation and neuronal ...
Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand. Barry R. Palmer, ... Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand ... Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand ... Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand ...
Genes Chromosomes Cancer. 1994 May;10(1):1-6. Research Support, Non-U.S. Govt; Research Support, U.S. Govt, P.H.S. ... Genes Chromosomes Cancer. 1994 May;10(1):1-6.. Deletion mapping reveals two regions of chromosome 8 allele loss in colorectal ... Although at least four different genes have been implicated in the process, the detection of allele loss from other regions of ... To define the region of common deletion containing the putative tumor suppressor gene, we analyzed a series of 87 carcinomas ...
30-kb deletion forming monomodular alleles that carry chimeric CYP21A1P/A2 genes corresponds to ~9% of disease-causing alleles ... large gene conversions or mutations in CYP21A2 gene. The human gene is located at 6p21.3 within a locus containing the genes ... Twenty patients carrying at least one allele with C4/CYP21 30-kb deletion were included in the study. An allele carrying a ... Alleles were first selected after Southern blotting. The composition of CYP21A1P/A2 chimeric genes was investigated by ASO-PCR ...
mutations affects gene structure: Why are truncated. proteins made in each case? b. How would you classify the mutant alleles? ... The different mutations like G to A transition, base deletion, and C to G transversion in the different exons of the SCN9A gene ... gene called SCN9A cause complete insensitivity to. pain (congenital pain insensitivity or CPA) and a total. lack of the sense ... The SCN9A gene encodes for a sodium ion channel that is dependent on voltage. It is composed of 26 exons and its exact ...
We analysed the distribution of genotypes and allele frequencies of the insertion/deletion (I/D) polymorphism in the ACE gene ... Carrier-state of D allele in ACE gene insertion/deletion polymorphism is associated with coronary artery disease, in contrast ... Angiotensin converting enzyme gene deletion allele is independently and strongly associated with coronary atherosclerosis and ... angiotensin converting enzyme gene (ACE) coronary artery disease methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms ...
Higher prevalence of deletion allele in angiotensin converting enzyme gene among type 2 diabetic subjects with lower estimated ... The aim of the study was to determine the angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism in ... The ID and DD genotype of ACE gene confers a greater role in genetic variations underlying high risk stage of CKD especially in ...
We report tm6429 and tm6475 as novel deletion alleles of the gene Y73E7A.1 that is a homologue of mammalian Coiled-coil domain ... The alleles were isolated from the comprehensive screening of gene deletions generated by TMP/UV3. In the screening, both the ... Suehiro, Y; Yoshina, S; Hori, S; Mitani, S (2017). Novel deletion alleles of a C. elegans gene Y73E7A.1, named as tm6429 and ... 355 bp deletion + 1 bp insertion (T)] - TTAAAAATGAGAAAAAATGGGGAAAAAATT and CAAACGCGCTCTATGGAGAATGTGGAATTA- [242 bp deletion] - ...
Insertion of gene trap vector. Intergenic deletion. Intragenic deletion. Inversion. Not Applicable. Not Specified. Nucleotide ... Allele Attributes Conditional ready. Recombinase. RMCE-ready. Inserted expressed sequence. Humanized sequence. Reporter. ... Deletion. Disruption caused by insertion of vector. Duplication. Insertion. ... Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse ...
1 Center for Transgene Technology and Gene Therapy, Flanders Interuniversity Institute for Biotechnology, Leuven, Belgium. ... Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele Nature. 1996 Apr 4;380(6573):435-9. doi ... is unprecedented for a targeted autosomal gene inactivation, and is indicative of a tight dose-dependent regulation of ... Gene Deletion * Heterozygote * Homozygote * Lymphokines / deficiency * Lymphokines / genetics* * Lymphokines / physiology* * ...
Cloning of DNF7 (NCR169) and detection of the deletion in dnf7 alleles. (A) Map position of the dnf7-2 mutant locus in LG 7. (B ... 26). Analysis of the expression profile of the two genes in the M. truncatula Gene Expression Atlas (27) revealed that the gene ... The Gene Medtr7g029760 Is Deleted in Multiple dnf7 Alleles.. Genetic mapping identified the position of the dnf7-2 locus on the ... There are eight annotated genes in the common deletion region (arrowheads indicate gene orientations). Horizontal arrows ...
Uniparental inheritance of microsatellite alleles of the cystic fibrosis gene (CFTR): Identification of a 50 kilobase deletion ... Uniparental inheritance of microsatellite alleles of the cystic fibrosis gene (CFTR) : Identification of a 50 kilobase deletion ... Uniparental inheritance of microsatellite alleles of the cystic fibrosis gene (CFTR): Identification of a 50 kilobase deletion ... Uniparental inheritance of microsatellite alleles of the cystic fibrosis gene (CFTR) : Identification of a 50 kilobase deletion ...
Loss of wtL9 Allele by 6132A-PRO Cells Is due to its Deletion from Chromosome 5.. The absence of the wtL9 allele in the 6132A- ... Mutation of one allele of a regulatory gene, followed by inactivation of the second allele by loss (as we observe with L9) or ... but also that neither tumor retains a normal allele. In 6139B-PRO, we find that both alleles of the L26 gene are mutant; each ... only two different mL26 alleles and no wtL26 alleles were detected (Table 1). This indicated that no wtL26 gene remained in the ...
1. Deletion of the 4.3 kb SCE from the Oct-6 locus. (A) Gene targeting scheme for the Oct-6 SCE. The SCE is indicated with a ... 4. The ΔSCE allele is a hypomorphic allele of Oct-6. (A) Comparison of sciatic nerve morphology in Oct-6ΔSCE/ΔSCE (a) and Oct-6 ... 5. Oct-6 expression is lost in Schwann cells of mice homozygous for the ΔSCE allele. (A) Homozygous deletion of the SCE results ... In this study we have generated a Schwann cell-specific Oct-6 allele through deletion of the Schwann cell-specific enhancer ...
deletion/duplication defect. alleles. different forms that genes can take at a certain locus on the chromosome. ... outward appearance of individual r/t gene and environment. heterozygote. loci affect of one allele may mask another when they ... x-linked recessive gene; p. 154 ). cystic fibrosis. autosomal recessive gene (homozygous, aa, to be expressed, long arm of ... gene cell therapy. not presently happening, but is the process of inserting genes into embryo-alter future descentants as well ...
Deletion allele of the angiotensin-converting enzyme gene as a risk factor for pneumonia in elderly patients.. Morimoto S1, ... Because the insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene (ACE) has been associated ... The ACE DD allele (vs. ID + II) was associated with an increased risk of pneumonia (relative risk [RR] = 2.9; 95% confidence ... The ACE D allele is an independent risk factor for pneumonia in elderly persons. ...
Generating loss-of-function alleles by targeted intragenic deletion. 4. Redundancy of essential genes. 5. Pleiotropic essential ... An essential gene is defined here as a gene necessary for growth to a fertile adult. Some essential genes were identified ... null alleles generated by targeted deletions will be inadequate for full understanding of essential gene functions. ... deletions in targeted genes. The worms carrying the deletions are enriched and eventually isolated by sibling selection schemes ...
progression to AIDS by a deletion. allele of the CKR5 structural gene.. ... The isolation and characterization of multiple alleles for thousands of other disease-associated genes is on the way. This ... of the many molecular mechanisms of diseases caused by novel alleles, while not losing sight of other causes, in particular ... new knowledge about disease-associated human alleles. ... Lee, C-K, et al, 1999. Gene. expression profile of aging and ...
Deletion alleles of bocks were generated by imprecise deletion of a P element inserted at +11 in the bocksCB03586 allele ( ... A) Structure of the bocks locus, including a portion of the uncharacterized CG8312 gene and the overlapping P581PK gene. The ... and adults homozygous for one of the two bocks deletion alleles. The Western blot was probed with antibodies against Bocks and ... A) Three genes encode nuclear lamina-enriched LEM-D proteins, otefin (ote), dMAN1, and bocksbeutel (bocks). All of the encoded ...
These cases still have one allele of the p16 gene present and it is unclear what the status of the remaining allele is in these ... of the deletions), seven with hemizygous deletions (p16+/-), i.e. one allele detectable (10·4% of the deletions), and 14 with ... Detection of p16 gene deletions. FISH for the presence of the p15/p16 gene was performed on 122 diagnostic samples from T-ALL ... had hemizygous deletions, i.e. one allele detectable, and 14% presented a mixture of populations with 0-2 alleles. The ...
D) Deletion of B alleles (see discussion section); (X) normal crossing over; (C) gene conversion. LOD against independent ... represents the putative deletion of the B allele, rather than its replacement by the C3 allele (see text). Assortants showing ... B-allele-determined band absent; for 1EO3R, (B) C3-allele-determined band absent, (C) C3-allele-determined band present. Key to ... Conversely, all but one of 23 assortants having the 0.9 Mb ARP form carried the C3 allele at the 1JO9 and 1EO3R loci. (The sole ...
Construction of the tatC-Null Allele.. An internal sequence of the tatA gene from Prov. stuartii was amplified by PCR with the ... A Rhomboid Protease Gene Deletion Affects a Novel Oligosaccharide N-Linked to the S-layer Glycoprotein of Haloferax volcanii ... mirabilis tatA gene, the native tatA gene from Prov. stuartii did not rescue the phenotypes of an aarA mutant. In this study, ... In a search for Proteus mirabilis genes that can complement the loss of aarA in Prov. stuartii, the tatA gene in multicopy was ...
Detection of the poor metabolizer-associated CYP2D6(D) gene deletion allele by long-PCR technology. Steen, Vidar M.; Andreassen ... Lung cancer and mutations at the polymorphic NAT2 gene locus. Martínez, Carmen; Agúndez, José A. G.; Olivera, Manuela; More ... Cloning, sequencing and expression of NAT1 and NAT2 encoding genes from rapid and slow acetylator inbred rats. Doll, Mark A.; ...
ResultsWhile IL28B T-allele variant was found a good marker associated with HCV-outcome together with TLR2 del variant, the PD- ... Among the immune genes studied, only the IL28B and TLR2 variants remain significant markers associated with HCV-related ... Among the immune genes studied, only the IL28B and TLR2 variants remain significant markers associated with H... ... Results While IL28B T-allele variant was found a good marker associated with HCV-outcome together with TLR2 del variant, the PD ...
LOH). The loss of one allele at a heterozygous locus. This loss can occur by mutation, deletion or gene conversion, using the ... Gene duplication and the evolution of ribosomal protein gene regulation in yeast. Proc. Natl Acad. Sci. USA 107, 5505-5510 ( ... Interaction between alleles of genes leading to a lower (negative epitasis) or increased (positive epistasis) phenotypic value ... Johnston, M. A model fungal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbiol. Rev. 51, 458-476 ( ...
  • Congenital adrenal hyperplasia due to 21-hydroxylase deficiency is caused by deletions, large gene conversions or mutations in CYP21A2 gene. (biomedcentral.com)
  • Homozygosity for extremely rare mutations in a human gene called SCN9A cause complete insensitivity to pain (congenital pain insensitivity or CPA) and a total lack of the sense of smell (anosmia). (bartleby.com)
  • Hypothesize as to how each of the three SCN9A mutations affects gene structure: Why are truncated proteins made in each case? (bartleby.com)
  • The different mutations like G to A transition, base deletion, and C to G transversion in the different exons of the SCN9A gene produce truncated proteins. (bartleby.com)
  • More than 250 mutations have been detected in the cystic fibrosis (CF) transmembrane regulator (CFTR) gene, most of which are single point mutations or small deletions or insertions of a few nucleotides. (elsevier.com)
  • Temperature sensitive mutations are valuable tools for studies of essential genes, but our ability to analyze essential genes would benefit from development of new tools for conditional inactivation or activation of specific genes. (wormbook.org)
  • Some essential genes were identified fortuitously, but most essential genes have been identified through mutant screens designed specifically to isolate lethal and sterile mutations. (wormbook.org)
  • Based on the frequency of X chromosome lethal mutations, Brenner estimated that the C. elegans genome had about 2000 essential genes ( Brenner, 1974 ). (wormbook.org)
  • Inclusion of sterile mutations raised this estimate to about 3000, and a number of screens for lethal and sterile mutations in specific genomic regions in the 1970s and 80s yielded gene frequencies raising the upper limit of this estimate to as high as 30% of the genome or about 5700. (wormbook.org)
  • With the sequencing of the genome and the development of methods to target specific genes, it is now within our power to obtain loss-of-function mutations in every gene in the worm, and efforts are under way to do just that. (wormbook.org)
  • Such mutations define genes whose expression in the mother is required for embryonic development. (wormbook.org)
  • The antigens are ribosomal proteins altered by somatic tumor-specific point mutations, and the progressor (PRO) variants lack the corresponding normal alleles. (rupress.org)
  • In the second tumor, 6139B-PRO, both alleles of the L26 gene have point mutations, and each encodes a different tumor-specific CD4 + T cell-recognized antigen. (rupress.org)
  • Tumor antigens are encoded by genes that are either normal but aberrantly expressed or overexpressed ( 1 )( 2 ), or altered as the result of cancer-specific somatic mutations ( 3 )( 4 )( 5 ). (rupress.org)
  • Gene conversion may be a frequent cause of 21-hydroxylase deficiency alleles due to the presence of six chi-like sequences (GCTGGGG) in the CYP21 genes and the close proximity of the CYP21A pseudogene, which has several potentially deleterious mutations. (uniprot.org)
  • Divergence from the reference sequences (from genetic mutations) results in poor annealing of the primers so that the marker cannot be used, representative of a null allele. (wikipedia.org)
  • We have now determined the mutations on both alleles of a child with fulminant, neonatal onset ADA- SCID and accumulation of extremely high concentrations of deoxyATP. (jimmunol.org)
  • Genetic studies have shown that small missing pieces of chromosome (deletions, which remove many genes) and changes to the lettering of genes (which stop the gene from working, mutations) can cause intellectual disability or obesity. (plos.org)
  • Here we identified 9 children with intellectual disability and obesity who have mutations in a gene called MYT1L . (plos.org)
  • We have identified a new genetic condition caused by MYT1L mutations, further study of this gene will help us understand, and treat, intellectual disability and obesity. (plos.org)
  • Class A genes when mutated cause a Muv phenotype with class B and class C mutations. (biologists.org)
  • Deletions in the GPC3 gene have been found in a number of SGBS kindreds supplying strong evidence that such mutations are responsible for SGBS. (bmj.com)
  • These mutations alter the levels or function of the proteins encoded by growth-regulating genes, effectively altering cell division. (sigmaaldrich.com)
  • Mutations and deletions of the homeobox transcription factor gene SHOX are known to cause short stature. (bmj.com)
  • Although mutations in several genes have been reported that cause pronounced short or tall stature with a drastic effect on height (10-30 cm per "mutant" allele), this normally accounts for only a very small proportion of patients with short stature. (bmj.com)
  • However, mutations in the connexin 26 (locus designation GJB 2) gene at the DFNB1 locus, located on the long arm of chromosome 13, may account for half of all early-onset cases of hereditary non-syndromic hearing loss (NSHL). (ispub.com)
  • Germline mutations in four of these genes (hMSH2, hMLH1, hPMS1, and hPMS2) have been identified in HNPCC kindreds (2-7). (google.co.uk)
  • Important mutations in human ABO genes are categorized. (google.com)
  • Almost all patients with von Hippel-Lindau disease were found to have germ line mutations of 1 allele of the VHL tumor suppressor gene, and autosomal dominant inheritance from the affected parent was confirmed [3,4]. (urotoday.com)
  • at least 33 ACE gene mutations have been found in people with this disorder. (medlineplus.gov)
  • Renal tubular dysgenesis can be caused by mutations in both copies of any of the genes involved in the renin-angiotensin system. (medlineplus.gov)
  • The ACE gene mutations that cause this disorder prevent the production of functional angiotensin-converting enzyme, which impairs the formation of angiotensin II and results in a nonfunctional renin-angiotensin system. (medlineplus.gov)
  • ACCPN is inherited as an autosomal recessive, through mutations in the SLC12A6 gene. (snpedia.com)
  • To search for additional mutations in the THRA1 gene, all nine protein-encoding exons of THRA1 were examined for point mutations via single strand conformation analysis in a series of primary breast tumors, breast cancer cell lines, and lymphoblastoid cell lines derived from the youngest affected members of several German breast cancer families. (aacrjournals.org)
  • No point mutations were detected, including the unrearranged THRA1 allele in BT474. (aacrjournals.org)
  • A major locus for high blood pressure (BP/SP1) is located on rat chromosome 10, which contains the rat angiotensin-converting enzyme gene ( ACE ) locus, according to several rat crosses between a genetically hypertensive rat strain and normotensive controls. (ahajournals.org)
  • The Prader-Willi syndrome (PWS) usually results from a paternal deletion of 15q11-q13 or maternal disomy for chromosome 15. (nih.gov)
  • Deletion mapping reveals two regions of chromosome 8 allele loss in colorectal carcinomas. (nih.gov)
  • To define the region of common deletion containing the putative tumor suppressor gene, we analyzed a series of 87 carcinomas for allele loss in different regions of the short arm of chromosome 8 by using Southern blot analysis and a panel of polymorphic probes. (nih.gov)
  • We found allele loss in 33% of our cases, which involves two separate regions, one in the p-terminal region of the chromosome, 8p23.1-pter, where 45% of informative cases demonstrated loss, and the other in the mid-p region, at 8p21, where 31% of cases showed allele loss. (nih.gov)
  • These findings suggest the presence of two discrete genes related to colorectal carcinogenesis on the short arm of chromosome 8. (nih.gov)
  • The tumor lacks the normal L9 allele because of an interstitial deletion from chromosome 5. (rupress.org)
  • The data also strongly suggest that the random distribution of alleles in the Tetrahymena macronucleus is due to the random distribution of the MAC chromosome pieces that carry them. (genetics.org)
  • Single nucleotide polymorphism/comparative genomic hybridization (SNP/CGH) array analysis demonstrated in both siblings a homozygous duplication of chromosome 6q12 involving the ADGRB3 (MIM 602684) gene, inherited from the heterozygous parents. (nature.com)
  • The gene encoding this protein (CYP21B) and a closely linked pseudogene (CYP21A) are located in the HLA complex on chromosome 6p. (uniprot.org)
  • Deletions at chromosome 2p25.3 are associated with a syndrome consisting of intellectual disability and obesity. (plos.org)
  • Although located 11kb away from it, rs366631 is effectively a pseudo-SNP tagging the status of the GSTM1 gene, due to the nature of the duplications and deletions in this part of chromosome 1. (snpedia.com)
  • In copy-neutral LOH, one allele or whole chromosome from a parent is missing. (wikipedia.org)
  • The Angelman syndrome gene (UBE3A) is located at chromosome 15, band q12, as depicted. (angelman.org)
  • In the brain, the Angelman gene is primarily expressed from the maternally inherited chromosome 15. (angelman.org)
  • This gene, which is located at chromosome 3p25-26, has now been completely sequenced, and its role as a tumor suppressor gene for both the sporadic and the familial forms of clear cell RCC has been confirmed [3]. (urotoday.com)
  • We have previously described a common region of deletion and allele loss on chromosome 17q in sporadic breast cancers that is likely to contain a tumor suppressor gene. (aacrjournals.org)
  • Leukocyte immunoglobulin-like receptor subfamily A member 3 (LILR-A3) also known as CD85 antigen-like family member E (CD85e), immunoglobulin-like transcript 6 (ILT-6), and leukocyte immunoglobulin-like receptor 4 (LIR-4) is a protein that in humans is encoded by the LILRA3 gene located within the leukocyte receptor complex on chromosome 19q13.4. (wikipedia.org)
  • Clinical status of the 3 CF patients, of which two have the ΔF508 mutation as the other CF allele, suggests that this mutation is responsible for a severe clinical phenotype, indistinguishable from homozygous ΔF508 patients. (elsevier.com)
  • By demonstrating that deletion of a single member of the NCR gene family can result in an ineffective symbiotic phenotype, we show that specific NCR peptides can have essential, non-redundant roles in controlling bacterial differentiation and symbiotic nitrogen fixation. (pnas.org)
  • Moreover, early genetic work in Tetrahymena showed that when cells with a MAC heterozygous at a given locus undergo vegetative multiplication, subclones that irreversibly express the phenotype associated with homozygotes for either of the alternative alleles arise. (genetics.org)
  • A genetic null or amorphic allele has the same phenotype when homozygous as when heterozygous with a deficiency that disrupts the locus in question. (wikipedia.org)
  • If the manipulated allele (now heterozygous) did not present a heterozygous phenotype, the allele was suspected to be null. (wikipedia.org)
  • Such genotype-phenotype correlations may be important to consider in evaluating results of ongoing trials of "gene" and enzyme replacement therapy. (jimmunol.org)
  • We hypothesized that single nucleotide variants (SNVs) in MYT1L would cause a phenotype resembling deletion at 2p25.3. (plos.org)
  • The phenotype of SNV carriers overlapped with that of 2p25.3 deletion carriers. (plos.org)
  • The most common CYP2A6 allele, CYP2A6*1, is considered to give rise to a fast metabolizing phenotype. (snpedia.com)
  • Animals defective in genes in any two classes have a Muv phenotype, whereas animals defective in genes from a single class are not Muv. (biologists.org)
  • Angelman syndrome caused by deletion: A genotype-phenotype correlation determined by breakpoint. (angelman.org)
  • Through additional fine mapping and whole-genome sequencing, we determined that the talpid2 phenotype was linked to a 1.4 Mb region on GGA1q that contained the gene encoding the ciliary protein C2CD3. (usda.gov)
  • Finally, we identified a 19 bp deletion in talpid2 C2CD3 that produces a premature stop codon, and thus a truncated protein, as the likely causal allele for the phenotype. (usda.gov)
  • Deletion mutants were complemented to wild-type phenotype by transformation with the native allele. (usda.gov)
  • However, patient DNA samples with the functional deletion mutation from the original Japanese study 1 were positive in our assay, indicating that any positive samples in our New Zealand sample population would have been detected had they been present. (ahajournals.org)
  • Nakayama T, Soma M, Takahashi Y, Rehemudula D, Kanmatsuse K, Furuya K. Functional deletion mutation of the 5′-flanking region of type A human natriuretic peptide receptor gene and its association with essential hypertension and left ventricular hypertrophy in the Japanese. (ahajournals.org)
  • Mutation in this gene can lead to loss of sensation to pain and odor. (bartleby.com)
  • 2)frameshift mutation- insertion, deletion. (studystack.com)
  • A mutation in this household gene causes a CD8 + T cell-recognized antigen in a human melanoma ( 10 ). (rupress.org)
  • This mutation is normally present in the CYP21A pseudogene, so that it may have been transferred to the mutant CYP21B gene by gene conversion. (uniprot.org)
  • in one of these patients, the mutation was present as part of a larger gene conversion involving at least exons 3-6. (uniprot.org)
  • A null allele is a nonfunctional allele (a variant of a gene) caused by a genetic mutation. (wikipedia.org)
  • A genetic null allele may be both a protein null and an RNA null, but may also express normal levels of a gene product that is nonfunctional due to mutation. (wikipedia.org)
  • Novel deletion and a new missense mutation (Glu 217 Lys) at the catalytic site in two adenosine deaminase alleles of a patient with neonatal onset adenosine deaminase- severe combined immunodeficiency. (jimmunol.org)
  • The second allele carried a missense mutation (G649A) resulting in replacement of Glu217, an amino acid involved in the catalytic site, by Lys and predicting a major alteration in charge. (jimmunol.org)
  • This deletion caused increased and detectable interaction between the mutant DnaD and wild type DnaB in a yeast two-hybrid assay, similar to the increased interaction caused by a missense mutation in dnaB that is an extragenic suppressor of dnaD23ts. (mit.edu)
  • Is alpha thalassemia a mutation or a deletion? (brainscape.com)
  • Is beta thalassemia a mutation or a deletion? (brainscape.com)
  • Mutation or deletion of tumor suppressor genes is believed to initiate many forms of cancer. (sigmaaldrich.com)
  • In non-familial cases, inactivation of both alleles occurs via somatic mutation or deletion. (sigmaaldrich.com)
  • This is the case in Angelman syndrome, a severe neurodevelopmental disorder caused by mutation or deletion of the maternal allele of Ube3a. (wired.com)
  • Cre-mediated recombination results in a deletion allele which phenocopies our previously reported Smad2(DeltaC) null mutation. (unboundmedicine.com)
  • To generate this conditional allele, we first made a targeted mutation which introduced a floxed neo cassette into intron 10. (unboundmedicine.com)
  • The prevalence of the 35delG mutation in Connexin 26 gene-in thirty-one Egyptian families diagnosed with NSHL-was examined. (ispub.com)
  • All DNA samples were screened for the 35delG mutation using an allele-specific polymerase chain reaction (AS-PCR). (ispub.com)
  • By introducing these genes into cells and transgenic plants, new cell lines and plant varieties with novel and useful properties can be prepared more efficiently than by relying on the natural rate of mutation. (google.co.uk)
  • testing the cell to determine whether the gene of interest harbors a mutation. (google.co.uk)
  • CYP2D6*3 (2.7% frequency) causes a frameshift mutation, and CYP3D6*5 (2.6%) is an entire deletion of the CYP2D6 gene. (medscape.com)
  • In this submission, using a genomics and molecular biology, the causative gene and likely mutation for talpid 2, characterized by polydactyly, was identified. (usda.gov)
  • Protein expression analyses confirmed that the deletion led to protein misfolding and suggest this is a class II mutation, similar to P23H, the most common class II mutation seen in North America. (molvis.org)
  • Background -The Framingham Study recently revealed that the homozygous deletion polymorphism of the angiotensin-converting enzyme gene ( ACE DD ) is associated with increased risk for essential hypertension in a male-specific manner. (ahajournals.org)
  • Conclusions -Despite the lower frequency of the DD genotype in Japanese than in whites, the ACE gene polymorphism was associated with increased risk for hypertension, suggesting that this polymorphism is a mild but certain genetic risk factor for essential hypertension in men. (ahajournals.org)
  • 8 9 An insertion/deletion ( I/D ) polymorphism in intron 16 of ACE was significantly associated with hypertension only in men. (ahajournals.org)
  • 16 If so, the effect of gene polymorphism should be examined within a large homogeneous population. (ahajournals.org)
  • Background The ACE gene is characterized by a polymorphism based on the presence (insertion [ I ]) or absence (deletion [ D ]) within intron 16 of a 287-basepair alu repeat sequence, resulting in three genotypes. (ahajournals.org)
  • 2 After its cloning, the ACE gene was shown to be characterized by an insertion/deletion polymorphism based on the presence (insertion [ I ]) or absence (deletion [ D ]) within intron 16 of a 287-basepair alu repeat sequence, resulting in three genotypes ( DD and II homozygotes and ID heterozygotes). (ahajournals.org)
  • 3 The I/D polymorphism was found to be in strong linkage disequilibrium with the major gene locus controlling plasma ACE with mean plasma ACE level in DD subjects approximately twice that of II subjects, with ID subjects having intermediate values. (ahajournals.org)
  • However, we found little or no relationship between the occurrence of hypopigmentation and the polymorphism haplotype of the intact P allele. (nih.gov)
  • Nakayama et al 1 have described an interesting polymorphism in the NPR-A gene in a Japanese population. (ahajournals.org)
  • These findings suggest that this functional deletion polymorphism is rare outside Japanese populations. (ahajournals.org)
  • This conclusion is supported by the report of Knowles et al, 5 who studied the structure of the entire NPR-A gene from 34 unrelated individuals of black, white, and unknown ethnicities, finding 10 polymorphic sites in noncoding regions of the gene, but not the 5′ UTR 8 bp I/D polymorphism. (ahajournals.org)
  • Palmer B, Pilbrow A, Frampton C, Yandle T, Nicholls M, Richards A, Cameron V. ACE gene polymorphism interacts with LVEF and BNP levels to predict mortality following myocardial infarction. (ahajournals.org)
  • Carrier-state of D allele in ACE gene insertion/deletion polymorphism is associated with coronary artery disease, in contrast to the C677→T transition in the MTHFR gene. (edu.pl)
  • We analysed the distribution of genotypes and allele frequencies of the insertion/deletion (I/D) polymorphism in the ACE gene using PCR amplification, and the C677→T polymorphism in the MTHFR gene using PCR-RFLP analysis. (edu.pl)
  • Agerholm-Larsen B, Nordestgaard BG, Tybjaerg-Hansen A. (2000) ACE gene polymorphism in cardiovascular disease. (edu.pl)
  • Bohn M, Berge KE, Bakken A, Erikssen J, Berg K. (1993) Insertion/deletion (I/D) polymorphism at the locus for angiotensin-converting enzyme and parental history of myocardial infarction. (edu.pl)
  • The aim of the study was to determine the angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism in different stages of chronic kidney disease (CKD) among subjects with type 2 diabetes (T2DM). (journalcra.com)
  • Because the insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene (ACE) has been associated with the cough reflex, we studied whether this genetic polymorphism was also associated with the risk of pneumonia. (cdc.gov)
  • 50% of the study members carried CNVs in UGT2B genes, of which 76% showed deletion polymorphism. (hindawi.com)
  • In Chinese population, heterozygous deletion polymorphism of UGT2B17 was higher (86%) than homozygous deletion (73%) [ 2 , 7 ]. (hindawi.com)
  • Gaedigk A, Blum M, Gaedigk R, Eichelbaum M, Meyer UA: Deletion of the entire cytochrome P450 CYP2D6 gene as a cause of impaired drug metabolism in poor metabolizers of the debrisoquine/sparteine polymorphism. (drugbank.ca)
  • It is a deletion/insertion polymorphism (DIP). (wikipedia.org)
  • OBJECTIVE -We tested whether determination of the ACE insertion/deletion polymorphism is useful for renal and cardiovascular prognoses of type 2 diabetic subjects. (diabetesjournals.org)
  • RESEARCH DESIGN AND METHODS -The French participants (3,126 of 4,912) in the Non-Insulin-Dependent Diabetes, Hypertension, Microalbuminuria or Proteinuria, Cardiovascular Events, and Ramipril (DIABHYCAR) trial were studied for their prognosis over 4 years according to their ACE insertion/deletion polymorphism. (diabetesjournals.org)
  • We investigated the effect of the insertion/deletion polymorphism on the primary outcome in the DIABHYCAR trial (defined as the first of the following events to occur: cardiovascular death, nonfatal myocardial infarction, stroke, heart failure leading to hospital admission, or end-stage renal failure) and its components. (diabetesjournals.org)
  • CONCLUSIONS -We were not able to demonstrate the manifest usefulness of the ACE insertion/deletion polymorphism for the prognosis of type 2 diabetic subjects. (diabetesjournals.org)
  • A polymorphism in the promoter region of the SLC6A4 gene consists of a 44bp insertion or deletion involving repeat elements. (medscape.com)
  • DNA from the proband was sequenced using a gene panel for inherited retinal disorders, and a single nucleotide polymorphism (SNP) array was conducted to detect the presence of deletions and uniparental disomy. (molvis.org)
  • By Sanger sequencing, the 30bp flanking sequences of the alleles tm6429 and tm6475 were identified as TTTTAAATCGATTTTTGAGCACCAAAATTA- [355 bp deletion + 1 bp insertion (T)] - TTAAAAATGAGAAAAAATGGGGAAAAAATT and CAAACGCGCTCTATGGAGAATGTGGAATTA- [242 bp deletion] - TTTTATATAGGATTTTAATTTTCAGGCCAC, respectively. (micropublication.org)
  • Gene disruption has been accomplished through successive transformations with insertion/deletion alleles that are constructed in vitro ( 2 , 7 , 12 ). (asm.org)
  • RESULTS -In DIABHYCAR, the primary outcome and most of its components were not affected by the ACE insertion/deletion genotype. (diabetesjournals.org)
  • Two CA9 SNPs in exons, including rs2071676 (+201, G/A) in exon 1 and rs3829078 (+1081, A/G) in exon 7, rs1048638 (+1584, C/A) in 3′-untranslated region of exon 11, as well as an 18-base pair deletion/insertion (376deltion393) in exon 1 were selected and their genotypic distributions were determined by real-time polymerase chain reaction. (medsci.org)
  • it is called the insertion, or I, allele. (medlineplus.gov)
  • How would you classify the mutant alleles? (bartleby.com)
  • Active ZFNs are those in which somatic lesion frequencies were greater than 0.5% or that successfully generated founders for mutant alleles. (biologists.org)
  • Multiple different experiments have used genetic manipulation to induce null allele mutants in mice populations in order to observe the consequences of different allele combinations at specific loci. (wikipedia.org)
  • In a screen reexamining Caenorhabditis elegans legacy mutants isolated 30 years ago, we identified a novel allele of the gene encoding topoisomerase II, top-2 ( it7 ). (genetics.org)
  • The arrows at left in (C) indicate HindIII fragments (5, 3.5, 2, 1.4, 1.2, and 1.0 kb, top to bottom) that are absent in the rga/ga1-3 deletion mutants. (plantcell.org)
  • The new HindIII fragments present in the deletion mutants are indicated by the arrows at right. (plantcell.org)
  • 1 2 3 Studies of the renin-angiotensin system have shown that several genetic variants of the angiotensinogen gene ( AGT ) play a role in increasing risk for hypertension. (ahajournals.org)
  • Tumor antigens, whether encoded by normal or mutant genes, may be lost by more malignant variants that arise during tumor progression in mice ( 11 )( 12 )( 13 )( 14 )( 15 )( 16 ). (rupress.org)
  • On the other hand, we confirmed in this study that the polymorphic variants within IFNL3 and TLR2 immune response genes are significantly associated with HCV-related disease progression in our cohort of Italian patients. (frontiersin.org)
  • These findings further support this association and also suggest that biallelic variants affecting the function of the ADGRB3 gene may also cause cognitive impairments and ataxia. (nature.com)
  • Steen VM, Molven A, Aarskog NK, Gulbrandsen AK: Homologous unequal cross-over involving a 2.8 kb direct repeat as a mechanism for the generation of allelic variants of human cytochrome P450 CYP2D6 gene. (drugbank.ca)
  • The basis of this evaluation will be identification of the allelic variants of human genes, description of the frequency of these variants in different populations, identification of diseases influenced by these variants and assessment of the magnitude of the associated risk. (cdc.gov)
  • Identification of genetic variants and gene expression relationships associated with pharmacogenes in humans. (snpedia.com)
  • The 82 allelic variants and numerous subvariants reported to date are summarized in the Human CYP Allele Nomenclature Committee website [ 5 ]. (hindawi.com)
  • The genotyping of the CYP2D6 gene was difficult due to its polymorphic nature, the presence of two flanking pseudogenes, and copy number variants. (hindawi.com)
  • The human gene is located at 6p21.3 within a locus containing the genes for putative serine/threonine Kinase RP , complement C4 , steroid 21-hydroxylase CYP21 tenascin TNX , normally, in a duplicated cluster known as RCCX module. (biomedcentral.com)
  • Such alleles are considered to result from unequal crossovers within the bimodular C4/CYP21 locus . (biomedcentral.com)
  • Depending on the localization of recombination breakpoint, different alleles can be generated conferring the locus high degree of allelic variability. (biomedcentral.com)
  • A) Structure of the bocks locus, including a portion of the uncharacterized CG8312 gene and the overlapping P581PK gene. (genetics.org)
  • We showed that Atp2b4-/- mice demonstrate increased MCHC, confirming ATP2B4 as the causal gene at this GWAS locus. (jci.org)
  • A null allele cannot be distinguished from deletion of the entire locus solely from phenotypic observation. (wikipedia.org)
  • A microsatellite null allele is an allele at a microsatellite locus that does not amplify to detectable levels in a polymerase chain reaction test. (wikipedia.org)
  • 1 2 3 However, in total these large scale studies only pinpointed candidate genes of relatively minor effect within each locus, explaining only a small proportion of the phenotypic variance in the normal population, and thus accounting together for little more than 5% of our height (0.4 cm per "increasing" allele). (bmj.com)
  • UV-induced locus-specific reversion of an ochre allele ( arg4-17) is reduced in the rad30 deletion mutant. (springer.com)
  • Analysis of the nine ORFs (FVEG_08287 to FVEG_08295) at the FDB1 locus indicated that one of the genes (FVEG_08291) encodes a protein having a metallo-beta-lactamase domain, and deletion of the gene in wild-type strain M3125 resulted in the fungus being unable to grow on BOA-amended agar due to an inability to metabolize the compound. (usda.gov)
  • Furthermore, rearrangements within the gene locus have created multiple functional gene copies or deleted the entire gene, resulting in increased or absent drug metabolism, respectively [ 6 , 7 ]. (hindawi.com)
  • This deletion region overlaps the BRCA1 locus, which predisposes to familial breast and ovarian cancer. (aacrjournals.org)
  • The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. (bartleby.com)
  • The SCN9A gene has 26 exons and encodes a 1977-amino acid polypeptide. (bartleby.com)
  • Here we report the first large deletion identified in the CFTR gene, which involves 50 kb in two stretches of DNA: one of 10 kb from exon 4 to exon 7, and another of 40 kb, spanning exons 11 to 18. (elsevier.com)
  • One allele carried a large deletion that arose by non-homologous recombination and included the first five exons and promoter region. (jimmunol.org)
  • In this allele, exons 9 and 10 are flanked by loxP sites and the gene is functionally wildtype. (unboundmedicine.com)
  • The VHL gene consists of 3 exons, and it encodes a protein of 213 amino acids. (urotoday.com)
  • This rearrangement represented a deletion of exons 8-10 of one THRA1 allele that was also coamplified with ERBB2 . (aacrjournals.org)
  • To assess whether polymorphisms of the genes encoding these peptides are associated with CAD in Silesian we conducted a study among 68 individuals suffering from CAD (including 52 cases after myocardial infarction), 51 subjects with positive family history of CAD and 111 controls. (edu.pl)
  • Polymorphisms in the immune response genes can contribute to clearance of hepatitis C virus (HCV) infection but also mediate liver inflammation and cancer pathogenesis. (frontiersin.org)
  • This study aimed to investigate the association of polymorphisms in PD-1 (PDCD1), IFNL3 (IL28B), and TLR2 immune related genes in chronic HCV patients with different hepatic and lymphoproliferative HCV-related diseases. (frontiersin.org)
  • These UGT2B genes are highly polymorphic in nature and have distinct polymorphisms associated with specific regions around the globe. (hindawi.com)
  • We report the presence of UGT2B gene deletion and duplication polymorphisms in Indian families. (hindawi.com)
  • Here, we report the presence of UGT 2B gene deletion and duplication polymorphisms and also the network analysis of the UGT 2B genes, which predicts the involvement of other possible genes in the uridine diphospho-glucuronosyltransferase activity. (hindawi.com)
  • These polymorphisms are referred to as either a long allele or a short allele. (medscape.com)
  • The presence of polymorphisms in the CYP2D6 gene may modulate the enzyme level and activity affecting individual responses, to pharmacological treatment in drug level, response and adverse reactions. (hindawi.com)
  • More than 130 Single Nucleotide Polymorphisms (SNPs) have been identified within the CYP2D6 gene, including numerous nonsynonymous variations, as well as silent, promoter, and intronic changes. (hindawi.com)
  • It was therefore of interest to investigate the polymorphic condition of UGT 2B genes in the Indian families as family studies are more robust to population stratification. (hindawi.com)
  • Here we used a mouse model of MHC-matched HCT with C57BL/6 donors and MHC-congenic BALB.B recipients that only differ in polymorphic autosomal background genes, including minor-H loci coding for minor-H antigens (minor-HAg). (frontiersin.org)
  • To generalize our results, we searched for genic deletions that are polymorphic in both humans and chimpanzees. (biomedcentral.com)
  • Cytochrome P450 2D6 ( CYP2D6 ) is a highly polymorphic gene, which is responsible for the metabolism of several key endogenous substrates and other xenobiotics [ 1 ] and about 25% of the most commonly prescribed drugs [ 2 - 4 ] (Table 1 ). (hindawi.com)
  • However, tumorigenesis is not initiated until the second allele is inactivated in a somatic cell. (sigmaaldrich.com)
  • In Pex11β -deficient mice, we observed that the deletion of a single allele of the Pex11β gene ( Pex11β +/− heterozygous mice) caused cell death in primary neuronal cultures prepared from the neocortex and cerebellum, although to a lesser extent as compared with the homozygous-null animals ( Pex11β −/− mice). (biologists.org)
  • In the course of successive divisions of an initially heterozygous macronucleus, the random distribution of alleles of loci carried on these copies eventually generates macronuclei that are pure for one allele or the other. (genetics.org)
  • SNP/CGH array analysis in this family demonstrated in both siblings a biallelic duplication inherited from the heterozygous parents, disrupting the ADGRB3 gene. (nature.com)
  • Null alleles are difficult to identify because a heterozygous individual for one null allele and one active allele is phenotypically indistinguishable from a homozygous individual with both active alleles. (wikipedia.org)
  • These potential null alleles were then confirmed when they failed to produce a heterozygous electrophoretic pattern. (wikipedia.org)
  • In the healthy smokers study, a lower urinary ratio of NNAL-glucuronide to NNAL was observed in women with the UGT2B17 deletion (0/0) as compared with women with either the wild-type or heterozygous genotypes ( P = 0.058). (aacrjournals.org)
  • Caspi et al found that persons who were homozygous or heterozygous for the short allele had more depressive symptoms and suicidality in association with stressful life events than those patients who were homozygous for the long allele. (medscape.com)
  • Pearson syndrome in an infant heterozygous for C282Y allele of HFE gene. (thefreedictionary.com)
  • Blood samples are also analyzed by CYP2D6 genotyping to test for CYP2D6 gene variation (i.e., *3, *4, *6, *10, *17, and *41) in genes that encode tamoxifen-metabolizing enzymes. (clinicaltrials.gov)
  • Additional CYP2D6 alleles, including gene duplication and gene deletion (*5) are assessed. (clinicaltrials.gov)
  • More than 100 CYP2D6 variant alleles have been identified. (medscape.com)
  • Individuals homozygous for these alleles have no CYP2D6 activity. (medscape.com)
  • IMs tend to have only one functional copy of CYP2D6 , whereas UMs have extra CYP2D6 gene copies. (medscape.com)
  • Our results indicated that CYP2D6 allele frequencies in Sardinians differed from those previously detected in the Caucasian Population. (hindawi.com)
  • For this reason, we aimed to create a primary CYP2D6 PCR strategy based on the amplification of the entire gene (6.572 Kb) coupled to direct genomic DNA sequencing analysis. (hindawi.com)
  • therefore, we analyzed the CYP2D6 gene for sequence variations in Sardinians and also compared resulting allele frequencies with those observed in Caucasian population. (hindawi.com)
  • Thus, our results indicate that hypopigmentation is likely the result of deletion of the P gene in the context of PWS but do not support the linked hypothesis that hypopigmentation results from hemizygosity for variant P alleles with reduced function. (nih.gov)
  • While the rs12979860 IFNL3 T allele was found a good marker associated with HCV-outcome together with the rs111200466 TLR2 del variant, the rs10204525 PD-1.6 A allele was found to have an insignificant role in patients with HCV-related hepatic disorders. (frontiersin.org)
  • Though in Asian patients the combination of IFNL3 and PD-1.6 markers better define the HCV-related outcomes, in our series of Caucasian patients the PD-1.6 A-allele variant was observed very rarely. (frontiersin.org)
  • While most of them behave as dominant alleles and have been identified in sporadic diseases, recessive CNVs have also been associated with several disorders, either in a homozygous state or as associated with a recessive variant in the other allele. (nature.com)
  • Another variant is missing this region of DNA and is called the deletion, or D, allele. (medlineplus.gov)
  • Genomic approaches are increasingly contributing to our understanding of how budding yeasts adapt to natural environments by identifying the genes that are involved in adaptation within natural substrates. (nature.com)
  • A subsequent analysis of the breakpoint regions clearly indicated a direct tandem duplication disrupting the genomic structure of the gene. (nature.com)
  • Here, we describe disruption of C. albicans genes with PCR products that have 50 to 60 bp of homology to a genomic sequence on each end of a selectable marker. (asm.org)
  • Gene discovery has been facilitated greatly by access to much of the C. albicans genomic sequence ( 11 ). (asm.org)
  • Based on comparisons between cancer tissue and corresponding normal tissues, the identification of regions with a high frequency of genomic deletion detected by allelic loss or loss of heterozygosity (LOH) has been used to localize genes that predispose to cancer (tumor suppressor genes). (sigmaaldrich.com)
  • Other chip-based methods such as comparative genomic hybridization can detect genomic gains or deletions leading to LOH. (wikipedia.org)
  • Since both L9 and L26 encode proteins essential for ribosomal biogenesis, complete loss of the tumor-specific target antigens in the absence of a normal allele would abrogate tumor growth. (rupress.org)
  • A) Three genes encode nuclear lamina-enriched LEM-D proteins, otefin ( ote ), dMAN1 , and bocksbeutel ( bocks ). (genetics.org)
  • At the top of the hierarchy is the flhDC operon, encoding two proteins which form the heterotetrameric positive transcriptional regulator of the class II genes. (asm.org)
  • These results indicate that Eς 54 is responsible for the expression of genes encoding structural components of the flagellar export apparatus, the motor, the hook, and the basal body proteins. (asm.org)
  • Many synMuv genes encode homologs of chromatin-remodeling proteins and transcriptional repressors. (biologists.org)
  • [14] The maize P gene encodes a Myb homolog that recognizes the sequence CCT/AACC, in sharp contrast with the C/TAACGG bound by vertebrate Myb proteins. (wikipedia.org)
  • On the other hand are the tumor suppressor genes, which normally block the development of malignancies by encoding for proteins that suppress tumor initiation and growth. (sigmaaldrich.com)
  • STAT proteins were recognized initially as transcription factors that were involved in expressions of specific genes, but not required for cell proliferation ( 3 , 14 ). (jimmunol.org)
  • To date, six genes have been identified in humans that encode proteins which appear to participate in the MMR process, including the mutS homologs GTBP, hMSH2, and hMSH3 and the mutL homologs hMLH1, hPMS1, and hPMS2 (2-7). (google.co.uk)
  • Proteins with sequence similarity to DinB have been predicted from genes cloned from various prokaryotic and eukaryotic organisms, including Caenorhabditis elegans . (springer.com)
  • The D allele carriers (DD + ID genotypes) were more frequent in the CAD patients (85%) compared to control group (65%) (P = 0.003, OR = 3.14), whereas the familial CAD risk group shows the highest frequency of the ID genotype (57% vs 43% in controls). (edu.pl)
  • The OR (95% CI) for male was ID 3.1(1.3-7.4), DD 6.1(1.7-12.4), and female was ID 5.3(1.3-4.5), DD 8.8 (3.0-10.7) Conclusion: The ID and DD genotype of ACE gene confers a greater role in genetic variations underlying high risk stage of CKD especially in women subjects. (journalcra.com)
  • Issues that are particularly important in the appraisal of studies of genotype prevalence and gene-disease associations include the analytical validity of genotyping, selection of subjects, confounding (especially as a result of population stratification), gene-environment and gene-gene interactions, statistical power and multiple statistical comparisons. (cdc.gov)
  • This paper presents recommendations regarding considerations that should be addressed when conducting, analyzing, and reporting studies of genotype prevalence and gene-disease associations, both for individual investigations and for systematic reviews. (cdc.gov)
  • The SCN9A gene encodes a sodium channel protein required for transmission of electrical signals from particular nerves in the body to the brain. (bartleby.com)
  • In the first tumor, 6132A-PRO, the antigen is encoded by a point-mutated L9 ribosomal protein gene. (rupress.org)
  • For example, the ribosomal protein L9 is essential for protein synthesis and homozygous deletion of L9 is lethal in Drosophila ( 9 ). (rupress.org)
  • Another example is the human homologue of the yeast bet 5 gene which encodes a protein that is part of the transport protein particle involved in ER-to-Golgi transport. (rupress.org)
  • B)Western blot of protein extracts isolated from bocks +/+ (+/+), bocks CB03586 (CB) adults, and adults homozygous for one of the two bocks deletion alleles. (genetics.org)
  • As in the Drosophila Hedgehog (Hh) signaling pathway, binding of Shh to its receptor, Patched homolog 1 (Ptch1), allows activation of the membrane protein Smoothened (Smo), which regulates the Ci/Gli transcription factors that control Hh target gene expression. (pnas.org)
  • A mutant allele that produces no RNA transcript is called an RNA null (shown by Northern blotting or by DNA sequencing of a deletion allele), and one that produces no protein is called a protein null (shown by Western blotting). (wikipedia.org)
  • Sequencing of the subcloned PCR products showed a 13 bp deletion of nucleotides 391-403 in exon 2 (fig 1 ) predicted to generate a frameshift with a premature stop codon at nt 445-447 (TAA) resulting in a truncated 79 amino acid protein. (bmj.com)
  • Myb proto-oncogene protein also known as transcriptional activator Myb is a protein that in humans is encoded by the MYB gene . (wikipedia.org)
  • In sorghum, the corresponding yellow seed 1 gene (y1) [16] also encodes a R2R3 type of Myb domain protein that regulates the expression of chalcone synthase , chalcone isomerase and dihydroflavonol reductase genes required for the biosynthesis of 3-deoxyflavonoids . (wikipedia.org)
  • To find a drug that might allow the paternal copy of Ube3a to be expressed, they first made mice in which only the paternal copy of the gene was linked to the gene for yellow fluorescent protein. (wired.com)
  • Fragile X syndrome (FXS) is a heritable cognitive disability and autism spectrum disorder caused by loss of expression of the gene encoding the RNA binding protein FMRP. (sciencemag.org)
  • Specifically, the talpid 2 allele has a deletion that would result in a truncated and probably nonfunctional protein. (usda.gov)
  • For example, a large, complete deletion of a protein coding gene will obviously lead to the elimination of the expression of that protein. (biomedcentral.com)
  • They affect more nucleotides per genome than SNP variation [ 2 ] and contribute significantly to variation among normal individuals, both in levels of gene expression and in phenotypes of medical relevance [ 3 , 4 ]. (hindawi.com)
  • This test covers all coding nucleotides of genes PRSS1, SPINK1 , and CFTR , plus at least two and typically 20 flanking intronic nucleotides upstream and downstream of each coding exon, covering the conserved donor and acceptor splice sites, as well as typically 20 flanking nucleotides in the 5′ and 3′ UTR. (labcorp.com)
  • A total of 27 loci were tested in red pines and null alleles were found at 3 of those loci. (wikipedia.org)
  • No null alleles were detected at the X-linked loci, but 13 of the 20 autosomal loci contained null alleles. (wikipedia.org)
  • SNP-based genetic linkage analysis can be used to map disease loci, and determine disease susceptibility genes in individuals. (wikipedia.org)
  • Two gene clusters were identified that correspond to the previously characterized FDB1 and FDB2 loci, with both loci being necessary for metabolic tolerance to 2-benzoxazolinone (BOA), one of the maize phytoprotectants. (usda.gov)
  • There are currently 301 genes and loci reported for IRD ( RetNet ), making molecular diagnosis challenging. (molvis.org)
  • Colorectal carcinogenesis is associated with the accumulation of genetic changes involving both dominant oncogenes and tumor suppressor genes. (nih.gov)
  • gene therapy, inserting normal genes into person with genetic dx. (studystack.com)
  • Approaches for identifying essential genes include several types of classical forward genetic screens, genome-wide RNA interference screens and systematic targeted gene knockout. (wormbook.org)
  • Genetic redundancy masks some essential functions and pleiotropy of many essential genes poses a challenge for a full understanding of their functions. (wormbook.org)
  • However, even with this new ability to systematically knock out genes, many essential functions can remain cryptic due to genetic redundancy or to pleiotropy. (wormbook.org)
  • While the second category seemed until recently to be shrinking, and the last category is certainly getting smaller, the first is growing rapidly, not due to increased incidence of genetic disease, but due to a fast moving front of new knowledge about disease-associated human alleles. (columbia.edu)
  • In genetics, rs28363170 (DAT1-VNTR) is a genetic variation at SLC6A3, the gene that encodes the dopamine transporter. (wikipedia.org)
  • The ε4 isoform of the APOE gene is the greatest genetic risk factor for sporadic, late onset AD, and is also associated with risk for type 2 diabetes mellitus (T2DM). (plos.org)
  • The ε4 isoform of the APOE gene is the most significant genetic risk factor for AD [7] . (plos.org)
  • Sophisticated molecular genetic linkage studies in patients with von Hippel-Lindau disease eventually led to the identification of the VHL tumor suppressor gene [2]. (urotoday.com)
  • In conclusion, we report the alterations in the brain caused by the deletion of a single allele of the Pex11β gene. (biologists.org)
  • We report here a 13 base pair deletion which causes a frameshift and premature termination of the GPC3 gene in the Dutch-Canadian SGBS family in whom the trait was originally mapped. (bmj.com)
  • A ) Location of frameshift caused by the um27 deletion in the zebrafish gata2a gene. (biologists.org)
  • This spontaneously arising frameshift deletion is located in exon 2 at position 103308576 bp (NCBI Build 37) and results in a premature stop codon. (jax.org)
  • This review aims to evaluate the state-of-the-art of the effect of (1) genetics on mercury toxicokinetics and (2) gene-mercury interactions on neurodevelopment and neurotoxicity. (springer.com)
  • We conducted a PubMed search in September 2014 and retrieved 14 studies on the influence of genetics on mercury toxicokinetics and ten on neurological effects of gene-mercury interactions. (springer.com)
  • Including environmental risk along with genetics is important in studying the aetiology of MDD and PRS provide a useful approach to investigating gene-environment interactions in complex traits. (cambridge.org)
  • To assess the function of Stat3 in adult tissues, we disrupted the Stat3 gene specifically in T cells by conditional gene targeting using Cre-loxP system. (jimmunol.org)
  • To circumvent the early lethality and study the spatially and temporally specific functions of Smad2, we utilized the Cre-loxP system to generate a Smad2 conditional allele. (unboundmedicine.com)
  • Here we show that a conditional allele, Smad2(flox), was generated. (unboundmedicine.com)
  • TY - JOUR T1 - Generation of novel conditional and hypomorphic alleles of the Smad2 gene. (unboundmedicine.com)
  • Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus. (nih.gov)
  • Identification of duplications and deletions in the P. pacificus strains. (nih.gov)
  • From his epidemiologic studies of retinoblastoma, Knudson proposed his 'two-hit hypothesis' to explain mechanisms involved in inactivating tumor suppressor genes during tumorigenesis. (sigmaaldrich.com)
  • For example, tumor suppressor genes help keep cancer from developing. (wikipedia.org)
  • By measuring the fitness difference between the wild-type and null alleles of ~5,000 nonessential genes in yeast, we found that in any given environment, yeast expresses hundreds of genes that harm rather than benefit the organism, demonstrating widespread AP. (nih.gov)
  • Null alleles can have lethal effects depending on the importance of the mutated gene. (wikipedia.org)
  • Null alleles can also have beneficial effects, such as the elevated harvest index of semi-dwarf rice of the green revolution caused by null alleles in GA20ox-2. (wikipedia.org)
  • Strong evidence of null alleles was first seen in analysis of bears in 1995. (wikipedia.org)
  • Null alleles or genes have been studied in different organisms from the red pines of Minnesota to Drosophila melanogaster and mice. (wikipedia.org)
  • Alleles that produced an enzyme lacking catalytic activity were denoted as null alleles. (wikipedia.org)
  • in 1980 to determine existence and frequency of null alleles. (wikipedia.org)
  • These observations argue that HRM101 and ENX3 sequences are indeed portions of genes and that the respective gene products have related functions. (asm.org)
  • These methods have thus far required isolation of substantial DNA segments, and yet new genes of interest are often identified through DNA sequences of 400 to 600 bp ( 3a ). (asm.org)
  • 26%) involved only enhancer sequences residing a considerable distance away from the gene. (bmj.com)
  • 45%) involve enhancer sequences and leave the SHOX gene intact. (bmj.com)
  • In addition, the combination of different approaches revealed nine haplotypes for deleted 21-hydroxylase deficiency alleles. (biomedcentral.com)
  • Expression of NPR-A from the D allele was reduced compared with the wild-type allele and it is suggested that the deletion interferes with binding of regulatory factors to the 5′ UTR of the gene. (ahajournals.org)
  • Their analysis provided a foundation for understanding the complexity of lethal phenotypes as well as insight into the relative contributions of maternal vs. zygotic gene expression to the developmental process (see Wood, 1988 for references and discussion). (wormbook.org)
  • We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. (nih.gov)
  • The micronucleus is diploid, lacks gene expression, and is the germline of the cell. (genetics.org)
  • Gene expression of the flagellar system is tightly controlled by external stimuli or intracellular signals. (asm.org)
  • Our results are discussed in the context of a possible regulatory hierarchy controlling flagellar gene expression in R. sphaeroides . (asm.org)
  • In Salmonella enterica serovar Typhimurium, biosynthesis of the flagellum depends on the expression of more than 40 genes. (asm.org)
  • The expression of these genes follows a hierarchical pattern that is highly regulated. (asm.org)
  • The expression of class II genes is dependent on the RNA polymerase-ς 70 holoenzyme (Eς 70 ) and FlhD-FlhC. (asm.org)
  • FliA is a specific sigma factor (ς 28 ) required for the expression of class III genes, while FlgM is an anti-sigma factor that inhibits FliA activity. (asm.org)
  • Detailed analyses of some structural components of the flagellum have been described, but nothing is known about the factors that regulate gene expression. (asm.org)
  • Gene expression is normalized to mean of nondeletion clones for the same sgRNA pair. (jci.org)
  • C ) ATP2B4 expression in 293T cell clones exposed to enhancer targeting sgRNA pairs, but without deletion ( n = 4) or with biallelic deletion ( n = 3). (jci.org)
  • D ) ATP2B4 expression in HUDEP-2 cells with 98-bp core enhancer deletion. (jci.org)
  • Gene expression is normalized to unedited cells. (jci.org)
  • Gene Ontology analysis in knockout cells demonstrated altered expression of genes that regulate gene expression and that are localized to the nucleus. (plos.org)
  • The mechanism is related to dysregulated expression of neurodevelopmental genes and altered development of the neuroendocrine hypothalamus. (plos.org)
  • which regulate the transcription of an unknown set of genes to control the expression of the vulval cell fate. (biologists.org)
  • 1. We seek to elucidate how menin suppresses endocrine cells, such as pancreatic beta cells, via regulating histone methylations and expression of pro-proliferative genes. (upenn.edu)
  • Paternal Ube3a is normally silenced by what's called an antisense transcript-a piece of RNA that covers up the gene to prevent its expression. (wired.com)
  • In Angelman's syndrome, the brain architecture seems normal at birth, so it is possible that the restoration of normal gene expression could correct some of the pathologies. (wired.com)
  • Gene expression assays suggest that TaTOE1-B1 and TaFT3-B1 are expressed more during short days. (jic.ac.uk)
  • One approach used to generate hypermutable plants is through the expression of dominant negative alleles of mismatch repair genes in transgenic plants or derived cells. (google.co.uk)
  • Moreover, methods to inhibit the expression and activity of endogenous plant MMR genes and their encoded products are also useful to generate hypermutable plants. (google.co.uk)
  • Transcriptome analysis revealed unusual upregulation of vascular gene expression in Dgcr8 cKO hearts. (springer.com)
  • 2017 ). Recent advance in single cell RNA-sequencing technology makes it possible to measure global gene expression in every cell of an organ. (springer.com)
  • microPublication / Biology / Novel deletion alleles of a. (micropublication.org)
  • We report tm6429 and tm6475 as novel deletion alleles of the gene Y73E7A.1 that is a homologue of mammalian Coiled-coil domain containing 124 (Ccdc124)1. (micropublication.org)
  • Cloning of an exon 3 PCR product and direct sequencing of single clones identified a novel deletion in the third exon of RHO, c.614-622del (p.Y206-F208del). (molvis.org)
  • This novel deletion in exon 3 of the RHO gene, c.614-622del results in a classical form of adRP in a multi-generation French family. (molvis.org)
  • A novel deletion in a Pearson syndrome infant with hypospadias and cleft lip and palate. (thefreedictionary.com)
  • Hematologic features and clinical course of an infant with Pearson syndrome caused by a novel deletion of mitochon drial DNA. (thefreedictionary.com)
  • Although at least four different genes have been implicated in the process, the detection of allele loss from other regions of the genome suggests the involvement of additional genes. (nih.gov)
  • We investigated the presence of CNVs in UGT2B genes in 31 members from eight Indian families using Affymetrix Genome-Wide Human SNP Array 6.0 chip. (hindawi.com)
  • We report here a rapid method for disruption of C. albicans genes with PCR products that contain short regions of homology to the genome. (asm.org)
  • Blood spots have also been used for screening patients at risk for mitochondrial disorders such as medium-chain acyl-CoA dehydrogenase deficiency (19,20) and Pearson syndrome , a multisystem juvenile disorder associated with deletions in the mitochondrial genome (21). (thefreedictionary.com)
  • Two different large-scale screening methods are being used: systematic RNA interference (RNAi) and PCR-based screens for intragenic deletions after mutagenesis. (wormbook.org)
  • One intragenic suppressor was a deletion of two amino acids in DnaD. (mit.edu)
  • We isolated both intragenic and extragenic suppressors of the two dnaBts alleles. (mit.edu)
  • This allele (Smad2(3loxP)) functions hypomorphically when placed opposite a null allele, and unlike the other published Smad2 hypomorphic allele, can be maintained in the homozygous state. (unboundmedicine.com)
  • This hypomorphic allele causes in frame skipping of exon 7, which is predicted to delete part of the 2nd and 3rd ectodomains, and cause reduced message stability. (jax.org)
  • Arbustini E, Grasso M, Fasani R, Klersy C, Diegoli M, Porcu E, Banchieri N, Fortina P, Danesino C, Specchia G. (1995) Angiotensin converting enzyme gene deletion allele is independently and strongly associated with coronary atherosclerosis and myocardial infarction. (edu.pl)
  • Deletion allele of the angiotensin-converting enzyme gene as a risk factor for pneumonia in elderly patients. (cdc.gov)
  • FliA is then free to associate with the RNA polymerase core enzyme in order to transcribe class III genes ( 10 , 15 ). (asm.org)
  • This gene encodes gamma-glutamyl transpeptidase, a plasmamembrane-associated enzyme that cleaves the peptide bond between gamma-glutamyl and cysteinyl glycine moieties of glutathione. (jax.org)
  • The ACE gene provides instructions for making the angiotensin-converting enzyme. (medlineplus.gov)
  • The upper 95% confidence limit for the prevalence of carriers of the D allele is 0.60% in this PMI patient cohort. (ahajournals.org)
  • However, the prevalence of AP, which genes are subject to AP, and to what extent and how AP may be resolved remain unclear. (nih.gov)
  • B ) gata2a coding and amino acid sequence in the region of the um27 deletion. (biologists.org)
  • Twenty patients carrying at least one allele with C4/CYP21 30-kb deletion were included in the study. (biomedcentral.com)
  • Carriers of the functional deletion ( D ) allele had higher plasma BNP levels, a strong marker of cardiac stress, than those with the wild-type allele. (ahajournals.org)
  • The end result is the same in both cases, the lack of a functional tumor suppressor gene leads to tumor development. (sigmaaldrich.com)
  • it has definitely been valuable in showing how a dormant but functional gene can be reactivated. (wired.com)
  • If a person has one mutated and dysfunctional copy of a tumor suppressor gene and his second, functional copy of the gene gets damaged, they may become more likely to develop cancer. (wikipedia.org)
  • For example, say that the mother's allele is wild-type and fully functional, and the fathers's allele is mutated. (wikipedia.org)
  • These results demonstrate that the recyclable marker system is fully functional, and therefore the pyrG-dpl237 marker can be used for sequential gene deletions in M. circinelloides . (g3journal.org)
  • Conclusions Within the limitations of the available data, the meta-analysis therefore supports an association of the ACE D allele with MI risk and strengthens the justification for further evaluation in appropriately powered studies. (ahajournals.org)
  • PCR amplification of exon 2 of the GPC3 gene was performed using the oligonucleotide primers EX2 A (5′ gtttgccctgtttgccatg 3′) and EX2 B (5′ caaataatgatgccactaagc 3′) producing a 329 bp fragment in normal subjects. (bmj.com)
  • they are found to harbor both deletion and duplication alleles [ 5 ]. (hindawi.com)
  • This problem leads to duplication of the other parental allele. (wikipedia.org)
  • Overall, our results support the emerging notion that metabolizing gene families, such as the GSTM, NAT, UGT and CYP , have been evolving rapidly through gene duplication and deletion events in primates, leading to complex structural variation within and among species with unknown evolutionary consequences. (biomedcentral.com)
  • New C. albicans genes have been identified frequently through sequence homology to known genes or gene families. (asm.org)
  • 2. The method of claim 1 wherein the step of testing comprises analyzing a nucleotide sequence of the gene of interest. (google.co.uk)
  • RGA sequence (L er allele) is compared with GAI ( Peng et al. (plantcell.org)
  • Three Conserved Domains Revealed by Sequence Alignment between RGA, Other Cloned Genes, and ESTs. (plantcell.org)
  • The deletion has been detected via uniparental inheritance of CFTR microsatellite alleles (TVS17BTA and IVS1TBCA) in 3 independent CF families. (elsevier.com)
  • Six affected and 14 unaffected individuals from three-generations were available for linkage analysis using microsatellite markers flanking the rhodopsin ( RHO) gene. (molvis.org)
  • When women had the diplotypes, carrying at least one haplotype A1AA (one mutant allele A in rs2071676, no deletion in 376del393, no mutant allele A in rs3829078 and one mutant allele A in rs1048638), they were significantly susceptible to cervical invasive cancer. (medsci.org)
  • relies on identification and analysis of essential genes, genes required for growth to a fertile adult. (wormbook.org)
  • Understanding the biology of C. elegans relies on identification and analysis of essential genes. (wormbook.org)
  • The P gene, located in this same region, is associated with OCA2, an autosomal recessive disorder that is the most frequent form of tyrosinase-positive oculocutaneous albinism. (nih.gov)
  • Gene-environment interaction studies in MDD have typically investigated candidate genes, though the disorder is known to be highly polygenic. (cambridge.org)
  • Isolated populations, such as that found in Sardinia [ 9 , 10 ], could be extremely useful for mapping novel SNPs and haplotypes for specific genes. (hindawi.com)
  • The isolation and characterization of multiple alleles for thousands of other disease-associated genes is on the way. (columbia.edu)
  • we report the cloning and characterization of a nondeleted mutant CYP21B gene. (uniprot.org)
  • It is not clear what the impact of the frequent p16 deletions is within the subgroup of T-lineage ALL. (wiley.com)
  • The authors conclude that enhancer deletions in the SHOX gene region are a relatively frequent cause of growth failure in patients with idiopathic short stature and Leri-Weill syndrome. (bmj.com)
  • This study aimed to analyze the determination of allele frequencies in Sardinians and the comparison to frequencies found in the Caucasian Population. (hindawi.com)
  • SNP arrays, however, have an additional advantage of being able to detect copy-neutral LOH (also called uniparental disomy or gene conversion). (wikipedia.org)
  • Both copies of the UGT2B17 gene are deleted in ∼10% of Whites and the deletion is associated with a reduction in NNAL glucuronidation activity in vitro . (aacrjournals.org)
  • If the mother's allele is missing and the child has two copies of the father's mutant allele, disease can occur. (wikipedia.org)
  • Because people have two copies of each gene, each individual can have two I alleles (II), two D alleles (DD), or one allele of each (ID). (medlineplus.gov)
  • We surveyed all 38 putative HMT genes in C. elegans and identified met-1 and met-2 as negative regulators of vulval cell-fate specification. (biologists.org)
  • Shaye DD, Greenwald I. OrthoList: a compendium of C. elegans genes with human orthologs. (micropublication.org)
  • A recent study with mice genetically deficient in the Stat3 gene has revealed its important role in the early embryogenesis. (jimmunol.org)
  • Both diseases are genetically heterogeneous: 25 genes are known to be causative for LCA and more than 80 genes for non-syndromic RP ( RetNet ). (molvis.org)
  • We screened 498 patients from the Christchurch Post-Myocardial Infarction (PMI) Study 2-4 who had acute myocardial infarction for the NPR-A D allele. (ahajournals.org)
  • The two major categories of genes mutated in cancer are oncogenes and tumor suppressors. (sigmaaldrich.com)
  • This mutant gene is expressed on transfection into mouse Y1 adrenal cells, producing mRNA levels similar to those seen after transfection of the normal CYP21B gene. (uniprot.org)
  • Several gene disruption methods described previously employ long regions of homology flanking a selectable marker. (asm.org)
  • Notably, lethality is prevented and control of cytopathogenic infection is restored when viral antigen presentation is enhanced by deletion of immune evasion genes from the infecting virus. (frontiersin.org)
  • however, it is highly homologous to other LILR genes, and can bind human leukocyte antigen (HLA) class I. Therefore, if secreted, the LILRA3 might impair interactions of membrane-bound LILRs (such as LILRB1, an inhibitory receptor expressed on effector and memory CD8 T cells) with their HLA ligands, thus modulating immune reactions and influencing susceptibility to disease. (wikipedia.org)