Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Gene Deletion: A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Sequence Deletion: Deletion of sequences of nucleic acids from the genetic material of an individual.Gene Frequency: The proportion of one particular in the total of all ALLELES for one genetic locus in a breeding POPULATION.Polymorphism, Genetic: The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.Chromosome Deletion: Actual loss of portion of a chromosome.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Homozygote: An individual in which both alleles at a given locus are identical.Mice, Knockout: Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.Heterozygote: An individual having different alleles at one or more loci regarding a specific character.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.Integrases: Recombinases that insert exogenous DNA into the host genome. Examples include proteins encoded by the POL GENE of RETROVIRIDAE and also by temperate BACTERIOPHAGES, the best known being BACTERIOPHAGE LAMBDA.Pedigree: The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Recombination, Genetic: Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.Genetic Predisposition to Disease: A latent susceptibility to disease at the genetic level, which may be activated under certain conditions.Mice, Inbred C57BLPolymorphism, Single Nucleotide: A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Haplotypes: The genetic constitution of individuals with respect to one member of a pair of allelic genes, or sets of genes that are closely linked and tend to be inherited together such as those of the MAJOR HISTOCOMPATIBILITY COMPLEX.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Genetic Variation: Genotypic differences observed among individuals in a population.Models, Genetic: Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.Genetic Markers: A phenotypically recognizable genetic trait which can be used to identify a genetic locus, a linkage group, or a recombination event.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Gene Knockout Techniques: Techniques to alter a gene sequence that result in an inactivated gene, or one in which the expression can be inactivated at a chosen time during development to study the loss of function of a gene.Point Mutation: A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.Genes, Fungal: The functional hereditary units of FUNGI.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Saccharomyces cerevisiae Proteins: Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.Polymorphism, Restriction Fragment Length: Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.Gene Targeting: The integration of exogenous DNA into the genome of an organism at sites where its expression can be suitably controlled. This integration occurs as a result of homologous recombination.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.In Situ Hybridization, Fluorescence: A type of IN SITU HYBRIDIZATION in which target sequences are stained with fluorescent dye so their location and size can be determined using fluorescence microscopy. This staining is sufficiently distinct that the hybridization signal can be seen both in metaphase spreads and in interphase nuclei.Bacterial Proteins: Proteins found in any species of bacterium.Gene Dosage: The number of copies of a given gene present in the cell of an organism. An increase in gene dosage (by GENE DUPLICATION for example) can result in higher levels of gene product formation. GENE DOSAGE COMPENSATION mechanisms result in adjustments to the level GENE EXPRESSION when there are changes or differences in gene dosage.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.Mutagenesis, Insertional: Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Genes, Essential: Those genes found in an organism which are necessary for its viability and normal function.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Multigene Family: A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Microsatellite Repeats: A variety of simple repeat sequences that are distributed throughout the GENOME. They are characterized by a short repeat unit of 2-8 basepairs that is repeated up to 100 times. They are also known as short tandem repeats (STRs).Cell Line: Established cell cultures that have the potential to propagate indefinitely.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Gene Expression Regulation, Fungal: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in fungi.Genes, Lethal: Genes whose loss of function or gain of function MUTATION leads to the death of the carrier prior to maturity. They may be essential genes (GENES, ESSENTIAL) required for viability, or genes which cause a block of function of an essential gene at a time when the essential gene function is required for viability.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Fungal Proteins: Proteins found in any species of fungus.Crosses, Genetic: Deliberate breeding of two different individuals that results in offspring that carry part of the genetic material of each parent. The parent organisms must be genetically compatible and may be from different varieties or closely related species.Haploidy: The chromosomal constitution of cells, in which each type of CHROMOSOME is represented once. Symbol: N.Genes, Bacterial: The functional hereditary units of BACTERIA.Syndrome: A characteristic symptom complex.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Genome, Fungal: The complete gene complement contained in a set of chromosomes in a fungus.Frameshift Mutation: A type of mutation in which a number of NUCLEOTIDES deleted from or inserted into a protein coding sequence is not divisible by three, thereby causing an alteration in the READING FRAMES of the entire coding sequence downstream of the mutation. These mutations may be induced by certain types of MUTAGENS or may occur spontaneously.Gene Duplication: Processes occurring in various organisms by which new genes are copied. Gene duplication may result in a MULTIGENE FAMILY; supergenes or PSEUDOGENES.Haploinsufficiency: A copy number variation that results in reduced GENE DOSAGE due to any loss-of-function mutation. The loss of heterozygosity is associated with abnormal phenotypes or diseased states because the remaining gene is insufficient.Heterozygote Detection: Identification of genetic carriers for a given trait.Chromosomes, Human, Pair 9: A specific pair of GROUP C CHROMSOMES of the human chromosome classification.Case-Control Studies: Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.Introns: Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.Genetic Linkage: The co-inheritance of two or more non-allelic GENES due to their being located more or less closely on the same CHROMOSOME.Abnormalities, MultiplePolymorphism, Single-Stranded Conformational: Variation in a population's DNA sequence that is detected by determining alterations in the conformation of denatured DNA fragments. Denatured DNA fragments are allowed to renature under conditions that prevent the formation of double-stranded DNA and allow secondary structure to form in single stranded fragments. These fragments are then run through polyacrylamide gels to detect variations in the secondary structure that is manifested as an alteration in migration through the gels.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Hemoglobins, Abnormal: Hemoglobins characterized by structural alterations within the molecule. The alteration can be either absence, addition or substitution of one or more amino acids in the globin part of the molecule at selected positions in the polypeptide chains.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Genetic Engineering: Directed modification of the gene complement of a living organism by such techniques as altering the DNA, substituting genetic material by means of a virus, transplanting whole nuclei, transplanting cell hybrids, etc.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Chromosomes, Human, Pair 17: A specific pair of GROUP E CHROMOSOMES of the human chromosome classification.Glutathione Transferase: A transferase that catalyzes the addition of aliphatic, aromatic, or heterocyclic FREE RADICALS as well as EPOXIDES and arene oxides to GLUTATHIONE. Addition takes place at the SULFUR. It also catalyzes the reduction of polyol nitrate by glutathione to polyol and nitrite.delta-Thalassemia: A hereditary disorder characterized by reduced or absent DELTA-GLOBIN thus effecting the level of HEMOGLOBIN A2, a minor component of adult hemoglobin monitored in the diagnosis of BETA-THALASSEMIA.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.Dystrophin: A muscle protein localized in surface membranes which is the product of the Duchenne/Becker muscular dystrophy gene. Individuals with Duchenne muscular dystrophy usually lack dystrophin completely while those with Becker muscular dystrophy have dystrophin of an altered size. It shares features with other cytoskeletal proteins such as SPECTRIN and alpha-actinin but the precise function of dystrophin is not clear. One possible role might be to preserve the integrity and alignment of the plasma membrane to the myofibrils during muscle contraction and relaxation. MW 400 kDa.Steroid 21-Hydroxylase: An adrenal microsomal cytochrome P450 enzyme that catalyzes the 21-hydroxylation of steroids in the presence of molecular oxygen and NADPH-FERRIHEMOPROTEIN REDUCTASE. This enzyme, encoded by CYP21 gene, converts progesterones to precursors of adrenal steroid hormones (CORTICOSTERONE; HYDROCORTISONE). Defects in CYP21 cause congenital adrenal hyperplasia (ADRENAL HYPERPLASIA, CONGENITAL).Intellectual Disability: Subnormal intellectual functioning which originates during the developmental period. This has multiple potential etiologies, including genetic defects and perinatal insults. Intelligence quotient (IQ) scores are commonly used to determine whether an individual has an intellectual disability. IQ scores between 70 and 79 are in the borderline range. Scores below 67 are in the disabled range. (from Joynt, Clinical Neurology, 1992, Ch55, p28)Virulence: The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.Gene Rearrangement: The ordered rearrangement of gene regions by DNA recombination such as that which occurs normally during development.Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)Mice, Transgenic: Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Genetic Loci: Specific regions that are mapped within a GENOME. Genetic loci are usually identified with a shorthand notation that indicates the chromosome number and the position of a specific band along the P or Q arm of the chromosome where they are found. For example the locus 6p21 is found within band 21 of the P-arm of CHROMOSOME 6. Many well known genetic loci are also known by common names that are associated with a genetic function or HEREDITARY DISEASE.Muscular Dystrophies: A heterogeneous group of inherited MYOPATHIES, characterized by wasting and weakness of the SKELETAL MUSCLE. They are categorized by the sites of MUSCLE WEAKNESS; AGE OF ONSET; and INHERITANCE PATTERNS.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).Reverse Transcriptase Polymerase Chain Reaction: A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.Comparative Genomic Hybridization: A method for comparing two sets of chromosomal DNA by analyzing differences in the copy number and location of specific sequences. It is used to look for large sequence changes such as deletions, duplications, amplifications, or translocations.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.Mice, Mutant Strains: Mice bearing mutant genes which are phenotypically expressed in the animals.Genes, Dominant: Genes that influence the PHENOTYPE both in the homozygous and the heterozygous state.DNA Transposable Elements: Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.alpha-Globins: Members of the alpha-globin family. In humans, they are encoded in a gene cluster on CHROMOSOME 16. They include zeta-globin and alpha-globin. There are also pseudogenes of zeta (theta-zeta) and alpha (theta-alpha) in the cluster. Adult HEMOGLOBIN is comprised of 2 alpha-globin chains and 2 beta-globin chains.Loss of Heterozygosity: The loss of one allele at a specific locus, caused by a deletion mutation; or loss of a chromosome from a chromosome pair, resulting in abnormal HEMIZYGOSITY. It is detected when heterozygous markers for a locus appear monomorphic because one of the ALLELES was deleted.Disease Models, Animal: Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Genetic Testing: Detection of a MUTATION; GENOTYPE; KARYOTYPE; or specific ALLELES associated with genetic traits, heritable diseases, or predisposition to a disease, or that may lead to the disease in descendants. It includes prenatal genetic testing.X Chromosome: The female sex chromosome, being the differential sex chromosome carried by half the male gametes and all female gametes in human and other male-heterogametic species.Metabolic Engineering: Methods and techniques used to genetically modify cells' biosynthetic product output and develop conditions for growing the cells as BIOREACTORS.Metabolic Networks and Pathways: Complex sets of enzymatic reactions connected to each other via their product and substrate metabolites.Linkage Disequilibrium: Nonrandom association of linked genes. This is the tendency of the alleles of two separate but already linked loci to be found together more frequently than would be expected by chance alone.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Selection, Genetic: Differential and non-random reproduction of different genotypes, operating to alter the gene frequencies within a population.Clonal Deletion: Removal, via CELL DEATH, of immature lymphocytes that interact with antigens during maturation. For T-lymphocytes this occurs in the thymus and ensures that mature T-lymphocytes are self tolerant. B-lymphocytes may also undergo clonal deletion.Repressor Proteins: Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.DNA Probes: Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Asian Continental Ancestry Group: Individuals whose ancestral origins are in the southeastern and eastern areas of the Asian continent.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Chromosomes, Human, Pair 22: A specific pair of GROUP G CHROMOSOMES of the human chromosome classification.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Chromosome Aberrations: Abnormal number or structure of chromosomes. Chromosome aberrations may result in CHROMOSOME DISORDERS.Genetic Techniques: Chromosomal, biochemical, intracellular, and other methods used in the study of genetics.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Genetic Vectors: DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.Karyotyping: Mapping of the KARYOTYPE of a cell.DNA, Fungal: Deoxyribonucleic acid that makes up the genetic material of fungi.Nerve Tissue ProteinsMutation, Missense: A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)Neuronal Apoptosis-Inhibitory Protein: An inhibitor of apoptosis protein that was initially identified during analysis of CHROMOSOME DELETIONS associated with SPINAL MUSCULAR ATROPHY. Naip contains a nucleotide binding oligomerization domain and a carboxy-terminal LEUCINE rich repeat.Cyclin-Dependent Kinase Inhibitor p16: A product of the p16 tumor suppressor gene (GENES, P16). It is also called INK4 or INK4A because it is the prototype member of the INK4 CYCLIN-DEPENDENT KINASE INHIBITORS. This protein is produced from the alpha mRNA transcript of the p16 gene. The other gene product, produced from the alternatively spliced beta transcript, is TUMOR SUPPRESSOR PROTEIN P14ARF. Both p16 gene products have tumor suppressor functions.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Genes, Tumor Suppressor: Genes that inhibit expression of the tumorigenic phenotype. They are normally involved in holding cellular growth in check. When tumor suppressor genes are inactivated or lost, a barrier to normal proliferation is removed and unregulated growth is possible.Genetics, Microbial: A subdiscipline of genetics which deals with the genetic mechanisms and processes of microorganisms.Chromosomes, Human, Pair 7: A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.Mosaicism: The occurrence in an individual of two or more cell populations of different chromosomal constitutions, derived from a single ZYGOTE, as opposed to CHIMERISM in which the different cell populations are derived from more than one zygote.DNA Restriction Enzymes: Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.Molecular Biology: A discipline concerned with studying biological phenomena in terms of the chemical and physical interactions of molecules.Thalassemia: A group of hereditary hemolytic anemias in which there is decreased synthesis of one or more hemoglobin polypeptide chains. There are several genetic types with clinical pictures ranging from barely detectable hematologic abnormality to severe and fatal anemia.Eye Abnormalities: Congenital absence of or defects in structures of the eye; may also be hereditary.alpha-Thalassemia: A disorder characterized by reduced synthesis of the alpha chains of hemoglobin. The severity of this condition can vary from mild anemia to death, depending on the number of genes deleted.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.Embryo, Mammalian: The entity of a developing mammal (MAMMALS), generally from the cleavage of a ZYGOTE to the end of embryonic differentiation of basic structures. For the human embryo, this represents the first two months of intrauterine development preceding the stages of the FETUS.DNA, Neoplasm: DNA present in neoplastic tissue.Viral Proteins: Proteins found in any species of virus.Epistasis, Genetic: A form of gene interaction whereby the expression of one gene interferes with or masks the expression of a different gene or genes. Genes whose expression interferes with or masks the effects of other genes are said to be epistatic to the effected genes. Genes whose expression is affected (blocked or masked) are hypostatic to the interfering genes.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Open Reading Frames: A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).HLA-DRB1 Chains: A subtype of HLA-DRB beta chains that includes over one hundred allele variants. The HLA-DRB1 subtype is associated with several of the HLA-DR SEROLOGICAL SUBTYPES.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.Chromosome Disorders: Clinical conditions caused by an abnormal chromosome constitution in which there is extra or missing chromosome material (either a whole chromosome or a chromosome segment). (from Thompson et al., Genetics in Medicine, 5th ed, p429)Immunohistochemistry: Histochemical localization of immunoreactive substances using labeled antibodies as reagents.Haloferax volcanii: A species of halophilic archaea found in the Dead Sea.Hemoglobin H: An abnormal hemoglobin composed of four beta chains. It is caused by the reduced synthesis of the alpha chain. This abnormality results in ALPHA-THALASSEMIA.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Cyclin-Dependent Kinase Inhibitor p15: An INK4 cyclin-dependent kinase inhibitor containing four ANKYRIN-LIKE REPEATS. INK4B is often inactivated by deletions, mutations, or hypermethylation in HEMATOLOGIC NEOPLASMS.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Gene Expression Regulation, Developmental: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.Chromosomes, Human, Pair 1: A specific pair of human chromosomes in group A (CHROMOSOMES, HUMAN, 1-3) of the human chromosome classification.Gene Expression Profiling: The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.Deoxyribonucleases, Type II Site-Specific: Enzyme systems containing a single subunit and requiring only magnesium for endonucleolytic activity. The corresponding modification methylases are separate enzymes. The systems recognize specific short DNA sequences and cleave either within, or at a short specific distance from, the recognition sequence to give specific double-stranded fragments with terminal 5'-phosphates. Enzymes from different microorganisms with the same specificity are called isoschizomers. EC 3.1.21.4.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Genetic Association Studies: The analysis of a sequence such as a region of a chromosome, a haplotype, a gene, or an allele for its involvement in controlling the phenotype of a specific trait, metabolic pathway, or disease.Genetics, Population: The discipline studying genetic composition of populations and effects of factors such as GENETIC SELECTION, population size, MUTATION, migration, and GENETIC DRIFT on the frequencies of various GENOTYPES and PHENOTYPES using a variety of GENETIC TECHNIQUES.Genes, Viral: The functional hereditary units of VIRUSES.DNA Copy Number Variations: Stretches of genomic DNA that exist in different multiples between individuals. Many copy number variations have been associated with susceptibility or resistance to disease.Gene Order: The sequential location of genes on a chromosome.Suppression, Genetic: Mutation process that restores the wild-type PHENOTYPE in an organism possessing a mutationally altered GENOTYPE. The second "suppressor" mutation may be on a different gene, on the same gene but located at a distance from the site of the primary mutation, or in extrachromosomal genes (EXTRACHROMOSOMAL INHERITANCE).Recombinant Proteins: Proteins prepared by recombinant DNA technology.Oligonucleotide Array Sequence Analysis: Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.Tumor Suppressor Proteins: Proteins that are normally involved in holding cellular growth in check. Deficiencies or abnormalities in these proteins may lead to unregulated cell growth and tumor development.Williams Syndrome: A disorder caused by hemizygous microdeletion of about 28 genes on chromosome 7q11.23, including the ELASTIN gene. Clinical manifestations include SUPRAVALVULAR AORTIC STENOSIS; MENTAL RETARDATION; elfin facies; impaired visuospatial constructive abilities; and transient HYPERCALCEMIA in infancy. The condition affects both sexes, with onset at birth or in early infancy.Genes, Recessive: Genes that influence the PHENOTYPE only in the homozygous state.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.22q11 Deletion Syndrome: Condition with a variable constellation of phenotypes due to deletion polymorphisms at chromosome location 22q11. It encompasses several syndromes with overlapping abnormalities including the DIGEORGE SYNDROME, VELOCARDIOFACIAL SYNDROME, and CONOTRUNCAL AMOMALY FACE SYNDROME. In addition, variable developmental problems and schizoid features are also associated with this syndrome. (From BMC Med Genet. 2009 Feb 25;10:16) Not all deletions at 22q11 result in the 22q11deletion syndrome.Genome, Bacterial: The genetic complement of a BACTERIA as represented in its DNA.Muscular Dystrophy, Duchenne: An X-linked recessive muscle disease caused by an inability to synthesize DYSTROPHIN, which is involved with maintaining the integrity of the sarcolemma. Muscle fibers undergo a process that features degeneration and regeneration. Clinical manifestations include proximal weakness in the first few years of life, pseudohypertrophy, cardiomyopathy (see MYOCARDIAL DISEASES), and an increased incidence of impaired mentation. Becker muscular dystrophy is a closely related condition featuring a later onset of disease (usually adolescence) and a slowly progressive course. (Adams et al., Principles of Neurology, 6th ed, p1415)DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Green Fluorescent Proteins: Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.Genes, Reporter: Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.Operon: In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.Genome, Human: The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.INDEL Mutation: A mutation named with the blend of insertion and deletion. It refers to a length difference between two ALLELES where it is unknowable if the difference was originally caused by a SEQUENCE INSERTION or by a SEQUENCE DELETION. If the number of nucleotides in the insertion/deletion is not divisible by three, and it occurs in a protein coding region, it is also a FRAMESHIFT MUTATION.Biosynthetic Pathways: Sets of enzymatic reactions occurring in organisms and that form biochemicals by making new covalent bonds.Transgenes: Genes that are introduced into an organism using GENE TRANSFER TECHNIQUES.Cell Cycle Proteins: Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.Germ-Line Mutation: Any detectable and heritable alteration in the lineage of germ cells. Mutations in these cells (i.e., "generative" cells ancestral to the gametes) are transmitted to progeny while those in somatic cells are not.Chromosomes, Artificial, Bacterial: DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.Trans-Activators: Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.Adrenal Hyperplasia, Congenital: A group of inherited disorders of the ADRENAL GLANDS, caused by enzyme defects in the synthesis of cortisol (HYDROCORTISONE) and/or ALDOSTERONE leading to accumulation of precursors for ANDROGENS. Depending on the hormone imbalance, congenital adrenal hyperplasia can be classified as salt-wasting, hypertensive, virilizing, or feminizing. Defects in STEROID 21-HYDROXYLASE; STEROID 11-BETA-HYDROXYLASE; STEROID 17-ALPHA-HYDROXYLASE; 3-beta-hydroxysteroid dehydrogenase (3-HYDROXYSTEROID DEHYDROGENASES); TESTOSTERONE 5-ALPHA-REDUCTASE; or steroidogenic acute regulatory protein; among others, underlie these disorders.DiGeorge Syndrome: Congenital syndrome characterized by a wide spectrum of characteristics including the absence of the THYMUS and PARATHYROID GLANDS resulting in T-cell immunodeficiency, HYPOCALCEMIA, defects in the outflow tract of the heart, and craniofacial anomalies.Spores, Fungal: Reproductive bodies produced by fungi.Chromosomes, Bacterial: Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.
Two gene loci and so four alleles exist. It is also connected to the deletion of the 16p chromosome. α Thalassemias result in ... The severity of alpha and beta thalassemia depends on how many of the four genes for alpha globin or two genes for beta globin ... The β globin chains are encoded by a single gene on chromosome 11; α globin chains are encoded by two closely linked genes on ... Deletion of one of the α loci has a high prevalence in people of African or Asian descent, making them more likely to develop α ...
People have two copies of the HBA2 gene in each cell. Each copy is called an allele. For each gene, one allele is inherited ... Alpha Thalassemia typically results from deletion involving the HBA1 and HBA2 genes. Both of these genes provide instructions ... Normally each person has four genes for alpha globin, Alpha thalassemia happens when one or more of the genes that control the ... It's carried in the genes and passed on from parents to children. People who are carriers of a thalassemia gene show no ...
It is an deletion/insertion polymorphism (DIP). The 9-repeat and the 10-repeat are the most common alleles. https://www.ncbi. ... In genetics, rs28363170 (DAT1-VNTR) is a genetic variation at SLC6A3, the gene that encodes the dopamine transporter. It is ... A. Sano; K. Kondoh; Y. Kakimoto (May 1993). "A 40-nucleotide repeat polymorphism in the human dopamine transporter gene". Human ...
Insertion/deletion is an intronic polymorphism of LRPAP gene, Influencing DD genotype and D allele for the synthesis of LRPAP ... Also insertion allele being larger than deletion allele makes possible in detecting difference by gel electrophoresis. ... The studies suggested that DD genotype and *D allele of LRPAP gene showed increased frequency for degenerative dementias on ... Pandey P, Pradhan S, Mittal B (2008). "LRP-associated protein gene (LRPAP1) and susceptibility to degenerative dementia". Genes ...
Sequencing of the agouti signalling peptide in the agouti gene coding region revealed a 2-base pair deletion in black domestic ... Ten unrelated melanistic jaguars were either homozygous or heterozygous for this allele. A 24-base pair deletion causes the ... These data suggest the near fixation of the dark allele in the region. The expected time to fixation of this recessive allele ... Melanistic animals were found to carry at least one copy of a mutant MC1R sequence allele, bearing a 15-base pair inframe ...
There are two wild-type alleles of this gene-a high-expressivity allele and a low-expressivity allele. When the mutant gene is ... of 28 genes led by the deletion of ~1.6 Mb. These dosage-sensitive genes are vital for human language and constructive ... A haploinsufficient gene is described as needing both alleles to be functional in order to express the wild type. A mutation is ... One of the two copies of the gene may be missing due to a deletion. The message or protein produced by the cell may be unstable ...
... beta-thalassemia alleles can be created by many different mutations including both deletion and non-deletion forms. Patient may ... A sickle allele is always the same mutation of the beta-globin gene (glutamic acid to valine at amino acid six). In contrast, ... Ashley-Koch, A; Yang, Q; Olney, R. S. (2000). "Sickle hemoglobin (HbS) allele and sickle cell disease: A HuGE review". American ... Ashley-Koch, A; Yang, Q; Olney, R. S. (2000). "Sickle hemoglobin (HbS) allele and sickle cell disease: A HuGE review". American ...
"Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene". Science. 273 ... As of April 2013, two primary approaches are being pursued in the search for a HIV cure: The first is gene therapy that aims to ... In the past 7 years, scientists have been using different approaches of stem cell based gene therapy in an attempt to develop a ... Experimental long-term in vivo HIV gene therapy have had huge issues due to both transduction ending in multiple copies of ...
Key: In the following sections, alleles are referred to as +=wildtype, m=mutant, Df=gene deletion, Dp=gene duplication. ... Hypermorphic alleles are gain of function alleles. A hypermorph can result from an increase in gene dose (a gene duplication), ... The phenotype of a hypomorph is more severe in trans to a deletion allele than when homozygous. m/DF > m/m Hypomorphs are ... Muller's classification of mutant alleles Muller, H. J. 1932. Further studies on the nature and causes of gene mutations. ...
Humans with a deletion in one allele of the GAP43 gene fail to form telencephalic commissures and are mentally retarded. Model ... Growth Associated Protein 43 also known as GAP43 is a protein that in humans is encoded by the GAP43 gene. GAP43 has been ... "Entrez Gene: GAP43 growth associated protein 43". Benowitz LI, Routtenberg A (Feb 1997). "GAP-43: an intrinsic determinant of ... Nielander HB, De Groen PC, Eggen BJ, Schrama LH, Gispen WH, Schotman P (Sep 1993). "Structure of the human gene for the neural ...
"Characterization of a deletion allele of a sorghum Myb gene yellow seed1 showing loss of 3-deoxyflavonoids". Plant Science. 169 ... The p1 gene encodes an Myb-homologous transcriptional activator of genes required for biosynthesis of red phlobaphene pigments ... gene which encodes an R2R3 myb-like transcriptional activator of the A1 gene encoding for the dihydroflavonol 4-reductase ( ... homologous P gene controls phlobaphene pigmentation in maize floral organs by directly activating a flavonoid biosynthetic gene ...
It is caused by a deletion or mutation of the maternal allele for the ubiquitin protein ligase E3A. UBE3A is expressed in most ... However, in neurons only the maternal copy of the gene is expressed. UBE3A is located on chromosome 15 and the paternal copy ... Treatment involves unsilencing the paternal allele allowing the normal paternal UBE3A allele to be transcribed. UBE3A, in ... The maternal copy control center of the gene is methylated, suppressing transcription in the antisense direction while the ...
CCR5-Δ32 is an allelic variant of CCR5 gene with a 32 base pair deletion that results in a truncated receptor. People with this ... Although this allele originated much earlier, its frequency rose dramatically about 700 years ago. This led scientists to ... Many in vivo mouse studies have refuted this claim by showing no protective effects of CCR5-Δ32 allele in mice infected with Y ... An unusually high frequency of this allele is found in European Caucasian population, with an observed cline towards the north ...
This locus consists of 8-10 protein-coding genes, specifically expressed from the maternal allele (including the KCNQ1 gene), ... The deletion of KCNQ1OT1 in males can result in a removal of the repressor in six cis genes. Offspring from the males that had ... KCNQ1OT1 is a paternally expressed allele and KCNQ1 is a maternally expressed allele. KCNQ1OT1 is a nuclear, 91 kb transcript, ... and the paternally expressed non-coding RNA gene KCNQ1OT1. KCNQ1OT1 and KCNQ1 are imprinted genes and are part of an imprinting ...
... deletion in both alleles. Researchers have since reported more efficient Cre-Lox conditional gene mutagenesis in the developing ... "Deletion of the DNA polymerase beta gene in T cells using tissue-specific gene targeting". Science. 265: 103-106. doi:10.1126/ ... 1995). "T-cell specific deletion of a polypeptide N-acetylgalactosaminyltransferase gene by site-directed recombination". Proc ... Placing Lox sequences appropriately allows genes to be activated, repressed, or exchanged for other genes. At a DNA level many ...
Sep 1996). "Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene. ... CCR5-Δ32 (or CCR5-D32 or CCR5 delta 32) is an allele of CCR5. CCR5 Δ32 is a 32-base-pair deletion that introduces a premature ... Lucotte G (2001). "Distribution of the CCR5 gene 32-basepair deletion in West Europe. A hypothesis about the possible ... A study measuring allele frequencies in 18 European populations found a North-to-South gradient, with the highest allele ...
Altered alleles often occur among children with reading and writing difficulties. The gene appears to have a strong linkage ... But this is controverse since a recent study proposed that there is a "low likelihood of a direct deletion effect on reading ... Doublecortin domain-containing protein 2 is a protein that in humans is encoded by the DCDC2 gene. This gene encodes a protein ... "Entrez Gene: DCDC2 doublecortin domain containing 2". Lind PA, Luciano M, Wright MJ, Montgomery GW, Martin NG, Bates TC (June ...
"Arrangement of the ILT gene cluster: a common null allele of the ILT6 gene results from a 6.7-kbp deletion". European Journal ... "Entrez Gene: LILRA3 leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3". Jones DC, Kosmoliaptsis ... however it is highly homologous to other LILR genes, and can bind human leukocyte antigen (HLA) class I. Therefore, if secreted ... deletion in psoriatic patients and healthy controls". Human Immunology. 64 (4): 458-61. doi:10.1016/S0198-8859(03)00025-9. PMID ...
The mouse homolog to the Jrk mutant is the ClockΔ19 mutant that possesses a deletion in exon 19 of the Clock gene. This ... Clock mutant organisms can either possess a null mutation or an antimorphic allele at the Clock locus that codes for an ... BMAL1 Period gene Suprachiasmatic nucleus Timeless gene Pdf Cycle gene GRCh38: Ensembl release 89: ENSG00000134852 - Ensembl, ... Nascent research in the expression of circadian genes in adipose tissue suggests that suppression of the CLOCK gene may ...
LOH occurs when one allele of a gene is mutated in a deleterious way and the normally-functioning allele is lost. LOH occurs ... Other chip-based methods such as comparative genomic hybridization can detect genomic gains or deletions leading to LOH. SNP ... If the mother's allele is missing and the child has two copies of the father's mutant allele, disease can occur. High density ... If a person has one mutated and dysfunctional copy of a tumor suppressor gene and his second, functional copy of the gene gets ...
... the deletion of a 32-bp segment results in a nonfunctional receptor, thus preventing HIV entry; two copies of this gene provide ... This allele is found in around 10% of Europeans but is rare in Africans and Asians. Multiple studies of HIV-infected persons ... Wade, Nicholas (July 18, 2008). "Gene Variation May Raise Risk of H.I.V., Study Finds". New York Times. Retrieved 2008-09-06. ... They first reviewed the role of genes in encoding chemokine receptors (CCR5 and CCR2) and chemokines (SDF-1). While CCR5 has ...
Niu T, Chen X, Xu X (2002). "Angiotensin converting enzyme gene insertion/deletion polymorphism and cardiovascular disease: ... Mar 2007). "Angiotensin-converting enzyme gene polymorphism and allele frequencies in the Lebanese population: prevalence and ... People carrying the I-allele usually have lower ACE levels while people carrying the D-allele have higher ACE levels. People ... During physical exercise the blood pressure of D-allele carriers will therefore increase sooner than for I-allele carriers. ...
Deletion of 1 or 2 alleles is clinically silent. Deletion of 3 alleles causes HbH disease, resulting in anemia and ... Coelho A, Picanço I, Seuanes F, Seixas MT, Faustino P (Aug 2010). "Novel large deletions in the human alpha-globin gene cluster ... Deletion of all 4 alleles is lethal because it renders the body unable to make fetal hemoglobin (HbF), adult hemoglobin (HbA) ... Alpha-thalassemias most commonly result from deletions of any of the four alpha alleles, although some alpha thalassemias have ...
Bohne W, von Figura K, Gieselmann V (1991). "An 11-bp deletion in the arylsulfatase A gene of a patient with late infantile ... Nelson PV, Carey WF, Morris CP (1991). "Population frequency of the arylsulphatase A pseudo-deficiency allele". Hum. Genet. 87 ... 1992). "Terminal 22q deletion associated with a partial deficiency of arylsulphatase A". J. Med. Genet. 29 (6): 432-3. doi: ... Kreysing J, von Figura K, Gieselmann V (1990). "Structure of the arylsulfatase A gene". Eur. J. Biochem. 191 (3): 627-31. doi: ...
... that are able to verify that there are most frequently really two alleles of each, so we can be sure that there is no gene ... deletion. Family genealogies have proven many times, that parallel changes on all markers located on the same palindrome are ... From a pair of equivalent ("homologous"), but slightly different (heterozygous) genes, a pair of identical genes results. In ... Null allele Paternal mtDNA transmission List of genetic genealogy topics RecLOH explained. ...
In many cases, genotypic interactions between the two alleles at a locus can be described as leading to dominant or recessive, according to which of the two homozygous phenotypes the heterozygote most resembles. Where the heterozygote is indistinguishable from one of the homozygotes, the allele expressed is the one that leads to the dominant phenotype.[6] The degree and pattern of dominance varies among loci. This type of interaction was first formally described by Gregor Mendel. However, many traits defy this simple categorization and the phenotypes are modeled by co-dominance and polygenic inheritance. The term "wild type" allele is sometimes used to describe an allele that is thought to contribute to the typical phenotypic character as seen in "wild" populations of organisms, such as fruit flies (Drosophila melanogaster). Such a "wild type" allele was historically regarded as leading to a dominant (overpowering - always expressed), common, and normal phenotype, in contrast to "mutant" ...
The stepwise mutation model (SMM) is a mathematical theory, developed by Motoo Kimura and Tomoko Ohta, that allows for investigation of the equilibrium distribution of allelic frequencies in a finite population where neutral alleles are produced in step-wise fashion. The original model assumes that if an allele has a mutation that causes it to change in state, mutations that occur in repetitive regions of the genome will increase or decrease by a single repeat unit at a fixed rate (i.e. by the addition or subtraction of one repeat unit per generation) and these changes in allele states are expressed by an integer (. . . A-1, A, A1, .. .). The model also assumes random mating and that all alleles are selectively equivalent for each locus. The SMM is distinguished from the Kimura-Crow model, also known as the infinite alleles model (IAM), in that as the population size increases to infinity, while the product of the Ne ...
When a previously stable population undergoes inbreeding, if nothing else changes, natural selection should consist mainly of purging. The joint consequences of inbreeding and purging on fitness vary depending on many factors: the previous history of the population, the rate of increase of inbreeding, the harshness of the environment or of the competitive conditions, etc. The effects of purging were first noted by Darwin[10] in plants, and have been detected in laboratory experiments and in vertebrate populations undergoing inbreeding in zoos or in the wild, as well as in humans.[11] The detection of purging is often obscured by many factors, but there is consistent evidence that, in agreement with the predictions explained above, slow inbreeding results in more efficient purging, so that a given inbreeding F leads to less threat to population viability if it has been produced more slowly.[12] Nevertheless, in practical situations, the genetic change in fitness also depends ...
In epigenetics, a paramutation is an interaction between two alleles at a single locus, whereby one allele induces a heritable change in the other allele. The change may be in the pattern of DNA methylation or histone modifications. The allele inducing the change is said to be paramutagenic, while the allele that has been epigenetically altered is termed paramutable. A paramutable allele may have altered levels of gene expression, which may continue in offspring which inherit that allele, even though the paramutagenic allele may no longer be present. Through proper breeding, paramutation can result in sibling plants that have the same genetic sequence, but with drastically different phenotypes. Though studied primarily in maize, paramutation has been described in a number of other systems, including animal systems like Drosophila melanogaster and mice. ...
... is the phenomenon in which different mutations at the same locus cause the same phenotype. These allelic variations can arise as a result of natural selection processes, as a result of exogenous mutagens, genetic drift, or genetic migration. Many of these mutations take the form of single nucleotide polymorphisms in which a single nucleotide base is altered compared to a consensus sequence. They can also exist as copy number variants (CNV) in which the copies of a gene or DNA sequence is different from the population. Mutated alleles expressing allelic heterogeneity can be classified as adaptive or disadaptive. These mutations can occur in the germ line cells, somatic cells, or in the mitochondrial. Mutations in germ line cells can be inherited as well as mitochondrial allelic mutations. The mitochondrial allelic mutations are inherited maternally. ...
An allele is a form of a gene at a particular position (locus) on a chromosome.[1]15 It is the bit of coding DNA at that place.[2]p6 Typical plants and animals have two sets of chromosomes, one set inherited from each parent.[1]123 These organisms are called diploid. Since such organisms have two sets of chromosomes, they have (except on the sex chromosomes) two alleles at each gene locus.[2]p6 If the two alleles are identical, the individual is called a homozygote and is said to be homozygous. If instead the two alleles are different, the individual is a heterozygote and is heterozygous.[1]205 ...
The distinction between genotype and phenotype is commonly experienced when studying family patterns for certain hereditary diseases or conditions, for example, hemophilia. Humans and most animals are diploid; thus there are two alleles for any given gene. These alleles can be the same (homozygous) or different (heterozygous), depending on the individual (see zygote). With a dominant allele, the offspring is guaranteed to inherit the trait in question irrespective of the second allele.. In the case of an albino with a recessive allele (aa), the phenotype depends upon the other allele (Aa, aA, aa or AA). An affected person mating with a heterozygous individual (Aa or aA, also carrier) there is a 50-50 chance the offspring will be albino's phenotype. If a heterozygote mates with another heterozygote, there is 75% chance passing the gene on and only a 25% chance that the gene ...
... (B15) is an HLA-B serotype. The serotype identifies the B*15 gene-allele protein products of HLA-B. B15 is a broad antigen can be subdivided into several split antigens that are often used in characterization. These are B62, B63, B70, B71, B72, B75, B76, B77. B*15 is the largest allele grouping for any known human autosomal locus, identified as of August 2008 there are more than 150 alleles and ~140 amino acid sequence variants from those gene products. Some of these alleles are discussed below. Other alleles, such as B*46 evolved from B*15. One reason for the diversity of this group is that B15 is among a group of alleles enriched in the original humans that left Africa and dispersed across East Asia and Australia. As people traveled east the frequency of many alleles dropped or disappeared from migrants. However B*15 persisted, expanded and ...
An allele, or allel, is ane o a nummer o alternative forms o the same gene or same genetic locus.[1][2] Whiles, different alleles can result in different observable phenotypic traits, such as different pigmentation. Houiver, maist genetic variations result in little or no observable variation. ...
... is the part of genetics that is solely about the method in which genetic traits are transmitted via the acts of reproduction. Genetics is, generally, the study of genes, genetic variation, and heredity. The process by which characteristics are passed down from parents to their offspring is called heredity. In the sense of classical genetics, variation is known as the lack of resemblance in related individuals and can be categorized as discontinuous or continuous. Genes are a fundamental part of DNA that is aligned linearly on a eukaryotic chromosome. Chemical information that is transported and encoded by each gene is referred to as a trait. Many organisms possess two ...
It follows that any systematic change in the frequency of alleles in a population must be due to the effect of one or more of these causes. Of course, like all aspects of Mendelian inheritance, the expected proportions of alleles are probabilities. It was for that reason that statistical tests of significance, such as standard errors, were developed. Although all changes must be due to perturbations, not all perturbations lead to changes. The classic case is balancing selection, such as heterozygote advantage: "Heterosis: the heterozygote at a locus is fitter than either homozygote".[4][5][6] Balancing selection leads to an equilibrium population with Hardy-Weinberg proportions ...
It follows that any systematic change in the frequency of alleles in a population must be due to the effect of one or more of these causes. Of course, like all aspects of Mendelian inheritance, the expected proportions of alleles are probabilities. It was for that reason that statistical tests of significance, such as standard errors, were developed. Although all changes must be due to perturbations, not all perturbations lead to changes. The classic case is balancing selection, such as heterozygote advantage: "Heterosis: the heterozygote at a locus is fitter than either homozygote".[4][5][6] Balancing selection leads to an equilibrium population with Hardy-Weinberg proportions ...
In population genetics, Ewens' sampling formula, describes the probabilities associated with counts of how many different alleles are observed a given number of times in the sample. Ewens' sampling formula, introduced by Warren Ewens, states that under certain conditions (specified below), if a random sample of n gametes is taken from a population and classified according to the gene at a particular locus then the probability that there are a1 alleles represented once in the sample, and a2 alleles represented twice, and so on, is Pr ⁡ ( a 1 , … , a n ; θ ) = n ! θ ( θ + 1 ) ⋯ ( θ + n − 1 ) ∏ j = 1 n θ a j j a j a j ! , {\displaystyle \operatorname {Pr} (a_{1},\dots ,a_{n};\theta )={n! \over \theta (\theta +1)\cdots (\theta +n-1)}\prod _{j=1}^{n}{\theta ^{a_{j}} \over j^{a_{j}}a_{j}!},} for some positive number θ representing the population mutation rate, whenever a1, ..., ak is a sequence of ...
Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men. The Suita Study ... Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men ... Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men ... Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men ...
2017) Micropublication: biology "Novel deletion alleles of a C. elegans gene Y48E1C.1, named as tm5468, tm5625 and ...." ... 2017) Micropublication: biology "Novel deletion alleles of a C. elegans gene Y48E1C.1, named as tm5468, tm5625 and ...." ... 2017) Micropublication: biology "Novel deletion alleles of a C. elegans gene Y48E1C.1, named as tm5468, tm5625 and ...." ... Start here to access encyclopedic information about the worm genome and its genes, proteins, and other encoded features… Find ...
Genetic Restriction of HIV-1 Infection and Progression to AIDS by a Deletion Allele of the CKR5 Structural Gene ... Genetic Restriction of HIV-1 Infection and Progression to AIDS by a Deletion Allele of the CKR5 Structural Gene ... Genetic Restriction of HIV-1 Infection and Progression to AIDS by a Deletion Allele of the CKR5 Structural Gene ... Genetic Restriction of HIV-1 Infection and Progression to AIDS by a Deletion Allele of the CKR5 Structural Gene ...
Deletion of one allele of the Pex11β gene slightly increased the abundance of peroxisomes, whereas the deletion of both alleles ... In Pex11β-deficient mice, we observed that the deletion of a single allele of the Pex11β gene (Pex11β+/− heterozygous mice) ... Deletion of a single allele of the Pex11β gene is sufficient to cause oxidative stress, delayed differentiation and neuronal ... Deletion of a single allele of the Pex11β gene is sufficient to cause oxidative stress, delayed differentiation and neuronal ...
Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand. Barry R. Palmer, ... Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand ... Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand ... Absence of a NPR-A Gene Functional Deletion Allele in a Postmyocardial Infarction Cohort From New Zealand ...
Genes Chromosomes Cancer. 1994 May;10(1):1-6. Research Support, Non-U.S. Govt; Research Support, U.S. Govt, P.H.S. ... Genes Chromosomes Cancer. 1994 May;10(1):1-6.. Deletion mapping reveals two regions of chromosome 8 allele loss in colorectal ... Although at least four different genes have been implicated in the process, the detection of allele loss from other regions of ... To define the region of common deletion containing the putative tumor suppressor gene, we analyzed a series of 87 carcinomas ...
30-kb deletion forming monomodular alleles that carry chimeric CYP21A1P/A2 genes corresponds to ~9% of disease-causing alleles ... large gene conversions or mutations in CYP21A2 gene. The human gene is located at 6p21.3 within a locus containing the genes ... Twenty patients carrying at least one allele with C4/CYP21 30-kb deletion were included in the study. An allele carrying a ... Alleles were first selected after Southern blotting. The composition of CYP21A1P/A2 chimeric genes was investigated by ASO-PCR ...
We analysed the distribution of genotypes and allele frequencies of the insertion/deletion (I/D) polymorphism in the ACE gene ... Carrier-state of D allele in ACE gene insertion/deletion polymorphism is associated with coronary artery disease, in contrast ... Angiotensin converting enzyme gene deletion allele is independently and strongly associated with coronary atherosclerosis and ... angiotensin converting enzyme gene (ACE) coronary artery disease methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms ...
Higher prevalence of deletion allele in angiotensin converting enzyme gene among type 2 diabetic subjects with lower estimated ... The aim of the study was to determine the angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism in ... The ID and DD genotype of ACE gene confers a greater role in genetic variations underlying high risk stage of CKD especially in ...
We report tm6429 and tm6475 as novel deletion alleles of the gene Y73E7A.1 that is a homologue of mammalian Coiled-coil domain ... The alleles were isolated from the comprehensive screening of gene deletions generated by TMP/UV3. In the screening, both the ... Suehiro, Y; Yoshina, S; Hori, S; Mitani, S (2017). Novel deletion alleles of a C. elegans gene Y73E7A.1, named as tm6429 and ... 355 bp deletion + 1 bp insertion (T)] - TTAAAAATGAGAAAAAATGGGGAAAAAATT and CAAACGCGCTCTATGGAGAATGTGGAATTA- [242 bp deletion] - ...
mutations affects gene structure: Why are truncated. proteins made in each case? b. How would you classify the mutant alleles? ... The different mutations like G to A transition, base deletion, and C to G transversion in the different exons of the SCN9A gene ... gene called SCN9A cause complete insensitivity to. pain (congenital pain insensitivity or CPA) and a total. lack of the sense ... The SCN9A gene encodes for a sodium ion channel that is dependent on voltage. It is composed of 26 exons and its exact ...
Insertion of gene trap vector. Intergenic deletion. Intragenic deletion. Inversion. Not Applicable. Not Specified. Nucleotide ... Allele Attributes Conditional ready. Recombinase. RMCE-ready. Inserted expressed sequence. Humanized sequence. Reporter. ... Deletion. Disruption caused by insertion of vector. Duplication. Insertion. ... Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse ...
1 Center for Transgene Technology and Gene Therapy, Flanders Interuniversity Institute for Biotechnology, Leuven, Belgium. ... Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele Nature. 1996 Apr 4;380(6573):435-9. doi ... is unprecedented for a targeted autosomal gene inactivation, and is indicative of a tight dose-dependent regulation of ... Gene Deletion * Heterozygote * Homozygote * Lymphokines / deficiency * Lymphokines / genetics* * Lymphokines / physiology* * ...
Uniparental inheritance of microsatellite alleles of the cystic fibrosis gene (CFTR): Identification of a 50 kilobase deletion ... Uniparental inheritance of microsatellite alleles of the cystic fibrosis gene (CFTR) : Identification of a 50 kilobase deletion ... Uniparental inheritance of microsatellite alleles of the cystic fibrosis gene (CFTR): Identification of a 50 kilobase deletion ... Uniparental inheritance of microsatellite alleles of the cystic fibrosis gene (CFTR) : Identification of a 50 kilobase deletion ...
deletion/duplication defect. alleles. different forms that genes can take at a certain locus on the chromosome. ... outward appearance of individual r/t gene and environment. heterozygote. loci affect of one allele may mask another when they ... x-linked recessive gene; p. 154 ). cystic fibrosis. autosomal recessive gene (homozygous, aa, to be expressed, long arm of ... gene cell therapy. not presently happening, but is the process of inserting genes into embryo-alter future descentants as well ...
Loss of wtL9 Allele by 6132A-PRO Cells Is due to its Deletion from Chromosome 5.. The absence of the wtL9 allele in the 6132A- ... Mutation of one allele of a regulatory gene, followed by inactivation of the second allele by loss (as we observe with L9) or ... but also that neither tumor retains a normal allele. In 6139B-PRO, we find that both alleles of the L26 gene are mutant; each ... only two different mL26 alleles and no wtL26 alleles were detected (Table 1). This indicated that no wtL26 gene remained in the ...
Deletion allele of the angiotensin-converting enzyme gene as a risk factor for pneumonia in elderly patients.. Morimoto S1, ... Because the insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene (ACE) has been associated ... The ACE DD allele (vs. ID + II) was associated with an increased risk of pneumonia (relative risk [RR] = 2.9; 95% confidence ... The ACE D allele is an independent risk factor for pneumonia in elderly persons. ...
1. Deletion of the 4.3 kb SCE from the Oct-6 locus. (A) Gene targeting scheme for the Oct-6 SCE. The SCE is indicated with a ... 4. The ΔSCE allele is a hypomorphic allele of Oct-6. (A) Comparison of sciatic nerve morphology in Oct-6ΔSCE/ΔSCE (a) and Oct-6 ... 5. Oct-6 expression is lost in Schwann cells of mice homozygous for the ΔSCE allele. (A) Homozygous deletion of the SCE results ... In this study we have generated a Schwann cell-specific Oct-6 allele through deletion of the Schwann cell-specific enhancer ...
... and adapted chromosomal gene replacement technology to manipulate the viral genome. This technology exploits the power of ... is a new platform for gene therapy. We cloned the human herpesvirus HSV-1 strain F genome into a bacterial artificial ... Allele Replacement: An Application That Permits Rapid Manipulation of Herpes Simplex Virus Type 1 Genomes Gene Ther. 1999 May;6 ... Gene Deletion* * Gene Transfer Techniques* * Genetic Vectors / genetics* * Genome, Viral * Herpesvirus 1, Human / genetics* ...
Two gene loci and so four alleles exist. It is also connected to the deletion of the 16p chromosome. α Thalassemias result in ... The severity of alpha and beta thalassemia depends on how many of the four genes for alpha globin or two genes for beta globin ... The β globin chains are encoded by a single gene on chromosome 11; α globin chains are encoded by two closely linked genes on ... Deletion of one of the α loci has a high prevalence in people of African or Asian descent, making them more likely to develop α ...
Generating loss-of-function alleles by targeted intragenic deletion. 4. Redundancy of essential genes. 5. Pleiotropic essential ... An essential gene is defined here as a gene necessary for growth to a fertile adult. Some essential genes were identified ... null alleles generated by targeted deletions will be inadequate for full understanding of essential gene functions. ... deletions in targeted genes. The worms carrying the deletions are enriched and eventually isolated by sibling selection schemes ...
Deletion alleles of bocks were generated by imprecise deletion of a P element inserted at +11 in the bocksCB03586 allele ( ... A) Structure of the bocks locus, including a portion of the uncharacterized CG8312 gene and the overlapping P581PK gene. The ... and adults homozygous for one of the two bocks deletion alleles. The Western blot was probed with antibodies against Bocks and ... A) Three genes encode nuclear lamina-enriched LEM-D proteins, otefin (ote), dMAN1, and bocksbeutel (bocks). All of the encoded ...
progression to AIDS by a deletion. allele of the CKR5 structural gene.. ... The isolation and characterization of multiple alleles for thousands of other disease-associated genes is on the way. This ... of the many molecular mechanisms of diseases caused by novel alleles, while not losing sight of other causes, in particular ... new knowledge about disease-associated human alleles. ... Lee, C-K, et al, 1999. Gene. expression profile of aging and ...
Deletion of Cox-2 alleles leads to similar effects to those by the ASA treatment. The results discussed earlier led us to ... 3B). When we evaluated the effects of Cox-2 gene status on chemokine expressions in the TME, the Cox-2−/− mice exhibited lower ... Deletion of Cox-2 alleles leads to similar effects to those by the ASA treatment. Gliomas were induced in C57BL/6 background ... C57BL/6 background mice deficient for the following genes were obtained from The Jackson Laboratory: Cox-2, Ccl2, and Cxcl10 (C ...
  • By Sanger sequencing, the 30bp flanking sequences of the alleles tm6429 and tm6475 were identified as TTTTAAATCGATTTTTGAGCACCAAAATTA- [355 bp deletion + 1 bp insertion (T)] - TTAAAAATGAGAAAAAATGGGGAAAAAATT and CAAACGCGCTCTATGGAGAATGTGGAATTA- [242 bp deletion] - TTTTATATAGGATTTTAATTTTCAGGCCAC, respectively. (micropublication.org)
  • Cases of dominantly inherited α- and β-thalassemias have been reported, the first of which was in an Irish family with two deletions of 4 and 11 bp in exon 3 interrupted by an insertion of 5 bp in the β-globin gene. (wikipedia.org)
  • it is called the insertion, or I, allele. (medlineplus.gov)
  • Gene disruption has been accomplished through successive transformations with insertion/deletion alleles that are constructed in vitro ( 2 , 7 , 12 ). (asm.org)
  • RESULTS -In DIABHYCAR, the primary outcome and most of its components were not affected by the ACE insertion/deletion genotype. (diabetesjournals.org)
  • Two CA9 SNPs in exons, including rs2071676 (+201, G/A) in exon 1 and rs3829078 (+1081, A/G) in exon 7, rs1048638 (+1584, C/A) in 3′-untranslated region of exon 11, as well as an 18-base pair deletion/insertion (376deltion393) in exon 1 were selected and their genotypic distributions were determined by real-time polymerase chain reaction. (medsci.org)
  • They affect more nucleotides per genome than SNP variation [ 2 ] and contribute significantly to variation among normal individuals, both in levels of gene expression and in phenotypes of medical relevance [ 3 , 4 ]. (hindawi.com)
  • This test covers all coding nucleotides of genes PRSS1, SPINK1 , and CFTR , plus at least two and typically 20 flanking intronic nucleotides upstream and downstream of each coding exon, covering the conserved donor and acceptor splice sites, as well as typically 20 flanking nucleotides in the 5′ and 3′ UTR. (labcorp.com)
  • Including environmental risk along with genetics is important in studying the aetiology of MDD and PRS provide a useful approach to investigating gene-environment interactions in complex traits. (cambridge.org)
  • It was therefore of interest to investigate the polymorphic condition of UGT 2B genes in the Indian families as family studies are more robust to population stratification. (hindawi.com)
  • Here we used a mouse model of MHC-matched HCT with C57BL/6 donors and MHC-congenic BALB.B recipients that only differ in polymorphic autosomal background genes, including minor-H loci coding for minor-H antigens (minor-HAg). (frontiersin.org)
  • To generalize our results, we searched for genic deletions that are polymorphic in both humans and chimpanzees. (biomedcentral.com)
  • While the rs12979860 IFNL3 T allele was found a good marker associated with HCV-outcome together with the rs111200466 TLR2 del variant, the rs10204525 PD-1.6 A allele was found to have an insignificant role in patients with HCV-related hepatic disorders. (frontiersin.org)
  • Though in Asian patients the combination of IFNL3 and PD-1.6 markers better define the HCV-related outcomes, in our series of Caucasian patients the PD-1.6 A-allele variant was observed very rarely. (frontiersin.org)
  • While most of them behave as dominant alleles and have been identified in sporadic diseases, recessive CNVs have also been associated with several disorders, either in a homozygous state or as associated with a recessive variant in the other allele. (nature.com)
  • Furthermore, when a variant affects only some isoforms of a gene, it is difficult to infer its impact on gene function without the knowledge of the isoforms that are expressed in the tissue of interest and how their levels of expression affect gene function. (nature.com)
  • Another variant is missing this region of DNA and is called the deletion, or D, allele. (medlineplus.gov)
  • More than 100 CYP2D6 variant alleles have been identified. (medscape.com)
  • The expression of class II genes is dependent on the RNA polymerase-ς 70 holoenzyme (Eς 70 ) and FlhD-FlhC. (asm.org)
  • FliA is then free to associate with the RNA polymerase core enzyme in order to transcribe class III genes ( 10 , 15 ). (asm.org)
  • The Δ SCE allele affects Oct-6 expression in the Schwann cell lineage only. (nih.gov)
  • Their analysis provided a foundation for understanding the complexity of lethal phenotypes as well as insight into the relative contributions of maternal vs. zygotic gene expression to the developmental process (see Wood, 1988 for references and discussion). (wormbook.org)
  • Gene expression of the flagellar system is tightly controlled by external stimuli or intracellular signals. (asm.org)
  • Our results are discussed in the context of a possible regulatory hierarchy controlling flagellar gene expression in R. sphaeroides . (asm.org)
  • In Salmonella enterica serovar Typhimurium, biosynthesis of the flagellum depends on the expression of more than 40 genes. (asm.org)
  • The expression of these genes follows a hierarchical pattern that is highly regulated. (asm.org)
  • FliA is a specific sigma factor (ς 28 ) required for the expression of class III genes, while FlgM is an anti-sigma factor that inhibits FliA activity. (asm.org)
  • Detailed analyses of some structural components of the flagellum have been described, but nothing is known about the factors that regulate gene expression. (asm.org)
  • Gene expression is normalized to mean of nondeletion clones for the same sgRNA pair. (jci.org)
  • C ) ATP2B4 expression in 293T cell clones exposed to enhancer targeting sgRNA pairs, but without deletion ( n = 4) or with biallelic deletion ( n = 3). (jci.org)
  • D ) ATP2B4 expression in HUDEP-2 cells with 98-bp core enhancer deletion. (jci.org)
  • Gene expression is normalized to unedited cells. (jci.org)
  • Gene Ontology analysis in knockout cells demonstrated altered expression of genes that regulate gene expression and that are localized to the nucleus. (plos.org)
  • The mechanism is related to dysregulated expression of neurodevelopmental genes and altered development of the neuroendocrine hypothalamus. (plos.org)
  • The loss of Cx43 expression was monitored in a cell-autonomous manner via conditional replacement of the Cx43-coding region by a lacZ reporter gene. (jneurosci.org)
  • which regulate the transcription of an unknown set of genes to control the expression of the vulval cell fate. (biologists.org)
  • Paternal Ube3a is normally silenced by what's called an antisense transcript-a piece of RNA that covers up the gene to prevent its expression. (wired.com)
  • In Angelman's syndrome, the brain architecture seems normal at birth, so it is possible that the restoration of normal gene expression could correct some of the pathologies. (wired.com)
  • Gene expression assays suggest that TaTOE1-B1 and TaFT3-B1 are expressed more during short days. (jic.ac.uk)
  • Transcriptome analysis revealed unusual upregulation of vascular gene expression in Dgcr8 cKO hearts. (springer.com)
  • 2017 ). Recent advance in single cell RNA-sequencing technology makes it possible to measure global gene expression in every cell of an organ. (springer.com)
  • One approach used to generate hypermutable plants is through the expression of dominant negative alleles of mismatch repair genes in transgenic plants or derived cells. (google.co.uk)
  • Moreover, methods to inhibit the expression and activity of endogenous plant MMR genes and their encoded products are also useful to generate hypermutable plants. (google.co.uk)
  • These studies strongly suggest that wasting and lethality in acrodermatitis enteropathica patients reflects the loss-of-function of the intestine zinc transporter ZIP4, which leads to abnormal Paneth cell gene expression, disruption of the intestinal stem cell niche, and diminished function of the intestinal mucosa. (prolekare.cz)
  • 1. We seek to elucidate how menin suppresses endocrine cells, such as pancreatic beta cells, via regulating histone methylations and expression of pro-proliferative genes. (upenn.edu)
  • This hypomorphic allele causes in frame skipping of exon 7, which is predicted to delete part of the 2nd and 3rd ectodomains, and cause reduced message stability. (jax.org)
  • Here, we describe disruption of C. albicans genes with PCR products that have 50 to 60 bp of homology to a genomic sequence on each end of a selectable marker. (asm.org)
  • New C. albicans genes have been identified frequently through sequence homology to known genes or gene families. (asm.org)
  • Gene discovery has been facilitated greatly by access to much of the C. albicans genomic sequence ( 11 ). (asm.org)
  • RGA sequence (L er allele) is compared with GAI ( Peng et al. (plantcell.org)
  • Three Conserved Domains Revealed by Sequence Alignment between RGA, Other Cloned Genes, and ESTs. (plantcell.org)
  • B ) gata2a coding and amino acid sequence in the region of the um27 deletion. (biologists.org)
  • 2. The method of claim 1 wherein the step of testing comprises analyzing a nucleotide sequence of the gene of interest. (google.co.uk)
  • Sequence comparisons of Wx hp and Wx b alleles (from Nipponbare) showed several nucleotide changes in the upstream regulatory regions (including the promoter, 5′-untranslated region, and first intron 5′ splicing junction site). (deepdyve.com)
  • The composition of CYP21A1P/A2 chimeric genes was investigated by ASO-PCR and MLPA analyses followed by sequencing to refine the location of recombination breakpoints. (biomedcentral.com)
  • Blood samples are also analyzed by CYP2D6 genotyping to test for CYP2D6 gene variation (i.e., *3, *4, *6, *10, *17, and *41) in genes that encode tamoxifen-metabolizing enzymes. (clinicaltrials.gov)
  • Gene-environment interaction studies in MDD have typically investigated candidate genes, though the disorder is known to be highly polygenic. (cambridge.org)
  • it has definitely been valuable in showing how a dormant but functional gene can be reactivated. (wired.com)
  • These results demonstrate that the recyclable marker system is fully functional, and therefore the pyrG-dpl237 marker can be used for sequential gene deletions in M. circinelloides . (g3journal.org)
  • The products of these genes are required for several flagellar processes, including assembly, export, and transcriptional control (for recent reviews, see references 1 and 16 ). (asm.org)
  • Thus, chromatin remodeling factors can control cell-fate determination through the transcriptional regulation of cell-fate specification genes ( Fisher, 2002 ). (biologists.org)
  • Ruby is a MYB transcriptional activator of genes that produce anthocyanin in citrus fruits. (wikipedia.org)
  • Notably, lethality is prevented and control of cytopathogenic infection is restored when viral antigen presentation is enhanced by deletion of immune evasion genes from the infecting virus. (frontiersin.org)
  • however it is highly homologous to other LILR genes, and can bind human leukocyte antigen (HLA) class I. Therefore, if secreted, the LILRA3 might impair interactions of membrane-bound LILRs (such as LILRB1, an inhibitory receptor expressed on effector and memory CD8 T cells) with their HLA ligands, thus modulating immune reactions and influencing susceptibility to disease. (wikipedia.org)
  • The orange box represents the counterselection cassette containing the HSV TK gene plus promoter linked to a polyoma virus enhancer. (nih.gov)
  • Erythroid cells with a deletion of the ATP2B4 enhancer had abnormally high intracellular calcium levels. (jci.org)
  • Nondeletion ( n = 13), monoallelic deletion ( n = 13), and biallelic deletion ( n = 14) are clones with, respectively, 0, 1, or 2 ATP2B4 enhancer alleles deleted. (jci.org)
  • The authors have analysed SHOX enhancer regions in a large cohort of short stature patients to study the importance of regulatory regions in developmentally relevant genes like SHOX . (bmj.com)
  • Conclusions Within the limitations of the available data, the meta-analysis therefore supports an association of the ACE D allele with MI risk and strengthens the justification for further evaluation in appropriately powered studies. (ahajournals.org)
  • Here we report the first instance of a homozygous disruption of ADGRB3 and discuss the possible role of this gene in the pathogenesis of the disease in this family. (nature.com)
  • Disruption of newly identified genes in the pathogen Candida albicans is a vital step in determination of gene function. (asm.org)
  • Several gene disruption methods described previously employ long regions of homology flanking a selectable marker. (asm.org)
  • Now, the rate-limiting step in analysis of gene function in this diploid organism is the creation of a homozygous disruption mutant. (asm.org)