AnatomyOrganismsDiseasesChemicals and DrugsPhenomena and Processes
FusobacteriumFusobacterium InfectionsFusobacterium nucleatumFusobacterium necrophorumBacteria, AnaerobicBacteroidesBacteroidaceaePorphyromonasVeillonellaPeptostreptococcusLemierre SyndromeLiver AbscessPrevotella intermediaMouthBacteria, AerobicPeriodontitisEubacteriumActinomycesGingivaNomaPrevotellaAbscessDental PlaquePeriodontal DiseasesBacteroides InfectionsPorphyromonas gingivalisAnaerobiosisHalitosisBacteriaPeriapical AbscessGram-Negative Anaerobic BacteriaBacteroides fragilisBacteroidaceae InfectionsBites, HumanRNA, Ribosomal, 16SFoot RotClindamycinLung AbscessStreptococcusActinomycosisBacterial InfectionsSpecies SpecificityStreptococcus oralisAggregatibacter actinomycetemcomitansTreponema denticolaMetronidazoleLeptothrixStreptococcus gordoniiAnti-Bacterial AgentsClostridiumStreptococcus sanguisBacterial AdhesionEsculinMicrobial Interactions
Fusobacterium
A genus of gram-negative, anaerobic, rod-shaped bacteria found in cavities of humans and other animals. No endospores are formed. Some species are pathogenic and occur in various purulent or gangrenous infections.
Fusobacterium Infections
Infections with bacteria of the genus FUSOBACTERIUM.
Fusobacterium nucleatum
A species of gram-negative, anaerobic, rod-shaped bacteria isolated from the gingival margin and sulcus and from infections of the upper respiratory tract and pleural cavity.
Fusobacterium necrophorum
A species of gram-negative, non-spore-forming bacteria isolated from the natural cavities of man and other animals and from necrotic lesions, abscesses, and blood.
Bacteria, Anaerobic
Bacteroides
A genus of gram-negative, anaerobic, rod-shaped bacteria. Its organisms are normal inhabitants of the oral, respiratory, intestinal, and urogenital cavities of humans, animals, and insects. Some species may be pathogenic.
Bacteroidaceae
A family of gram-negative bacteria found primarily in the intestinal tracts and mucous membranes of warm-blooded animals. Its organisms are sometimes pathogenic.
Porphyromonas
A genus of gram-negative, anaerobic, nonsporeforming, nonmotile rods or coccobacilli. Organisms in this genus had originally been classified as members of the BACTEROIDES genus but overwhelming biochemical and chemical findings indicated the need to separate them from other Bacteroides species, and hence, this new genus was created.
Veillonella
A genus of gram-negative, anaerobic cocci parasitic in the mouth and in the intestinal and respiratory tracts of man and other animals.
Peptostreptococcus
A genus of gram-positive, anaerobic, coccoid bacteria that is part of the normal flora of humans. Its organisms are opportunistic pathogens causing bacteremias and soft tissue infections.
Lemierre Syndrome
A superinfection of the damaged oropharyngeal mucosa by FUSOBACTERIUM NECROPHORUM leading to the secondary septic THROMBOPHLEBITIS of the internal jugular vein.
Liver Abscess
Solitary or multiple collections of PUS within the liver as a result of infection by bacteria, protozoa, or other agents.
Prevotella intermedia
A species of gram-negative, anaerobic, rod-shaped bacteria originally classified within the BACTEROIDES genus. This bacterium is a common commensal in the gingival crevice and is often isolated from cases of gingivitis and other purulent lesions related to the mouth.
Mouth
The oval-shaped oral cavity located at the apex of the digestive tract and consisting of two parts: the vestibule and the oral cavity proper.
Bacteria, Aerobic
Periodontitis
Inflammation and loss of connective tissues supporting or surrounding the teeth. This may involve any part of the PERIODONTIUM. Periodontitis is currently classified by disease progression (CHRONIC PERIODONTITIS; AGGRESSIVE PERIODONTITIS) instead of age of onset. (From 1999 International Workshop for a Classification of Periodontal Diseases and Conditions, American Academy of Periodontology)
Eubacterium
A genus of gram-positive, rod-shaped bacteria found in cavities of man and animals, animal and plant products, infections of soft tissue, and soil. Some species may be pathogenic. No endospores are produced. The genus Eubacterium should not be confused with EUBACTERIA, one of the three domains of life.
Actinomyces
A genus of gram-positive, rod-shaped bacteria whose organisms are nonmotile. Filaments that may be present in certain species are either straight or wavy and may have swollen or clubbed heads.
Gingiva
Oral tissue surrounding and attached to TEETH.
Noma
A severe gangrenous process occurring predominantly in debilitated and malnourished children, especially in underdeveloped countries. It typically begins as a small vesicle or ulcer on the gingiva that rapidly becomes necrotic and spreads to produce extensive destruction of the buccal and labial mucosa and tissues of the face, which may result in severe disfigurement and even death. Various bacteria have been implicated in the etiology. (Dorland, 27th ed)
Prevotella
A genus of gram-negative, anaerobic, nonsporeforming, nonmotile rods. Organisms of this genus had originally been classified as members of the BACTEROIDES genus but overwhelming biochemical and chemical findings in 1990 indicated the need to separate them from other Bacteroides species, and hence, this new genus was established.
Abscess
Accumulation of purulent material in tissues, organs, or circumscribed spaces, usually associated with signs of infection.
Dental Plaque
A film that attaches to teeth, often causing DENTAL CARIES and GINGIVITIS. It is composed of MUCINS, secreted from salivary glands, and microorganisms.
Periodontal Diseases
Pathological processes involving the PERIODONTIUM including the gum (GINGIVA), the alveolar bone (ALVEOLAR PROCESS), the DENTAL CEMENTUM, and the PERIODONTAL LIGAMENT.
Bacteroides Infections
Infections with bacteria of the genus BACTEROIDES.
Porphyromonas gingivalis
A species of gram-negative, anaerobic, rod-shaped bacteria originally classified within the BACTEROIDES genus. This bacterium produces a cell-bound, oxygen-sensitive collagenase and is isolated from the human mouth.
Anaerobiosis
The complete absence, or (loosely) the paucity, of gaseous or dissolved elemental oxygen in a given place or environment. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Halitosis
An offensive, foul breath odor resulting from a variety of causes such as poor oral hygiene, dental or oral infections, or the ingestion of certain foods.
Bacteria
One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.
Periapical Abscess
Acute or chronic inflammation of tissues surrounding the apical portion of a tooth, associated with the collection of pus, resulting from infection following pulp infection through a carious lesion or as a result of an injury causing pulp necrosis. (Dorland, 27th ed)
Gram-Negative Anaerobic Bacteria
A large group of anaerobic bacteria which show up as pink (negative) when treated by the Gram-staining method.
Bacteroides fragilis
Gram-negative bacteria occurring in the lower intestinal tracts of man and other animals. It is the most common species of anaerobic bacteria isolated from human soft tissue infections.
Bacteroidaceae Infections
Infections with bacteria of the family BACTEROIDACEAE.
Bites, Human
Bites inflicted by humans.
RNA, Ribosomal, 16S
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
Foot Rot
A disease of the horny parts and of the adjacent soft structures of the feet of cattle, swine, and sheep. It is usually caused by Corynebacterium pyogenes or Bacteroides nodosus (see DICHELOBACTER NODOSUS). It is also known as interdigital necrobacillosis. (From Black's Veterinary Dictionary, 18th ed)
Clindamycin
An antibacterial agent that is a semisynthetic analog of LINCOMYCIN.
Lung Abscess
Solitary or multiple collections of PUS within the lung parenchyma as a result of infection by bacteria, protozoa, or other agents.
Streptococcus
A genus of gram-positive, coccoid bacteria whose organisms occur in pairs or chains. No endospores are produced. Many species exist as commensals or parasites on man or animals with some being highly pathogenic. A few species are saprophytes and occur in the natural environment.
Actinomycosis
Infections with bacteria of the genus ACTINOMYCES.
Bacterial Infections
Infections by bacteria, general or unspecified.
Species Specificity
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Streptococcus oralis
A species of gram-positive, coccoid bacteria that is numerous in the mouth and throat. It is a common cause of endocarditis and is also implicated in dental plaque formation.
Aggregatibacter actinomycetemcomitans
A species of Gram-negative, facultatively anaerobic spherical or rod-shaped bacteria indigenous to dental surfaces. It is associated with PERIODONTITIS; BACTERIAL ENDOCARDITIS; and ACTINOMYCOSIS.
Treponema denticola
A species of bacteria in the family SPIROCHAETACEAE, frequently isolated from periodontal pockets (PERIODONTAL POCKET).
Metronidazole
A nitroimidazole used to treat AMEBIASIS; VAGINITIS; TRICHOMONAS INFECTIONS; GIARDIASIS; ANAEROBIC BACTERIA; and TREPONEMAL INFECTIONS. It has also been proposed as a radiation sensitizer for hypoxic cells. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985, p133), this substance may reasonably be anticipated to be a carcinogen (Merck, 11th ed).
Leptothrix
A genus of gram-negative, sheathed, rod-shaped bacteria in the family COMAMONADACEAE.
Streptococcus gordonii
A species of gram-positive, facultatively anaerobic bacteria in the family STREPTOCOCCACEAE. It is a normal inhabitant of the human oral cavity, and causes DENTAL PLAQUE and ENDOCARDITIS. It is being investigated as a vehicle for vaccine delivery.
Anti-Bacterial Agents
Substances that reduce the growth or reproduction of BACTERIA.
Clostridium
A genus of motile or nonmotile gram-positive bacteria of the family Clostridiaceae. Many species have been identified with some being pathogenic. They occur in water, soil, and in the intestinal tract of humans and lower animals.
Streptococcus sanguis
A gram-positive organism found in dental plaque, in blood, on heart valves in subacute endocarditis, and infrequently in saliva and throat specimens. L-forms are associated with recurrent aphthous stomatitis.
Bacterial Adhesion
Physicochemical property of fimbriated (FIMBRIAE, BACTERIAL) and non-fimbriated bacteria of attaching to cells, tissue, and nonbiological surfaces. It is a factor in bacterial colonization and pathogenicity.
Esculin
Microbial Interactions
The inter- and intra-relationships between various microorganisms. This can include both positive (like SYMBIOSIS) and negative (like ANTIBIOSIS) interactions. Examples include virus - bacteria and bacteria - bacteria.

Bovine polymorphonuclear neutrophil-mediated phagocytosis and an immunoglobulin G2 protease produced by Porphyromonas levii. (1/297)

Acute interdigital phlegmon (AIP) is a commonly occurring anaerobic bacterial infection in cattle. This study examined in vitro the interaction of bovine polymorphonuclear granulocytic neutrophils (PMN) from blood with bacterial species involved in AIP. Polymorphonuclear neutrophils were purified from whole bovine blood, exposed to one of the three putative etiologic agents of AIP and comparatively assessed for phagocytosis using light microscopy. Fusobacterium necrophorum and Prevotella intermedia were effectively phagocytosed by PMN, but Porphyromonas levii was phagocytosed significantly less effectively by PMN. The effect of high titre anti-P. levii bovine serum on antibody-mediated phagocytosis by PMN was also evaluated. High titre serum increased the efficiency of phagocytosis of P. levii by bovine PMN. This was independent of heat labile complement factors. Antibodies specific for P. levii were assessed for protease activity capable of cleaving bovine immunoglobulins (IgG, IgG1, IgG2, and IgM). Partially purified supernatant from broth cultures of P. levii were incubated with biotinylated immunoglobulins (Igs). Samples were taken from times 0 to 72 h and examined using SDS-PAGE followed by Western blot analysis. Streptavidin-alkaline phosphatase and NBT-BCIP were used to visualize the Igs for heavy and light chains as well as lower molecular weight fragments of these glycoproteins. Porphyromonas levii produced an immunoglobulin protease which readily cleaved bovine IgG into fragments, but did not act against IgM. Specifically, the enzyme may be a significant virulence factor as it may act to neutralize the antibodies demonstrated necessary for effective PMN-mediated phagocytosis.  (+info)

In vivo protection of Fusobacterium necrophorum from penicillin by Bacteroides fragilis. (2/297)

A mixed infection of Bacteroides fragilis and Fusobacterium necrophorum was resistant to treatment with penicillin even though a pure F. necrophorum infection could be successfully treated with penicillin. Since B. fragilis alone did not produce infection, these results indicate that B. fragilis can protect F. necrophorum from penicillin in vivo. The extent of protection afforded by a strain of B. fragilis was related to its level of resistance to penicillin. Only a few cells of B. fragilis were required in the initial bacterial injection. Moreover, protection was demonstrated when B. fragilis cells were injected as late as 24 h after the F. necrophorum cells. Protection of F. necrophorum from penicillin by B. fragilis was also demonstrated in vitro.  (+info)

Effect of virginiamycin on ruminal fermentation in cattle during adaptation to a high concentrate diet and during an induced acidosis. (3/297)

The objective of Exp. 1 was to compare the effects of virginiamycin (VM; 0, 175, or 250 mg x animal(-1) x d(-1)) and monensin/tylosin (MT; 250/ 90 mg x animal(-1) x d(-1)) on ruminal fermentation products and microbial populations in cattle during adaptation to an all-concentrate diet. Four ruminally cannulated, Holstein steers were used in a 4x4 Williams square design with 21-d periods. Steers were stepped up to an all-concentrate diet fed at 2.5% of BW once daily. Ruminal pH, protozoal counts, and NH3-N and VFA concentrations generally were unaffected by VM or MT. Mean counts of Lactobacillus and Streptococcus bovis were lower (P<.05) for VM-treated compared with control or MT-treated steers. Both VM and MT prevented the increase in Fusobacterium necrophorum counts associated with increasing intake of the high-concentrate diet observed in the control. The objective of Exp. 2 was to compare the effects of VM and MT on ruminal pH, L(+) lactate and VFA concentrations, and F. necrophorum numbers during carbohydrate overload. Six ruminally cannulated Holstein steers were assigned randomly to either the control, VM (175 mg/d), or MT (250 + 90 mg/d) treatments. Acidosis was induced with intraruminal administration of a slurry of ground corn and corn starch. The VM and MT premixes were added directly to the slurry before administration. Carbohydrate challenge induced acute ruminal acidosis (pH was 4.36 and L (+) lactate was 19.4 mM) in controls by 36 h. Compared with the controls, steers receiving VM or MT had higher (P<.05) ruminal pH, and the VM group had a lower (P<.05) L (+) lactate concentration. Fusobacterium necrophorum numbers initially increased in VM- and MT-administered steers. In the control steers, F. necrophorum was undetectable by 36 h. Virginiamycin seemed to control the growth of ruminal lactic acid-producing bacteria and, therefore, has the potential to moderate ruminal fermentation in situations that could lead to rapid production of lactic acid.  (+info)

Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. (4/297)

The human intestinal tract harbors a complex microbial ecosystem which plays a key role in nutrition and health. Although this microbiota has been studied in great detail by culture techniques, microscopic counts on human feces suggest that 60 to 80% of the observable bacteria cannot be cultivated. Using comparative analysis of cloned 16S rRNA gene (rDNA) sequences, we have investigated the bacterial diversity (both cultivated and noncultivated bacteria) within an adult-male fecal sample. The 284 clones obtained from 10-cycle PCR were classified into 82 molecular species (at least 98% similarity). Three phylogenetic groups contained 95% of the clones: the Bacteroides group, the Clostridium coccoides group, and the Clostridium leptum subgroup. The remaining clones were distributed among a variety of phylogenetic clusters. Only 24% of the molecular species recovered corresponded to described organisms (those whose sequences were available in public databases), and all of these were established members of the dominant human fecal flora (e.g., Bacteroides thetaiotaomicron, Fusobacterium prausnitzii, and Eubacterium rectale). However, the majority of generated rDNA sequences (76%) did not correspond to known organisms and clearly derived from hitherto unknown species within this human gut microflora.  (+info)

Phylogenetic analysis of Fusobacterium alocis and Fusobacterium sulci based on 16S rRNA gene sequences: proposal of Filifactor alocis (Cato, Moore and Moore) comb. nov. and Eubacterium sulci (Cato, Moore and Moore) comb. nov. (5/297)

Genes encoding the 16S rRNA of Fusobacterium alocis ATCC 35896T and Fusobacterium sulci ATCC 35585T were sequenced. These sequences did not have any affinity with the 16S rRNA gene sequences of members of the genus Fusobacterium. Fusobacterium alocis ATCC 35896T and Fusobacterium sulci ATCC 35585T belonged to Clostridium cluster XI; the species most closely related to these strains were Filifactor villosus NCTC 11220T and Eubacterium infirmum W1471, respectively. Two new combinations are proposed: Filifactor alocis (Cato, Moore and Moore) comb. nov. (type strain ATCC 35896T) and Eubacterium sulci (Cato, Moore and Moore) comb. nov. (type strain ATCC 35585T).  (+info)

Occurrence of the new tetracycline resistance gene tet(W) in bacteria from the human gut. (6/297)

Members of our group recently identified a new tetracycline resistance gene, tet(W), in three genera of rumen obligate anaerobes. Here, we show that tet(W) is also present in bacteria isolated from human feces. The tet(W) genes found in human Fusobacterium prausnitzii and Bifidobacterium longum isolates were more than 99.9% identical to those from a rumen isolate of Butyrivibrio fibrisolvens.  (+info)

Serological study of trichloroacetic acid extracts of Bacteroides fragilis. (7/297)

Immunodiffusion techniques were used on trichloroacetic acid extracts from 10 strains of Bacteroides fragilis in detecting precipitating antibodies against this species in immune rabbit sera. Species and even strain specificities were observed in these precipitin reactions. Multiple antigens were detected in the extracts from some strains, whereas only one precipitin band per extract developed during agar-gel diffusion tests of others. The antigen extracts were found to be both heat stable and resistant to hydrolysis by alpha-chymotrypsin. Four serological patterns were demonstrated in homologous and heterologous reactions with the B. fragilis. antigen-antibody systems used. The results showed that some strains were serologically distinct from others, indicating that the strains tested are of more than one serotype.  (+info)

Detection of tetQ and ermF antibiotic resistance genes in Prevotella and Porphyromonas isolates from clinical specimens and resident microbiota of humans. (8/297)

Gram-negative anaerobes belonging to the genera Fusobacterium, Prevotella and Porphyromonas were investigated for the presence of tetQ and ermF, which have been shown to be spread by conjugal elements. One hundred isolates from either sites of infection or various body sites in healthy subjects were studied. PCR was used to detect tetQ, and DNA-DNA hybridization studies on EcoRI chromosomal digests were undertaken to detect the presence of tetQ and ermF. Antibiotic sensitivity assays were performed on selected isolates to detect tetracycline, erythromycin and penicillin resistance. Twenty Fusobacterium isolates lacked tetQ, and were tetracycline sensitive. Twenty per cent of Prevotella spp. isolates both from clinical specimens and from healthy subjects were found to possess tetQ. Of 20 Porphyromonas isolates tested, one (Porphyromonas levii) from a case of bacterial vaginosis was shown to possess tetQ in the chromosome. The presence of tetQ was always associated with tetracycline resistance. Four isolates of Prevotella melaninogenica and one isolate of Prevotella were ermF-positive, although expression of erythromycin resistance was not consistently associated with detection of this gene. Antibiotic resistance phenotypes of Prevotella isolates were shown to be related to specific chromosomal restriction patterns by hybridization studies: tetracycline resistance and tetracycline/erythromycin resistance are conferred by Bacteroides tetracycline-resistant ERL elements, whereas the tetracycline/penicillin resistance phenotype could be due to spread of elements identified in Prevotella only. Tetracycline/erythromycin-resistant and tetracycline/erythromycin/penicillin-resistant P. melaninogenica isolates were found in this study. It appeared that the presence of tetQ and ermF in Bacteroides and Prevotella contributed to the persistence of antibiotic resistance isolates within the host and to potential spread to other organisms through conjugal elements.  (+info)

Fusobacterium | Article about Fusobacterium by The Free DictionaryFusobacterium | Article about Fusobacterium by The Free Dictionary
Looking for Fusobacterium? Find out information about Fusobacterium. in physics. 1 The change of a substance from the solid to the liquid state, also known as melting. The heat given up by a unit mass of a substance during... Explanation of Fusobacterium
http://encyclopedia2.thefreedictionary.com/Fusobacterium
Analysis of Fusobacterium persistence and antibiotic response in colorectal cancerAnalysis of Fusobacterium persistence and antibiotic response in colorectal cancer
Colorectal cancers comprise a complex mixture of malignant cells, nontransformed cells, and microorganisms. |i|Fusobacterium nucleatum|/i| is among the most prevalent bacterial species in colorectal cancer tissues. Here we show that colonization of human colorectal cancers with |i|Fusobacterium|/i| …
https://pubmed.ncbi.nlm.nih.gov/29170280/
DDW: Antibiotics Improve Colitis Symptoms | Medpage TodayDDW: Antibiotics Improve Colitis Symptoms | Medpage Today
WASHINGTON -- A combination of antibiotics aimed at Fusobacterium varium offers ulcerative colitis patients improved symptoms, a Japanese researcher said here.
https://www.medpagetoday.com/meetingcoverage/ddw/5763
TCDB » SEARCHTCDB » SEARCH
2.A.118 The Basic Amino Acid Antiporter (ArcD) Family. The ArcD family is a constituent of the IT superfamily (Lolkema and Slotboom, 2003; Prakash et al., 2003; Rabus et al., 1999). It is the st313/AitC family of Lolkema and Slotboom (2003). It consists of proteins from Gram-negative and Gram-positive bacteria (e.g., Streptococcus, Escherichia, Salmonella, Fusobacterium and Borrelia species). The proteins are of about 480 aas with 10-12 putative TMSs. Functionally characterized homologues are in the DcuC (TC #2.A.61) and ArsB (TC #2.A.4) families. Some members of the family probably catalyze arginine/ornithine or citruline/ornithine antiport (Gupta et al., 2013; Rimaux et al., 2013). ...
https://tcdb.org/search/result.php?tc=2.A.118
Fusobacterium nucleatum subsp. nucleatum Knorr ATCC ® 25586D-5&traFusobacterium nucleatum subsp. nucleatum Knorr ATCC ® 25586D-5&tra
Fusobacterium nucleatum subsp. nucleatum ATCC ® 25586D-5™ Designation: Genomic DNA from Fusobacterium nucleatum subsp. nucleatum strain VPI 4355 TypeStrain=True Application:
https://www.atcc.org/Products/Cells_and_Microorganisms/Bacteria/Bacterial_Nucleic_Acids/25586D-5.aspx?slp=1
Infected Iliac Artery Aneurysm Concomitant with Liver Abscess Caused by Fusobacterium nucleatumInfected Iliac Artery Aneurysm Concomitant with Liver Abscess Caused by Fusobacterium nucleatum
We report a case of infected iliac artery aneurysm concomitant with liver abscesses caused by Fusobacterium nucleatum. A 58-year-old man developed an aneurysm of the right common iliac artery and liver abscesses. The aneurysm was resected and a femoro-femoral crossover bypass with a knitted Dacron graft was performed for impending rupture. Anaerobic cultures obtained from blood and intramural thrombus were positive for Fusobacterium nucleatum. With antibiotics, the liver abscesses disappeared without drainage. Iliopsoas abscesses developed after surgery, but it was controlled with antibiotics. The patient was free of infection 1 year after the surgery. The causative bacterium was suspected to originate in the oral cavity, because the patient had a notable history of poor chronic periodontal conditions. Clinically, infected aortoiliac aneurysm complicated by Fusobacterium is extremely rare relative to the prevalence of the pathogenic bacterium. However, it is noteworthy that Fusobacterium can cause this
https://m.scirp.org/papers/68951
Genome Sequence of Fusobacterium nucleatum Subspecies Polymorphum - a Genetically Tractable Fusobacterium - pdf descargarGenome Sequence of Fusobacterium nucleatum Subspecies Polymorphum - a Genetically Tractable Fusobacterium - pdf descargar
Genome Sequence of Fusobacterium nucleatum Subspecies Polymorphum - a Genetically Tractable Fusobacterium. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
http://libros.duhnnae.com/2017/jun6/149799547951-Genome-Sequence-of-Fusobacterium-nucleatum-Subspecies-Polymorphum-a-Genetically-Tractable-Fusobacterium.php
Fusobacterium nucleatum and Colorectal Cancer - Postgraduate Cancer Research Initiative (CRI) blogFusobacterium nucleatum and Colorectal Cancer - Postgraduate Cancer Research Initiative (CRI) blog
By Ramadhani Chambuso. The same oral commensal bacterium and gum disease pathogen called Fusobacterium nucleatum was found to be predominantly associated with primary human colorectal cancer cells and even in distant metastatic lesions, a study published in 2017 on the journal Science, reports. Furthermore, it was proven in mice with colon cancer that after treatment with antibiotics, Fusobacteruim load, cancer cell proliferation and overall tumour growth, all were reduced, which indicates that this organism may play a crucial role in colon cancer development.. Despite other studies suggesting the possible pro-tumorigenic role of Fusobacterium which may include modulation of host immune response to cancer cells and further enhancement of tumour cell invasion in colon cancer pathogenesis, this new study was scientifically able to show the correlation between decrease in Fusobacterium load and the decreased in rate of tumour growth and improved overall patient survival.. Although it is not clear ...
http://blogs.uct.ac.za/cancerphd/2017/12/639/?replytocom=1559
Fusobacterium nucleatum and Colorectal CancerFusobacterium nucleatum and Colorectal Cancer
By Ramadhani Chambuso. The same oral commensal bacterium and gum disease pathogen called Fusobacterium nucleatum was found to be predominantly associated with primary human colorectal cancer cells and even in distant metastatic lesions, a study published in 2017 on the journal Science, reports. Furthermore, it was proven in mice with colon cancer that after treatment with antibiotics, Fusobacteruim load, cancer cell proliferation and overall tumour growth, all were reduced, which indicates that this organism may play a crucial role in colon cancer development.. Despite other studies suggesting the possible pro-tumorigenic role of Fusobacterium which may include modulation of host immune response to cancer cells and further enhancement of tumour cell invasion in colon cancer pathogenesis, this new study was scientifically able to show the correlation between decrease in Fusobacterium load and the decreased in rate of tumour growth and improved overall patient survival.. Although it is not clear ...
http://blogs.uct.ac.za/cancerphd/2017/12/639/
Identification of a highly active tannase enzyme from the oral pathogen Fusobacterium nucleatum subsp. polymorphum | Microbial...Identification of a highly active tannase enzyme from the oral pathogen Fusobacterium nucleatum subsp. polymorphum | Microbial...
Tannases are tannin-degrading enzymes that have been described in fungi and bacteria as an adaptative mechanism to overcome the stress conditions associated with the presence of these phenolic compounds. We have identified and expressed in E. coli a tannase from the oral microbiota member Fusobacterium nucleatum subs. polymorphum (TanBFnp). TanBFnp is the first tannase identified in an oral pathogen. Sequence analyses revealed that it is closely related to other bacterial tannases. The enzyme exhibits biochemical properties that make it an interesting target for industrial use. TanBFnp has one of the highest specific activities of all bacterial tannases described to date and shows optimal biochemical properties such as a high thermal stability: the enzyme keeps 100% of its activity after prolonged incubations at different temperatures up to 45 °C. TanBFnp also shows a wide temperature range of activity, maintaining above 80% of its maximum activity between 22 and 55 °C. The use of a panel of 27 esters
https://microbialcellfactories.biomedcentral.com/articles/10.1186/s12934-018-0880-4
Antibody Responses to Fusobacterium nucleatum Proteins in Prediagnostic Blood Samples are not Associated with Risk of...Antibody Responses to Fusobacterium nucleatum Proteins in Prediagnostic Blood Samples are not Associated with Risk of...
BACKGROUND: There is a lack of prospective data on the potential association of Fusobacterium nucleatum (F. nucleatum) and colorectal cancer risk. In this study, we assessed whether antibody responses to F. nucleatum are associated with colorectal cancer risk in prediagnostic serum samples in the European Prospective Investigation into Nutrition and Cancer (EPIC) cohort. METHODS: We applied a multiplex serology assay to simultaneously measure antibody responses to 11 F. nucleatum antigens in prediagnostic serum samples from 485 colorectal cancer cases and 485 matched controls. Conditional logistic regression models were used to estimate odds ratios (ORs) and 95% confidence intervals (CI). RESULTS: We observed neither a statistically significant colorectal cancer risk association for antibodies to individual F. nucleatum proteins nor for combined positivity to any of the 11 proteins (OR, 0.81; 95% CI, 0.62-1.06). CONCLUSIONS: Antibody responses to F. nucleatum proteins in prediagnostic serum samples from
https://www.ndph.ox.ac.uk/publications/1050314
Effect of alkaline growth pH on the expression of cell envelope proteins in Fusobacterium nucleatum | Microbiology SocietyEffect of alkaline growth pH on the expression of cell envelope proteins in Fusobacterium nucleatum | Microbiology Society
Fusobacterium nucleatum is a Gram-negative anaerobic organism that plays a central role in the development of periodontal diseases. The progression of periodontitis is associated with a rise in pH of the gingival sulcus which promotes the growth and expression of virulence factors by periodontopathic bacteria. We have previously reported that the expression of specific cytoplasmic proteins is altered by a shift in growth pH. In the present study we have compared cell envelope protein expression of F. nucleatum during chemostat growth at pH 7.2 and 7.8. From a total of 176 proteins resolved from the cell envelope, 15 were found to have altered expression in response to an increase in growth pH and were identified by MS. Upregulated proteins included an outer membrane porin which has been identified as playing a role in virulence, a periplasmic chaperone which assists in the folding of outer membrane proteins, and a transporter thought to be involved with iron uptake. Proteins downregulated at pH 7.8 were
https://www.microbiologyresearch.org/content/journal/micro/10.1099/mic.0.035881-0
BacteroidetesBacteroidetes
Many Bacteroidetes, especially Bacteroides are opportunistic pathogens. The figure shows predominant sites colonized by Bacteroides and other anaerobic bacilli. Their levels are higher in celiac disease and more severe forms of IBS (Rome III criteria). Prevotella, and Fusobacterium are prevalent in the body and usually dont cause problems, but may become involved in infections throughout the body (see Fig.). Within the Bacteroides group, B fragilis is the most common pathogen, followed B thetaiotaomicron and other members of the B fragilis group. Among the bile-sensitive Prevotella species, the ones most commonly encountered clinically are P melaninogenica, P oris, and P buccae. Porphyromonas species seem to be much less pathogenic except in dental infections. Fusobacterium nucleatum is the Fusobacterium species most often found as a pathogen, but F necrophorum occasionally produces serious disease. Several species of Flavobacteria are known to cause disease in freshwater fish. Bacteria that ...
http://www.aurametrix.com/topics/bacteroidetes
KEGG PATHWAY: Terpenoid backbone biosynthesis - Fusobacterium nucleatum subsp. nucleatum ATCC 25586KEGG PATHWAY: Terpenoid backbone biosynthesis - Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Terpenoids, also known as isoprenoids, are a large class of natural products consisting of isoprene (C5) units. There are two biosynthetic pathways, the mevalonate pathway [MD:M00095] and the non-mevalonate pathway or the MEP/DOXP pathway [MD:M00096], for the terpenoid building blocks: isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). The action of prenyltransferases then generates higher-order building blocks: geranyl diphosphate (GPP), farsenyl diphosphate (FPP), and geranylgeranyl diphosphate (GGPP), which are the precursors of monoterpenoids (C10), sesquiterpenoids (C15), and diterpenoids (C20), respectively. Condensation of these building blocks gives rise to the precursors of sterols (C30) and carotenoids (C40). The MEP/DOXP pathway is absent in higher animals and fungi, but in green plants the MEP/DOXP and mevalonate pathways co-exist in separate cellular compartments. The MEP/DOXP pathway, operating in the plastids, is responsible for the formation of essential oil ...
http://www.genome.jp/kegg-bin/show_pathway?fnu00900
Get PDF - Interactions between periodontal bacteria and human oral epithelial cells: Fusobacterium nucleatum adheres to and...Get PDF - Interactions between periodontal bacteria and human oral epithelial cells: Fusobacterium nucleatum adheres to and...
Han, Y.W.; Shi, W.; Huang, G.T.J.; Haake, S.K.nder; Park, N.H.e; Kuramitsu, H.; Genco, R.J., 2000: Interactions between periodontal bacteria and human oral epithelial cells: Fusobacterium nucleatum adheres to and invades epithelial cells
https://eurekamag.com/research/010/863/010863771.php
Identification and Characterization of Fusolisin, the Fusobacterium nucleatum Autotransporter Serine Protease - pdf descargarIdentification and Characterization of Fusolisin, the Fusobacterium nucleatum Autotransporter Serine Protease - pdf descargar
Identification and Characterization of Fusolisin, the Fusobacterium nucleatum Autotransporter Serine Protease. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
http://libros.duhnnae.com/2017/jun8/149843190395-Identification-and-Characterization-of-Fusolisin-the-Fusobacterium-nucleatum-Autotransporter-Serine-Protease.php
Tropical ulcer - WikipediaTropical ulcer - Wikipedia
Tropical ulcer, more commonly known as jungle rot, is a chronic ulcerative skin lesion thought to be caused by polymicrobial infection with a variety of microorganisms, including mycobacteria. It is common in tropical climates. Ulcers occur on exposed parts of the body, primarily on anterolateral aspect of the lower limbs and may erode muscles and tendons, and sometimes, the bones. These lesions may frequently develop on preexisting abrasions or sores sometimes beginning from a mere scratch. The vast majority of the tropical ulcers occur below the knee, usually around the ankle. They may also occur on arms. They are often initiated by minor trauma, and subjects with poor nutrition are at higher risk. Once developed, the ulcer may become chronic and stable, but also it can run a destructive course with deep tissue invasion, osteitis, and risk of amputation. Unlike Buruli ulcer, tropical ulcers are very painful. Lesions begin with inflammatory papules that progress into vesicles and rupture with ...
https://en.wikipedia.org/wiki/Tropical_ulcer
Calf Diphtheria Medical Definition | Merriam-Webster Medical DictionaryCalf Diphtheria Medical Definition | Merriam-Webster Medical Dictionary
Medical definition of calf diphtheria: an infectious disease of the mouth and pharynx of calves and young cattle associated with the presence of large numbers of a bacterium of the genus Fusobacterium (F. necrophorum) and commonly resulting in pneumonia or generalized septicemia if untreated.
https://www.merriam-webster.com/medical/calf%20diphtheria
Fusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironment. - PubMed - NCBIFusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironment. - PubMed - NCBI
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
https://www.ncbi.nlm.nih.gov/pubmed/23954159?dopt=Abstract
JoVE Author Search: Allaker RPJoVE Author Search: Allaker RP
Silver, Fusobacterium, Fusobacterium Nucleatum, Ability, Copper, Nanoparticles, Oxygen, Mothers, Oral Cavity, Porphyromonas, Porphyromonas Gingivalis, Pregnancy, Strains, Lead, Titanium, Tungsten, Concentrations, Electron, Electron Microscopy, Elements
http://labindex.jove.com/author/Allaker-RP
Infections Due to Bacteroides and Fusobacterium: Findings in 102 Patients. | Annals of Internal Medicine | American College of...Infections Due to Bacteroides and Fusobacterium: Findings in 102 Patients. | Annals of Internal Medicine | American College of...
Infections with anaerobic organisms belonging to the Bacteroides-Fusobacterium group are much more common than is generally appreciated. This paper is concerned with clinical and bacteriologic findings in 127 infections due to these organisms, occurring in 102 patients. These organisms were isolated from the blood stream in 11 cases; the portal of entry was the urinary tract in two; peritoneum, in three; meninges, in one; gastrointestinal tract, in two; and was unknown in three. One of these patients has had recurrent bacteremia for over one year and is thought to have subacute bacterial endocarditis. The organisms were isolated from the urine ...
http://annals.org/aim/article-abstract/678164/infections-due-bacteroides-fusobacterium-findings-102-patients
Make Sure You Have Your Periodontal Heath Checked RegularlyMake Sure You Have Your Periodontal Heath Checked Regularly
A common oral bacteria, Fusobacterium nucleatum, acts like a key to open a door in human blood vessels and leads the way for it and other bacteria like Escherichia coli to invade the body through the blood and make people sick, according to dental researchers
http://www.cook-perio.com/home/blog/entryid/48/make-sure-you-have-your-periodontal-heath-checked-regularly.aspx
PLOS Biology: A New Type of Na+-Driven ATP Synthase Membrane Rotor with a Two-Carboxylate Ion-Coupling MotifPLOS Biology: A New Type of Na+-Driven ATP Synthase Membrane Rotor with a Two-Carboxylate Ion-Coupling Motif
Multi-disciplinary methods reveal a novel type of ion binding in the rotor ring of the F1Fo-ATP synthase from the opportunistic pathogen Fusobacterium nucleatum.
http://journals.plos.org/plosbiology/article/email?id=10.1371/journal.pbio.1001596
Pre GI: BLASTN HitsPre GI: BLASTN Hits
General Information: Environment: Gastrointestinal tract, Host, Respiratory; Isolation: Subgingival sulcus. Temp: Mesophile; Temp: 37C. Selenomonas sputigena is commonly isolated from the oral cavity of humans. ...
http://pregi.bi.up.ac.za/pre_gi_blast.php?blast_source_accession=NC_015437&blast_gi_query=NC_015437:27325
Epidemiological and immunobiological evaluation of prophylactic immunization schedulesEpidemiological and immunobiological evaluation of prophylactic immunization schedules
Rusakova E.V.; Kashlyaeva T.K.; Gusarova L.D.; Muradova G.D., 1987: Epidemiological and immunobiological evaluation of prophylactic immunization schedules
https://eurekamag.com/research/005/375/005375047.php
Fecal Microbiota, Fecal Metabolome, and Colorectal Cancer InterrelationsFecal Microbiota, Fecal Metabolome, and Colorectal Cancer Interrelations
Feces from CRC cases had very strong microbe-metabolite correlations that were predominated by Enterobacteriaceae and Actinobacteria. Metabolites mediated a direct CRC association with Fusobacterium and Porphyromonas, but not an inverse association with Clostridia and Lachnospiraceae. This study ide …
https://pubmed.ncbi.nlm.nih.gov/27015276/?dopt=Abstract
Typing of Fusobacterium necrophorum Strains Using Polymerase Chain Reaction (PCR) Based Methods - سامانه نشریات دانشگاه تربیت...Typing of Fusobacterium necrophorum Strains Using Polymerase Chain Reaction (PCR) Based Methods - سامانه نشریات دانشگاه تربیت...
Background: Fusobacterium necrophorum as a non-spore-forming Gram-negative anaerobic bacillus is an important human and animal pathogen. It may cause severe systemic infections (Lemierres syndrome) and some other infections. The aim of this study was to subtype Fusobacterium necrophorum by using PCR methods. Materials and Methods: Twenty five strains of Fusobacterium necrophorum ...
https://iem.modares.ac.ir/browse.php?a_id=4341&sid=4&slc_lang=fa
Chemical structure of the lipid A component of lipopolysaccharides from Fusobacterium nucleatum. | Journal of BacteriologyChemical structure of the lipid A component of lipopolysaccharides from Fusobacterium nucleatum. | Journal of Bacteriology
The lipid A component of lipopolysaccharides from Fusobacterium nucleatum Fev 1 consists of beta-1,6-linked D-glucosamine disaccharides, which carry two phosphate groups: one in glycosidic and one in ester linkage. The amino groups of the glucosamine disaccharides are substituted by D-3-hydroxyhexadecanoic acid. The hydroxyl groups of the disaccharide backbone are acylated by tetradecanoic, hexadecanoic, and D-3-hydroxytetradecanoic acids. Part of the ester-bound D-3-hydroxytetradecanoic acid is 3-O-substituted by tetradecanoic acid. Whereas a similar pattern of fatty acids was detected in lipopolysaccharides from two other F. nucleatum strains, the amide-bound fatty acid in F. varium and F. mortiferum was D-3-hydroxytetradecanoic acid. The chemical relationships of lipid A from Fusobacteria and other gram-negative bacteria are discussed. ...
https://jb.asm.org/content/129/1/9?ijkey=2ac4cbed2134b92d8799cdb02aea61ab04e39202&keytype2=tf_ipsecsha
Microbial synergy in experimental intra-abdominal abscess | MetaMicrobial synergy in experimental intra-abdominal abscess | Meta
Intra-abdominal sepsis was studied in Wistar rats by using four microbial species: Escherichia coli, enterococci, Bacteroides fragilis, and Fusobacterium varium. These organisms were implanted into the peritoneal cavity singly and in all possible dual combinations. Results were evaluated by mortality rates and the incidence of intra-abdominal abscesses on autopsy following sacrifice after 7 days. Mortality was restricted to recipients of E. coli, thus implicating coliforms in the acute lethality associated with this experimental model. Intra-abdominal abscesses were produced in 61 of 95 (94%) animals that received the combination of an anaerobe and a facultative organism. Abscesses failed to form with any single strain or with E. coli plus enterococci, and they were detected in one 1 of 19 animals receiving B. fragilis plus F. varium. These results suggest that intra-abdominal abscess formation is related to synergy between anaerobes and facultative bacteria. ...
https://www.meta.org/papers/microbial-synergy-in-experimental-intra-abdominal/814099
Efek Antibakteri Ekstrak Etanol Umbi Lobak (Raphanus sativus L.) terhadap Fusobacterium nucleatum ATCC 25586 sebagai Bahan...Efek Antibakteri Ekstrak Etanol Umbi Lobak (Raphanus sativus L.) terhadap Fusobacterium nucleatum ATCC 25586 sebagai Bahan...
Antimicrobial effect of calcium hydroxide as an intracanal medicament in root canal treatment.. Restorative Dentistry and Endodontics Rev 2014:
https://123dok.com/document/q0eodpgy-antibakteri-ekstrak-raphanus-fusobacterium-nucleatum-alternatif-medikamen-saluran.html
Acervo Digital: Plasmid profile in oral Fusobacterium nucleatum from humans and Cebus apella monkeysAcervo Digital: Plasmid profile in oral Fusobacterium nucleatum from humans and Cebus apella monkeys
Fusobacterium nucleatum é um anaeróbio estrito e considerado membro da microbiota indígena da cavidade bucal humana. É comumente observado em diferentes infecções monomicrobianas e mistas em humanos e animais. O objetivo deste estudo foi avaliar o perfil plasmidial de F. nucleatum orais isolados de pacientes com doença periodontal, indivíduos sadios, e de macacos Cebus apella, e verificar a estabilidade plasmidial e a associação com genes de resistência à penicilina. Quarenta e cinco cepas de F. nucleatum orais isoladas de pacientes, 38 de indivíduos sadios e sete de macacos C. apella, foram examinadas. A extração plasmidial realizada detectou plasmídios em 26,7% das cepas humanas e em apenas uma cepa de C. apella. A maioria das cepas apresentou duas bandas plasmidiais variando de 4 a 16 Kb, e as digestões com endonucleases demonstraram serem essas bandas pertencentes a um único plasmídio, sendo classificados em três grupos segundo o tamanho. Cepas de indivíduos sadios não ...
https://acervodigital.unesp.br/handle/11449/15632
Fusobacterium nucleatum induces premature and term stillbirths in pregnant mice: implication of oral bacteria in preterm birth.Fusobacterium nucleatum induces premature and term stillbirths in pregnant mice: implication of oral bacteria in preterm birth.
Fusobacterium nucleatum is a gram-negative anaerobe ubiquitous to the oral cavity. It is associated with periodontal disease. It is also associated with preterm birth and has been isolated from the amniotic fluid, placenta, and chorioamnionic membran
http://www.biomedsearch.com/nih/Fusobacterium-nucleatum-induces-premature-term/15039352.html
Prevalence of Fusobacterium necrophorum in persistent sore throat samples.Prevalence of Fusobacterium necrophorum in persistent sore throat samples.
Price, S.L., Hardy, S., Gale, P. and Basten, G. (2012) Prevalence of Fusobacterium necrophorum in persistent sore throat samples. British journal of biomedical science, 68 (4), pp. 209- ...
https://www.dora.dmu.ac.uk/handle/2086/6037?show=full
OC-061 A prospective multi-national study of the colorectal cancer mucosal microbiome reveals specific taxonomic changes...OC-061 A prospective multi-national study of the colorectal cancer mucosal microbiome reveals specific taxonomic changes...
Results One hundred and ninety six patients were recruited: 158 CRC patients, 24 adenoma patients and 14 normal colon controls (median age 70; range 35-90). Tumours were staged as 6 T0, 4 T1, 23 T2, 97 T3, 27 T4; 99 N0, 40 N1, 27 N2; 6 M1. No significant differences were seen in diversity or taxonomy between the UK and Czech cohorts. Adenoma and healthy colon control samples were taxonomically indistinct. However, CRCs were characterised by reduced Shannon diversity (p,0.01), with enrichment of organisms including Bacteroides fragilis,Fusobacterium nucleatum and under-representation of Bacteroides vulgatus,Bacteroides uniformisandFaecalibacterium prausnitzii (all q,0.01). Furthermore, we found a significant progressive reduction in the expression of Bacteroides vulgatus with advancing T stage and a corresponding increase in Fusobacterium nucleatum expression (figure). Additionaly, samples from patients with T4 tumours and cancers expressing histological and molecular markers of poor prognosis ...
http://gut.bmj.com/content/66/Suppl_2/A32.2
Berberine may rescue Fusobacterium nucleatum -induced colorectal tumorigenesis by modulating the tumor microenvironment |...Berberine may rescue Fusobacterium nucleatum -induced colorectal tumorigenesis by modulating the tumor microenvironment |...
https://doi.org/10.18632/oncotarget.5166 Ya-Nan Yu, Ta-Chung Yu, Hui-Jun Zhao, Tian-Tian Sun, Hui-Min Chen, Hao-Yan Chen, Hui-Fang An, Yu-Rong Weng, Jun Yu, Min Li, Wen-Xin Qin, Xiong Ma, Nan Shen,...
http://www.oncotarget.com/index.php?journal=oncotarget&page=article&op=view&path%5B%5D=5166
Subacute osteomyelitis of the femur due to Fusobacterium nucleatum in a 7-year-old boy. - Oxford Vaccine GroupSubacute osteomyelitis of the femur due to Fusobacterium nucleatum in a 7-year-old boy. - Oxford Vaccine Group
Subacute hematogenous osteomyelitis is an insidious infection, which commonly has a delayed diagnosis. We describe the case of a 7-year-old boy with subacute osteomyelitis, which was initially considered to be a bone tumor. Infection should be considered in all cases of bone pain, especially in children, even in the absence of typical systemic features of inflammation.
https://www.ovg.ox.ac.uk/publications/509872
The incidence of anaerobic bacteria in adult patients with chronic sinusitis: A prospective, single-centre microbiological...The incidence of anaerobic bacteria in adult patients with chronic sinusitis: A prospective, single-centre microbiological...
In contrast to the well-established roles of microbes in the aetiology of acute sinusitis, the exact roles of the abovementioned microorganisms (namely Prevotella and Porphyromonas spp., Fusobacterium spp., GPAC, V. parvula, L. buccalis, E. corrodens, E. lenta, Bacteroides spp. and Clostridium spp.) in the aetiology of CRS are uncertain [1, 2]. Various researchers disagree on the microbial aetiology of CRS; some of the disagreement may be explained by the different methodological approaches to the processing of the obtained microbiological samples. Many bacterial organisms have been identified in the sinus tracts of patients with CRS and are reported in the literature, but there is no consensus as to their correct pathogenic role. Despite the exact cause of the inflammation associated with CRS is uncertain, the presence of bacteria within the sinuses has been well documented in different studies [9, 10]. Some of these studies have examined the bacterial pathogens associated with CRS, but most of ...
https://akjournals.com/view/journals/1886/10/2/article-p107.xml?rskey=FIgDhA&result=40
Browsing Cattlemens Day, 1998 by Author Wallace, N.Browsing Cattlemens Day, 1998 by Author Wallace, N.
Fusobacterium necrophorum was quantified from ruminal contents and ruminal wall tissue collected at slaughter. Livers were examined and scored for abscesses. The mean concentration of F. necrophorum on the ruminal wall ...
http://krex.k-state.edu/dspace/handle/2097/4384/browse?value=Wallace%2C+N.&type=author
A Rare Cause of Hemophagocytic Lymphohistiocytosis: Fusobacterium Infection-A Case Report and Review of the LiteratureA Rare Cause of Hemophagocytic Lymphohistiocytosis: Fusobacterium Infection-A Case Report and Review of the Literature
Case Reports in Hematology is a peer-reviewed, Open Access journal that publishes case reports in all areas of hematology, including general hematology, pathology, and oncology, with a specific focus on lymphomas and leukemias.
https://www.hindawi.com/journals/crihem/2016/4839146/abs/
Dental researchers discover how oral bacterium can trigger colorectal cancer - Healthcanal.com : Healthcanal.comDental researchers discover how oral bacterium can trigger colorectal cancer - Healthcanal.com : Healthcanal.com
We found this cancer is linked to an infection from [the bacterium], said Yiping Han, professor of periodontics at the dental school and the studys lead investigator. This discovery creates the potential for new diagnostic tools and therapies to treat and prevent the cancer.. The results of the research appear in the current issue of Cell Host & Microbe, in conjunction with a second study from a different research group that highlights how the bacteria can speed the accumulation of cancerous cells.. The researchers also learned how to prevent the microorganism, called Fusobacterium nucleatum (Fn), from attaching to colon cells and potentially triggering a cascade of changes that can lead to cancer.. The latest findings advance research from 2011, in which Han and her team identified an adhesive molecule on Fns surface-called FadA-that can attach to VE-cadherin, a cell receptor from the cadherin group on blood vessels.. As Han completed the work on FadA and VE-cadherin, researchers from ...
https://www.healthcanal.com/cancers/41887-dental-researchers-discover-how-oral-bacterium-can-trigger-colorectal-cancer.html
Citation tools | Clinical and Vaccine ImmunologyCitation tools | Clinical and Vaccine Immunology
González, Octavio A. et al HIV-1 Reactivation Induced by the Periodontal Pathogens Fusobacterium nucleatum and Porphyromonas gingivalis Involves Toll-Like Receptor 4 and 9 Activation in Monocytes/Macrophages. Clinical and Vaccine Immunology 17.9 (2010): 1417-1427. Web. 03 June. 2020. ...
https://cvi.asm.org/highwire/citation/11192/download
serums 2019 - Cancer Collaborative Research Networkserums 2019 - Cancer Collaborative Research Network
Multimorbidity of intestinal cancer (IC), type 2 diabetes (T2D) and obesity is a posh set of ailments, affected by environmental and genetic threat components. High-fat diet (HFD) and oral bacterial infection play essential roles in the etiology of these ailments by way of irritation and numerous organic mechanisms. To research the complexity of this multimorbidity, we used the collaborative cross (CC) mouse genetics reference inhabitants. We aimed to research the multimorbidity of IC, T2D, and obesity using CC lines, measuring their responses to HFD and oral bacterial infection.. The research used 63 mice of each sexes generated from two CC lines (IL557 and IL711). For 12 weeks, experimental mice have been maintained on particular dietary regimes mixed with co-infection with oral micro organism Porphyromonas gingivalis and Fusobacterium nucleatum, whereas management teams werent contaminated. Body weight (BW) and outcomes of a intraperitoneal glucose tolerance check (IPGTT) have been recorded ...
https://kancrn.org/tag/serums-2019/
panel beater - Cancer Collaborative Research Networkpanel beater - Cancer Collaborative Research Network
Multimorbidity of intestinal cancer (IC), type 2 diabetes (T2D) and obesity is a posh set of ailments, affected by environmental and genetic threat components. High-fat diet (HFD) and oral bacterial infection play essential roles in the etiology of these ailments by way of irritation and numerous organic mechanisms. To research the complexity of this multimorbidity, we used the collaborative cross (CC) mouse genetics reference inhabitants. We aimed to research the multimorbidity of IC, T2D, and obesity using CC lines, measuring their responses to HFD and oral bacterial infection.. The research used 63 mice of each sexes generated from two CC lines (IL557 and IL711). For 12 weeks, experimental mice have been maintained on particular dietary regimes mixed with co-infection with oral micro organism Porphyromonas gingivalis and Fusobacterium nucleatum, whereas management teams werent contaminated. Body weight (BW) and outcomes of a intraperitoneal glucose tolerance check (IPGTT) have been recorded ...
http://kancrn.org/tag/panel-beater/
Buy Sumycin Online | Order Sumycin Over The CounterBuy Sumycin Online | Order Sumycin Over The Counter
Melbourne: World Health Organization. Fusobacterium fusiforme. Ischemia to new screening. Tongue sumycin for sale in Canada. Always reconsider your healthcare provider to ensure the nausea displayed on this page exists to Sumycin uterine circumstances. Dispersion Details. These millions have been hit by both the oral and stated afternoon of tetracyclines but are less stress after parenteral use. Back Next. Into a white strip of oral curb. The Wall Column Journal. In pulse with high quality and acquisition manufacture, weight, and destination you will save money. It and relieve to your life schedule is higher when used medications, usually grants new, pandas to help in clinical regulation. Japanese women, protracted into Sumycin with jerks and associated neck. Stresses have a broad comprehensive of buddhist rose. Antibiotics Using Sumycin during pregnancy could harm the maximum baby or cause erectile tooth whitening later in the babys life. Immensely newsletter. Latin women, all Sumycin as is a ...
https://buyvermoxonline.com/catalog/Antibiotics/Order-Sumycin-Online.htm
Propionibacterium Infections: Background, EpidemiologyPropionibacterium Infections: Background, Epidemiology
Propionibacterium species are nonsporulating, gram-positive anaerobic bacilli that are considered commensal bacteria on the skin. They are usually nonpathogenic and are common contaminants of blood and body fluid cultures.
https://emedicine.medscape.com/article/226337-overview
Clinical Clues to Diagnosis of Anaerobic Infections - Anaerobic InfectionsClinical Clues to Diagnosis of Anaerobic Infections - Anaerobic Infections
Infections caused by anaerobic bacteria are common and may be serious and life-threatening. Anaerobes are the predominant components of the bacterial flora of
https://www.americorpshealth.biz/anaerobic-infections/clinical-clues-to-diagnosis-of-anaerobic-infections.html
Bacteroides sp. 3 1 40ABacteroides sp. 3 1 40A
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
http://www.uniprot.org/taxonomy/469593
Mouth Bacteria Can Worsen Colorectal Cancer - Cancer Network - OralSystemicLink.proMouth Bacteria Can Worsen Colorectal Cancer - Cancer Network - OralSystemicLink.pro
If we know how fusobacteria localize and become enriched in colon tumors, hopefully we can utilize the same or similar mechanisms to guide and deliver cancer therapeutics to colon tumors, said co-senior author Wendy Garrett, MD, PhD, of the Harvard T.H. Chan School of Public Health in Boston, in a press release. ...
http://oralsystemiclink.pro/cancer/mouth-bacteria-can-worsen-colorectal-cancer-cancer-network/
F. nucleatum </i> 23726 FusoPortal Gene 779 - by The...F. nucleatum </i> 23726 FusoPortal Gene 779 - by The...
ATGAAAAAAATATTAGCATTTATTAGTTTATTATTTTTAATGGTAGCTTGTTCTTCAACAGAAGAAGTTA AAAGTACTGGTAATAGAAATATTAACAGAGGAAGTAATATTTCAAGAAGTCAAACAACAATAAGAAATAT TGGAAAATTCCAAGTTGACTCAAATTCTTATGTGGCAACAGGGAAAAATGAAAGAATTCAATTTATTATT GTTCACTATACAGCAACAGATAATGCAGGTGCTATTAAAGAATTGACTTCAAGTAGAGTAAGTTCACATT TCTTAGTTTTAGATGAAGATGATAATAAAATATACAGCCTAGTTCCACTTGAACAAAGAGCTTGGCATGC AGGAGCAAGTGCATTTAGAGGAAGAACAAATATAAATGATACTTCTGTTGGAATTGAAATAGTGAGTGAA GGTATAGCAAAAGAATTTGTACCTGACCCTAATCCATATCATCCTTATGATCACTATGTTGATTATAAGC CAATACAAATAGAAAAGACTGCACAAATCATAAAATATGTAGCAGAAAAATATAATATTCCTGCAAGAAA TATACTTGCACATTCTGATATTGCACCAAGTAGAAAGAAAGATCCGGGAGCAAAATTTCCTTGGAAAGAA TTATATGATAAATATAATATAGGTGCTTGGTATGATGAAGCAGATAAACAAGAATTTATGGATGAAGAAA AATTTAATGCTACTTCAATTAGAGAAATAAAAGATGAATTGAGAAAATATGGTTATGAAATAAATAGATT TGATGAATGGGATAAAGAAAGTAAAGATGTGGTTTATGCTTTTCAATTGCACTTTAATCCTAAAAATCCA ACAGGAGAAATGGATTTAGAAACTTTTGCAATTTTAAAAGCATTGAATAAAAAATATCCTGAATAA ...
http://fusoportal.org/23726/23726_FusoPortal_Gene_779.html
Cuts to pest control services posing significant threat to public health finds research - LocalGov.co.uk - Your authority on UK...Cuts to pest control services posing significant threat to public health finds research - LocalGov.co.uk - Your authority on UK...
Councils have cut their pest control units by 25% since 2012, leading to a dramatic decrease in the number of reports dealt with, research reveals.
https://www.localgov.co.uk/Cuts-to-pest-control-services-posing-significant-threat-to-public-health-finds-research/43202

No data available that match "fusobacterium"


Fusobacterium - WikipediaFusobacterium - Wikipedia
Fusobacterium is a genus of anaerobic, Gram-negative, non-sporeforming bacteria, similar to Bacteroides. Individual cells are ... Strains of Fusobacterium cause several human diseases, including periodontal diseases, Lemierres syndrome, and topical skin ... Although older sources state that Fusobacterium is part of the normal flora of the human oropharynx, the current consensus is ... October 2004). "Real-time PCR investigation into the importance of Fusobacterium necrophorum as a cause of acute pharyngitis in ...
https://en.wikipedia.org/wiki/Fusobacterium
Fusobacterium endocarditis treated with metronidazole. | The BMJFusobacterium endocarditis treated with metronidazole. | The BMJ
Fusobacterium endocarditis treated with metronidazole.. Br Med J 1978; 1 doi: https://doi.org/10.1136/bmj.1.6118.960 (Published ...
http://www.bmj.com/content/1/6118/960
Fusobacterium and Lemierres Syndrome | Lexington Herald LeaderFusobacterium and Lemierre's Syndrome | Lexington Herald Leader
We live in wondrous times. An astute physician and antibiotics gave my son what could have eluded him in earlier years - a tomorrow.
http://www.kentucky.com/latest-news/article44090415.html
Fusobacterium polymorphum - WikipediaFusobacterium polymorphum - Wikipedia
Fusobacterium polymorphum is a bacterium that has been isolated from the gingival crevice in humans, and has been implicated in ... 1977). "Anticomplementary activity of Fusobacterium polymorphum in normal and C4-deficient sources of guinea pig complement". ...
https://en.wikipedia.org/wiki/Fusobacterium_polymorphum
Uterine Necrosis Associated with Fusobacterium necrophorum InfectionUterine Necrosis Associated with Fusobacterium necrophorum Infection
Infections caused by ,i,Fusobacterium necrophorum,/i, within the fields of obstetrics and gynecology have been infrequently ... i,Fusobacterium necrophorum,/i, is infrequently implicated as a pathogenic organism. When pathogenic, the typical clinical ... "Fusobacterium necrophorum," "Fusobacteria," "Fusobacterium," "bacterial infection," and "obstetrics," "gynecology," "cerclage ... Uterine Necrosis Associated with Fusobacterium necrophorum Infection. T. Widelock. ,1 R. Elkattah,1 S. Gibbs. ,1 Z. Mashak. ,1 ...
https://www.hindawi.com/journals/criog/2015/934913/
Fusobacterium nucleatum subsp. vincentii ATCC 49256 Contig0349, whole - Nucleotide - NCBIFusobacterium nucleatum subsp. vincentii ATCC 49256 Contig0349, whole - Nucleotide - NCBI
Fusobacterium nucleatum subsp. vincentii ATCC 49256 Contig0349, whole genome shotgun sequence. GenBank: AABF01000021.1 ...
https://www.ncbi.nlm.nih.gov/nuccore/27887554?report=graph
Fusobacterium nucleatum in periodontal health and diseaseFusobacterium nucleatum in periodontal health and disease
... Curr Issues Mol Biol. 2011;13(2):25-36. Epub 2011 Jan 10. ... Among gram-negative bacteria implicated in periodontal diseases, Fusobacterium nucleatum, is one of the most interesting. This ...
https://pubmed.ncbi.nlm.nih.gov/21220789/?dopt=Abstract
Fusobacterium Infections | GreenMedInfo | Disease | Natural MedicineFusobacterium Infections | GreenMedInfo | Disease | Natural Medicine
Diseases : Fusobacterium Infections, Periodontal Diseases. Pharmacological Actions : Anti-Bacterial Agents, Anti-Inflammatory ... 2 Abstracts with Fusobacterium Infections Research. Filter by Study Type. In Vitro Study. ...
https://www.greenmedinfo.com/disease/fusobacterium-infections
Fusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironment. - PubMed - NCBIFusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironment. - PubMed - NCBI
D) Western blot of nuclear extracts from human colon cancer with a high or low Fusobacterium relative abundance. Fusobacterium ... Fusobacterium nucleatum promotes small and large intestinal tumorigenesis and is enriched in tumor tissues of ApcMin/+ mice ... A)Fusobacterium abundance for normal tissue (x-axis) vs adenoma (y-axis) is plotted. 29 matched adenoma normal tissues pairs ... C) Fusobacterium spp. transcript relative abundance are plotted for the 133 TCGA colon tumors (upper panel and lower panel x- ...
https://www.ncbi.nlm.nih.gov/pubmed/23954159?dopt=Abstract
Effect of kefir on Fusobacterium nucleatum in potentially prevent...: Ingenta ConnectEffect of kefir on Fusobacterium nucleatum in potentially prevent...: Ingenta Connect
Background&58; Fusobacterium spp. are known to be part of mouth and intestinal microbiota. Fusobacterium nucleatum is an ...
https://www.ingentaconnect.com/content/doaj/21603855/2016/00000006/00000007/art00002
Filifactor alocis (strain ATCC 35896 / D40 B5) (Fusobacterium alocis)Filifactor alocis (strain ATCC 35896 / D40 B5) (Fusobacterium alocis)
Filifactor alocis, originally known as Fusobacterium alocis, was first isolated in1985 from the human gingival crevice, and has ... Proteomes - Filifactor alocis (strain ATCC 35896 / D40 B5) (Fusobacterium alocis). Basket 0 ...
https://www.uniprot.org/proteomes/UP000007468
Fusobacterium nucleatum subsp. nucleatum Knorr ATCC ® 25586D-5&traFusobacterium nucleatum subsp. nucleatum Knorr ATCC ® 25586D-5&tra
nucleatum ATCC ® 25586D-5™ Designation: Genomic DNA from Fusobacterium nucleatum subsp. nucleatum strain VPI 4355 TypeStrain= ... Fusobacterium nucleatum subsp. nucleatum Knorr (ATCC® 25586D-5™) Strain Designations: Genomic DNA from Fusobacterium nucleatum ... Fusobacterium nucleatum subsp. nucleatum Knorr ATCC® 25586D-5™ dried Total DNA: At least 5 µg in 1X TE buffer. OD260/OD280: 1.6 ... Genomic DNA from Fusobacterium nucleatum subsp. nucleatum strain VPI 4355 [ATCC® 25586™] ...
https://www.atcc.org/Products/Cells_and_Microorganisms/Bacteria/Bacterial_Nucleic_Acids/25586D-5.aspx?slp=1
RCSB PDB - 5NCK: The Crystal Structure of N-acetylmannosamine kinase in Fusobacterium nucleatumRCSB PDB - 5NCK: The Crystal Structure of N-acetylmannosamine kinase in Fusobacterium nucleatum
The Crystal Structure of N-acetylmannosamine kinase in Fusobacterium nucleatum ... Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / CIP 101130 / JCM 8532 / LMG 13131). Mutation(s): 0 EC: 2.7.1.60. ... Find proteins for Q8RDN7 (Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / CIP 101130 / JCM 8532 / LMG 13131)) ... Crystal structure of N-acetylmannosamine kinase from Fusobacterium nucleatum.. Caing-Carlsson, R., Goyal, P., Sharma, A., Ghosh ...
https://www.rcsb.org/structure/5nck
Fusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironmentFusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironment
Metagenomic analyses indicate that symbiotic Fusobacterium spp. are associated with human colorectal carcinoma, but whether ... We find that Fusobacterium spp. are enriched in human c … ... We find that Fusobacterium spp. are enriched in human colonic ... Fusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironment Cell Host Microbe ... Metagenomic analyses indicate that symbiotic Fusobacterium spp. are associated with human colorectal carcinoma, but whether ...
https://pubmed.ncbi.nlm.nih.gov/23954159/
Lemierres syndrome and other disseminated Fusobacterium necrophorum infections in Denmark: a prospective epidemiological and...Lemierre's syndrome and other disseminated Fusobacterium necrophorum infections in Denmark: a prospective epidemiological and...
... all cases of disseminated Fusobacterium necrophoruminfections found in Denmark from 1998 to 2001 were analysed, with the aim of ... Burden P (1991) Fusobacterium necrophorum and Lemierres syndrome. J Infect 23(3):227-231PubMedCrossRefGoogle Scholar ... Pace-Balzan A, Keith AO, Curley JW et al (1991) Otogenic Fusobacterium necrophorum meningitis. J Laryngol Otol 105(2):119-120 ... Brazier JS, Hall V, Yusuf E et al (2002) Fusobacterium necrophorum infections in England and Wales 1990-2000. J Med Microbiol ...
https://link.springer.com/article/10.1007%2Fs10096-008-0496-4
Human Infection with Fusobacterium necrophorum without Jugular Venous Thrombosis: A Varied Presentation of Lemierres SyndromeHuman Infection with Fusobacterium necrophorum without Jugular Venous Thrombosis: A Varied Presentation of Lemierre's Syndrome
Fusobacterium necrophorum usually causes infection in animals and rarely affects humans. We hereby present a case of ... Lemierres syndrome is also known as postangina septicemia, which is commonly caused by Fusobacterium necrophorum also known as ...
https://www.hindawi.com/journals/criid/2017/5358095/abs/
Splenic Abscess from Fusobacterium nucleatum | Annals of Internal Medicine | American College of PhysiciansSplenic Abscess from Fusobacterium nucleatum | Annals of Internal Medicine | American College of Physicians
Fusobacterium nucleatum has not been reported previously in this setting; however, we describe a behavioral pattern that may ... We report a case of splenic abscess due to Fusobacterium nucleatum in a patient who had a history of intravenous drug abuse and ... Splenic Abscess from Fusobacterium nucleatum. Ann Intern Med. 1989;110:948. doi: 10.7326/0003-4819-110-11-948_1 ... Splenic Abscess from Fusobacterium nucleatum Stuart W. Haber, MD; Carl A. Perlino, MD ...
https://annals.org/aim/article-abstract/703163/splenic-abscess-from-fusobacterium-nucleatum
Evolution of Invasion in a Diverse Set of Fusobacterium Species | mBioEvolution of Invasion in a Diverse Set of Fusobacterium Species | mBio
Genome sequence of Fusobacterium nucleatum subspecies polymorphum-a genetically tractable Fusobacterium. PLoS One 2:e659. doi: ... Evolution of Invasion in a Diverse Set of Fusobacterium Species. Abigail Manson McGuire, Kyla Cochrane, Allison D. Griggs, ... Evolution of Invasion in a Diverse Set of Fusobacterium Species. Abigail Manson McGuire, Kyla Cochrane, Allison D. Griggs, ... Little-known Fusobacterium species and miscellaneous genera. Rev. Infect. Dis. 3:599-626. doi:10.1093/clinids/3.3.599. ...
https://mbio.asm.org/content/5/6/e01864-14
KEGG PATHWAY: Terpenoid backbone biosynthesis - Fusobacterium nucleatum subsp. nucleatum ATCC 25586KEGG PATHWAY: Terpenoid backbone biosynthesis - Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Terpenoid backbone biosynthesis - Fusobacterium nucleatum subsp. nucleatum ATCC 25586 [ Pathway menu , Organism menu , Pathway ...
http://www.genome.jp/kegg-bin/show_pathway?fnu00900
Fusobacterium-Positive and Streptococcal-Positive Pharyngitis | Annals of Internal Medicine | American College of PhysiciansFusobacterium-Positive and Streptococcal-Positive Pharyngitis | Annals of Internal Medicine | American College of Physicians
Fusobacterium-Positive and Streptococcal-Positive Pharyngitis James R. Uhl, MS; Daniel R. Gustafson, BS; Stefanea L. Rucinski, ... Fusobacterium-Positive and Streptococcal-Positive Pharyngitis. Ann Intern Med. 2015;162:876-877. doi: 10.7326/L15-5099-2 ... The Clinical Presentation of Fusobacterium-Positive and Streptococcal-Positive Pharyngitis in a University Health Clinic: A ...
https://annals.org/aim/article-abstract/2322813/fusobacterium-positive-streptococcal-positive-pharyngitis
Fusobacterium nucleatum in colorectal carcinoma tissue and patient prognosis | GutFusobacterium nucleatum in colorectal carcinoma tissue and patient prognosis | Gut
Fusobacterium nucleatum may promote colorectal tumour growth and inhibit T cell-mediated immune responses against colorectal ...
https://gut.bmj.com/content/early/2015/08/26/gutjnl-2015-310101
Chemical structure of the lipid A component of lipopolysaccharides from Fusobacterium nucleatum. | Journal of BacteriologyChemical structure of the lipid A component of lipopolysaccharides from Fusobacterium nucleatum. | Journal of Bacteriology
Chemical structure of the lipid A component of lipopolysaccharides from Fusobacterium nucleatum.. S Hase, T Hofstad, E T ... The lipid A component of lipopolysaccharides from Fusobacterium nucleatum Fev 1 consists of beta-1,6-linked D-glucosamine ... Chemical structure of the lipid A component of lipopolysaccharides from Fusobacterium nucleatum. ... Chemical structure of the lipid A component of lipopolysaccharides from Fusobacterium nucleatum. ...
https://jb.asm.org/content/129/1/9?ijkey=2ac4cbed2134b92d8799cdb02aea61ab04e39202&keytype2=tf_ipsecsha
Detection of Fusobacterium nucleatum in stool and colonic tissues from Norwegian colorectal cancer patients | SpringerLinkDetection of Fusobacterium nucleatum in stool and colonic tissues from Norwegian colorectal cancer patients | SpringerLink
CRC Fusobacterium nucleatum Early detection Non-invasive Biomarker qPCR This is a preview of subscription content, log in to ... Nosho K, Sukawa Y, Adachi Y, Ito M, Mitsuhashi K, Kurihara H et al (2016) Association of Fusobacterium nucleatum with immunity ... Flanagan L, Schmid J, Ebert M, Soucek P, Kunicka T, Liska V et al (2014) Fusobacterium nucleatum associates with stages of ... Wong SH, Kwong TNY, Chow TC, Luk AKC, Dai RZW, Nakatsu G et al (2017) Quantitation of faecal Fusobacterium improves faecal ...
https://link.springer.com/article/10.1007/s10096-019-03562-7
Atopobium and Fusobacterium as novel candidates for sarcoidosis-associated microbiota | European Respiratory SocietyAtopobium and Fusobacterium as novel candidates for sarcoidosis-associated microbiota | European Respiratory Society
Atopobium and Fusobacterium as novel candidates for sarcoidosis-associated microbiota. Alexandra Zimmermann, Henrik Knecht, ... Atopobium and Fusobacterium as novel candidates for sarcoidosis-associated microbiota. Alexandra Zimmermann, Henrik Knecht, ... Atopobium and Fusobacterium as novel candidates for sarcoidosis-associated microbiota. Alexandra Zimmermann, Henrik Knecht, ... Atopobium and Fusobacterium as novel candidates for sarcoidosis-associated microbiota Message Subject (Your Name) has sent you ...
https://erj.ersjournals.com/content/50/6/1600746.abstract
PROTEOMIC CHARACTERIZATION OF FUSOBACTERIUM NUCLEATUM OUTER MEMBRANE VESICLESPROTEOMIC CHARACTERIZATION OF FUSOBACTERIUM NUCLEATUM OUTER MEMBRANE VESICLES
Fusobacterium nucleatum is a Gram-negative anaerobic bacterium prevalent in the human oral cavity. This oral commensal ...
https://ecommons.cornell.edu/handle/1813/59678
Fusobacterium May Help Colorectal Cancer Grow And SpreadFusobacterium May Help Colorectal Cancer Grow And Spread
... this certainly holds true for Fusobacterium! This bacteria could help colon cancer grow & spread. Learn more about it here. ... What is Fusobacterium?. According to recent research[1], Fusobacterium is found at the site of colon and rectal tumors. The ... Fusobacterium is one of the bacterial species recently identified in the gastrointestinal tract, with implications for the ... It was only recently discovered that bacterial species such as Fusobacterium are found in the colorectal tumors. In order to ...
https://www.colonhealthmagazine.com/colon-cancer/fusobacterium-causes-colon-cancer.html
COVID-19-Associated Fusobacterium nucleatum Bacteremia, Belgium - Volume 27, Number 3-March 2021 - Emerging Infectious Diseases...COVID-19-Associated Fusobacterium nucleatum Bacteremia, Belgium - Volume 27, Number 3-March 2021 - Emerging Infectious Diseases...
Abed J, Maalouf N, Manson AL, Earl AM, Parhi L, Emgård JEM, et al. Colon cancer-associated Fusobacterium nucleatum may ... Strauss J, Kaplan GG, Beck PL, Rioux K, Panaccione R, Devinney R, et al. Invasive potential of gut mucosa-derived Fusobacterium ... Nohrström E, Mattila T, Pettilä V, Kuusela P, Carlson P, Kentala E, et al. Clinical spectrum of bacteraemic Fusobacterium ... Fusobacterium nucleatum: a commensal-turned pathogen. Curr Opin Microbiol. 2015;23:141-7. DOIPubMedGoogle Scholar ...
https://wwwnc.cdc.gov/eid/article/27/3/20-2284_article
Analysis of Fusobacterium persistence and antibiotic response in colorectal cancer | ScienceAnalysis of Fusobacterium persistence and antibiotic response in colorectal cancer | Science
Fusobacterium "High" if Fusobacterium RA was ,1% (n = 110, median RA = 5%, mean RA = 7.4%) and Fusobacterium "Low/Neg" if RA ... Fusobacterium-positive primary tumor and Fusobacterium-negative metastases (n = 1 pair), and Fusobacterium-negative primary ... Feeding mice with Fusobacterium (16-18), infection of colorectal cancer cell lines with Fusobacterium (19-21), and generation ... 3 Fusobacterium and co-occurring anaerobes persist in colon adenocarcinoma PDXs.. (A) Assessment of Fusobacterium persistence ...
https://science.sciencemag.org/content/358/6369/1443
Table - COVID-19-Associated Fusobacterium nucleatum Bacteremia, Belgium - Volume 27, Number 3-March 2021 - Emerging Infectious...Table - COVID-19-Associated Fusobacterium nucleatum Bacteremia, Belgium - Volume 27, Number 3-March 2021 - Emerging Infectious...
We report 4 cases of Fusobacterium nucleatum bacteremia associated with coronavirus disease (COVID-19). Three cases occurred ... COVID-19-Associated Fusobacterium nucleatum Bacteremia, Belgium Louis Wolff, Delphine Martiny, Véronique Yvette Miendje Deyi, ... Characteristics of 4 cases of Fusobacterium nucleatum bacteremia in patients with COVID-19, Belgium* ...
https://wwwnc.cdc.gov/eid/article/27/3/20-2284-t1
Fusobacterium nucleatum in colorectal carcinoma tissue and patient prognosis | GutFusobacterium nucleatum in colorectal carcinoma tissue and patient prognosis | Gut
Fusobacterium nucleatum may promote colorectal tumour growth and inhibit T cell-mediated immune responses against colorectal ... MM applies a patent on Fusobacterium in colorectal cancer diagnosis, and has ownership interest in and is a consultant and ...
https://gut.bmj.com/content/65/12/1973
SubspPorphyromonasSpeciesInfectionsInfectionBacteremiaMicrobiotaGenusPositive for Fusobacterium nucleatumPolymorphumLiverBacteriaBacteriumPeriodontitisTumorsMicrobiologyPeriodontal diseasesBacteroidesAbscessEpithelial CellsBacterialPathogenTumorigenesisAntimicrobialClinicalDiagnosed with colorectal cancerStrainsAntibioticMiceGram-negativeCarcinogenesisAnaerobeMetronidazolePrevalence2016OrganismVirulence1991StreptococcusColonTumour growth
Subsp9
  • Fusobacterium nucleatum subsp. (nih.gov)
  • Genomic DNA from Fusobacterium nucleatum subsp. (atcc.org)
  • AE009951 Fusobacterium nucleatum subsp. (atcc.org)
  • Terpenoid backbone biosynthesis - Fusobacterium nucleatum subsp. (genome.jp)
  • Fusobacterium n. subsp. (vetstream.com)
  • TIG_FUSNN Trigger factor OS=Fusobacterium nucleatum subsp. (uniprot.org)
  • annotation:(type:'catalytic activity' rhea:21736) AND reviewed:yes AND organism:'Fusobacterium nucleatum subsp. (uniprot.org)
  • The only alignments we obtained that were markedly disproportionate between tumor and control were to the genome of Fusobacterium nucleatum subsp. (ivanrivasmd.com)
  • Detection of Fusobacterium necrophorum subsp. (microbiologyresearch.org)
Porphyromonas11
  • Although infections with periopathogenic bacteria such as Porphyromonas gingivalis ( P. gingivalis ) and Fusobacterium nucleatum ( F. nucleatum ) are essential for inducing periodontitis, the nature and magnitude of the disease is determined by the host's immune response. (pubmedcentralcanada.ca)
  • Using an in vitro tissue culture model, a selected group of gram-negative anaerobic bacteria frequently associated with periodontal diseases, including Bacteroides forsythus, Campylobacter curvus, Eikenella corrodens, Fusobacterium nucleatum, Porphyromonas gingivalis, and Prevotella intermedia, were examined for their ability to adhere to and invade primary cultures of human gingival epithelial cells (HGEC). (eurekamag.com)
  • Since Toll-like receptor 2 (TLR2), TLR4, and TLR9 activation have been involved in HIV-1 recrudescence, we sought to determine the role of these TLRs in HIV-1 reactivation induced by the periodontal pathogens Fusobacterium nucleatum and Porphyromonas gingivalis using BF24 monocytes/macrophages stably transfected with the HIV-1 promoter driving chloramphenicol acetyltransferase (CAT) expression and THP89GFP cells, a model of HIV-1 latency. (asm.org)
  • The present research aims to examine a periodontal disease model in which specific pathogen-free Wistar rats are orally exposed to Porphyromonas gingivalis associated with Fusobacterium nucleatum . (bvsalud.org)
  • The experimental animals were repeatedly infected with Porphyromonas gingivalis and Fusobacterium nucleatum for one week. (bvsalud.org)
  • Our study showed that four weeks following infection with Porphyromonas gingivalis and Fusobacterium nucleatum bone loss in Wistar rats could be identified. (bvsalud.org)
  • Este estudo teve o objetivo de induzir doença periodontal pela inoculação oral da Porphyromonas gingivalis associada à Fusobacterium nucleatum em ratos da linhagem Wistar. (bvsalud.org)
  • Os animais do grupo experimental foram infectados oralmente por Porphyromonas gingivalis associada à Fusobacterium nucleatum durante uma semana. (bvsalud.org)
  • O presente estudo demonstrou que 4 semanas de infecção pelas bactérias Porphyromonas gingivalis e Fusobacterium nucleatum promoveu perda óssea em ratos da linhagem Wistar. (bvsalud.org)
  • Abstract The aim of this study was to compare the biological activity of lipopolysaccharides (LPS) purified from Fusobacterium nucleatum and Porphyromonas gingivalis strains , both isolated from primary endodontic infection (PEI) in the levels of IL-1 β and TNF-α released by macrophage cells . (bvsalud.org)
  • Resumo O objetivo deste estudo foi comparar a atividade biológica de lipopolissacarídeos (LPS) purificados a partir de linhagens de Fusobacterium nucleatum e Porphyromonas gingivalis , ambas isoladas de infecções endodônticas primárias (IEP) nos níveis de IL-1 β e TNF-α produzidos por macrófagos . (bvsalud.org)
Species31
  • Synergy in biofilm formation between Fusobacterium nucleatum and Prevotella species" (PDF). (wikipedia.org)
  • The diverse Fusobacterium genus contains species implicated in multiple clinical pathologies, including periodontal disease, preterm birth, and colorectal cancer. (asm.org)
  • Actively invading Fusobacterium species can enter host cells independently, whereas passively invading species need additional factors, such as compromise of mucosal integrity or coinfection with other microbes. (asm.org)
  • In the largest and most comprehensive comparison of sequenced Fusobacterium species to date, we have generated a testable model for the molecular pathogenesis of Fusobacterium infection and illuminate new therapeutic or diagnostic strategies. (asm.org)
  • IMPORTANCE Fusobacterium species have recently been implicated in a broad spectrum of human pathologies, including Crohn's disease, ulcerative colitis, preterm birth, and colorectal cancer. (asm.org)
  • Largely due to the genetic intractability of member species, the mechanisms by which Fusobacterium causes these pathologies are not well understood, although adherence to and active invasion of host cells appear important. (asm.org)
  • We examined whole-genome sequence data from a diverse set of Fusobacterium species to identify genetic determinants of active forms of host cell invasion. (asm.org)
  • Our analyses revealed that actively invading Fusobacterium species have larger genomes than passively invading species and possess a specific complement of genes-including a class of genes of unknown function that we predict evolved to enable host cell adherence and invasion. (asm.org)
  • The bacterial genus Fusobacterium is comprised of at least 13 species that are primarily anaerobic, nonmotile, non-spore-forming, Gram-negative rods and members of the normal human microbiota ( 1 ). (asm.org)
  • 16S rRNA gene-based sequencing projects have resolved the Fusobacterium genus into groups of species that can be loosely characterized by their interactions with the human host and potential to cause disease ( 1 - 3 ). (asm.org)
  • Some Fusobacterium species are capable of "actively" invading host cells without the aid of other factors, whereas other species require compromise of mucosal integrity or coinfection with a virus for host cell invasion ( 4 ). (asm.org)
  • Fusobacterium is one of the bacterial species recently identified in the gastrointestinal tract, with implications for the treatment of colorectal cancer . (colonhealthmagazine.com)
  • It was only recently discovered that bacterial species such as Fusobacterium are found in the colorectal tumors. (colonhealthmagazine.com)
  • Further research is necessary to determine the underlying connection between Fusobacterium as bacterial species and colorectal cancer cells. (colonhealthmagazine.com)
  • For all of these reasons, scientists believe that, in the future, the treatment for colorectal cancer might target the Fusobacterium bacterial species living in close connection with the tumor. (colonhealthmagazine.com)
  • In performing this study, scientists were able to confirm that Fusobacterium is an invasive bacterial species, supporting the inflammation [2] in the gastrointestinal tract. (colonhealthmagazine.com)
  • The anaerobic, Gram-negative bacterial species Fusobacterium nucleatum is a common resident of the human mouth and gut and varies in its pathogenic potential. (asm.org)
  • The non-spore-forming, anaerobic, Gram-negative bacterial species Fusobacterium nucleatum is both a normal inhabitant of the human mouth and gut and a recognized opportunistic pathogen implicated in inflammatory diseases of both the mouth, such as periodontitis, and the gut, such as appendicitis and IBD ( 36 , 40 , 43 ). (asm.org)
  • However, the Fusobacterium species and subspecies involved and their oncogenic mechanisms remain to be determined. (aacrjournals.org)
  • Fusobacterium nucleatum is a gram-negative anaerobic species residing in the oral cavity and implicated in several inflammatory processes in the human body. (biomedcentral.com)
  • Fusobacterium species (spp. (biomedcentral.com)
  • Fusobacterium species is a topic covered in the Johns Hopkins ABX Guide . (hopkinsguides.com)
  • Johns Hopkins Guide , www.hopkinsguides.com/hopkins/view/Johns_Hopkins_ABX_Guide/540675/all/Fusobacterium_species. (hopkinsguides.com)
  • Pediatrics Central , peds.unboundmedicine.com/pedscentral/view/Johns_Hopkins_ABX_Guide/540675/all/Fusobacterium_species. (unboundmedicine.com)
  • In addition to these established risk factors, increasing evidence has linked CRC with some bacterial species in the gastrointestinal tract such as Fusobacterium nucleatum . (ivanrivasmd.com)
  • Fusobacterium is a genus of the Fusobacteriaceae family, containing bacterial species isolated from both human and animal sources. (ivanrivasmd.com)
  • Multiple Fusobacterium species are oral pathogens that infect a broad range of human organ and tissue niches ( 1 , 2 ). (asm.org)
  • Fusobacterium nucleatum is a strictly anaerobic microorganism that is indigenous to the human oral cavity, where it coexists with more than 500 other species [ 1 ]. (biomedcentral.com)
  • Previous research from several laboratories identified the bacterial species, called Fusobacterium nucleatum , as one of the most prevalent in colorectal tumors. (cancer.gov)
  • Several other species of bacteria often found living with Fusobacterium were also detected in both primary and metastatic tumors and in similar proportions at both sites, suggesting a stable microbial community centered around Fusobacterium , wrote the authors. (cancer.gov)
  • The research team then created a new mouse model of colorectal cancer using tissue taken from patients whose tumors harbored Fusobacterium and other associated bacterial species. (cancer.gov)
Infections10
  • Infections caused by Fusobacterium necrophorum within the fields of obstetrics and gynecology have been infrequently reported. (hindawi.com)
  • Filifactor alocis, originally known as Fusobacterium alocis, was first isolated in1985 from the human gingival crevice, and has since been discovered in patients suffering from chronic periodontitis, generalized aggressive, periodontitis and endodontic infections. (uniprot.org)
  • In a 3-year prospective study, all cases of disseminated Fusobacterium necrophorum infections found in Denmark from 1998 to 2001 were analysed, with the aim of describing the epidemiology and clinical features of the variants of Lemierre's syndrome and disseminated non-head-and-neck-associated F. necrophorum infections. (springer.com)
  • Alternative to penicillin G for treatment of infections caused by Fusobacterium fusiforme (Vincent's infection). (drugs.com)
  • Although uncommon, Fusobacterium infections have a wide clinical spectrum, ranging from local pharyngeal infections to septic shock. (jccm.ro)
  • Our aim was to characterize and analyze the clinical features and outcomes in patients with Fusobacterium infections, and determine which variables were able to predict a poor outcome. (jccm.ro)
  • Although we found no deaths attributable to Fusobacterium, 15 patients (57%) were found to have severe infections due to this pathogen, and 7 patients (26.9%) were admitted to the Intensive Care Unit (ICU). (jccm.ro)
  • Fusobacterium infections are uncommon. (jccm.ro)
  • Fusobacterium nucleatum is a strict anaerobic microorganism that causes disease entities such as periodontal and soft tissue abscesses, pulmonary and intraabdominal infections and very rarely intracerebral infections. (biomedcentral.com)
  • Created by the university's Sanjeev Narayanan, Amit Kumar, T.G. Nagaraja and M.M. Chengappa, the new technology can be used to treat infections caused by Fusobacterium without the use of antibiotics. (outbreaknewstoday.com)
Infection8
  • We describe a 19-year-old woman who underwent a cesarean delivery complicated by sepsis and purulent uterine necrosis secondary to Fusobacterium necrophorum infection. (hindawi.com)
  • Riordan T (2007) Human infection with Fusobacterium necrophorum (Necrobacillosis), with a focus on Lemierre's syndrome. (springer.com)
  • Fusobacterium necrophorum usually causes infection in animals and rarely affects humans. (hindawi.com)
  • 2016), that described how we intended to replicate an experiment from the paper ' Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma' (Castellarin et al. (elifesciences.org)
  • The researchers developed a solution that could provide effective, antibiotic-free prevention of Fusobacterium necrophorum infection. (outbreaknewstoday.com)
  • Fusobacterium nucleatum is a prominent member of the oral microbiota and is a common cause of human infection. (duhnnae.com)
  • The team discovered a specific protein that plays a pivotal role in mediating Fusobacterium attachment to the host cells that allow pathologic infection of the host. (outbreaknewstoday.com)
  • Our invention helps induce an immunologic response in the host, which would prevent attachment and establishment of Fusobacterium in cattle, thus providing protection against the infection. (outbreaknewstoday.com)
Bacteremia3
  • We report 4 cases of Fusobacterium nucleatum bacteremia associated with coronavirus disease (COVID-19). (cdc.gov)
  • In addition, the relative role of co-morbidities on the acquisition of Fusobacterium bacteremia has not yet been teased out. (biomedcentral.com)
  • A 25-year-old male without prior co-morbidities was admitted to hospital with Fusobacterium necrophorum bacteremia, where he was found to have liver and splenic abscesses. (nebraska.edu)
Microbiota4
  • Leung A, Tsoi H, Yu J (2015) Fusobacterium and Escherichia: models of colorectal cancer driven by microbiota and the utility of microbiota in colorectal cancer screening. (springer.com)
  • Fusobacterium nucleatum is a gram-negative anaerobic rod member of the oral and digestive microbiota ( 1 ). (cdc.gov)
  • However, the disturbance of intestinal microbiota and the role of Fusobacterium nucleatum during the colorectal adenoma-carcinoma sequence have not yet been evaluated. (oncotarget.com)
  • Fusobacterium nucleatum é um anaeróbio estrito e considerado membro da microbiota indígena da cavidade bucal humana. (unesp.br)
Genus3
  • Fusobacterium is a genus of anaerobic, Gram-negative, non-sporeforming bacteria, similar to Bacteroides. (wikipedia.org)
  • The genus Fusobacterium was highly enriched in tumors, while the Bacteroidetes and Firmicutes phyla were depleted.We show that in the \(Apc^{Min/+}\) mouse model of intestinal tumorigenesis, Fusobacterium nucleatum increases tumor multiplicity, selectively recruits tumor-infiltrating myeloid cells, and is associated with a pro-inflammatory expression signature that is shared with human fusobacteria-positive colorectal carcinomas. (harvard.edu)
  • Recently, certain gut bacteria, including some in the Fusobacterium genus, have been implicated in playing a role in human colorectal cancer development. (aacrjournals.org)
Positive for Fusobacterium nucleatum1
  • Anaerobic cultures obtained from blood and intramural thrombus were positive for Fusobacterium nucleatum. (scirp.org)
Polymorphum2
  • Fusobacterium polymorphum is a bacterium that has been isolated from the gingival crevice in humans, and has been implicated in the immunopathology of periodontal disease. (wikipedia.org)
  • Genome Sequence of Fusobacterium nucleatum Subspecies Polymorphum - a Genetically Tractable Fusobacterium - Descarga este documento en PDF. (duhnnae.com)
Liver10
  • Fusobacterium nucleatum is an obligate anaerobe, Gram negative, non-spore forming pleomorphic bacillus that can cause diseases not only in the mouth and teeth but also in the brain, pleura, lungs and liver. (ingentaconnect.com)
  • The research confirmed the presence of Fusobacterium in both primary tumors and liver metastases. (colonhealthmagazine.com)
  • We report a case of infected iliac artery aneurysm concomitant with liver abscesses caused by Fusobacterium nucleatum. (scirp.org)
  • A Rare Case of Fusobacterium Necrophorum Liver Abscesses. (hepaton.com)
  • Fusobacterium necrophorum causing liver abscesses is a rare condition and only a few cases have been reported. (hepaton.com)
  • Nagaraja and his associates discovered that the Fusobacterium bacterium is able to survive in the liver because it produces leukotoxins. (outbreaknewstoday.com)
  • Liver abscess, diverticulosis, Fusobacterium necrophorum. (clinicsandpractice.org)
  • To see whether Fusobacterium is also found at sites in the body where colorectal cancer has spread, the research team performed whole-genome sequencing on frozen tissue samples from primary tumors and liver metastases from 11 patients. (cancer.gov)
  • Multiloculated Liver Abscess Caused by Fusobacterium: Role of Karius Testing in Diagnosis. (infectoforum.net)
  • Fusobacterium is well known for causing liver abscesses in cattle and sheep, and has been identified as a human pathogen that can cause some periodontal - or gum - diseases, topical skin ulcers, Lemierre's syndrome and other conditions. (outbreaknewstoday.com)
Bacteria7
  • Among gram-negative bacteria implicated in periodontal diseases, Fusobacterium nucleatum, is one of the most interesting. (nih.gov)
  • However, the recent research confirmed that the Fusobacterium bacteria travel at the same time with the cancerous cells, through the bloodstream. (colonhealthmagazine.com)
  • Fusobacterium nucleatum induces premature and term stillbirths in pregnant mice: implication of oral bacteria in preterm birth. (biomedsearch.com)
  • Identification of a Fusobacterium nucleatum PK1594 galactose-binding adhesin which mediates coaggregation with periopathogenic bacteria and hemagglutination. (asm.org)
  • Higher-density Fusobacterium was found in CRC patients comparing to the health through quantitative PCR and bacteria 16S rDNA sequence analysis, including tumor tissues and faeces. (ivanrivasmd.com)
  • This suggests that the bacteria may be travelling with cancer cells through the bloodstream to the sites of metastasis, instead of new Fusobacterium cells joining the metastatic cells at their distant sites, he said. (cancer.gov)
  • If an approach to specifically killing Fusobacterium could destroy only the cancer-associated community of bacteria, "then maybe that would impact the cancer without having a lot of impact on the rest of the [body's] microbiome," he concluded. (cancer.gov)
Bacterium6
  • Fusobacterium nucleatum is a Gram-negative anaerobic bacterium prevalent in the human oral cavity. (cornell.edu)
  • The same oral commensal bacterium and gum disease pathogen called Fusobacterium nucleatum was found to be predominantly associated with primary human colorectal cancer cells and even in distant metastatic lesions, a study published in 2017 on the journal Science , reports. (uct.ac.za)
  • Clinically, infected aortoiliac aneurysm complicated by Fusobacterium is extremely rare relative to the prevalence of the pathogenic bacterium. (scirp.org)
  • Fusobacterium nucleatum is a gram-negative anaerobic bacterium best known as a component of the oral plaque and a key pathogen in gingivitis and periodontitis [ 1 ]. (biomedcentral.com)
  • Fusobacterium nucleatum , a gram-negative anaerobic bacterium, is one of the commensal microbes which is found naturally in the microflora of mouth and gastrointestinal tract in healthy humans. (ivanrivasmd.com)
  • Fusobacterium nucleatum has recently been connected with colorectal cancer (CRC) ( 3 , 4 ), with studies showing that this bacterium induces a proinflammatory microenvironment and chemoresistance against drugs used to treat CRC ( 5 - 7 ). (asm.org)
Periodontitis4
  • Fusobacterium nucleatum is associated with periodontitis. (ivanrivasmd.com)
  • Chronic inflammation is regarded as one of the main causes of digestion system cancer.It has been report that Fusobacterium could induce gingivitis , periodontitis , and oral ulcerations. (ivanrivasmd.com)
  • In summary, FusoPortal ( http://fusoportal.org ) is the first database of MinION-sequenced and completely assembled Fusobacterium genomes, and this central Fusobacterium genomic and bioinformatic resource will aid the scientific community in developing a deeper understanding of how this human pathogen contributes to an array of diseases, including periodontitis and colorectal cancer. (asm.org)
  • We believe that the availability of this resource will result in the discovery of proteins and molecular mechanisms used by an oral pathogen, with the potential to further our understanding of how Fusobacterium nucleatum contributes to a repertoire of diseases, including periodontitis, preterm birth, and colorectal cancer. (asm.org)
Tumors4
  • According to recent research [1] , Fusobacterium is found at the site of colon and rectal tumors. (colonhealthmagazine.com)
  • Of these, seven had Fusobacterium DNA in both the primary and metastatic tumors. (cancer.gov)
  • Erythromycin had no effect on the growth of Fusobacterium -positive tumors, but metronidazole reduced both the number of Fusobacterium in tumors and the rate of tumor cell proliferation and tumor growth. (cancer.gov)
  • The tumors are [likely] benefiting from Fusobacterium -the Fusobacterium may be providing essential nutrients or growth signals to the tumor," explained Phillip Daschner, a program director with NCI's Division of Cancer Biology who was not involved with the study. (cancer.gov)
Microbiology1
  • We thank all of the Danish departments of clinical microbiology, who sent us the Fusobacterium necrophorum isolates, the clinical departments, who provided us with records from all of the patients, E. Olsen for help with the SPSS software and N. Nørskov-Lauritsen for critical advice with the manuscript. (springer.com)
Periodontal diseases2
  • Strains of Fusobacterium cause several human diseases, including periodontal diseases, Lemierre's syndrome, and topical skin ulcers. (wikipedia.org)
  • Fusobacterium nucleatum is a Gram-negative anaerobic organism that plays a central role in the development of periodontal diseases. (microbiologyresearch.org)
Bacteroides1
  • Lemierre's syndrome is also known as postangina septicemia, which is commonly caused by Fusobacterium necrophorum also known as Necrobacillus and also by other microorganisms like Staphylococcus , Streptococcus , Peptostreptococcus , and Bacteroides . (hindawi.com)
Abscess5
  • We report a case of splenic abscess due to Fusobacterium nucleatum in a patient who had a history of intravenous drug abuse and no evidence of endocarditis. (annals.org)
  • Haber SW, Perlino CA. Splenic Abscess from Fusobacterium nucleatum . (annals.org)
  • Fusobacterium necrophorum is a well-known cause of Lemirre's disease and accumulating evidence support its pathogenic role in peritonsillar abscess while its role in recurrent and chronic tonsillitis is uncertain. (biomedcentral.com)
  • Culture of the abscess fluid grew Fusobacterium necrophorum. (hepaton.com)
  • Here, we report the rare case of a previously healthy 25-year-old German man with a cerebellar abscess caused by Fusobacterium nucleatum that resulted in rapid brain death. (biomedcentral.com)
Epithelial Cells2
  • Fusobacterium nucleatum promotes tumor formation by epithelial cells via unclear mechanisms. (unboundmedicine.com)
  • Fusobacterium nucleatum (F. nucleatum), which has been associated with colorectal carcinogenesis, can impair anti-tumour immunity, and actively invade colon epithelial cells. (elsevier.com)
Bacterial1
  • RESULTS: The anti-bacterial activity of 6% and 9% turmeric solution was statistically significant against Fusobacterium nucleatum when compared to 2% Chlorhexidine and 5% sodium hypochlorite. (mendeley.com)
Pathogen1
  • Although older sources state that Fusobacterium is part of the normal flora of the human oropharynx, the current consensus is that Fusobacterium should always be treated as a pathogen. (wikipedia.org)
Tumorigenesis3
  • Fusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironment. (nih.gov)
  • Additionally, in the Apc(Min/+) mouse model of intestinal tumorigenesis, Fusobacterium nucleatum increases tumor multiplicity and selectively recruits tumor-infiltrating myeloid cells, which can promote tumor progression. (nih.gov)
  • Bashir A, Miskeen AY, Bhat A, Fazili KM, Ganai BA (2015) Fusobacterium nucleatum: an emerging bug in colorectal tumorigenesis. (springer.com)
Antimicrobial1
  • Although it is not clear yet if good oral hygiene would probably add advantage to preventive measures to colorectal cancer outcome, these scientists recommended the use of antibiotic Metronidazole, Fusobacterium -specific antimicrobial agents or phage therapy concurrently in colon cancer treatment. (uct.ac.za)
Clinical5
  • in clinical colorectal cancer specimens by targeted sequencing of Fusobacterium 16S ribosomal RNA gene. (aacrjournals.org)
  • Recent studies show that a high amount of tissue-associated Fusobacterium nucleatum (Fn) has been connected to an advanced disease stage and poor clinical outcome in colorectal cancer (CRC) [ 1 , 2 ]. (oncotarget.com)
  • Clinical syndromes caused by Fusobacterium spp. (biomedcentral.com)
  • Fusobacterium necrophorum may cause a number of clinical syndromes, collectively known as necrobacillosis. (springer.com)
  • This case emphasizes the need for a high index of clinical suspicion to make the diagnosis of Fusobacterium necrophorum meningitis. (springer.com)
Diagnosed with colorectal cancer1
  • The potential antibiotics that might be used to eliminate the Fusobacterium in patients diagnosed with colorectal cancer would have to present a high level of particularity. (colonhealthmagazine.com)
Strains1
  • IMPORTANCE In this report, we describe a hybrid MinION whole-genome sequencing pipeline and the genomic characteristics of the first eight Fusobacterium strains deposited in the FusoPortal database. (asm.org)
Antibiotic2
  • To test how antibiotic treatment might impact tumor growth, the researchers treated these mice with erythromicin, which does not kill Fusobacterium, or metronidazole , which does. (cancer.gov)
  • Potential antibiotic approaches to killing Fusobacterium in patients with colorectal cancer would need to be very specific, explained Dr. Meyerson. (cancer.gov)
Mice1
  • D ) Fusobacterium abundance in matched tumor (T) versus normal (N) tissues from colons of Apc Min/+ mice fed F. nucleatum measured by quantitative PCR. (nih.gov)
Gram-negative2
  • Fusobacterium nucleatum is a gram-negative anaerobe ubiquitous to the oral cavity. (biomedsearch.com)
  • During the last decade, the anaerobic, pleomorphic Gram-negative rod Fusobacterium necrophorum has been suggested to play an important pathogenic role in acute and recurrent tonsillitis as well as in persistent sore throat syndrome [ 12 - 15 ]. (biomedcentral.com)
Carcinogenesis1
  • The underlying mechanism of Fusobacterium nucleatum (Fn) in the carcinogenesis of colorectal cancer (CRC) is poorly understood. (oncotarget.com)
Anaerobe2
  • Fusobacterium nucleatum is an oral anaerobe associated with periodontal disease, adverse pregnancy outcomes and colorectal carcinoma. (duhnnae.com)
  • Fusobacterium nucleatum is a strict anaerobe and is indigenous of the human oral cavity. (unesp.br)
Metronidazole1
  • Fusobacterium endocarditis treated with metronidazole. (bmj.com)
Prevalence1
  • Prevalence of Fusobacterium necrophorum in persistent sore throat samples. (dmu.ac.uk)
20161
  • Nosho K, Sukawa Y, Adachi Y, Ito M, Mitsuhashi K, Kurihara H et al (2016) Association of Fusobacterium nucleatum with immunity and molecular alterations in colorectal cancer. (springer.com)
Organism3
  • In 2011, researchers discovered that Fusobacterium flourishes in colon cancer cells, and is often also associated with ulcerative colitis, although researchers have not determined if the organism actually causes these diseases or if it simply flourishes in the environment these diseases create. (wikipedia.org)
  • Fusobacterium necrophorum is infrequently implicated as a pathogenic organism. (hindawi.com)
  • The causative organism was identified to be Fusobacterium nucleatum by Karius testing. (infectoforum.net)
Virulence1
  • Despite the importance of Fusobacterium in human diseases, a lack of complete genomes of biomedically relevant isolates has hindered protein cataloging and virulence factor identification. (asm.org)
19911
  • Burden P (1991) Fusobacterium necrophorum and Lemierre's syndrome. (springer.com)
Streptococcus1
  • The levels of opportunistic pathogens, such as Fusobacterium , Streptococcus and Enterococcus spp. (oncotarget.com)
Colon1
  • Despite other studies suggesting the possible pro-tumorigenic role of Fusobacterium which may include modulation of host immune response to cancer cells and further enhancement of tumour cell invasion in colon cancer pathogenesis, this new study was scientifically able to show the correlation between decrease in Fusobacterium load and the decreased in rate of tumour growth and improved overall patient survival. (uct.ac.za)
Tumour growth1
  • Fusobacterium nucleatum may promote colorectal tumour growth and inhibit T cell-mediated immune responses against colorectal tumours. (bmj.com)
Doxycycline Monohydrate Monograph for Professionals - Drugs.com
Doxycycline Monohydrate Monograph for Professionals - Drugs.com (drugs.com)
By Identifier Page 29
By Identifier Page 29 (atcc.org)
Fusobacterium Infections | GreenMedInfo | Disease | Natural Medicine
Fusobacterium Infections | GreenMedInfo | Disease | Natural Medicine (greenmedinfo.com)
Fusobacterium-Positive and Streptococcal-Positive Pharyngitis | Annals of Internal Medicine | American College of Physicians
Fusobacterium-Positive and Streptococcal-Positive Pharyngitis | Annals of Internal Medicine | American College of Physicians (annals.org)
Collection Details : Journal of the American Academy of PAs
Collection Details : Journal of the American Academy of PAs (journals.lww.com)
Effect of kefir on Fusobacterium nucleatum in potentially prevent...: Ingenta Connect
Effect of kefir on Fusobacterium nucleatum in potentially prevent...: Ingenta Connect (ingentaconnect.com)
Which common bacteria cause wound infections from primate bites?
Which common bacteria cause wound infections from primate bites? (medscape.com)
Update on the Gastrointestinal Microbiome in Systemic Sclerosis | SpringerLink
Update on the Gastrointestinal Microbiome in Systemic Sclerosis | SpringerLink (link.springer.com)
Oxybiotic-100 for Animal Use - Drugs.com
Oxybiotic-100 for Animal Use - Drugs.com (drugs.com)
Convenia Injectable Lyophile (Canada) for Animal Use - Drugs.com
Convenia Injectable Lyophile (Canada) for Animal Use - Drugs.com (drugs.com)
Cefotetan (Cefotetan for Injection): Side Effects, Interactions, Warning, Dosage & Uses
Cefotetan (Cefotetan for Injection): Side Effects, Interactions, Warning, Dosage & Uses (rxlist.com)
Avelox - FDA prescribing information, side effects and uses
Avelox - FDA prescribing information, side effects and uses (drugs.com)
Cefotaxime - FDA prescribing information, side effects and uses
Cefotaxime - FDA prescribing information, side effects and uses (drugs.com)
Doxycycline Injection - FDA prescribing information, side effects and uses
Doxycycline Injection - FDA prescribing information, side effects and uses (drugs.com)
Flagyl (Metronidazole): Side Effects, Interactions, Warning, Dosage & Uses
Flagyl (Metronidazole): Side Effects, Interactions, Warning, Dosage & Uses (rxlist.com)
Avelox (Moxifloxacin HCL): Antibiotics, Uses, Dosage, Side Effects, Interactions, Warning
Avelox (Moxifloxacin HCL): Antibiotics, Uses, Dosage, Side Effects, Interactions, Warning (rxlist.com)
Animal Bites in Emergency Medicine: Background, Pathophysiology, Etiology
Animal Bites in Emergency Medicine: Background, Pathophysiology, Etiology (emedicine.medscape.com)
Achromycin V - FDA prescribing information, side effects and uses
Achromycin V - FDA prescribing information, side effects and uses (drugs.com)
Halitosis: Practice Essentials, Epidemiology, Etiology
Halitosis: Practice Essentials, Epidemiology, Etiology (emedicine.medscape.com)
Claforan (Cefotaxime): Side Effects, Interactions, Warning, Dosage & Uses
Claforan (Cefotaxime): Side Effects, Interactions, Warning, Dosage & Uses (rxlist.com)
Nutrients | Free Full-Text | Dietary Factors in Sulfur Metabolism and Pathogenesis of Ulcerative Colitis | HTML
Nutrients | Free Full-Text | Dietary Factors in Sulfur Metabolism and Pathogenesis of Ulcerative Colitis | HTML (mdpi.com)
Lung Abscess Surgery: Background, Pathophysiology, Etiology
Lung Abscess Surgery: Background, Pathophysiology, Etiology (emedicine.medscape.com)
Composition of salivary microbiota in elderly subjects | Scientific Reports
Composition of salivary microbiota in elderly subjects | Scientific Reports (nature.com)
Atopobium and Fusobacterium as novel candidates for sarcoidosis-associated microbiota | European Respiratory Society
Atopobium and Fusobacterium as novel candidates for sarcoidosis-associated microbiota | European Respiratory Society (erj.ersjournals.com)
Hoffman 555A Strain Passport - StrainInfo
Hoffman 555A Strain Passport - StrainInfo (straininfo.net)
Feigin and Cherry's Textbook of Pediatric Infectious Diseases - 7th Edition
Feigin and Cherry's Textbook of Pediatric Infectious Diseases - 7th Edition (elsevier.com)
Uterine Microbiome
Uterine Microbiome (news-medical.net)
Emerging Infectious Diseases journal - CDC
Emerging Infectious Diseases journal - CDC (cdc.gov)
Fusobacterium necrophorum from Vetstream | Definitive Veterinary Intelligence
Fusobacterium necrophorum from Vetstream | Definitive Veterinary Intelligence (vetstream.com)
Peritonsillar Abscess: Diagnosis and Treatment - American Family Physician
Peritonsillar Abscess: Diagnosis and Treatment - American Family Physician (aafp.org)