Feline acquired immunodeficiency syndrome. Medical search

An acquired defect of cellular immunity associated with infection by the human immunodeficiency virus (HIV), a CD4-positive T-lymphocyte count under 200 cells/microliter or less than 14% of total lymphocytes, and increased susceptibility to opportunistic infections and malignant neoplasms. Clinical manifestations also include emaciation (wasting) and dementia. These elements reflect criteria for AIDS as defined by the CDC in 1993.

A species of LENTIVIRUS, subgenus feline lentiviruses (LENTIVIRUSES, FELINE) isolated from cats with a chronic wasting syndrome, presumed to be immune deficiency. There are 3 strains: Petaluma (FIP-P), Oma (FIP-O) and Puma lentivirus (PLV). There is no antigenic relationship between FIV and HIV, nor does FIV grow in human T-cells.

Acquired defect of cellular immunity that occurs in mice infected with mouse leukemia viruses (MuLV). The syndrome shows striking similarities with human AIDS and is characterized by lymphadenopathy, profound immunosuppression, enhanced susceptibility to opportunistic infections, and B-cell lymphomas.

A characteristic symptom complex.

Acquired defect of cellular immunity that occurs in cats infected with feline immunodeficiency virus (FIV) and in some cats infected with feline leukemia virus (FeLV).

The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.

A species of GAMMARETROVIRUS causing leukemia, lymphosarcoma, immune deficiency, or other degenerative diseases in cats. Several cellular oncogenes confer on FeLV the ability to induce sarcomas (see also SARCOMA VIRUSES, FELINE).

Includes the spectrum of human immunodeficiency virus infections that range from asymptomatic seropositivity, thru AIDS-related complex (ARC), to acquired immunodeficiency syndrome (AIDS).

The domestic cat, Felis catus, of the carnivore family FELIDAE, comprising over 30 different breeds. The domestic cat is descended primarily from the wild cat of Africa and extreme southwestern Asia. Though probably present in towns in Palestine as long ago as 7000 years, actual domestication occurred in Egypt about 4000 years ago. (From Walker's Mammals of the World, 6th ed, p801)

Species of the genus LENTIVIRUS, subgenus primate immunodeficiency viruses (IMMUNODEFICIENCY VIRUSES, PRIMATE), that induces acquired immunodeficiency syndrome in monkeys and apes (SAIDS). The genetic organization of SIV is virtually identical to HIV.

Human immunodeficiency virus. A non-taxonomic and historical term referring to any of two species, specifically HIV-1 and/or HIV-2. Prior to 1986, this was called human T-lymphotropic virus type III/lymphadenopathy-associated virus (HTLV-III/LAV). From 1986-1990, it was an official species called HIV. Since 1991, HIV was no longer considered an official species name; the two species were designated HIV-1 and HIV-2.

Opportunistic infections found in patients who test positive for human immunodeficiency virus (HIV). The most common include PNEUMOCYSTIS PNEUMONIA, Kaposi's sarcoma, cryptosporidiosis, herpes simplex, toxoplasmosis, cryptococcosis, and infections with Mycobacterium avium complex, Microsporidium, and Cytomegalovirus.

Diseases of the domestic cat (Felis catus or F. domesticus). This term does not include diseases of the so-called big cats such as CHEETAHS; LIONS; tigers, cougars, panthers, leopards, and other Felidae for which the heading CARNIVORA is used.

Acquired defect of cellular immunity that occurs naturally in macaques infected with SRV serotypes, experimentally in monkeys inoculated with SRV or MASON-PFIZER MONKEY VIRUS; (MPMV), or in monkeys infected with SIMIAN IMMUNODEFICIENCY VIRUS.

A prodromal phase of infection with the human immunodeficiency virus (HIV). Laboratory criteria separating AIDS-related complex (ARC) from AIDS include elevated or hyperactive B-cell humoral immune responses, compared to depressed or normal antibody reactivity in AIDS; follicular or mixed hyperplasia in ARC lymph nodes, leading to lymphocyte degeneration and depletion more typical of AIDS; evolving succession of histopathological lesions such as localization of Kaposi's sarcoma, signaling the transition to the full-blown AIDS.

Syndromes in which there is a deficiency or defect in the mechanisms of immunity, either cellular or humoral.

A species of the genus VESIVIRUS infecting cats. Transmission occurs via air and mechanical contact.

A species of CORONAVIRUS infecting cats of all ages and commonly found in catteries and zoos. Cats are often found carrying the virus but only a small proportion develop disease. Feline coronavirus and Feline infectious peritonitis virus (FIPV) are virtually the same virus in genetic and antigenetic terms, and are morphologically indistinguishable. Since they only differ in their disease potential (with FIPV causing a more serious illness), they are considered biotypes of each other.

The sexual attraction or relationship between members of the same SEX.

Group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. It is inherited as an X-linked or autosomal recessive defect. Mutations occurring in many different genes cause human Severe Combined Immunodeficiency (SCID).

Development of neutralizing antibodies in individuals who have been exposed to the human immunodeficiency virus (HIV/HTLV-III/LAV).

A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by an azido group. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. The compound is a potent inhibitor of HIV replication, acting as a chain-terminator of viral DNA during reverse transcription. It improves immunologic function, partially reverses the HIV-induced neurological dysfunction, and improves certain other clinical abnormalities associated with AIDS. Its principal toxic effect is dose-dependent suppression of bone marrow, resulting in anemia and leukopenia.

Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.

Agents used to treat AIDS and/or stop the spread of the HIV infection. These do not include drugs used to treat symptoms or opportunistic infections associated with AIDS.

A highly contagious DNA virus infection of the cat family, characterized by fever, enteritis and bone marrow changes. It is also called feline ataxia, feline agranulocytosis, feline infectious enteritis, cat fever, cat plague, and show fever. It is caused by FELINE PANLEUKOPENIA VIRUS or the closely related MINK ENTERITIS VIRUS or CANINE PARVOVIRUS.

The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.

Species of GAMMARETROVIRUS isolated from fibrosarcoma in cats. The viruses are actually recombinant feline leukemia viruses (FeLV) where part of the genome has been replaced by cellular oncogenes. It is unique to individuals and not transmitted naturally to other cats. FeSVs are replication defective and require FeLV to reproduce.

The number of CD4-POSITIVE T-LYMPHOCYTES per unit volume of BLOOD. Determination requires the use of a fluorescence-activated flow cytometer.

Heterogeneous group of immunodeficiency syndromes characterized by hypogammaglobulinemia of most isotypes, variable B-cell defects, and the presence of recurrent bacterial infections.

A pulmonary disease in humans occurring in immunodeficient or malnourished patients or infants, characterized by DYSPNEA, tachypnea, and HYPOXEMIA. Pneumocystis pneumonia is a frequently seen opportunistic infection in AIDS. It is caused by the fungus PNEUMOCYSTIS JIROVECII. The disease is also found in other MAMMALS where it is caused by related species of Pneumocystis.

Common coronavirus infection of cats caused by the feline infectious peritonitis virus (CORONAVIRUS, FELINE). The disease is characterized by a long incubation period, fever, depression, loss of appetite, wasting, and progressive abdominal enlargement. Infection of cells of the monocyte-macrophage lineage appears to be essential in FIP pathogenesis.

Antibodies reactive with HIV ANTIGENS.

B-cell lymphoid tumors that occur in association with AIDS. Patients often present with an advanced stage of disease and highly malignant subtypes including BURKITT LYMPHOMA; IMMUNOBLASTIC LARGE-CELL LYMPHOMA; PRIMARY EFFUSION LYMPHOMA; and DIFFUSE, LARGE B-CELL, LYMPHOMA. The tumors are often disseminated in unusual extranodal sites and chromosomal abnormalities are frequently present. It is likely that polyclonal B-cell lymphoproliferation in AIDS is a complex result of EBV infection, HIV antigenic stimulation, and T-cell-dependent HIV activation.

Proteins encoded by the TAT GENES of the HUMAN IMMUNODEFICIENCY VIRUS.

A species of PARVOVIRUS infecting cats with a highly contagious enteric disease. Host range variants include mink enteritis virus, canine parvovirus (PARVOVIRUS, CANINE), and raccoon parvovirus. After infecting their new hosts, many of these viruses have further evolved and are now considered distinct species.

Antigens associated with specific proteins of the human adult T-cell immunodeficiency virus (HIV); also called HTLV-III-associated and lymphadenopathy-associated virus (LAV) antigens.

Drug regimens, for patients with HIV INFECTIONS, that aggressively suppress HIV replication. The regimens usually involve administration of three or more different drugs including a protease inhibitor.

An HIV species related to HIV-1 but carrying different antigenic components and with differing nucleic acid composition. It shares serologic reactivity and sequence homology with the simian Lentivirus SIMIAN IMMUNODEFICIENCY VIRUS and infects only T4-lymphocytes expressing the CD4 phenotypic marker.

Proteins coded by the retroviral gag gene. The products are usually synthesized as protein precursors or POLYPROTEINS, which are then cleaved by viral proteases to yield the final products. Many of the final products are associated with the nucleoprotein core of the virion. gag is short for group-specific antigen.

Ribonucleic acid that makes up the genetic material of viruses.

A genus in the family RETROVIRIDAE consisting of exogenous horizontally-transmitted viruses found in a few groups of mammals. Infections caused by these viruses include human B- or adult T-cell leukemia/lymphoma (LEUKEMIA-LYMPHOMA, T-CELL, ACUTE, HTLV-I-ASSOCIATED), and bovine leukemia (ENZOOTIC BOVINE LEUKOSIS). The type species is LEUKEMIA VIRUS, BOVINE.

Virus diseases caused by the Lentivirus genus. They are multi-organ diseases characterized by long incubation periods and persistent infection.

External envelope protein of the human immunodeficiency virus which is encoded by the HIV env gene. It has a molecular weight of 120 kDa and contains numerous glycosylation sites. Gp120 binds to cells expressing CD4 cell-surface antigens, most notably T4-lymphocytes and monocytes/macrophages. Gp120 has been shown to interfere with the normal function of CD4 and is at least partly responsible for the cytopathic effect of HIV.

Deoxyribonucleic acid that makes up the genetic material of viruses.

Virus diseases caused by the RETROVIRIDAE.

Established cell cultures that have the potential to propagate indefinitely.

A multicentric, malignant neoplastic vascular proliferation characterized by the development of bluish-red cutaneous nodules, usually on the lower extremities, most often on the toes or feet, and slowly increasing in size and number and spreading to more proximal areas. The tumors have endothelium-lined channels and vascular spaces admixed with variably sized aggregates of spindle-shaped cells, and often remain confined to the skin and subcutaneous tissue, but widespread visceral involvement may occur. Kaposi's sarcoma occurs spontaneously in Jewish and Italian males in Europe and the United States. An aggressive variant in young children is endemic in some areas of Africa. A third form occurs in about 0.04% of kidney transplant patients. There is also a high incidence in AIDS patients. (From Dorland, 27th ed & Holland et al., Cancer Medicine, 3d ed, pp2105-7) HHV-8 is the suspected cause.

The quantity of measurable virus in a body fluid. Change in viral load, measured in plasma, is sometimes used as a SURROGATE MARKER in disease progression.

The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.

A species of the genus MACACA inhabiting India, China, and other parts of Asia. The species is used extensively in biomedical research and adapts very well to living with humans.

A neoplastic disease of cats frequently associated with feline leukemia virus infection.

A major core protein of the human immunodeficiency virus encoded by the HIV gag gene. HIV-seropositive individuals mount a significant immune response to p24 and thus detection of antibodies to p24 is one basis for determining HIV infection by ELISA and Western blot assays. The protein is also being investigated as a potential HIV immunogen in vaccines.

Infection of the retina by cytomegalovirus characterized by retinal necrosis, hemorrhage, vessel sheathing, and retinal edema. Cytomegalovirus retinitis is a major opportunistic infection in AIDS patients and can cause blindness.

An infection caused by an organism which becomes pathogenic under certain conditions, e.g., during immunosuppression.

The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.

55-kDa antigens found on HELPER-INDUCER T-LYMPHOCYTES and on a variety of other immune cell types. CD4 antigens are members of the immunoglobulin supergene family and are implicated as associative recognition elements in MAJOR HISTOCOMPATIBILITY COMPLEX class II-restricted immune responses. On T-lymphocytes they define the helper/inducer subset. CD4 antigens also serve as INTERLEUKIN-15 receptors and bind to the HIV receptors, binding directly to the HIV ENVELOPE PROTEIN GP120.

A critical subpopulation of T-lymphocytes involved in the induction of most immunological functions. The HIV virus has selective tropism for the T4 cell which expresses the CD4 phenotypic marker, a receptor for HIV. In fact, the key element in the profound immunosuppression seen in HIV infection is the depletion of this subset of T-lymphocytes.

A chromosome disorder associated either with an extra chromosome 21 or an effective trisomy for chromosome 21. Clinical manifestations include hypotonia, short stature, brachycephaly, upslanting palpebral fissures, epicanthus, Brushfield spots on the iris, protruding tongue, small ears, short, broad hands, fifth finger clinodactyly, Simian crease, and moderate to severe INTELLECTUAL DISABILITY. Cardiac and gastrointestinal malformations, a marked increase in the incidence of LEUKEMIA, and the early onset of ALZHEIMER DISEASE are also associated with this condition. Pathologic features include the development of NEUROFIBRILLARY TANGLES in neurons and the deposition of AMYLOID BETA-PROTEIN, similar to the pathology of ALZHEIMER DISEASE. (Menkes, Textbook of Child Neurology, 5th ed, p213)

A cluster of metabolic risk factors for CARDIOVASCULAR DISEASES and TYPE 2 DIABETES MELLITUS. The major components of metabolic syndrome X include excess ABDOMINAL FAT; atherogenic DYSLIPIDEMIA; HYPERTENSION; HYPERGLYCEMIA; INSULIN RESISTANCE; a proinflammatory state; and a prothrombotic (THROMBOSIS) state. (from AHA/NHLBI/ADA Conference Proceedings, Circulation 2004; 109:551-556)

Inhibitors of reverse transcriptase (RNA-DIRECTED DNA POLYMERASE), an enzyme that synthesizes DNA on an RNA template.

Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.

Proteins from the family Retroviridae. The most frequently encountered member of this family is the Rous sarcoma virus protein.

Retroviral proteins, often glycosylated, coded by the envelope (env) gene. They are usually synthesized as protein precursors (POLYPROTEINS) and later cleaved into the final viral envelope glycoproteins by a viral protease.

Immunoglobulins produced in response to VIRAL ANTIGENS.

Infections of the BRAIN caused by the protozoan TOXOPLASMA gondii that primarily arise in individuals with IMMUNOLOGIC DEFICIENCY SYNDROMES (see also AIDS-RELATED OPPORTUNISTIC INFECTIONS). The infection may involve the brain diffusely or form discrete abscesses. Clinical manifestations include SEIZURES, altered mentation, headache, focal neurologic deficits, and INTRACRANIAL HYPERTENSION. (From Joynt, Clinical Neurology, 1998, Ch27, pp41-3)

In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.

Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.

A reverse transcriptase encoded by the POL GENE of HIV. It is a heterodimer of 66 kDa and 51 kDa subunits that are derived from a common precursor protein. The heterodimer also includes an RNAse H activity (RIBONUCLEASE H, HUMAN IMMUNODEFICIENCY VIRUS) that plays an essential role the viral replication process.

Duplex DNA sequences in eukaryotic chromosomes, corresponding to the genome of a virus, that are transmitted from one cell generation to the next without causing lysis of the host. Proviruses are often associated with neoplastic cell transformation and are key features of retrovirus biology.

Agents used in the prophylaxis or therapy of VIRUS DISEASES. Some of the ways they may act include preventing viral replication by inhibiting viral DNA polymerase; binding to specific cell-surface receptors and inhibiting viral penetration or uncoating; inhibiting viral protein synthesis; or blocking late stages of virus assembly.

An enzyme that synthesizes DNA on an RNA template. It is encoded by the pol gene of retroviruses and by certain retrovirus-like elements. EC 2.7.7.49.

Proteins encoded by the NEF GENES of the HUMAN IMMUNODEFICIENCY VIRUS.

Diseases of LYMPH; LYMPH NODES; or LYMPHATIC VESSELS.

Immune status consisting of non-production of HIV antibodies, as determined by various serological tests.

Immunologic tests for identification of HIV (HTLV-III/LAV) antibodies. They include assays for HIV SEROPOSITIVITY and HIV SERONEGATIVITY that have been developed for screening persons carrying the viral antibody from patients with overt symptoms of AIDS or AIDS-RELATED COMPLEX.

A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by a hydrogen. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. Didanosine is a potent inhibitor of HIV replication, acting as a chain-terminator of viral DNA by binding to reverse transcriptase; ddI is then metabolized to dideoxyadenosine triphosphate, its putative active metabolite.

DNA sequences that form the coding region for the viral envelope (env) proteins in retroviruses. The env genes contain a cis-acting RNA target sequence for the rev protein (= GENE PRODUCTS, REV), termed the rev-responsive element (RRE).

Proteins encoded by the GAG GENE of the HUMAN IMMUNODEFICIENCY VIRUS.

Death resulting from the presence of a disease in an individual, as shown by a single case report or a limited number of patients. This should be differentiated from DEATH, the physiological cessation of life and from MORTALITY, an epidemiological or statistical concept.

Abuse, overuse, or misuse of a substance by its injection into a vein.

CCR receptors with specificity for CHEMOKINE CCL3; CHEMOKINE CCL4; and CHEMOKINE CCL5. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; MACROPHAGES; MAST CELLS; and NK CELLS. The CCR5 receptor is used by the HUMAN IMMUNODEFICIENCY VIRUS to infect cells.

A neurologic condition associated with the ACQUIRED IMMUNODEFICIENCY SYNDROME and characterized by impaired concentration and memory, slowness of hand movements, ATAXIA, incontinence, apathy, and gait difficulties associated with HIV-1 viral infection of the central nervous system. Pathologic examination of the brain reveals white matter rarefaction, perivascular infiltrates of lymphocytes, foamy macrophages, and multinucleated giant cells. (From Adams et al., Principles of Neurology, 6th ed, pp760-1; N Engl J Med, 1995 Apr 6;332(14):934-40)

Studies of the number of cases where human immunodeficiency virus (HIV) is present in a specific population at a designated time. The presence in a given individual is determined by the finding of HIV antibodies in the serum (HIV SEROPOSITIVITY).

Vaccines or candidate vaccines containing inactivated HIV or some of its component antigens and designed to prevent or treat AIDS. Some vaccines containing antigens are recombinantly produced.

Inhibitors of HIV PROTEASE, an enzyme required for production of proteins needed for viral assembly.

The measurement of infection-blocking titer of ANTISERA by testing a series of dilutions for a given virus-antiserum interaction end-point, which is generally the dilution at which tissue cultures inoculated with the serum-virus mixtures demonstrate cytopathology (CPE) or the dilution at which 50% of test animals injected with serum-virus mixtures show infectivity (ID50) or die (LD50).

Regulatory sequences important for viral replication that are located on each end of the HIV genome. The LTR includes the HIV ENHANCER, promoter, and other sequences. Specific regions in the LTR include the negative regulatory element (NRE), NF-kappa B binding sites , Sp1 binding sites, TATA BOX, and trans-acting responsive element (TAR). The binding of both cellular and viral proteins to these regions regulates HIV transcription.

Antiprotozoal agent effective in trypanosomiasis, leishmaniasis, and some fungal infections; used in treatment of PNEUMOCYSTIS pneumonia in HIV-infected patients. It may cause diabetes mellitus, central nervous system damage, and other toxic effects.

Proteins encoded by the REV GENES of the HUMAN IMMUNODEFICIENCY VIRUS.

Elements of limited time intervals, contributing to particular results or situations.

Trans-acting transcription factors produced by retroviruses such as HIV. They are nuclear proteins whose expression is required for viral replication. The tat protein stimulates LONG TERMINAL REPEAT-driven RNA synthesis for both viral regulatory and viral structural proteins. tat stands for trans-activation of transcription.

A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by a hydrogen. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. The compound is a potent inhibitor of HIV replication at low concentrations, acting as a chain-terminator of viral DNA by binding to reverse transcriptase. Its principal toxic side effect is axonal degeneration resulting in peripheral neuropathy.

An aspect of personal behavior or lifestyle, environmental exposure, or inborn or inherited characteristic, which, on the basis of epidemiologic evidence, is known to be associated with a health-related condition considered important to prevent.

Mature LYMPHOCYTES and MONOCYTES transported by the blood to the body's extravascular space. They are morphologically distinguishable from mature granulocytic leukocytes by their large, non-lobed nuclei and lack of coarse, heavily stained cytoplasmic granules.

Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.

The classic hemophilia resulting from a deficiency of factor VIII. It is an inherited disorder of blood coagulation characterized by a permanent tendency to hemorrhage.

A human or animal whose immunologic mechanism is deficient because of an immunodeficiency disorder or other disease or as the result of the administration of immunosuppressive drugs or radiation.

Ratio of T-LYMPHOCYTES that express the CD4 ANTIGEN to those that express the CD8 ANTIGEN. This value is commonly assessed in the diagnosis and staging of diseases affecting the IMMUNE SYSTEM including HIV INFECTIONS.

DNA sequences that form the coding region for proteins associated with the viral core in retroviruses. gag is short for group-specific antigen.

A condition characterized by severe PROTEINURIA, greater than 3.5 g/day in an average adult. The substantial loss of protein in the urine results in complications such as HYPOPROTEINEMIA; generalized EDEMA; HYPERTENSION; and HYPERLIPIDEMIAS. Diseases associated with nephrotic syndrome generally cause chronic kidney dysfunction.

A nontuberculous infection when occurring in humans. It is characterized by pulmonary disease, lymphadenitis in children, and systemic disease in AIDS patients. Mycobacterium avium-intracellulare infection of birds and swine results in tuberculosis.

The number of WHITE BLOOD CELLS per unit volume in venous BLOOD. A differential leukocyte count measures the relative numbers of the different types of white cells.

Layers of protein which surround the capsid in animal viruses with tubular nucleocapsids. The envelope consists of an inner layer of lipids and virus specified proteins also called membrane or matrix proteins. The outer layer consists of one or more types of morphological subunits called peplomers which project from the viral envelope; this layer always consists of glycoproteins.

Transmembrane envelope protein of the HUMAN IMMUNODEFICIENCY VIRUS which is encoded by the HIV env gene. It has a molecular weight of 41,000 and is glycosylated. The N-terminal part of gp41 is thought to be involved in CELL FUSION with the CD4 ANTIGENS of T4 LYMPHOCYTES, leading to syncytial formation. Gp41 is one of the most common HIV antigens detected by IMMUNOBLOTTING.

Contraceptive devices used by males.

Family of RNA viruses that infects birds and mammals and encodes the enzyme reverse transcriptase. The family contains seven genera: DELTARETROVIRUS; LENTIVIRUS; RETROVIRUSES TYPE B, MAMMALIAN; ALPHARETROVIRUS; GAMMARETROVIRUS; RETROVIRUSES TYPE D; and SPUMAVIRUS. A key feature of retrovirus biology is the synthesis of a DNA copy of the genome which is integrated into cellular DNA. After integration it is sometimes not expressed but maintained in a latent state (PROVIRUSES).

Chronic inflammatory and autoimmune disease in which the salivary and lacrimal glands undergo progressive destruction by lymphocytes and plasma cells resulting in decreased production of saliva and tears. The primary form, often called sicca syndrome, involves both KERATOCONJUNCTIVITIS SICCA and XEROSTOMIA. The secondary form includes, in addition, the presence of a connective tissue disease, usually rheumatoid arthritis.

Proteins synthesized by HUMAN IMMUNODEFICIENCY VIRUSES such as the HIV-1 and HIV-2.

Enzyme of the human immunodeficiency virus that is required for post-translational cleavage of gag and gag-pol precursor polyproteins into functional products needed for viral assembly. HIV protease is an aspartic protease encoded by the amino terminus of the pol gene.

Infection resulting from inhalation or ingestion of spores of the fungus of the genus HISTOPLASMA, species H. capsulatum. It is worldwide in distribution and particularly common in the midwestern United States. (From Dorland, 27th ed)

The worsening of a disease over time. This concept is most often used for chronic and incurable diseases where the stage of the disease is an important determinant of therapy and prognosis.

Products of the retroviral NEF GENE. They play a role as accessory proteins that influence the rate of viral infectivity and the destruction of the host immune system. nef gene products were originally found as factors that trans-suppress viral replication and function as negative regulators of transcription. nef stands for negative factor.

Proteins encoded by the VPR GENES of the HUMAN IMMUNODEFICIENCY VIRUS.

White blood cells formed in the body's lymphoid tissue. The nucleus is round or ovoid with coarse, irregularly clumped chromatin while the cytoplasm is typically pale blue with azurophilic (if any) granules. Most lymphocytes can be classified as either T or B (with subpopulations of each), or NATURAL KILLER CELLS.

Sexual activities of humans.

A complex that includes several strains of M. avium. M. intracellulare is not easily distinguished from M. avium and therefore is included in the complex. These organisms are most frequently found in pulmonary secretions from persons with a tuberculous-like mycobacteriosis. Strains of this complex have also been associated with childhood lymphadenitis and AIDS; M. avium alone causes tuberculosis in a variety of birds and other animals, including pigs.

Infection with CYTOMEGALOVIRUS, characterized by enlarged cells bearing intranuclear inclusions. Infection may be in almost any organ, but the salivary glands are the most common site in children, as are the lungs in adults.

The transmission of infectious disease or pathogens from one generation to another. It includes transmission in utero or intrapartum by exposure to blood and secretions, and postpartum exposure via breastfeeding.

The presence of viruses in the blood.

CXCR receptors with specificity for CXCL12 CHEMOKINE. The receptors may play a role in HEMATOPOIESIS regulation and can also function as coreceptors for the HUMAN IMMUNODEFICIENCY VIRUS.

Morphologic alteration of small B LYMPHOCYTES or T LYMPHOCYTES in culture into large blast-like cells able to synthesize DNA and RNA and to divide mitotically. It is induced by INTERLEUKINS; MITOGENS such as PHYTOHEMAGGLUTININS, and by specific ANTIGENS. It may also occur in vivo as in GRAFT REJECTION.

An envelope protein of the human immunodeficiency virus that is encoded by the HIV env gene. It has a molecular weight of 160,000 kDa and contains numerous glycosylation sites. It serves as a precursor for both the HIV ENVELOPE PROTEIN GP120 and the HIV ENVELOPE PROTEIN GP41.

A genus of the subfamily CERCOPITHECINAE, family CERCOPITHECIDAE, consisting of 16 species inhabiting forests of Africa, Asia, and the islands of Borneo, Philippines, and Celebes.

The total number of cases of a given disease in a specified population at a designated time. It is differentiated from INCIDENCE, which refers to the number of new cases in the population at a given time.

Primary immunodeficiency syndrome characterized by recurrent infections and hyperimmunoglobulinemia E. Most cases are sporadic. Of the rare familial forms, the dominantly inherited subtype has additional connective tissue, dental and skeletal involvement that the recessive type does not share.

Visible morphologic changes in cells infected with viruses. It includes shutdown of cellular RNA and protein synthesis, cell fusion, release of lysosomal enzymes, changes in cell membrane permeability, diffuse changes in intracellular structures, presence of viral inclusion bodies, and chromosomal aberrations. It excludes malignant transformation, which is CELL TRANSFORMATION, VIRAL. Viral cytopathogenic effects provide a valuable method for identifying and classifying the infecting viruses.

Studies in which subsets of a defined population are identified. These groups may or may not be exposed to factors hypothesized to influence the probability of the occurrence of a particular disease or other outcome. Cohorts are defined populations which, as a whole, are followed in an attempt to determine distinguishing subgroup characteristics.

Proteins encoded by the ENV GENE of the HUMAN IMMUNODEFICIENCY VIRUS.

The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.

A genus of ascomycetous FUNGI, family Pneumocystidaceae, order Pneumocystidales. It includes various host-specific species causing PNEUMOCYSTIS PNEUMONIA in humans and other MAMMALS.

This drug combination has proved to be an effective therapeutic agent with broad-spectrum antibacterial activity against both gram-positive and gram-negative organisms. It is effective in the treatment of many infections, including PNEUMOCYSTIS PNEUMONIA in AIDS.

Species of GAMMARETROVIRUS, containing many well-defined strains, producing leukemia in mice. Disease is commonly induced by injecting filtrates of propagable tumors into newborn mice.

The infective system of a virus, composed of the viral genome, a protein core, and a protein coat called a capsid, which may be naked or enclosed in a lipoprotein envelope called the peplos.

A critical subpopulation of regulatory T-lymphocytes involved in MHC Class I-restricted interactions. They include both cytotoxic T-lymphocytes (T-LYMPHOCYTES, CYTOTOXIC) and CD8+ suppressor T-lymphocytes.

The type species of LENTIVIRUS, subgenus bovine lentiviruses (LENTIVIRUSES, BOVINE), found in cattle and causing lymphadenopathy, LYMPHOCYTOSIS, central nervous system lesions, progressive weakness, and emaciation. It has immunological cross-reactivity with other lentiviruses including HIV.

An antiviral agent used in the treatment of cytomegalovirus retinitis. Foscarnet also shows activity against human herpesviruses and HIV.

The number of new cases of a given disease during a given period in a specified population. It also is used for the rate at which new events occur in a defined population. It is differentiated from PREVALENCE, which refers to all cases, new or old, in the population at a given time.

Studies used to test etiologic hypotheses in which inferences about an exposure to putative causal factors are derived from data relating to characteristics of persons under study or to events or experiences in their past. The essential feature is that some of the persons under study have the disease or outcome of interest and their characteristics are compared with those of unaffected persons.

Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.

Antibodies produced by a single clone of cells.

Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.

Trans-acting nuclear proteins whose functional expression are required for retroviral replication. Specifically, the rev gene products are required for processing and translation of the gag and env mRNAs, and thus rev regulates the expression of the viral structural proteins. rev can also regulate viral regulatory proteins. A cis-acting antirepression sequence (CAR) in env, also known as the rev-responsive element (RRE), is responsive to the rev gene product. rev is short for regulator of virion.

A genus in the family FELIDAE comprising one species, Puma concolor. It is a large, long-tailed, feline of uniform color. The names puma, cougar, and mountain lion are used interchangeably for this species. There are more than 20 subspecies.

Ongoing scrutiny of a population (general population, study population, target population, etc.), generally using methods distinguished by their practicability, uniformity, and frequently their rapidity, rather than by complete accuracy.

Substances elaborated by viruses that have antigenic activity.

Involuntary weight loss of greater than 10 percent associated with intermittent or constant fever and chronic diarrhea or fatigue for more than 30 days in the absence of a defined cause other than HIV infection. A constant feature is major muscle wasting with scattered myofiber degeneration. A variety of etiologies, which vary among patients, contributes to this syndrome. (From Harrison's Principles of Internal Medicine, 13th ed, p1611).

Proteins prepared by recombinant DNA technology.

Classes of retroviruses for which monkeys or apes are hosts. Those isolated from the West African green monkey and the Asian rhesus macaque monkey are of particular interest because of their similarities to viruses causing cancer and acquired immunodeficiency syndrome (AIDS) in humans.

Observation of a population for a sufficient number of persons over a sufficient number of years to generate incidence or mortality rates subsequent to the selection of the study group.

Infection of the mucous membranes of the mouth by a fungus of the genus CANDIDA. (Dorland, 27th ed)

A syndrome of defective gonadal development in phenotypic females associated with the karyotype 45,X (or 45,XO). Patients generally are of short stature with undifferentiated GONADS (streak gonads), SEXUAL INFANTILISM, HYPOGONADISM, webbing of the neck, cubitus valgus, elevated GONADOTROPINS, decreased ESTRADIOL level in blood, and CONGENITAL HEART DEFECTS. NOONAN SYNDROME (also called Pseudo-Turner Syndrome and Male Turner Syndrome) resembles this disorder; however, it occurs in males and females with a normal karyotype and is inherited as an autosomal dominant.

Therapy with two or more separate preparations given for a combined effect.

A species of the genus MACACA which inhabits Malaya, Sumatra, and Borneo. It is one of the most arboreal species of Macaca. The tail is short and untwisted.

Inflammation of ARTERIES in the CENTRAL NERVOUS SYSTEM that occurs in patients with ACQUIRED IMMUNODEFICIENCY SYNDROME or AIDS-RELATED OPPORTUNISTIC INFECTIONS.

Inflammation of the RETINA. It is rarely limited to the retina, but is commonly associated with diseases of the choroid (CHORIORETINITIS) and of the OPTIC DISK (neuroretinitis).

Agents used to treat RETROVIRIDAE INFECTIONS.

DNA sequences that form the coding region for retroviral enzymes including reverse transcriptase, protease, and endonuclease/integrase. "pol" is short for polymerase, the enzyme class of reverse transcriptase.

An alkylamino-alcohol complex of inosine used in the treatment of a variety of viral infections. Unlike other antiviral agents, it acts by modifying or stimulating cell-mediated immune processes rather than acting on the virus directly.

Large, chiefly nocturnal mammals of the cat family FELIDAE, species Panthera leo. They are found in Africa and southern Asia.

The co-occurrence of pregnancy and an INFECTION. The infection may precede or follow FERTILIZATION.

The functional hereditary units of VIRUSES.

Large, phagocytic mononuclear leukocytes produced in the vertebrate BONE MARROW and released into the BLOOD; contain a large, oval or somewhat indented nucleus surrounded by voluminous cytoplasm and numerous organelles.

Proteins encoded by the VIF GENES of the HUMAN IMMUNODEFICIENCY VIRUS.

An infant during the first month after birth.

An agency of the UNITED STATES PUBLIC HEALTH SERVICE that conducts and supports programs for the prevention and control of disease and provides consultation and assistance to health departments and other countries.

The relatively long-lived phagocytic cell of mammalian tissues that are derived from blood MONOCYTES. Main types are PERITONEAL MACROPHAGES; ALVEOLAR MACROPHAGES; HISTIOCYTES; KUPFFER CELLS of the liver; and OSTEOCLASTS. They may further differentiate within chronic inflammatory lesions to EPITHELIOID CELLS or may fuse to form FOREIGN BODY GIANT CELLS or LANGHANS GIANT CELLS. (from The Dictionary of Cell Biology, Lackie and Dow, 3rd ed.)

Meningeal inflammation produced by CRYPTOCOCCUS NEOFORMANS, an encapsulated yeast that tends to infect individuals with ACQUIRED IMMUNODEFICIENCY SYNDROME and other immunocompromised states. The organism enters the body through the respiratory tract, but symptomatic infections are usually limited to the lungs and nervous system. The organism may also produce parenchymal brain lesions (torulomas). Clinically, the course is subacute and may feature HEADACHE; NAUSEA; PHOTOPHOBIA; focal neurologic deficits; SEIZURES; cranial neuropathies; and HYDROCEPHALUS. (From Adams et al., Principles of Neurology, 6th ed, pp721-2)

Infections with bacteria of the genus MYCOBACTERIUM.

An immunoassay utilizing an antibody labeled with an enzyme marker such as horseradish peroxidase. While either the enzyme or the antibody is bound to an immunosorbent substrate, they both retain their biologic activity; the change in enzyme activity as a result of the enzyme-antibody-antigen reaction is proportional to the concentration of the antigen and can be measured spectrophotometrically or with the naked eye. Many variations of the method have been developed.

Technique using an instrument system for making, processing, and displaying one or more measurements on individual cells obtained from a cell suspension. Cells are usually stained with one or more fluorescent dyes specific to cell components of interest, e.g., DNA, and fluorescence of each cell is measured as it rapidly transverses the excitation beam (laser or mercury arc lamp). Fluorescence provides a quantitative measure of various biochemical and biophysical properties of the cell, as well as a basis for cell sorting. Other measurable optical parameters include light absorption and light scattering, the latter being applicable to the measurement of cell size, shape, density, granularity, and stain uptake.

Multinucleated masses produced by the fusion of many cells; often associated with viral infections. In AIDS, they are induced when the envelope glycoprotein of the HIV virus binds to the CD4 antigen of uninfected neighboring T4 cells. The resulting syncytium leads to cell death and thus may account for the cytopathic effect of the virus.

Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.

Cellular receptors that bind the human immunodeficiency virus that causes AIDS. Included are CD4 ANTIGENS, found on T4 lymphocytes, and monocytes/macrophages, which bind to the HIV ENVELOPE PROTEIN GP120.

Intestinal infection with organisms of the genus CRYPTOSPORIDIUM. It occurs in both animals and humans. Symptoms include severe DIARRHEA.

Lymphoid cells concerned with humoral immunity. They are short-lived cells resembling bursa-derived lymphocytes of birds in their production of immunoglobulin upon appropriate stimulation.

The cat family in the order CARNIVORA comprised of muscular, deep-chested terrestrial carnivores with a highly predatory lifestyle.

Conditions resulting from abnormalities in the arteries branching from the ASCENDING AORTA, the curved portion of the aorta. These syndromes are results of occlusion or abnormal blood flow to the head-neck or arm region leading to neurological defects and weakness in an arm. These syndromes are associated with vascular malformations; ATHEROSCLEROSIS; TRAUMA; and blood clots.

The acquired form of infection by Toxoplasma gondii in animals and man.

The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.

Clonal hematopoietic stem cell disorders characterized by dysplasia in one or more hematopoietic cell lineages. They predominantly affect patients over 60, are considered preleukemic conditions, and have high probability of transformation into ACUTE MYELOID LEUKEMIA.

Diseases of Old World and New World monkeys. This term includes diseases of baboons but not of chimpanzees or gorillas (= APE DISEASES).

Chemical substances that are destructive to spermatozoa used as topically administered vaginal contraceptives.

A bacterium causing tuberculosis in domestic fowl and other birds. In pigs, it may cause localized and sometimes disseminated disease. The organism occurs occasionally in sheep and cattle. It should be distinguished from the M. avium complex, which infects primarily humans.

DNA sequences that form the coding region for a protein that down-regulates the expression of human immunodeficiency virus (HIV). nef is short for negative factor.

Infections produced by oncogenic viruses. The infections caused by DNA viruses are less numerous but more diverse than those caused by the RNA oncogenic viruses.

Insertion of viral DNA into host-cell DNA. This includes integration of phage DNA into bacterial DNA; (LYSOGENY); to form a PROPHAGE or integration of retroviral DNA into cellular DNA to form a PROVIRUS.

The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.

Proteins found in any species of virus.

Trans-acting proteins which accelerate retroviral virus replication. The vpr proteins act in trans to increase the levels of specified proteins. vpr is short for viral protein R, where R is undefined.

Infection with a fungus of the species CRYPTOCOCCUS NEOFORMANS.

Genotypic differences observed among individuals in a population.

The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.

Persons who have experienced prolonged survival of HIV infection. This includes the full spectrum of untreated, HIV-infected long-term asymptomatics to those with AIDS who have survived due to successful treatment.

An ACYCLOVIR analog that is a potent inhibitor of the Herpesvirus family including cytomegalovirus. Ganciclovir is used to treat complications from AIDS-associated cytomegalovirus infections.

DNA sequences that form the coding region for the protein responsible for trans-activation of transcription (tat) in human immunodeficiency virus (HIV).

DNA sequences that form the coding region for a protein that regulates the expression of the viral structural and regulatory proteins in human immunodeficiency virus (HIV). rev is short for regulator of virion.

A condition caused by prolonged exposure to excess levels of cortisol (HYDROCORTISONE) or other GLUCOCORTICOIDS from endogenous or exogenous sources. It is characterized by upper body OBESITY; OSTEOPOROSIS; HYPERTENSION; DIABETES MELLITUS; HIRSUTISM; AMENORRHEA; and excess body fluid. Endogenous Cushing syndrome or spontaneous hypercortisolism is divided into two groups, those due to an excess of ADRENOCORTICOTROPIN and those that are ACTH-independent.

Any of the infectious diseases of man and other animals caused by species of MYCOBACTERIUM.

The ability of viruses to resist or to become tolerant to chemotherapeutic agents or antiviral agents. This resistance is acquired through gene mutation.

Differential cell tropism of feline immunodeficiency virus molecular clones in vivo. (1/233)

Independent studies have demonstrated different cell tropisms for molecular clones of feline immunodeficiency virus (FIV). In this report, we examined three clones, FIV-pF34, FIV-14, and FIV-pPPR, for replication in Crandell feline kidney (CrFK) cells, feline peripheral blood mononuclear cells (PBMC), and feline macrophage cultures. Importantly, cell tropism for these three clones was also examined in vivo. FIV-pF34 replication was efficient in CrFK cells but severely restricted in PBMC, whereas replication of FIV-pPPR was vigorous in PBMC but severely restricted in CrFK cells. FIV-14 replication was productive in both CrFK cells and PBMC. Interestingly, all three molecular clones replicated with similar efficiencies in primary feline monocyte-derived macrophages. In vivo, FIV-pF34 proved least efficient for establishing persistent infection, and proviral DNA when detectable, was localized predominately to nonlymphoid cell populations (macrophages). FIV-pPPR proved most efficient for induction of a persistent viremia in vivo, and proviral DNA was localized predominately in CD4(+) and CD8(+) lymphocyte subsets. FIV-14 inoculation of cats resulted in an infection characterized by seroconversion and localization of proviral DNA in CD4(+) lymphocytes only. Results of this study on diverse FIV molecular clones revealed that in vitro replication efficiency of an FIV isolate in PBMC directly correlated with replication efficiency in vivo, whereas proficiency for replication in macrophages in vitro was not predictive for replication potential in vivo. Also, infection of both CD4(+) and CD8(+) lymphocyte subsets was associated with higher virus load in vivo. Results of the studies on these three FIV clones, which exhibited differential cell tropism, indicated a correlation between in vitro and in vivo cell tropism and virus replication. (+info)

Feline immunodeficiency virus subtype C is prevalent in northern part of Taiwan. (2/233)

The seroepidemiological survey of cats conducted in northern part of Taiwan in 1998 revealed that the positive rate of feline immunodeficiency virus (FIV)-infection was 21.9% (7/32) and the rate was much higher than those of previous reports. We succeeded in isolation of three strains of FIV from peripheral blood mononuclear cells of the blood samples. Nucleotide sequences of the env variable V3 to V5 region of the strains revealed that the isolates from distinct areas belong to subtype C. These data together with our previous report (Inada et al. 1997. Arch. Virol., 142: 1459-1467) indicate that FIV subtype C is prevalent in northern part of Taiwan. (+info)

Suppression of feline immunodeficiency virus replication in vitro by a soluble factor secreted by CD8+ T lymphocytes. (3/233)

Mitogen-activated lymphoblasts isolated from the blood and lymph nodes, but not the spleen, of domestic cats acutely infected with the Petaluma or Glasgow8 isolates of feline immunodeficiency virus (FIV), suppressed the replication of FIV in the MYA-1 T-cell line in a dose-dependent manner. This effect was not limited to the homologous isolate of FIV. The suppressor activity declined with progression to chronic infection, with lower levels of activity detectable only in the lymph nodes. Immunization of domestic cats with whole inactivated FIV vaccine elicited profound suppressor activity in both the blood and lymph nodes. The suppressor activity was associated with the CD8+ T-cell subpopulation, the effect did not appear to be major histocompatibility complex-restricted, and was mediated by a soluble factor(s). This activity may be associated with the control of virus replication during both the asymptomatic stages of FIV infection, and in the protective immunity observed in cats immunized with whole inactivated virus vaccines. (+info)

Progressive expansion of an L-selectin-negative CD8 cell with anti-feline immunodeficiency virus (FIV) suppressor function in the circulation of FIV-infected cats. (4/233)

The acute stage of feline immunodeficiency virus (FIV) infection is characterized by the appearance of a major CD8 subpopulation with reduced expression of the CD8 beta chain (CD8alpha+betalo). CD8 antiviral activity was subsequently shown to be mediated by the CD8alpha+betalo phenotype, which is the dominant CD8 phenotype in long-term infected cats. Two- and three-color flow cytometric analysis demonstrated that the CD8alpha+betalo subset is L-selectin negative (CD62L-) and has increased expression of CD44, CD49d, and CD18, consistent with an activation phenotype. The CD8alpha+betaloCD62L- cells but not the CD8alpha+betahiCD62L+ cells demonstrated strong antiviral activity in the FIV acute-infection assay. The progressive expansion of the CD8alpha+betaloCD62L- effector subset cells in FIV-infected cats parallels that seen in human immunodeficiency virus (HIV)-infected patients, suggesting that failure in homeostatic mechanisms regulating lymphocyte activation or trafficking (or both) may be a consequence of both HIV and FIV infections. (+info)

T cells overexpressing interferon-gamma and interleukin-10 are found in both the thymus and secondary lymphoid tissues of feline immunodeficiency virus-infected cats. (5/233)

Similar to human immunodeficiency virus type 1, feline immunodeficiency virus (FIV) replicates in the thymus of infected animals, causing marked alteration in thymic lymphocyte subpopulations. The immune phenotype and cytokine patterns in the thymus and secondary lymphoid tissues of FIV-infected cats were investigated. FIV infection caused an acute-stage transient reduction in CD4CD8 double-positive thymocytes, a marked increase in CD8 single-positive thymocytes, and formation of thymic B cell lymphoid follicles. Interferon (IFN)-gamma and interleukin (IL)-10 mRNA were up-regulated in both the thymus and lymph nodes of FIV-infected cats. Analysis of purified CD4 and CD8 cells revealed that CD4 cells produced most of the IL-10, whereas IFN-gamma was produced by both subsets. Quantitative-competitive reverse-transcription polymerase chain reaction analysis revealed that thymocytes, especially CD4CD8 thymocytes, had much greater levels of gag mRNA than did lymph node T cells. Thus, overexpression of IFN-gamma and IL-10 is a feature of the thymus and secondary lymphoid tissues of FIV-infected cats. (+info)

In vivo infection of ramified microglia from adult cat central nervous system by feline immunodeficiency virus. (6/233)

Infection of microglial cells by the human immunodeficiency virus (HIV) is supposed to play an important role in the pathogenesis of AIDS-related central nervous system (CNS) complications. So far, however, experimental data about interactions between HIV and ramified microglia from the adult CNS were only occasionally reported, making it difficult to understand the exact nature of pathogenic events contributing to HIV-encephalopathy. Therefore, we used the animal model of feline immunodeficiency virus (FIV) infection of domestic cats to establish an experimental system which is suitable for studying the relationships between an immunodeficiency virus and the mature ramified microglia of the central nervous system. By means of density gradient centrifugation approximately 95% pure microglial cells could be isolated from adult feline brain that were characterized by their CD45(low) phenotype. Resident microglia extracted from the CNS of experimentally infected cats harbored FIV-specific DNA and cocultivation with mitogen-activated, but uninfected peripheral blood mononuclear cells (PBMC) resulted in recovery of high-titered infectious virus. Double labeling of brain cell monocultures explanted from persistently infected animals for both microglia and FIV markers disclosed less than 1% of viral antigen expressing microglial cells. This suggests that during the subclinical phase of the infection only a small number of brain-resident macrophages are productively infected. However, interaction of FIV-infected microglia and inflammatory lymphocytes may promote viral replication, thus supporting viral spread in brain tissue. (+info)

8-Difluoromethoxy-4-quinolone derivatives as anti-feline immunodeficiency virus (FIV) agents: important structural features for inhibitory activity of FIV replication. (7/233)

The inhibitory activities of various 8-difluoromethoxy-4-quinolone derivatives against feline immunodeficiency virus (FIV) replication in the chronically infected cell line P-CrFK were investigated. Certain derivatives were found to inhibit FIV production from P-CrFK cells in a dose-dependent manner without exhibiting cytotoxic effects at inhibitory concentrations. Based on this study, the structures important for anti-FIV activity are suggested to be (i) a carboxyl group at position C-3, and (ii) an aromatic modification at position 4 of the C-7 piperazinyl moiety. (+info)

Effects of multiple acute morphine exposures on feline immunodeficiency virus disease progression. (8/233)

Drug abuse is a common method of human immunodeficiency virus type 1 transmission, but the role of opiates on lentivirus disease progression is not well understood. The feline immunodeficiency virus (FIV)/cat system was used to model the weekend opiate abuser: the nondependent, nonaddicted, and nontolerant person. Sixteen cats were placed into 4 groups: FIV only, morphine only, morphine/FIV, and controls. Multiple acute morphine exposure did not increase the severity of early lentivirus infection. On the contrary, it delayed or moderated the FIV-induced disease progression. Although the animals were exposed to only 1 injection of morphine per day for 2 consecutive days per week, the morphine-treated FIV-infected animals had a delayed onset of the FIV-induced lymphadenopathy, did not develop or had a significant delay in the FIV-induced effects on brain stem auditory evoked potentials, and demonstrated a trend toward decreased virus load. (+info)

... feline acquired immunodeficiency syndrome MeSH C22.180.440 - feline infectious peritonitis MeSH C22.180.460 - feline ... murine acquired immunodeficiency syndrome MeSH C22.836.120 - bluetongue MeSH C22.836.160 - border disease MeSH C22.836.259 - ... simian acquired immunodeficiency syndrome MeSH C22.735.750 - monkeypox MeSH C22.795.239 - ectromelia, infectious MeSH C22.795. ... poult enteritis mortality syndrome MeSH C22.131.800 - sarcoma, avian MeSH C22.131.921 - tuberculosis, avian MeSH C22.180.350 - ...

https://en.wikipedia.org/wiki/List_of_MeSH_codes_(C22)

... feline acquired immunodeficiency syndrome MeSH C02.782.815.616.400 - hiv infections MeSH C02.782.815.616.400.040 - acquired ... simian acquired immunodeficiency syndrome MeSH C02.782.815.616.900 - visna MeSH C02.782.815.622 - leukemia, feline MeSH C02.782 ... acquired immunodeficiency syndrome MeSH C02.800.801.400.048 - aids arteritis, central nervous system MeSH C02.800.801.400.050 ... murine acquired immunodeficiency syndrome MeSH C02.782.815.725 - pulmonary adenomatosis, ovine MeSH C02.782.815.800 - sarcoma, ...

https://en.wikipedia.org/wiki/List_of_MeSH_codes_(C02)

... and individuals with acquired immunodeficiency syndrome). Some common and preventable forms of zoonosis are as follows: ... Feline asthma Feline hepatic lipidosis also known as Feline Fatty Liver Syndrome, is one of the most common forms of liver ... Feline calicivirus (FCV), a common viral cause of respiratory infection in cats. Feline parvovirus, which causes feline ... "Domestic cat genome sequenced". Genome Research. Retrieved 14 Feb 2015. "Feline Immunodeficiency Virus (FIV)". Cornell ...

https://en.wikipedia.org/wiki/Cat_health

Finally, the cat progresses into the final stage (known as the feline acquired immune deficiency syndrome (FAIDS) stage), ... Feline immunodeficiency virus (FIV) is a Lentivirus that affects cats worldwide, with 2.5% to 4.4% of felines being infected. ... Feline vaccination Winn Feline Foundation Johnson (2005), Proceedings Might, Jennifer Lynne (2004), Feline Immunodeficiency ... PMID 20210778 American Association of Feline Practitioners (2002), "Feline Immunodeficiency Virus", Cornell Feline Health ...

https://en.wikipedia.org/wiki/Feline_immunodeficiency_virus

... the virus that causes acquired immunodeficiency syndrome (AIDS). "Lymphadenopathy syndrome" has been used to describe the first ... Infectious causes of lymphadenopathy may include bacterial infections such as cat scratch disease, tularemia, brucellosis, or ... Klotz, SA; Ianas, V; Elliott, SP (2011). "Cat-scratch Disease". American Family Physician. 83 (2): 152-155. PMID 21243990. ... Generalized lymphadenopathy is an early sign of infection with human immunodeficiency virus (HIV), ...

https://en.wikipedia.org/wiki/Lymphadenopathy

Cats usually become immune to the infection, while dogs may be very symptomatic. Humans may also acquire it through flea or ... March 1993). "Syndrome of Rochalimaea henselae adenitis suggesting cat scratch disease". Ann. Intern. Med. 118 (5): 331-6. doi: ... yields Bartonella henselae from human immunodeficiency virus-positive patient and unique Bartonella strain from his cat". J ... Cats are the main reservoir of Bartonella henselae, and the bacterium is transmitted to cats by the cat flea Ctenocephalides ...

https://en.wikipedia.org/wiki/Bartonellosis

... of which 16,528 progressed to acquired immune deficiency syndrome (AIDS); 9,554 have died. The actual number of HIV-positive ... In September 2018, the Hanoi People's Committee urged the citizens of the country to stop eating dog and cat meat as it can ... By the following year, Vietnam had diagnosed 101,291 human immunodeficiency virus (HIV) cases, ... Cat Bi International Airport, Can Tho International Airport, and Long Thanh International Airport. The planned Long Thanh ...

https://en.wikipedia.org/wiki/Vietnam

AIDS stands for acquired immuno-deficiency syndrome which is not a proper name, while Aids is in the style of one. Some style ... TICA for The International Cat Association, DOJ for Department of Justice). Abbreviations formed from a string of initials and ... from acquired immuno-deficiency syndrome, and scuba from self-contained underwater breathing apparatus). However, this is only ... Rebranding can lead to redundant acronym syndrome, as when Trustee Savings Bank became TSB Bank, or when Railway Express Agency ...

https://en.wikipedia.org/wiki/Acronym

... a distinct vascular disorder in patients with the acquired immunodeficiency syndrome or AIDS-related complex". Lancet. 2 (8560 ... Cats may be bacteremic for weeks to years, but infection is more common in young cats. Transmission to humans is thought to ... Therefore, elimination and control of fleas in the cat's environment are key to prevention of infection in both cats and humans ... "An atypical subcutaneous infection associated with acquired immune deficiency syndrome". Am J Clin Pathol. 80 (5): 714-8. doi: ...

https://en.wikipedia.org/wiki/Bacillary_angiomatosis

These community-acquired infections occur principally in immunocompetent individuals. While many H. cinaedi infections in ... Helicobacter cinaedi has been isolated from cats, dogs, hamsters, rats, foxes, and rhesus monkeys; the bacterium is part of the ... or the myelodysplastic syndrome), chemotherapy treatments, or splenectomy. H. cinaedi infection has also occurred in persons ... common variable immunodeficiency, various malignancies (e.g. lung cancer, multiple myeloma, leukemia, lymphoma, ...

https://en.wikipedia.org/wiki/Helicobacter_cinaedi

Since patients with acquired immunodeficiency syndrome (AIDS) have a progressive decline in the number of CD4 cells, they also ... Animal source: bee, wasp, cats, insects, rats, etc. Environmental factors: dust mites, latex, pollen, mold, etc. Atopic ...

https://en.wikipedia.org/wiki/Hypersensitivity

... as can occur in acquired immunodeficiency syndrome or when being treated with immunosuppressive drugs, as in cancer treatment ... Opportunistic infections caused by feline leukemia virus and feline immunodeficiency virus retroviral infections can be treated ... Cat feces (e.g. cat litter): source of Toxoplasma gondii, Bartonella spp. Soil/dust in areas where there is known ... Immunodeficiency or immunosuppression are characterized by the absence of or disruption in components of the immune system, ...

https://en.wikipedia.org/wiki/Opportunistic_infection

Clinical Syndromes: Health Care-Associated Infections Chapter 137: Infections Acquired in Health Care Facilities Chapter 138: ... Human Immunodeficiency Virus Disease: AIDS and Related Disorders Section 15: Infections Due to RNA Viruses Chapter 198: Viral ... Including Cat-Scratch Disease Chapter 168: Donovanosis Section 7: Miscellaneous Bacterial Infections Chapter 169: Nocardiosis ... Sjögren's Syndrome Chapter 355: The Spondyloarthritides Chapter 356: The Vasculitis Syndromes Chapter 357: Behçet's Syndrome ...

https://en.wikipedia.org/wiki/Harrison's_Principles_of_Internal_Medicine

"Disseminated bilateral chorioretinitis due to Histoplasma capsulatum in a patient with the acquired immunodeficiency syndrome ... Cat diseases, Dog diseases, Fungal diseases). ... in patients with acquired immunodeficiency syndrome". Cutis. 72 ... Presumed ocular histoplasmosis syndrome causes chorioretinitis, where the choroid and retina of the eyes are scarred, resulting ... Distinct from POHS, acute ocular histoplasmosis may rarely occur in immunodeficiency. In absence of proper treatment and ...

https://en.wikipedia.org/wiki/Histoplasmosis

... a precursor of the acquired immunodeficiency syndrome (AIDS) in humans. There are several distinct strains of HIV, indicating ... Cat meat Dog meat Game - animals hunted for food Indigenous cuisine of the Americas Malnutrition Roadkill cuisine Wildlife ... Simian immunodeficiency virus present in chimpanzees is reportedly derived from older strains of the virus present in the ... and syphilis acquired by early agrarians. The emergence of HIV-1, AIDS, Ebola virus disease, and Creutzfeldt-Jakob disease are ...

https://en.wikipedia.org/wiki/Bushmeat

May 1983). "Acquired immunodeficiency syndrome in a colony of macaque monkeys". Proceedings of the National Academy of Sciences ... Related viruses in other groups in the genus infect other mammals like sheep and goats, horses, cattle, cats and a few others. ... King NW, Hunt RD, Letvin NL (December 1983). "Histopathologic changes in macaques with an acquired immunodeficiency syndrome ( ... "CCR5 as a Coreceptor for Human Immunodeficiency Virus and Simian Immunodeficiency Viruses: A Prototypic Love-Hate Affair". ...

https://en.wikipedia.org/wiki/Simian_immunodeficiency_virus

"Expression of fibroblast growth factors and their receptors in acquired immunodeficiency syndrome-associated Kaposi sarcoma ... "Four independent mutations in the feline fibroblast growth factor 5 gene determine the long-haired phenotype in domestic cats ... This has been demonstrated in many species, including cats, dogs, mice, rabbits, donkeys, sheep and goats, where it is often ... "Mutations within the FGF5 gene are associated with hair length in cats". Animal Genetics. 38 (3): 218-21. doi:10.1111/j.1365- ...

https://en.wikipedia.org/wiki/FGF5

Duesberg P (1989). "Human immunodeficiency virus and acquired immunodeficiency syndrome: correlation but not causation". Proc ... feline leukemia virus, and human T-lymphotropic virus. Duesberg claims that the supposedly innocuous nature of all retroviruses ... Update on Acquired Immunodeficiency Syndrome (AIDS), United States. [Centers for Disease Control and Prevention, Morbidity and ... Revision of the CDC Surveillance Case Definition of Acquired Immunodeficiency Syndrome for National Reporting, United States. [ ...

https://en.wikipedia.org/wiki/Duesberg_hypothesis

Severe cases are also more likely to occur in the very young, very old, and persons with immunodeficiency, such as HIV/AIDS ... In Australia, one locally-acquired case of B. microti has been reported, which was fatal. A subsequent investigation found no ... Shaw, Susan E.; Day, Michael J. (11 April 2005). Arthropod-borne Infectious Diseases of the Dog and Cat. Manson Publishing. p. ... including adult respiratory distress syndrome. Sepsis in people who have had a splenectomy can occur rapidly, consistent with ...

https://en.wikipedia.org/wiki/Babesiosis

Journal of Acquired Deficiency Syndromes. 2: 311. Haseltine, WA (1992). "Molecular Biology of the AIDS Virus: Ten Years of ... The first product, developed for the French company Virbac, was a vaccine to protect domestic cats from infection by the feline ... "Cis-Acting Sequences Responsive to the rev Gene Product of the Human Immunodeficiency Virus". Journal of Acquired Immune ... LeukoSite, also initially funded by Healthcare Ventures, acquired ProScript which in turn was acquired by Millenium ...

https://en.wikipedia.org/wiki/William_A._Haseltine

Cats with feline immunodeficiency virus are particularly at risk. However, the overall risk of blastomycosis in cats is 28 to ... Cats in particular are often only diagnosed after death. Dogs and humans frequently acquire blastomycosis from the same ... are present they may range from mild pneumonia resembling a pneumococcal infection to acute respiratory distress syndrome (ARDS ... Lester, RS; DeKoven, JG; Kane, J; Simor, AE; Krajden, S; Summerbell, RC (2000). "Novel cases of blastomycosis acquired in ...

https://en.wikipedia.org/wiki/Blastomycosis

Malnutrition and immunodeficiency tend to exacerbate the condition, leading to more severe cases or secondary conditions that ... These symptoms are usually mild but in cases of poult enteritis and mortality syndrome (PEMS), which has dehydration, immune ... Feline astrovirus 1, Porcine astrovirus 1, Mink astrovirus 1 and Ovine astrovirus 1. Astroviruses have a star-like appearance ... Lee and Kurtz discover two serotypes of astrovirus that are used to type 13 strains of community-acquired astrovirus 1987: Gray ...

https://en.wikipedia.org/wiki/Astrovirus

May 1983). "Acquired immunodeficiency syndrome in a colony of macaque monkeys". Proceedings of the National Academy of Sciences ... Dirofilariasis is caused by Dirofilaria immitis through mosquitoes infected by mammals like dogs and cats. Cat-scratch disease ... King NW, Hunt RD, Letvin NL (December 1983). "Histopathologic changes in macaques with an acquired immunodeficiency syndrome ( ... Dogs and cats are routinely vaccinated against rabies. Pets can also transmit ringworm and Giardia, which are endemic in both ...

https://en.wikipedia.org/wiki/Zoonosis

In 1977 the WHO recorded the last case of smallpox infection acquired outside a laboratory in Somalia. In 1980 the WHO ... Nipah virus infection Rift Valley fever Severe acute respiratory syndrome Severe fever with thrombocytopenia syndrome Zika They ... but also in those who cannot be vaccinated due to age or immunodeficiency, who could contract infections from unvaccinated ... Medicine portal Viruses portal Antitoxin COVID-19 vaccine DNA vaccination Feline vaccination H5N1 clinical trials Immunization ...

https://en.wikipedia.org/wiki/Vaccination

Over time, the genome of ERVs not only acquire point mutations, but also shuffle and recombine with other ERVs. ERVs with a ... Nevertheless, it is clear from studies in birds and non-human mammal species including mice, cats and koalas, that younger (i.e ... Sjögren syndrome (SS). On a protein level, a direct interaction between TLRs and certain HERV proteins has been shown. For ... human immunodeficiency virus type-1 (HIV-1), human T-lymphotropic virus 1 (HTLV-1); 2) RNA viruses - influenza A virus, ...

https://en.wikipedia.org/wiki/Endogenous_retrovirus

Parker, J; Murphy W; Wang D; O'Brien S; Parrish C (2001). "Canine and feline parvoviruses can use human or feline transferrin ... This was important for the study of developmental disorders such as Down syndrome that involved the number of chromosomes. In ... The membranes have been segmented from data acquired with Electron Microscopy. The 1997 documentary The Way of All Flesh by ... Mondor, Isabelle; Ugolini, Sophie; Sattentau, Quentin J. (1998-05-01). "Human Immunodeficiency Virus Type 1 Attachment to HeLa ...

https://en.wikipedia.org/wiki/HeLa

Although such strings were commonly referred to as "catgut" strings, cats were never used as a source for gut strings. Sheep ... Intestinal pseudo-obstruction is a syndrome caused by a malformation of the digestive system, characterized by a severe ... Influence on innate and acquired immunity". World Journal of Gastroenterology. 22 (4): 1433-1448. doi:10.3748/wjg.v22.i4.1433. ... "Gut epithelial barrier dysfunction in human immunodeficiency virus-hepatitis C virus coinfected patients: ...

https://en.wikipedia.org/wiki/Gastrointestinal_tract

... a precursor of the acquired immunodeficiency syndrome in humans. The body parts of many animals, such as tigers and ... Banks, D.; Lawson, S. & Wright, B. (2006). Skinning the Cat: Crime and Politics of the Big Cat Skin Trade (PDF) (Report). ...

https://en.wikipedia.org/wiki/Poaching

... acquired immunodeficiency syndrome). Most virologists believe that HIV originated in Kinshasa in the Democratic Republic of ... Pigs, cattle, goats, sheep, horses, camels, cats and dogs were all kept and bred in captivity. These animals would have brought ... Severe acute respiratory syndrome (SARS) is caused by a new type of coronavirus. Other coronaviruses were known to cause mild ... This acquired immunity is only passed down to offspring temporarily, by antibodies in breast milk and other antibodies that ...

https://en.wikipedia.org/wiki/Social_history_of_viruses

... the terms human immunodeficiency virus and acquired immunodeficiency syndrome are abbreviated to HIV and AIDS, respectively. ... Bubonic plague Bullous impetigo Cat scratch disease (cat scratch fever, English-Wear infection, inoculation lymphoreticulosis, ... Turner syndrome Ulnar-mammary syndrome Van Der Woude syndrome Von Hippel-Lindau syndrome Watson syndrome Werner syndrome (adult ... Job syndrome) Immunodeficiency with hyper-IgM Immunodeficiency-centromeric instability-facial anomalies syndrome (ICF syndrome ...

https://en.wikipedia.org/wiki/List_of_skin_conditions

Lastly, a community-acquired infection is one in which the infection is acquired from a whole community. One manner of proving ... Other techniques (such as X-rays, CAT scans, PET scans or NMR) are used to produce images of internal abnormalities resulting ... In contrast, the human immunodeficiency virus (HIV) kills its victims very slowly by attacking their immune system. As a result ... E.g. HIV, Rhinovirus, Lyssaviruses such as Rabies virus, Ebolavirus and Severe acute respiratory syndrome coronavirus 2) Fungi ...

https://en.wikipedia.org/wiki/Infection

Discovery of the cause of Down syndrome (chromosome 21 trisomy) by Jérôme Lejeune in 1958-1959 (syndrome first described by ... "His Smoke Eating Cats Now Attack Traffic Smog." Popular Science, June 1955, pp. 83-85/244. Boucher, François. 20,000 Years of ... Discovery of human immunodeficiency virus by Françoise Barré-Sinoussi and Luc Montagnier (1983). Deep brain stimulation (DBS) ... Lamarckism, the first cohesive theory of evolution as well as a theory of inheritance of acquired characteristics, laid out by ...

https://en.wikipedia.org/wiki/List_of_French_inventions_and_discoveries

"France outlaws lewd cat-calls to women in public amid attack uproar". Reuters. 2 August 2018 - via www.reuters.com. "Adultery ... United States, Tennessee: Tennessee banned abortions because of a prenatal diagnosis of Down syndrome or because of the gender ... United States: The Supreme Court reinstated federal rules mandating anyone having a medication abortion to acquire the pills ... human immunodeficiency virus (HIV) screening and counseling; FDA-approved contraceptive methods and contraceptive counseling; ...

https://en.wikipedia.org/wiki/Timeline_of_women's_legal_rights_(other_than_voting)

Severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS) are caused by new types of coronaviruses. ... During this process, the virus acquires its envelope, which is a modified piece of the host's plasma or other, internal ... Companion animals such as cats, dogs, and horses, if not vaccinated, are susceptible to serious viral infections. Canine ... "Reducing the risk of mother-to-child human immunodeficiency virus transmission: past successes, current progress and challenges ...

https://en.wikipedia.org/wiki/Virus

Cutaneous vascular lesions and disseminated cat scratch disease in patients with the acquired immunodeficiency syndrome (AIDS) ... Dolan MJ, Wong MT, Regnery RL, Jorgensen JH, Garcia M, Peters J, Syndrome of Rochalimaea henselae adenitis suggesting cat ... The cat-scratch syndrome, many diseases or one disease? Prog Med Virol. 1967;9:256-301.PubMedGoogle Scholar ... Enter New Syndromes Enter Rochalimaea henselae The Cat-scratch Connection: A Synthesis Felis domesticus: A Reservoir for ...

http://wwwnc.cdc.gov/eid/article/1/1/09-0103_article.htm

Feline Immunodeficiency Virus (FIV) infection in domestic cats results in an acquired immunodeficiency syndrome (AIDS) similar ... Feline Immunodeficiency Virus (FIV): Develop of Quantitative Competitive Polymerase Chain Reaction (QC-PCR) to Evaluate Viral ... In Argentine, FIV-infected cats are treated with oral Zidovudine (AZT) and Valproic Acid because using drug cocktails enhances ... The aforementioned therapy showed statistically significant differences in infected cats, with regards clinical parameters and ...

https://www.vin.com/apputil/project/defaultadv1.aspx?pid=11223&catid=&id=3859187&meta=&authorid=

Feline AIDS Feline Acquired Immune Deficiency Syndrome Feline Acquired Immuno Deficiency Syndrome Feline Acquired Immuno- ... Feline AIDS. Feline Acquired Immune Deficiency Syndrome. Feline Acquired Immuno Deficiency Syndrome. Feline Acquired Immuno- ... Feline Acquired Immunodeficiency Syndrome - Preferred Concept UI. M0024698. Scope note. Acquired defect of cellular immunity ... Feline Acquired Immunodeficiency Syndrome Entry term(s). AIDS, Feline FAIDS ...

https://decs.bvsalud.org/en/ths/resource/?id=28932&filter=ths_exact_term&q=S%C3%8DNDROME+DE+IMUNODEFICI%C3%8ANCIA+ADQUIRIDA+FELINA

Feline AIDS is caused by the feline immunodeficiency virus (FIV). Boosting the immune system and reducing stress are essential ... AIDS stands for Acquired Immune Deficiency Syndrome. It is generally well known to people with respect to HIV, or Human ... The condition known as Feline AIDS is caused by the presence of the Feline Immunodeficiency Virus, otherwise known as Feline ... FIV only affects members of the cat family. If your cat has been diagnosed with Feline FIV or Feline AIDS, you cannot catch it ...

https://www.cat-lovers-only.com/feline-aids.html

Medical evaluation, which included a renal sonogram and an abdominal CAT scan, revealed no cause for his complaints, and his ... Epidemiologic Notes and Reports An Evaluation of the Acquired Immunodeficiency Syndrome (AIDS) Reported in Health-Care ... patients meeting the CDC surveillance definition of the acquired immunodeficiency syndrome (AIDS) (1). Of these, four were ... Update on acquired immune deficiency syndrome (AIDS)--United States. MMWR 1982;31:507-8, 513-14. ...

https://www.cdc.gov/mmwr/preview/mmwrhtml/00000108.htm

Finally, the cat progresses into the final stage (known as the feline acquired immune deficiency syndrome (FAIDS) stage), ... Feline immunodeficiency virus (FIV) is a Lentivirus that affects cats worldwide, with 2.5% to 4.4%[1][2] of felines being ... American Association of Feline Practitioners (2002), "Feline Immunodeficiency Virus", Cornell Feline Health Center, Cornell ... 1987), "Isolation of a T-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome", Science, 235 (4790): ...

https://en.wikipedia.org/wiki/FIV

FAIDS use Feline Acquired Immunodeficiency Syndrome Failed Back Surgery Syndrome Failure Analyses, Equipment use Equipment ... Familial Cold Autoinflammatory Syndrome use Cryopyrin-Associated Periodic Syndromes Familial Cold Autoinflammatory Syndrome 1 ... Familial Kleine-Levin Syndrome use Kleine-Levin Syndrome Familial Lipoprotein Lipase Deficiency use Hyperlipoproteinemia Type I ... Familial Hibernation (Kleine-Levin) Syndrome use Kleine-Levin Syndrome Familial High Density Lipoprotein Deficiency Disease use ...

https://decs.bvs.br/I/DeCS2018_Alfab-F.htm

... here are the vaccines you may choose to NOT give to your cat, depending on her particular situation. ... This is the feline acquired immunodeficiency syndrome, the AIDS of cats.. It affects cats older than 4 years of age. Because of ... Feline Immunodeficiency Virus (FIV). The feline immunodeficiency virus (FIV) shares a lot of characteristics with the FeLV. ... Feline leukemia virus and feline immunodeficiency virus in Canada: recommendations for testing and management. Can Vet J. 2011 ...

https://animalpatient.com/vaccination-guide/cat-non-core-vaccines

It is generally parasitic in animals such as cats and dogs. Diegonella mansoni is widely distributed, and it is reported to be ... A Case of Acquired Immunodeficiency Syndrome With Cerebral Sparganosis and Review of the Literature. ...

https://www.researchsquare.com/article/rs-434937/v1

https://wwwnc-origin.cdc.gov/eid/article/1/1/09-0103

feline acquired immunodeficiency syndrome. *enzootic bovine leukosis. *ovine pulmonary adenomatosis. *equine infectious anemia ...

https://agclass.nal.usda.gov/vocabularies/nalt/concept?uri=https%3A//lod.nal.usda.gov/nalt/341900

Cat scratch. Acquired immunodeficiency syndrome (AIDS). Metabolic. Diabetes mellitus. Hyperthyroidism. Pregnancy. Hypertension ... Opercular syndrome (cortical lesion in facial motor area). Millard-Gubler syndrome (abducens palsy with contralateral ... Opercular syndrome (cortical lesion in facial motor area). Millard-Gubler syndrome (abducens palsy with contralateral ... All of the reviews studies looked at patients with Bell palsy, with three also including patients with Ramsey Hunt syndrome. [ ...

http://emedicine.staging.medscape.com/article/1290547-overview

Acquired Immunodeficiency Syndrome (AIDS) in Persons with Hemophilia; 1984:10:26. Update: Acquired Immunodeficiency Syndrome ... Epidemiologic Notes and Reports Encephalitis Associated with Cat Scratch Disease -- Broward and Palm Beach Counties, Florida, ... Acquired Immunodeficiency Syndrome (AIDS): Precautions for Health-Care Workers and Allied Professionals; 1983:09:02. Acquired ... Human Immunodeficiency Virus Infection/Acquired Immunodeficiency Syndrome Revised Chapter X from "Guidelines for STD Control ...

https://wonder.cdc.gov/wonder/prevguid/titles_a.html

Mike Richards says, "Feline immundeficiency virus infection does not lead to acquired immunodeficiency syndrome in cats as ... Feline Immunodeficiency Virus (FIV). What is FIV & how is it transmitted? Feline Immunodeficiency Virus (FIV) is a retrovirus ... Local rescues that that accept FIV cats:. Finding a home or rescue to take an FIV (Feline Immunodeficiency Virus) cat can be ... FIV is a cat-to-cat only disease and cannot be passed to humans, dogs, or other non-feline species. The primary mode of ...

https://www.thecatcornerinc.com/fiv-facts--resources.html

... responsible for the Murine Acquired Immunodeficiency Syndrome (MAIDS), and cats co-infected with T. gondii and the Feline ... "Feline Immunodeficiency Virus" (FIV) ont une sensibilité accrue à la toxoplasmose acquise mais la réactivation dune infection ... Immunodeficiency Virus (FIV) are more susceptible to primary acquired toxoplasmosis, but reactivation of chronic infection is ... gondii in hosts presenting virus induced immunodeficiencies. Mice co-infected with T. gondii and the retrovirus LP-BM5, ...

https://www.parasite-journal.org/articles/parasite/abs/1995/04/parasite1995023p243/parasite1995023p243.html

Feline Acquired Immunodeficiency Syndrome [C01.925.839.400] Feline Acquired Immunodeficiency Syndrome * Leukoencephalopathy, ...

https://decs.bvsalud.org/en/ths/resource/?id=33630&filter=ths_exact_term&q=ALEUTIAN+MINK+DISEASE

https://decs2020.bvsalud.org/I/DeCS2016_Alfab-F.htm

https://decs2019.bvsalud.org/I/DeCS2016_Alfab-F.htm

FAIDS use Feline Acquired Immunodeficiency Syndrome Failed Back Surgery Syndrome Failure Analyses, Equipment use Equipment ... Familial Cold Autoinflammatory Syndrome use Cryopyrin-Associated Periodic Syndromes Familial Cold Autoinflammatory Syndrome 1 ... Familial Kleine-Levin Syndrome use Kleine-Levin Syndrome Familial Lipoprotein Lipase Deficiency use Hyperlipoproteinemia Type I ... Familial Third and Fourth Pharyngeal Pouch Syndrome use DiGeorge Syndrome Familial Thrombotic Microangiopathy use Purpura, ...

https://decs2017.bvsalud.org/I/DeCS2017_Alfab-F.htm

Here are the top problems we see with indoor cats and with outdoor cats. ... Pay attention to signs that your cat needs immediate veterinary attention. ... FIV cats may live long lives without symptoms, but the virus can also create an acquired immunodeficiency syndrome with ... Other infected cats can transmit serious viruses to your outdoor cat: feline immunodeficiency virus (FIV) and feline leukemia ( ...

https://www.petful.com/pet-health/veterinarian-outdoor-cats/

FAIDS use Feline Acquired Immunodeficiency Syndrome Failed Back Surgery Syndrome Failure Analyses, Equipment use Equipment ... Familial Cold Autoinflammatory Syndrome use Cryopyrin-Associated Periodic Syndromes Familial Cold Autoinflammatory Syndrome 1 ... Familial Kleine-Levin Syndrome use Kleine-Levin Syndrome Familial Lipoprotein Lipase Deficiency use Hyperlipoproteinemia Type I ... Familial Third and Fourth Pharyngeal Pouch Syndrome use DiGeorge Syndrome Familial Thrombotic Microangiopathy use Purpura, ...

https://decs2018.bvsalud.org/I/DeCS2018_Alfab-F.htm

Those with immature or weakened immune systems, such as infants, individuals with acquired immunodeficiency syndrome (AIDS), ... Cat, cat advise, Cat Care, cat conditions, cat health, cat help, cat issues, cat kidney, cat medical conditions, cat problems, ... Cat, cat advise, Cat Care, cat conditions, cat health, cat help, cat hygiene, cat issues, cat medical conditions, cat problems ... Cat, cat advise, Cat Care, cat conditions, cat health, cat help, cat issues, cat medical conditions, cat problems, cat welfare ...

https://www.snapcats.org/tag/cat/

Results of search for ccl=su:{Acquired immunodeficiency syndrome} Refine your search. *. Availability. * Limit to currently ... au syndrome tuberculose/VIH, aux jeunes et à la population générale. by Oberzaucher, Nicola , Baggaley, Rachel , UNAIDS. ...

https://kohahq.searo.who.int/cgi-bin/koha/opac-search.pl?q=ccl=su%3A%7BAcquired%20immunodeficiency%20syndrome%7D&sort_by=relevance_dsc&count=20&limit=se:ONUSIDA%20collection%20meilleures%20pratiques

... most often due to acquired immunodeficiency syndrome. ... The domestic cat serves as the carrier for Bartonella henselae ... Bacteremia in naturally infected cats with chronic infection was successfully cleared from nine out of 14 cats treated with ... Cat scratch disease does not typically respond well to antibiotic therapy.[3] Numerous reports have evaluated the effectiveness ... B. henselae is the primary etiologic agent of cat scratch disease, which seems to be the most common Bartonella infection in ...

https://www.medscape.com/viewarticle/734138_5

Acquired immunodeficiency syndrome.} and su-to:HIV infections Refine your search. *. Availability. * Limit to currently ...

https://kohahq.searo.who.int/cgi-bin/koha/opac-search.pl?q=ccl=su%3A%7BAcquired%20immunodeficiency%20syndrome.%7D%20and%20su-to%3AHIV%20infections&offset=740&sort_by=relevance_dsc&count=20

... exist a few reports of systemic infection caused by Bartonella vinsonii in patients with acquired immunodeficiency syndrome. A ... Immunodeficiency was excluded in seven patients. Seven patients cats were screened by veterinarians and treated when infected ... Bartonella DNA was detected in 11/87 cats (12.64 %). Sequencing results revealed the presence of B. henselae in cats from ... henselae the causative agent of cat scratch disease. Despite the important role of cats in the epidemiology of bartonellosis, ...

https://pesquisa.bvsalud.org/brasil/?lang=pt&q=mh:Infec%C3%A7%C3%B5es+por+Bartonella/diagn%C3%B3stico

Interface dermatitis in patients with the acquired immunodeficiency syndrome. J Am Acad Dermatol. 1987;16:1209-18.. 17. Kharfan ... Blood flow and epithelial thickness in different regions of feline oral mucosa and skin. J Oral Pathol. 1987;16:317-21.. 15. ... interface dermatitis in eruptions in patients with the acquired immunodeficiency syndrome [16]. The rippled almost livedoid ...

https://escholarship.org/uc/item/0nq2c0bx

Human immunodeficiency virus (HIV) and JC virus in acquired immune deficiency syndrome (AIDS) patients with progressive ... Effects of MK-801 upon neurologic outcome following cardiac arrest in cats. Fleischer, J. E., Tateishi, A., Drummond, J. C., ... Preservation of evoked potentials in a case of anterior spinal artery syndrome. Zornow, M. H., Grafe, M. R., Tybor, C. & ... Effects of nimodipine upon neurologic outcome following cardiac arrest in cats. Tateishi, A., Fleischer, J. E., Drummond, J. C. ...

https://ohsu.pure.elsevier.com/en/organisations/pathology/publications/?type=%2Fdk%2Fatira%2Fpure%2Fresearchoutput%2Fresearchoutputtypes%2Fcontributiontojournal%2Farticle&page=18

Review and meta-analysis of randomized patients with acquired Baltic Pharmaceuticals Sustanon immunodeficiency syndrome ...

https://awnry.com/cat-steroid-9-2.html

Acquired Immunodeficiency Syndrome. * Know Scientia. * What is it? * Participants * Dissemination of the scientific production ...

https://scientiasalut.gencat.cat/handle/11351/2630/browse?rpp=20&etal=-1&sort_by=-1&type=subject_mesh&starts_with=A&order=ASC

Feline Immunodeficiency Virus (FIV) infection in domestic cats results in an acquired immunodeficiency syndrome (AIDS) similar to that caused by Human Immunodeficiency Virus (HIV) infection in humans. (vin.com)
The condition known as Feline AIDS is caused by the presence of the Feline Immunodeficiency Virus, otherwise known as Feline FIV. (cat-lovers-only.com)
AIDS stands for Acquired Immune Deficiency Syndrome. (cat-lovers-only.com)
I've gotten some questions from readers about whether "cat AIDS" is contagious to humans. (cat-lovers-only.com)
If your cat has been diagnosed with Feline FIV or Feline AIDS, you cannot catch it from her. (cat-lovers-only.com)
Also, not all cats who are FIV positive will develop full blown AIDS. (cat-lovers-only.com)
In the case of Feline AIDS or FIV, that means doing all you can to support the immune system of your cat, and treating the secondary infections and conditions that may arise in due course. (cat-lovers-only.com)
Of course, you'd want to do this anyway, but the obvious increase in danger to a Feline AIDS patient makes this very important. (cat-lovers-only.com)
Above all, a Feline AIDS patient needs lots of love and constancy in her life. (cat-lovers-only.com)
As of July 11, 1983, physicians and health departments in the United States and Puerto Rico had reported a total of 1,831 patients meeting the CDC surveillance definition of the acquired immunodeficiency syndrome (AIDS) (1). (cdc.gov)
Feline Immunodeficiency Virus (FIV) is a retrovirus in the same family as the human AIDS virus, with a few significant differences. (thecatcornerinc.com)
Dr. Mike Richards says, "Feline immundeficiency virus infection does not lead to acquired immunodeficiency syndrome in cats as often as human immunodeficiency virus leads to AIDS in people. (thecatcornerinc.com)
Among immunodeficient individuals, toxoplasmosis most often occurs in those with defects of T-cell-mediated immunity, such as those with hematologic malignancies, bone marrow and solid organ transplants, or acquired immunodeficiency syndrome (AIDS).In most immunocompetent individuals, primary or chronic (latent) T gondii infection is asymptomatic. (medscape.com)
4, 5] Infection with the human immunodeficiency virus (HIV) does not seem to effect T gondii seropositivity, and there does not appear to be any difference in the rate of toxoplasmosis infection among patients with AIDS with and without cats. (medscape.com)
Human immunodeficiency virus type 1 (HIV-1) infection is a global health problem for which the pathogenic mechanisms causing disease occurrence and the acquired immunodeficiency syndrome (AIDS) are incompletely understood [ 1 - 5 ]. (biomedcentral.com)
HIV, or human immunodeficiency virus, attacks the body's immune system and can eventually lead to AIDS, or Acquired Immune Deficiency Syndrome. (differencebetweenz.com)
Human immunodeficiency virus-1 (HIV-1), which causes AIDS (acquired immune deficiency syndrome), possesses an essential gene, tat, whose product, acting through the long terminal repeat (LTR) sequences of HIV-1, activates viral genes and replication. (cshl.edu)
Chorioretinitis in a patients with acquired immunodeficiency syndrome (AIDS). (medscape.com)
however, up to 25% of culture-positive patients with advanced acquired immunodeficiency syndrome (AIDS) never develop anti-Bartonella antibodies. (clinicalcorrelations.org)
It can lead to the development of acquired immunodeficiency syndrome (AIDS). (northernwilds.com)
Human Immunodeficiency Virus (HIV) HIV (human immunodeficiency virus) infection left untreated causes AIDS (acquired immunodeficiency syndrome). (shrewdproductions.com)
Cryptosporidiosis has recently gained attention because of its occurrence in patients with acquired immunodeficiency syndrome (AIDS) [1]. (who.int)
Tenofovir is used in combination with other antiviral medications to treat human immunodeficiency virus (HIV) in patients with acquired immunodeficiency syndrome (AIDS). (globalpharmacyplus.com)
The human immunodeficiency virus (HIV) is a lentivirus (a subgroup of retrovirus) that causes the acquired immunodeficiency syndrome (AIDS), a condition in human in which progressive failure of the immune system. (hightopbio.com)
HIV stands for human immunodeficiency virus which can lead to AIDS, or acquired immunodeficiency syndrome. (bookrags.com)
Acquired Immunode Ficiency Syndrome (AIDS) is a disease of human immune system. (technobotz.com)
It is the famous human immunodeficiency virus (HIV)-AIDS virus. (verycoldscience.com)
The disease caused by HIV is called Acquired Immune Deficiency Syndrome, or AIDS. (verycoldscience.com)

FIV can be tolerated well by cats, but can eventually lead to debilitation of the immune system in its feline hosts by the infection and exhaustion of T-helper (CD4+) cells. (wikipedia.org)
On rare occasions infection is transmitted from an infected mother cat to her kittens, usually during passage through the birth canal or when the newborn kittens ingest infected milk. (thecatcornerinc.com)
En fonction de la souche utilisée, il est possible d'obtenir une infection aiguë, subaiguë ou chronique dont le suivi peut être réalisé par l'étude de la survie, l'examen histo-pathologique des lésions ou, de préférence, par le titrage parasitaire dans les tissus, par subinoculation à l'animal ou par culture cellulaire. (parasite-journal.org)
L'interaction entre infection virale et parasitaire est la règle chez la plupart des malades immunodéprimés et en particulier au cours du SIDA. (parasite-journal.org)
Des souris co-infec-tées par T. gondii et lerétro-virus LP-BM5, responsable du SIDA murin, ou des chats co-infectés par T. gondii et te "Feline Immunodeficiency Virus" (FIV) ont une sensibilité accrue à la toxoplasmose acquise mais la réactivation d'une infection chronique n'est pas constamment obtenue. (parasite-journal.org)
The infection produces a wide range of clinical syndromes in humans, land and sea mammals, and various bird species. (medscape.com)
Wolf, Cowan, and Paige (1937-1939) determined that these findings represented the syndrome of severe congenital T gondii infection. (medscape.com)
During a primary infection, the cat can excrete millions of oocysts daily for 1-3 weeks. (medscape.com)
Infection can occur by ingestion of oocysts following the handling of contaminated soil or cat litter or through the consumption of contaminated water or food sources (eg, unwashed garden vegetables). (medscape.com)
The main risk factors for B. henselae infection are contact with flea-infested cats and cat scratches, while those for B. quintana are lice infestation and homelessness. (clinicalcorrelations.org)
But what's most interesting is they said: 'Infection mediation by a spike protein variant whose cytoplasmic domain had been truncated and altered to include a fragment of the cytoplasmic tail of the Human Immunodeficiency Virus Type 1 envelope glycoprotein was, in both cases more efficient than the wild-type spike protein. (forbiddenknowledgetv.net)
The kit is suitable forclinical screening and diagnosis of Human Immunodeficiency Virus infection. (hightopbio.com)
An acquired defect of cellular immunity associated with infection by the human immunodeficiency virus (HIV), a CD4-positive T-lymphocyte count under 200 cells/microliter or less than 14% of total lymphocytes, and increased susceptibility to opportunistic infections and malignant neoplasms. (bvsalud.org)
While periodontal disease is seen in cats of all ages, it is generally considered to progress with age, although its extent and severity are impacted on by such factors as diet and co-morbid disease (especially kidney disease and infection with feline immunodeficiency virus and/or feline calicivirus). (biomedcentral.com)

Defecto adquirido de la inmunidad celular que ocurre en gatos infectados por el virus de la inmunodeficiencia felina (FIV) y en algunos gatos con virus de la leucemia felina (FeLV). (bvsalud.org)
Acquired defect of cellular immunity that occurs in cats infected with feline immunodeficiency virus ( FIV ) and in some cats infected with feline leukemia virus (FeLV). (bvsalud.org)
Nowadays, thanks to vaccination and simple hygiene measures, the number of cats infected by the FeLV virus has dramatically decreased. (animalpatient.com)
Moreover, the quantity of FeLV viruses necessary to infect a cat, the infective dose , is quite high. (animalpatient.com)
Thus, the risk for cats of being infected by the FeLV virus closely depends on their lifestyle. (animalpatient.com)
Lymphocyte T-Cell Immunomodulator (LTCI) is the first and only USDA-Approved treatment aid for cats infected with Feline Leukemia Virus (FeLV) and/or Feline Immunodeficiency Virus (FIV). (thecatcornerinc.com)
Results from clinical studies have shown LTCI to have positive benefits on the health of cats infected with FeLV and FIV. (thecatcornerinc.com)
The Cat Corner does not have the proper facilities to house FIV or FeLV (Leukemia) positive cats and because of this we cannot accept FIV or FeLV positive cats into our shelter. (thecatcornerinc.com)

The Feline Leukemia virus is a retrovirus. (animalpatient.com)

FIV was first isolated in 1986, by Niels C Pedersen and Janet K. Yamamoto at the UC Davis School of Veterinary Medicine in a colony of cats that had a high prevalence of opportunistic infections and degenerative conditions and was originally called Feline T-lymphotropic virus. (wikipedia.org)
A vigilant pet owner who treats secondary infections can allow an infected cat to live a reasonably long life. (wikipedia.org)
as a result, cats in households with stable social structures where housemates do not fight are at little risk for acquiring FIV infections. (thecatcornerinc.com)
With a high protein diet and aggressive treatment of secondary infections, an FIV-positive cat can lead a reasonably normal life span. (thecatcornerinc.com)
The largest threat to FIV-positive cats is secondary infections, such as bladder, skin, and upper respiratory infections. (thecatcornerinc.com)
These secondary infections should be treated promptly and aggressively in any cat, but especially with an FIV cat. (thecatcornerinc.com)
Multiple opportunistic infections can manifest simultaneously when immunosuppression is severe in patients infected with the human immunodeficiency virus. (bvsalud.org)
Human Immunodeficiency Virus (HIV) impacts a person's immune system and makes them less able to fight off infections and other diseases. (northernwilds.com)
Infections resulting from cat bites, in both feline and human patients [ 8 ], are typically polymicrobial with a preponderance of obligate anaerobes and facultative anaerobic bacteria, of which only some are cultivatable using routine laboratory methods. (biomedcentral.com)

Low levels of CD4+ and other affected immune system cells cause the cat to be susceptible to opportunistic diseases once the disease progresses to feline acquired immune deficiency syndrome (FAIDS). (wikipedia.org)
All of our cats and kittens are tested for such viruses and diseases prior to entering our shelter. (thecatcornerinc.com)
Outdoor cats have a greater chance of contact with parasites and infectious diseases. (petful.com)
While occasional vomiting is normal for many cats, vomiting is a symptom of many feline diseases. (petful.com)
Beyond the neonatal period, chorioretinitis can be diagnosed in diverse clinical conditions and can reflect newly acquired diseases or reactivation. (medscape.com)

Viral diversity and abundance are defining properties of human immunodeficiency virus (HIV)-1's biology and pathogenicity. (biomedcentral.com)

This may include herbal formulas, homeopathic remedies, and immune boosters like transfer factor for cats . (cat-lovers-only.com)
FIV compromises the immune system of cats by infecting many cell types, including CD4+ and CD8+ T lymphocytes , B lymphocytes , and macrophages . (wikipedia.org)

Many cats are affected by lower urinary tract disease, sometimes referred to as cystitis . (petful.com)

The search for the infectious agents responsible for cat-scratch disease, bacillary angiomatosis, and related syndromes has a long and often circuitous history. (cdc.gov)
The quest for the etiologic agent of cat-scratch disease (CSD) has frequently been described as a mystery ( 1 , 2 ). (cdc.gov)
Unusual manifestations of CSD, which occur in up to 14% of patients, include Perinaud's oculoglandular syndrome (6%), encephalopathy (2%), hepatic granulomas (0.3%), osteomyelitis (0.3%), and pulmonary disease (0.2%) ( 4 , 5 , 8 ). (cdc.gov)
Your cat will, however, carry the disease with her for life. (cat-lovers-only.com)
Some cats can have the disease for many years before it is diagnosed, or before any symptoms are present. (cat-lovers-only.com)
FIV+ cats can share water bowls, food bowls (for both wet and dry cat food), and use the same litter box with low danger of transmitting the disease. (wikipedia.org)
FIV is a cat-to-cat only disease and cannot be passed to humans, dogs, or other non-feline species. (thecatcornerinc.com)
One side is horrified that anyone would ever let their cats outside, given all the hazards (traffic, predators, disease, deeply disturbed cat-hating humanoids). (petful.com)
In 1 week alone, I saw cats vomiting from inflammatory GI disease, kidney disease, hyperthyroidism, constipation, eating a rodent, eating house plants and a few cases still undiagnosed. (petful.com)
BA is a disease that most frequently affects individuals infected with the human immunodeficiency virus (HIV) and typically presents with multiple cutaneous papules and nodules. (clinicalcorrelations.org)
Estos elementos reflejan los criterios de SIDA definidos por los CDC (Centers for Disease Control and Prevention) en 1993. (bvsalud.org)
Periodontal disease is highly prevalent amongst domestic cats, causing pain, gingival bleeding, reduced food intake, loss of teeth and possibly impacts on overall systemic health. (biomedcentral.com)
Diet has been suggested to play a role in the development of periodontal disease in cats. (biomedcentral.com)
There is a complete lack of information about how diet (composition and texture) affects the feline oral microbiome, the composition of which may influence oral health and the development of periodontal disease. (biomedcentral.com)
Indeed, some feline diets are specifically formulated to prevent and/or ameliorate the severity of feline periodontal disease. (biomedcentral.com)
The third disease condition of the feline oral cavity is referred to as feline chronic gingivostomatitis (FCGS). (biomedcentral.com)
The microbiome of the gingival cleft impacts additionally on common and important feline disease conditions outside the oral cavity. (biomedcentral.com)
however, immunocompromised immunocompromised A human or animal whose immunologic mechanism is deficient because of an immunodeficiency disorder or other disease or as the result of the administration of immunosuppressive drugs or radiation. (lecturio.com)

However, humans cannot be infected by FIV, nor can cats be infected by HIV. (wikipedia.org)

Whole genome characterization of feline-like G3P[8] reassortant rotavirus A strains bearing the DS-1-like backbone genes detected in Vietnam, 2016. (cdc.gov)

Toxoplasma gondii est un protozoaire parasite ubiquiste, responsable d'infections sévères, voire mortelles chez les sujets immunodé-primés et en cas de contamination congénitale. (parasite-journal.org)
A cat becomes infected with T gondii by eating contaminated raw meat, wild birds, or mice. (medscape.com)

Feline immunodeficiency virus ( FIV ) is a Lentivirus that affects cats worldwide, with 2.5% to 4.4% [1] [2] of felines being infected. (wikipedia.org)

FIV is transmitted primarily through deep bite wounds, where the virus present in the infected cat's saliva enters the body tissues of another cat. (wikipedia.org)
The chance that an FIV-infected cat will pass the virus to other cats within a household is low, unless there is fighting between cats, or wounds present that could allow entry of the virus from infected to non-infected cat. (wikipedia.org)
The American Association of Feline Practitioners (an organization in the United States), as well as many feral cat organizations, recommends against euthanizing FIV-positive cats, or even spending funds to test for the virus, as spaying or neutering cats seems to effectively control transmission (spayed/neutered cats are less likely to engage in territorial fights). (wikipedia.org)
In the 50s-70s, the feline leukemia virus was the cause of 70% of lymphoma, the main form of cancerous tumor in cats. (animalpatient.com)
However, the virus may still cause very serious disorders in cats and especially in kittens. (animalpatient.com)
The feline leukemia virus IS NOT very contagious because it can't survive for a long time outside cats' organism. (animalpatient.com)
The behavior of the feline leukemia Virus in the body is highly variable. (animalpatient.com)
In some cases, the feline leukemia virus induces lymphocytes proliferation and initiates cancerous tumors formation in many organs. (animalpatient.com)
It is estimated that in the United States, 2% of cats are infected with the FIV virus. (thecatcornerinc.com)
Finding a home or rescue to take an FIV (Feline Immunodeficiency Virus) cat can be difficult. (thecatcornerinc.com)
Múltiples infecciones oportunistas pueden manifestarse simultáneamente cuando la inmunosupresión es grave en pacientes infectados por el virus de la inmunodeficiencia humana. (bvsalud.org)
Kalau bengkak cik en akan tahu yang kucing tu ada virus atau bakteria. (nurfuzie.com)
Comparisons of human immunodeficiency virus type 1 envelope variants in blood and genital fluids near the time of male-to-female transmission. (cdc.gov)

FIV only affects members of the cat family. (cat-lovers-only.com)
FLU is a general term used to describe any condition that affects the feline lower urinary tract. (differencebetweenz.com)

Sporozoites become infectious 24 hours or more after the cat sheds the oocyst via feces. (medscape.com)

We are also available for free feline health and behavior consultation on most subjects during working hours. (snapcats.org)

The first step is easy: it consists of including in the program the core vaccines, the vaccines that all cats should receive whatever their exposure to pathogens or their lifestyle. (animalpatient.com)
You'll have to choose from the optional, non-core vaccines list those your cat really needs. (animalpatient.com)

It is generally parasitic in animals such as cats and dogs. (researchsquare.com)

The aforementioned therapy showed statistically significant differences in infected cats, with regards clinical parameters and increase of the CD4+ cells counts. (vin.com)

Could my cat be especially susceptible to one of these viruses or bacteria? (animalpatient.com)

[4] It has been suggested FIV originated in Africa and has since spread to feline species worldwide. (wikipedia.org)
FIV is known in other feline species, and in fact is endemic in some large wild cats, such as African lions . (wikipedia.org)
Malabsorptive syndromes have been studied in most detail in dogs, but basic diagnostic and therapeutic principles are relevant to other species. (msdvetmanual.com)
This deep sequencing revealed the feline oral microbiome to be diverse, containing 411 bacterial species from 14 phyla. (biomedcentral.com)

Did you know that dogs and cats donned masks during the Great Influenza ? (bookrags.com)

Low Stress - Stress is not good for anyone, especially an immunodeficient cat. (cat-lovers-only.com)

In fact, many cats can live apparently healthy, symptom free lives for many years. (cat-lovers-only.com)

Although hairballs are considered a cause of vomiting in the cat, a normal cat develops hairballs and passes them without excessive vomiting. (petful.com)

Kidney failure is also frequently seen in cats with FIV. (thecatcornerinc.com)
The most common reasons of death for cats are cancer and kidney failure, with dogs being more dependant on size, age, and breed. (learnsomethinginteresting.com)

We believe, if given a few more days or weeks or months, an older or special needs or feral cat can find the home that they deserve. (snapcats.org)

Here is a list of Virginia shelters, rescues and sanctuaries that take FIV cats. (thecatcornerinc.com)
Drop off and pick up SNAP Cats from local venues (vets, mobile adoptions, events, etc.), or longer distance transfers to/from other shelters, rescues and sanctuaries. (snapcats.org)

Between 25% and 60% of patients report a primary cutaneous inoculation lesion (0.5- to 1-cm papule or pustule) at the site of a cat scratch or bite ( 5 , 7 ). (cdc.gov)
Additionally, an investigation was carried out on patients' pets, within the context of One Health, and serum samples collected from cats and dogs were reactive by indirect immunofluorescence assay. (bvsalud.org)

This is why contamination most often occurs by direct contact from one cat to another. (animalpatient.com)
The sexual cycle occurs only in cats, the definitive host. (medscape.com)

Pay attention to signs that your cat needs immediate veterinary attention. (petful.com)

Cats are the primary reservoir hosts for several zoonotic Bartonella spp. (bvsalud.org)

FLU can be painful and even life-threatening for cats, so it is important to seek veterinary care if you think your cat may be affected. (differencebetweenz.com)

Cats may also be infected when they share the same feeding dish or use the same litter box. (animalpatient.com)
If cats are mildly affected, they exhibit occasional straining to urinate in the litter box or they stop using the box. (petful.com)

A cat vomiting frequently, even if the cat appears healthy, has an underlying condition. (petful.com)

La enfermedad ocurre en visones de cualquier tipo de color, pero es particularmente susceptible el visón homocigoto recesivo para el gen aleutiano que codifica el color claro del pelaje. (bvsalud.org)

As a foster family you'll provide in-home care to SNAP Cats recovering from injuries/surgeries, cats in need of socializing (in a family environment outside of our campus), and possibly bottle feeding kittens who've lost their mother. (snapcats.org)

Its mission was to design guidelines on vaccination in cats and dogs. (animalpatient.com)
Pet ownership has quadrupled since the mid 1960's, making more homes now have cats and dogs than there are homes which have children. (learnsomethinginteresting.com)

Although there are palliative medications to perhaps make a vomiting cat feel better, don't take the Band-Aid approach if your cat continues to vomit. (petful.com)

A Case of Acquired Immunodeficiency Syndrome With Cerebral Sparganosis and Review of the Literature. (researchsquare.com)
In the worst case, the cat cannot pass urine (urinary blockage), which is an extreme medical emergency. (petful.com)

In this work, a 594 bp fragment (wild-type template) of the highly conserved FIV gag gene was amplificated by primers FIV-771-f (AGAACCTGGTGATATACCAGAGAC) and R2-r (TCTGCTTGTTGTTCTTGAGTT) from blood samples of a naturally FIV-infected cat. (vin.com)

That means, as much as possible, catering to your cat and trying to keep her daily routine stable. (cat-lovers-only.com)

Amongst this higher diversity, cats on dry-food diets had a higher abundance of Porphyromonas spp. (biomedcentral.com)

The implication here is that you should keep your cat indoors in order to protect her from getting to the rodents, and the fleas. (cat-lovers-only.com)
The other side regards keeping cat indoors as akin to life imprisonment. (petful.com)

Fleas can carry parasites that can harm your cat, so flea control is important. (cat-lovers-only.com)
Flea control for cats involves keeping rats and mice away as well, as they can carry fleas. (cat-lovers-only.com)

Anatomy16

Organisms31

Diseases71

Chemicals and Drugs61

Analytical, Diagnostic and Therapeutic Techniques and Equipment30

Psychiatry and Psychology8

Phenomena and Processes35

Anthropology, Education, Sociology and Social Phenomena2

Information Science7

Named Groups2

Health Care15

Geographicals7

Differential cell tropism of feline immunodeficiency virus molecular clones in vivo. (1/233)

Feline immunodeficiency virus subtype C is prevalent in northern part of Taiwan. (2/233)

Suppression of feline immunodeficiency virus replication in vitro by a soluble factor secreted by CD8+ T lymphocytes. (3/233)

Progressive expansion of an L-selectin-negative CD8 cell with anti-feline immunodeficiency virus (FIV) suppressor function in the circulation of FIV-infected cats. (4/233)

T cells overexpressing interferon-gamma and interleukin-10 are found in both the thymus and secondary lymphoid tissues of feline immunodeficiency virus-infected cats. (5/233)

In vivo infection of ramified microglia from adult cat central nervous system by feline immunodeficiency virus. (6/233)

8-Difluoromethoxy-4-quinolone derivatives as anti-feline immunodeficiency virus (FIV) agents: important structural features for inhibitory activity of FIV replication. (7/233)

Effects of multiple acute morphine exposures on feline immunodeficiency virus disease progression. (8/233)

Acquired Immunodeficiency Syndrome

Immunodeficiency Virus, Feline

Murine Acquired Immunodeficiency Syndrome

Syndrome

Feline Acquired Immunodeficiency Syndrome

HIV-1

Leukemia Virus, Feline

HIV Infections

Cats

Simian immunodeficiency virus

HIV

AIDS-Related Opportunistic Infections

Cat Diseases

Simian Acquired Immunodeficiency Syndrome

AIDS-Related Complex

Immunologic Deficiency Syndromes

Calicivirus, Feline

Coronavirus, Feline

Homosexuality

Severe Combined Immunodeficiency

HIV Seropositivity

Zidovudine

Molecular Sequence Data

Anti-HIV Agents

Feline Panleukopenia

Virus Replication

Sarcoma Viruses, Feline

CD4 Lymphocyte Count

Common Variable Immunodeficiency

Pneumonia, Pneumocystis

Feline Infectious Peritonitis

HIV Antibodies

Lymphoma, AIDS-Related

tat Gene Products, Human Immunodeficiency Virus

Feline panleukopenia virus

HIV Antigens

Antiretroviral Therapy, Highly Active

HIV-2

Gene Products, gag

RNA, Viral

Deltaretrovirus

Lentivirus Infections

HIV Envelope Protein gp120

DNA, Viral

Retroviridae Infections

Cell Line

Sarcoma, Kaposi

Viral Load

Base Sequence

Macaca mulatta

Leukemia, Feline

HIV Core Protein p24

Cytomegalovirus Retinitis

Opportunistic Infections

Amino Acid Sequence

Antigens, CD4

CD4-Positive T-Lymphocytes

Down Syndrome

Metabolic Syndrome X

Reverse Transcriptase Inhibitors

T-Lymphocytes

Retroviridae Proteins

Gene Products, env

Antibodies, Viral

Toxoplasmosis, Cerebral

Polymerase Chain Reaction

Mutation

HIV Reverse Transcriptase

Proviruses

Antiviral Agents

RNA-Directed DNA Polymerase

nef Gene Products, Human Immunodeficiency Virus

Lymphatic Diseases

HIV Seronegativity

AIDS Serodiagnosis

Didanosine

Genes, env

gag Gene Products, Human Immunodeficiency Virus

Fatal Outcome

Substance Abuse, Intravenous