Enzymes that catalyze the synthesis of FATTY ACIDS from acetyl-CoA and malonyl-CoA derivatives.
Animal form of fatty acid synthase which is encoded by a single gene and consists of seven catalytic domains and is functional as a homodimer. It is overexpressed in some NEOPLASMS and is a target in humans of some ANTINEOPLASTIC AGENTS and some ANTI-OBESITY AGENTS.
Organic, monobasic acids derived from hydrocarbons by the equivalent of oxidation of a methyl group to an alcohol, aldehyde, and then acid. Fatty acids are saturated and unsaturated (FATTY ACIDS, UNSATURATED). (Grant & Hackh's Chemical Dictionary, 5th ed)
A gram-positive organism found in dairy products, fresh and salt water, marine organisms, insects, and decaying organic matter.
Consists of a polypeptide chain and 4'-phosphopantetheine linked to a serine residue by a phosphodiester bond. Acyl groups are bound as thiol esters to the pantothenyl group. Acyl carrier protein is involved in every step of fatty acid synthesis by the cytoplasmic system.
An enzyme of long-chain fatty acid synthesis, that adds a two-carbon unit from malonyl-(acyl carrier protein) to another molecule of fatty acyl-(acyl carrier protein), giving a beta-ketoacyl-(acyl carrier protein) with the release of carbon dioxide. EC 2.3.1.41.
Large enzyme complexes composed of a number of component enzymes that are found in STREPTOMYCES which biosynthesize MACROLIDES and other polyketides.
Enzymes from the transferase class that catalyze the transfer of acyl groups from donor to acceptor, forming either esters or amides. (From Enzyme Nomenclature 1992) EC 2.3.
Systems of enzymes which function sequentially by catalyzing consecutive reactions linked by common metabolic intermediates. They may involve simply a transfer of water molecules or hydrogen atoms and may be associated with large supramolecular structures such as MITOCHONDRIA or RIBOSOMES.
A flavoprotein enzyme that catalyzes the formation of acetolactate from 2 moles of PYRUVATE in the biosynthesis of VALINE and the formation of acetohydroxybutyrate from pyruvate and alpha-ketobutyrate in the biosynthesis of ISOLEUCINE. This enzyme was formerly listed as EC 4.1.3.18.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
FATTY ACIDS in which the carbon chain contains one or more double or triple carbon-carbon bonds.
A group of fatty acids, often of marine origin, which have the first unsaturated bond in the third position from the omega carbon. These fatty acids are believed to reduce serum triglycerides, prevent insulin resistance, improve lipid profile, prolong bleeding times, reduce platelet counts, and decrease platelet adhesiveness.
Enzymes that catalyze the cleavage of a carbon-carbon bond of a 3-hydroxy acid. (Dorland, 28th ed) EC 4.1.3.
FATTY ACIDS found in the plasma that are complexed with SERUM ALBUMIN for transport. These fatty acids are not in glycerol ester form.
A family of enzymes that catalyze the stereoselective, regioselective, or chemoselective syn-dehydrogenation reactions. They function by a mechanism that is linked directly to reduction of molecular OXYGEN.
Long chain organic acid molecules that must be obtained from the diet. Examples are LINOLEIC ACIDS and LINOLENIC ACIDS.
FATTY ACIDS which have the first unsaturated bond in the sixth position from the omega carbon. A typical American diet tends to contain substantially more omega-6 than OMEGA-3 FATTY ACIDS.
Fatty acids which are unsaturated in only one position.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Lipid infiltration of the hepatic parenchymal cells resulting in a yellow-colored liver. The abnormal lipid accumulation is usually in the form of TRIGLYCERIDES, either as a single large droplet or multiple small droplets. Fatty liver is caused by an imbalance in the metabolism of FATTY ACIDS.
Short-chain fatty acids of up to six carbon atoms in length. They are the major end products of microbial fermentation in the ruminant digestive tract and have also been implicated in the causation of neurological diseases in humans.
An unsaturated fatty acid that is the most widely distributed and abundant fatty acid in nature. It is used commercially in the preparation of oleates and lotions, and as a pharmaceutical solvent. (Stedman, 26th ed)
A group of fatty acids that contain 18 carbon atoms and a double bond at the omega 9 carbon.
Lipids containing one or more phosphate groups, particularly those derived from either glycerol (phosphoglycerides see GLYCEROPHOSPHOLIPIDS) or sphingosine (SPHINGOLIPIDS). They are polar lipids that are of great importance for the structure and function of cell membranes and are the most abundant of membrane lipids, although not stored in large amounts in the system.
Fractionation of a vaporized sample as a consequence of partition between a mobile gaseous phase and a stationary phase held in a column. Two types are gas-solid chromatography, where the fixed phase is a solid, and gas-liquid, in which the stationary phase is a nonvolatile liquid supported on an inert solid matrix.
A broad category of membrane transport proteins that specifically transport FREE FATTY ACIDS across cellular membranes. They play an important role in LIPID METABOLISM in CELLS that utilize free fatty acids as an energy source.
A group of 16-carbon fatty acids that contain no double bonds.
UNSATURATED FATTY ACIDS that contain at least one double bond in the trans configuration, which results in a greater bond angle than the cis configuration. This results in a more extended fatty acid chain similar to SATURATED FATTY ACIDS, with closer packing and reduced fluidity. HYDROGENATION of unsaturated fatty acids increases the trans content.
A common saturated fatty acid found in fats and waxes including olive oil, palm oil, and body lipids.
Fats present in food, especially in animal products such as meat, meat products, butter, ghee. They are present in lower amounts in nuts, seeds, and avocados.
A group of compounds that are derivatives of octadecanoic acid which is one of the most abundant fatty acids found in animal lipids. (Stedman, 25th ed)
Physiological processes in biosynthesis (anabolism) and degradation (catabolism) of LIPIDS.
Important polyunsaturated fatty acid found in fish oils. It serves as the precursor for the prostaglandin-3 and thromboxane-3 families. A diet rich in eicosapentaenoic acid lowers serum lipid concentration, reduces incidence of cardiovascular disorders, prevents platelet aggregation, and inhibits arachidonic acid conversion into the thromboxane-2 and prostaglandin-2 families.
A generic term for fats and lipoids, the alcohol-ether-soluble constituents of protoplasm, which are insoluble in water. They comprise the fats, fatty oils, essential oils, waxes, phospholipids, glycolipids, sulfolipids, aminolipids, chromolipids (lipochromes), and fatty acids. (Grant & Hackh's Chemical Dictionary, 5th ed)
A somewhat heterogeneous class of enzymes that catalyze the transfer of alkyl or related groups (excluding methyl groups). EC 2.5.
Oils high in unsaturated fats extracted from the bodies of fish or fish parts, especially the LIVER. Those from the liver are usually high in VITAMIN A. The oils are used as DIETARY SUPPLEMENTS. They are also used in soaps and detergents and as protective coatings.
A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.
Salts and esters of the 16-carbon saturated monocarboxylic acid--palmitic acid.
Intracellular proteins that reversibly bind hydrophobic ligands including: saturated and unsaturated FATTY ACIDS; EICOSANOIDS; and RETINOIDS. They are considered a highly conserved and ubiquitously expressed family of proteins that may play a role in the metabolism of LIPIDS.
C22-unsaturated fatty acids found predominantly in FISH OILS.
A doubly unsaturated fatty acid, occurring widely in plant glycosides. It is an essential fatty acid in mammalian nutrition and is used in the biosynthesis of prostaglandins and cell membranes. (From Stedman, 26th ed)
S-Acyl coenzyme A. Fatty acid coenzyme A derivatives that are involved in the biosynthesis and oxidation of fatty acids as well as in ceramide formation.
The relationships of groups of organisms as reflected by their genetic makeup.
An epoxydodecadienamide isolated from several species, including ACREMONIUM, Acrocylindrum, and Helicoceras. It inhibits the biosynthesis of several lipids by interfering with enzyme function.
An enzyme that converts UDP glucosamine into chitin and UDP. EC 2.4.1.16.
Chromatography on thin layers of adsorbents rather than in columns. The adsorbent can be alumina, silica gel, silicates, charcoals, or cellulose. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Enzymes that catalyze the formation of acyl-CoA derivatives. EC 6.2.1.
Eighteen-carbon essential fatty acids that contain two double bonds.
Unsaturated fats or oils used in foods or as a food.
A coenzyme A derivative which plays a key role in the fatty acid synthesis in the cytoplasmic and microsomal systems.
A microanalytical technique combining mass spectrometry and gas chromatography for the qualitative as well as quantitative determinations of compounds.
The rate dynamics in chemical or physical systems.
Specialized connective tissue composed of fat cells (ADIPOCYTES). It is the site of stored FATS, usually in the form of TRIGLYCERIDES. In mammals, there are two types of adipose tissue, the WHITE FAT and the BROWN FAT. Their relative distributions vary in different species with most adipose tissue being white.
Usually high-molecular-weight, straight-chain primary alcohols, but can also range from as few as 4 carbons, derived from natural fats and oils, including lauryl, stearyl, oleyl, and linoleyl alcohols. They are used in pharmaceuticals, cosmetics, detergents, plastics, and lube oils and in textile manufacture. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 5th ed)
An unsaturated, essential fatty acid. It is found in animal and human fat as well as in the liver, brain, and glandular organs, and is a constituent of animal phosphatides. It is formed by the synthesis from dietary linoleic acid and is a precursor in the biosynthesis of prostaglandins, thromboxanes, and leukotrienes.
Derivatives of ACETIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain the carboxymethane structure.
12-Carbon saturated monocarboxylic acids.
Ligases that catalyze the joining of adjacent AMINO ACIDS by the formation of carbon-nitrogen bonds between their carboxylic acid groups and amine groups.
Regular course of eating and drinking adopted by a person or animal.
Oils derived from plants or plant products.
A fatty acid that is found in plants and involved in the formation of prostaglandins.
Derivatives of caprylic acid. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain a carboxy terminated eight carbon aliphatic structure.
A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement.
DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.
The addition of an organic acid radical into a molecule.
The principal sterol of all higher animals, distributed in body tissues, especially the brain and spinal cord, and in animal fats and oils.
Enzymes of the isomerase class that catalyze reactions in which a group can be regarded as eliminated from one part of a molecule, leaving a double bond, while remaining covalently attached to the molecule. (From Enzyme Nomenclature, 1992) EC 5.5.
Lipids, predominantly phospholipids, cholesterol and small amounts of glycolipids found in membranes including cellular and intracellular membranes. These lipids may be arranged in bilayers in the membranes with integral proteins between the layers and peripheral proteins attached to the outside. Membrane lipids are required for active transport, several enzymatic activities and membrane formation.
An enzyme that catalyzes reversibly the conversion of palmitoyl-CoA to palmitoylcarnitine in the inner mitochondrial membrane. EC 2.3.1.21.
A 51-amino acid pancreatic hormone that plays a major role in the regulation of glucose metabolism, directly by suppressing endogenous glucose production (GLYCOGENOLYSIS; GLUCONEOGENESIS) and indirectly by suppressing GLUCAGON secretion and LIPOLYSIS. Native insulin is a globular protein comprised of a zinc-coordinated hexamer. Each insulin monomer containing two chains, A (21 residues) and B (30 residues), linked by two disulfide bonds. Insulin is used as a drug to control insulin-dependent diabetes mellitus (DIABETES MELLITUS, TYPE 1).
The process of converting an acid into an alkyl or aryl derivative. Most frequently the process consists of the reaction of an acid with an alcohol in the presence of a trace of mineral acid as catalyst or the reaction of an acyl chloride with an alcohol. Esterification can also be accomplished by enzymatic processes.
A CALCIUM-dependent, constitutively-expressed form of nitric oxide synthase found primarily in NERVE TISSUE.
An enzyme that catalyzes the formation of oleoyl-CoA, A, and water from stearoyl-CoA, AH2, and oxygen where AH2 is an unspecified hydrogen donor.
The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.
Eighteen-carbon essential fatty acids that contain three double bonds.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Enzyme complexes that catalyze the formation of PROSTAGLANDINS from the appropriate unsaturated FATTY ACIDS, molecular OXYGEN, and a reduced acceptor.
The glyceryl esters of a fatty acid, or of a mixture of fatty acids. They are generally odorless, colorless, and tasteless if pure, but they may be flavored according to origin. Fats are insoluble in water, soluble in most organic solvents. They occur in animal and vegetable tissue and are generally obtained by boiling or by extraction under pressure. They are important in the diet (DIETARY FATS) as a source of energy. (Grant & Hackh's Chemical Dictionary, 5th ed)
Oil from soybean or soybean plant.
Compounds that interfere with FATTY ACID SYNTHASE resulting in a reduction of FATTY ACIDS. This is a target mechanism in humans of some ANTINEOPLASTIC AGENTS and ANTI-OBESITY AGENTS and of some ANTI-INFECTIVE AGENTS which interfere with CELL WALL and CELL MEMBRANE formation.
The metabolic process of breaking down LIPIDS to release FREE FATTY ACIDS, the major oxidative fuel for the body. Lipolysis may involve dietary lipids in the DIGESTIVE TRACT, circulating lipids in the BLOOD, and stored lipids in the ADIPOSE TISSUE or the LIVER. A number of enzymes are involved in such lipid hydrolysis, such as LIPASE and LIPOPROTEIN LIPASE from various tissues.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.
An NADPH-dependent enzyme that catalyzes the conversion of L-ARGININE and OXYGEN to produce CITRULLINE and NITRIC OXIDE.
A trihydroxy sugar alcohol that is an intermediate in carbohydrate and lipid metabolism. It is used as a solvent, emollient, pharmaceutical agent, and sweetening agent.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
An omega-6 fatty acid produced in the body as the delta 6-desaturase metabolite of linoleic acid. It is converted to dihomo-gamma-linolenic acid, a biosynthetic precursor of monoenoic prostaglandins such as PGE1. (From Merck Index, 11th ed)
GLYCEROL esterified with FATTY ACIDS.
Stable carbon atoms that have the same atomic number as the element carbon, but differ in atomic weight. C-13 is a stable carbon isotope.

The synthesis and hydrolysis of long-chain fatty acyl-coenzyme A thioesters by soluble and microsomal fractions from the brain of the developing rat. (1/1123)

1. The specific activities of long-chain fatty acid-CoA ligase (EC6.2.1.3) and of long-chain fatty acyl-CoA hydrolase (EC3.1.2.2) were measured in soluble and microsomal fractions from rat brain. 2. In the presence of either palmitic acid or stearic acid, the specific activity of the ligase increased during development; the specific activity of this enzyme with arachidic acid or behenic acid was considerably lower. 3. The specific activities of palmitoyl-CoA hydrolase and of stearoyl-CoA hydrolase in the microsomal fraction decreased markedly (75%) between 6 and 20 days after birth; by contrast, the corresponding specific activities in the soluble fraction showed no decline. 4. Stearoyl-CoA hydrolase in the microsomal fraction is inhibited (99%) by bovine serum albumin; this is in contrast with the microsomal fatty acid-chain-elongation system, which is stimulated 3.9-fold by albumin. Inhibition of stearoyl-CoA hydrolase does not stimulate stearoyl-CoA chain elongation. Therefore it does not appear likely that the decline in the specific activity of hydrolase during myelogenesis is responsible for the increased rate of fatty acid chain elongation. 5. It is suggested that the decline in specific activity of the microsomal hydrolase and to a lesser extent the increase in the specific activity of the ligase is directly related to the increased demand for long-chain acyl-CoA esters during myelogenesis as substrates in the biosynthesis of myelin lipids.  (+info)

Transcriptional regulation of fatty acid synthase gene by insulin/glucose, polyunsaturated fatty acid and leptin in hepatocytes and adipocytes in normal and genetically obese rats. (2/1123)

Transcriptional regulation of the fatty acid synthase (FAS) gene by insulin/glucose, polyunsaturated fatty acids and leptin was investigated in hepatocytes and adipocytes of Wistar fatty rats and their lean littermates. The sequence spanning nucleotides -57 to -35 of FAS gene, which is responsive to insulin/glucose stimulation [Fukuda, H., Iritani, N. & Noguchi, T. (1997) FEBS Lett. 406, 243-248], was linked to a reporter gene containing a heterologous promoter and transfected into rat hepatocytes or adipocytes. The activity of the reporter, chloramphenicol acetyltransferase, in the presence of glucose alone was similar in the primary cultured cells from the lean and obese rats. In the presence of insulin/glucose, however, chloramphenicol acetyltransferase activity was markedly increased in hepatocytes of lean rats, but was not significantly increased in those of obese rats. The stimulation by insulin/glucose was reduced in arachidonic acid-treated cells of lean rats. Similarly, the stimulation by insulin/glucose was reduced in leptin-treated cells and in cells from lean rats containing an expression vector encoding leptin. However, neither polyunsaturated fatty acids nor leptin-treated cells from obese rats responded to insulin-stimulation. The same effects were observed at endogenous FAS mRNA and enzyme levels. Similar results were seen in adipocytes, although the stimulation and suppression were much smaller than in hepatocytes. The insulin-binding capacities of the receptors of liver and adipose tissue were reduced in the presence of leptin or polyunsaturated fatty acids. Leptin and polyunsaturated fatty acids appeared to suppress the insulin stimulation of FAS transcription by reducing the insulin-binding capacities of receptors. Leptin converged on the insulin/glucose response element of FAS gene and suppressed the transcription.  (+info)

FIRE3 in the promoter of the rat fatty acid synthase (FAS) gene binds the ubiquitous transcription factors CBF and USF but does not mediate an insulin response in a rat hepatoma cell line. (3/1123)

Several putative insulin-responsive elements (IRE) in the fatty acid synthase (FAS) promoter have been identified and shown to be functional in adipocytes and hepatocytes. Here we report on the insulin-responsiveness in the rat hepatoma cell line H4IIE of four cis-elements in the FAS promoter: the FAS insulin-responsive elements, FIRE2 and FIRE3; the inverted CCAAT element, ICE; and the insulin/glucose-binding element, designated hepatic FIRE element, hFIRE, originally identified in rat hepatocytes. Using electrophoretic mobility shift assay (EMSA) competition experiments together with supershifts and in vitro transcription/translation we show that FIRE3 (-68/-58) binds not only the upstream stimulatory factors USF-1/USF-2 but also the CCAAT-binding factor CBF, also known as the nuclear factor Y, NF-Y. The putative IRE FIRE2, which shows sequence similarity to FIRE3, is located between -267 and -249. Gel retardation experiments indicate that USF-1 and USF-2 also bind to this element, which contains an imperfect E-box motif. Using the same approach we have shown that hFIRE binds the stimulatory proteins Sp1 and Sp3 in addition to CBF. Transient transfection experiments using FAS promoter constructs deleted for FIRE2 and FIRE3 demonstrate that neither of these elements mediates the insulin response of the FAS promoter in the rat hepatoma cell line H4IIE, however, ICE at -103/-87 is responsible for mediating the effect of the insulin antagonist cAMP. The hFIRE element located at -57/-34, in spite of its role in the glucose/insulin response in primary rat hepatocytes, is apparently not involved in the insulin regulation of the rat FAS promoter in H4IIE cells. The fact that the topology of the promoters of the FAS genes in rat, human, goose and chicken is conserved regarding CBF-binding sites and USF-binding sites implies an important role for these ubiquitously expressed transcription factors in the regulation of the FAS promoter.  (+info)

Dibromopropanone cross-linking of the phosphopantetheine and active-site cysteine thiols of the animal fatty acid synthase can occur both inter- and intrasubunit. Reevaluation of the side-by-side, antiparallel subunit model. (4/1123)

The objective of this study was to test a new model for the homodimeric animal FAS which implies that the condensation reaction can be catalyzed by the amino-terminal beta-ketoacyl synthase domain in cooperation with the penultimate carboxyl-terminal acyl carrier protein domain of either subunit. Treatment of animal fatty acid synthase dimers with dibromopropanone generates three new molecular species with decreased electrophoretic mobilities; none of these species are formed by fatty acid synthase mutant dimers lacking either the active-site cysteine of the beta-ketoacyl synthase domain (C161A) or the phosphopantetheine thiol of the acyl carrier protein domain (S2151A). A double affinity-labeling strategy was used to isolate dimers that carried one or both mutations on one or both subunits; the heterodimers were treated with dibromopropanone and analyzed by a combination of sodium dodecyl sulfate/polyacrylamide gel electrophoresis, Western blotting, gel filtration, and matrix-assisted laser desorption mass spectrometry. Thus the two slowest moving of these species, which accounted for 45 and 15% of the total, were identified as doubly and singly cross-linked dimers, respectively, whereas the fastest moving species, which accounted for 35% of the total, was identified as originating from internally cross-linked subunits. These results show that the two polypeptides of the fatty acid synthase are oriented such that head-to-tail contacts are formed both between and within subunits, and provide the first structural evidence in support of the new model.  (+info)

Induction of lipogenesis during differentiation in a "preadipocyte" cell line. (5/1123)

3T3-L1 fibroblasts differentiate in culture into cells having adipocyte character. This transition is accompanied by a 40- to 50-fold rise in the incorporation of [14C]acetate into triglyceride. The increase in lipogenic rate is exactly parallel to a coordinate rise in the activities of the key enzymes of the fatty acid biosynthetic pathway (ATP-citrate lyase, acetyl-CoA carboxylase, and fatty acid synthetase). Immunological studies indicate that the elevated acetyl-CoA carboxylase activity is the product of an increased cellular enzyme level.  (+info)

Arachidonic acid and PGE2 regulation of hepatic lipogenic gene expression. (6/1123)

N-6 polyunsaturated fatty acids (PUFA) suppress hepatic and adipocyte de novo lipogenesis by inhibiting the transcription of genes encoding key lipogenic proteins. In cultured 3T3-L1 adipocytes, arachidonic acid (20:4,n-6) suppression of lipogenic gene expression requires cyclooxygenase (COX) activity. In this study, we found no evidence to support a role for COX-1 or -2 in the 20:4,n-6 inhibition of hepatocyte lipogenic gene expression. In contrast to L1 preadipocytes, adipocytes and rat liver, RT-PCR and Western analyses did not detect COX-1 or COX-2 expression in cultured primary hepatocytes. Moreover, the COX inhibitor, flurbiprofen, did not affect the 20:4,n-6 regulation of lipogenic gene expression in primary hepatocytes. Despite the absence of COX-1 and -2 expression in primary hepatocytes, prostaglandins (PGE2 and PGF2alpha) suppressed fatty acid synthase, l-pyruvate kinase, and the S14 protein mRNA, while having no effect on acyl-CoA oxidase or CYP4A2 mRNA. Using PGE2 receptor agonist, the PGE2 effect on lipogenic gene expression was linked to EP3 receptors. PGE2 inhibited S14CAT activity in transfected primary hepatocytes and targeted the S14 PUFA-response region located -220 to -80 bp upstream from the transcription start site. Taken together, these studies show that COX-1 and COX-2 do not contribute to the n-6 PUFA suppression of hepatocyte lipogenic gene expression. However, cyclooxygenase products from non-parenchymal cells can act on parenchymal cells through a paracrine process and mimic the effects of n-6 PUFA on lipogenic gene expression.  (+info)

Novel form of lipolysis induced by leptin. (7/1123)

Hyperleptinemia causes disappearance of body fat without a rise in free fatty acids (FFA) or ketones, suggesting that leptin can deplete adipocytes of fat without releasing FFA. To test this, we measured FFA and glycerol released from adipocytes obtained from normal lean Zucker diabetic fatty rats (+/+) and incubated for 0, 3, 6, or 24 h in either 20 ng/ml recombinant leptin or 100 nM norepinephrine (NE). Whereas NE increased both FFA and glycerol release from adipocytes of +/+ rats, leptin increased glycerol release in +/+ adipocytes without a parallel increase in FFA release. In adipocytes of obese Zucker diabetic fatty rats (fa/fa) with defective leptin receptors, NE increased both FFA and glycerol release, but leptin had no effect on either. Leptin significantly lowered the mRNA of leptin and fatty acid synthase of adipocytes (FAS) (p < 0.05), and up-regulated the mRNA of peroxisome proliferator-activated receptor (PPAR)-alpha, carnitine palmitoyl transferase-1, (CPT-1), and acyl CoA oxidase (ACO) (p < 0.05). NE (100 nM) also lowered leptin mRNA (p < 0.05) but did not affect FAS, PPARalpha, ACO, or CPT-1 expression. We conclude that in normal adipocytes leptin directly decreases FAS expression, increases PPARalpha and the enzymes of FFA oxidation, and stimulates a novel form of lipolysis in which glycerol is released without a proportional release of FFA.  (+info)

Polyunsaturated fatty acids inhibit fatty acid synthase and spot-14-protein gene expression in cultured rat hepatocytes by a peroxidative mechanism. (8/1123)

In vivo, polyunsaturated fatty acids (PUFA) inhibit the expression of hepatic genes related to the lipogenic process such as fatty acid synthase and spot-14-protein (S14) genes. In vitro studies have suggested that this was a direct transcriptional effect of PUFA. In hepatocytes, the inhibition of the lipogenic rate by PUFA is not specific, but is linked to a cytotoxic effect due to peroxidative mechanisms. We have investigated whether peroxidation could also explain the inhibitory effect of PUFA on gene expression. Rat hepatocytes were cultured for 24 h with mono-unsaturated or PUFA. PUFA inhibited the expression of fatty acid synthase and S14 genes, and this inhibition was directly related to the number of unsaturations. However, the beta-actin and albumin mRNA concentrations were also affected by the most unsaturated fatty acids, suggesting a non-specific effect of PUFA on gene expression. Measurement of lactate dehydrogenase released into the medium indicated a cytotoxicity of PUFA. This was associated with their peroxidation as evaluated by the presence of thiobarbituric acid-reactive substances in the culture medium. The addition of high concentrations of antioxidants abolished lipid peroxidation and lactate dehydrogenase leakage and completely reversed the inhibitory effect of PUFA on gene expression. This suggests (i) that the results obtained previously in cultured hepatocytes in the presence of low concentrations of antioxidants must be interpretated cautiously and (ii) that in vivo, the inhibitory effect of PUFA on lipogenesis-related genes could be indirect through hormonal or metabolic changes or that their effect on gene expression is somehow linked to peroxidative mechanisms.  (+info)

One in seven men over the age of 60 will be diagnosed with prostate cancer. Elucidation of early cellular changes that may predict progression to prostate cancer and the identification of factors that may inhibit or reverse these cellular changes would be of great clinical significance. Alteration of the fatty acid synthase FAS pathway is an early cellular change that has recently come under investigation. Overexpression of the lipogenic enzyme FAS has been noted in several tumor and pre-cancerous tissue types, including prostatic intraepithelial neoplasia PIN and prostate cancer and has been suggested as an independent predictor of disease stage. Additionally, inhibition of FAS has been demonstrated to induce apoptosis and reduce cell proliferation in cancer cells. Fatty acid synthase expression in cancer and normal cells is regulated by the transcription factor sterol regulatory element binding protein 1c SREBP-1. The up-regulation of SREBP-1 in tumor cells results in increased FAS expression and
Human fatty acid synthase (FAS) is uniquely expressed at high levels in many tumor types. Pharmacological inhibition of FAS therefore represents an important therapeutic opportunity. The drug Orlistat, which has been approved by the US Food and Drug Administration, inhibits FAS, induces tumor cell-s …
BACKGROUND: Overexpression of fatty acid synthase (FAS), the cytosolic enzyme responsible for the conversion of dietary carbohydrates to fatty acids, has been reported in several human malignancies and pointed as a potential prognostic marker for some tumors. This study investigated whether FAS immunohistochemical expression is correlated with the clinicopathological characteristics of oral squamous cell carcinoma (OSCC). MATERIALS AND METHODS: The clinical features of 102 patients with OSCC of the tongue treated in a single institution were obtained from the medical records and all histopathological diagnoses were reviewed. The expression of FAS was determined by the standard immunoperoxidase technique in formalin-fixed and paraffin-embedded specimens and correlated with the clinicopathological characteristics of the tumors. RESULTS: Eighty-one cases (79.41%) were positive for FAS. Microscopic characteristics such as histological grade (P , 0.05), lymphatic permeation (P , 0.001), perineural ...
TY - JOUR. T1 - Control of fatty acid synthase promoter activity by insulin-like growth factor-1 in 3T3-L1 fibroblasts. AU - Moustaid-Moussa, Naima. AU - Misra, S.. AU - Sakamoto, K.. PY - 1994. Y1 - 1994. M3 - Article. SP - 575. EP - 578. JO - Default journal. JF - Default journal. ER - ...
Daidzein Modulations of Apolipoprotein B and Fatty Acid Synthase mRNA Expression in Chick Liver Vary Depending on Dietary Protein Levels - Daidzein;Low Protein Diet;Chick;Fatty Liver;Apolipoprotein B mRNA;Fatty Acid Synthase mRNA;
Singh, K.; Graf, B.; Linden, A.; Sautner, V.; Urlaub, H.; Tittmann, K.; Stark, H.; Chari, A.: Discovery of a regulatory subunit of the yeast fatty acid synthase. Cell 180 (6), pp. 1130 - 1143.e20 (2020 ...
Singh, K.; Graf, B.; Linden, A.; Sautner, V.; Urlaub, H.; Tittmann, K.; Stark, H.; Chari, A.: Discovery of a regulatory subunit of the yeast fatty acid synthase. Cell 180 (6), pp. 1130 - 1143.e20 (2020 ...
HER2 transactivation by the HER3 ligand heregulin (HRG) promotes an endocrine-resistant phenotype in the estrogen receptor-positive (ER+) luminal-B subtype of breast cancer. The underlying biological mechanisms that link them are, however, incompletely understood. Here, we evaluated the putative role of the lipogenic enzyme fatty acid synthase (FASN) as a major cause of HRG-driven endocrine resistance in ER+/HER2-negative breast cancer cells. MCF-7 cells engineered to stably overexpress HRG (MCF-7/HRG), an in vitro model of tamoxifen/fulvestrant-resistant luminal B-like breast cancer, showed a pronounced up-regulation of FASN gene/FASN protein expression. Autocrine HRG up-regulated FASN expression via HER2 transactivation and downstream activation of PI-3K/AKT and MAPK-ERK1/2 signaling pathways. The HRG-driven FASN-overexpressing phenotype was fully prevented in MCF-7 cells expressing a structural deletion mutant of HRG that is sequestered in a cellular compartment and lacks the ability to promote
Disruption from the gut microbiota by high-fat diet (HFD) has been implicated in the development of obesity. microbiota in the DIO group had already moved back to the CHO space, and continued to progress along the same age trajectory and completely converged with CHO after 10 weeks. Redundancy analysis identified 77 key phylotypes responding to the dietary perturbations. HFD-induced shifts of these phylotypes all reverted to CHO levels over time. Some of these phylotypes exhibited robust age-related changes despite the dramatic abundance variations in response to dietary alternations. These findings suggest that HFD-induced structural changes of the gut microbiota can be attributed to reversible elevation or diminution of specific phylotypes, indicating the significant structural resilience of the gut microbiota of adult mice to dietary perturbations. may be associated with obesity and body weight loss upon dietary intervention (Ley species and an increase in the prevalence of a single class of ...
Background Lipid oxidation of membrane phospholipids is accompanied by the formation of oxidation-specific epitopes (OSE). antibodies as a result of Siglec-G deficiency inhibits diet-induced hepatic inflammation and atherosclerosis in mice [9]. However, the relationship between plasma antibody levels targeting OSE and hepatic inflammation during NAFLD has not been investigated Lurasidone in humans so far. Here, we aimed to determine an association between plasma antibodies targeting OSE and NAFLD in humans. For this purpose, IgM and IgG antibody titers against different model epitopes of oxidized lipids were measured in the plasma of patients with NAFLD and compared to those in control subjects. Liver biopsies from patients with biopsy-proven NASH were examined for the presence of MDA epitopes by immunohistochemistry. Additionally, to test the specificity of our findings for NAFLD, antibody levels were determined in two cohorts consisting of patients with hepatitis C and inflammatory bowel ...
fatty acid synthase activity, cellular response to sucrose stimulus, cuticle hydrocarbon biosynthetic process, methyl-branched fatty acid biosynthetic process
Author: Gajewski, J. et al.; Genre: Journal Article; Published in Print: 2017-04; Open Access; Title: Engineering fatty acid synthases for directed polyketide production.
Mice with defects in their ability to make the enzyme fatty acid synthase in their intestines develop inflammation, and diabetes. In a new study, Washington University researchers made the surprising discovery that diabetes may get its start in the intestines, rather than in the pancreas or the liver. The culprit is that inflammation related to not having fatty acid synthase in gut tissues.
R. Wagner, G. Stübiger, D. Veigel, M. Wuczkowski, P. Lanzerstorfer, J. Weghuber, E. Karteris, K. Nowikovsky, N. Wilfinger, C. Singer, R. Colomer, B. Benhamu, M. Lopez-Rodrguez, P. Valent, T. Grunt - Multi-level suppression of receptor-PI3K-mTORC1 by fatty acid synthase inhibitors is crucial for their efficacy against ovarian cancer cells - Oncotarget, Vol. 8, No. 7, ...
Rabbit polyclonal Fatty Acid Synthase antibody validated for WB, IP, IHC, ICC/IF and tested in Human and Mouse. Immunogen corresponding to -
Definition of D-aminolevulinic acid synthase with photos and pictures, translations, sample usage, and additional links for more information.
1GQ9: Catalytic Mechanism of Cmp:2-Keto-3-Deoxy-Manno-Octonic Acid Synthetase as Derived from Complexes with Reaction Educt and Product.
1H7E: The Structure of Cmp:2-Keto-3-Deoxy-Manno-Octonic Acid Synthetase and of its Complexes with Substrates and Substrate Analogs
D. GRAHAME HARDIE, ALUN D. McCARTHY, MARTIN BRADDOCK; Mammalian fatty acid synthase: a chimeric protein which has evolved by gene fusion. Biochem Soc Trans 1 June 1986; 14 (3): 568-570. doi: https://doi.org/10.1042/bst0140568. Download citation file:. ...
Excel brewers yeast fatty acids & garlic supplement - Eight In One Products K778 Excel Brewers Yeast with Omega 3.... We provides discount Herbal Yeastrol. At lasts a safe, homeopathic remedy is available that eases multiple symptoms of yeast infection.
The activities of two lipogenic enzymes, acetyl-CoA carboxylase and fatty acid synthase, were determined in two transplantable mammary adenocarcinomas (13762 and R3230AC) carried by non-pregnant, pregnant and lactating rats, and in mammary tissue of control animals (non-tumour-carrying) of comparable physiological states. During mammary-gland differentiation of control or tumour-carrying animals, the activities of acetyl-CoA carboxylase and fatty acid synthase in the lactating gland increased by about 40-50-fold over the values found in non-pregnant animals. On the other hand, in tumours carried by lactating dams there were only modest increases (1.5-2-fold) in acetyl-CoA carboxylase and fatty acid synthase compared with the neoplasms carried by non-pregnant animals. On the basis of the Km values for different substrates and immunodiffusion and immunotitration data, the fatty acid synthase of neoplastic tissues appeared to be indistinguishable from the control mammary-gland enzyme. However, a ...
We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. ...
The assignment of Cys163 as the active site cysteine is based on several lines of evidence. In a sequence comparison of 42 condensing enzymes of fatty acid and polyketide synthesis, Siggaard‐Andersen (1993) identified one conserved cysteine residue, which in KAS II corresponds to Cys163. In addition, this cysteine residue superimposes with the active site cysteine in thiolase I, Cys125. Covalent modification studies of β‐ketoacyl synthases (Kauppinen et al., 1988; Funabashi et al., 1989) and thiolases (Izbicka‐Dimitrijevio et al., 1982) as well as mutagenesis of this residue in the β‐ketoacyl synthase domain of rat fatty acid synthase (Joshi et al., 1997) and thiolase from Zooglea ramigera (Thompson et al., 1989) support the proposed role of this cysteine as the nucleophile in the catalytic reaction.. At the entrance of the active site pocket, a bulky conserved residue, Phe400, is located. This residue points into the active site pocket and in part blocks access to the nucleophilic ...
The lipogenic enzyme fatty acid synthase (FAS) is up-regulated in a wide variety of cancers, and is considered a potential metabolic oncogene by virtue of its ability to enhance tumor cell survival. Inhibition of tumor FAS causes both cell cycle arrest and apoptosis, indicating FAS is a promising target for cancer treatment. Here, we used gene expression profiling to conduct a global study of the cellular processes affected by siRNA mediated knockdown of FAS in MDA-MB-435 mammary carcinoma cells. The study identified 169 up-regulated genes (≥ 1.5 fold) and 110 down-regulated genes (≤ 0.67 fold) in response to knockdown of FAS. These genes regulate several aspects of tumor function, including metabolism, cell survival/proliferation, DNA replication/transcription, and protein degradation. Quantitative pathway analysis using Gene Set Enrichment Analysis software further revealed that the most pronounced effect of FAS knockdown was down-regulation in pathways that regulate lipid metabolism, glycolysis,
Resistance to the action of insulin affects fatty acid delivery to the liver, fatty acid synthesis and oxidation within the liver, and triglyceride export from the liver. To understand the metabolic consequences of hepatic fatty acid synthesis, partitioning, oxidation, and net liver fat content in the fasted and postprandial states, we used stable-isotope tracer methodologies to study healthy men and women with varying degrees of insulin resistance before and after consumption of a mixed meal. Subjects were classified as being normoinsulinemic (NI) (fasting plasma insulin |11.2 mU/L, n = 18) or hyperinsulinemic (HI) (fasting plasma insulin |11.2 mU/L, n = 19). Liver fat content was similar between HI and NI individuals, despite HI subjects having marginally more visceral fat. However, de novo lipogenesis was higher and fatty acid oxidation was lower in HI individuals compared with NI subjects. These data suggest that metabolic pathways promoting fat accumulation are enhanced in HI but, paradoxically,
The effect of a temperature rise from 28 to 37 degrees C on the biosynthesis of 5-inosine acid (IMP) by the mutant Brevibacterium ammoniagenes 225-5 was studied. The inhibitory effect of increased temperature on the IMP biosynthesis was dependent on the adenine concentration. The study of IMP synthesis on the media with different adenine concentrations showed that adenine controlled not only the synthesis of purines de novo but also, to a larger extent, so-called salvage IMP synthesis from hypoxanthine. The effect of increased temperature was identical to that of excessive adenine. Temperature rise as well as increase in adenine concentration intensified metabolic processes (increased the level of glucose consumption and the rate of nucleic acid synthesis) and restored in part cell permeability. This was indicated by the release of protein and ribose-5-phosphate into the culture fluid, and by the change in cell morphology. An optimal adenine concentration may be altered either way in response ...
Retinoic acid (RA), at 1-10 microM, inhibited adipose conversion of 3T3-F442A cells as determined by the activities of lipogenic enzymes, glycerophosphate dehydrogenase (GPD) and malic enzyme. This inhibition was reversible by RA removal, but the increase in lipogenic enzyme activities was considerably delayed in a dose-dependent manner. The onset of the two lipogenic enzyme activities could be regulated somewhat independently, suggesting that expression of the two enzymes is subject to noncoordinated regulation. The RA-inhibited cells had a more flattened and elongated shape, suggesting cytoskeletal changes. Cytochalasin B (CB) did not prevent RA inhibition and did not promote adipose conversion in cultures supplemented with nonadipogenic medium. Reversion of inhibition was accelerated if cells were cultured for 3 days with adipogenic medium containing CB. The drug promoted an early increase in lipogenic enzyme activities. On the other hand, cells cultured on fibronectin-coated dishes, a condition that
Yet another study that points the finger straight at fat as a key factor in one of the most common causes of inpatient hospital mortality - sepsis. Sepsis is currently considered to be a condition of infectious (bacterial) etiology, driven by endotoxin. However, in light of the new findings it may be more appropriate to consider sepsis a metabolic/energetic disease. Despite all the advances in modern medicine, sepsis remains a condition with mortality in the 20%-30% range. Over the last several years a number of studies were published indicating a simple combination of thiamine, vitamin C (and sometimes cortisol) is remarkably effective in decreasing mortality from sepsis. However, the mechanism of action of this approach remains unknown.. Well, as the study below demonstrates, overactivation of the enzyme fatty acid synthase (FAS) likely plays a major role in the sepsis pathology. While the study does not mention it, overactive FAS means reduced glucose oxidation as a result of the Randle ...
FABP7 - FABP7 (GFP-tagged) - Human fatty acid binding protein 7, brain (FABP7) available for purchase from OriGene - Your Gene Company.
Fatty acid synthetase catalyzes the formation of long-chain fatty acids from acetyl-CoA, malonyl-CoA and NADPH. This multifunctional protein has 7 catalytic activities and an acyl carrier protein.
Abstract: There is a critical need for mapping early metabolic changes in schizophrenia to capture failures in regulation of biochemical pathways and networks. This information could provide valuable insights about disease mechanisms, trajectory of disease progression, and diagnostic biomarkers. We used a lipidomics platform to measure individual lipid species in 20 drug-na?ve patients with a first episode of schizophrenia (FE group), 20 patients with chronic schizophrenia that had not adhered to prescribed medications (RE group), and 29 race-matched control subjects without schizophrenia. Lipid metabolic profiles were evaluated and compared between study groups and within groups before and after treatment with atypical antipsychotics, risperidone and aripiprazole. Finally, we mapped lipid profiles to n3 and n6 fatty acid synthesis pathways to elucidate which enzymes might be affected by disease and treatment. Compared to controls, the FE group showed significant down-regulation of several n3 ...
Like i said, i dont know anyone who is tattooed with flawless work, but i suppose i could ask to see if the staff has a tattoo done by the artist. Indices of mammary fatty acid synthesis and desaturase activity, however, suggest that the mammary gland was not simply a passive recipient of more lipogenic dating sites for married seniors substrate. Enjoy the unlimited full version of jewel match 2 reloaded! You must pay the dartford crossing charge by midnight the day after you cross. May not be your where to meet singles in la free search boat if you like to live a little closer to the edge. Philips is producing men dating after divorce the film with bradley cooper, one of the lead actors of phillips the hangover trilogy. For 32 years, gary served with honor and distinction, receiving a special commendation for bravery in. This completely free senior online dating site fabric is ideal for designing your own jacket or draped dress - with a cotton jersey underneath. Of womens unnatural, ...
We report the identification and sequence from Escherichia coli and Salmonella enterica strains of the cld gene, encoding the chain-length determinant (CLD) which confers a modal distribution of chain length on the O-antigen component of lipopolysaccharide (LPS). The distribution of chain lengths in …
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Complete information for FASN gene (Protein Coding), Fatty Acid Synthase, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
Contact Us. Tel:732-484-9848. Fax:888-484-5008. Email:[email protected]. Add:1 Deer Park Dr, Suite Q,. Monmouth Junction, NJ 08852, USA. ...
Radiopaque microspheres were visible with multiple radiologic imaging modalities during transarterial embolization in the VX2 rabbit liver tumor model and increased conspicuity of tumor location and its feeding arteries. microsphere group), 70C150-m radiopaque microspheres in contrast material (radiopaque microsphere plus contrast material group), and 70C150-m radiolucent microspheres in contrast 498-02-2 supplier material (nonradiopaque microsphere plus …Read More. ...
Shop Inactive tetrahydrocannabinolic acid synthase ELISA Kit, Recombinant Protein and Inactive tetrahydrocannabinolic acid synthase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
There are three groups of fatty acids, so what makes the de novo group so important? The data from Quebec clearly demonstrates that herds with more de novo fatty acids also have higher fat and protein levels in their milk. This relationship has also been demonstrated elsewhere in the world.
Cyclopropane fatty acid synthase genes and polypeptides are described. Plants are transformed with such genes to produce such polypeptides.
Cyclopropane fatty acid synthase genes and polypeptides are described. Plants are transformed with such genes to produce such polypeptides.
Ketoacyl synthases (KSs) catalyze the condensation reaction of acyl-CoA or acyl-acyl ACP with malonyl-CoA to form 3-ketoacyl-CoA or with malonyl-ACP to form 3-ketoacyl-ACP. This reaction is a key step in the fatty acid synthesis cycle, as the resulting acyl chain is two carbon atoms longer than before. KSs exist as individual enzymes, as they do in type II fatty acid synthesis and type II polyketide synthesis, or as domains in large multidomain enzymes, such as type I fatty acid synthases (FASs) and polyketide synthases (PKSs). KSs are divided into five families: KS1, KS2, KS3, KS4, and KS5. Fatty acid synthase (FAS) is the enzyme system involved in de novo fatty acid synthesis. FAS is an iterative multienzyme consisting of several component enzymes, one of which is ketoacyl synthase. There are two types of FASs: type I and type II. Type I FASs are highly integrated multidomain enzymes. They contain discrete functional domains responsible for specific catalytic activities of the reaction ...
TY - JOUR. T1 - Resveratrol downregulates acetyl-CoA carboxylase α and fatty acid synthase by AMPK-mediated downregulation of mTOR in breast cancer cells. AU - Sahng, Wook Park. AU - Yoon, Sarah. AU - Moon, Jong Seok. AU - Park, Byeong Woo. AU - Kim, Kyung Sup. PY - 2008/11/21. Y1 - 2008/11/21. N2 - Overexpression of HER2 in breast cancer cells is considered to induce the expression of acetyl-CoA carboxylase α (ACACA) and fatty acid synthase (FASN) through activation of mammalian target of rapamycin (mTOR) signaling pathway. Resveratrol, a red wine polyphenol, has been shown to induce apoptosis in several cancers by interfering in several signaling pathways. Present study elucidated the mechanism by which resveratrol downregulates ACACA and FASN in breast cancer cells. Resveratrol activated AMP-activated protein kinase (AMPK) and downregulated mTOR in BT-474 cells. These effects of resveratrol were mimicked by AICAR, an AMPK activator, and exogenously expressed constitutively active AMPK, ...
Author Summary Vaccinia virus, the prototypic poxvirus, is closely related to variola virus, the etiological agent of smallpox. A full understanding of the poxviral life cycle is imperative for the development of novel antiviral therapies, the design of new vaccines, and the effective and safe use of these viruses as oncolytic agents. Metabolomic studies have shed light on the novel mechanisms used by viruses to replicate efficiently within their hosts. de novo fatty acid biosynthesis has been shown to be of relevance for numerous viral infections as well as for the development of cancer. Here we describe an important role for de novo fatty acid biosynthesis during vaccinia infection. Ongoing synthesis of palmitate is needed to fuel the production of energy within mitochondria. The biochemical events of viral DNA replication and protein synthesis are minimally affected by inhibition of this pathway, but viral assembly is disrupted more dramatically. Further exploration of this pathway will provide
Fatty acid biosynthesis and lipogenic enzyme activities in subcutaneous adipose tissue of feedlot steers fed supplementary palm oil or soybean oil. J Anim
Multiple myeloma is a haematological malignancy characterized by the clonal proliferation of plasma cells. It has been proposed that targeting cancer cell metabolism would provide a new selective anticancer therapeutic strategy. In this work, we tested the hypothesis that inhibition of β-oxidation and de novo fatty acid synthesis would reduce cell proliferation in human myeloma cells. We evaluated the effect of etomoxir and orlistat on fatty acid metabolism, glucose metabolism, cell cycle distribution, proliferation, cell death and expression of G1/S phase regulatory proteins in myeloma cells. Etomoxir and orlistat inhibited β-oxidation and de novo fatty acid synthesis respectively in myeloma cells, without altering significantly glucose metabolism. These effects were associated with reduced cell viability and cell cycle arrest in G0/G1. Specifically, etomoxir and orlistat reduced by 40-70% myeloma cells proliferation. The combination of etomoxir and orlistat resulted in an additive inhibitory effect
LB-237 Many human cancers including breast cancer exhibit increased de novo fatty acid synthesis with overexpression of fatty acid synthase (FAS). Unlike normal cells and tissues that preferentially utilize circulating fatty acids derived from the diet, cancers synthesize fatty acids endogenously for membrane biosynthesis to sustain cell proliferation. The transcription factor Sp1 is highly expressed in a variety of cancers. Sp1 regulates gene expression by interacting with GC-rich promoter sequences. Genes that regulate cell cycle progression often contain such promoter sequences, and Sp1 is critical for their expression. The promoter region of FAS also has Sp1 binding sites, and Sp1 together with sterol regulatory element-binding protein-1 (SREBP-1) has been shown to regulate FAS expression in hepatocytes. Here, we hypothesize that Sp1 coordinately regulates FAS and cell cycle progression in estrogen-responsive MCF-7 breast cancer cells. Based on previous studies, to up-regulate Sp1 activity ...
Colorectal cancer cells set up a crosstalk with the tumor microenvironment such that implantation and development of the tumor is generally favoured. inflammation and in particular the IL-6 pro-inflammatory pathway that induces pro-apoptotic genes and HIF1α-elicited VEGF secretion. miRNAs also play a significant role in controlling metabolic genes such as the upregulation of the fatty acid synthase gene with the concomitant down-regulation of the carnitine palmitoyl transferase 1 gene. Within the metastatic environment the Discoidin domain receptor-2 (DDR2) gene encodes a tyrosine kinase receptor for fibrillar collagen that contributes to colorectal Mouse monoclonal to Glucose-6-phosphate isomerase cancer metastasis by increasing myofibroblasts neoangiogenic vessels and proliferating cancer cells. Ongoing identification of gene signatures differentiating between primary tumor cells and their metastatic counterparts promises a wealth of new targets to be exploited for further therapeutic use ...
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fatty Acid Binding Protein 1, Liver (FABP1) in samples from serum, plasma or other biological fluids ...
Barry, Cornelius S., M. Immaculada Llop-Tous, and Donald Grierson. The Regulation of 1-Aminocyclopropane-1-Carboxylic Acid Synthase Gene Expression during the Transition from System-1 to System-2 Ethylene Synthesis in Tomato. Plant Physiology 123.3 (2000): 979-986. Web. 20 Nov. 2019. ...
Intersections of distinct biological pathways in cells allow for nodes of metabolic regulation. This work describes the discovery of the intersection of two pathways in yeast mitochondria: RNA processing and fatty acid synthesis and attachment. Analysis of the components of the pathways is presented here along with a model illustrating the connection as a potential mode of regulation of mitochondrial gene expression. A genome-wide screen of respiratory-deficient Saccharomyces cerevisiae deletion strains for defects in mitochondrial RNA processing revealed that two novel genes affect processing of mitochondrial tRNAs by RNase P. One gene encodes Htd2, an enzyme in the type II mitochondrial fatty acid synthesis pathway (FAS II). The other gene is described here as encoding Lip3, an enzyme involved in the synthesis and attachment of the co-factor lipoic acid, which is synthesized from a product of the FAS II pathway. RPM1 is the mitochondrial-encoded RNA subunit of mitochondrial RNase P. The ...
In animals, when there is an oversupply of dietary carbohydrate, the excess carbohydrate is converted to triglycerides. This involves the synthesis of fatty acids from acetyl-CoA and the esterification of fatty acids in the production of triglycerides, a process called lipogenesis.[87] Fatty acids are made by fatty acid synthases that polymerize and then reduce acetyl-CoA units. The acyl chains in the fatty acids are extended by a cycle of reactions that add the acetyl group, reduce it to an alcohol, dehydrate it to an alkene group and then reduce it again to an alkane group. The enzymes of fatty acid biosynthesis are divided into two groups, in animals and fungi all these fatty acid synthase reactions are carried out by a single multifunctional protein,[88] while in plant plastids and bacteria separate enzymes perform each step in the pathway.[89][90] The fatty acids may be subsequently converted to triglycerides that are packaged in lipoproteins and secreted from the liver. The synthesis of ...
Pihlajamäki J, Boes T, Kim EY, Dearie F, Kim BW, Schroeder J, Mun E, Nasser I, Park PJ, Bianco AC, Goldfine AB, Patti ME. Thyroid hormone-related regulation of gene expression in human fatty liver. J Clin Endocrinol Metab. 2009 Sep; 94(9):3521-9 ...
Desoxyrhaponticin (DC, DES), a stilbene glycoside from Rheum tanguticum Maxim. ex Balf. (rhubarb) which is a traditional Chinese nutritional food, is a fatty acid synthase (FAS/FASN) inhibitor. Desoxyrhaponticin (DC, DES) is also a competitive inhibitor of glucose uptake with IC50 of 148.3 μM and 30.9 μM in rabbit intestinal membrane vesicles and in rat everted gut sleeves, respectively. Desoxyrhaponticin has apoptotic effect on human cancer cells.. ...
Learn about milk fat as the esters of fatty acids of alcohol or glycerol. Lean about a fatty acid as a long chain of carboxylic acid, and numbered fatty acids.
In the human body, each cell is like a factory. It has pipelines of nutrients coming in, machines to process the raw materials, and pipelines going out with products the cell needs, such as energy. Most cells in the body divide or grow at a leisurely rate. They are perfectly happy with the nutrition provided by daily meals. But cancer cells are different. They need more pipelines to fuel their abnormal growth. And its this progression - the metabolic change before the development of cancer - that has intrigued Dr. Lupu for two decades.. Specifically, how cancer uses fat.. Fat used by the body is in the form of fatty acids. Fatty acids are long chains of carbon atoms that store energy. Theyre built by enzymes, starting with fatty acid synthase. Fatty acid synthase is like a three-dimensional assembly line, connecting carbon after carbon into fatty acids. The more often this process takes place, the more energy and materials the cell has for growth and division.. For cancer cells, its the feast ...
Furthermore to key jobs in embryonic neurogenesis and myelinogenesis, -aminobutyric acidity (GABA) acts as the principal inhibitory mammalian neurotransmitter. amounts in the mind and liver, anticipated using a defect in mitophagy, and morphologically unusual mitochondria. Administration of rapamycin to these mice decreased mTOR Trametinib activity, decreased the raised mitochondrial amounts, and normalized aberrant antioxidant amounts. These outcomes confirm a book function for GABA in cell signaling and high light potential pathomechanisms and remedies in various individual pathologies, including SSADH insufficiency, and also other diseases seen as a elevated degrees of GABA. gene which encodes the SSADH enzyme, resulting in increased degrees of GABA and its own metabolite, GHB, in sufferers (Gibson and mutant from the GABA shunt pathway, partly inhibited pexophagy set alongside the WT, as proven by the hold off in degradation from the peroxisomal matrix proteins, Pot1, on the 12-h period ...
6156 bp ATGGACGCTTACTCCACAAGACCATTAACCCTATCTCACGGTTCTTTAGAGCACGTGCTT CTGGTACCAACCGCTTCATTTTTCATTGCTTCGCAATTACAAGAACAATTTAATAAAATT TTGCCCGAACCCACTGAAGGGTTTGCTGCAGATGACGAGCCTACCACACCTGCTGAACTA GTGGGGAAATTCCTTGGCTACGTATCTTCTCTAGTCGAACCTTCCAAGGTCGGTCAATTC GATCAGGTCTTGAACCTTTGCTTAACAGAATTTGAAAACTGTTATTTAGAAGGCAATGAC ATTCACGCCTTGGCTGCTAAACTATTACAGGAAAACGACACAACTTTAGTGAAGACTAAA GAACTAATTAAAAATTATATTACCGCCAGAATAATGGCTAAGAGACCATTTGACAAAAAA TCCAACTCTGCTCTTTTTAGGGCCGTCGGCGAGGGTAACGCACAATTGGTAGCCATTTTC GGTGGTCAAGGTAACACCGACGACTACTTTGAAGAATTGCGTGATCTATATCAAACTTAT CATGTCTTAGTGGGAGATTTAATCAAGTTCTTCGCTGAAACTTTAAGTGAACTGATTAGA ACTACTTTAGATGCTGAAAAAGTCTTTACTCAAGGTTTAAACATATTGGAATGGTTGGAG AACCCTTCAAATACCCCAGACAAGGACTATTTACTTTCCATTCCAATTTCATGCCCCTTA ATTGGTGTCATTCAATTGGCTCACTACGTAGTTACTGCCAAGCTTTTGGGTTTCACTCCA GGTGAGTTAAGATCTTACTTAAAAGGTGCTACAGGTCACTCTCAAGGTTTGGTTACTGCT GTCGCCATAGCTGAGACGGATTCCTGGGAATCCTTCTTCGTCTCCGTAAGAAAAGCAATT ACTGTATTATTCTTCATCGGTGTTCGTTGTTACGAAGCATACCCAAACACTTCCCTACCA ...
Shop Sialic acid synthase ELISA Kit, Recombinant Protein and Sialic acid synthase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Fatty acid synthesis occurs similarly to Beta-oxidation - acetyl groups are added to a growing chain. This notes explains the fatty acid synthesis process..
Recombinant Human FABP4 is produced by our E.coli expression system and the target gene encoding Cys2-Ala132 is expressed with a 6His tag at the N-terminus. Bon Opus Cat. #C136
View Notes - 44106a_Q8 from BICH 441 at Texas A&M. reactants and products and the name of the enzyme. 3. (6 pts). A and B represent intermediates in fatty acid synthesis catalyzed by fatty acid
COVER The enzymes that catalyze fatty acid formation are large protein complexes with multiple active sites. The architecture of the mammalian multienzyme (catalytic domains in various colors) is quite different from that of the fungal fatty acid synthase (in gray). Nonetheless, they catalyze the same conserved reaction pathway. See pages 1258 and 1263. Image: S. Jenni and T. Maier ...
The interplay of general and specialized transcription factors in the retinoic acid stimulation of the fatty acid synthase (FAS) promoter: United Kingdom
Piyathilake CJ, Frost AR, Manne U, Bell WC, Weiss H, Heimburger DC, Grizzle WE. The Expression of Fatty Acid Synthase (FASE) is an Early Event in the Development and Progression of Squamous Cell Carcinoma of the Lung. Human Pathol 2000;31:1068-73 ...
Fatty acids are an important energy source, for they yield over twice as much energy as an equal mass of carbohydrate or protein. In humans, the primary dietary source of fatty acids is triacylglycerols. This lecture will describe the metabolism of fatty acids. The two main components of fatty acid metabolism are β oxidation and fatty acid synthesis. Upon completion of this lecture, you will understand that the fatty-acid breakdown reactions of β oxidation result in the formation of reduced cofactors and acetyl-CoA molecules, which can be further catabolized to release free energy. ...
Yn aml mae gan enynnau lawer o gyfystyron. Mae hyn oherwydd eu bod yn aml yn cael eu darganfod gan nifer o bobl mewn cyd-destunau gwahanol heb wybod mair un genynnau oeddyn nhw. Hefyd mae gan wahanol gymunedau gwyddonol safonau gwahanol ar gyfer enwi genynnau. Dyma restr o gyfystyron ar gyfer y genyn FASN. ...
Tian, Wei-Xi (2006). "Inhibition of Fatty Acid Synthase by Polyphenols". Current Medicinal Chemistry. 13 (8): 967-977. doi: ... morin was found to be a weak inhibitor of fatty acid synthase with an IC50 of 2.33 μM. Morin was also found to inhibit amyloid ...
CEF scientists used detailed structural knowledge of the fatty acid synthase (FAS) megacomplex to engineer FAS for the ... "Engineering fungal de novo fatty acid synthesis for short chain fatty acid production". Nat Commun. 8: 14650. Bibcode:2017NatCo ... "Engineering fatty acid synthases for directed polyketide production". Nat Chem Biol. 13 (4): 363-365. doi:10.1038/nchembio.2314 ... chain-length control of the FAS of Saccharomyces cerevisiae to create a baker's yeast able to produce short-chain fatty acids. ...
Progestogen-induced fatty acid synthase (also a potential therapeutic target. Its early overexpression may partly explain the ... metab., 60, (1985), p. 692-697 D. Chalbos et al., « Fatty acid synthetase and its mRNA are induced by progestin in breast ... chem., 262, (1987), p. 9923-9926 D. Chalbos et al., « Expression of the progestin-induced fatty acid synthetase in benign ...
... s acylated derivatives have a fatty acid synthase inhibitory activity. It has the A03AX12 code in the A03AX Other ... "Fatty acid synthase inhibitory activity of acylphloroglucinols isolated from Dryopteris crassirhizoma". Bioorganic & Medicinal ... phloroglucinol & phloretic acid gives 30% yield of phloretin. Phloroglucinol is also generally found in the flavonoid ring A ... Phloroglucinol is a weak triprotic acid. The first two pKa's are 8.5 and 8.9. As an enol, phloroglucinol in principle exists in ...
... of fatty acid synthases, ACPs of polyketide synthases, the peptidyl carrier proteins (PCP), as well as aryl carrier proteins ( ... "Acyl-carrier protein-phosphopantetheinyltransferase partnerships in fungal fatty acid synthases". Chembiochem : a European ... The acyl carrier protein (ACP) is a cofactor of both fatty acid and polyketide biosynthesis machinery. It is one of the most ... The ACPs are small negatively charged α-helical bundle proteins with a high degree of structural and amino acid similarity. The ...
"Hematopoietic prostaglandin D synthase". Prostaglandins Leukot. Essent. Fatty Acids. 69 (2-3): 163-7. doi:10.1016/S0952-3278(03 ... 2000). "Prostaglandin D synthase gene is involved in the regulation of non-rapid eye movement sleep". Proc. Natl. Acad. Sci. U. ... Prostaglandin-D synthase is a sigma class glutathione-S-transferase family member. The enzyme catalyzes the conversion of PGH2 ... Mahmud I, Ueda N, Yamaguchi H, Yamashita R, Yamamoto S, Kanaoka Y, Urade Y, Hayaishi O (Dec 1997). "Prostaglandin D synthase in ...
Allene oxide synthase (CYP74A; EC 4.2.1.92), fatty acid hydroperoxide lyase (CYP74B), prostacyclin synthase (CYP8; EC 5.3.99.4 ... Fatty acid β-hydroxylase P450BSβ from Bacillus subtilis (CYP152A1) and fatty acid α-hydroxylase P450SPα from Pseudomonas ... Substrates for all these enzymes are fatty acid derivatives containing partially reduced dioxygen (either hydroperoxy or ... catalyse the hydroxylation reaction of long-chain fatty acids using hydrogen peroxide (H2O2) as an oxidant. These enzymes do ...
With Strong Inhibitory Activity on Fatty Acid Synthase and Antioxidant Activity". Chemistry & Biodiversity. 7 (12): 2931-2940. ...
Flavin R, Peluso S, Nguyen PL, Loda M (April 2010). "Fatty acid synthase as a potential therapeutic target in cancer". Future ... Pandey PR, Liu W, Xing F, Fukuda K, Watabe K (May 2012). "Anti-cancer drugs targeting fatty acid synthase (FAS)". Recent ... Orlistat is also a potent thioesterase inhibitor and therefore inhibits fatty acid synthase (FAS). Since FAS is essential for ... by inhibiting fatty acid synthase. Pancreatic lipase inhibitor was originally discovered and isolated from fermented broth of ...
Fatty acid biosynthesis is carried out by the ubiquitous Fatty Acid Synthase. Fatty acid synthase pathways are divided into two ... fatty acid biosynthesis yields the most energy dense products. As a result, microbial fatty acid derivatives are emerging as a ... In Type I, Fatty Acid Synthase (found in humans and other mammals) is a single large polypeptide composed of several distinct ... Yu X, Liu T, Zhu F, Khosla C (Nov 2011). "In vitro reconstitution and steady-state analysis of the fatty acid synthase from ...
Fatty acid synthase from yeast at 0.59 nanometer resolution. This huge enzyme complex is responsible for building the long ... "Direct structural insight into the substrate-shuttling mechanism of yeast fatty acid synthase by electron cryomicroscopy". ... chain fatty acids essential for cellular life. A 0.33 nanometer reconstruction of Aquareovirus. These viruses infect fish and ... The reconstruction has high enough resolution to have amino acid side chain densities easily visible. EM Data Bank (EM Data ...
... hydroxy fatty acids as substrates. The two classes of PHA synthases differ in the specific use of hydroxy fatty acids of short ... PHB copolymers, which may include other fatty acids such as beta-hydroxyvaleric acid, may be elastic. Structure of poly-3- ... contained hydroxy fatty acids). They are UV stable, in contrast to other bioplastics from polymers such as polylactic acid, ... The resulting PHA is of the two types: Poly (HA SCL) from hydroxy fatty acids with short chain lengths including three to five ...
"Production of Polyunsaturated Fatty Acids by Polyketide Synthases in Both Prokaryotes and Eukaryotes". Science. 293 (5528): 290 ... Improves Growth and Fatty Acid Deposition in Juvenile Nile Tilapia ( Oreochromis niloticus )". PLOS ONE. 11 (6): e0156684. ... Yue Jiang; King-Wai Fan; Raymond Tsz-Yeung Wong & Feng Chen (2004). "Fatty acid composition and squalene content of the marine ... DHA synthesis in Schizochytrium does not involve membrane-bound desaturases or fatty acid elongation enzymes such as those ...
"Arabidopsis Peroxisomal Citrate Synthase Is Required for Fatty Acid Respiration and Seed Germination". The Plant Cell. 17 (7): ... Smith was also instrumental in defining pathways of energy metabolism involving peroxisomes, particularly fatty acid beta- ... Graham, Ian A.; Smith, Laura M.; Brown, John W. S.; Leaver, Christopher J.; Smith, Steven M. (1989). "The malate synthase gene ... Graham, Ian Alexander (1989). Structure and function of the cucumber malate synthase gene and expression during plant ...
Lee, JS; Sul, JY; Park, JB; Lee, MS; Cha, EY; Song, IS; Kim, JR; Chang, ES (2013). "Fatty Acid Synthase Inhibition by ... be mediated by its inhibition of fatty acid synthase), and antagonist activity at the κ-opioid receptor (Ke = 490 nmol L−1) as ... "Fatty acid synthase inhibition by amentoflavone induces apoptosis and antiproliferation in human breast cancer cells" (PDF). ... "Inhibition of fatty acid synthase by amentoflavone reduces coxsackievirus B3 replication". Arch. Virol. 157 (2): 259-269. doi: ...
The acylphloroglucinols (flavaspidic acids) isolated from D. crassirhizoma show in vitro antibacterial and fatty acid synthase ... Na, M; Jang, J; Min, BS; Lee, SJ; Lee, MS; Kim, BY; Oh, WK; Ahn, JS (2006). "Fatty acid synthase inhibitory activity of ... flavaspidic acids AB and PB, from Dryopteris crassirhizoma". Archives of Pharmacal Research. 32 (5): 655-9. doi:10.1007/s12272- ...
Fatty acid synthase Pantothenic acid Elovson J, Vagelos PR (July 1968). "Acyl carrier protein. X. Acyl carrier protein ... of fatty acid synthases, ACPs of polyketide synthases, the peptidyl carrier proteins (PCP), as well as aryl carrier proteins ( ... This coupling is mediated by acyl carrier protein synthase (ACPS), a 4'-phosphopantetheinyl transferase. Phosphopantetheine ...
... to over 2,500 residues in the animal fatty acid synthase. Only a small portion of their structure (around 2-4 amino acids) is ... Smith S (December 1994). "The animal fatty acid synthase: one gene, one polypeptide, seven enzymes". FASEB Journal. 8 (15): ... For example, fatty acids are synthesized by one set of enzymes in the cytosol, endoplasmic reticulum and Golgi and used by a ... As a result, the substrate does not simply bind to a rigid active site; the amino acid side-chains that make up the active site ...
The encoded protein may be part of a fatty acid synthase complex that is more like the type II prokaryotic and plastid ... and interaction of two components of a human mitochondrial fatty acid synthase. Malonyltransferase and acyl carrier protein". ...
Aldol condensation Fatty acid synthesis Polyketide synthase Dieckmann condensation Carey, F. A. (2006). Organic Chemistry (6th ... Aqueous acid (e.g. sulfuric acid or phosphoric acid) is added in the final step to neutralize the enolate and any base still ... The Stobbe condensation is a modification specific for the diethyl ester of succinic acid requiring less strong bases. An ... A reaction mechanism that explains the formation of both an ester group and a carboxylic acid group is centered on a lactone ...
It is thought that jasmolone is a derivative of cyclized and altered fatty acids. The cyclization of the fatty acids is similar ... Next, an allene oxide synthase occurs followed by allene oxide cyclase. 12-Oxophytodienoic acid is formed. It is unknown how ... 12-Oxophytodienoic acid is also used in the production of jasmonic acid. Jasmonic acid is used in the production of secondary ... α-linolenic acid. Lipooxygenase specifically binds to polyunsaturated fatty acids that have a cis,cis-1,4-pentadiene present. ...
Then, the enzyme fatty-acid synthase is responsible for turning malonlyl-CoA into fatty-acid chain. De novo fatty-acid ... De novo fatty-acid synthesis is regulated by two important enzymes, namely acetyl-CoA carboxylase and fatty acid synthase. The ... Mashima T, Seimiya H, Tsuruo T (May 2009). "De novo fatty-acid synthesis and related pathways as molecular targets for cancer ... from the circulation are converted into fatty acids, which can by further converted into triglycerides or other lipids. Acetate ...
2004). "C75, a fatty acid synthase inhibitor, reduces food intake via hypothalamic AMP-activated protein kinase". J. Biol. Chem ... 2004). "C75, a fatty acid synthase inhibitor, modulates AMP-activated protein kinase to alter neuronal energy metabolism". J. ... key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit may be a positive regulator ... Pilon G, Dallaire P, Marette A (2004). "Inhibition of inducible nitric-oxide synthase by activators of AMP-activated protein ...
... it has been reported to bind in equimolar ratio to b-keto-acyl-ACP synthase, one of the seven moieties of fatty acid synthase, ... Cerulenin is an antifungal antibiotic that inhibits fatty acid and steroid biosynthesis. In fatty acid synthesis, ... July 2004). "Inhibition of fatty acid synthase (FAS) suppresses HER2/neu (erbB-2) oncogene overexpression in cancer cells". ... and targeting of fatty acid synthase by related drugs has been suggested as a possible treatment. Antiproliferative and pro- ...
... other biologically synthesized organofluorines include ω-fluoro fatty acids, fluoroacetone, and 2-fluorocitrate. In bacteria, ... the enzyme adenosyl-fluoride synthase, which makes the carbon-fluorine bond, has been isolated. The discovery was touted as ... it is far more dangerous than conventional strong mineral acids, such as nitric acid, sulfuric acid, or hydrochloric acid. ... perfluorooctanesulfonic acid (PFOS) and perfluorooctanoic acid (PFOA). The U.S. Environmental Protection Agency classifies ...
Fatty acids from lipids are commonly used as an energy source by vertebrates as fatty acids are degraded through beta oxidation ... The glyoxylate cycle utilizes five of the eight enzymes associated with the tricarboxylic acid cycle: citrate synthase, ... The net result of the glyoxylate cycle is therefore the production of glucose from fatty acids. Succinate generated in the ... Evidence exists for malate synthase activity in humans due to a dual functional malate/B-methylmalate synthase of mitochondrial ...
Fatty acids are made by fatty acid synthases that polymerize and then reduce acetyl-CoA units. The acyl chains in the fatty ... The enzymes of fatty acid biosynthesis are divided into two groups: in animals and fungi, all these fatty acid synthase ... The fats are a large group of compounds that contain fatty acids and glycerol; a glycerol molecule attached to three fatty acid ... Fats are catabolised by hydrolysis to free fatty acids and glycerol. The glycerol enters glycolysis and the fatty acids are ...
... is a generic term for an enzyme that catalyzes carbon chain extension of an organic molecule, especially a fatty acid ... Very-long-chain (3R)-3-hydroxyacyl-(acyl-carrier protein) dehydratase Icosanoyl-CoA synthase Jump, D. B. (2009). "Mammalian ... Fatty Acid Elongases". Methods in Molecular Biology. 579: 375-389. doi:10.1007/978-1-60761-322-0_19. ISBN 978-1-60761-321-3. ...
... was also recently found to inhibit the thioesterase domain of fatty acid synthase (FAS), an enzyme involved in the ... "Crystal structure of the thioesterase domain of human fatty acid synthase inhibited by Orlistat". Nat. Struct. Mol. Biol. 14 (8 ... When lipase activity is blocked, triglycerides from the diet are not hydrolyzed into absorbable free fatty acids, and instead ... Devarajan, Uma (1 March 2009). "Fatty issues". The Deccan Chronicle. Retrieved 26 November 2009. Jeanne Whalen (20 April 2012 ...
2004). "The isopeptidase USP2a regulates the stability of fatty acid synthase in prostate cancer". Cancer Cell. 5 (3): 253-61. ...
These fatty acids inhibitors have been used as drugs to relieve pain because they can act as the substrate, and bind to the ... For example, sulfanilamide competitively binds to the enzyme in the dihydropteroate synthase (DHPS) active site by mimicking ... Essential fatty acids form the prostaglandins and when this was discovered, it turned out that these were actually very good ... Bacteria must synthesize folic acid because they do not have a transporter for it. Without folic acid, bacteria cannot grow and ...
... increasing fecal bulk and producing short-chain fatty acids as byproducts with wide-ranging physiological activities.[14] This ... In general, β-1,3 linkages are created by 1,3-Beta-glucan synthase, and β-1,4 linkages are created by cellulose synthase. The ... Mennink-Kersten MA, Warris A, Verweij PE (2006). "1,3-β-D-Glucan in patients receiving intravenous amoxicillin-clavulanic acid ...
Middle, a bacterial or eukaryotic phospholipid: 5, fatty acid chains; 6, ester linkages; 7, D-glycerol moiety; 8, phosphate ... The energy stored in these electrochemical gradients is then converted into ATP by ATP synthase.[86] This process is a form of ... Deppenmeier, U. (2002). "The unique biochemistry of methanogenesis". Prog Nucleic Acid Res Mol Biol. Progress in Nucleic Acid ... the fatty acids in the membranes of other organisms have straight chains without side branches or rings. Although isoprenoids ...
Fatty acid synthesis/. Fatty acid synthase. *Beta-ketoacyl-ACP synthase. *Β-Ketoacyl ACP reductase ... fatty acid metabolic process. • metabolism. • cardiolipin acyl-chain remodeling. • fatty acid beta-oxidation. ... a severe fatty acid oxidation disorder with cardiac and neurologic involvement". The Journal of Pediatrics. 142 (6): 684-9. doi ... "Combined enzyme defect of mitochondrial fatty acid oxidation". The Journal of Clinical Investigation. 90 (4): 1219-25. doi: ...
fatty acid degradation. *Carnitine palmitoyltransferase I. *Long-chain-fatty-acid-CoA ligase ... citric acid cycle. *Citrate synthase. *Aconitase. *Isocitrate dehydrogenase. *Oxoglutarate dehydrogenase complex. *Succinyl ... MT-TI is a small 69 nucleotide RNA (human mitochondrial map position 4263-4331) that transfers the amino acid isoleucine to a ... May 2003). "A homoplasmic mitochondrial transfer ribonucleic acid mutation as a cause of maternally inherited hypertrophic ...
"Fatty acid specific δ13C values reveal earliest Mediterranean cheese production 7,200 years ago". PLOS ONE. 13 (9): e0202807. ... GSD type 0 (glycogen synthase deficiency). *GSD type IV (Andersen's disease, branching enzyme deficiency) ... Unfortunately, too much acid can denature it,[67] so it should not be taken on an empty stomach. Also, the enzyme is ... It functions well only in high-acid environments, such as that found in the human gut due to the addition of gastric juices ...
They are involved in catabolism of very long chain fatty acids, branched chain fatty acids, D-amino acids, and polyamines, ... In animal cells, the long fatty acids are converted to medium chain fatty acids, which are subsequently shuttled to ... A major function of the peroxisome is the breakdown of very long chain fatty acids through beta oxidation. ... Peroxisomes contain oxidative enzymes, such as D-amino acid oxidase and uric acid oxidase.[9] However the last enzyme is absent ...
Smith S (December 1994). "The animal fatty acid synthase: one gene, one polypeptide, seven enzymes". 》FASEB Journal》 8 (15): ... "Nucleic Acids Research》 41 (Database issue): D764-72. doi:10.1093/nar/gks1049. PMC 3531171. PMID 23203881.. ... Flatmark T, Stevens RC (August 1999). "Structural Insight into the Aromatic Amino Acid Hydroxylases and Their Disease-Related ... an enzyme composed of 62 amino acid residues per monomer". 》The Journal of Biological Chemistry》 267 (25): 17716-21. PMID ...
... catalysed by an enzyme to produce cannabigerolic acid,[35] which is cyclized by the enzyme THC acid synthase to give THCA. Over ... Because they are extremely lipid soluble, cannabinoids accumulate in fatty tissues, reaching peak concentrations in 4-5 days. ... The main metabolite in urine is the ester of glucuronic acid and THC-COOH and free THC-COOH. In the feces, mainly 11-OH-THC was ... The pathway for THCA biosynthesis is similar to that which produces the bitter acid humulone in hops.[36][37] ...
fatty acid Sodium butyrate M (y) 5, 6, 7 ; H (ny) D (y) 11 M (y) 14; R (y) 15; D (y) 16, 18; H (ny) ... "Temporal correlation of the memory deficit with Alzheimer-like lesions induced by activation of glycogen synthase kinase-3". ... Valproic acid. Valproic acid added to cells from SMA patients increased SMN2 mRNA and protein levels and that the drug directly ... Valproic acid. Valproic acid treatment increased mutant Htt H3 and H4 acetylation levels comparable to wild-type Htt in ...
A Personal Retrospective: Elevating Anandamide (AEA) by Targeting Fatty Acid Amide Hydrolase (FAAH) and the Fatty Acid Binding ... Activation of CB1 enhances AMT activity through increased nitric oxide synthase (NOS) activity and subsequent increase of NO ... These include the heat shock proteins (Hsp70s) and fatty acid binding proteins for anandamide (FABPs).[6][7] FABPs such as ... FABP inhibitors attenuate the breakdown of anandamide by the enzyme fatty acid amide hydrolase (FAAH) in cell culture.[6] One ...
Glycolysis → Pyruvate decarboxylation → Citric acid cycle → Oxidative phosphorylation (electron transport chain + ATP synthase) ... Fatty acid metabolism. *Fatty acid degradation (Beta oxidation). *Fatty acid synthesis. Other. *Steroid metabolism ... A mannose sugar is added to the first tryptophan residue in the sequence W-X-X-W (W indicates tryptophan; X is any amino acid ...
Nutrients that are commonly used by animal and plant cells in respiration include sugar, amino acids and fatty acids, and the ... Glycolysis → Pyruvate decarboxylation → Citric acid cycle → Oxidative phosphorylation (electron transport chain + ATP synthase) ... Citric acid cycle. Main article: Citric acid cycle. This is also called the Krebs cycle or the tricarboxylic acid cycle. When ... The above value of 3 H+/ATP for the synthase assumes that the synthase translocates 9 protons, and produces 3 ATP, per rotation ...
Fatty acyl CoA dehydrogenase requires FAD in fatty acid oxidation. *FAD is required to convert retinol (vitamin A) to retinoic ... Riboflavin synthase. ReferencesEdit. *^ a b c d e f g h "riboflavin". The American Society of Health-System Pharmacists. ... Large cultures of Micrococcus luteus growing on pyridine (left) and succinic acid (right). The yellow pigment being produced in ... Oxidation of pyruvate, α-ketoglutarate, and branched-chain amino acids requires FAD in the shared E3 portion of their ...
This agent can eventually compromise the pathways of fatty acid, glycine, and pyruvate metabolism, and then become detectable ... Under normal conditions, SSADH works with the enzyme GABA transaminase to convert GABA to succinic acid. Succinic acid can then ... accumulates and cannot be oxidized to succinic acid and is therefore reduced to gamma-hydroxybutyric acid (GHB) by gamma- ... Taurine is a non-protein sulfur amino acid that is found in high concentrations in human milk. It has been shown to have ...
This expands the genetic code, beyond the twenty canonical amino acids found in nature, to include an unnatural amino acid as ... Argininosuccinate synthase. *Holocarboxylase synthetase. *GMP synthase. *Asparagine synthetase. *Carbamoyl phosphate synthetase ... the cavity that holds the amino acid can be mutated and modified to carry unnatural amino acids synthesized in the lab, and to ... and redox-active amino acids.[14] Another use is introducing amino acids bearing reactive functional groups for chemically ...
Their function is to convert the potential energy of glucose, amino acids, and fatty acids into adenosine triphosphate (ATP) in ... ATP synthase, an enzyme that directly generates ATP. Without ATP synthase, the electron transport chain will not produce any ... Succinic acid has been studied, and shown effective for both Leigh syndrome, and MELAS syndrome.[13][14] A high-fat, low- ... Assessing the level of organic acids in urine can also indicate a dysfunction in the metabolic pathway.[6] ...
These compounds are normally produced during bodily metabolism of amino acids and odd-chain fatty acids, but accumulate in ... in some patients with homocystinuria to boost the activity of the residual cystathione synthase enzyme, administration of ... The acylcarnitine combination profile detects compounds such as organic acids and fatty acids conjugated to carnitine. The test ... Measurement of amino acids in plasma or serum is used in the evaluation of disorders of amino acid metabolism such as urea ...
Fatty acid amide hydrolase. *Histone deacetylase *Sirtuin. 3.5.2: Cyclic amides/. Amidohydrolases. *Barbiturase ... Inosine monophosphate synthase. *DCMP deaminase. *GTP cyclohydrolase I. *Cytidine deaminase *AICDA. *Activation-induced ...
Folinic acid is not the same as folic acid. Folic acid supplements have little established role in cancer chemotherapy.[46][47] ... The conversion is catalyzed by thymidylate synthase. ... "Folic Acid". ChemSrc.. *^ a b c d e f g "Folate". Micronutrient ... Folate in the form of folic acid is used to treat anemia caused by folic acid deficiency.[4] Folic acid is also used as a ... Folic acid, B12 and iron[edit]. A complex interaction occurs between folic acid, vitamin B12, and iron. A deficiency of one may ...
This enzyme is also called N-succinyl-L-alpha,epsilon-diaminopimelic acid deacylase. This enzyme participates in lysine ... Inosine monophosphate synthase. *DCMP deaminase. *GTP cyclohydrolase I. *Cytidine deaminase *AICDA. *Activation-induced ... Kindler SH, Gilvarg C (December 1960). "N-Succinyl-L-2,6-diaminopimelic acid deacylase". The Journal of Biological Chemistry. ... Fatty acid amide hydrolase. *Histone deacetylase *Sirtuin. 3.5.2: Cyclic amides/. Amidohydrolases. *Barbiturase ...
D-amino-acid oxidase Ja 1.4.3.4 monoamine oxidase Ja 1.4.3.5 pyridoxal 5'-phosphate synthase Ja ... long-chain-fatty-acyl-CoA reductase Ja 1.2.3.1 aldehyde oxidase Ja ... L-amino-acid oxidase Ja 1.4.3.3 ... S)-2-hydroxy-acid oxidase Ja 1.1.4.1 vitamin-K-epoxide ...
Arachidonic acidEdit. ALOX5 metabolizes the omega-6 fatty acid, Arachidonic acid (AA, i.e. 5Z,8Z,11Z,15Z-eicosatrienoic acid), ... also termed LTA4 synthase) activity which converts 5S-HpETE to its epoxide, 5S,6S-hydroxy-6E,8Z,11Z,14Z-eicosatetraenoic acid ( ... Eicosapentaenoic acidEdit. ALOX5 metabolizes the omega-3 fatty acid, Eicosapentaenoic acid (EPA, i.e. 4Z,8Z,11Z,14Z,17Z- ... Docosahexaenoic acidEdit. ALOX5 acts in series with ALOX15 to metabolize the omega 3 fatty acid, docosahexaenoic acid (DHA, i.e ...
Long-chain-fatty-acid-CoA ligase. 6.3: Carbon-Nitrogen. *Glutamine synthetase. *Ubiquitin ligase *Cullin ... This entry also includes folylpolyglutamate synthase that transfers glutamate to folylpolyglutamate and cyanophycin synthetase ... 1) formation of UDP-N-acetylmuramic acid (UDPMurNAc) from N-acetylglucosamine (GlcNAc). ... N-acetylmuramic acid. All four Mur ligases are topologically similar to one another, even though they display low sequence ...
For example, fatty acids are synthesized by one set of enzymes in the cytosol, endoplasmic reticulum and Golgi apparatus. Then ... Examples of this include ATP synthase. It makes a chemical called ATP. Another example is DNA polymerase. It reads an intact ... It breaks down fats into smaller molecules, fatty acids and glycerol.d ... The amino acid side-chains of the active site are bent into positions so the enzyme does its catalytic work. In some cases, ...
Johns C (January 2009). "Glycyrrhizic acid toxicity caused by consumption of licorice candy cigars". Canadian Journal of ... the Gene mutated will result in an aldosterone synthase that is ACTH-sensitive, which is normally not.[22][23][24][25][26] GRA ...
... aspirin-treated COX-2 metabolizes a variety of polyunsaturated fatty acids to hydroperoxy products which are then further ... role of inducible nitric oxide synthase". Journal of Physiology and Pharmacology. 57 Suppl 5 (5): 125-36. PMID 17218764.. ... 2-acetoxybenzoic acid. acetylsalicylate. acetylsalicylic acid. O-acetylsalicylic acid, Aspirin (BAN UK), Aspirin (USAN US). ... Salicylic acid is treated with acetic anhydride, an acid derivative, causing a chemical reaction that turns salicylic acid's ...
Nutrients used in cellular respiration include carbohydrates, amino acids and fatty acids. These nutrients are oxidized to ... An ATP synthase enzyme uses that chemiosmotic potential to make ATP during photophosphorylation, whereas NADPH is a product of ... creating the four-carbon organic acid oxaloacetic acid. Oxaloacetic acid or malate synthesized by this process is then ... Blue nodes: amino acid metabolism. Grey nodes: vitamin and cofactor metabolism. Brown nodes: nucleotide and protein metabolism. ...
response to fatty acid. • leukotriene metabolic process. • toll-like receptor 2 signaling pathway. • positive regulation of ... positive regulation of nitric-oxide synthase biosynthetic process. • MyD88-dependent toll-like receptor signaling pathway. • ... cellular response to lipoteichoic acid. • positive regulation of NF-kappaB transcription factor activity. • immune response. • ... TLR2 resides on the plasma membrane where it responds to lipid-containing PAMPs such as lipoteichoic acid and di- and tri- ...
Fatty Acid Synthase: RCSB PDB Molecule of the Month. *3D electron microscopy structures of fatty acid synthase from the EM Data ... FASN, fatty acid synthase, Fasn, A630082H08Rik, FAS, OA-519, SDR27X1, Fatty acid synthase. ... "Human fatty acid synthase: assembling recombinant halves of the fatty acid synthase subunit protein reconstitutes enzyme ... Fatty acid synthase is a multi-enzyme protein that catalyzes fatty acid synthesis. It is not a single enzyme but a whole ...
Yeast fatty acid synthase may refer to: Fatty acid synthase Fatty-acyl-CoA synthase This disambiguation page lists articles ... associated with the title Yeast fatty acid synthase. If an internal link led you here, you may wish to change the link to point ...
Thank you for your interest in spreading the word about Science.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
Fatty acid biosynthesis is catalyzed in most bacteria by a group of highly conserved proteins known as the type II fatty acid ... Product diversity and regulation of type II fatty acid synthases.. Lu YJ1, Zhang YM, Rock CO. ... multiple mechanisms to generate unsaturated fatty acids and the accessory components required for branched-chain fatty acid ... However, newly identified transcriptional factors in bacterial fatty acid biosynthetic pathways are a fertile field for new ...
Keywords: Akt signaling; Anticancer; Antiobesity; Black tea; Fatty acid synthase (FAS); Green tea; HepG2 cells; JNK signaling; ... Fatty acid synthase (FAS) is a key enzyme of lipogenesis. Overexpression of FAS is dominant in cancer cells and proliferative ... Pu-erh Tea Supplementation Suppresses Fatty Acid Synthase Expression in the Rat Liver Through Downregulating Akt and JNK ...
Volpe JJ, Marasa JC: Hormonal regulation of fatty acid synthetase, acetyl-CoA carboxylase and fatty acid synthesis in mammalian ... Liu LH, Wang XK, Hu YD, Kang JL, Wang LL, Li S: Effects of a fatty acid synthase inhibitor on adipocyte differentiation of ... Yin D, Clarke SD, Peters JL, Etherton TD: Somatotropin-dependent decrease in fatty acid synthase mRNA abundance in 3T3-F442A ... Yin D, Griffin MJ, Etherton TD: Analysis of the signal pathways involved in the regulation of fatty acid synthase gene ...
Rabbit polyclonal Fatty Acid Synthase antibody validated for WB, IP, IHC, ICC/IF and tested in Human and Mouse. Immunogen ... Anti-Fatty Acid Synthase antibody. See all Fatty Acid Synthase primary antibodies. ... Fatty acid synthetase catalyzes the formation of long-chain fatty acids from acetyl-CoA, malonyl-CoA and NADPH. This ... A region within amino acids 2462-2511 of Human Fatty Acid Synthase (NP_004095.4). ...
Fatty acid synthetase catalyzes the formation of long-chain fatty acids from acetyl-CoA, malonyl-CoA and NADPH. This ... Fatty acid synthaseAdd BLAST. 2505. Amino acid modifications. Feature key. Position(s). DescriptionActions. Graphical view. ... Fatty acid synthetase catalyzes the formation of long-chain fatty acids from acetyl-CoA, malonyl-CoA and NADPH. This ... Fatty acid synthase (EC:2.3.1.85). Including the following 7 domains:. [Acyl-carrier-protein] S-acetyltransferase (EC:2.3.1.38) ...
... for Anti-Fatty Acid Synthase antibody used in Western blot. Abcam provides excellent in-house scientific support ...
... ... "MMDB and VAST+: tracking structural similarities between macromolecular complexes.Nucleic Acids Res. 2014 Jan; 42(Database ... 2s,3s,5s)-5-[(N-Formyl-L-Leucyl)oxy]-2-Hexyl-3-Hydroxyhexadecanoic Acid. ...
A second paper by Bans group reveals that the carrier protein places a fatty acid intermediate in a ketoacyl synthase active ... Home > Volume 85 Issue 16 > scic > Sharper image of fatty acid synthase ... The gargantuan 2.6-megadalton protein complex that catalyzes the iterative assembly of fungal fatty acids has just come into ... A special carrier protein shuttles intermediates around the reaction chamber; the fatty acid chain length increases by two ...
Shop a large selection of products and learn more about Biomatik CorporationMouse Fatty Acid Synthase (FASN) ELISA Kit, 96 ... The Mouse Fatty Acid Synthase (FASN) ELISA Kit allows for quantitative determination of Fatty Acid Synthase in Tissue ... Cross Activity: No significant cross-reactivity or interference between Fatty Acid Synthase and analogues was observed. ...
Oncogenic properties of the endogenous fatty acid metabolism: molecular pathology of fatty acid synthase in cancer cells. Curr ... Fatty acid synthase as a tumor marker: its extracellular expression in human breast cancer. J Exp Ther Oncol 2004; 4: 101-110. ... Extracellular Fatty Acid Synthase: A Possible Surrogate Biomarker of Insulin Resistance. Jose Manuel Fernandez-Real, Javier A. ... Extracellular Fatty Acid Synthase: A Possible Surrogate Biomarker of Insulin Resistance. Jose Manuel Fernandez-Real, Javier A. ...
Browse our Fatty Acid Synthase/FASN product catalog backed by our Guarantee+. ... Fatty Acid Synthase/FASN products available through Novus Biologicals. ... PTMs for Fatty Acid Synthase/FASN. Learn more about PTMs related to Fatty Acid Synthase/FASN.. Phosphorylation. Methylation. ... Diseases related to Fatty Acid Synthase/FASN. Discover more about diseases related to Fatty Acid Synthase/FASN.. Malignant ...
Browse our Fatty Acid Synthase/FASN ELISA Kits all backed by our Guarantee+. ... Fatty Acid Synthase/FASN ELISA Kits available through Novus Biologicals. ...
An Overview of Pipeline Products for Fatty Acid Synthase (FAS) Inhibitor 4. Comparative Analysis. 5. Fatty Acid Synthase (FAS) ... Table 2: Fatty Acid Synthase (FAS) Inhibitor Therapeutic Products in Clinical Stages. Table 3: Fatty Acid Synthase (FAS) ... Figure 2: Fatty Acid Synthase (FAS) Inhibitor Therapeutic Products in Clinical Stages. Figure 3: Fatty Acid Synthase (FAS) ... Pipeline Therapeutics assessment of products for Fatty Acid Synthase (FAS) Inhibitor The report assesses the active Fatty Acid ...
Ausgesuchte Qualitäts-Hersteller für Fatty Acid Synthase Antikörper. Hier bestellen. ... Monoklonale und polyklonale Fatty Acid Synthase Antikörper für viele Methoden. ... fatty acid synthase , fatty acid synthase Fas , Fatty acid synthase Fas , FAS , Fatty Acid SyNthase family member (fasn-1) , ... fatty-acid synthase , fatty-acid synthase II , fatty-acid synthase fas , CG3523-PA , CG3523-PC , fatty acid synthetase , ...
The fatty acids found in the human circulation are mainly palmitic acid, oleic acid, and stearic acid. It has been suggested ... PGI2 synthase activity was assessed in vivo after fatty acid infusion in rats. Finally, the in vivo effects of FFA-induced ROS ... the albumin concentrations used to bind the fatty acids were so low that the relevance of these observations to fatty acid ... Oleic acid, pure fatty acid-free albumin, and NA were from Sigma-Aldrich; CM-H2DCFDA was from Invitrogen Corp. TDGA was a gift ...
Retrieved from "http://proteopedia.org/wiki/index.php/Fatty_acid_synthase_3D_structures" ...
Fatty acid synthesis is essential in embryonic development: fatty acid synthase null mutants and most of the heterozygotes die ... virus nonstructural protein 3 redistributes fatty acid synthase to sites of viral replication and increases cellular fatty acid ... Fatty-acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition. 2000;16:202-8.CrossRefPubMed ... Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry. 1989;28:4523-30.CrossRefPubMedGoogle Scholar ...
Fatty acid synthase, a novel target for anti-glioma therapy. Weiling Zhao, Steven Kridel, Joy Little, Sachidanand Hebbar and ... Fatty acid synthase, a novel target for anti-glioma therapy. Weiling Zhao, Steven Kridel, Joy Little, Sachidanand Hebbar and ... Fatty acid synthase, a novel target for anti-glioma therapy. Weiling Zhao, Steven Kridel, Joy Little, Sachidanand Hebbar and ... Fatty acid synthase, a novel target for anti-glioma therapy Message Subject (Your Name) has forwarded a page to you from Cancer ...
... J Natl Cancer Inst. 2009 Apr 1;101(7):519-32. ... Background: Overexpression of the fatty acid synthase (FASN) gene has been implicated in prostate carcinogenesis. We sought to ... Fatty Acid Synthase, Type I / genetics* * Fatty Acid Synthase, Type I / metabolism ...
Selected quality suppliers for anti-Fatty Acid Synthase antibodies. ... Order monoclonal and polyclonal Fatty Acid Synthase antibodies for many applications. ... fatty acid synthase , fatty acid synthase Fas , Fatty acid synthase Fas , FAS , Fatty Acid SyNthase family member (fasn-1) , ... fatty-acid synthase , fatty-acid synthase II , fatty-acid synthase fas , CG3523-PA , CG3523-PC , fatty acid synthetase , ...
Fatty acid synthase (FAS) is the major enzyme in lipogenesis, and its circulating level is a bi-omarker of metabolically ... free fatty acid uptake, synthesizing, storing and exporting lipids; non-alcoholic fatty liver disease (NAFLD) develops if there ... Evaluation of Circulating Fatty Acid Synthase as a Biomarker in Non-Alcoholic Fatty Liver Disease ... Evaluation of Circulating Fatty Acid Synthase as a Biomarker in Non-Alcoholic Fatty Liver Disease. Open Journal of ...
Fatty acid synthesis is essential in embryonic development: Fatty acid synthase null mutants and most of the heterozygotes die ... Fatty acid synthesis is essential in embryonic development: Fatty acid synthase null mutants and most of the heterozygotes die ... Fatty acid synthesis is essential in embryonic development: Fatty acid synthase null mutants and most of the heterozygotes die ... Fatty acid synthesis is essential in embryonic development: Fatty acid synthase null mutants and most of the heterozygotes die ...
BioVision develops and offers a wide variety of products including assay kits, antibodies, recombinant proteins & enzymes, and other innovative research tools for studying Apoptosis, Metabolism, Cell Proliferation, Cellular Stress, Cell Damage and Repair, Diabetes, Obesity and Metabolic Syndrome, Stem Cell Biology, Gene Regulation, Signal Transduction, etc. BioVisions products are currently being sold in more than 60 countries worldwide.
Fatty acid synthase (E.C.2.3.1.85; FASN) is a lipogenic enzyme which catalyzes the de novo synthesis of long-chain fatty acids ... Novel Inhibitors of Fatty Acid Synthase with Anticancer Activity. Teresa Puig, Carlos Turrado, Bellinda Benhamú, Helena Aguilar ... Novel Inhibitors of Fatty Acid Synthase with Anticancer Activity. Teresa Puig, Carlos Turrado, Bellinda Benhamú, Helena Aguilar ... Novel Inhibitors of Fatty Acid Synthase with Anticancer Activity. Teresa Puig, Carlos Turrado, Bellinda Benhamú, Helena Aguilar ...
High sensitivity ELISA kit for detection of Fatty Acid Synthase/FASN. Backed by our 100% Guarantee. ... Rat Fatty Acid Synthase/FASN ELISA Kit (Colorimetric). ... Fatty Acid Synthase/FASN ELISA Kits. * Fatty Acid Synthase/FASN ... Home » Fatty Acid Synthase/FASN » Fatty Acid Synthase/FASN ELISA Kits » Rat Fatty Acid Synthase/FASN ELISA Kit (Colorimetric) ... Rat Fatty Acid Synthase/FASN ELISA Kit (Colorimetric) Summary. Specificity. This kit recognizes Rat Fatty Acid Synthase/FASN in ...
... British Journal of Haematology 141(5): 659- ... Retraction: Fatty Acid Synthase is a Novel Therapeutic Target in Multiple Myeloma. ... This study investigated the biological significance of the inhibition of fatty acid synthase (FAS) in multiple myeloma (MM) ...
Down-regulation of fatty acid synthase increases the resistance of Saccharomyces cerevisiae cells to H2O2.. [Ana C Matias, Nuno ... Here this mechanism was addressed and two lines of evidence showed for the first time that fatty acid synthase (Fas) plays a ... Very-long-chain fatty acids (VLCFA) through interdigitation or by modulating formation of lipid rafts may decrease the overall ... However, the fas1Delta strain plasma membrane had large increases in the levels of lignoceric acid (C24:0) (40%) and cerotic ...
  • Fatty acid synthase is a multi-enzyme protein that catalyzes fatty acid synthesis . (wikipedia.org)
  • Its main function is to catalyze the synthesis of palmitate (C16:0, a long-chain saturated fatty acid ) from acetyl-CoA and malonyl-CoA , in the presence of NADPH . (wikipedia.org)
  • Type II is found in archaea and bacteria, and is characterized by the use of discrete, monofunctional enzymes for fatty acid synthesis. (wikipedia.org)
  • These include multiple mechanisms to generate unsaturated fatty acids and the accessory components required for branched-chain fatty acid synthesis in Gram-positive bacteria. (nih.gov)
  • Specifically, FAS catalyzes the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. (novusbio.com)
  • Therefore, FAS antibodies are useful tools for studies on fatty acid synthesis and research on certian cancers. (novusbio.com)
  • Using purinome capture media, we observed that HIV-1 infection increases intracellular levels of fatty acid synthase (FASN), a NADPH-using enzyme critical to the synthesis of de novo fatty acids. (springer.com)
  • Cerulenin-mediated inhibition of lipid synthesis was determined using 14 C labeled acetic acid. (aacrjournals.org)
  • Endogenous fatty acid synthesis in cerulenin-treated glioma cells decreased by 49%, 49.7% and 51.1% at 2 hours in NSB-19, U251, and C6 cells, respectively. (aacrjournals.org)
  • In animals, including humans, the source of long-chain saturated fatty acids is de novo synthesis, which is mediated by fatty acid synthase (FAS), ingested food, or both. (pnas.org)
  • To understand the importance of de novo fatty acid synthesis, we generated FAS knockout mice. (pnas.org)
  • The FAS complex catalyzes the synthesis of the saturated fatty acids myristate, palmitate, and stearate by using the substrates acetyl-CoA, malonyl-CoA, and NADPH ( 1 - 4 ). (pnas.org)
  • Hence, the importance and contribution of the de novo fatty acid synthesis catalyzed by FAS during embryonic development and the general well-being of animals is not known. (pnas.org)
  • FASN) is a lipogenic enzyme which catalyzes the de novo synthesis of long-chain fatty acids from acetyl-CoA, malonyl-CoA, and NADPH precursors ( 1 ). (aacrjournals.org)
  • FASN expression is generally low or undetectable in human tissues other than the liver and adipose tissue, and nonmalignant cells preferentially use circulating dietary fatty acids for the synthesis of new structural lipids. (aacrjournals.org)
  • The widespread expression of FASN in human cancer and its association with poor prognosis suggest that fatty acid synthesis provides an advantage for tumor growth, and could be a promising target for antitumor drug development ( 7 ). (aacrjournals.org)
  • Fatty acid synthase (FAS) is a multifunctional protein, whose primary role is the NADPH-mediated synthesis of palmitate from acetyl-CoA and malonyl-CoA, into long-chain saturated fatty acids. (clontech.com)
  • Thus, the dual action of inhibiting fatty acid synthesis and stimulating fatty acid oxidation by C75 could be developed as a promising adjuvant therapy strategy to protect against hemorrhagic shock. (ovid.com)
  • Mammalian fatty acid synthase (FAS) is a complex multifunctional enzyme that contains seven catalytic domains and a phosphopantotheine prosthetic group on a single polypeptide and catalyzes the synthesis of palmitate from the substrates acetyl-CoA, malonyl-CoA, and NADPH ( 1 ). (aacrjournals.org)
  • The endogenous synthesis of fatty acid is usually minimal in cells because diet supplies most of the fatty acids, and, consequently, FAS is expressed at low or undetectable level in most normal human tissues, with the exception of lactating breast and cycling endometrium ( 1 ). (aacrjournals.org)
  • FAS catalyzes the reductive synthesis of long-chain fatty acids from acetyl-coenzyme A (acetyl-CoA) and malonyl-CoA ( 2 ). (sciencemag.org)
  • To investigate the physiological consequences of in vivo inhibition of fatty acid synthesis on global lipid metabolism, we administered cerulenin [60 mg/kg body weight per day (mg/kg/day) for 7 days] or C75 (single dose of 7.5 to 30 mg/kg) to mice by ip injection. (sciencemag.org)
  • Early studies had shown that INH inhibited the synthesis of mycolic acids, α-alkyl β-hydroxy long-chain fatty acids (60 to 90 carbons in length) that cover the surface of mycobacteria ( 34 , 40 ). (asm.org)
  • Unlike most organisms, mycobacteria have two fatty acid synthases, the fatty acid synthase I (FASI) and FASII systems (Fig. 1 A). The discovery that mycobacteria had FASI was surprising, as it is the first prokaryote shown to have FASI, a multidomain enzyme that encodes all the activities necessary for fatty acid synthesis in one large polypeptide ( 7 ). (asm.org)
  • Carcinoma cells are dependent on endogenous fatty acid synthesis for growth in vitro . (aacrjournals.org)
  • De novo synthesis of long-chain fatty acids, mitochondrial fatty acid synthesis, acylation of certain secondary metabolites and coenzymes, fatty acid elongation, and the vast diversity of mycobacterial lipids each result from specific FAS activities. (asm.org)
  • Even among archebacteria, which contain exclusively diphytanylglycerol diethers rather than diacylglycerides as membrane lipids, the synthesis of myristic acid for membrane protein acylation was discussed ( 26 , 109 ). (asm.org)
  • Thus, the enzyme system involved in de novo fatty acid synthesis, fatty acid synthase (FAS), is one of the household enzymes of the cell. (asm.org)
  • Even though there is considerable variation in the molecular structures of FASs from different sources, the reaction mechanism of de novo fatty acid synthesis is essentially the same in all biological systems. (asm.org)
  • Endogenous fatty acid synthesis has been observed in some rapidly proliferating cells and tissues, both normal and neoplastic, and probably supports membrane synthesis. (biomedsearch.com)
  • Sterol regulatory element binding proteins (SREBPs) are transcription factors that regulate the expression of genes for both cholesterol and fatty acid synthesis. (biomedsearch.com)
  • Intracellular lipid depletion triggers proteolytic cleavage of SREBP, allowing the amino terminus to enter the nucleus and activate the expression of enzymes, including acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS), major biosynthetic enzymes for fatty acid synthesis. (biomedsearch.com)
  • The expression patterns of ACC, FAS, SREBP, and Ki-67 in fetal tissues were compared to determine whether SREBP is likely to participate in the regulation of proliferation-associated fatty acid synthesis during fetal growth. (biomedsearch.com)
  • Here we used Western blot analysis to examine the impact of gestation and 0.2% ECD on the expression levels of fatty acid synthase (FAS), HMGR and SREBP-1/2, which are involved in either lipid or cholesterol synthesis. (biomedsearch.com)
  • The results were validated utilizing a radiolabeled fatty acid synthesis assay. (asm.org)
  • Synthesis of novel beta-lactone inhibitors of fatty acid synthase. (semanticscholar.org)
  • Practical, catalytic, asymmetric synthesis of beta-lactones via a sequential ketene dimerization/hydrogenation process: inhibitors of the thioesterase domain of fatty acid synthase. (semanticscholar.org)
  • Total synthesis and comparative analysis of orlistat, valilactone, and a transposed orlistat derivative: Inhibitors of fatty acid synthase. (semanticscholar.org)
  • Fatty acid synthase (FASN), the enzyme responsible for de novo synthesis of lipids from sugars, is overexpressed in up to 80% of ovarian carcinomas and signifies unfavorable clinical outcome ( 11, 12 ). (aacrjournals.org)
  • FAS enzyme is responsible for the de novo synthesis of fatty acids, and it has emerged as a potential therapeutic target for human cancer ( 10 ). (aacrjournals.org)
  • In eukaryotes, fatty acid synthase (FAS) is the enzyme responsible for synthesis of palmitate, the precursor of long-chain nonessential fatty acids. (semanticscholar.org)
  • Artesunate Activates the Intrinsic Apoptosis of HCT116 Cells through the Suppression of Fatty Acid Synthesis and the NF-κB Pathway. (semanticscholar.org)
  • Control mechanisms in the synthesis of saturated fatty acids. (microbiologyresearch.org)
  • Acyl carrier protein: effect of acetylation and tryptic hydrolysis on function in fatty acid synthesis. (microbiologyresearch.org)
  • The present invention is directed to synthase enzymes relevant to fatty acid synthesis in plants, protein preparations, amino acid and nucleic acid sequences related thereto, and methods of use for such compositions. (google.com)
  • The absence of endoperoxide-containing products derived from 10,10-difluoroarachidonic acid has been thought to indicate the importance of a C-10 carbocation in PGG2 synthesis. (wikipedia.org)
  • Western blot analysis of H-460 cell lysates using Rabbit anti fatty acid synthase antibody at a 1/200 dilution. (bio-rad-antibodies.com)
  • Western blot analysis of control and fatty acid synthase knockout HEK 293T cell lysate using Rabbit anti fatty acid synthase antibody at a 1/1000 dilution. (bio-rad-antibodies.com)
  • Rabbit anti fatty acid synthase antibody recognizes fatty acid synthase (FASN), also known as 3-oxoacyl-[acyl-carrier-protein] synthase. (bio-rad-antibodies.com)
  • The growing fatty acid chain is carried between these active sites while attached covalently to the phosphopantetheine prosthetic group of an acyl carrier protein (ACP), and is released by the action of a thioesterase (TE) upon reaching a carbon chain length of 16 (palmitic acid). (wikipedia.org)
  • The gargantuan 2.6-megadalton protein complex that catalyzes the iterative assembly of fungal fatty acids has just come into sharper focus. (acs.org)
  • The protein has two reaction chambers with three full sets of active sites, so six fatty acids can be synthesized simultaneously. (acs.org)
  • A second paper by Ban's group reveals that the carrier protein places a fatty acid intermediate in a ketoacyl synthase active site as if the intermediate were at the end of an opening switchblade ( Science 2007 , 316, 288). (acs.org)
  • Despite the requirement of FASN for nascent virion production, FASN activity was not required for intracellular Gag protein production, indicating that FASN dependent de novo fatty acid biosynthesis contributes to a late step of HIV-1 replication. (springer.com)
  • Additionally we are shipping Fatty Acid Synthase Kits (72) and Fatty Acid Synthase Proteins (14) and many more products for this protein. (antibodies-online.com)
  • Many bacterial small RNAs (sRNAs) control membrane protein production, but sRNA-mediated regulation of membrane fatty acid composition is less well understood. (asm.org)
  • Mycobacterium tuberculosis mtFabD is an essential malonyl-CoA:AcpM transacylase and is important for vital protein-protein interactions within type 2 fatty acid synthase FASII. (hindawi.com)
  • A new approach for eradicating tuberculosis has been proposed that centers on perturbing vital protein-protein interactions associated with the essential mycobacterial process of type 2 fatty acid synthase, FASII [ 1 ]. (hindawi.com)
  • Despite this complexity, a preponderance of evidence implicates inhA , which codes for an enoyl-acyl carrier protein reductase of the fatty acid synthase II (FASII), as the primary target of INH. (asm.org)
  • Further work revealed that InhA encoded an NADH-specific enoyl-acyl carrier protein (ACP) reductase activity ( 10 , 29 ) which converts Δ 2 -unsaturated to saturated fatty acids and is involved in the elongation of long-chain fatty acids to mycolic acids. (asm.org)
  • Recombinant protein encompassing a sequence within the N-terminus region of human Fatty Acid Synthase. (genetex.com)
  • Fatty Acid Synthase antibody [N1], N-term detects Fatty Acid Synthase protein at cytoplasm on human colon carcinoma by immunohistochemical analysis. (genetex.com)
  • Fatty Acid Synthase antibody [N1], N-term detects FASN protein by western blot analysis. (genetex.com)
  • In mammals and birds, these multiple functions for de novo biosynthesis of fatty acids are consolidated into a single protein that is the product of a single gene. (aacrjournals.org)
  • The individual FAS component enzymes are ac(et)yltransferase (AC), malonyl/acetyl- or malonyl/palmitoyl-transacylase (AT, MPT), ketoacyl synthase (KS) ketoacyl reductase (KR), dehydratase (DH), enoyl reductase (ER), acyl carrier protein (ACP), and thioesterase (TE). (asm.org)
  • Suppression of Fasn (fatty acid synthase) transcription involves two PUFA-responsive regions, but the majority of PUFA sensitivity maps to a region within the proximal promoter containing binding sites for NF-Y (nuclear factor-Y), Sp1 (stimulatory protein 1), SREBP (sterol-regulatory-elementbinding protein), and USF (upstream stimulatory factor). (portlandpress.com)
  • Lipogenic enzymes fatty acid synthase and acetyl-coenzyme A carboxylase are coexpressed with sterol regulatory element binding protein and Ki-67 in fetal tissues. (biomedsearch.com)
  • A critical lipid metabolism protein, fatty acid synthase was down-regulated through siRNA and inhibited with orlistat and the effect on DENV infection determined by flow cytometry, plaque assay, western blotting and confocal microscopy. (biomedcentral.com)
  • While drug treatment reduced virus titer by up to 3Log10, no significant effect on DENV non-structural protein expression was observed, suggesting that fatty acid synthase acts through an effect on virion formation. (biomedcentral.com)
  • Mammalian FASN consists of 2 identical 270-kD polypeptide chains, each comprising all 7 required domains (i.e., beta-ketoacyl synthase, malonyl/acetyltransferase, dehydrase, enoyl reductase, β-ketoacyl reductase, acyl carrier protein, and thioesterase) that assembles into homodimers for enzymatic activity ( 14 )( 15 )( 16 )( 17 )( 18 )( 19 )( 20 )( 21 ). (aaccjnls.org)
  • To explore the underlying mechanism of Steroidogenic acute regulatory protein (StAR)'s protective effect on endothelial dysfunction model, the inhibitor of fatty acid synthase and HMG-CoA reductase, Cerulenin ( 5 μg/mL) and Lovastatin, are used before palmitic acid (PA) added. (medchemexpress.com)
  • Overexpression of steroidogenic acute regulatory protein in rat aortic endothelial cells attenuates palmitic acid-induced inflammation and reduction in nitric oxide bioavailability. (medchemexpress.com)
  • For optimal activity the partially purified synthase required the presence of acetyl-CoA, malonyl-CoA, NADH and NADPH as well as a cell-free fraction containing the acyl carrier protein (ACP). (microbiologyresearch.org)
  • 1. A cDNA sequence encoding a Ricinus communis β-ketoacyl-ACP synthase protein, wherein said cDNA sequence comprises the mature protein encoding portion of said synthase protein, and wherein said mature protein has a molecular weight of approximately 50 kD. (google.com)
  • 4. The DNA construct of claim 3 wherein said initiation and termination regions are functional in a plant cell, and wherein said construct further comprises, immediately 5′ to said mature synthase protein encoding sequence, a transit peptide encoding sequence. (google.com)
  • 7. A DNA construct comprising, in the 5′ to 3′ direction of transcription, a transcription initiation region functional in a plant seed cell, said β-ketoacyl-ACP synthase protein encoding sequence of claim 1 or claim 2 and a transcriptional termination region functional in a plant seed cell, wherein said β-ketoacyl-ACP synthase protein encoding sequence is oriented for expression of antisense sequence. (google.com)
  • 12. The plant cell of claim 11 wherein said plant β-ketoacyl-ACP synthase protein encoding sequence is heterologous to said plant cell. (google.com)
  • Along with exploring the synthetic capability of FAS, we aim to build a foundation for efficient protein engineering, with the specific goal of harnessing evolutionarily related megadalton-scale polyketide synthases (PKS) for the tailored production of bioactive natural compounds. (mpg.de)
  • FASN (Fatty Acid Synthase) is a Protein Coding gene. (genecards.org)
  • The relatively low beta-ketoacyl synthase activity may be attributable to the low 4-phosphopantetheine content of the protein. (genecards.org)
  • In the biosynthesis of fatty acids, the beta-Ketoacyl Acyl Carrier Protein Synthases (Kas) catalyse chain elongation by the addition of two-carbon units derived from malonyl-ACP, to an acyl group bound to CoA or the small protein ACP. (ki.se)
  • Stearoyl Acyl Carrier Protein Desaturase is a soluble enzyme that catalyses the formation of a cis-double bond between carbon-9 and carbon-10 in stearic acid. (ki.se)
  • Structure of the complex between the antibiotic cerulenin and its target, beta-ketoacyl-acyl carrier protein synthase. (ki.se)
  • The crystal structure of beta-ketoacyl-acyl carrier protein synthase II from Synechocystis sp. (ki.se)
  • 2004. Soy protein affects serum insulin and hepatic SREBP-1 mRNA and reduces fatty liver in rats. (koreascience.or.kr)
  • Following reduction by ferredoxin, the di-iron centre activate molecular oxygen and reactive oxygen intermediates are formed that abstract hydrogen atoms from the bound fatty acid. (ki.se)
  • Immunohistochemical analysis of paraffin-embedded human ovarian carainoma, using Fatty Acid Synthase(GTX109833) antibody at 1:500 dilution. (genetex.com)
  • Fatty Acid Synthase antibody [N1], N-term (GTX109833) diluted at 1:500. (genetex.com)
  • Non-transfected (-) and transfected (+) 293T whole cell extracts (30 µg) were separated by 5% SDS-PAGE, and the membrane was blotted with Fatty Acid Synthase antibody [N1], N-term (GTX109833) diluted at 1:2000. (genetex.com)
  • Fatty Acid Synthase antibody LS-C693932 is an FITC-conjugated rabbit polyclonal antibody to rat Fatty Acid Synthase (FASN). (lsbio.com)
  • In these bacteria, the FAS I system produces palmitic acid, and cooperates with the FAS II system to produce a greater diversity of lipid products. (wikipedia.org)
  • non-alcoholic fatty liver disease (NAFLD) develops if there is any interruption or derangements in lipid metabolim. (scirp.org)
  • Very-long-chain fatty acids (VLCFA) through interdigitation or by modulating formation of lipid rafts may decrease the overall or localized plasma membrane permeability to H2O2, respectively, thus conferring a higher resistance to H2O2. (sigmaaldrich.com)
  • Alteration of membrane lipid composition is a key mechanism for bacteria to survive low-pH environments, and we show that cfa translation increases in an sRNA-dependent manner when cells are subjected to mild acid stress. (asm.org)
  • Abnormalities of lipid metabolism through overexpression of fatty acid synthase (FASN), which catalyzes the formation of long-chain fatty acids, are associated with the development of inflammatory bowel disease (IBD). (springer.com)
  • Using lipid fractionation methodologies, Takayama and colleagues later demonstrated that INH treatment of Mycobacterium tuberculosis inhibited mycolic acid biosynthesis and caused the accumulation of hexacosanoic acid (C 26:0 ), a saturated C 26 fatty acid ( 36 ). (asm.org)
  • Fatty acid synthase (FAS) expression is normally regulated and inhibited by several hormones in normal tissues [ 1 ] and FAS is usually expressed in hormone-sensitive and high-lipid-metabolism cells in humans [ 2 ]. (omicsonline.org)
  • Fatty acid synthase (FAS) is a valuable lipid enzyme involved in lipid biosynthesis and suggested to contribute in tumor carcinogenesis. (springermedizin.de)
  • This study sought to characterize the changes in lipid metabolism gene expression and investigated the role of one enzyme, fatty acid synthase, in DENV infection. (biomedcentral.com)
  • Cameron, N. and Enser, M. (1991) Fatty acid composition of lipid in longissimus dorsi muscle of Duroc and British Landrace pigs and its relationship with eating quality. (koreascience.or.kr)
  • Here, we show that glycogen synthase kinase-3α (GSK-3α) mediates lipid accumulation in the heart. (cdc.gov)
  • FFA-induced overproduction of superoxide activated a variety of proinflammatory signals previously implicated in hyperglycemia-induced vascular damage and inactivated 2 important antiatherogenic enzymes, prostacyclin synthase and eNOS. (jci.org)
  • We evaluated the in vitro effects of the compounds on breast cancer cell growth (SK-Br3, MCF-7, and MDA-MB-231), apoptosis [as assessed by cleavage of poly(ADP-ribose) polymerase], cell signaling (HER2, ERK1/2, and AKT), and fatty acid metabolism enzymes (FASN and CPT-1). (aacrjournals.org)
  • In this study, we examine the role, in the CHIKV viral cycle, of fatty acid synthase (FASN) and stearoyl-CoA desaturase (SCD1), two key lipogenic enzymes required for fatty acid production and early desaturation. (medworm.com)
  • Dietary PUFAs (polyunsaturated fatty acids) co-ordinately suppress transcription of a group of hepatic genes encoding glycolytic and lipogenic enzymes. (portlandpress.com)
  • The activities of two lipogenic enzymes, acetyl-CoA carboxylase and fatty acid synthase, were determined in two transplantable mammary adenocarcinomas (13762 and R3230AC) carried by non-pregnant, pregnant and lactating rats, and in mammary tissue of control animals (non-tumour-carrying) of comparable physiological states. (biochemj.org)
  • In Arabidopsis , monogalactosyldiacylglycerol (MGDG) is synthesized by a multigenic family of MGDG synthases consisting of two types of enzymes differing in their N-terminal portion: type A (atMGD1) and type B (atMGD2 and atMGD3). (pnas.org)
  • The PTGS (COX) enzymes catalyze the conversion of arachidonic acid to prostaglandins in two steps. (wikipedia.org)
  • During mammary-gland differentiation of control or tumour-carrying animals, the activities of acetyl-CoA carboxylase and fatty acid synthase in the lactating gland increased by about 40-50-fold over the values found in non-pregnant animals. (biochemj.org)
  • On the other hand, in tumours carried by lactating dams there were only modest increases (1.5-2-fold) in acetyl-CoA carboxylase and fatty acid synthase compared with the neoplasms carried by non-pregnant animals. (biochemj.org)
  • Overexpression of HER2 in breast cancer cells is considered to induce the expression of acetyl-CoA carboxylase α (ACACA) and fatty acid synthase (FASN) through activation of mammalian target of rapamycin (mTOR) signaling pathway. (elsevier.com)
  • Here, we evaluated the putative role of the lipogenic enzyme fatty acid synthase (FASN) as a major cause of HRG-driven endocrine resistance in ER+/HER2-negative breast cancer cells. (mdpi.com)
  • The lipogenic enzyme fatty acid synthase (FASN) is overexpressed in approximately 80% of ovarian carcinomas. (aacrjournals.org)
  • Fatty acid synthase ( FAS ) is an enzyme that in humans is encoded by the FASN gene . (wikipedia.org)
  • Overexpression of the fatty acid synthase (FASN) gene has been implicated in prostate carcinogenesis. (nih.gov)
  • Here, the gene for a mitochondrially targeted mtFabD was ectopically expressed in Saccharomyces cerevisiae mct1 mutant cells lacking the corresponding mitochondrial malonyl-CoA transferase Mct1p, allowing the mutants to recover their abilities to respire on glycerol and synthesize lipoic acid. (hindawi.com)
  • Using electrophoretic mobility-shift assay and chromatin immunoprecipitation analysis, we demonstrate for the first time that PUFAs decrease in vivo binding of NF-Y and SREBP-1c to the proximal promoter of the hepatic Fasn gene and the promoters of three additional genes, spot 14, stearoyl-CoA desaturase and farnesyl diphosphate synthase that are also down-regulated by PUFA. (portlandpress.com)
  • PZA is a prodrug of the pharmacologically active agent pyrazinoic acid (POA), which is formed upon hydrolysis of the amide by a mycobacterial pyrazinamidase encoded by the pncA gene ( 21 ). (asm.org)
  • The results showed alterations of gene transcription and expression were seen in genes variously associated with lipogenesis, lipolysis and fatty acid β-oxidation during DENV infection. (biomedcentral.com)
  • Trans-chalcone and quercetin down-regulate fatty acid synthase gene expression and reduce ergosterol content in the human pathogenic dermatophyte Trichophyton rubrum. (medchemexpress.com)
  • A region within amino acids 2462-2511 of Human Fatty Acid Synthase (NP_004095.4). (abcam.com)
  • Multalin- and Genedoc-based comparison of the deduced amino acid sequence of M. tuberculosis FabD (Rv2243), E. coli FabD (AP_001718), and S. cerevisiae Mct1p (Yor221cp). (hindawi.com)
  • Black shadings refer to conserved amino acid residues among all three sequences whereas the darker and lighter grey shadings denote regions with more relaxed residue similarities not necessarily shared by the full set of sequences. (hindawi.com)
  • PM20D1 is a bidirectional N-fatty-acyl amino acid synthase/hydrolase that regulates the production of N-fatty-acyl amino acids. (immunodiagnostics.com.hk)
  • 2003. The effects of DLmethionine and DL-methionine hydroxy analogue on growth performance, contents of serum amino acids and activities of digestive proteases in broilers. (koreascience.or.kr)
  • the membrane-binding domain consists of a series of amphipathic α helices with several hydrophobic amino acids exposed to a membrane monolayer. (wikipedia.org)
  • Fatty acid biosynthesis is catalyzed in most bacteria by a group of highly conserved proteins known as the type II fatty acid synthase (FAS II) system. (nih.gov)
  • Among its related pathways are Fatty acid biosynthesis (KEGG) and Sterol Regulatory Element-Binding Proteins (SREBP) signalling . (genecards.org)
  • The enzyme fatty acid synthase (FASN) has been shown to be a key therapeutic target in cancer given its importance in tumor biology. (aacrjournals.org)
  • However, INH treatment of Mycobacterium tuberculosis causes the accumulation of hexacosanoic acid (C 26:0 ), a result unexpected for the blocking of an enoyl-reductase. (asm.org)
  • Effect of an enriched cholesterol diet during gestation on fatty acid synthase, HMG-CoA reductase and SREBP-1/2 expressions in rabbits. (biomedsearch.com)
  • FAS synthesizes long-chain, saturated fatty acids from acetyl-CoA, malonyl-CoA, and nicotineamide-adenine dinucleotide phosphate. (aacrjournals.org)
  • Inhibitor of fatty acid synthase (FAS) reducing food intake and body weight in mice. (agscientific.com)
  • Orlistat is a novel inhibitor of fatty acid synthase with antitumor activity. (semanticscholar.org)
  • In this study, curcumin is found to be an effective inhibitor of fatty acid synthase (FAS), and its effects on adipocytes are further evaluated. (deepdyve.com)
  • Cerulenin, the best known natural inhibitor of fatty acid synthase ( FAS ), is an epoxide produced by the fungus Cephalosporium caeruleus . (medchemexpress.com)
  • Polyketide synthases use a similar mechanism and homologous domains to produce secondary metabolite lipids. (wikipedia.org)
  • Wax esters are hydrophobic lipids consisting of a fatty acid moiety linked to a fatty alcohol with an ester bond. (nih.gov)
  • Long-chain fatty acids are essential constituents of all biological membrane lipids and are important substrates for energy metabolism. (aacrjournals.org)
  • Under normal conditions, cells generally use circulating fatty acids from dietary lipids. (aacrjournals.org)
  • Growth hormone (GH) diminishes adipose tissue mass in vivo and decreases expression and activity of fatty acid synthase (FAS) in adipocytes. (diabetesjournals.org)
  • In addition, studies have shown that PRL reduces lipoprotein lipase (LPL) activity in cultured human adipocytes ( 18 ) and the activity of LPL and fatty acid synthase (FAS) in adipose tissue of lactating mice ( 24 ). (diabetesjournals.org)
  • Has been proposed to activiate CPT-1 activity in liver and adipose tissue, leading to increased fatty acid oxidation and energy production. (agscientific.com)
  • Type I systems utilise a single large, multifunctional polypeptide and are common to both mammals and fungi (although the structural arrangement of fungal and mammalian synthases differ). (wikipedia.org)
  • During the purification of GSTs from pancreas as well as from heart, liver, lung, brain and muscle, the fatty acid ethyl ester synthase (FAEES) activity was monitored in order to evaluate the role of GSTs in metabolism of ethanol, as suggested in earlier studies. (biochemj.org)
  • Fatty acid synthase (FAS) is a key enzyme in the de novo biosynthesis of fatty acids. (aacrjournals.org)
  • Novel antagonists of the thioesterase domain of human fatty acid synthase. (semanticscholar.org)
  • Human fatty acid synthase: structure and substrate selectivity of the thioesterase domain. (semanticscholar.org)
  • This study investigated the biological significance of the inhibition of fatty acid synthase (FAS) in multiple myeloma (MM) using the small molecule inhibitor Cerulenin. (harvard.edu)
  • Both systemic and intracerebroventricular treatment of mice with fatty acid synthase (FAS) inhibitors (cerulenin and a synthetic compound C75) led to inhibition of feeding and dramatic weight loss. (sciencemag.org)
  • Cerulenin covalently binds to the catalytic site of FAS and disrupts the condensation reaction of acetyl-COA and malonyl-COA, inhibiting the biosynthesis of fatty acids and sterols in yeast. (medchemexpress.com)
  • Cerulenin blockade of fatty acid synthase reverses hepatic steatosis in ob/ob mice. (medchemexpress.com)
  • C75 is a small compound that inhibits fatty acid synthase, a key enzyme in the control of fatty acid metabolism that also stimulates fatty acid oxidation. (ovid.com)
  • Altogether, our results identify FASN and SCD1 as conserved druggable cofactors of Alphavirus genome replication and support the broad-spectrum activity of drugs targeting the host fatty acids metabolism. (medworm.com)
  • Objective Non-oxidative metabolism of ethanol (NOME) produces fatty acid ethyl esters (FAEEs) via carboxylester lipase (CEL) and other enzyme action implicated in mitochondrial injury and acute pancreatitis (AP). (bmj.com)
  • Design Intracellular calcium ([Ca 2+ ] C ), NAD(P)H, mitochondrial membrane potential and activation of apoptotic and necrotic cell death pathways were examined in isolated pancreatic acinar cells in response to ethanol and/or palmitoleic acid (POA) in the presence or absence of 4-methylpyrazole (4-MP) to inhibit oxidative metabolism. (bmj.com)
  • Conclusions A combination of low ethanol and fatty acid that did not exert deleterious effects per se became toxic when oxidative metabolism was inhibited. (bmj.com)
  • Fatty acids (FAs) 1 for animal metabolism have 2 sources, exogenously derived (dietary) FAs and de novo endogenously synthesized FAs. (aaccjnls.org)
  • Fat metabolism in higher plants - properties of a soluble fatty acid synthetase from avocado mesocarp. (microbiologyresearch.org)
  • In addition, carnitine palmitoyltransferase-1 (CPT-1) inhibitor up-regulated the ceramide and BNIP3 levels in these cells, whereas treatment of tumor cells with FAS siRNA in the presence of a ceramide synthase inhibitor abrogated the up-regulation of BNIP3 and inhibited apoptosis. (aacrjournals.org)
  • It has been suggested that cell death resulting from the blockade of FAS may be metabolic in origin and occurs due to inhibition of fatty acid β-oxidation ( 10 ). (aacrjournals.org)
  • It has been reported that inhibition of fatty-acid synthase (FAS) is selectively cytotoxic to human cancer cells. (elsevier.com)
  • The products of FAS, palmitate and stearate (C18), also serve as substrates for chain elongation to produce very-long-chain fatty acids. (pnas.org)
  • They proposed three possible sites of action: (i) a desaturase, (ii) a cyclopropanase, and (iii) an enzyme involved in long-chain fatty acid elongation. (asm.org)
  • FASN catalyzes the formation of long-chain fatty acids such as palmitate. (utexas.edu)
  • Fatty acid synthase (FASN), EC 2.3.1.85, is a multienzyme that catalyzes the conversion of acetyl-CoA and malonyl-CoA to the 16-carbon fatty acid palmitate. (genecards.org)
  • Activation of AKT and overexpression of fatty acid synthase (FAS) are frequently observed in human ovarian cancer. (elsevier.com)
  • Biochemistry, molecular biology, and pharmacology of fatty acid synthase, an emerging therapeutic target and diagnosis/prognosis marker. (semanticscholar.org)
  • Administration of C75 after hemorrhage and resuscitation decreased the increase in serum free fatty acids, decreased markers of tissue injury, downregulated the expression of inflammatory mediators, and decreased neutrophil infiltration and lung injury. (ovid.com)
  • Treatment with C75 in colitis mice inhibited the elevation of FASN, cyclooxygenase-2 and inducible nitric oxide synthase expression as well as IκB degradation in colon tissues. (springer.com)
  • Increased fatty acid synthase (FAS) expression is detected in various cancers. (omicsonline.org)
  • Modulation of fatty acid synthase enzyme activity and expression during hepatitis C virus replication. (semanticscholar.org)
  • Fatty acid synthase as a tumor marker: its extracellular expression in human breast cancer. (semanticscholar.org)
  • Fatty acid synthase (FASN) is normally upregulated during human prostate cancer onset and metastatic progression and its expression positively correlates with the development of advanced metastatic disease. (jefferson.edu)
  • The expression of fatty acid synthase (FASE) is an early event in the development and progression of squamous cell carcinoma of the lung. (springermedizin.de)
  • However, newly identified transcriptional factors in bacterial fatty acid biosynthetic pathways are a fertile field for new investigation into the genetic control of the FAS II system. (nih.gov)
  • Discover related pathways, diseases and genes to Fatty Acid Synthase/FASN. (novusbio.com)
  • Fatty Acid Synthase (FAS) is a very large enzymatic system involved in de novo lipogenesis (triglyceride production). (novusbio.com)
  • Fatty acid biosynthesis requires a coordinated series of enzymatic reactions. (aacrjournals.org)
  • Fatty-acid synthase (FAS) (EC 2.3.1.85'2.3.1.85) is a key enzyme in lipogenesis. (scirp.org)
  • The present study evaluated novel anticancer compounds that inhibited FASN activity and did not have effects on fatty acid oxidation or caused weight loss in experimental animals. (aacrjournals.org)
  • 16 - 18 ), the enzyme responsible for the regulation of mitochondrial fatty acid oxidation. (aacrjournals.org)
  • This enzyme also plays a pivotal role in energy homeostasis by converting excess carbon intake into fatty acids for storage, which, when necessary, provide energy via β-oxidation ( 1 ). (aacrjournals.org)
  • The observations that 5-Cl-PZA inhibits fatty acid synthase I (FASI) in M. smegmatis and that both 5-Cl PZA and PZA inhibit M. tuberculosis FASI (albeit with the proviso that PZA requires acidic conditions) ( 32 ) suggest that FASI is a potential antituberculosis drug target. (asm.org)
  • Fatty acid synthase (FASN) is overexpressed in human breast carcinoma. (aacrjournals.org)
  • Kusakabe T, Nashimoto A, Honma K, Suzuki T. Fatty acid synthase is highly expressed in carcinoma, adenoma and in regenerative epithelium and intestinal metaplasia of the stomach. (springermedizin.de)
  • Fatty acid synthase and stearoyl-CoA desaturase-1 are conserved druggable cofactors of Old World Alphavirus genome replication. (medworm.com)
  • There are multiple potential sources of reactive species in the myocardium including the mitochondrial electron transport chain, xanthine oxidase, NADPH oxidases, and uncoupled nitric oxide synthases (NOS), while the antioxidant (reducing) defenses include glutathione, superoxide dismutase, and thioredoxin. (frontiersin.org)
  • A fatty acid synthase blockade induces tumor cell-cycle arrest by down-regulating Skp2. (semanticscholar.org)
  • Interference of fatty acid synthase with either siRNA or orlistat had marked effects on virus production, with orlistat having an EC 50 value of 10.07 μM at 24 h post infection. (biomedcentral.com)
  • FASII is dedicated to the production of mycolic acids and is targeted by isoniazid, which represents only one of less than a handful of veteran first-line drugs for combating Mycobacterium tuberculosis . (hindawi.com)
  • Similarly, INH treatment of Mycobacterium bovis BCG caused an inhibition of mycolic acid biosynthesis, a decrease in C 16:0 , and a concomitant accumulation of C 26:0 . (asm.org)
  • Mycobacterium phlei fatty acid synthetase - a bacterial multienzyme complex. (microbiologyresearch.org)
  • The sRNA RydC was previously shown to stabilize cfa (cyclopropane fatty acid synthase) mRNA, resulting in higher levels of cyclopropane fatty acids in the cell membrane. (asm.org)
  • One postsynthetic modification is the conversion of a preexisting UFA to a cyclopropane fatty acid (CFA) by the enzyme cyclopropane fatty acid synthase (encoded by cfa ). (asm.org)
  • In enzymology, a cyclopropane-fatty-acyl-phospholipid synthase (EC 2.1.1.79) is an enzyme that catalyzes the chemical reaction S-adenosyl-L-methionine + phospholipid olefinic fatty acid ⇌ {\displaystyle \rightleftharpoons } S-adenosyl-L-homocysteine + phospholipid cyclopropane fatty acid Thus, the two substrates of this enzyme are S-adenosyl methionine and phospholipid olefinic fatty acid, whereas its two products are S-adenosylhomocysteine and phospholipid cyclopropane fatty acid. (wikipedia.org)
  • Other names in common use include cyclopropane synthetase, unsaturated-phospholipid methyltransferase, cyclopropane synthase, cyclopropane fatty acid synthase, cyclopropane fatty acid synthetase, and CFA synthase. (wikipedia.org)
  • CONTEXT Circulating fatty acid synthase (FASN) is a biomarker of metabolically demanding human diseases. (diabetesjournals.org)
  • Human Fatty Acid Synthase/FASN ELI. (novusbio.com)
  • Fatty acid synthase (FAS) is the major enzyme in lipogenesis, and its circulating level is a bi-omarker of metabolically demanding human diseases. (scirp.org)
  • As found in many other types of human tumors, overexpression or hyperactivation of FAK and fatty acid synthase (FAS) has recently been found in most ovarian cancers, in which it is highly associated with high aggressiveness and poor patient survival ( 4 , 9 - 11 ). (aacrjournals.org)
  • Fatty acid synthase (FASN) is frequently activated and overexpressed in human cancers, and plays a crucial role in the carcinogenesis of various cancers. (biomedcentral.com)
  • The latter biosynthesis is catalyzed by FA synthase (FASN), which synthesizes long-chain FAs by using acetyl coenzyme A (CoA) as a primer, malonyl-CoA as a 2-carbon donor, and NADPH as reducing equivalent. (aaccjnls.org)
  • Fatty acid synthase (FAS) is a 250-270 kd cytosolic multifunctional polypeptide required for the conversion of dietary carbohydrates to fatty acids. (aacrjournals.org)
  • Fatty acid synthase (FAS) is necessary for growth and survival of tumor cells and is a promising drug target for oncology. (semanticscholar.org)
  • Caveolin-1 is required for the upregulation of fatty acid synthase (FASN), a tumor promoter, during prostate cancer progression. (jefferson.edu)
  • and Lisanti, Michael P, "Caveolin-1 is required for the upregulation of fatty acid synthase (FASN), a tumor promoter, during prostate cancer progression. (jefferson.edu)
  • 2017). Engineering fatty acid synthases for directed polyketide production. (mpg.de)
  • In this study, we engineered fatty acid synthases (FAS) for the biosynthesis of short-chain fatty acids and polyketides, guided by a combined in vitro and in silico approach. (mpg.de)
  • The evolutionary history of fatty acid synthases are very much intertwined with that of polyketide synthases (PKS). (wikipedia.org)
  • Furthermore, polyketide synthases also exhibit a Type I and Type II organization. (wikipedia.org)
  • On the basis of the Km values for different substrates and immunodiffusion and immunotitration data, the fatty acid synthase of neoplastic tissues appeared to be indistinguishable from the control mammary-gland enzyme. (biochemj.org)
  • Fatty acids are aliphatic acids fundamental to energy production and storage, cellular structure and as intermediates in the biosynthesis of hormones and other biologically important molecules. (wikipedia.org)
  • Cross Activity: No significant cross-reactivity or interference between Fatty Acid Synthase and analogues was observed. (fishersci.com)
  • The crystal structures of the molecular oxygen analogues, azide and acetate, in complex with desaturase have been determined in order to elucidate how the di-iron centre activates molecular oxygen and further controls the reactive oxygen intermediates to catalyse fatty acid desaturation. (ki.se)
  • SREBP, ACC, and FAS coexpression without Ki-67 occurs in differentiated tissues that may synthesize fatty acids for other functions. (biomedsearch.com)
  • Background: An emerging paradigm supports the notion that deregulation of fatty acid synthase (FASN)-catalyzed de novo FA biogenesis could play a central role in the pathogenesis of metabolic diseases sharing the hallmark of insulin-resistance. (aaccjnls.org)