A plant genus of the family POACEAE that is the source of EDIBLE GRAIN. A hybrid with rye (SECALE CEREALE) is called TRITICALE. The seed is ground into FLOUR and used to make BREAD, and is the source of WHEAT GERM AGGLUTININS.
A plant genus of the family POACEAE. The EDIBLE GRAIN, barley, is widely used as food.
Complex nucleoprotein structures which contain the genomic DNA and are part of the CELL NUCLEUS of PLANTS.
Any method used for determining the location of and relative distances between genes on a chromosome.
The genetic complement of a plant (PLANTS) as represented in its DNA.
Partial cDNA (DNA, COMPLEMENTARY) sequences that are unique to the cDNAs from which they were derived.
The functional hereditary units of PLANTS.
A variety of simple repeat sequences that are distributed throughout the GENOME. They are characterized by a short repeat unit of 2-8 basepairs that is repeated up to 100 times. They are also known as short tandem repeats (STRs).
An increase number of repeats of a genomic, tandemly repeated DNA sequence from one generation to the next.
Microsatellite repeats consisting of three nucleotides dispersed in the euchromatic arms of chromosomes.
Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.
Deoxyribonucleic acid that makes up the genetic material of plants.
Annual cereal grass of the family POACEAE and its edible starchy grain, rice, which is the staple food of roughly one-half of the world's population.
The chromosomal constitution of a cell containing multiples of the normal number of CHROMOSOMES; includes triploidy (symbol: 3N), tetraploidy (symbol: 4N), etc.
Carcinoma that arises from the PANCREATIC DUCTS. It accounts for the majority of cancers derived from the PANCREAS.
Tumors or cancer of the PANCREAS. Depending on the types of ISLET CELLS present in the tumors, various hormones can be secreted: GLUCAGON from PANCREATIC ALPHA CELLS; INSULIN from PANCREATIC BETA CELLS; and SOMATOSTATIN from the SOMATOSTATIN-SECRETING CELLS. Most are malignant except the insulin-producing tumors (INSULINOMA).
A publication issued at stated, more or less regular, intervals.
A malignant epithelial tumor with a glandular organization.
A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.
"The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A plant genus in the CHENOPODIACEAE family.
Plants that can grow well in soils that have a high SALINITY.
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
The goosefoot plant family of the order Caryophyllales, subclass Caryophyllidae, class Magnoliopsida. It includes beets and chard (BETA VULGARIS), as well as SPINACH, and salt tolerant plants.
A plant family of the order Myrtales, subclass Rosidae, class Magnoliopsida. They are mainly trees and shrubs. Many members contain mucilage and COUMARINS.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
The pattern of GENE EXPRESSION at the level of genetic transcription in a specific organism or under specific circumstances in specific cells.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Techniques of nucleotide sequence analysis that increase the range, complexity, sensitivity, and accuracy of results by greatly increasing the scale of operations and thus the number of nucleotides, and the number of copies of each nucleotide sequenced. The sequencing may be done by analysis of the synthesis or ligation products, hybridization to preexisting sequences, etc.
Overlapping of cloned or sequenced DNA to construct a continuous region of a gene, chromosome or genome.
A genus of FUNGI, in the family Magnaporthaceae of uncertain position (incertae sedis). It is best known for its species, M. grisea, which is one of the most popular experimental organisms of all fungal plant pathogens. Its anamorph is PYRICULARIA GRISEA.
Diseases of plants.
The parts of fungi.
A phylum of fungi which have cross-walls or septa in the mycelium. The perfect state is characterized by the formation of a saclike cell (ascus) containing ascospores. Most pathogenic fungi with a known perfect state belong to this phylum.
Proteins found in any species of fungus.
Flagellate EUKARYOTES, found mainly in the oceans. They are characterized by the presence of transverse and longitudinal flagella which propel the organisms in a rotating manner through the water. Dinoflagellida were formerly members of the class Phytomastigophorea under the old five kingdom paradigm.
Toxic or poisonous substances elaborated by marine flora or fauna. They include also specific, characterized poisons or toxins for which there is no more specific heading, like those from poisonous FISHES.
A compound that contains a reduced purine ring system but is not biosynthetically related to the purine alkaloids. It is a poison found in certain edible mollusks at certain times; elaborated by GONYAULAX and consumed by mollusks, fishes, etc. without ill effects. It is neurotoxic and causes RESPIRATORY PARALYSIS and other effects in MAMMALS, known as paralytic SHELLFISH poisoning.
Poisoning from toxins present in bivalve mollusks that have been ingested. Four distinct types of shellfish poisoning are recognized based on the toxin involved.
All of the divisions of the natural sciences dealing with the various aspects of the phenomena of life and vital processes. The concept includes anatomy and physiology, biochemistry and biophysics, and the biology of animals, plants, and microorganisms. It should be differentiated from BIOLOGY, one of its subdivisions, concerned specifically with the origin and life processes of living organisms.
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.
A plant species of the family POACEAE. It is a tall grass grown for its EDIBLE GRAIN, corn, used as food and animal FODDER.
An excited state of molecular oxygen generated photochemically or chemically. Singlet oxygen reacts with a variety of biological molecules such as NUCLEIC ACIDS; PROTEINS; and LIPIDS; causing oxidative damages.
The reproductive organs of plants.

Mining SNPs from EST databases. (1/3795)

There is considerable interest in the discovery and characterization of single nucleotide polymorphisms (SNPs) to enable the analysis of the potential relationships between human genotype and phenotype. Here we present a strategy that permits the rapid discovery of SNPs from publicly available expressed sequence tag (EST) databases. From a set of ESTs derived from 19 different cDNA libraries, we assembled 300,000 distinct sequences and identified 850 mismatches from contiguous EST data sets (candidate SNP sites), without de novo sequencing. Through a polymerase-mediated, single-base, primer extension technique, Genetic Bit Analysis (GBA), we confirmed the presence of a subset of these candidate SNP sites and have estimated the allele frequencies in three human populations with different ethnic origins. Altogether, our approach provides a basis for rapid and efficient regional and genome-wide SNP discovery using data assembled from sequences from different libraries of cDNAs.  (+info)

UCP4, a novel brain-specific mitochondrial protein that reduces membrane potential in mammalian cells. (2/3795)

Uncoupling proteins (UCPs) are a family of mitochondrial transporter proteins that have been implicated in thermoregulatory heat production and maintenance of the basal metabolic rate. We have identified and partially characterized a novel member of the human uncoupling protein family, termed uncoupling protein-4 (UCP4). Protein sequence analyses showed that UCP4 is most related to UCP3 and possesses features characteristic of mitochondrial transporter proteins. Unlike other known UCPs, UCP4 transcripts are exclusively expressed in both fetal and adult brain tissues. UCP4 maps to human chromosome 6p11.2-q12. Consistent with its potential role as an uncoupling protein, UCP4 is localized to the mitochondria and its ectopic expression in mammalian cells reduces mitochondrial membrane potential. These findings suggest that UCP4 may be involved in thermoregulatory heat production and metabolism in the brain.  (+info)

Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes. (3/3795)

Comparing patterns of gene expression in cell lines and tissues has important applications in a variety of biological systems. In this study we have examined whether the emerging technology of cDNA microarrays will allow a high throughput analysis of expression of cDNA clones generated by suppression subtractive hybridization (SSH). A set of cDNA clones including 332 SSH inserts amplified by PCR was arrayed using robotic printing. The cDNA arrays were hybridized with fluorescent labeled probes prepared from RNA from ER-positive (MCF7 and T47D) and ER-negative (MDA-MB-231 and HBL-100) breast cancer cell lines. Ten clones were identified that were over-expressed by at least a factor of five in the ER-positive cell lines. Northern blot analysis confirmed over-expression of these 10 cDNAs. Sequence analysis identified four of these clones as cytokeratin 19, GATA-3, CD24 and glutathione-S-transferase mu-3. Of the remaining six cDNA clones, four clones matched EST sequences from two different genes and two clones were novel sequences. Flow cytometry and immunofluorescence confirmed that CD24 protein was over-expressed in the ER-positive cell lines. We conclude that SSH and microarray technology can be successfully applied to identify differentially expressed genes. This approach allowed the identification of differentially expressed genes without the need to obtain previously cloned cDNAs.  (+info)

The Dictyostelium developmental cDNA project: generation and analysis of expressed sequence tags from the first-finger stage of development. (4/3795)

In an effort to identify and characterize genes expressed during multicellular development ill Dictyostelium, we have undertaken a cDNA sequencing project. Using size-fractionated subsets of cDNA from the first finger stage, two sets of gridded libraries were constructed for cDNA sequencing. One, library S, consisting of 9984 clones, carries relatively short inserts, and the other, library L, which consists of 8448 clones, has longer inserts. We sequenced all the selected clones in library S from their 3'-ends, and this generated 3093 non-redundant, expressed sequence tags (ESTs). Among them, 246 ESTs hit known Dictyostelium genes and 910 showed significant similarity to genes of Dictyostelium and other organisms. For library L, 1132 clones were randomly sequenced and 471 non-redundant ESTs were obtained. In combination, the ESTs from the two libraries represent approximately 40% of genes expressed in late development, assuming that the non-redundant ESTs correspond to independent genes. They will provide a useful resource for investigating the genetic networks that regulate multicellular development of this organism.  (+info)

Molecular identification of human G-substrate, a possible downstream component of the cGMP-dependent protein kinase cascade in cerebellar Purkinje cells. (5/3795)

G-substrate, an endogenous substrate for cGMP-dependent protein kinase, exists almost exclusively in cerebellar Purkinje cells, where it is possibly involved in the induction of long-term depression. A G-substrate cDNA was identified by screening expressed sequence tag databases from a human brain library. The deduced amino acid sequence of human G-substrate contained two putative phosphorylation sites (Thr-68 and Thr-119) with amino acid sequences [KPRRKDT(p)PALH] that were identical to those reported for rabbit G-substrate. G-substrate mRNA was expressed almost exclusively in the cerebellum as a single transcript. The human G-substrate gene was mapped to human chromosome 7p15 by radiation hybrid panel analysis. In vitro translation products of the cDNA showed an apparent molecular mass of 24 kDa on SDS/PAGE which was close to that of purified rabbit G-substrate (23 kDa). Bacterially expressed human G-substrate is a heat-stable and acid-soluble protein that cross-reacts with antibodies raised against rabbit G-substrate. Recombinant human G-substrate was phosphorylated efficiently by cGMP-dependent protein kinase exclusively at Thr residues, and it was recognized by antibodies specific for rabbit phospho-G-substrate. The amino acid sequences surrounding the sites of phosphorylation in G-substrate are related to those around Thr-34 and Thr-35 of the dopamine- and cAMP-regulated phosphoprotein DARPP-32 and inhibitor-1, respectively, two potent inhibitors of protein phosphatase 1. However, purified G-substrate phosphorylated by cGMP-dependent protein kinase inhibited protein phosphatase 2A more effectively than protein phosphatase 1, suggesting a distinct role as a protein phosphatase inhibitor.  (+info)

Cloning, expression, and genetic mapping of Sema W, a member of the semaphorin family. (6/3795)

The semaphorins comprise a large family of membrane-bound and secreted proteins, some of which have been shown to function in axon guidance. We have cloned a transmembrane semaphorin, Sema W, that belongs to the class IV subgroup of the semaphorin family. The mouse and rat forms of Sema W show 97% amino acid sequence identity with each other, and each shows about 91% identity with the human form. The gene for Sema W is divided into 15 exons, up to 4 of which are absent in the human cDNAs that we sequenced. Unlike many other semaphorins, Sema W is expressed at low levels in the developing embryo but was found to be expressed at high levels in the adult central nervous system and lung. Functional studies with purified membrane fractions from COS7 cells transfected with a Sema W expression plasmid showed that Sema W has growth-cone collapse activity against retinal ganglion-cell axons, indicating that vertebrate transmembrane semaphorins, like secreted semaphorins, can collapse growth cones. Genetic mapping of human SEMAW with human/hamster radiation hybrids localized the gene to chromosome 2p13. Genetic mapping of mouse Semaw with mouse/hamster radiation hybrids localized the gene to chromosome 6, and physical mapping placed the gene on bacteria artificial chromosomes carrying microsatellite markers D6Mit70 and D6Mit189. This localization places Semaw within the locus for motor neuron degeneration 2, making it an attractive candidate gene for this disease.  (+info)

Exon shuffling by L1 retrotransposition. (7/3795)

Long interspersed nuclear elements (LINE-1s or L1s) are the most abundant retrotransposons in the human genome, and they serve as major sources of reverse transcriptase activity. Engineered L1s retrotranspose at high frequency in cultured human cells. Here it is shown that L1s insert into transcribed genes and retrotranspose sequences derived from their 3' flanks to new genomic locations. Thus, retrotransposition-competent L1s provide a vehicle to mobilize non-L1 sequences, such as exons or promoters, into existing genes and may represent a general mechanism for the evolution of new genes.  (+info)

A RAPID algorithm for sequence database comparisons: application to the identification of vector contamination in the EMBL databases. (8/3795)

MOTIVATION: Word-matching algorithms such as BLAST are routinely used for sequence comparison. These algorithms typically use areas of matching words to seed alignments which are then used to assess the degree of sequence similarity. In this paper, we show that by formally separating the word-matching and sequence-alignment process, and using information about word frequencies to generate alignments and similarity scores, we can create a new sequence-comparison algorithm which is both fast and sensitive. The formal split between word searching and alignment allows users to select an appropriate alignment method without affecting the underlying similarity search. The algorithm has been used to develop software for identifying entries in DNA sequence databases which are contaminated with vector sequence. RESULTS: We present three algorithms, RAPID, PHAT and SPLAT, which together allow vector contaminations to be found and assessed extremely rapidly. RAPID is a word search algorithm which uses probabilities to modify the significance attached to different words; PHAT and SPLAT are alignment algorithms. An initial implementation has been shown to be approximately an order of magnitude faster than BLAST. The formal split between word searching and alignment not only offers considerable gains in performance, but also allows alignment generation to be viewed as a user interface problem, allowing the most useful output method to be selected without affecting the underlying similarity search. Receiver Operator Characteristic (ROC) analysis of an artificial test set allows the optimal score threshold for identifying vector contamination to be determined. ROC curves were also used to determine the optimum word size (nine) for finding vector contamination. An analysis of the entire expressed sequence tag (EST) subset of EMBL found a contamination rate of 0.27%. A more detailed analysis of the 50 000 ESTs in est10.dat (an EST subset of EMBL) finds an error rate of 0.86%, principally due to two large-scale projects. AVAILABILITY: A Web page for the software exists at http://bioinf.man.ac.uk/rapid, or it can be downloaded from ftp://ftp.bioinf.man.ac.uk/RAPID CONTACT: [email protected]  (+info)

article{e9ac4e46-7f3f-4f79-aec3-ce5508715b29, abstract = {Comparative analysis of expressed sequence tags is becoming an important tool in molecular ecology for comparing gene expression in organisms grown in certain environments. Additionally, expressed sequence tag database information can be used for the construction of DNA microarrays and for the detection of single nucleotide polymorphisms. For such applications, we present PHOREST, a web-based tool for managing, analysing and comparing various collections of expressed sequence tags. It is written in PHP (PHP: Hypertext Preprocessor) and runs on UNIX, Microsoft Windows and Macintosh (Mac OS X) platforms.}, author = {Ahrén, Dag and Troein, Carl and Johansson, Tomas and Tunlid, Anders}, issn = {1471-8278}, language = {eng}, number = {2}, pages = {311--314}, publisher = {Wiley-Blackwell}, series = {Molecular Ecology Notes}, title = {PHOREST: a web-based tool for comparative analyses of expressed sequence tag data}, url = ...
EST sequences are valuable data for gene discovery, especially for plant species with large genomes that have not been fully sequenced, and they provide a convenient means of accessing the transcriptome of a given species. However, ESTs generally correspond to only partial cDNA sequences, and EST samples are typically highly redundant (especially if EST sets are not derived from normalized EST libraries). Therefore, the assembly of overlapping ESTs into putative unique transcript contigs on a frequent and regular basis constitutes the first step for all EST analyses performed at PlantGDB (for more details, see http://www.plantgdb.org/prj/ESTCluster/progress.php). A similar analysis is provided by the TIGR gene indices for selected species with sufficiently large numbers of ESTs (http://www.tigr.org/tdb/tgi/plant.shtml; Lee et al., 2005).. EST assembly remains a computational challenge given the large number of EST sequences currently available. For example, with more than 400,000 maize ESTs, ...
Read Large-scale EST sequencing in rice, Plant Molecular Biology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
A normalised cDNA library was constructed from Bermudagrass to attain notion into the transcriptome of Cynodondactylon L. An entire of 15 588 high-top quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Evaluation Gene Indices clustering devices to offer a unigene set.. An entire of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation course of was environment friendly. A giant-scale comparative genomic analysis of the unigenes was carried out using publicly obtainable devices, harking back to BLAST, InterProScan and Gene Ontology. The unigenes have been moreover subjected to a search for EST-derived straightforward sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), which might be useful as DNA markers.. Although the candidate EST-SSRs and CISPs found throughout the present study needs to be empirically examined, ...
Theoretical considerations predict that amplification of expressed gene transcripts by reverse transcription-PCR using arbitrarily chosen primers will result in the preferential amplification of the central portion of the transcript. Systematic, high-throughput sequencing of such products would result in an expressed sequence tag (EST) database consisting of central, generally coding regions of expressed genes. Such a database would add significant value to existing public EST databases, which consist mostly of sequences derived from the extremities of cDNAs, and facilitate the construction of contigs of transcript sequences. We tested our predictions, creating a database of 10,000 sequences from human breast tumors. The data confirmed the central distribution of the sequences, the significant normalization of the sequence population, the frequent extension of contigs composed of existing human ESTs, and the identification of a series of potentially important homologues of known genes. This approach
Sequencing of expressed sequence tags (ESTs) has been one of the primary techniques used for transcriptome analysis in a wide spectrum of species including those utilized for aquaculture. However, many researchers are still unfamiliar with the many genome applications and byprod- ucts of EST analysis, and they often regard ESTs as only short random sequences. Additionally, lack of cDNA library normalization, project planning, and quality control have often restricted the value of EST resources created in many laboratories. This review aims to address these issues by providing information on the construction of normalized cDNA libraries for efficient generation and analysis of ESTs and by highlighting the significance of EST analysis for the genome research of species lacking a sequenced genome. A successful EST project can provide the sequence tools needed for not only gene discovery, but also for physical, linkage and compara- tive mapping, analysis of alternative splicing and gene duplication, ...
Several methods have been developed for the comprehensive analysis of gene expression in complex biological systems. Generally these procedures assess either a portion of the cellular transcriptome or a portion of the cellular proteome. Each approach has distinct conceptual and methodological advantages and disadvantages. We have investigated the application of both methods to characterize the gene expression pathway mediated by androgens and the androgen receptor in prostate cancer cells. This pathway is of critical importance for the development and progression of prostate cancer. Of clinical importance, modulation of androgens remains the mainstay of treatment for patients with advanced disease. To facilitate global gene expression studies we have first sought to define the prostate transcriptome by assembling and annotating prostate-derived expressed sequence tags (ESTs). A total of 55000 prostate ESTs were assembled into a set of 15953 clusters putatively representing 15953 distinct transcripts.
Abstract Expressed sequence tags (ESTs) are complementary deoxyribonucleic acid (cDNA) fragments, which are reverse transcribed from mature ribonucleic acid (mRNA), a direct gene transcript. ESTs are a readily rich information source of complete expressed gene sequences. They reveal the type and number of genes being expressed in an organism. Joining ESTs into complete gene sequences is computationally expensive because they are numerous, erroneous, redundant and mixed up. ESTs that originate from the same gene are grouped together. This enables efficient consensus sequences generation, which reveals underlying gene sequences and their possible alternative splicings. EST clustering enables efficient discovery of expressed genes based on which several fields rely such as: disease diagnostics, drug discovery, genetic engineering, alternative splicing and many others. Most clustering algorithms developed so far are quadratic and their running time is prohibitively high. A tree-structured index ...
Isolation and sequence analysis of ZNRF2. The full-length cDNA sequence of human and mouse ZNRF2 was determined by analyzing expressed sequence tag (EST) clones (wh57e11, wi35c02, and xs53e14 for human; ux04e08, my52g11, and mu26f10 for mouse) obtained from the Washington University-Merck EST project. These clones were sequenced completely, and the sequence information was combined with those present in GenBank (Unigene clusters Hs.127294, Hs.209125, Hs.288088, Hs.300734, and Hs.351657 for human and Mm.423 and Mm.158534 for mouse) to create contiguous full-length sequences. Sequence editing, mapping, alignment, and contig production was performed using the DNASTAR (Madison, WI) and Vector NTI Suite 6 (InforMax, Frederick, MD) software packages. Human genome sequences for ZNRF1 and ZNRF2 were obtained from the database ( accession number AC099508 for ZNRF1; accession number AC006978 for ZNRF2) and compared with cDNA sequences of ZNRF1 and ZNRF2 using BLAST2 (basic local alignment search ...
BACKGROUND: Publicly accessible EST libraries contain valuable information that can be utilized for studies of tissue-specific gene expression and processing of individual genes. This information is, however, confounded by multiple systematic effects arising from the procedures used to generate these libraries. RESULTS: We used alignment of ESTs against a reference set of transcripts to estimate the size distributions of the cDNA inserts and sampled mRNA transcripts in individual EST libraries and show how these measurements can be used to inform quantitative comparisons of libraries. While significant attention has been paid to the effects of normalization and substraction, we also find significant biases in transcript sampling introduced by the combined procedures of reverse transcription and selection of cDNA clones for sequencing. Using examples drawn from studies of mRNA 3-processing (cleavage and polyadenylation), we demonstrate effects of the transcript sampling bias, and provide a
The zebrafish is a powerful system for understanding the vertebrate genome, allowing the combination of genetic, molecular, and embryological analysis. Expressed sequence tags (ESTs) provide a rapid means of identifying an organisms genes for further analysis, but any EST project is limited by the availability of suitable libraries. Such cDNA libraries must be of high quality and provide a high rate of gene discovery. However, commonly used normalization and subtraction procedures tend to select for shorter, truncated, and internally primed inserts, seriously affecting library quality. An alternative procedure is to use oligonucleotide fingerprinting (OFP) to precluster clones before EST sequencing, thereby reducing the re-sequencing of common transcripts. Here, we describe the use of OFP to normalize and subtract 75,000 clones from two cDNA libraries, to a minimal set of 25,102 clones. We generated 25,788 ESTs (11,380 3 and 14,408 5) from over 16,000 of these clones. Clustering of 10,654 ...
TY - JOUR. T1 - Long-range heterogeneity at the 3′ ends of human mRNAs. AU - Iseli, Christian. AU - Stevenson, Brian J.. AU - De Souza, Sandro J.. AU - Samaia, Helena B.. AU - Camargo, Anamaria A.. AU - Buetow, Kenneth H.. AU - Strausberg, Robert L.. AU - Simpson, Andrew J.G.. AU - Bucher, Philipp. AU - Victor Jongeneel, C.. PY - 2002/7/30. Y1 - 2002/7/30. N2 - The publication of a draft of the human genome and of large collections of transcribed sequences has made it possible to study the complex relationship between the transcriptome and the genome. In the work presented here, we have focused on mapping mRNA 3′ ends onto the genome by use of the raw data generated by the expressed sequence tag (EST) sequencing projects. We find that at least half of the human genes encode multiple transcripts whose polyadenylation is driven by multiple signals. The corresponding transcript 3′ ends are spread over distances in the kilobase range. This finding has profound implications for our ...
Author: Hilson, P. et al.; Genre: Journal Article; Published in Print: 2004; Keywords: repeat-containing gene|br/|secondary cell-wall|br/|vacuolar h+-atpase|br/|microarray analysis|br/|escherichia-coli|br/|wide expression|br/|restorer gene|br/|plant-growth|br/|design|br/|thaliana; Title: Versatile gene-specific sequence tags for Arabidopsis functional genomics: Trancript profiling and reverse genetics applications
Purification of CASKIN. Rat brain proteins were affinity-purified on immobilized glutathioneS-transferase (GST)-CASK1-337 fusion protein essentially as described previously (Butz et al., 1998). Three proteins were detectable on Coomassie-stained gels: Mint 1, a 180 kDa protein called Caskin 1 in this study, and a 225 kDa protein. The 180 kDa and 225 kDa bands were eluted from the gel and digested by trypsin, and tryptic peptides were purified by HPLC and sequenced by Edman degradation essentially as described previously (Hata et al., 1993). The 180 kDa peptide sequences did not match any protein in the database except for KIAA and expressed sequence tag (EST) sequences (see Results), whereas the 225 kDa protein was identified as the rat homolog of NEDD4-like ubiquitin ligase 1 (GenBank accession #BAB13352).. cDNA cloning and sequencing. GenBank searches identified a random human brain cDNA (KIAA1306) and human EST clones that contained the sequences of the peptide fragments. To determine the ...
ul,,li,Preparation of EST data: Sequences were extracted from dbEST and were subjected to quality control screening (vector, E. coli, polyA, T, or CT removal, minimum length = 100 bp, < 3% N).,/li,,li,Preparation of transcript (ET) database: All sequences from the appropriate divisions of GenBank (including RefSeq) were extracted. Non-coding sequences were discarded and cDNAs and coding sequences from genomic entries were saved. Sequences and related information (e.g. PubMed links) are stored in the qcGene database (qcGene).,/li,,li,Assembly: Cleaned EST sequences and non-redundant transcript (ET) sequences were combined. Using the Paracel Transcript Assembler Program, sequences were assembled into contigs. TCs are consensus sequences based on two or more ESTs (and possibly an ET) that overlap for at least 40 bases with at least 94% sequence identity. These strict criteria help minimize the creation of chimeric contigs. These contigs are assigned a TC (Tentative Consensus) number. TCs may ...
The DNATools sequencing software package version 5.1.375 is available for downloading at: http://www.crc.dk/phys/Dnatools/A01B04C04_Downloading.htm New in this revision: + Searching with protein strings on nucleotide sequences refined + File list based on Text Header content improved + Auto-build Text Headers after mail blast search improved + SAGE functions improved and thoroughly tested + Reporting facilities after SAGE tag file comparisons improved + Back-translation based on codon usage data now correct + Contig builder/editor improved (simple merge function) + Close redundant files improved (mostly for EST projects) + PSG (project subgroup) file handling improved DNATools is continuously being improved (as you may have noticed as a reader of this news group). This does not imply that upgrading is necessary each time a new revision is released. Im most cases the new revision only corrects minor bugs that you may not have noticed. My ambition, however, is to make bug fixes and improvements ...
Nygaard, V; Liu, Fang; Holden, Marit; Kuo, Winston P.; Trimarchi, Jeff; Ohno-Machado, Lucila; Cepko, Connie L.; Frigessi, Arnoldo; Glad, Ingrid K.; Wiel, Mark A. van de; Hovig, Eivind & Lyng, H (2008). Validation of oligoarrays for quantitative exploration of the transcriptome. BMC Genomics. ISSN 1471-2164. 9 . doi: 10.1186/1471-2164-9-258 Vis sammendrag Background Oligoarrays have become an accessible technique for exploring the transcriptome, but it is presently unclear how absolute transcript data from this technique compare to the data achieved with tag-based quantitative techniques, such as massively parallel signature sequencing (MPSS) and serial analysis of gene expression (SAGE). By use of the TransCount method we calculated absolute transcript concentrations from spotted oligoarray intensities, enabling direct comparisons with tag counts obtained with MPSS and SAGE. The tag counts were converted to number of transcripts per cell by assuming that the sum of all transcripts in a single ...
ESTviewer is a web application for interactively visualizing human gene structures, with emphasis on mammalian and avian expressed sequence tags (ESTs) that are conserved in the human genome and alternatively spliced (AS) variants. AS variants from the UCSC, Vega and PSEP annotations are presented in this application for comparison. EST data from six species, human, mouse, rat, cattle, pig and chicken, are mapped to the human genome to show cross-species EST conservation in annotated exonic and intronic regions. Cross-species EST conservation is evolutionarily and functionally important because it represents the effects of selection pressure on genic regions and transcriptome over evolutionary time. Emphatically, ESTviewer provides a convenient tool to compare highly conserved non-human ESTs and human AS variants. The application takes human gene accession Ids or coordinates of genomic sequences as inputs and presents annotated gene structures and their AS variants. In addition, the lengths and
In this study, we employed in silico analysis to identify a panel of marker genes for NSCLC prognosis and assessment of therapy efficacy. Based on our experimental results, the National Cancer Institute-Cancer Genome Anatomy Project database and the Digital Gene Expression Displayer program are useful tools for identifying differentially expressed genes between two pools of samples provided that a sufficient number of expressed sequence tags libraries for the tissue of interest are archived in the database. The differentially expressed genes can be further developed into marker genes for diagnostic or prognostic purposes by experimental verification procedures such as real-time qPCR.. NSCLC is heterogeneous with respect to histology and biological characteristics (15). Individual NSCLC cells within a tumor and in different patients tumors express different amounts of marker gene transcripts. The heterogeneity of marker gene expression levels in NSCLC cells limits the reliability of an assay ...
Usage: fossil tag SUBCOMMAND ... Run various subcommands to control tags and properties. fossil tag add ?OPTIONS? TAGNAME CHECK-IN ?VALUE? Add a new tag or property to CHECK-IN. The tag will be usable instead of a CHECK-IN in commands such as update and merge. If the --propagate flag is present, the tag value propagates to all descendants of CHECK-IN Options: --raw Raw tag name. --propagate Propagating tag. --date-override DATETIME Set date and time added. --user-override USER Name USER when adding the tag. --dryrun,-n Display the tag text, but do not actually insert it into the database. The --date-override and --user-override options support importing history from other SCM systems. DATETIME has the form YYYY-MMM-DD HH:MM:SS. fossil tag cancel ?--raw? TAGNAME CHECK-IN Remove the tag TAGNAME from CHECK-IN, and also remove the propagation of the tag to any descendants. Use the the --dryrun or -n options to see what would have happened. fossil tag find ?OPTIONS? TAGNAME List all objects that ...
AceView provides a curated, comprehensive and non-redundant sequence representation of all public mRNA sequences (mRNAs from GenBank or RefSeq, and single pass cDNA sequences from dbEST and Trace). These experimental cDNA sequences are first co-aligned on the genome then clustered into a minimal number of alternative transcript variants and grouped into genes. Using exhaustively and with high quality standards the available cDNA sequences evidences the beauty and complexity of mammals transcriptome, and the relative simplicity of the nematode and plant transcriptomes. Genes are classified according to their inferred coding potential; many presumably non-coding genes are discovered. Genes are named by Entrez Gene names when available, else by AceView gene names, stable from release to release. Alternative features (promoters, introns and exons, polyadenylation signals) and coding potential, including motifs, domains, and homologies are annotated in depth; tissues where expression has been ...
The Pig Analysis Database presents accurate pig gene annotations in all sequenced genomic regions. It integrates various available pig sequence data, including 3.84 million whole-genome-shortgun (WGS) reads and 0.7 million Expressed Sequence Tags (ESTs) generated by Sino-Danish Pig Genome Project, and 1 million miscellaneous GenBank records. The Pig Analysis Database has covered nearly 50% of the whole pig genome and over 70% of the coding sequences (CDS), and aims to provide the most complete pig gene set to date.. In addition to gene annotations, the Pig Analysis Database also presents expressional information from 98 EST libraries, SNPs detected from both WGS reads and ESTs, oligos that can be used in microarray design and relevant evolutionary data.. Various views can be found here.. ...
To make an EST, RNA is isolated from cells and reverse transcribed into cDNA. Typically, the cDNA is cloned into a plasmid vector and a read is taken from the 5 and/or 3 primer. For most - but not all - ESTs, the reverse transcription is primed by an oligo-dT, which hybridizes with the poly-A tail of mature mRNA. The reverse transcriptase may or may not make it to the 5 end of the mRNA, which may or may not be degraded. In general, the 3 ESTs mark the end of transcription reasonably well, but the 5 ESTs may end at any point within the transcript. Some of the newer cap-selected libraries cover transcription start reasonably well. Before the cap-selection techniques emerged, some projects used random rather than poly-A priming in an attempt to retrieve sequence distant from the 3 end. These projects were successful at this, but as a side effect also deposited sequences from unprocessed mRNA and perhaps even genomic sequences into the EST databases. Even outside of the random-primed projects, ...
Hubbard T, Barker D, Birney E, Cameron G, Chen Y, Clark L, Cox T, Cuff J, Curwen V, Down T et al. The Ensembl genome database project. Nucleic Acids Res. 2002 Jan 1;30(1):38-41. PMID: 11752248; PMC: PMC99161 Pruitt KD, Harrow J, Harte RA, Wallin C, Diekhans M, Maglott DR, Searle S, Farrell CM, Loveland JE, Ruef BJ et al. The consensus coding sequence (CCDS) project: Identifying a common protein-coding gene set for the human and mouse genomes. Genome Res. 2009 Jul;19(7):1316-23. PMID: 19498102; PMC: PMC2704439 Pruitt KD, Tatusova T, Maglott DR. NCBI Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 2005 Jan 1;33(Database issue):D501-4. PMID: 15608248; PMC: PMC539979 ...
STACK_PACK EST CLUSTERING MANAGEMENT AND ANALYSIS TOOL-SUITE now available SANBI announces the free academic availability of the STACK_PACK EST clustering management and analysis tool-suite. STACK_PACK 1.0 has been developed by SANBI in collaboration with Electric Genetics, Cape Town (PTY) LTD, to support analysis of the increasing EST load for Gene Discovery. The tool-suite interchangeably supports modules such as PHRAP and other assemblers, and includes D2-cluster and CRAW together with other codes specifically developed for the system. STACK_PACK manages flow and stringent analysis of data between these applications. The system creates two outputs: a standard data set as well as a more highly-qualified data subset based upon consensus quality. Alternate splicing and low quality EST consensi are also detected and processed. This system has been used to manufacture STACK, the sequence tag alignment and consensus knowledgebase which is also distributed by SANBI. ...
Nor does this list include all approved institution tags. Our practice on tags for institutions, organizations, named projects, and so on, is in flux. We have tags for some but not all publishers; some but not all universities; some but not all societies; some but not all named projects, and so on. The reason we have some is that some are major players who come up a lot. The reason we dont have all, or dont aspire to have all, is that there are thousands of them. We dont even have a principle or firm border line to help distinguish those that do and dont have tags, or those that should and shouldnt. Bottom line: Feel free to create a tag for any institution, organization, project, and so on. On the other hand, if the institution, organization, or project is mentioned in your description, then users can still find those tag records with keyword searches, even if they cant find them with tag searches; hence feel free to avoid creating or using tags for them ...
Shop for Estée Lauder Personal Care and read product reviews. Find cheap prices on Estée Lauder Personal Care from a selection of brands and stores .
brain, neuroblastoma, non-normalized, cell line, EST, unknown developmental stage, MGC, Rubin non-normalized, size fractionated, plasmid vector, directionally cloned, oligo-dT ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 20000 reputation, your tag wiki will be peer reviewed before it is published.) ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 20000 reputation, your tag wiki will be peer reviewed before it is published.) ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 20000 reputation, your tag wiki will be peer reviewed before it is published.) ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 4000 reputation, your tag wiki will be peer reviewed before it is published.) ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 4000 reputation, your tag wiki will be peer reviewed before it is published.) ...
Lib=934[Homo_sapiens,prostate,prostatic_intraepithelial_neoplasia_- _high_grade,,,adult] Length=234 Length = 234 Plus Strand HSPs: Score = 156 (23.4 bits), Expect = 1.4, P = 0.76 Identities = 82/128 (64%), Positives = 82/128 (64%), Strand = Plus / Plus Query: 225 TGGGAATAAAATT-CTA-AGTGAATACATAAAGAAATTAAAAGAAACTACAGNATCATTA 282 TGG AA AA ATT CT A TG TACATAAAGAAATT A GAAA T AT TT Sbjct: 76 TGGTAACAACATTTCTTCAATGT-TACATAAAGAAATTGAGGGAAATTTTGCAATACTTG 134 Query: 283 AGATTACCAAAATTTA-CATGGACAACTA--CACTTG-ATCTTGTGCAAACATCGACATC 338 G TTACC TTTA C TGGACA A CACT G AT T GC AC T G CA C Sbjct: 135 GGGTTACCTT--TTTATCTTGGACAGTGATCCACTAGTATATCAGGCTGACCTAGTCAAC 192 Query: 339 TA-TGGGTATT 348 T TGG TATT Sbjct: 193 TGGTGGCTATT 203 cbil,dbest,162347>>cbil,dbest,162347 T92226 ye17e11.r1 5 Lib=249[Homo_sapiens,lung,,,,72_years] Length=245 Length = 245 Plus Strand HSPs: Score = 146 (21.9 bits), Expect = 4.6, P = 0.99 Identities = 54/80 (67%), Positives = 54/80 (67%), Strand = Plus / Plus Query: 212 ...
Both examples act differently because the data inside the tags are parsed differently according to the tag type. Now, imagine the parser goes from left to right. In the first case, after entering the div tag, the parser stays as html and opens an a tag with the title attribute (because the closing div tag is text in an attribute, it will not close the tag).. In the second case, when the parser enters the style tag, it changes to CSS parser, which means no a tag is created, and the style tag will be closed where the attribute was supposed to be.. So, how can this information help us in finding vulnerabilities? Imagine a tag that parses differently in different cases, for example, the noscript tag. The trick here is that the noscript tag in HTML is treated differently, whether JavaScript (JS) is enabled or disabled. When JS is enabled, the data inside the tag is parsed as JS. But, when its disabled, the data is parsed as html. In nearly all cases, JS is enabled in browsers.. Lets take a look ...
Lib=9[Plasmodium_falciparum,,,,,] Length=346 Length = 346 Plus Strand HSPs: Score = 184 (27.6 bits), Expect = 0.028, P = 0.028 Identities = 130/206 (63%), Positives = 130/206 (63%), Strand = Plus / Plus Query: 22 TTACA-ATATTTTGTGAATAAACTTTTTGGTGATTTGCCATCAAGTTTTAATTATATGAT 80 TTA A AT TTTTGTGA T A TT TG T TG A AAG AATT T GA Sbjct: 4 TTATACATCTTTTGTGATTTAGGTTAAAA-TG-TATGTTA--AAGAAGAAATTGTG-GAG 58 Query: 81 -AGGCAAAACGATA-GAG-T-ATGA-TATAAAGATTAGTTATTATGAAATATATGAAGGG 135 A G AAAAC AT GA T AT A TA AAAGA AG A AT AAATATATGAA GG Sbjct: 59 GAAGAAAAACTATCTGATATTATCAATAAAAAGAA-AGAAAACATAAAATATATGAAAGG 117 Query: 136 CATGNTAAAAATGGTGAAGAGGTTTGTGT-ATTT-ATATATGAGAAGAA--TAATAAAGA 191 ATG AAAA T TGAA A TT G ATTT A A TGA A GAA TA T A GA Sbjct: 118 AATG--AAAATTCCTGAAAATATTCTAGCCATTTCAAACTTGA-AGGAAGTTATTGATGA 174 Query: 192 AACGAGTTTTGTAAAANGATATATAAA-ACNCCATT 226 C AG TTTGT AA T TAT A AC CCA T Sbjct: 175 TGC-AGATTTGTTAATATTTGTATTACCACACCAAT 209 cbil,dbest,1133595>>cbil,dbest,1133595 AA488925 aa55b10.r1 5 ...
Hi i have created several div tags and the corresponding css ids and am having a problem with creating a final tag that will house 3 individual div tags. the problem tag is the #selection tag. i...
In gene expression when exposed to CO2 elevated to 560 mmolmol21. The expression of 4600 expressed sequence tags in poplar have been investigated by Gupta et
The most important resource in your organization is your People. Labor Efficiency Ratio tool discovers if have the right people, doing the right things right?
标签蛋白的表达是研究目标蛋白的一种重要办法。而这个可能会影响到蛋白结构和功能研究的蛋白标签往往需要被去除。该视频介绍了几种用于标签蛋白柱上酶切的试剂,以及在使用过程中的一些小技巧。. The expression of tagged proteins is the major source of proteins for research purposes. It is often recommended to remove the tag, which might otherwise interfere with protein function or interactions. This video will give you some examples of automated on-column tag removal with different cleavage agents ...
HRP偶联6X His tag®抗体(ab1269)经WB, ELISA, ICC实验严格验证,被3篇文献引用并得到3个独立的用户反馈,实验条件参看说明书。中国75%以上现货。
Get your new Doctor luggage tags from Zazzle. Choose any of our great designs for your bag tag and help your luggage stand out. Start shopping today!
HA tag兔多克隆抗体(ab75640)经WB, IP实验严格验证,被1篇文献引用。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
The public EST (expressed sequence tag) databases represent an enormous but heterogeneous repository of sequences, including many from a broad selection of
Transcriptome analysis can provide useful data for refining genome sequence annotation. Application of massively parallel signature sequencing (MPSS) revealed reproducible transcription, in multiple MPSS cycles, from 73% of computationally predicted genes in the Theileria parva schizont lifecycle stage. Signatures spanning consecutive exons confirmed 142 predicted introns. MPSS identified 83 putative genes, , 100 codons overlooked by annotation software, and 139 potentially incorrect gene models (with either truncated ORFs or overlooked exons) by interfacing signature locations with stop codon maps. Twenty representative models were confirmed as likely to be incorrect using reverse transcription PCR amplification from independent schizont cDNA preparations. More than 50% of the 60 putative single copy genes in T. parva that were absent from the genome of the closely related T. annulata had MPSS signatures. This study illustrates the utility of MPSS for improving annotation of small, gene-rich ...
TY - JOUR. T1 - Annotation and analysis of 10,000 expressed sequence tags from developing mouse eye and adult retina.. AU - Yu, Jindan. AU - Farjo, Rafal. AU - MacNee, Sean P.. AU - Baehr, Wolfgang. AU - Stambolian, Dwight E.. AU - Swaroop, Anand. N1 - Copyright: This record is sourced from MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine. PY - 2003. Y1 - 2003. N2 - BACKGROUND: As a biomarker of cellular activities, the transcriptome of a specific tissue or cell type during development and disease is of great biomedical interest. We have generated and analyzed 10,000 expressed sequence tags (ESTs) from three mouse eye tissue cDNA libraries: embryonic day 15.5 (M15E) eye, postnatal day 2 (M2PN) eye and adult retina (MRA). RESULTS: Annotation of 8,633 non-mitochondrial and non-ribosomal high-quality ESTs revealed that 57% of the sequences represent known genes and 43% are unknown or novel ESTs, with M15E having the highest percentage of novel ESTs. Of these, 2,361 ESTs ...
Little information is available on gene expression profiling of halophyte A. canescens. To elucidate the molecular mechanism for stress tolerance in A. canescens, a full-length complementary DNA library was generated from A. canescens exposed to 400 mM NaCl, and provided 343 high-quality ESTs. In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ESTs) were identified according to their significant similarities with proteins of known functions. All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. According to Arabidopsis MIPS functional category and GO classifications, we identified 193 unigenes of the 311 annotations EST, representing 72 non-redundant unigenes sharing similarities with genes related to the defense response. The sets of ESTs obtained provide a rich genetic resource and 17 up-regulated genes related to salt stress resistance were identified by qRT-PCR.
dbEST is a division of GenBank that contains sequence data and other information on single-pass cDNA sequences, or Expressed Sequence Tags, from a number of organisms. Expressed Sequence Tags (ESTs) are short (usually about 300-500 bp), single-pass sequence reads from mRNA (cDNA). Typically they are produced in large batches. They represent a snapshot of genes expressed in a given tissue and/or at a given developmental stage. They are tags (some coding, others not) of expression for a given cDNA library. Most EST projects develop large numbers of sequences. These are commonly submitted to GenBank and dbEST as batches of dozens to thousands of entries, with a great deal of redundancy in the citation, submitter and library information. To improve the efficiency of the submission process for this type of data, we have designed a special streamlined submission process and data format. dbEST also includes sequences that are longer than the traditional ESTs, or are produced as single sequences or ...
Citation: Vogel, J.P., Gu, Y.Q., Twigg, P., Lazo, G.R., Chingcuanco, D.L., Hayden, D.M., Donze, T., Vivia-Lindsay, A., Stamova, B., Coleman-Derr, D. 2006. EST sequencing and phylogenetic analysis of the model grass brachypodium distachyon. Theoretical and Applied Genetics. 113: 186-195. Interpretive Summary: Brachypodium distachyon is a small grass that serves as a model system for the temperate grasses (i.e. forage grasses and cereals). Expressed sequence tags (ESTs) are short DNA sequences from random cDNAs (genes). ESTs are useful tools for many functional and physical genomic experiments including the construction of microarrays and the development of molecular markers. This paper describes the sequencing of a large collection of ESTs from five different cDNA libraries. Analysis of the ESTs included the identification of putative lignin biosynthetic genes and the construction of phylogentic trees that demonstrated the close relationship of Brachypodium to wheat and barley. Technical ...
Expressed sequence tags (EST) are potential source for the development of genic microsatellite markers, gene discovery, comparative genomics, and other genomic studies. In the present study, 7630 ESTs were examined from NCBI for SSR identification and characterization. A total of 263 SSRs were identified with an average density of one SSR/4.2 kb (3.4% frequency). Analysis revealed that trinucleotide repeats (47.52%) were most abundant followed by tetranucleotide (19.77%), dinucleotide (19.01%), pentanucleotide (9.12%), and hexanucleotide repeats (4.56%). Functional annotation was done through homology search and gene ontology, and 35 EST-SSRs were selected. Primer pairs were designed for evaluation of cross transferability and polymorphism among 11 plants belonging to five different families. Total 402 alleles were generated at 155 loci with an average of 2.6 alleles/locus and the polymorphic information content (PIC) ranged from 0.15 to 0.92 with an average of 0.75.
Despite advances in sequencing technology, we are still a long way from having well-annotated genome sequences for all organisms of interest. Instead, EST (Expressed Sequence Tag) data is available for less popular organisms in many cases, prior to a genome project. EST data presents a particular challenge for the identification of proteins using mass spectrometry (MS): it is often redundant (multiple copies of the same gene), consists primarily of short fragments of coding sequence, contains many sequencing errors and is generally poorly annotated. Nevertheless, generating EST libraries represents a much cheaper alternative to full genome sequence and has the advantage of focusing on the parts of the genome of interest to proteomics, i.e. the expressed genes, many of which will be protein-coding. The School of Biological Sciences, Centre for Proteomic Research and the National Oceanography Centre, Southampton have been collaborating to develop bioinformatics analysis tools to help clean up the ...
In genetics, an expressed sequence tag (EST) is a short sub-sequence of a cDNA sequence. ESTs may be used to identify gene transcripts, and are instrumental in gene discovery and in gene-sequence determination. The identification of ESTs has proceeded rapidly, with approximately 74.2 million ESTs now available in public databases (e.g. GenBank 1 January 2013, all species). An EST results from one-shot sequencing of a cloned cDNA. The cDNAs used for EST generation are typically individual clones from a cDNA library. The resulting sequence is a relatively low-quality fragment whose length is limited by current technology to approximately 500 to 800 nucleotides. Because these clones consist of DNA that is complementary to mRNA, the ESTs represent portions of expressed genes. They may be represented in databases as either cDNA/mRNA sequence or as the reverse complement of the mRNA, the template strand. One can map ESTs to specific chromosome locations using physical mapping techniques, such as ...
Siamese mud carp (Henichorynchus siamensis) is a freshwater teleost of high economic importance in the Mekong River Basin. However, genetic data relevant for delineating wild stocks for management purposes currently are limited for this species. Here, we used 454 pyrosequencing to generate a partial genome survey sequence (GSS) dataset to develop simple sequence repeat (SSR) markers from H. siamensis genomic DNA. Data generated included a total of 65,954 sequence reads with average length of 264 nucleotides, of which 2.79% contain SSR motifs. Based on GSS-BLASTx results, 10.5% of contigs and 8.1% singletons possessed significant similarity (E value | 10-5) with the majority matching well to reported fish sequences. KEGG analysis identified several metabolic pathways that provide insights into specific potential roles and functions of sequences involved in molecular processes in H. siamensis. Top protein domains detected included reverse transcriptase and the top putative functional transcript identified
At PlantGDB, efforts are undertaken to identify and remove all contaminant DNA so that a clean dataset is made available to researchers. Here, we use the Vmatch program (with options -l 50 -identity 90) to screen EST sequences against UniVec for vector contaminations as well as against E. coli genomes for bacterial sequences contaminations. The table lists the individual contaminated sequence. (Return to Vector Contamination menu). ...
1 #include ,graphics.h, 2 3 #include ,iostream.h, 4 #include ,math.h, 5 #include ,dos.h, 6 #include ,conio.h, 7 8 void main( ) 9 { 10 float x, y, x1, y1, x2, y2, dx, dy, step; 11 int i, gd = DETECT, gm; 12 initgraph(&gd, &gm, C:\\TURBOC3\\BGI); 13 14 cout ,, Enter the value of x1 and y1 : ; 15 cin ,, x1 ,, y1; 16 cout ,, Enter the value of x2 and y2: ; 17 cin ,, x2 ,, y2; 18 19 dx = (x2 - x1); 20 dy = (y2 - y1); 21 if(abs(dx) ,= abs(dy)) 22 step = abs(dx); 23 else 24 step = abs(dy); 25 dx = dx / step; 26 dy = dy / step; 27 x = x1; 28 y = y1; 29 i = 1; 30 while(i ,= step) { 31 putpixel(x, y, 5); 32 x = x + dx; 33 y = y + dy; 34 i = i + 1; 35 delay(100); 36 } 37 getch(); 38 closegraph(); 39 } ...
Major recent improvements in biotechnology have led to an accelerated production of DNA sequences. The completion of the human genome sequence, along with the genomes of more than two hundred other species, has marked the arrival of the genome era. The ultimate goal is to understand the structure and function of genomes and their genes. This thesis has focused on the computational analysis of complementary DNA (cDNA) sequences. These are copies of mRNA transcripts that correspond to the coding regions of genomes.. Studying the expression patterns of genes is essential for understanding gene function. Many gene expression profiling techniques generate short sequence tags that derive from transcripts. A pilot study was performed to assess the feasibility of using the pyrosequencing platform for gene expression analysis. The sequences generated by pyrosequencing in most cases (≈ 85%) were long enough (, 18 nucleotides) to uniquely identify the corresponding transcripts through database searches. ...
Animals and Treatments. All animal experiments and treatments were reviewed and approved by the Research Animal Resource Center at the University of Wisconsin or by the appropriate oversight department of submitting institutions. Institutions, strains, sex, ages, treatment vehicle, circadian time, and route of administration are recorded for all experiments and can be found for each experiment at the EDGE Web site.. Expressed Sequence Tag Libraries. Poly-A mRNA was isolated from total RNA via the Oligotex kit (QIAGEN, Valencia, CA). Construction of expressed sequence tag (EST) libraries was typically performed by using the cDNA Timesaver kit (Amersham Biosciences Inc., Sunnyvale, CA). In brief, 5 μg of poly-A was used to generate first strand cDNA with an anchored poly-T oligonucleotide [dT(18)-N] that also contained a NotI-specific restriction site. First strand cDNA was then purified via a phenol/chloroform extraction. After second strand synthesis, cDNA was again purified using ...
abstract = {A novel mosquito antimicrobial peptide, gambicin, and the corresponding gene were isolated in parallel through differential display-PCR, an expressed sequence tag (EST) project, and characterization of an antimicrobial activity in a mosquito cell line by reverse-phase chromatography. The 616-bp gambicin ORF encodes an 81-residue protein that is processed and secreted as a 61-aa mature peptide containing eight cysteines engaged in four disulfide bridges. Gambicin lacks sequence homology with other known proteins. Like other Anopheles gambiae antimicrobial peptide genes, gambicin is induced by natural or experimental infection in the midgut, fatbody, and hemocyte-like cell lines. Within the midgut, gambicin is predominantly expressed in the anterior part. Both local and systemic gambicin expression is induced during early and late stages of natural malaria infection. In vitro experiments showed that the 6.8-kDa mature peptide can kill both Gram-positive and Gram-negative bacteria, has ...
Multimeric protein complexes have a role in many cellular pathways and are highly interconnected with various other proteins. The characterization of their domain composition and organization provides useful information on the specific role of each region of their sequence. We identified a new module, the PAM domain (P CI/PINT a ssociated m odule), present in single subunits of well characterized multiprotein complexes, like the regulatory lid of the 26S proteasome, the COP-9 signalosome and the Sac3-Thp1 complex. This module is an around 200 residue long domain with a predicted TPR-like all-alpha-helical fold. The occurrence of the PAM domain in specific subunits of multimeric protein complexes, together with the role of other all-alpha-helical folds in protein-protein interactions, suggest a function for this domain in mediating transient binding to diverse target proteins.
EST). A short partial sequence, typically 200-400 bp long, of a complementary DNA (cDNA) clone. Because cDNAs are prepared by reverse transcription of messenger RNA molecules, ESTs act as markers for genes that are expressed in particular tissues or organs. EST sequence data are held on databases, and researchers use computer programs to search for sequences that correspond to, say, a partial amino-acid sequence for a protein under investigation. The EST sequence can then be used to construct a DNA probe to locate the respective clone from a DNA library. ...
Hsiang, T. and P.H. Goodwin. 2003. Distinguishing plant and fungal sequences in ESTs from infected plant tissues. Journal of Microbiological Methods 54:339-351. Expressed sequence tags (ESTs) from fungal-infected plant tissues are composed of a mixture of plant and fungal sequences. Using freely available software and tools, a novel procedure is described for distinguishing plant and fungal DNA sequences. Although the GenBank non-redundant database is larger and therefore one would presume that BLASTX analysis of it would be more accurate, superior resolution of 700 randomly selected fungal ESTs was found with Standalone TBLASTX analyses with a local matching database composed of a plant and a fungal genome. Standalone TBLASTX analyses of 3983 ESTs from nine different fungal-infected plant EST libraries also proved to be superior in identifying the origin of sequences as either plant or fungal compared to GenBank BLASTX analysis. Standalone TBLASTX with a matching database comprised of a single ...
Mon choix dun puerh cru ancien en vrac a pour but de me faire voyager dans le temps et de retourner en enfance, quand les Noëls étaient magiques et dune joie innocente sans faille. Ce nest pas tant que cétait mieux autrefois, mais que cétait plus simple de croire au père Noël, aux anges qui annoncent Jésus aux bergers... quand on est enfant que quand on est adulte. La dégustation dun puerh vieux et si pur et si délicieux est un petit miracle qui ouvre la porte à limagination. En plus, jai la parfaite théière pour loccasion: une Yixing antique (fin de la dynastie Qing) en forme de buche! Elle est décorée de fleurs de prunus (symbole de résistance à lhiver) et sa décoration avec des émaux de couleur (falangcai) vert, jaune, bleu et rose convient assez à le décoration bariolée de Noël. Mais surtout, cette théière a une glaise zisha fine, assez poreuse, légèrement sous cuite qui arrondit et intensifie bien le goût du puerh cru ancien ...
De Novo Characterization of Flower Bud Transcriptomes and the Development of EST-SSR Markers for the Endangered Tree Tapiscia sinensis. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
p,Transcript Support Level 1, when transcripts are supported by at least one non-suspect mRNA.,/p,,p,The ,a href=https://genome.ucsc.edu/cgi-bin/hgc?hgsid=423831555_sqRhAapgi8atmzzBPBAz8Me5797J&c=chr14&o=94517268&t=94547548&g=wgEncodeGencodeCompV19&i=ENST00000544005.1#tsl target=_self,Transcript Support Level,/a, (TSL) is a method to highlight the well-supported and poorly-supported transcript models for users. The method relies on the primary data that can support full-length transcript structure: mRNA and EST alignments supplied by UCSC and Ensembl.,/p,TSL:1The GENCODE set is the gene set for human and mouse. ,a href=/Help/Glossary?id=500 class=popup,GENCODE Basic,/a, is a subset of representative transcripts (splice variants).GENCODE basic,p,PRINCIPAL1 - APPRIS candidate principal isoform.,/p,,p,,a class=popup href=/Homo_sapiens/Help/Glossary?id=521,APPRIS,/a, is a system to annotate alternatively spliced transcripts based on a range of computational methods.,/p,APPRIS P1 ...
ARTICLE. Ayoubi P, Jin X, Leite S, Liu X, Martajaja J, Abduraham A, Wan Q, Yan W, Misawa E and Prade R 2002 PipeOnline 2.0: Automated EST Processing and Functional Data Sorting Nucleic Acid Research 30: 4761-4769. Expressed sequence tags (ESTs) are generated and deposited in the public domain, as redundant, un-annotated, single-pass reactions, with virtually no biological content. PipeOnline automatically analyses and transforms large collections of raw DNA-sequence data from chromatograms or FASTA files by calling the quality of bases, screening and removing vector sequences, assembling and rewriting consensus sequences of redundant input files into a unigene EST data set and finally through translation, amino acid sequence similarity searches, annotation of public databases and functional data. PipeOnline generates an annotated database, retaining the processed unigene sequence, clone/file history, alignments with similar sequences, and proposed functional classification, if available. ...
p,Transcript Support Level 1, when transcripts are supported by at least one non-suspect mRNA.,/p,,p,The ,a href=https://genome.ucsc.edu/cgi-bin/hgc?hgsid=423831555_sqRhAapgi8atmzzBPBAz8Me5797J&c=chr14&o=94517268&t=94547548&g=wgEncodeGencodeCompV19&i=ENST00000544005.1#tsl target=_self,Transcript Support Level,/a, (TSL) is a method to highlight the well-supported and poorly-supported transcript models for users. The method relies on the primary data that can support full-length transcript structure: mRNA and EST alignments supplied by UCSC and Ensembl.,/p,TSL:1The GENCODE set is the gene set for human and mouse. ,a href=/Help/Glossary?id=500 class=popup,GENCODE Basic,/a, is a subset of representative transcripts (splice variants).GENCODE basic,p,PRINCIPAL1 - APPRIS candidate principal isoform.,/p,,p,,a class=popup href=/Homo_sapiens/Help/Glossary?id=521,APPRIS,/a, is a system to annotate alternatively spliced transcripts based on a range of computational ...
All ESTs in GenBank on the date of the track data freeze for the given organism are used - none are discarded. When two ESTs have identical sequences, both are retained because this can be significant corroboration of a splice site.. ESTs are aligned against the genome using the Blat program. When a single EST aligns in multiple places, the alignment having the highest base identity is found. Only alignments that have a base identity level within a selected percentage of the best are kept. Alignments must also have a minimum base identity to be kept. For more information on the selection criteria specific to each organism, consult the description page accompanying the EST track for that organism.. The maximum intron length allowed by Blat is 500,000 bases, which may eliminate some ESTs with very long introns that might otherwise align. If an EST aligns non-contiguously (i.e. an intron has been spliced out), it is also a candidate for the Spliced EST track, provided it meets various quality ...
All ESTs in GenBank on the date of the track data freeze for the given organism are used - none are discarded. When two ESTs have identical sequences, both are retained because this can be significant corroboration of a splice site.. ESTs are aligned against the genome using the Blat program. When a single EST aligns in multiple places, the alignment having the highest base identity is found. Only alignments that have a base identity level within a selected percentage of the best are kept. Alignments must also have a minimum base identity to be kept. For more information on the selection criteria specific to each organism, consult the description page accompanying the EST track for that organism.. The maximum intron length allowed by Blat is 500,000 bases, which may eliminate some ESTs with very long introns that might otherwise align. If an EST aligns non-contiguously (i.e. an intron has been spliced out), it is also a candidate for the Spliced EST track, provided it meets various quality ...
The high frequency of alternative splicing among plant Serine/Arginine-rich (SR) family of proteins has been linked to important roles in gene regulation during development and in response to environmental stress. In this report, the genomes of maize and sorghum have been searched and the manual annotation of all the SR proteins have been performed. The experimental validation of gene structure by RT-PCR analysis revealed, with few exceptions, that SR genes produced multiple isoforms of transcripts by alternative splicing. Despite sharing high structural similarity and conserved positions of the introns, alternative splicing profiles of vast majority of SR genes are not conserved between maize and sorghum. These include many transcript isoforms discovered by RT-PCR and not represented in extant EST collection. The occurrence of several isoforms of maize and sorghum SR mRNAs have been determined and that these isoforms display evolutionary conservation of splicing events with their homologous SR ...
Global Animal Tag Supplier Directory, Animal Tag, Animal Tag Manufacturers, Animal Tag Factories, Animal Tag Manufacturing, Animal Tag Manufacturer, Factory,Animal Tag Export Company, Animal Tag Suppliers, Exporters, Animal Tag Producers, Wholesalers, Distributors, International Animal Tag, OEM Animal Tag, Agriculture.
Global Animal Tag Supplier Directory, Animal Tag, Animal Tag Manufacturers, Animal Tag Factories, Animal Tag Manufacturing, Animal Tag Manufacturer, Factory,Animal Tag Export Company, Animal Tag Suppliers, Exporters, Animal Tag Producers, Wholesalers, Distributors, International Animal Tag, OEM Animal Tag, Agriculture.
Transcriptome profiling and digital gene expression are tewo examples that illustrate the power of NGS. For a few thousand dollars, a single run of a SOLiD or Illumina sequencer can produce more ESTs (Expressed Sequence Tags) than exist in all of dbEST. Even more striking is that the data in dbEST were collected over many years and 100s million dollars were invested in getting the sequences. Also, it is important to understand that the data in dbEST represent only a relatively small number of molecules from a broad range of organisms and tissues. While dbEST has been useful for providing a glimpse into the complex nature of gene expression and, in the case of human, mouse and a few other organisms, mapping a reasonable number of genes, the resource is unable to provide the deeper details and insights into alternative splicing, antisense transcription, small RNA expression, and allelic variation that can only be achieved when a cells complement of RNA is sampled deeply. As recent literature ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue we will assume that you are happy to receive all cookies and you will not see this message again. Click Find out more for information on how to change your cookie settings ...
You can often find vector information at NCBI, either directly or in their list of vectors screened for contamination of new sequence at Vecscreen. VectorDB contains information about many common vectors, including yeast vectors. The EMBL Hamburg outstation maintains a large database of vectors. I.M.A.G.E. Consortium Vectors contains information about plasmids commonly used in EST collections such as those sold by OpenBioSystems and Invitrogen. For eukaryotic vectors (Fish, Xenopus) see Minnesota. The Forsburg Lab maintains a list of Fisson Yeast vectors. Promega maintains a list of their vectors. NEB maintains a list of common vectors. Epicentre also maintains its own list. Lucigen provides transcription-free vectors for cloning AT-rich and other difficult DNAs. Addgenes Vector DB contains most of the information from Stanfords VectorDB, plus more vector information they have curated from commercial websites and added through our plasmid curation efforts. (However, it seems to be rather ...
So its still a shotgun-style technique, and the problem has been getting long enough read lengths to assemble the pieces into a whole sequence. Think of it like a jigsaw puzzle. The smaller the pieces are, the more you have that look identical, and the harder it is to figure out where to put them. Given 3 x 109 bases in the human genome, youd need a read length of about 17 base pairs to be certain of ending up with all different pieces. They report average read lengths of 23 bp, with each individual sequence chunk represented about 150 times, and every part of the genome represented. This allows them to keep the error rate low enough that they could sequence different strains of the virus, and reliably pick up the genomic differences between the two. The paper doesnt say how long this takes, but their marketing material says the process takes only one day.. The technique as practiced by Helicos has one major drawback, however, that will limit how low it can take the cost/base. It requires ...
After switching from Preview to Show All Tags view composer has what appears to be a second body tag (actually a graphic relic) showing in the show all tags view. Build: 2001091003 Reproducibility: Everytime Steps to Reproduce: 1.Open Composer 2.Switch to Preview view 3.Switch to Show All Tags view Actual Results: A second body tag will appear to show up behind the real one. This is not a real body tag but something that appears there. Expected Results: I would expect that only one body tag would appear no matter what view I switch from ...
Please be a careful not to add a redundant tag.. You can label this presentation with either an existing tag or a new tag. To add an existing tag, simply chose the appropriate one from the drop down menu below on the left. Or, to add a new tag, enter it in the box on the right. Then click Add Tag. Before creating a new tag, please check the menu on the left to see if that tag already exists! ...
Boguski, M.S.; Lowe, T.M.; Tolstoshev, C.M. (1993). "dbEST--database for "expressed sequence tags"". Nature Genetics. 4 (4): ... in part to aid multiplexing with MPBLAST and in part to aid analysis of segmented query sequences from shotgun sequencing ... Construction of the DFA was O(n), where n is the sum of the lengths of the query sequences. The DFA could then be used to scan ... Sense from Sequences: Stephen F. Altschul on Bettering BLAST Aho, Alfred V.; Corasick, Margaret J. (June 1975). "Efficient ...
... low-throughput sequencing using the Sanger method was used to sequence random transcripts, producing expressed sequence tags ( ... An expressed sequence tag (EST) is a short nucleotide sequence generated from a single RNA transcript. RNA is first copied as ... Legend: RAM - random access memory; MPI - message passing interface; EST - expressed sequence tag. Quantification of sequence ... June 1991). "Complementary DNA sequencing: expressed sequence tags and human genome project". Science. 252 (5013): 1651-6. ...
... using expressed sequence tags in genetic analyses, ... sequencing of microbial genomes, and his leadership in ... sequencing ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... "Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... Lumican is highly expressed in pleural effusions (lung fluid) of patients with adenocarcinoma.[17] Its expression was low in ... "Lumican is down-regulated in cells expressing endoglin. Evidence for an inverse correlationship between Endoglin and Lumican ... "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proceedings of the National ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... positive regulation of sequence-specific DNA binding transcription factor activity. • extracellular matrix organization. • ... Abedinia M, Layfield R, Jones SM, Nixon PF, Mattick JS (1992). "Nucleotide and predicted amino acid sequence of a cDNA clone ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... Human HSCs express the CD34 marker.[citation needed] CD34 is expressed in roughly 20% of murine haematopoietic stem cells, and ... It is expressed on lymph node endothelia, whereas the L-selectin to which it binds is on the T cell. Conversely, under other ... Cells expressing CD34 (CD34+ cell) are normally found in the umbilical cord and bone marrow as haematopoietic cells, or in ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... This gene, an active X chromosome homolog of the Y chromosome RBMY gene, is widely expressed whereas the RBMY gene evolved a ... sequence and characterization of a glycosylated RNA-binding protein". Nucleic Acids Research. 21 (18): 4210-7. doi:10.1093/nar/ ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... Heterologously expressed CNGA1 can form a functional channel that is permeable to calcium. In rod photoreceptors, however, ... amino acid sequence, gene structure, and functional expression". The Journal of Neuroscience. 12 (8): 3248-56. doi:10.1523/ ... exchanger oligomers with cGMP-gated channel subunits as probed with heterologously expressed cDNAs" (PDF). Biochemistry. 42 (15 ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... The protein encoded by this gene is a ubiquitously expressed nuclear protein and belongs to a highly conserved subfamily of WD- ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... ArgBP2 is highly abundant in cardiac muscle cells at sarcomeric Z-disc structures, and is expressed in other cells at actin ... sequencing and analysis of 500 novel complete protein coding human cDNAs". Genome Research. 11 (3): 422-35. doi:10.1101/gr. ...
September 1996). "Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi: ... "Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence" (PDF). ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... which binds to the consensus DNA sequence, 5-GGAA/T-3 within a 9-to-10 bp sequence, in the target genes it regulates. ETV6 ... Fainstein E, Einat M, Gokkel E, Marcelle C, Croce CM, Gale RP, Canaani E (December 1989). "Nucleotide sequence analysis of ... the gene is expressed in virtually all cell types and tissues. Mice depleted of the ETV6 gene by Gene knockout die between day ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... In addition, the haptoglobin gene is expressed in murine and human adipose tissue. Haptoglobin had been shown to be expressed ... Raugei G, Bensi G, Colantuoni V, Romano V, Santoro C, Costanzo F, Cortese R (1983). "Sequence of human haptoglobin cDNA: ... Maeda N (1985). "Nucleotide sequence of the haptoglobin and haptoglobin-related gene pair. The haptoglobin-related gene ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... "A new growth-regulated complementary DNA with the sequence of a putative trans-activating factor". Cell Growth & ...
Sudo K, Chinen K, Nakamura Y (Nov 1994). "2058 expressed sequence tags (ESTs) from a human fetal lung cDNA library". Genomics. ... "Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... These proteins bind specific DNA sequences, including the kappa-B motif (GGGACTTTCC), in the promoters and enhancer regions of ... protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... OCT-4 consists of an octamer motif, a particular DNA sequence of AGTCAAAT that binds to their target genes and activates or ... Wey E, Lyons GE, Schäfer BW (March 1994). "A human POU domain gene, mPOU, is expressed in developing brain and specific adult ... Ben-Shushan E, Thompson JR, Gudas LJ, Bergman Y (April 1998). "Rex-1, a gene encoding a transcription factor expressed in the ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-828. doi:10.1101/gr.6.9.807. PMID ... The CHRNA7 gene is primarily expressed in the posterior amygdalar nucleus and the field CA3 of Ammon's horn in the mouse, and ... An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a ... Groot Kormelink PJ, Luyten WH (1997). "Cloning and sequence of full-length cDNAs encoding the human neuronal nicotinic ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... The complete sequences of 150 new cDNA clones from brain which code for large proteins in vitro". DNA Research. 7 (1): 65-73. ... Nagase T, Kikuno R, Ishikawa KI, Hirosawa M, Ohara O (Feb 2000). "Prediction of the coding sequences of unidentified human ... sequencing and analysis of 500 novel complete protein coding human cDNAs". Genome Research. 11 (3): 422-35. doi:10.1101/gr. ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... Adams MD, Dubnick M, Kerlavage AR, Moreno R, Kelley JM, Utterback TR, Nagle JW, Fields C, Venter JC (March 1992). "Sequence ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... "NotI flanking sequences: a tool for gene discovery and verification of the human genome". Nucleic Acids Research. 30 (14): 3163 ... "Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence" (PDF). ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... Adenosine deamination of pre-mRNA results in a change in the amino acid sequence of the gene product, which differs from that ... predicted by the genomic DNA sequence. Other members of this family include DRADA (ADAR) and RED1 (ADARB1). Unlike ADAR1 and ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... In contrast to the other class IA PI3Ks p110α and p110β, p110δ is principally expressed in leukocytes (white blood cells). ... The p55γ regulatory subunit is not thought to be expressed at significant levels in immune cells. There is no evidence for ... a novel phosphatidylinositol 3-kinase catalytic subunit that associates with p85 and is expressed predominantly in leukocytes ...
"Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes ... "Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... Homer1 is expressed widely in the central nervous system as well as peripheral tissue including heart, kidney, ovary, testis, ... This sequence motif exists in group 1 metabotrophic glutamate receptor (mGluR1 and mGluR5), IP3 receptors (IP3R), Shank, ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... This protein is expressed most abundantly in skeletal and cardiac muscle. The mutations in this gene have been associated with ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... Abedinia M, Layfield R, Jones SM, Nixon PF, Mattick JS (1992). "Nucleotide and predicted amino acid sequence of a cDNA clone ...
"Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... Sanger Centre, The; Washington University Genome Sequencing Cente, The (1998). "Toward a complete human genome sequence". ... When expressed in cells, this protein activates NF-κB and induces the phosphorylation of BCL10. CARD11 has been shown to ...
"Shotgun sequencing of the human transcriptome with ORF expressed sequence tags". Proceedings of the National Academy of ... "Generation and analysis of 280,000 human expressed sequence tags". Genome Research. 6 (9): 807-28. doi:10.1101/gr.6.9.807. PMID ... The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro". DNA Research. 5 (1): 31-9 ... Nagase T, Ishikawa K, Miyajima N, Tanaka A, Kotani H, Nomura N, Ohara O (February 1998). "Prediction of the coding sequences of ...
"Shotgun sequencing of the human transcriptome with ORF expressed sequence tags". Proc. Natl. Acad. Sci. U.S.A. 97 (7): 3491-6. ... Shome B، Parlow AF، Liu WK، Nahm HS، Wen T، Ward DN (سبتمبر 1989). "A reevaluation of the amino acid sequence of human ... Watkins PC، Eddy R، Beck AK، Vellucci V، Leverone B، Tanzi RE، Gusella JF، Shows TB (أغسطس 1987). "DNA sequence and regional ... Saxena BB، Rathnam P (1976). "Amino acid sequence of the beta subunit of follicle-stimulating hormone from human pituitary ...
A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and ... 2004). "Mass spectrometry analysis of recombinant human ZP3 expressed in glycosylation-deficient CHO cells". Biochemistry. 43 ( ... "Secretion and assembly of zona pellucida glycoproteins by growing mouse oocytes microinjected with epitope-tagged cDNAs for ... The nascent protein contains a N-terminal signal peptide sequence, a conserved "ZP domain" module, a consensus furin cleavage ...
Bulk submissions of Expressed Sequence Tag (EST), Sequence-tagged site (STS), Genome Survey Sequence (GSS), and High-Throughput ... The GenBank sequence database is an open access, annotated collection of all publicly available nucleotide sequences and their ... lack peer-reviewed sequences of type strains and sequences of non-type strains. On the other hand, while commercial databases ... A paper released in the Journal of Clinical Microbiology[10] evaluated the 16S rRNA gene sequencing results analyzed with ...
This sequence relates with changes in processing speed and working memory in overlapping cycles such that relations with speed ... Each cycle culminates into insight about the cycle's representations and underlying inferential processes that is expressed ... tagging new concepts or solutions to symbols that help one recall and mentally manipulate them, are just a few examples of how ... When a child realizes that the sequencing of the if ... then connectives in language is associated with situations in which the ...
Científicos: en 1991 comeza a secuenciación con EST (Expressed Sequence Tags, marcaxe de secuencias expresadas);[60] ao ano ... expressed sequence tags and human genome project". Science 252 (5013).. *↑ Weissenbach, J.; et al. (1992). "A second-generation ... Expressed sequence tag, Marcador de secuencia expresada), SAGE (Serial Analysis of Gene Expression, Análise en serie da ... C. elegans Sequencing Consortium (1998). "Genome sequence of the nematode C. elegans: a platform for investigating biology". ...
If you have express permission, this must be verified either by explicit release at the source or by e-mail or letter to the ... If you have tagged the article for investigation, please complete the following steps: *Add the following to the bottom of ... In genetics, a biomarker (identified as genetic marker) is a DNA sequence that causes disease or is associated with ... Posting copyrighted material without the express permission of the copyright holder is unlawful and against Wikipedia policy. ...
2002). „The DNA sequence and comparative analysis of human chromosome 20.". Nature. 414 (6866): 865-71. PMID 11780052. doi: ... Yung LY, Tsim KW, Pei G, Wong YH (2000). „Immunoglobulin G1 Fc fragment-tagged human opioid receptor-like receptor retains the ... Agonist-induced internalization and desensitization of the human nociceptin receptor expressed in CHO cells.". Cell. Mol. Life ... 2003). „Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.". Proc. Natl. Acad. Sci ...
In bacteria that express a 20S proteasome, the β subunits have high sequence identity to archaeal and eukaryotic β subunits, ... Proteins are tagged for degradation with a small protein called ubiquitin. The tagging reaction is catalyzed by enzymes called ... The result is a polyubiquitin chain that is bound by the proteasome, allowing it to degrade the tagged protein.[1] The ... Long sequences of alternating glycine and alanine have been shown to inhibit substrate unfolding, decreasing the efficiency of ...
... in 2008 following in silico screening of databases describing expressed sequence tags from an evolutionarily diverse group of ... but lacks obvious similarity at the level of primary amino acid sequence. It also lacks a YDYVHL sequence at the N-terminal end ... the CASS4 transcripts are most highly expressed in spleen and lung among normal tissues, and are highly expressed in ovarian ... Amino acid sequence homology of this isoform of human CASS4 with other family members is 26% overall identity and 42% ...
Class I has two highly conserved sequence motifs. It aminoacylates at the 2'-OH of a terminal adenosine nucleotide on tRNA, and ... The unnatural amino acid is coded by a nonsense (TAG, TGA, TAA) triplet, a quadruplet codon, or in some cases a redundant rare ... The organism that expresses the mutant synthetase can then be genetically programmed to incorporate the unnatural amino acid ... For instance, one can start with the gene for a protein that binds a certain sequence of DNA, and, by directing an unnatural ...
Here, a "tag" consisting of a specific amino acid sequence, often a series of histidine residues (a "His-tag"), is attached to ... A useful technique for assessing cellular localization uses genetic engineering to express in a cell a fusion protein or ... The sequence of amino acid residues in a protein is defined by the sequence of a gene, which is encoded in the genetic code. In ... Sequence motif. Short amino acid sequences within proteins often act as recognition sites for other proteins.[26] For instance ...
Sequence of events[edit]. This section may require cleanup to meet Wikipedia's quality standards. The specific problem is: ... Tamim expressed frustration at the lack of detail: "Why is it that every time an Israeli is involved in a crime, everyone goes ... Cleanup tagged articles with a reason field from February 2019. *Wikipedia pages needing cleanup from February 2019 ... expressed the country's deep concern that expertly doctored passports from nations that do not require advance visas were used ...
In development, sequencing the RNAs expressed by individual cells can give insight into the existence and behavior of different ... "Amplification-free whole-genome bisulfite sequencing by post-bisulfite adaptor tagging". Nucleic Acids Research. 40 (17): e136 ... Single cell sequencing examines the sequence information from individual cells with optimized next-generation sequencing (NGS) ... specific sequences may be transcribed inefficiently, thus causing sequence drop-out or generating incomplete sequences.[1][40] ...
S. Munro, H. R. Pelham: Use of peptide tagging to detect proteins expressed from cloned genes: deletion mapping functional ... A Short Polypeptide Marker Sequence Useful for Recombinant Protein Identification and Purification. In: Bio/Technology. 6, 1988 ... Die nächsten Protein-Tags waren im Jahr 1988 das MBP-Tag[13], das HA-Tag[10] das His-Tag[11] und das FLAG-Tag.[8] ... Als Protein-Tag, Affinitäts-Tag oder Epitop-Tag (engl. tag für ‚Markierung', ‚Schildchen' oder ‚Etikett') werden in der ...
The Jury expressed concern over the impact of GM crops on farming, the environment, food safety and other potential health ... tag; name "BASFppt" defined multiple times with different content (see the help page). ... concluded that the risks to human health associated with the use of specific viral DNA sequences in GM plants are negligible, ... In our view, the potential for GM foods to cause harmful health effects is very small and many of the concerns expressed apply ...
Some authors consider the orcas "usually" behaviorally dominant over sperm whales but express that the two species are "fairly ... Tagging studies have shown that sperm whales hunt upside down at the bottom of their deep dives. It is suggested that the ... relationships of artiodactyls and cetaceans as deduced from the comparison of cytochrome b and 12S RNA mitochondrial sequences" ... "Sperm whale sound production studied with ultrasound time/depth-recording tags". Journal of Experimental Biology. 205 (Pt 13): ...
Therefore, the check digit has to be 2, and the complete sequence is ISBN 0-306-40615-2. If the value of x. 10. {\displaystyle ... The Library of Congress catalogue contains books published with invalid ISBNs, which it usually tags with the phrase "Cancelled ... but requires more than the digits 0-9 to express the check digit. ... Thus, the check digit is 7, and the complete sequence is ISBN 978-0-306-40615-7. ...
Shotgun sequencing of the human transcriptome with ORF expressed sequence tags. (англ.) // Proceedings of the National Academy ... deduced from the mRNA sequence. (англ.) // Proceedings of the National Academy of Sciences of the United States of America : ... Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (англ.) // Proceedings of the ...
Every value is now a sequence (a single atomic value or node is regarded as a sequence of length one). XPath 1.0 node-sets are ... A streaming subset of XPath is used in W3C XML Schema 1.0 for expressing uniqueness and key constraints. In XSD 1.1, the use of ... XForms and the Internationalization Tag Set (ITS). ... A location path consists of a sequence of location steps. Each ... all leading and trailing whitespace is removed and any sequences of whitespace characters are replaced by a single space. This ...
Meanwhile, sequencing of human cDNA sequences called expressed sequence tags began in Craig Venter's lab, an attempt to capture ... Shotgun sequencing[edit]. Main article: Shotgun sequencing. Shotgun sequencing is a sequencing method designed for analysis of ... RNA sequencing was one of the earliest forms of nucleotide sequencing. The major landmark of RNA sequencing is the sequence of ... "Complementary DNA sequencing: expressed sequence tags and human genome project". Science. 252 (5013): 1651-56. Bibcode:1991Sci ...
"Identification of gastric cancer-related genes using a cDNA microarray containing novel expressed sequence tags expressed in ... length of sequence. {\displaystyle (({\text{number of }}C+{\text{number of }}G)/2)^{2}/{\text{length of sequence}}}. [7]. Many ... length of sequence. {\displaystyle ({\text{number of }}C*{\text{number of }}G)/{\text{length of sequence}}}. [6]. or ... If this pathway is over-expressed the excess mutations it causes can lead to cancer. PARP1 is over-expressed in tyrosine kinase ...
Some may have expressed recent additions as cut and past and reverted the post (A1 to bad), others may have seen the ... Being three score and thirteen in age, I do wonder whether kids learn the colors of the rainbow in sequence; that easily takes ... Curious that this didn't seem to be proofread, or do different browsers have different scope for [font color] tags in a table ... There are series of resistor values, namely E6, E12, E24 - these have a geometric sequence relation to each other in their ...
Dorst, John (1990). "Tags and Burners, Cycles and Networks: Folklore in the Telectronic Age". Journal of Folklore Research. ... The behaviour is such that in any other social context it would express and arouse hostility; but it is not meant seriously and ... "This telling is composed, as for stories, of three serially ordered and adjacently placed types of sequences … the preface [ ... Within this framework, humour appreciation is conceptualized as a biphasic sequence involving first the discovery of ...
November 2008). "An evolutionary expressed sequence tag analysis of Drosophila spermatheca genes." Evolution 62(11): 2936-2947 ...
Such evidence has come from two areas: amino acid sequences and DNA sequences. Proteins with the same three-dimensional ... Charles Darwin's views about common descent, as expressed in On the Origin of Species, were that it was probable that there was ... TAG Stop TGG Tryptophan C CTT CCT Proline CAT Histidine CGT Arginine ... Similarly, shared nucleotide sequences, especially where these are apparently neutral such as the positioning of introns and ...
Cleanup tag[edit]. I've tagged both the article and this talk page with cleanup, since there is a ton of unsourced trivia and ... 12321 and so on until the sequence terminates with the 9-digit sequence of ones listed. I propose that this interesting ... So I vote delete (and indeed I'm gonna delete it myself, on the grounds that noone else has ever expressed any support for ... I did tag it with citation needed, which is a tag that should also go lots of other places. By the way, I don't think I said ...
The Latin tag ("I think, therefore the world is such [as it is]") makes it clear that "must" indicates a deduction from the ... If the universe were 10 times older than it actually is, most stars would be too old to remain on the main sequence and would ... expressing a creatio evolutiva instead the elder notion of creatio continua.[58] From a strictly secular, humanist perspective ... Analysing an observer's experience into a sequence of "observer-moments" helps avoid certain paradoxes; but the main ambiguity ...
The TAG published an e-mail in 2005 on how to solve the problem, which became known as the httpRange-14 resolution.[26] The W3C ... A path component, consisting of a sequence of path segments separated by a slash (. /. ). A path is always defined for a URI, ... CURIE - defines a generic, abbreviated syntax for expressing URIs. *Dereferenceable Uniform Resource Identifier - a resource ... consisting of a sequence of characters beginning with a letter and followed by any combination of letters, digits, plus (. +. ...
This is the Shanghai Express. Everybody must talk like a train.. Josef von Sternberg, when asked why all the actors in the film ... The surviving film sequences suggest that I, Claudius might have been a genuinely great work. When production was aborted, ... Gallagher, Tag. 2002. Josef von Sternberg. Senses of Cinema, March, 2002. http://sensesofcinema.com/2002/feature-articles/ ... He was nominated for the Academy Award for Best Director for Morocco (1930) and Shanghai Express (1932).[6] ...
We performed an analysis of expressed sequence tags (ESTs) and obtained partial sequences from 2,039 clones, which represented ... Generation of expressed sequence tags of random root cDNA clones of Brassica napus by single-run partial sequencing. Plant ... Comparative analysis of expressed sequence tags of conifers and angiosperms reveals sequences specifically conserved in ... analysis of 5,692 expressed sequence tags. Proc Natl Acad Sci USA 95:13330-13335CrossRefPubMedGoogle Scholar ...
Obtaining partial cDNA sequences [expressed sequence tags (ESTs)] from various developmental stages and in response to various ... Construction and Evaluation of cDNA Libraries for Large-Scale Expressed Sequence Tag Sequencing in Wheat (Triticum aestivum L.) ... Lazo, G. R., S. Chao, D. D. Hummel, H. Edwards, C. C. Crossman et al., 2004 Development of an expressed sequence tag (EST) ... 2004 Construction and evaluation of cDNA libraries for large-scale expressed sequence tag sequencing in wheat (Triticum ...
An evolutionary expressed sequence tag analysis of Drosophila spermatheca genes.. Prokupek A1, Hoffmann F, Eyun SI, Moriyama E ...
Complementary DNA sequencing: expressed sequence tags and human genome project. By MD Adams, JM Kelley, JD Gocayne, M Dubnick, ... Complementary DNA sequencing: expressed sequence tags and human genome project. By MD Adams, JM Kelley, JD Gocayne, M Dubnick, ... Complementary DNA sequencing: expressed sequence tags and human genome project Message Subject. (Your Name) has forwarded a ... clones to generate expressed sequence tags (ESTs). ESTs have applications in the discovery of new human genes, mapping of the ...
Expressed sequence tags (EST) are potential source for the development of genic microsatellite markers, gene discovery, ... Expressed Sequence Tags (ESTs) Annotation and Primer Designing. EST sequences, from which the SSR markers developed, were ... Q. Kong, C. Xiang, Z. Yu et al., "Mining and charactering microsatellites in Cucumis melo expressed sequence tags from sequence ... Frequency of Microsatellites in Expressed Sequence Tags. A total of 7630 EST sequences of putative function (enzyme-encoding ...
SANTANA, Flávia A. et al. Differentially displayed expressed sequence tags in Melipona scutellaris (Hymenoptera, Apidae, ... Six, out of the nine ESTs described here, presented differentially expressed in the phases L1 or L2, or even in both of them, ...
Expressed sequence tags (ESTs) are short cDNA sequences that serve to "tag" the gene from which the messenger RNA (mRNA) ... Construction and Evaluation of cDNA Libraries for Large-Scale Expressed Sequence Tag Sequencing in Wheat (Triticum aestivum L.) ... Qi, L. L., B. Echalier, S. Chao, G. R. Lazo, G. E. Butler et al., 2004 A chromosome bin map of 16,000 expressed sequence tag ... Peng, J. H., H. Zadeh, G. R. Lazo, J. P. Gustafson, S. Chao et al., 2004 Chromosome bin map of expressed sequence tags in ...
... a significant fraction of the differentially expressed mRNAs identified correspond to expressed sequence tags (ESTs) and are ... novel highly expressed genes in pancreatic ductal adenocarcinomas through a bioinformatics analysis of expressed sequence tags. ... The GeneExpress(R) software system Fold Change Analysis Tool was used and 60 ESTs were identified that were expressed at levels ... Searches against the human genomic sequence and comparative genomic analysis of human and mouse genomes was carried out using ...
... Comp Funct Genomics. 2010;2010:757512. doi: 10.1155/ ... Putative functions of all 2752 differentially expressed unique sequences were designated by gene homology based on BLAST and ... Readable 2228 sequences for olive leaf and 1506 sequences for olive fruit were assembled into 205 and 69 contigs, respectively ... expressed proteins, and unknown proteins in NCBI-GenBank. 635 ESTs unique genes sequence have been identified by over 80% ...
In genetics, an expressed sequence tag (EST) is a short sub-sequence of a cDNA sequence. ESTs may be used to identify gene ... Because of the way ESTs are sequenced, many distinct expressed sequence tags are often partial sequences that correspond to the ... Jun 1991). "Complementary DNA sequencing: expressed sequence tags and human genome project". Science. 252 (5013): 1651-6. doi: ... In an effort to reduce the number of expressed sequence tags for downstream gene discovery analyses, several groups assembled ...
Select one publish paper in Expressed Sequence Tags and Describe the briefly methodology involved in preparing an EST database ... Analysis of 5,692 expressed sequence tags", by Sterky et al., 1998, expressed sequence tags (EST) database was prepared with ... www.ukessays.com/essays/biology/expressed-sequence-tags-est-gene-7057.php?vref=1 ,title=Gene Studies Expressed Sequence Tags ( ... Gene Studies Expressed Sequence Tags (EST). Retrieved from https://www.ukessays.com/essays/biology/expressed-sequence-tags-est- ...
An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating ... Expression profiles during dedifferentiation in newt lens regeneration revealed by expressed sequence tags. Nobuyasu Maki,1,2 ... The expression sequence tag (EST) resource is useful for the future study of newt dedifferentiation, and the sequence ... Sequencing, assembly, and functional annotation of newt expression sequence tags. As mentioned previously dedifferentiation ...
Additionally, among the 343 unigenes sequences, 22 simple sequence repeats (SSRs) were also identified contributing to the ... In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ... All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. According to ... expressed sequence tags; salt stress tolerance; SSRs Atriplex canescens; cDNA library; expressed sequence tags; salt stress ...
Systematic, high-throughput sequencing of such products would result in an expressed sequence tag (EST) database consisting of ... The data confirmed the central distribution of the sequences, the significant normalization of the sequence population, the ... the deciphering of the draft human genome sequence currently being compiled, and the shotgun sequencing of the human ... Such a database would add significant value to existing public EST databases, which consist mostly of sequences derived from ...
"Expressed Sequence Tags" by people in this website by year, and whether "Expressed Sequence Tags" was a major or minor topic of ... "Expressed Sequence Tags" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical ... Expressed Sequence Tags*Expressed Sequence Tags. *Expressed Sequence Tag. *Sequence Tag, Expressed ... Chasing migration genes: a brain expressed sequence tag resource for summer and migratory monarch butterflies (Danaus plexippus ...
... are attractive for decoding genomes and expressed sequence tags (ESTs). A variety of plant genomes and ESTs have been sequenced ... Sequenced plant genomes and ESTs have been entered into public databases, where they are freely downloadable. Sequences ... Sequencing technology has been rapidly advancing. Giga-sequencers, which produce several gigabases of fragmented sequences per ...
Over 28,000 expressed sequence tags (ESTs) were produced from cDNA libraries representing a variety of growth conditions and ... The estimate of 8,177 unique sequences indicates that over half of the genes of the fungus are represented in the ESTs. ... Approximately 23,000 of the ESTs could be clustered into 3,050 contigs, leaving 5,127 singleton sequences. ...
Here, we describe a brain expressed sequence tag (EST) resource to identify genes involved in migratory behaviors. A brain EST ... Of 9,484 unique sequences, 6068 had positive hits with the non-redundant protein database; the EST database likely represents ∼ ...
Analysis of an expressed sequence tag library from Dicrocoelium dentriticum. Authors: Martínez Ibeas, Ana ; Perteguer, M. J.; ... In fact, there is no information in the expressed sequence tag (EST) database about the parasite. Furthermore, the ... The deduced proteins expressed by these genes have been described as possible vaccine targets in other trematodes, and/or as ... A D. dendriticum cDNA encoding an 8-kDa recombinant protein has been cloned, expressed in Escherichia coli and evaluated in ...
Thus, large‑scale sequencing of P. minus cDNA libraries identified 4196 expressed sequences tags (ESTs) which were deposited in ... Sequence Analysis and Potentials of the Native RbcS Promoter in the Development of an Alternative Eukaryotic Expression System ...
Of the remaining sequences, most predict proteins with either catalytic (62%) or binding (19%) functions, as expected for ... Here we describe a collection of 691 sequences from the Western corn rootworm midgut, 27% of which predict proteins with no ... proteins expressed in the insect midgut. The utility of this approach for the identification of targets for novel toxins is ... Expressed sequence tags from Diabrotica virgifera virgifera midgut identify a coleopteran cadherin and a diversity of ...
HOMINIS FOR AN EXPRESSED SEQUENCE TAG LIBRARY: IDENTIFICATION OF HOMOLOGUES OF HOUSE DUST MITE ALLERGENS * KATJA FISCHER1, ... HOMINIS FOR AN EXPRESSED SEQUENCE TAG LIBRARY: IDENTIFICATION OF HOMOLOGUES OF HOUSE DUST MITE ALLERGENS ... Gene-based sequence-tagged sites (STSs) as the basis for a human gene map. Nat Genet 10: 415-423. ... hominis in the bacteriophage λ vector λZAP express. Sequences of 145 clones established that the libraries predominantly ...
Expressed sequence tag (EST) analysis of tobacco ( Nicotiana tabacum) anthers was performed for 200 cDNA clones randomly chosen ... Expressed sequence tags of fruits, peels, and carpels and analysis of mRNA expression levels of the tagged cDNAs of fruits from ... Analysis of 176 expressed sequence tags generated from cDNA clones of hot pepper by single-path sequencing. J Plant Biol 41: ... Lim CO, Kim HY, Kim MG, Lee SI, Chung WS, Park SH, Hwang I, Cho MJ (1996) Expressed sequence tags of Chinese cabbage flower bud ...
... and are instrumental in gene discovery and gene sequence… ... short sub sequence of a transcribed spliced nucleotide sequence ... An expressed sequence tag or EST is a ... Expressed sequence tag. An expressed sequence tag or EST is a ... Expressed Sequence Tag - Expressed Sequence Tags (EST) sind kurze DNA Sequenzen von meist 100-800 Basenpaaren Länge, die durch ... Expressed Sequence Tag - Marqueur de séquence exprimée Un marqueur de séquence exprimée, ou Expressed Sequence Tag (EST), est ...
... and expressed sequence tag (EST) data from three other species: Myzus persicae, Aphis gossypii and Toxoptera citricida. We ... assembled ESTs, predicted coding sequences, and identified potential pairs of orthologues (reciprocical best hits) with A. ... we compared the complete genome sequence of Acyrthosiphon pisum (reference gene set) ... Comparative analysis of the Acyrthosiphon pisum genome and expressed sequence tag-based gene sets from other aphid species. ...
We present an approach to mine expressed sequence tags to discover cancer biomarkers. A false discovery rate analysis suggests ... With this approach, we identify the 200 genes most consistently differentially expressed in cancer (called HM200) and proceed ... We present and validate a new approach to identifying cancer biomarkers by mining expressed sequence tags. Because expressed ... or Massively Parallel Signature Sequencing (MPSS) [12]. Expressed Sequence Tags such as found in dbEST [13] are another ...
Only a few studies have focused on developing expressed sequence tag (EST) libraries from the guts of lepidopteran larvae. ... Among the unique sequences, 62.7% encoded putative proteins that shared significant sequence similarities (E-value ≤ 10-3)with ... We constructed two cDNA libraries from the guts of the fifth-instar larvae of ECB and sequenced a total of 15,000 ESTs from ... We developed a relatively large EST database consisting of 12,519 high-quality sequences from a total of 15,000 cDNAs from the ...
Results We sequenced 2181 Expressed Sequence Tags (ESTs) from a S. moellendorffii cDNA library. One thousand three hundred and ... thaliana tentative consensus sequences. We compared S. moellendorffii ESTs to the A. thaliana and Physcomitrella patens EST ... one non-redundant sequences were assembled, containing 291 contigs and 1010 singletons. Approximately 75% of the ESTs matched ... We sequenced 2181 Expressed Sequence Tags (ESTs) from a S. moellendorffii cDNA library. One thousand three hundred and one non- ...
... tamarense CCMP 1598 for protein-coding sequences from 10865 expressed sequence tags (ESTs). We reconstructed a total of 4284 ... Dinoflagellate expressed sequence tag data indicate massive transfer of chloroplast genes to the nuclear genome. Protist. 2004; ... Insights into a dinoflagellate genome through expressed sequence tag analysis. BMC Genomics. 2005;6(1, article 80) [PMC free ... Tanikawa N, Akimoto H, Ogoh K, Chun W, Ohmiya Y. Expressed sequence tag analysis of the dinoflagellate Lingulodinium polyedrum ...
Comparison of RNA Expression Profiles Based on Maize Expressed Sequence Tag Frequency Analysis and Micro-Array Hybridization. ... Comparison of RNA Expression Profiles Based on Maize Expressed Sequence Tag Frequency Analysis and Micro-Array Hybridization ... Comparison of RNA Expression Profiles Based on Maize Expressed Sequence Tag Frequency Analysis and Micro-Array Hybridization ... Comparison of RNA Expression Profiles Based on Maize Expressed Sequence Tag Frequency Analysis and Micro-Array Hybridization ...
  • We performed an analysis of expressed sequence tags (ESTs) and obtained partial sequences from 2,039 clones, which represented 1,437 unigenes consisting of 249 contigs and 1,188 singletons. (springer.com)
  • About 43% of the wheat group 6 ESTs identified rice homologs upon comparisons of genome sequences. (genetics.org)
  • Obtaining partial cDNA sequences [expressed sequence tags (ESTs)] from various developmental stages and in response to various biotic and abiotic stresses of the plant is an efficient, economical, and quick approach to target the expressed portion of any genome. (genetics.org)
  • Despite its importance as a fiber source in the pulp and paper industry, a large-scale analysis of expressed sequence tags (ESTs) has not been performed in A. mangium . (springer.com)
  • In this study, we sequenced 10 752 clones of a normalized complementary DNA (cDNA) library prepared from A. mangium developing secondary xylem and shoot, and obtained a total of 8963 ESTs. (springer.com)
  • A total of 1918 loci, detected by the hybridization of 938 expressed sequence tag unigenes (ESTs) from 26 Triticeae cDNA libraries, were mapped to wheat ( Triticum aestivum L.) homoeologous group 4 chromosomes using a set of deletion, ditelosomic, and nulli-tetrasomic lines. (genetics.org)
  • Forty-nine percent of these ESTs were found to be homoologous to sequences on rice chromosome 3, 12% had matches with sequences on other rice chromosomes, and 39% had no matches with rice sequences at all. (genetics.org)
  • Automated partial DNA sequencing was conducted on more than 600 randomly selected human brain complementary DNA (cDNA) clones to generate expressed sequence tags (ESTs). (sciencemag.org)
  • ESTs have applications in the discovery of new human genes, mapping of the human genome, and identification of coding regions in genomic sequences. (sciencemag.org)
  • With the development of functional genomics, a huge number of expressed sequence tags (ESTs) have been deposited in the public database (NCBI) [ 16 ]. (hindawi.com)
  • An in silico approach, for retrieving EST sequences from NCBI, provides a potential source of EST-SSRs, and computational methods could assign putative functions of the ESTs to various metabolic pathways. (hindawi.com)
  • Six, out of the nine ESTs described here, presented differentially expressed in the phases L1 or L2, or even in both of them, suggesting that key mechanisms to the development of Melipona scutellaris are regulated in these stages. (scielo.br)
  • In most microarray experiments, a significant fraction of the differentially expressed mRNAs identified correspond to expressed sequence tags (ESTs) and are generally discarded from further analyses. (nih.gov)
  • The GeneExpress(R) software system Fold Change Analysis Tool was used and 60 ESTs were identified that were expressed at levels at least 3-fold greater in the pancreatic cancers as compared to normal tissues. (nih.gov)
  • Searches against the human genomic sequence and comparative genomic analysis of human and mouse genomes was carried out using basic local alignment search tools (BLAST), BLASTN, and BLASTX, for identifying protein coding genes corresponding to the ESTs. (nih.gov)
  • While 1339 ESTs show no homology to the database, 2024 ESTs have homology (under 80%) with hypothetical proteins, putative proteins, expressed proteins, and unknown proteins in NCBI-GenBank. (nih.gov)
  • ESTs may be used to identify gene transcripts, and are instrumental in gene discovery and in gene-sequence determination. (wikipedia.org)
  • Because these clones consist of DNA that is complementary to mRNA, the ESTs represent portions of expressed genes. (wikipedia.org)
  • Because of the way ESTs are sequenced, many distinct expressed sequence tags are often partial sequences that correspond to the same mRNA of an organism. (wikipedia.org)
  • When the complete genome sequence of an organism is available and transcripts are annotated, it is possible to bypass contig assembly and directly match transcripts with ESTs. (wikipedia.org)
  • Gene expression Complementary DNA (cDNA) transcriptomics IMAGE cDNA clones Whole genome sequencing (WGS) ESTs Factsheet. (wikipedia.org)
  • High-quality ESTs were identified, 1,117 in total, from leaf cDNAs and assembled into 502 contigs, comprising 202 consensus sequences and 300 singletons. (nih.gov)
  • In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ESTs) were identified according to their significant similarities with proteins of known functions. (mdpi.com)
  • Li J, Sun X, Yu G, Jia C, Liu J, Pan H. Generation and Analysis of Expressed Sequence Tags (ESTs) from Halophyte Atriplex canescens to Explore Salt-Responsive Related Genes. (mdpi.com)
  • The data confirmed the central distribution of the sequences, the significant normalization of the sequence population, the frequent extension of contigs composed of existing human ESTs, and the identification of a series of potentially important homologues of known genes. (epfl.ch)
  • Giga-sequencers, which produce several gigabases of fragmented sequences per run, are attractive for decoding genomes and expressed sequence tags (ESTs). (go.jp)
  • A variety of plant genomes and ESTs have been sequenced since the decoding of the genome of Arabidopsis thaliana , the model plant. (go.jp)
  • Sequenced plant genomes and ESTs have been entered into public databases, where they are freely downloadable. (go.jp)
  • Over 28,000 expressed sequence tags (ESTs) were produced from cDNA libraries representing a variety of growth conditions and cell types. (apsnet.org)
  • The estimate of 8,177 unique sequences indicates that over half of the genes of the fungus are represented in the ESTs. (apsnet.org)
  • We assembled ESTs, predicted coding sequences, and identified potential pairs of orthologues (reciprocical best hits) with A. pisum. (inria.fr)
  • Here, we show that cancer biomarkers can be discovered by mining human and mouse Expressed Sequence Tags (ESTs). (biomedcentral.com)
  • We extended TissueInfo to mine ESTs for genes that are differentially expressed in non-tumor versus tumor tissues (see [ 14 ] for details about TissueInfo and Methods for the description of the cancer discovery extension). (biomedcentral.com)
  • We constructed two cDNA libraries from the guts of the fifth-instar larvae of ECB and sequenced a total of 15,000 ESTs from these libraries. (biomedcentral.com)
  • We sequenced 2181 Expressed Sequence Tags (ESTs) from a S. moellendorffii cDNA library. (purdue.edu)
  • We have analyzed synonymous codon usage in the genome of A. tamarense CCMP 1598 for protein-coding sequences from 10865 expressed sequence tags (ESTs). (pubmedcentralcanada.ca)
  • For all the expressed sequence tags (ESTs), approximately 10.9 Mb of porcine sequence were generated with an average length of 674 bp per EST (range: 200-952 bp). (biomedcentral.com)
  • Clustering and assembly of these ESTs resulted in a total of 5,008 unique sequences with 1,776 contigs (35.46%) and 3,232 singleton (65.54%) ESTs. (biomedcentral.com)
  • Sequence analyses of these ESTs revealed microsatellite markers, single nucleotide polymorphisms, and homologs of transposable elements. (plantcell.org)
  • A collection of 30,147 expressed sequence tags (ESTs) was generated from four developmental stages, corresponding to distinct phases of gamma-glutamyl-S-methyl-cysteine accumulation, and covering the transitions to reserve accumulation and dessication. (uwo.ca)
  • A total of 9,447 high quality expressed sequence tags (ESTs) were obtained from the three libraries. (deepdyve.com)
  • To facilitate global gene expression studies we have first sought to define the prostate transcriptome by assembling and annotating prostate-derived expressed sequence tags (ESTs). (garvan.org.au)
  • Abstract Expressed sequence tags (ESTs) are complementary deoxyribonucleic acid (cDNA) fragments, which are reverse transcribed from mature ribonucleic acid (mRNA), a direct gene transcript. (wits.ac.za)
  • ESTs are a readily rich information source of complete expressed gene sequences. (wits.ac.za)
  • Joining ESTs into complete gene sequences is computationally expensive because they are numerous, erroneous, redundant and mixed up. (wits.ac.za)
  • I am attempting to use BLAST to identify UniGene ESTs that align with mapped SSR and SNP marker sequences (i.e. their sequences and positions are known), thereby allowing me to infer the position of the EST. (biostars.org)
  • We deliberately did not use translated expressed sequence tags (ESTs), because we wanted to investigate to usefulness of a target database made up of protein sequences originating mostly from (closely) related helminths. (biomedcentral.com)
  • Homology searches indicate that 89.5% of sequences share significant similarity to known/putative proteins or Rosaceae ESTs. (biomedcentral.com)
  • To remedy this discrepancy ~1800 expressed sequence tags (ESTs) were sequenced from a whole-plant cDNA library derived from various tissues of the Strawberry Festival cultivar. (biomedcentral.com)
  • Out of 955 simple sequence repeat (SSR) containing ESTs, 744 were used for primer design. (au.dk)
  • To begin to decipher the molecular processes underlying gene function, we constructed a database of expressed sequence tags (ESTs) generated from sparganum. (biomedcentral.com)
  • For contemporary functional genomic studies, the significant efforts invested in the creation of integrative transcript databases of expressed sequence tags (ESTs) derived from full-length cDNA libraries have provided opportunities to direct gene discovery and functional analysis. (biomedcentral.com)
  • Probe selection for cDNA microarrays using expressed sequence tags (ESTs) is challenging due to high sequence redundancy and potential cross-hybridization between paralogous genes. (biomedcentral.com)
  • Therefore, the goal of the design procedure described here is to select a subset of ESTs that will minimize sequence redundancy and characterize potential cross-hybridization while providing functionally representative probes. (biomedcentral.com)
  • Sequence similarity between ESTs, quantified by the E-value of pair-wise alignment, was used as a surrogate for expected hybridization between corresponding sequences. (biomedcentral.com)
  • An efficient and economic method to quantify their physiological responses is to collect the expressed sequence tags (ESTs) with the purpose of constructing cDNA microarrays, which can be used to screen their transcriptomes. (biomedcentral.com)
  • Because cDNAs are prepared by reverse transcription of messenger RNA molecules, ESTs act as markers for genes that are expressed in particular tissues or organs. (oup.com)
  • We have generated and analyzed 10,000 expressed sequence tags (ESTs) from three mouse eye tissue cDNA libraries: embryonic day 15.5 (M15E) eye, postnatal day 2 (M2PN) eye and adult retina (MRA). (northwestern.edu)
  • RESULTS: Annotation of 8,633 non-mitochondrial and non-ribosomal high-quality ESTs revealed that 57% of the sequences represent known genes and 43% are unknown or novel ESTs, with M15E having the highest percentage of novel ESTs. (northwestern.edu)
  • Results: A set of new pearl millet SSR markers were developed using available sequence information from 3520 expressed sequence tags (ESTs). (icrisat.org)
  • Over the earlier twenty years, expressed series tags (ESTs - unmarried cross reads from randomly chosen cDNAs), have confirmed to be a remarkably low cost course for the needs of gene discovery. (cartyspoetryjournal.com)
  • In Expressed series Tags (ESTs): iteration and Analysis , major specialists within the box introduce the reader to a few of the primary recommendations underlying the new release and research of ESTs via with no trouble available and cheap sequencing applied sciences. (cartyspoetryjournal.com)
  • Cutting-edge and straightforward to exploit, Expressed series Tags (ESTs): new release and research serves as a terrific reference for scientists carrying on with the important research of genes and the genome. (cartyspoetryjournal.com)
  • A total of 105 high quality ESTs were generated by sequencing of 250 random clones which resulted in 72 unigenes comprising 25 contigs and 47 singlets. (duhnnae.com)
  • Expressed sequence tags (ESTs) analysis enables the collection of nucleotide sequence information regarding protein-coding regions in a rapid and efficient manner, and should be helpful in detecting and identifying genes in genomes. (wenku365.com)
  • A total of 935 expressed sequence tags (ESTs) from male immature sexual organ were determined, of which 600 ESTs were assembled into 110 non-redundant groups, resulting in 445 unique EST sequences. (oup.com)
  • A total of 720 expressed sequence tags (ESTs) have been generated from 585 clones randomly selected from a mixed-stage C. elegans cDNA library. (cshl.edu)
  • Comparison of these ESTs with sequence databases identified 422 new C. elegans genes, of which 317 are not similar to any sequences in the database. (cshl.edu)
  • To identify genes involved in papaya fruit ripening, a total of 1171 expressed sequence tags (ESTs) were generated from randomly selected clones of two independent fruit cDNA libraries derived from yellow and red-fleshed fruit varieties. (qld.gov.au)
  • DNA sequence comparisons identified ESTs with significant similarity to genes associated with fruit softening, aroma and colour biosynthesis. (qld.gov.au)
  • Although short, the 454 reads are of sufficient length to map to a unique genome location as effectively as longer ESTs produced by conventional sequencing. (beds.ac.uk)
  • As with longer ESTs, 454 reads can be mapped uniquely onto genomic sequence to provide support for, and modifications of, gene predictions. (beds.ac.uk)
  • ESTs, are single-pass and partial sequences from cDNA clones that provide a rapid and cost-effective method to analyze transcribed portions of the genome while avoiding the non coding and repetitive DNA that can make up much of the genome of some crop plants. (beds.ac.uk)
  • Two hundred thirty-seven expressed sequence tags (ESTs) of Brassica napus were generated by single-run partial sequencing of 197 random root cDNA clones. (kribb.re.kr)
  • A computer search of these root ESTs revealed that 21 ESTs show significant similarity to the protein-coding sequences in the existing data bases, including five stress- or defense-related genes and four clones related to the genes from other kingdoms. (kribb.re.kr)
  • The results show that generation of the root ESTs by partial sequencing of random cDNA clones along with the expression analysis is an efficient approach to isolate genes that are functional in plant root in a large scale. (kribb.re.kr)
  • Approximately 3,000 clones from each library were randomly sequenced from the 59 end to generate a total of 11,101 high quality expressed sequence tags (ESTs). (umn.edu)
  • Sequence assembly of all ESTs together allowed the identification of 1,453 contigs and 4,403 singleton sequences, with the Basic Localized Alignment Search Tool (BLAST) being used to identify 4,138 presumptive orthologs to Arabidopsis thaliana genes. (umn.edu)
  • Several genes differentially expressed between median and lateral nectaries were initially identified based upon the number of BLAST hits represented by independent ESTs, and later confirmed via reverse transcription polymerase chain reaction (RT PCR). (umn.edu)
  • Sequencing of expressed sequence tags (ESTs) has been one of the primary techniques used for transcriptome analysis in a wide spectrum of species including those utilized for aquaculture. (hawaii.edu)
  • However, many researchers are still unfamiliar with the many genome applications and byprod- ucts of EST analysis, and they often regard ESTs as only short random sequences. (hawaii.edu)
  • This review aims to address these issues by providing information on the construction of normalized cDNA libraries for efficient generation and analysis of ESTs and by highlighting the significance of EST analysis for the genome research of species lacking a sequenced genome. (hawaii.edu)
  • Of 1,056 sequenced reactions attempted, 919 ESTs produced some lengths of readable sequences. (elsevier.com)
  • Based on their putative identification, 730 ESTs that showed significant similarity with amino acid sequences registered in the gene bank were divided into 13 functional categories. (elsevier.com)
  • To increase our understanding of the genetic diversity and gene-based control of these key traits in Actinidia, we have produced a collection of 132,577 expressed sequence tags (ESTs). (beds.ac.uk)
  • The ESTs were derived mainly from four Actinidia species ( A. chinensis, A. deliciosa, A. arguta and A. eriantha ) and fell into 41,858 non redundant clusters (18,070 tentative consensus sequences and 23,788 EST singletons). (beds.ac.uk)
  • The abundance of transcripts is expressed as a percentage of the total toxin transcripts and was calculated by dividing the number of ESTs of each toxin family by the total number of toxin ESTs reported in each study. (biomedcentral.com)
  • Gene expression profiling of the venom gland from the Venezuelan mapanare ( Bothrops colombiensis ) using expressed sequence tags (ESTs). (biomedcentral.com)
  • This study aims to explore the common up-regulated genes in liver and esophageal cancer tissues using expressed sequence tags (ESTs) and to identify the role of key genes in cancer development. (ac.ir)
  • In this study, 1597 high-quality expressed sequence tags (ESTs) were generated from a cDNA library of variety Pusa 1105 root tissue after cadmium (Cd) treatment. (qxmd.com)
  • Besides, the utility of ESTs was demonstrated by exploiting them for the development of 83 genic molecular markers including EST-simple sequence repeats and intron targeted polymorphism that would assist in tagging of genes related to metal stress for future prospects. (qxmd.com)
  • The 1,235 cDNA clones out of 2,039 (60.1%) were assigned putative functions, and the remaining 804 clones were not similar to any known gene sequences in the databases. (springer.com)
  • Tsugane T, Watanabe M, Yano K, Sakurai N, Suzuki H, Shibata D (2005) Expressed sequence tags of full-length cDNA clones from the miniature tomato ( Lycopersicon esculentum ) cultivar Micro-Tom. (springer.com)
  • In 1982, the idea of selecting random or semi-random clones from such a cDNA library for sequencing was explored by Greg Sutcliffe and coworkers. (wikipedia.org)
  • sequenced 178 clones from a rabbit muscle cDNA library. (wikipedia.org)
  • From the cDNA library 10,449 clones were sequenced and analyzed. (molvis.org)
  • Sequences of 145 clones established that the libraries predominantly contain sequences from S. scabiei, enabling a major sequencing program to begin. (ajtmh.org)
  • Expressed sequence tag (EST) analysis of tobacco ( Nicotiana tabacum ) anthers was performed for 200 cDNA clones randomly chosen from a cDNA library representing transcripts of developing tobacco anthers. (springer.com)
  • Only 21 clones showed significant homology to the nucleotide sequences in databases. (springer.com)
  • Hong ST, Chung JE, An G, Kim SR (1998) Analysis of 176 expressed sequence tags generated from cDNA clones of hot pepper by single-path sequencing. (springer.com)
  • We constructed a full-length enriched cDNA library of S. hermonthica , sequenced 37,710 clones from the library, and obtained 67,814 expressed sequence tag (EST) sequences. (biomedcentral.com)
  • In total, 5,760 randomly selected clones were picked and sequenced. (biomedcentral.com)
  • We examined the gene expression profile of human optic nerve (ON) and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. (biomedcentral.com)
  • While many cDNA libraries are normalized (a subtraction hybridization approach to reduce the representation of abundant clones) or amplified (an expansion in which different clones proliferate at different rates), most NEIBank libraries are unnormalized and unamplified so that random sequencing for EST analysis reflects more closely the natural abundance of common gene transcripts in each tissue. (biomedcentral.com)
  • In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST) sequences with high quality. (biomedcentral.com)
  • The C. sinensis cDNA library was constructed and DNA sequencing was performed with 450 randomly selected clones. (elsevier.com)
  • Four hundred and fifteen clones contained the amino-acid-encoding sequences. (elsevier.com)
  • The cDNA clones and sequence information can be used for future functional analysis and for construction of microarrays for monitoring of environmental stressors in coastal waters using wild or caged grass shrimp. (usm.edu)
  • The combined sequences represent 2676 clones describing 1669 individual genes. (edu.au)
  • Northern blot analysis of the 10 data base-matched cDNA clones revealed that many of the clones are expressed most abundantly in root but less abundantly in other organs. (kribb.re.kr)
  • The results suggest that genes involved in nectar production are conserved amongst the Brassicaceae, and also supply clones and sequence information that can be used to probe nectary function in B. rapa. (umn.edu)
  • After transformation, 2,880 clones were selected and sequenced. (ncku.edu.tw)
  • Readable 2228 sequences for olive leaf and 1506 sequences for olive fruit were assembled into 205 and 69 contigs, respectively, whereas 2478 were singletons. (nih.gov)
  • In an effort to reduce the number of expressed sequence tags for downstream gene discovery analyses, several groups assembled expressed sequence tags into EST contigs. (wikipedia.org)
  • Such a database would add significant value to existing public EST databases, which consist mostly of sequences derived from the extremities of cDNAs, and facilitate the construction of contigs of transcript sequences. (epfl.ch)
  • One thousand three hundred and one non-redundant sequences were assembled, containing 291 contigs and 1010 singletons. (purdue.edu)
  • A putative unigene set of 1304 sequences - 133 contigs and 1171 singlets - has been developed, and the transcripts have been functionally annotated. (biomedcentral.com)
  • After clustering, unigene sequences (2175 singlets and 317 contigs) were searched for the presence of SSRs. (icrisat.org)
  • In this study, we constructed cDNA library and determined 542 of distinct EST sequences composed of 284 singletons and 95 contigs. (malacol.or.kr)
  • We have constructed a cDNA library from an isolate of B. cinerea and have sequenced 11,482 expressed sequence tags that were assembled into 1,003 contigs sequences and 3,032 singletons. (bvsalud.org)
  • Putative functions of all 2752 differentially expressed unique sequences were designated by gene homology based on BLAST and annotated using BLAST2GO. (nih.gov)
  • With this approach, we identify the 200 genes most consistently differentially expressed in cancer (called HM200) and proceed to characterize these genes. (biomedcentral.com)
  • The differentially expressed transcripts were identified. (deepdyve.com)
  • Under heat stress, we find that 63 TUGs are differentially expressed (d.e.) at 25°C compared with lower, no-stress condition temperatures (4°C and 17°C). Approximately one-third of d.e. eelgrass genes were characteristic for the stress response of the terrestrial plant model Arabidopsis thaliana. (mpg.de)
  • In order to determine which genes are differentially expressed between the two specimens, suppression subtractive hybridization (SSH) was performed utilizing a chemistry negative and chemistry positive morphotype as the "driver" and "tester" populations respectively. (nova.edu)
  • Because only a small number of these genes have been characterized, we developed a screen for genes encoding extracellular proteins that are differentially expressed during Drosophila embryogenesis. (pnas.org)
  • In total, 2,518 individual cDNAs from the normalized library were screened by in situ hybridization, and 917 of these cDNAs represent genes differentially expressed during embryonic development. (pnas.org)
  • The kind of genes differentially expressed at the initiation of fruiting body include the following: (1) initiation-stress response and specific signal transduction, (2) reconstruction of proteome-protein degradation, modification and biosynthesis, and (3) switching of biochemical pathways and structural components like hydrophobins. (edu.hk)
  • Microsatellites or simple sequence repeats (SSRs) are sequences in which one or few bases are tandemly repeated, ranging from 1 to 6 base pair (bp) long units which are dispersed randomly and ubiquitously throughout the genomes including both prokaryotes and eukaryotes [ 13 - 15 ]. (hindawi.com)
  • Additionally, among the 343 unigenes sequences, 22 simple sequence repeats (SSRs) were also identified contributing to the study of A. canescens resources. (mdpi.com)
  • Level of genetic differentiation affects relative performances of expressed sequence tag and genomic SSRs. (academicjournals.org)
  • Thirty-two expressed sequence tag (EST)-derived microsatellite markers (SSRs) were developed and characterized in this study using publically available EST sequences. (archives-ouvertes.fr)
  • Furthermore, we found 1,445 putative simple sequence repeats (SSRs) in the S. hermonthica unigene dataset. (biomedcentral.com)
  • We detected 164 sequences containing SSRs (at least 14 bases in length), with a density of one per 1.75 kb of EST sequence. (icrisat.org)
  • Furthermore, we found 1,233 putative simple sequence repeats (SSRs) in the P. mume unigene dataset. (biomedcentral.com)
  • We evaluated the abundance and nature of simple sequence repeats (SSRs) in the causal agent of stem rust of wheat, Puccinia graminis f. sp. (edu.au)
  • After clustering and assembly, a total of 184,599 unique sequences were generated containing over 400 SSRs. (beds.ac.uk)
  • This generated EST's data and consensus sequences were submitted to NCBI as valuable source for functional genome studies of olive. (nih.gov)
  • Among 1301 clusters, 343 were categorized according to Gene Ontology (GO) hierarchy and were compared to the GO mapping of A. thaliana tentative consensus sequences. (purdue.edu)
  • This enables efficient consensus sequences generation, which reveals underlying gene sequences and their possible alternative splicings. (wits.ac.za)
  • article{e9ac4e46-7f3f-4f79-aec3-ce5508715b29, abstract = {Comparative analysis of expressed sequence tags is becoming an important tool in molecular ecology for comparing gene expression in organisms grown in certain environments. (lu.se)
  • Zhu J, Sun Y, Zhao FQ, Yu J, Craig R, Hu S. Analysis of tarantula skeletal muscle protein sequences and identification of transcriptional isoforms. (umassmed.edu)
  • Pearson WR (1991) Identifying distantly related protein sequences. (springer.com)
  • In a previous study, we used a custom protein database containing protein sequences from related helminths to identify T. solium metacestode excretion/secretion proteins. (biomedcentral.com)
  • At first, we identified 180 of EST sequences that have significant hits on protein sequences of the exclusive Mollusks database through BLASTX program and 343 of EST sequences that have significant hits on NCBI NR database. (malacol.or.kr)
  • In 1991, Adams and co-workers coined the term EST and initiated more systematic sequencing as a project (starting with 600 brain cDNAs). (wikipedia.org)
  • Although more than 34,000 cDNA sequences for the axolotl Ambystoma mexicanum , 677,000 cDNAs for the African clawed frog Xenopus laevis , and 1,271,000 cDNAs for the western clawed frog Xenopus tropicalis are available [ 8 - 13 ], cDNA resources are lacking in the newt field. (molvis.org)
  • Partial cDNA (DNA, COMPLEMENTARY) sequences that are unique to the cDNAs from which they were derived. (umassmed.edu)
  • Among those sequenced to date, cDNAs encoding S. scabiei homologues of 3 house dust mite allergens-the M-177 apolipoprotein, glutathione S-transferase, and paramyosin-were identified. (ajtmh.org)
  • Sung SK, Jeong DH, Nam J, Kim SH, Kim SR, An G (1998) Expressed sequence tags of fruits, peels, and carpels and analysis of mRNA expression levels of the tagged cDNAs of fruits from the Fuji apple. (springer.com)
  • We developed a relatively large EST database consisting of 12,519 high-quality sequences from a total of 15,000 cDNAs from the larval gut of ECB. (biomedcentral.com)
  • Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. (elsevierpure.com)
  • We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. (elsevierpure.com)
  • In parallel to 454 sequencing, 4,445 5'-prime reads were generated by conventional sequencing using the same library and from the assembled sequences it was shown to contain about 52% full length cDNAs encoding proteins from 50 to over 500 amino acids in length. (beds.ac.uk)
  • Sequence analysis of 1,001 cDNAs indicated that 811 represent genes not previously described in Drosophila . (pnas.org)
  • For a given stage in the agglomeration procedure, the EST having the highest similarity to all the other sequences within each cluster, the centroid EST, was selected as a microarray probe. (biomedcentral.com)
  • Most of these genes were previously annotated as olfactory receptors based solely on sequence similarity. (biomedcentral.com)
  • Approximately 81% of the unigenes showed significant similarity to genes coding for proteins with known functions more than 50% of the sequences code for genes involved in cellular metabolism , 12% for transport of metabolites, and approximately 10% for cellular organization . (bvsalud.org)
  • In terms of species distribution, majority of sequences found similarity with Medicago truncatula followed by Glycine max, Vitis vinifera and Populus trichocarpa and Pisum sativum sequences. (qxmd.com)
  • First opened to outside users in December 1989, the NCBI Experimental BLAST Network Service, running the latest BLAST software on SMP hardware against the latest releases of the major sequence databases, quickly established the NCBI as a convenient, one-stop shop for sequence similarity searching. (wikipedia.org)
  • At Washington University in St. Louis, Gish revolutionized similarity searching by developing the first BLAST suite of programs to combine rapid gapped sequence alignment with statistical evaluation methods appropriate for gapped alignment scores. (wikipedia.org)
  • This approach should make a significant contribution to the early identification of important human genes, the deciphering of the draft human genome sequence currently being compiled, and the shotgun sequencing of the human transcriptome. (epfl.ch)
  • Large-scale development of expressed sequence tag-derived simple sequence repeat markers by deep transcriptome sequencing in garlic ( Allium sativum L. (springer.com)
  • In order to develop SSR markers on a large scale, we performed transcriptome analysis using Illumina pair-end sequencing. (springer.com)
  • Deng Y, Yao J, Wang X, Guo H, Duan D (2012) Transcriptome sequencing and comparative analysis of Saccharina japonica (Laminariales, Phaeophyceae) under blue light induction. (springer.com)
  • One example is next-generation sequencing technology, which has the advantage of enhancing the sequencing output from the transcriptome of a weedy plant at a reduced cost. (bioone.org)
  • They may be represented in databases as either cDNA/mRNA sequence or as the reverse complement of the mRNA, the template strand. (wikipedia.org)
  • Foster GD, Robinson SW, Blundell RP, Roberts MR, Hodge R, Draper J, Scott RJ (1992) A Brassica napus mRNA encoding a protein homologous to phospholipid transfer proteins is expressed specifically in the tapetum and developing microspores. (springer.com)
  • Roberts MR, Robson F, Foster GD, Draper J, Scott RJ (1991) A Brassica napus mRNA expressed specifically in developing microspores. (springer.com)
  • An EST is produced by one-shot sequencing of a cloned mRNA (i.e. sequencing several hundred base pairs from an end of a cDNA clone taken from a cDNA library). (academic.ru)
  • They may be present in the database as either cDNA/mRNA sequence or as the reverse complement of the mRNA, the template strand . (academic.ru)
  • The variation around the regression line, however, reflects both the random sampling effect of EST sequencing (sequencing effectively randomly picks mRNA molecules from the pool available in a given tissue sample) and the differential regulation of the genes between the tumor and non tumor conditions. (biomedcentral.com)
  • Based on near-perfect complementarity between cannabis miRNAs and their target mRNA gene sequence, a total of 23 miRNAs targets were identified involved in processes such as plant development, signal transduction, secondary metabolite production, protein degradation, response to environmental stress and pathogen invasion, and ability to regulate their own biogenesis. (rroij.com)
  • The randomly selected 3840 colonies were sequenced for EST collection from both libraries. (nih.gov)
  • This makes it difficult to write programs that can unambiguously determine that two EST libraries were sequenced from the same tissue. (wikipedia.org)
  • Only a few studies have focused on developing expressed sequence tag (EST) libraries from the guts of lepidopteran larvae. (biomedcentral.com)
  • Since this is the first description of GRPs in this species, particular emphasis has been given to the expression pattern of these genes by analyzing their abundance and prevalence in the different cDNA-libraries of the Eucalyptus Genome Sequencing Project Consortium (ForEST). (ufrgs.br)
  • Approximately 1400 genes were sequenced, 70% from a cDNA library generated from dissected basal bulbs (containing the pharyngeal gland cells) and 30% from cDNA libraries generated from whole mixed stage nematodes. (brillonline.com)
  • Expressed sequence tag (EST) analysis of cDNA libraries can provide an informative overview of major transcripts in specific tissues. (biomedcentral.com)
  • A combined assembly of 8 341 expressed sequence tags was generated from Roche 454 GS-FLX sequencing of eight tissue-specific cDNA libraries. (usda.gov)
  • 3. Library Preparation and Sequencing Choices There are many options for determining who should prepare and sequence cDNA libraries. (cartyspoetryjournal.com)
  • Due to the large number of reads afforded by the 454 DNA sequencing technology, it is effective in revealing the expression of transcripts from a broad range of GO categories and contains many rare transcripts in normalized cDNA libraries, although only a limited portion of their sequence is uncovered. (beds.ac.uk)
  • We also discuss the results of the examination of cDNA libraries and sequencing methods suitable for this approach. (kribb.re.kr)
  • Based on the Plant Biology Journal entitled "Gene discovery in the wood-forming tissues of poplar: Analysis of 5,692 expressed sequence tags", by Sterky et al . (ukessays.com)
  • Expressed sequence tag (EST) projects provide a convenient and efficient approach for identifying and characterising the transcripts of genes expressed in tissues and cells. (biomedcentral.com)
  • As a first step to remedy this discrepancy a cDNA library has been developed from salicylate-treated, whole-plant tissues and over 1800 expressed sequence tags (EST's) have been sequenced and analyzed. (biomedcentral.com)
  • An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST) analysis. (biomedcentral.com)
  • Expression levels of these transposable elements indicate tissue specificity and differential expression in vegetative and reproductive tissues, suggesting that expressed TEs might contribute to sunflower development. (mdpi.com)
  • Oldenlandia affinis is a member of the Rubiaceae (coffee) family from which 18 cyclotides have been sequenced to date, but the details of their processing from precursor proteins have only begun to be elucidated. (nih.gov)
  • The deduced proteins expressed by these genes have been described as possible vaccine targets in other trematodes, and/or as relevant diagnosis antigens. (csic.es)
  • Here we describe a collection of 691 sequences from the Western corn rootworm midgut, 27% of which predict proteins with no matches in current databases. (unl.edu)
  • Of the remaining sequences, most predict proteins with either catalytic (62%) or binding (19%) functions, as expected for proteins expressed in the insect midgut. (unl.edu)
  • Among the unique sequences, 62.7% encoded putative proteins that shared significant sequence similarities (E-value ≤ 10 -3 )with the sequences available in GenBank. (biomedcentral.com)
  • Mass spectrometric analysis of androgen-regulated proteins in these cells identified the metastasis-suppressor gene NDKA/nm23, a finding that may explain a marked reduction in metastatic potential when these cells express a functional androgen receptor pathway. (garvan.org.au)
  • Genes encoding transthyretin-like proteins were abundant in the bulb library and in situ hybridisation confirmed that one of these is expressed in the basal bulb. (brillonline.com)
  • Phototransduction genes are preferentially identified in MRA, whereas transcripts for cell structure and regulatory proteins are highly expressed in the developing eye. (northwestern.edu)
  • Expressed papaya genes associated with fruit aroma included isoprenoid biosynthesis and shikimic acid pathway genes and proteins associated with acyl lipid catabolism. (qld.gov.au)
  • We present a large-scale screen for genes encoding secreted and transmembrane proteins that are expressed in specific tissue or cell types during embryonic development in Drosophila . (pnas.org)
  • The approach combines a cDNA library enriched for genes encoding extracellular proteins with a high throughput whole-embryo in situ hybridization procedure and subsequent sequence analysis. (pnas.org)
  • The highly expressed transcripts in the cDNA library were some genes related to photosynthesis, disease/defense, and flavonoid biosynthesis, including ribulose-bisphosphate carboxylase small-chain gene, pathogenesis-related protein gene, light-harvesting chlorophyll a/b binding protein of photosystem gene, catalase gene, and phenylcoumaran benzylic ether reductase gene et al. (springer.com)
  • Theoretical considerations predict that amplification of expressed gene transcripts by reverse transcription-PCR using arbitrarily chosen primers will result in the preferential amplification of the central portion of the transcript. (epfl.ch)
  • The scatter observed when considering all transcripts (top left panel of Figure 1 ) can be considerably reduced when focusing on transcripts preferentially expressed in a given tissue. (biomedcentral.com)
  • Cloning and sequencing of the 698 nt transcript for CpomGOBP1 resulted in the prediction of a 163 amino acid coding region, and subsequent RT-PCR indicated that the transcripts were mainly expressed in antennae and mouthparts. (usda.gov)
  • The 1 289 nt (160 amino acid) CpomGOBP2 and the novel 702 nt (169 amino acid) CpomGOBP3 transcripts are mainly expressed in antennae, mouthparts, and female abdomen tips. (usda.gov)
  • These results indicate that next generation sequencing is useful for the identification of novel transcripts of interest, and that codling moth expresses a transcript encoding for a new member of the GOBP subfamily. (usda.gov)
  • METHODOLOGY/PRINCIPAL FINDINGS: We generated and partially sequenced a cDNA library from B. plicatilis and constructed a database of over 2300 expressed sequence tags corresponding to more than 450 transcripts. (mblwhoilibrary.org)
  • In contrast to bdelloid rotifers, there was no evidence of a conserved trans-spliced leader sequence among the transcripts and most genes were single-copy. (mblwhoilibrary.org)
  • The remaining 201 unique sequences showed no significant matches and thus are likely to be novel transcripts. (oup.com)
  • 1500 transcripts per million were selected as highly expressed. (ac.ir)
  • Approximately 69.7 million clean sequence reads were generated, and these reads were eventually assembled into 135,360 unigenes. (springer.com)
  • Comparison could also be made about the conserved sequences and information on the regulatory elements for extending the genetic information from model to more complicated species [ 5 , 6 ]. (hindawi.com)
  • 635 EST's unique genes sequence have been identified by over 80% homology to known function in other species which were not previously described in Olea family. (nih.gov)
  • Comparative analysis of the Acyrthosiphon pisum genome and expressed sequence tag-based gene sets from other aphid species. (inria.fr)
  • To study gene repertoires and their evolution within aphids, we compared the complete genome sequence of Acyrthosiphon pisum (reference gene set) and expressed sequence tag (EST) data from three other species: Myzus persicae, Aphis gossypii and Toxoptera citricida. (inria.fr)
  • An expressed sequence tag (EST) library of the key grassland species perennial ryegrass ( Lolium perenne L.) has been exploited as a resource for microsatellite marker development. (au.dk)
  • In instances where genome sequence is not available, EST sequencing provides a first catalog of a species' gene inventory. (beds.ac.uk)
  • Here we report on the sequencing, assembly, and analyses of 96 randomly chosen BACs from sunflower to provide additional information on the repeat content of the sunflower genome, assess how repetitive elements in the sunflower genome are organized relative to genes, and compare the genomic distribution of these repeats to that found in other food crops and model species. (mdpi.com)
  • Linkage map positions of these EST-SSR were compared by homology search with mapped rice genomic sequences on the basis of pearl millet-rice synteny. (icrisat.org)
  • The functions of these genes could be assigned by DNA sequence homology. (elsevier.com)
  • Our data provide the first extensive set of molecular resources for studying S. hermonthica , and include EST sequences, a comparative analysis with other plant genomes, and useful genetic markers. (biomedcentral.com)
  • Definition of expressed gene sequence variation in the octoploid may aid in the understanding of polyploid evolution and/or silencing of component genomes. (biomedcentral.com)
  • All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. (mdpi.com)
  • In total, we deposited 16,110 high-quality sequences in the dbEST division of GenBank (accession numbers: DT319652-DT335761). (biomedcentral.com)
  • Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. (elsevierpure.com)
  • Gish also envisioned at this time a centralized search service, wherein all nucleotide sequences from GenBank would be maintained in memory to eliminate I/O bottlenecks-and stored in compressed form to conserve memory-with clients invoking FASTN searches remotely via the Internet. (wikipedia.org)
  • the NCBI non-redundant (nr) protein and nucleotide sequence databases, typically updated on a daily basis with all data from GenBank, Swiss-Prot, and the PIR. (wikipedia.org)
  • Using this value as a measure of dissimilarity, sequence redundancy reduction was performed by hierarchical cluster analyses. (biomedcentral.com)
  • The challenges on the roles of such genes were reviewed while an attempt was made to find putative candidates for androgenesis using Expressed Sequenced Tags (EST) and interolog based protein interaction analyses. (bvsalud.org)
  • A database containing mapped partial cDNA sequences from Caenorhabdhitis elegans will provide a ready starting point for identifying nematode homologues of important human genes and determining their functions in C. elegans. (cshl.edu)
  • A short partial sequence, typically 200-400 bp long, of a complementary DNA (cDNA) clone. (oup.com)
  • To increase the speed at which genes involved in cyclotide biosynthesis and processing are being discovered, an expressed sequence tag (EST) project was initiated to survey the transcript profile of O. affinis and to propose some future directions of research on in vivo protein cyclisation. (nih.gov)
  • Differences for one gene pair are apparently due to both unequal numbers of expressing cells and unequal transcript levels per expressing cell. (biomedcentral.com)
  • This fast approach to cDNA characterization will facilitate the tagging of most human genes in a few years at a fraction of the cost of complete genomic sequencing, provide new genetic markers, and serve as a resource in diverse biological research fields. (sciencemag.org)
  • Expressed sequence tags (EST) are potential source for the development of genic microsatellite markers, gene discovery, comparative genomics, and other genomic studies. (hindawi.com)
  • Genetic Diversity and Origin of Weedy Rice (Oryza sativa f. spontanea) Populations Found in North-eastern China Revealed by Simple Sequence Repeat (SSR) Markers. (academicjournals.org)
  • The lack of simple sequence repeat (SSR) markers is a major obstacle in genetic studies of garlic. (springer.com)
  • Many potentially fruitful research avenues, especially large-scale gene expression surveys and development of molecular genetic markers have been limited by a lack of sequence information in public databases. (biomedcentral.com)
  • Strawberry has unrealized potential as a research model and tool, and the lack of molecular markers for breeding and the eventual need for genetic improvement of the current suite of cultivars makes sequence examination especially timely. (biomedcentral.com)
  • Expressed sequence tag-derived microsatellite markers of perennial ryegrass (Lolium perenne L. (au.dk)
  • SpiroESTdb provides an integrated platform for expressed sequence data, expression dynamics, functional genes, genetic markers including single nucleotide polymorphisms and tandem repeats, gene ontology and KEGG pathway information. (biomedcentral.com)
  • Gene ontology (GO) annotation of unique sequences showed that approximately 31.7, 32.3, and 30.8% were assigned molecular function, biological process, and cellular component GO terms, respectively. (biomedcentral.com)
  • Annotation and analysis of 10,000 expressed sequence tags from developing mouse eye and adult retina. (northwestern.edu)
  • Fingerprint Dive into the research topics of 'Annotation and analysis of 10,000 expressed sequence tags from developing mouse eye and adult retina. (northwestern.edu)
  • Androgenesis in chickpea: Anther culture and expressed sequence tags derived annotation. (bvsalud.org)
  • Expressed Sequence Tag (EST) has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. (biomedcentral.com)
  • In this study, we addressed whether a single 454 Life Science GS20 sequencing run provides new gene discovery from a normalized cDNA library, and whether the short reads produced via this technology are of value in gene structure annotation. (beds.ac.uk)
  • In genome projects such as the Medicago Sequencing Initiative [ 1 ], Expressed Sequenced Tags are of great value for genome annotation because they provide evidence of expression of predicted genes, and by spliced alignment to genomic DNA, they can provide support for gene structures. (beds.ac.uk)
  • Here, we examine whether the deep sequencing made cost-effective by pyrosequencing technology leads to significant new gene discovery in a normalized cDNA library, and whether the short reads produced are of value in gene structure annotation and SSR identification. (beds.ac.uk)
  • Identification of novel highly expressed genes in pancreatic ductal adenocarcinomas through a bioinformatics analysis of expressed sequence tags. (nih.gov)
  • Comparative analysis of expressed sequence tags is becoming an important tool in molecular ecology for comparing gene expression in organisms grown in certain environments. (lu.se)
  • Analysis of expressed sequence tags from the ecto. (brillonline.com)
  • Analysis of expressed sequence tags of the cyclically parthenogenetic rotifer Brachionus plicatilis. (mblwhoilibrary.org)
  • In genetics, an expressed sequence tag (EST) is a short sub-sequence of a cDNA sequence. (wikipedia.org)
  • Highly expressed genes often exhibit a high degree of codon bias whereas lowly expressed genes often contain many alternative synonymous codons [ 5 ]. (pubmedcentralcanada.ca)
  • the fact that some are among the most highly expressed indicates their importance. (mblwhoilibrary.org)
  • In the quantitative real-time PCR analysis, five of the transcription factors and three of the transporter genes were found to be highly expressed after Cd treatment. (qxmd.com)
  • Lumican is highly expressed in pleural effusions ( lung fluid) of patients with adenocarcinoma . (wikipedia.org)
  • Approximately 20% of these novel sequences could be found in the Medicago genome sequence. (beds.ac.uk)
  • Several publicly funded large-scale sequencing efforts have been initiated with the goal of completing the first reference human genome sequence by the year 2005. (nih.gov)
  • Functional Analysis and Comparative Genomics of Expressed Sequence Tag" by Jing-Ke Weng, Milos Tanurdzic et al. (purdue.edu)
  • and Chapple, Clint, "Functional Analysis and Comparative Genomics of Expressed Sequence Tags From the Lycophyte Selaginella Moellendorffii" (2005). (purdue.edu)
  • A strong sequence database is the cornerstone of functional genomics studies, and this information will aid development of such tools in Fragaria and in the Rosaceae in general. (biomedcentral.com)
  • This integrative web-based database of sequence data, functional annotations and expression profiling data will serve as a useful tool to help understand and expand the characterization of parasitic infections. (biomedcentral.com)
  • Functional interpretation of the sequences was carried out by Gene Ontology assignments from matches to Arabidopsis and was shown to cover a broad range of GO categories. (beds.ac.uk)
  • The recent progress in functional genomics research based on large-scale expressed sequence tag (EST) generation, analysis and cloning of genes in cannabis plant has provided a critical significance on elucidating the molecular mechanism of growth, development, differentiation, metabolism, quality, yield, and stress resistance, as well as genetic manipulation via biotechnological approaches in the foreseeable future. (rroij.com)
  • Our full-length sequence data and tissue distribution data can be used to decipher the functional roles exhibited by the adipocyte under various perturbations via endocrine, environmental, genetic, nutritional, pharmacological, or physiological manipulations. (ncku.edu.tw)
  • This large genomic size makes dinoflagellates unlikely to be selected for complete genome sequencing. (pubmedcentralcanada.ca)
  • Sequences representative of particular functions or structures have been collected from public databases to curate smaller databases useful for studying protein function. (go.jp)
  • vulpes and the emerging public sequence databases from both opens up new possibilities in scabies research. (ajtmh.org)
  • Despite its value, fewer than 100 annotated sequences existed in public databases in early 2004. (biomedcentral.com)
  • EST sequence data are held on databases, and researchers use computer programs to search for sequences that correspond to, say, a partial amino-acid sequence for a protein under investigation. (oup.com)
  • Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. (elsevierpure.com)
  • Cluster analysis was performed, and the assembled contig of each cluster was subjected to search against DNA sequences in the nucleotide databases (NCBINR/TIGRGI). (ncku.edu.tw)
  • Gene Ontology (GO) terms for each sequence were provided using GOblet software. (usm.edu)
  • We report here a cDNA and its deduced amino acid sequence encoding a cathepsin D-like, aspartic protease from Chlamys farreri (denoted as CfCD) by expressed sequence tag and rapid amplification of cDNA ends techniques. (usda.gov)
  • For instance, cancer origin of a library is often mixed with the tissue name (e.g., the tissue name "glioblastoma" indicates that the EST library was sequenced from brain tissue and the disease condition is cancer). (wikipedia.org)
  • The isolation of genes expressed in backfat tissue is the first step toward a better understanding of backfat tissue on a genomic basis. (biomedcentral.com)
  • In this adipose tissue cDNA library, approximately 16% of the genes contained full-length sequences with start and stop codons. (ncku.edu.tw)
  • PCR and DNA sequence analysis have become standard tools for identification, detection and phylogenetic analysis of fungi. (edu.au)
  • Computational Prediction, Target Identification and Experimental Validation of miRNAs from Expressed Sequence Tags in Cannabis sativa. (rroij.com)
  • The resulting sequence is a relatively low-quality fragment whose length is limited by current technology to approximately 500 to 800 nucleotides. (wikipedia.org)
  • Assuming the 96 BACs are representative of the genome as a whole, then approximately 5.2% of the sunflower genome comprises non TE-related genic sequence, with an average gene density of 18kbp/gene. (mdpi.com)
  • Combinations of library normalization and deep sequencing are used to maximize gene discovery. (beds.ac.uk)
  • An expressed sequence tag or EST is a short sub-sequence of a transcribed spliced nucleotide sequence (either protein -coding or not). (academic.ru)
  • Reverse-genetic and/or post-genomic approaches predicated on nucleotide sequence information are vital for such investiga- tions [7,8]. (wenku365.com)
  • Moreover, it allows easier association to mRNAs and protein, allow detection of splice variants plus fewer sequences to analyse ( Ioannidis, 2004 ). (ukessays.com)
  • Plant microRNAs (miRNAs) are RNAs of 20-22 nucleotides in length with sequence complementarities to specific mRNAs that are targeted for either cleavage or translational repression. (civilica.com)
  • Here we present the results of analysis of 11.8 Mb of genomic sequence from chromosome 16. (nih.gov)
  • J. Kuo, M.-C. Chen, C.-H. Lin, and L.-S. Fang, "Comparative gene expression in the symbiotic and aposymbiotic Aiptasia pulchella by expressed sequence tag analysis," Biochemical and Biophysical Research Communications , vol. 318, no. 1, pp. 176-186, 2004. (hindawi.com)
  • Sequences derived from this effort may be used to speed gene discovery efforts in Fragaria and the Rosaceae in general and also open avenues of comparative mapping. (biomedcentral.com)
  • Here, we report on 464 EST-derived SSR primer sequences of perennial ryegrass established in laboratory assays, providing a dedicated tool for marker assisted breeding and comparative mapping within and among forage and turf grasses. (au.dk)
  • Comparative mapping, Expressed sequence tag (EST), Ryegrass (Lolium spp. (au.dk)
  • Ramezani M, Shamsabadi F, Oladnabi M. A Comparative Analysis of Gene Expression Profile in Liver and Esophageal Cancer using Expressed Sequence Tags. (ac.ir)
  • Sequence characterization of microsatellites in diploid and polyploid Ipomoea. (academicjournals.org)