Diminished or failed response of an organism, disease or tissue to the intended effectiveness of a chemical or drug. It should be differentiated from DRUG TOLERANCE which is the progressive diminution of the susceptibility of a human or animal to the effects of a drug, as a result of continued administration.
The ability of viruses to resist or to become tolerant to chemotherapeutic agents or antiviral agents. This resistance is acquired through gene mutation.
Resistance or diminished response of a neoplasm to an antineoplastic agent in humans, animals, or cell or tissue cultures.
Simultaneous resistance to several structurally and functionally distinct drugs.
The ability of microorganisms, especially bacteria, to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).
The ability of bacteria to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).
The ability of bacteria to resist or to become tolerant to several structurally and functionally distinct drugs simultaneously. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).
The ability of fungi to resist or to become tolerant to chemotherapeutic agents, antifungal agents, or antibiotics. This resistance may be acquired through gene mutation.
Any tests that demonstrate the relative efficacy of different chemotherapeutic agents against specific microorganisms (i.e., bacteria, fungi, viruses).
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Substances that reduce the growth or reproduction of BACTERIA.
The capacity of an organism to defend itself against pathological processes or the agents of those processes. This most often involves innate immunity whereby the organism responds to pathogens in a generic way. The term disease resistance is used most frequently when referring to plants.
The ability of viruses to resist or to become tolerant to several structurally and functionally distinct drugs simultaneously. This resistance phenotype may be attributed to multiple gene mutation.
A 170-kDa transmembrane glycoprotein from the superfamily of ATP-BINDING CASSETTE TRANSPORTERS. It serves as an ATP-dependent efflux pump for a variety of chemicals, including many ANTINEOPLASTIC AGENTS. Overexpression of this glycoprotein is associated with multidrug resistance (see DRUG RESISTANCE, MULTIPLE).
The force that opposes the flow of BLOOD through a vascular bed. It is equal to the difference in BLOOD PRESSURE across the vascular bed divided by the CARDIAC OUTPUT.
Drugs used in the treatment of tuberculosis. They are divided into two main classes: "first-line" agents, those with the greatest efficacy and acceptable degrees of toxicity used successfully in the great majority of cases; and "second-line" drugs used in drug-resistant cases or those in which some other patient-related condition has compromised the effectiveness of primary therapy.
Tuberculosis resistant to chemotherapy with two or more ANTITUBERCULAR AGENTS, including at least ISONIAZID and RIFAMPICIN. The problem of resistance is particularly troublesome in tuberculous OPPORTUNISTIC INFECTIONS associated with HIV INFECTIONS. It requires the use of second line drugs which are more toxic than the first line regimens. TB with isolates that have developed further resistance to at least three of the six classes of second line drugs is defined as EXTENSIVELY DRUG-RESISTANT TUBERCULOSIS.
Agents used to treat AIDS and/or stop the spread of the HIV infection. These do not include drugs used to treat symptoms or opportunistic infections associated with AIDS.
Substances that inhibit or prevent the proliferation of NEOPLASMS.
The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.
Agents used in the treatment of malaria. They are usually classified on the basis of their action against plasmodia at different stages in their life cycle in the human. (From AMA, Drug Evaluations Annual, 1992, p1585)
Enzyme of the human immunodeficiency virus that is required for post-translational cleavage of gag and gag-pol precursor polyproteins into functional products needed for viral assembly. HIV protease is an aspartic protease encoded by the amino terminus of the pol gene.
A sequence-related subfamily of ATP-BINDING CASSETTE TRANSPORTERS that actively transport organic substrates. Although considered organic anion transporters, a subset of proteins in this family have also been shown to convey drug resistance to neutral organic drugs. Their cellular function may have clinical significance for CHEMOTHERAPY in that they transport a variety of ANTINEOPLASTIC AGENTS. Overexpression of proteins in this class by NEOPLASMS is considered a possible mechanism in the development of multidrug resistance (DRUG RESISTANCE, MULTIPLE). Although similar in function to P-GLYCOPROTEINS, the proteins in this class share little sequence homology to the p-glycoprotein family of proteins.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
A reverse transcriptase encoded by the POL GENE of HIV. It is a heterodimer of 66 kDa and 51 kDa subunits that are derived from a common precursor protein. The heterodimer also includes an RNAse H activity (RIBONUCLEASE H, HUMAN IMMUNODEFICIENCY VIRUS) that plays an essential role the viral replication process.
Includes the spectrum of human immunodeficiency virus infections that range from asymptomatic seropositivity, thru AIDS-related complex (ARC), to acquired immunodeficiency syndrome (AIDS).
A species of gram-positive, aerobic bacteria that produces TUBERCULOSIS in humans, other primates, CATTLE; DOGS; and some other animals which have contact with humans. Growth tends to be in serpentine, cordlike masses in which the bacilli show a parallel orientation.
A class of plasmids that transfer antibiotic resistance from one bacterium to another by conjugation.
A family of MEMBRANE TRANSPORT PROTEINS that require ATP hydrolysis for the transport of substrates across membranes. The protein family derives its name from the ATP-binding domain found on the protein.
A cell line derived from cultured tumor cells.
Genes for MEMBRANE TRANSPORT PROTEINS that confer resistance to toxic compounds. Several superfamilies of these multidrug export proteins are known and found in both prokaryotes and eukaryotes.
Nonsusceptibility of bacteria to the action of TETRACYCLINE which inhibits aminoacyl-tRNA binding to the 30S ribosomal subunit during protein synthesis.
The ability of fungi to resist or to become tolerant to several structurally and functionally distinct drugs simultaneously. This resistance phenotype may be attributed to multiple gene mutations.
Nonsusceptibility of an organism to the action of penicillins.
An antibiotic produced by the soil actinomycete Streptomyces griseus. It acts by inhibiting the initiation and elongation processes during protein synthesis.
Antineoplastic antibiotic obtained from Streptomyces peucetius. It is a hydroxy derivative of DAUNORUBICIN.
A naphthacene antibiotic that inhibits AMINO ACYL TRNA binding during protein synthesis.
Inhibitors of reverse transcriptase (RNA-DIRECTED DNA POLYMERASE), an enzyme that synthesizes DNA on an RNA template.
Antibacterial agent used primarily as a tuberculostatic. It remains the treatment of choice for tuberculosis.
The prototypical antimalarial agent with a mechanism that is not well understood. It has also been used to treat rheumatoid arthritis, systemic lupus erythematosus, and in the systemic therapy of amebic liver abscesses.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Proteins found in any species of bacterium.
Diseases of plants.
Tests that demonstrate the relative effectiveness of chemotherapeutic agents against specific parasites.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
A semisynthetic antibiotic produced from Streptomyces mediterranei. It has a broad antibacterial spectrum, including activity against several forms of Mycobacterium. In susceptible organisms it inhibits DNA-dependent RNA polymerase activity by forming a stable complex with the enzyme. It thus suppresses the initiation of RNA synthesis. Rifampin is bactericidal, and acts on both intracellular and extracellular organisms. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p1160)
A species of protozoa that is the causal agent of falciparum malaria (MALARIA, FALCIPARUM). It is most prevalent in the tropics and subtropics.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Physiologically, the opposition to flow of air caused by the forces of friction. As a part of pulmonary function testing, it is the ratio of driving pressure to the rate of air flow.
A parasexual process in BACTERIA; ALGAE; FUNGI; and ciliate EUKARYOTA for achieving exchange of chromosome material during fusion of two cells. In bacteria, this is a uni-directional transfer of genetic material; in protozoa it is a bi-directional exchange. In algae and fungi, it is a form of sexual reproduction, with the union of male and female gametes.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
One of the FOLIC ACID ANTAGONISTS that is used as an antimalarial or with a sulfonamide to treat toxoplasmosis.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)
Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
Antibiotic complex produced by Streptomyces kanamyceticus from Japanese soil. Comprises 3 components: kanamycin A, the major component, and kanamycins B and C, the minor components.
Nonsusceptibility of bacteria to the action of the beta-lactam antibiotics. Mechanisms responsible for beta-lactam resistance may be degradation of antibiotics by BETA-LACTAMASES, failure of antibiotics to penetrate, or low-affinity binding of antibiotics to targets.
Inhibitors of HIV PROTEASE, an enzyme required for production of proteins needed for viral assembly.
A genus of parasitic nematodes found throughout the rain-forest areas of the Sudan and the basin of the Congo. L. loa inhabits the subcutaneous tissues, which it traverses freely.
A measure of the quality of health care by assessment of unsuccessful results of management and procedures used in combating disease, in individual cases or series.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Nonsusceptibility of bacteria to the action of CHLORAMPHENICOL, a potent inhibitor of protein synthesis in the 50S ribosomal subunit where amino acids are added to nascent bacterial polypeptides.
Malaria caused by PLASMODIUM FALCIPARUM. This is the severest form of malaria and is associated with the highest levels of parasites in the blood. This disease is characterized by irregularly recurring febrile paroxysms that in extreme cases occur with acute cerebral, renal, or gastrointestinal manifestations.
The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.
The functional hereditary units of BACTERIA.
The concentration of a compound needed to reduce population growth of organisms, including eukaryotic cells, by 50% in vitro. Though often expressed to denote in vitro antibacterial activity, it is also used as a benchmark for cytotoxicity to eukaryotic cells in culture.
A long acting sulfonamide that is used, usually in combination with other drugs, for respiratory, urinary tract, and malarial infections.
Nonsusceptibility of a microbe to the action of ampicillin, a penicillin derivative that interferes with cell wall synthesis.
Substances that destroy fungi by suppressing their ability to grow or reproduce. They differ from FUNGICIDES, INDUSTRIAL because they defend against fungi present in human or animal tissues.
Elements of limited time intervals, contributing to particular results or situations.
An enzyme of the oxidoreductase class that catalyzes the reaction 7,8-dihyrofolate and NADPH to yield 5,6,7,8-tetrahydrofolate and NADPH+, producing reduced folate for amino acid metabolism, purine ring synthesis, and the formation of deoxythymidine monophosphate. Methotrexate and other folic acid antagonists used as chemotherapeutic drugs act by inhibiting this enzyme. (Dorland, 27th ed) EC 1.5.1.3.
Proteins encoded by the POL GENE of the HUMAN IMMUNODEFICIENCY VIRUS.
Agents used in the prophylaxis or therapy of VIRUS DISEASES. Some of the ways they may act include preventing viral replication by inhibiting viral DNA polymerase; binding to specific cell-surface receptors and inhibiting viral penetration or uncoating; inhibiting viral protein synthesis; or blocking late stages of virus assembly.
Methods of investigating the effectiveness of anticancer cytotoxic drugs and biologic inhibitors. These include in vitro cell-kill models and cytostatic dye exclusion tests as well as in vivo measurement of tumor growth parameters in laboratory animals.
The capacity of a normal organism to remain unaffected by microorganisms and their toxins. It results from the presence of naturally occurring ANTI-INFECTIVE AGENTS, constitutional factors such as BODY TEMPERATURE and immediate acting immune cells such as NATURAL KILLER CELLS.
Chemical substances, produced by microorganisms, inhibiting or preventing the proliferation of neoplasms.
An antitubercular agent that inhibits the transfer of mycolic acids into the cell wall of the tubercle bacillus. It may also inhibit the synthesis of spermidine in mycobacteria. The action is usually bactericidal, and the drug can penetrate human cell membranes to exert its lethal effect. (From Smith and Reynard, Textbook of Pharmacology, 1992, p863)
A sterol regulatory element binding protein that regulates expression of GENES involved in FATTY ACIDS metabolism and LIPOGENESIS. Two major isoforms of the protein exist due to ALTERNATIVE SPLICING.
A psychological state of awareness, the practices that promote this awareness, a mode of processing information and a character trait. As a therapy mindfulness is defined as a moment-to-moment awareness of one's experience without judgment and as a state and not a trait.
A bacteriostatic antibiotic macrolide produced by Streptomyces erythreus. Erythromycin A is considered its major active component. In sensitive organisms, it inhibits protein synthesis by binding to 50S ribosomal subunits. This binding process inhibits peptidyl transferase activity and interferes with translocation of amino acids during translation and assembly of proteins.
Single preparations containing two or more active agents, for the purpose of their concurrent administration as a fixed dose mixture.
An inorganic and water-soluble platinum complex. After undergoing hydrolysis, it reacts with DNA to produce both intra and interstrand crosslinks. These crosslinks appear to impair replication and transcription of DNA. The cytotoxicity of cisplatin correlates with cellular arrest in the G2 phase of the cell cycle.
A subfamily of transmembrane proteins from the superfamily of ATP-BINDING CASSETTE TRANSPORTERS that are closely related in sequence to P-GLYCOPROTEIN. When overexpressed, they function as ATP-dependent efflux pumps able to extrude lipophilic drugs, especially ANTINEOPLASTIC AGENTS, from cells causing multidrug resistance (DRUG RESISTANCE, MULTIPLE). Although P-Glycoproteins share functional similarities to MULTIDRUG RESISTANCE-ASSOCIATED PROTEINS they are two distinct subclasses of ATP-BINDING CASSETTE TRANSPORTERS, and have little sequence homology.
Five membered rings containing a NITROGEN atom.
Agents used to treat RETROVIRIDAE INFECTIONS.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.
An enzyme that catalyzes the formation of dihydropteroate from p-aminobenzoic acid and dihydropteridine-hydroxymethyl-pyrophosphate. EC 2.5.1.15.
An antibiotic first isolated from cultures of Streptomyces venequelae in 1947 but now produced synthetically. It has a relatively simple structure and was the first broad-spectrum antibiotic to be discovered. It acts by interfering with bacterial protein synthesis and is mainly bacteriostatic. (From Martindale, The Extra Pharmacopoeia, 29th ed, p106)
Substances that prevent infectious agents or organisms from spreading or kill infectious agents in order to prevent the spread of infection.
The relationships of groups of organisms as reflected by their genetic makeup.
Anatomical areas of the body.
Proteins whose abnormal expression (gain or loss) are associated with the development, growth, or progression of NEOPLASMS. Some neoplasm proteins are tumor antigens (ANTIGENS, NEOPLASM), i.e. they induce an immune reaction to their tumor. Many neoplasm proteins have been characterized and are used as tumor markers (BIOMARKERS, TUMOR) when they are detectable in cells and body fluids as monitors for the presence or growth of tumors. Abnormal expression of ONCOGENE PROTEINS is involved in neoplastic transformation, whereas the loss of expression of TUMOR SUPPRESSOR PROTEINS is involved with the loss of growth control and progression of the neoplasm.
A unicellular budding fungus which is the principal pathogenic species causing CANDIDIASIS (moniliasis).
New abnormal growth of tissue. Malignant neoplasms show a greater degree of anaplasia and have the properties of invasion and metastasis, compared to benign neoplasms.
Non-susceptibility of a microbe to the action of METHICILLIN, a semi-synthetic penicillin derivative.
The relationship between the dose of an administered drug and the response of the organism to the drug.
Agents obtained from higher plants that have demonstrable cytostatic or antineoplastic activity.
A calcium channel blocker that is a class IV anti-arrhythmia agent.
A group of SESQUITERPENES and their analogs that contain a peroxide group (PEROXIDES) within an oxepin ring (OXEPINS).
Established cell cultures that have the potential to propagate indefinitely.
Triazole antifungal agent that is used to treat oropharyngeal CANDIDIASIS and cryptococcal MENINGITIS in AIDS.
The total number of cases of a given disease in a specified population at a designated time. It is differentiated from INCIDENCE, which refers to the number of new cases in the population at a given time.
Large cytoplasmic ribonucleoprotein particles that have an eight-fold symmetry with a central pore and petal-like structure giving the appearance of an octagonal dome. (The Dictionary of Cell Biology, Lackie and Dow, 2nd ed.)
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
MYCOBACTERIUM infections of the lung.
Any of the infectious diseases of man and other animals caused by species of MYCOBACTERIUM.
Enzymes found in many bacteria which catalyze the hydrolysis of the amide bond in the beta-lactam ring. Well known antibiotics destroyed by these enzymes are penicillins and cephalosporins.
Vertical transmission of hereditary characters by DNA from cytoplasmic organelles such as MITOCHONDRIA; CHLOROPLASTS; and PLASTIDS, or from PLASMIDS or viral episomal DNA.
Nonsusceptibility of bacteria to the action of VANCOMYCIN, an inhibitor of cell wall synthesis.
Potentially pathogenic bacteria found in nasal membranes, skin, hair follicles, and perineum of warm-blooded animals. They may cause a wide range of infections and intoxications.
A bacterial DNA topoisomerase II that catalyzes ATP-dependent breakage of both strands of DNA, passage of the unbroken strands through the breaks, and rejoining of the broken strands. Gyrase binds to DNA as a heterotetramer consisting of two A and two B subunits. In the presence of ATP, gyrase is able to convert the relaxed circular DNA duplex into a superhelix. In the absence of ATP, supercoiled DNA is relaxed by DNA gyrase.
A group of often glycosylated macrocyclic compounds formed by chain extension of multiple PROPIONATES cyclized into a large (typically 12, 14, or 16)-membered lactone. Macrolides belong to the POLYKETIDES class of natural products, and many members exhibit ANTIBIOTIC properties.
Therapy with two or more separate preparations given for a combined effect.
The action of a drug in promoting or enhancing the effectiveness of another drug.
A 51-amino acid pancreatic hormone that plays a major role in the regulation of glucose metabolism, directly by suppressing endogenous glucose production (GLYCOGENOLYSIS; GLUCONEOGENESIS) and indirectly by suppressing GLUCAGON secretion and LIPOLYSIS. Native insulin is a globular protein comprised of a zinc-coordinated hexamer. Each insulin monomer containing two chains, A (21 residues) and B (30 residues), linked by two disulfide bonds. Insulin is used as a drug to control insulin-dependent diabetes mellitus (DIABETES MELLITUS, TYPE 1).
The quantity of measurable virus in a body fluid. Change in viral load, measured in plasma, is sometimes used as a SURROGATE MARKER in disease progression.
A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.
Genotypic differences observed among individuals in a population.
Semi-synthetic derivative of penicillin that functions as an orally active broad-spectrum antibiotic.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
A protozoan disease caused in humans by four species of the PLASMODIUM genus: PLASMODIUM FALCIPARUM; PLASMODIUM VIVAX; PLASMODIUM OVALE; and PLASMODIUM MALARIAE; and transmitted by the bite of an infected female mosquito of the genus ANOPHELES. Malaria is endemic in parts of Asia, Africa, Central and South America, Oceania, and certain Caribbean islands. It is characterized by extreme exhaustion associated with paroxysms of high FEVER; SWEATING; shaking CHILLS; and ANEMIA. Malaria in ANIMALS is caused by other species of plasmodia.
Non-susceptibility of an organism to the action of the cephalosporins.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
A group of QUINOLONES with at least one fluorine atom and a piperazinyl group.
A very toxic anthracycline aminoglycoside antineoplastic isolated from Streptomyces peucetius and others, used in treatment of LEUKEMIA and other NEOPLASMS.
Drug regimens, for patients with HIV INFECTIONS, that aggressively suppress HIV replication. The regimens usually involve administration of three or more different drugs including a protease inhibitor.
Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.
A potent, non-nucleoside reverse transcriptase inhibitor used in combination with nucleoside analogues for treatment of HIV INFECTIONS and AIDS.
Tuberculosis resistant to ISONIAZID and RIFAMPIN and at least three of the six main classes of second-line drugs (AMINOGLYCOSIDES; polypeptide agents; FLUOROQUINOLONES; THIOAMIDES; CYCLOSERINE; and PARA-AMINOSALICYLIC ACID) as defined by the CDC.
Nonsusceptibility of bacteria to the antibiotic KANAMYCIN, which can bind to their 70S ribosomes and cause misreading of messenger RNA.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Diminished or failed response of PLANTS to HERBICIDES.
Substances that are destructive to protozoans.
Human immunodeficiency virus. A non-taxonomic and historical term referring to any of two species, specifically HIV-1 and/or HIV-2. Prior to 1986, this was called human T-lymphotropic virus type III/lymphadenopathy-associated virus (HTLV-III/LAV). From 1986-1990, it was an official species called HIV. Since 1991, HIV was no longer considered an official species name; the two species were designated HIV-1 and HIV-2.
Agents that inhibit PROTEIN KINASES.
Inhibitors of the enzyme, dihydrofolate reductase (TETRAHYDROFOLATE DEHYDROGENASE), which converts dihydrofolate (FH2) to tetrahydrofolate (FH4). They are frequently used in cancer chemotherapy. (From AMA, Drug Evaluations Annual, 1994, p2033)
Substances obtained from various species of microorganisms that are, alone or in combination with other agents, of use in treating various forms of tuberculosis; most of these agents are merely bacteriostatic, induce resistance in the organisms, and may be toxic.
The art or practice of preparing food. It includes the preparation of special foods for diets in various diseases.
A broad-spectrum antimicrobial carboxyfluoroquinoline.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
An anthracenedione-derived antineoplastic agent.
The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.
A family of gram-negative, facultatively anaerobic, rod-shaped bacteria that do not form endospores. Its organisms are distributed worldwide with some being saprophytes and others being plant and animal parasites. Many species are of considerable economic importance due to their pathogenic effects on agriculture and livestock.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
A group of compounds that contain the structure SO2NH2.
A cyclodecane isolated from the bark of the Pacific yew tree, TAXUS BREVIFOLIA. It stabilizes MICROTUBULES in their polymerized form leading to cell death.
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
Carbon-containing phosphonic acid compounds. Included under this heading are compounds that have carbon bound to either OXYGEN atom or the PHOSPHOROUS atom of the (P=O)O2 structure.
Glycosylated compounds in which there is an amino substituent on the glycoside. Some of them are clinically important ANTIBIOTICS.
Highly proliferative, self-renewing, and colony-forming stem cells which give rise to NEOPLASMS.
DNA TOPOISOMERASES that catalyze ATP-dependent breakage of both strands of DNA, passage of the unbroken strands through the breaks, and rejoining of the broken strands. These enzymes bring about relaxation of the supercoiled DNA and resolution of a knotted circular DNA duplex.
DNA sequences that form the coding region for retroviral enzymes including reverse transcriptase, protease, and endonuclease/integrase. "pol" is short for polymerase, the enzyme class of reverse transcriptase.
Differential and non-random reproduction of different genotypes, operating to alter the gene frequencies within a population.
Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.
A semisynthetic derivative of PODOPHYLLOTOXIN that exhibits antitumor activity. Etoposide inhibits DNA synthesis by forming a complex with topoisomerase II and DNA. This complex induces breaks in double stranded DNA and prevents repair by topoisomerase II binding. Accumulated breaks in DNA prevent entry into the mitotic phase of cell division, and lead to cell death. Etoposide acts primarily in the G2 and S phases of the cell cycle.
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by an azido group. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. The compound is a potent inhibitor of HIV replication, acting as a chain-terminator of viral DNA during reverse transcription. It improves immunologic function, partially reverses the HIV-induced neurological dysfunction, and improves certain other clinical abnormalities associated with AIDS. Its principal toxic effect is dose-dependent suppression of bone marrow, resulting in anemia and leukopenia.
An antitumor alkaloid isolated from VINCA ROSEA. (Merck, 11th ed.)
A potent liver poison. In rats, bromotrichloromethane produces about three times the degree of liver microsomal lipid peroxidation as does carbon tetrachloride.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
Tumors or cancer of the human BREAST.
Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.
Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
Transport proteins that carry specific substances in the blood or across cell membranes.
Deoxyribonucleic acid that makes up the genetic material of protozoa.
A genus of protozoa that comprise the malaria parasites of mammals. Four species infect humans (although occasional infections with primate malarias may occur). These are PLASMODIUM FALCIPARUM; PLASMODIUM MALARIAE; PLASMODIUM OVALE, and PLASMODIUM VIVAX. Species causing infection in vertebrates other than man include: PLASMODIUM BERGHEI; PLASMODIUM CHABAUDI; P. vinckei, and PLASMODIUM YOELII in rodents; P. brasilianum, PLASMODIUM CYNOMOLGI; and PLASMODIUM KNOWLESI in monkeys; and PLASMODIUM GALLINACEUM in chickens.
A selective increase in the number of copies of a gene coding for a specific protein without a proportional increase in other genes. It occurs naturally via the excision of a copy of the repeating sequence from the chromosome and its extrachromosomal replication in a plasmid, or via the production of an RNA transcript of the entire repeating sequence of ribosomal RNA followed by the reverse transcription of the molecule to produce an additional copy of the original DNA sequence. Laboratory techniques have been introduced for inducing disproportional replication by unequal crossing over, uptake of DNA from lysed cells, or generation of extrachromosomal sequences from rolling circle replication.
The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
Any method used for determining the location of and relative distances between genes on a chromosome.
A phospholipid-interacting antimalarial drug (ANTIMALARIALS). It is very effective against PLASMODIUM FALCIPARUM with very few side effects.
A gram-positive organism found in the upper respiratory tract, inflammatory exudates, and various body fluids of normal and/or diseased humans and, rarely, domestic animals.
Pesticides designed to control insects that are harmful to man. The insects may be directly harmful, as those acting as disease vectors, or indirectly harmful, as destroyers of crops, food products, or textile fabrics.
DNA elements that include the component genes and insertion site for a site-specific recombination system that enables them to capture mobile gene cassettes.
Membrane proteins encoded by the BCL-2 GENES and serving as potent inhibitors of cell death by APOPTOSIS. The proteins are found on mitochondrial, microsomal, and NUCLEAR MEMBRANE sites within many cell types. Overexpression of bcl-2 proteins, due to a translocation of the gene, is associated with follicular lymphoma.
Ribonucleic acid that makes up the genetic material of viruses.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Using MOLECULAR BIOLOGY techniques, such as DNA SEQUENCE ANALYSIS; PULSED-FIELD GEL ELECTROPHORESIS; and DNA FINGERPRINTING, to identify, classify, and compare organisms and their subtypes.
A hydroxynaphthoquinone that has antimicrobial activity and is being used in antimalarial protocols.
A set of statistical methods used to group variables or observations into strongly inter-related subgroups. In epidemiology, it may be used to analyze a closely grouped series of events or cases of disease or other health-related phenomenon with well-defined distribution patterns in relation to time or place or both.
A group of derivatives of naphthyridine carboxylic acid, quinoline carboxylic acid, or NALIDIXIC ACID.
This line KB is now known to be a subline of the ubiquitous KERATIN-forming tumor cell line HeLa. It was originally thought to be derived from an epidermal carcinoma of the mouth, but was subsequently found, based on isoenzyme analysis, HeLa marker chromosomes, and DNA fingerprinting, to have been established via contamination by HELA CELLS. The cells are positive for keratin by immunoperoxidase staining. KB cells have been reported to contain human papillomavirus18 (HPV-18) sequences.
A fluorescent probe with low toxicity which is a potent substrate for P-glycoprotein and the bacterial multidrug efflux transporter. It is used to assess mitochondrial bioenergetics in living cells and to measure the efflux activity of P-glycoprotein in both normal and malignant cells. (Leukemia 1997;11(7):1124-30)
Technique using an instrument system for making, processing, and displaying one or more measurements on individual cells obtained from a cell suspension. Cells are usually stained with one or more fluorescent dyes specific to cell components of interest, e.g., DNA, and fluorescence of each cell is measured as it rapidly transverses the excitation beam (laser or mercury arc lamp). Fluorescence provides a quantitative measure of various biochemical and biophysical properties of the cell, as well as a basis for cell sorting. Other measurable optical parameters include light absorption and light scattering, the latter being applicable to the measurement of cell size, shape, density, granularity, and stain uptake.
A genus of gram-negative, facultatively anaerobic, rod-shaped bacteria that utilizes citrate as a sole carbon source. It is pathogenic for humans, causing enteric fevers, gastroenteritis, and bacteremia. Food poisoning is the most common clinical manifestation. Organisms within this genus are separated on the basis of antigenic characteristics, sugar fermentation patterns, and bacteriophage susceptibility.
3,6-Diamino-10-methylacridinium chloride mixt. with 3,6-acridinediamine. Fluorescent dye used as a local antiseptic and also as a biological stain. It intercalates into nucleic acids thereby inhibiting bacterial and viral replication.
One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.
A genus of gram-positive, facultatively anaerobic, coccoid bacteria. Its organisms occur singly, in pairs, and in tetrads and characteristically divide in more than one plane to form irregular clusters. Natural populations of Staphylococcus are found on the skin and mucous membranes of warm-blooded animals. Some species are opportunistic pathogens of humans and animals.
Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.
Tumors or cancer of the OVARY. These neoplasms can be benign or malignant. They are classified according to the tissue of origin, such as the surface EPITHELIUM, the stromal endocrine cells, and the totipotent GERM CELLS.
Any liquid or solid preparation made specifically for the growth, storage, or transport of microorganisms or other types of cells. The variety of media that exist allow for the culturing of specific microorganisms and cell types, such as differential media, selective media, test media, and defined media. Solid media consist of liquid media that have been solidified with an agent such as AGAR or GELATIN.
Glucose in blood.

Nonbehavioral selection for pawns, mutants of Paramecium aurelia with decreased excitability. (1/8454)

The reversal response in Paramecium aurelia is mediated by calcium which carries the inward current during excitation. Electrophysiological studies indicate that strontium and barium can also carry the inward current. Exposure to high concentrations of barium rapidly paralyzes and later kills wild-type paramecia. Following mutagenesis with nitrosoguanidine, seven mutants which continued to swim in the ;high-barium' solution were selected. All of the mutants show decreased reversal behavior, with phenotypes ranging from extremely non-reversing (;extreme' pawns) to nearly wild-type reversal behavior (;partial' pawns). The mutations fall into three complementation groups, identical to the pwA, pwB, and pwC genes of Kunget al. (1975). All of the pwA and pwB mutants withstand longer exposure to barium, the pwB mutants surviving longer than the pwA mutants. Among mutants of each gene, survival is correlated with loss of reversal behavior. Double mutants (A-B, A-C, B-C), identified in the exautogamous progeny of crosses between ;partial' mutants, exhibited a more extreme non-reversing phenotype than either of their single-mutant (;partial' pawn) parents.---Inability to reverse could be expected from an alteration in the calcium-activated reversal mechanism or in excitation. A normal calcium-activated structure was demonstrated in all pawns by chlorpromazine treatment. In a separate report (Schein, Bennett and Katz 1976) the results of electrophysiological investigations directly demonstrate decreased excitability in all of the mutants, a decrease due to an altered calcium activation. The studies of the genetics, the survival in barium and the electro-physiology of the pawns demonstrate that the pwA and pwB genes have different effects on calcium activation.  (+info)

JNK2 is required for efficient T-cell activation and apoptosis but not for normal lymphocyte development. (2/8454)

BACKGROUND: The Jun N-terminal kinase (JNK) signaling pathway has been implicated in cell proliferation and apoptosis, but its function seems to depend on the cell type and inducing signal. In T cells, JNK has been implicated in both antigen-induced activation and apoptosis. RESULTS: We generated mice lacking the JNK2 isozymes. The mutant mice were healthy and fertile but defective in peripheral T-cell activation induced by antibody to the CD3 component of the T-cell receptor (TCR) complex - proliferation and production of interleukin-2 (IL-2), IL-4 and interferon-gamma (IFN-gamma) were reduced. The proliferation defect was restored by exogenous IL-2. B-cell activation was normal in the absence of JNK2. Activation-induced peripheral T-cell apoptosis was comparable between mutant and wild-type mice, but immature (CD4(+) CD8(+)) thymocytes lacking JNK2 were resistant to apoptosis induced by administration of anti-CD3 antibody in vivo. The lack of JNK2 also resulted in partial resistance of thymocytes to anti-CD3 antibody in vitro, but had little or no effect on apoptosis induced by anti-Fas antibody, dexamethasone or ultraviolet-C (UVC) radiation. CONCLUSIONS: JNK2 is essential for efficient activation of peripheral T cells but not B cells. Peripheral T-cell activation is probably required indirectly for induction of thymocyte apoptosis resulting from administration of anti-CD3 antibody in vivo. JNK2 functions in a cell-type-specific and stimulus-dependent manner, being required for apoptosis of immature thymocytes induced by anti-CD3 antibody but not for apoptosis induced by anti-Fas antibody, UVC or dexamethasone. JNK2 is not required for activation-induced cell death of mature T cells.  (+info)

Myths, models and mitigation of resistance to pesticides. (3/8454)

Resistance to pesticides in arthropod pests is a significant economic, ecological and public health problem. Although extensive research has been conducted on diverse aspects of pesticide resistance and we have learned a great deal during the past 50 years, to some degree the discussion about 'resistance management' has been based on 'myths'. One myth involves the belief that we can manage resistance. I will maintain that we can only attempt to mitigate resistance because resistance is a natural evolutionary response to environmental stresses. As such, resistance will remain an ongoing dilemma in pest management and we can only delay the onset of resistance to pesticides. 'Resistance management' models and tactics have been much discussed but have been tested and deployed in practical pest management programmes with only limited success. Yet the myth persists that better models will provide a 'solution' to the problem. The reality is that success in using mitigation models is limited because these models are applied to inappropriate situations in which the critical genetic, ecological, biological or logistic assumptions cannot be met. It is difficult to predict in advance which model is appropriate to a particular situation; if the model assumptions cannot be met, applying the model sometimes can increase the rate of resistance development rather than slow it down. Are there any solutions? I believe we already have one. Unfortunately, it is not a simple or easy one to deploy. It involves employing effective agronomic practices to develop and maintain a healthy crop, monitoring pest densities, evaluating economic injury levels so that pesticides are applied only when necessary, deploying and conserving biological control agents, using host-plant resistance, cultural controls of the pest, biorational pest controls, and genetic control methods. As a part of a truly multi-tactic strategy, it is crucial to evaluate the effect of pesticides on natural enemies in order to preserve them in the cropping system. Sometimes, pesticide-resistant natural enemies are effective components of this resistance mitigation programme. Another name for this resistance mitigation model is integrated pest management (IPM). This complex model was outlined in some detail nearly 40 years ago by V. M. Stern and colleagues. To deploy the IPM resistance mitigation model, we must admit that pest management and resistance mitigation programmes are not sustainable if based on a single-tactic strategy. Delaying resistance, whether to traditional pesticides or to transgenic plants containing toxin genes from Bacillus thuringiensis, will require that we develop multi-tactic pest management programmes that incorporate all appropriate pest management approaches. Because pesticides are limited resources, and their loss can result in significant social and economic costs, they should be reserved for situations where they are truly needed--as tools to subdue an unexpected pest population outbreak. Effective multi-tactic IPM programmes delay resistance (= mitigation) because the number and rates of pesticide applications will be reduced.  (+info)

Transformation of intestinal epithelial cells by chronic TGF-beta1 treatment results in downregulation of the type II TGF-beta receptor and induction of cyclooxygenase-2. (4/8454)

The precise role of TGF-beta in colorectal carcinogenesis is not clear. The purpose of this study was to determine the phenotypic alterations caused by chronic exposure to TGF-beta in non-transformed intestinal epithelial (RIE-1) cells. Growth of RIE-1 cells was inhibited by >75% following TGF-beta1 treatment for 7 days, after which the cells resumed a normal growth despite the presence of TGF-beta1. These 'TGF-beta-resistant' cells (RIE-Tr) were continuously exposed to TGF-beta for >50 days. Unlike the parental RIE cells, RIE-Tr cells lost contact inhibition, formed foci in culture, grew in soft agarose. RIE-Tr cells demonstrated TGF-beta-dependent invasive potential in an in vitro assay and were resistant to Matrigel and Na-butyrate-induced apoptosis. The RIE-Tr cells were also tumorigenic in nude mice. The transformed phenotype of RIE-Tr cells was associated with a 95% decrease in the level of the type II TGF-beta receptor (TbetaRII) protein, a 40-fold increase in cyclooxygenase-2 (COX-2) protein, and 5.9-fold increase in the production of prostacyclin. Most RIE-Tr subclones that expressed low levels of TbetaRII and high levels of COX-2 were tumorigenic. Those subclones that express abundant TbetaRII and low levels of COX-2 were not tumorigenic in nude mice. A selective COX-2 inhibitor inhibited RIE-Tr cell growth in culture and tumor growth in nude mice. The reduced expression of TbetaRII, increased expression of COX-2, and the ability to form colonies in Matrigel were all reversible upon withdrawal of exogenous TGF-beta1 for the RIE-Tr cells.  (+info)

Isolation and characterization of two mouse L cell lines resistant to the toxic lectin ricin. (5/8454)

Two variant mouse L cell lines (termed CL 3 and CL 6) have been selected for resistant to ricin, a galactose-binding lectin with potent cytotoxic activity. The resistant lines exhibit a 50 to 70% decrease in ricin binding and a 300- to 500-fold increase in resistance to the toxic effects of ricin. Crude membrane preparations of CL 3 cells have increased sialic acid content (200% of control), while the galactose, mannose, and hexosamine content is within normal limits. Both the glycoproteins and glycolipids of CL 3 cells have increased sialic acid, with the GM3:lactosylceramide ratios for parent L and CL 3 cells being 0.29 and 1.5, respectively. In contrast, the membranes of CL 6 cells have a decrease in sialic acid, galactose, and hexosamine content with mannose being normal. Both cell lines have specific alterations in glycosyltransferase activities which can account for the observed membrane sugar changes. CL 3 cells have increased CMP-sialic acid:glycoprotein sialyltransferase and GM3 synthetase activities, while CL 6 cells have decrease UDP-GlcNAc:glycoproteinN-acetylglucosaminyltransferase and DPU-galactose:glycoprotein galactosyltransferase activities. The increased sialic acid content of CL 3 cells serves to mask ricin binding sites, since neuraminidase treatment of this cell line restores ricin binding to essentially normal levels. However, the fact that neuraminidase-treated CL 3 cells are still 45-fold resistant to ricin indicates that either a special class of productive ricin binding sites is not being exposed or that the cell line has a second mechanism for ricin resistance.  (+info)

[3H]gemcitabine uptake by nucleoside transporters in a human head and neck squamous carcinoma cell line. (6/8454)

Cellular uptake of many chemotherapeutic nucleoside analogs is dependent on the activity of a family of nucleoside transport proteins located in the cell plasma membrane. In the present study, we examined the role of these transporters in the accumulation of gemcitabine by a human head and neck squamous carcinoma cell line. The uptake of [3H]gemcitibine was compared with that of [3H]uridine and [3H]formycin B in the parent cell line (HN-5a) and in a gemcitabine-resistant variant (GEM-8e). The HN-5a and GEM-8e cells were similar in their transport characteristics and expressed predominantly the es (equilibrative, inhibitor-sensitive) transporter subtype; less than 10% of the influx of [3H]formycin B or [3H]uridine was mediated by the ei (equilibrative inhibitor-resistant) system, and there was no evidence for Na+-dependent nucleoside transporters. [3H]Gemcitabine (10 microM) entered these cells via both the es and ei transporters with an initial rate of uptake similar to that seen with the use of [3H]formycin B or [3H]uridine. In addition, ATP-replete cells accumulated significantly less [3H]gemcitabine than did ATP-depleted cells, which is indicative of an active efflux mechanism for gemcitabine. These results show that gemcitabine is a substrate for both the es and ei nucleoside transporters of HN-5a and GEM-8e cells and that gemcitabine resistance of the GEM-8e cells cannot be attributed to changes in transporter activity. Further studies to define the characteristics of the putative efflux mechanism are clearly warranted because this system has the potential to significantly affect the clinical efficacy of gemcitabine.  (+info)

Resistance of paroxysmal nocturnal hemoglobinuria cells to the glycosylphosphatidylinositol-binding toxin aerolysin. (7/8454)

Paroxysmal nocturnal hemoglobinuria (PNH) is a clonal stem cell disorder caused by a somatic mutation of the PIGA gene. The product of this gene is required for the biosynthesis of glycosylphosphatidylinositol (GPI) anchors; therefore, the phenotypic hallmark of PNH cells is an absence or marked deficiency of all GPI-anchored proteins. Aerolysin is a toxin secreted by the bacterial pathogen Aeromonas hydrophila and is capable of killing target cells by forming channels in their membranes after binding to GPI-anchored receptors. We found that PNH blood cells (erythrocytes, lymphocytes, and granulocytes), but not blood cells from normals or other hematologic disorders, are resistant to the cytotoxic effects of aerolysin. The percentage of lysis of PNH cells after aerolysin exposure paralleled the percentage of CD59(+) cells in the samples measured by flow cytometry. The kinetics of red blood cell lysis correlated with the type of PNH erythrocytes. PNH type III cells were completely resistant to aerolysin, whereas PNH type II cells displayed intermediate sensitivity. Importantly, the use of aerolysin allowed us to detect PNH populations that could not be detected by standard flow cytometry. Resistance of PNH cells to aerolysin allows for a simple, inexpensive assay for PNH that is sensitive and specific. Aerolysin should also be useful in studying PNH biology.  (+info)

Electrophysiological evidence for tetrodotoxin-resistant sodium channels in slowly conducting dural sensory fibers. (8/8454)

A tetrodotoxin (TTX)-resistant sodium channel was recently identified that is expressed only in small diameter neurons of peripheral sensory ganglia. The peripheral axons of sensory neurons appear to lack this channel, but its presence has not been investigated in peripheral nerve endings, the site of sensory transduction in vivo. We investigated the effect of TTX on mechanoresponsiveness in nerve endings of sensory neurons that innervate the intracranial dura. Because the degree of TTX resistance of axonal branches could potentially be affected by factors other than channel subtype, the neurons were also tested for sensitivity to lidocaine, which blocks both TTX-sensitive and TTX-resistant sodium channels. Single-unit activity was recorded from dural afferent neurons in the trigeminal ganglion of urethan-anesthetized rats. Response thresholds to mechanical stimulation of the dura were determined with von Frey monofilaments while exposing the dura to progressively increasing concentrations of TTX or lidocaine. Neurons with slowly conducting axons were relatively resistant to TTX. Application of 1 microM TTX produced complete suppression of mechanoresponsiveness in all (11/11) fast A-delta units [conduction velocity (c.v.) 5-18 m/s] but only 50% (5/10) of slow A-delta units (1.5 +info)

Glucocorticoids are the mainstay of asthma management and effectively treat acute exacerbations of asthma. However, a small subset of asthmatics, usually with severe asthma, respond poorly even to systemic administration of high-dose glucocorticoids and this condition is termed steroid-resistant asthma. This cohort, although small, accounts for ~50% of total health care cost for asthma. New investigations into the mechanisms of glucocorticoid action have broadened and deepened our understanding of glucocorticoid resistance. Here we review the importance and characteristics of steroid resistant asthma, the mechanisms that mediate the function of glucocorticoids and that lead to the development of this disease and potential therapies to reverse resistance to treatment. Cellular and molecular factors, receptors and complex signalling pathways have all been implicated. Indeed, based on molecular biological studies, excessive activation of intracellular transcription factors, impaired histone ...
World Health Organization. Regional Office for the Western Pacific. (‎2016)‎. Second Biregional Meeting of Malaria Drug Resistance Monitoring Networks, Bangkok, Thailand, 24-26October 2016 : meeting report. Manila : WHO Regional Office for the Western Pacific. https://apps.who.int/iris/handle/10665/254664 ...
Don t use drugs to treat parasites! Drugs are always toxic. Do Dr. Clark s protocol completely and thoroughly instead! Not just the herbs, not just zap, not just for a couple days, but all of it as she recommends. I ve used it quite successfully for nearly 15 years. I learned about it here actually before the pharmaceutical companies got all their paid employees here to start denying what actually does work (zappers and Dr. Clark s information), and start hawking their good advice for what drugs/supplements to use, which barely work at all, or don t work, so you will keep coming back ...
Forward and backward stepwise selection is not guaranteed to give us the best model containing a particular subset of the p predictors but thats the price to pay in order to avoid overfitting. Even if p is less than 40, looking at all possible models may not be the best thing to do. The point is that is not always best to do a full search, even when you can do it because we will pay a price in variance (and thus in test error). Just because best subset has a better model on the training data doesnt mean that its really going to be a better model overall in the context of test data, which is what we really care about. ...
early_indicators_of_the_malaria_parasite_in_africa_developing_resistance_to_the_most_effective_drug_available_have_been_confirmed_according_to_new_research_published_in_antimicrobial_agents_and_chemotherapy_
The test uses unique PCR chemistries as well as a streamlined sample prep method to detect resistance mutations without DNA extraction.
The lab was able to show in patient samples that elevated levels of phosphorylated MSK1 and/or phosphorylated TAK-1 correlates with resistance to corticosteroid treatment. They also showed in an in-vitro model that treatment with a TAK-1 inhibitor was able to reverse the steroid resistance.
I would just like to comment that the malaria drug resistance scenario outlined by Livingston Monford is completely retarded. And I say this in the nicest way possible... The scenario as set forth does not coincide with any real world scenario that would arise. Speaking on observed human use of anti-biotics and anti-viral drugs, it is rare that a treatment group adheres 100% to any treatment regiment. Meaning that one person in the group not taking both medications, as outlined, would be infected with Malaria resistant to one of the drugs in question. The survivors of this group of Malaria would grow and replicate with the new resistance protein for the first drug and then be exposed to the second drug. This second drug would kill all the bacteria with the drug resistance to Drug 1, but would not kill any bacteria with any mutations offering resistance to Drug 2. Thus, these last stragglers would have the protein for Drug 1 resistance and now Drug 2 resistance. This group would grow and ...
I would just like to comment that the malaria drug resistance scenario outlined by Livingston Monford is completely retarded. And I say this in the nicest way possible... The scenario as set forth does not coincide with any real world scenario that would arise. Speaking on observed human use of anti-biotics and anti-viral drugs, it is rare that a treatment group adheres 100% to any treatment regiment. Meaning that one person in the group not taking both medications, as outlined, would be infected with Malaria resistant to one of the drugs in question. The survivors of this group of Malaria would grow and replicate with the new resistance protein for the first drug and then be exposed to the second drug. This second drug would kill all the bacteria with the drug resistance to Drug 1, but would not kill any bacteria with any mutations offering resistance to Drug 2. Thus, these last stragglers would have the protein for Drug 1 resistance and now Drug 2 resistance. This group would grow and ...
This poisoning occurs especially in dogs that are genetically hypersensitive to ivermectin, an anti-parasite medication most commonly used for heartworm prevention.
The drug resistant cell line MOR/0.2R has been derived from the parent line, MOR, by continuous exposure to increasing concentrations of doxorubicin (also known as adriamycin). MOR/0.2R accumulate lower levels of doxorubicin than the parent line and have been shown to overexpress multi drug resistance associated protein (MRP). Expression of a 190kDa membrane protein associated with the degree of drug-resistance has been indicated. Cells grow as easily detaching aggregates ...
gene among field parasite populations but none of them have next determined the IC50s of 3D7, three mutant lines (769N-2, -7, been conclusively linked to ART resistance. Some studies showed and -31) and two control lines (769S-9 and -17) to the three ART that deployments of ACTs were associated with changes of fre- derivatives. The IC50 of each parasite clone to each of the ART quencies of certain mutations in PfATP6. In one study the fre- derivatives was determined in 18 biological replicates, each with quency of the A623E mutation was increased in Niger after ACT three technical replications All transfectant lines and 3D7 use whereas in another study an increase in the frequency of a had similar IC50s against ATM, ATS, and DHA. The means of deletion mutant was noticed in Peru In the GMS, an absolute IC50s of the five transgenic lines were log transformed epicenter of malaria drug resistance with the most extensive use of and compared for statistical significance. Statistical analysis con- ART ...
Multiple drug resistance among bacteria has become a global issue with a considerable impact on the mortality associated with infectious diseases. This book is a detailed compilation of available knowledge on the surveillance and mechanisms of antibiotic resistance in various countries throughout the world. Readers will be updated on current information on the understanding of mechanisms involved in drug resistance and the geographical distribution of resistance determinant markers. This volume should be a useful guide for microbiologists and clinicians interested in designing antimicrobial therapies tailored for patients in specific geographical regions ...
BOSTON â An infectious-disease nightmare is unfolding: Bacteria that have been made resistant to nearly all antibiotics by an alarming new gene have...
Although molecularly targeted anticancer drugs can achieve complete clinical response, such responses are typically short-lived and patients relapse quickly (2, 47, 48). It is therefore critical to identify mechanism(s) of acquired resistance and to develop strategies to combat such resistance. In the present study, we elucidated the mechanisms of acquired resistance of two classes of apoptosis-inducing agents, the Bcl-2 inhibitors ABT-737/ABT-263, and the MDM2 inhibitor SAR405838 in two acute leukemia models in vitro and in vivo.. ABT-737 and ABT-263 effectively induce apoptosis in the RS4;11 cell line in vitro and achieve complete regression of RS4;11 xenograft tumors in mice. Both in vitro and in vivo treatments, however, lead to the development of sublines that possess profound acquired resistance to this class of drugs. BAX, but not BAK, is consistently downregulated in each of these resistant sublines obtained from in vitro and in vivo treatments with the Bcl-2 inhibitors (Fig. 1D; ...
Although resistance toward small-molecule chemotherapeutics has been well studied, the potential of tumor cells to avoid destruction by membrane-lytic compounds remains unexplored. Anticancer peptides (ACPs) are a class of such agents that disrupt tumor cell membranes through rapid and non-stereospecific mechanisms, encouraging the perception that cellular resistance toward ACPs is unlikely to occur. We demonstrate that eukaryotic cells can, indeed, develop resistance to the model oncolytic peptide SVS-1, which preferentially disrupts the membranes of cancer cells. Utilizing fission yeast as a model organism, we show that ACP resistance is largely controlled through the loss of cell-surface anionic saccharides. A similar mechanism was discovered in mammalian cancer cells where removal of negatively charged sialic acid residues directly transformed SVS-1-sensitive cell lines into resistant phenotypes. These results demonstrate that changes in cell-surface glycosylation play a major role in tumor cell
A little while back I witnessed an act of violence and an act of tenderness. Both, as it turned out, in the span of about 15 seconds and both in the same family. At a supermarket a family had their two young boys in those fun shopping carts that look like little cars. At the…
The potential role of transforming growth factor-beta in in vivo resistance was examined by administration of transforming growth factor-beta-neutralizing antibodies to animals bearing the EMT-6/Parent tumor or the antitumor alkylating resistance tumors, EMT-6/CTX or EMT-6/CDDP. Treatment of tumor b …
The underpinning research described above has provided the key evidence base to inform national and international strategy on the treatment of HIV. Our work provided an initial understanding of the molecular basis of drug resistance, and was pivotal to the development and implementation of sequence-based resistance testing across the NHS, along with the establishment of a national surveillance scheme. With more appropriate first-line therapy, based on individual resistance patterns, the subsequent risk of drug failure due to resistance has been reduced, leading to an overall reduction in resistance. Transmitted drug resistance in the UK has fallen from over 15% of new infections in 2000-2, to fewer than 10% in 2007 and onwards [a] representing a reduction of 300 new infections with such resistance per year.. Our work is referenced widely in treatment guidelines around the world. The British HIV Association recommend, based on our evidence of significant levels of transmitted resistance, that ...
Summary: What if we do not know which type of model to use? We can select a model based on its predictive accuracy, which we can estimate with AIC, BIC, Adjusted-R2, or Mallows Cp. Or we can directly measure the predictive accuracy with cross-validation. We can also use stepwise selection, but I wouldnt recommend it.. ...
The growing threat of drug resistance, which will increasingly leave more and more people vulnerable to diseases that were once easier to treat, like malaria, HIV and tuberculosis (TB)...
The US Dollar broke a significant level of resistance against the Japanese Yen. Namely, the resistance of a medium descending pattern that captured the week long sideways trading below the 110.00 level was broken. The event signals the end of sideways trading.. As the pair continues to surge upwards, it will face the weekly R1 at 110.14. After breaking the weekly R1, the pair is set to reach for the next resistance level at the 110.50 mark.. On the other hand, at any moment the pair might begin to consolidate its gains by trading sideways and waiting for the support of the 55 and 100-hour simple moving averages to approach the rate and initiate a continuation of the surge. ...
The related resistance band squats page,you can find more similar resistance band squats from Double Cube,china resistance band squats manufacturer,We provide you excellent products buy services.
Learning is about pushing the boundaries of what we know and stepping outside of our comfort zones, which causes resistance. If take the time to notice what you
|p||strong|Bonpard Resistance|br /||/strong|Bonpard Resistance Supplement has been developed for horses with a compromised immune system. This often manifests itself as vague health issues leading to suboptimal performance.  The specific composition
Concept: For range extension of current measurement in moving coil instrument, a resistance is connected in parallel or shunt with coil resistance. Because for
Going directly after the problem with someone who doesnt want to change only creates more resistance. Find out more about rolling with resistance.
A common use for LTSpice® is to run a time domain transient analysis where a parameter (e.g. voltage or current) can be plotted against time. Occasionally, you may wish to know the behavior of a circuit versus another parameter such as resistance. This can be done by using the
How a gene was inadvertently delivered to a cancer cell, camouflaging it from the therapy and allowing the cancer to develop resistance to treatment. The patient ultimately died.
The present application extends a successful multifaceted investigation of host resistance to viral infection. The strengths of our approach include: 1) an unbi...
Krishna V. Komanduri, MD; Stephen J. Schuster, MD; David Maloney, MD, PhD; and Michael Pulsipher, MD, describe the mechanisms of resistance after CAR T-cell infusion, including how their persistence relates to duration of response and whether patients can receive multiple infusions.
The relationship between current, voltage and resistance V = I*R was introduced by Ohm in the year 1827. Ohms Law: It states that the amount o
Buy Beautiful Resistance: The Joy of Conviction in a Culture of Compromise by Jon Tyson in Paperback format at Koorong (9780735290693).
Over the past few months, weve gotten a few good looks at Resistance 3, and what weve seen so far has been awfully promising. Easily the
Just because the market moves in one direction doesnt mean that all of the stocks are moving with it. Here are five stocks that are bumping up against overhead resistance.
إذا أردت ان تعرف ما هو resistance؟؟ ابحث في Sesli Sözlük والذي يعتبر مصدر للحصول على المعرفة اللغوية للعديد من الكلمات في لغات العالم المختلفة.
Что значит resistance? Узнай это здесь вместе с Сесли Сёзлюк - твой источник знаний для изучения множества языков по всему миру
Workout Trends helps you DESIGN an action plan for your life, a program you can follow despite the demands of a BUSY lifestyle, the one that can get you RESULTS. Learn what WORKS and what DOESNT for your fitness goals.. Read More ...
Traduction de resistance dans le dictionnaire Anglais-Allemand gratuit de LANGENSCHEIDT avec des exemples, des synonymes et la prononciation.
Assuming somebody does nothing it might take a few years to establish resistance to HPV. If someone takes the authors guidance, it requires just a few...
Incubation of adriamycin resistant Chinese hamster lung cells with low levels of N-ethylmaleimide (NEM) results in a major increase in the cellular accumulation of drug. When resistant cells are prelabeled with [32Pi] and thereafter treated with NEM there also occurs a selective superphosphorylation of an 180K plasma membrane glycoprotein (P-180). This phosphorylation reaction occurs at both serine and threonine residues. In similar experiments with drug sensitive cells only minor levels of this protein can be detected. Detailed studies have established that in cells which have reverted to drug sensitivity there is a parallel loss in the presence of phosphorylated P-180. Also in cells which have undergone partial reversion to drug sensitivity there is a correlation between levels of superphosphorylated P-180 and adriamycin resistance. These results provide evidence that adriamycin resistance is dependent on the presence of P-180. The results also suggest that the biological activity of this protein is
Mutations in the Plasmodium falciparum chloroquine resistance transporter (PfCRT) have been shown to be central to the molecular mechanism of quinoline antimalarial drug resistance. However, additional facets to resistance ...
Clinical resistance to chemotherapeutic agents is one of the major hindrances in the treatment of human cancers. Erythroblastosis virus E26 oncogene homolog 1 (ETS1) is involved in the drug resistance of various cancer cells, and is overexpressed in drug-resistant human breast cancer cell lines. In this study, we investigated the effects of ETS1 on adriamycin resistance in MCF-7/ADR cells. siRNAs against ETS1 or negative control siRNAs was transfected to MCF-7/ADR breast cancer cells. Reverse transcription-PCR and Western blotting were used to determine the mRNA and protein expression of ETS1 and MDR1. The cytotoxicity of adriamycin was assessed using the MTT assay. Drug efflux was investigated by flow cytometry using the Rhodamine 123 intracellular accumulation assay. ETS1 mRNA and protein was significantly overexpressed in MCF-7/ADR cells, compared to MCF-7 cells. ETS1 siRNA successfully silenced ETS1 mRNA and protein expression. Silencing of ETS1 also significantly reduced the mRNA and protein
LP INFORMATION offers a latest published report on Multiple Drug Resistance Bacterial Infection Treatment Market Analysis and Forecast 2019-2025 delivering key insights and providing a competitive advantage to clients through a detailed report.. According to this study, over the next five years the Multiple Drug Resistance Bacterial Infection Treatment market will register a xx% CAGR in terms of revenue, the global market size will reach US$ xx million by 2024, from US$ xx million in 2019. In particular, this report presents the global market share (sales and revenue) of key companies in Multiple Drug Resistance Bacterial Infection Treatment business, shared in Chapter 3.. Click to view the full report TOC, figure and tables:. https://www.lpinformationdata.com/reports/214783/global-multiple-drug-resistance-bacterial-infection. This report presents a comprehensive overview, market shares, and growth opportunities of Multiple Drug Resistance Bacterial Infection Treatment market by product type, ...
Looking for multiple drug resistance? Find out information about multiple drug resistance. in biology: see immunity immunity, ability of an organism to resist disease by identifying and destroying foreign substances or organisms. Although all... Explanation of multiple drug resistance
Angira, C.H., Otieno, O.A., Muga, R.O. and Abongo, B.O. (2010) Factors Contributing to Antimalarial Drug Resistance in Rachonyo District, Kenya. East African Journal of Public Health, 7, 11-15.
The latest market report published by Credence Research, Inc. Global Multiple Drug Resistance Bacterial Infection Treatment Market - Market Growth, Future Prospects, Competitive Analysis, 2017 - 2025, the global multiple drug resistance bacterial infection treatment market was valued at US$ 26,169.09 Mn in 2016, and is expected to reach US$ 44,060.77 Mn by 2025 expanding at a CAGR of 6.01 % from 2017 to 2025.. Browse the full report Global Multiple Drug Resistance Bacterial Infection Treatment Market - Market Growth, Future Prospects, Competitive Analysis, 2017 - 2025 at http://www.credenceresearch.com/report/multiple-drug-resistance-bacterial-infection-treatment-market. Market Insights. World Health Organization in 2016 had started a joint initiative between Global Antibiotic Research and Development Partnership (GARDP) and the Drugs for Neglected Diseases initiatives (DNDi) to develop new antibiotic treatment for antimicrobial resistance ensuring its optimal use. In 2016, critical segment ...
On 25th of April, the annual World Malaria Day, many health organisations will highlight important gains in fighting this deadly disease that claims more than one million lives every year. But despite notable progress in terms of innovation and investment, Médecins Sans Frontières/ Doctors Without Borders (MSF) continues to see continuously high rates of malaria in several African countries.
Despite the tremendous efforts for improving therapeutics of lung cancer patients, its prognosis remains disappointing. This can be largely attributed to the lack of comprehensive understanding of drug resistance leading to insufficient development of effective therapeutics in clinic. Based on the current progresses of lung cancer research, we classify drug resistance mechanisms into three different levels: molecular, cellular and pathological level. All these three levels have significantly contributed to the acquisition and evolution of drug resistance in clinic. Our understanding on drug resistance mechanisms has begun to change the way of clinical practice and improve patient prognosis. In this review, we focus on discussing the pathological changes linking to drug resistance as this has been largely overlooked in the past decades.
Augmentation of the therapeutic effectiveness of 3′,5′-dichloroamethopterin (DCM) against the M46R resistant variant of leukemia L1210 was demonstrated in mice preinoculated with the sensitive line of leukemia L1210. The increases in survival time were almost as extensive as those observed on treatment of the sensitive leukemia L1210 alone.. The augmentation of therapy for the M46R resistant variant in L1210-pretreated mice appeared to be dependent upon a schedule of continuous therapy.. In experiments in which the sensitive leukemia and the M46R resistant variant were inoculated concomitantly, no augmentation of therapy was obtained.. The employment of resistant sublines of tumor as tools in the study of the interrelationships of host-tumor factors in chemotherapy is discussed.. ...
Looking for infectious drug resistance? Find out information about infectious drug resistance. A type of drug resistance that is transmissible from one bacterium to another by infectivelike agents referred to as resistance factors Explanation of infectious drug resistance
Severe, steroid-resistant asthma is clinically and economically important since affected individuals do not respond to mainstay corticosteroid treatments for asthma. Patients with this disease experience more frequent exacerbations of asthma, are more likely to be hospitalized, and have a poorer qua …
Malaria is currently considered the most devastating parasitic disease in the world, with more than 500 million people infected worldwide, 1-3 millions death annually, and 40% of the world population at risk of infection. The emergence and rapid spread of multidrug resistant Plasmodia parasites coupled to the lack of an effective vaccine has resulted in the re-emergence of the disease. Efficient and cost effective drug alternatives are not yet available Contributing to the magnitud of the problem is the lack of a full understanding of the mechanisms responsible for the development of parasite drug resistance. Great efforts have been made to understand the mechanisms of Plasmodia drug resistance and several genes have been implicated. It is now well recognized that drug resistance in malaria is multifactorial and that multiple genes/factors play a critical role. The long term goal of our research is to elucidate molecular mechanisms underlying Plasmodia drug resistance. We are focusing our ...
Experimental models of AA: although there are several models of AA in use, very few models recapitulate the important clinical problem of severe and steroid-resistant asthma. We present two models to address this problem. One is a model of relapsing remitting allergic asthma developed by MUW. The lungs of animals recovered from one episode of allergic asthma maintain inflammatory infiltrates which respond to aerosol challenge with antigen at any time during their lifetime. Moreover, treatment with steroids, either inhaled or systemic, only reduces inflammation and additional disease parameters by half. We consider this a model of severe steroid-resistant allergic asthma. The second model is derived by transferring PBMCs from humans with severe steroid-resistant allergic asthma into SCID mice. These chimeric mice will develop disease that recapitulates the patients ...
A drug primarily used to treat animals is gaining traction with some who think they can use it as a treatment for COVID-19. Florida health experts say a new demand for ivermectin is causing a scary trend: a huge spike in illnesses among those who are using the medication wrong, with many finding the product at farm supply stores. We have noticed that there is a scarcity of it , said Brian Phillips, manager at Mannings Feed and Seed in Milton.
OR resistance/height2[All Fields] OR resistance/high[All Fields] OR resistance/homeostasis[All Fields] OR resistance/hyperglycemia[All Fields] OR resistance/hyperinsulinaemia[All Fields] OR resistance/hyperinsulinemia[All Fields] OR resistance/hyperinsulinemia/hyperglycemia[All Fields] OR resistance/hyperinsulinemic[All Fields] OR resistance/hyperinsulinism[All Fields] OR resistance/hyperlipidaemia[All Fields] OR resistance/hypersensitivity[All Fields] OR resistance/hypersusceptibility[All Fields] OR resistance/hypertension[All Fields] OR resistance/hypertriglyceridemia[All Fields] OR resistance/immunity[All Fields] OR resistance/impact[All Fields] OR resistance/impaired[All Fields] OR resistance/impedance[All Fields] OR resistance/inflammation[All Fields] OR resistance/inhibition[All Fields] OR resistance/innate[All Fields] OR resistance/insensitivity[All Fields] OR resistance/inspiratory[All Fields] OR resistance/insulinemia[All Fields] OR resistance/intermediate[All Fields] OR ...
An infectious-disease nightmare is unfolding: Bacteria that have been made resistant to nearly all antibiotics by an alarming new gene have sickened people in three states and are popping up all over the world, health officials reported Monday.. The U.S. cases and two others in Canada all involve people who had recently received medical care in India, where the problem is widespread. A British medical journal revealed the risk last month in an article describing dozens of cases in Britain in people who had gone to India for medical procedures.. How many deaths the gene may have caused is unknown; there is no central tracking of such cases. So far, the gene has mostly been found in bacteria that cause gut or urinary infections.. Scientists have long feared this - a very adaptable gene that hitches onto many types of common germs and confers broad drug resistance, creating dangerous superbugs.. Its a great concern, because drug resistance has been rising and few new antibiotics are in ...
In cases where drug resistance can lead to treatment failure, new research shows that therapies tailored to contain an infection or a tumor at tolerable levels can, in some cases, extend the effective life of the treatment and improve patient outcomes. In other cases, aggressive treatments aimed at eliminating as much of the infection or tumor as possible - the traditional approach - might be best. But how can we know which stands the better chance of working?
article{c94b2ddf-edd4-4046-a8cd-161d5151674b, abstract = {A review on the subject of aspirin resistance and its role in vascular diseases is presented. Although the clinical diagnosis of aspirin resistance is frequently made, little is known about its biochemical background. Only a few follow-up studies, with varying design, have dealt with the possible association between an aspirin resistant phenotype and clinical outcome in patients with atherothrombosis. However, it was recently shown that ibuprofen acts as a competitive inhibitor in the blockage of COX-1. This pharmacodynamic interaction results in secondary aspirin resistance, which may have clinical significance in patients taking both medicines. With the complex nature of vascular diseases in mind, it is not surprising that aspirin used as a single preventive strategy fails in many cases. At present, there is no clear evidence that treatment failure is associated with a particular aspirin resistant phenotype.}, author = {Hillarp, ...
WWARN is continually updating a library of standardised procedures that offer guidance in the execution of various activities in the fields of clinical, in vitro, pharmacology, data collection and molecular analysis for antimalarial drug resistance researchers. For resources that relate to other infectious and emerging diseases, visit iddo.org.. ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
SCLC remains one of the most aggressive and lethal malignancies, with a minimal role for curative surgery, no targetable driver mutations, and an mOS for metastatic disease generally less than 1 year. Nonetheless, SCLC is initially highly sensitive to DNA damage, and combinations that pair DNA-damaging agents with inhibitors of DNA-damage checkpoints and DNA repair, such as inhibitors of PARP, WEE1, CHK1, and ATR, have recently emerged as promising new strategies to treat relapsed SCLC (13-15, 18, 36-39). Two challenges unify these approaches: (i) development of biomarkers to identify sensitive cases, and (ii) determination of the common features of tumors that are cross-resistant to EP and subsequent DDR inhibitors. Recent progress has been made on both fronts, with the identification of SLFN11 as a marker of sensitivity for both PARP inhibition and EP (12, 13, 40), although unbiased screens for clinically relevant biomarkers have not been achieved. Here we describe a single-arm phase I/II ...
Chronic myeloid leukemia (CML) patients treated with imatinib develop frequent resistance generally due to a point mutation. Recently, large rearrangements of abl sequence have also been described. In this study, we focused on the complete deletion of exon 7. We screened for bcr-abldelexon7 in 63 resistant patients by high-resolution melting (HRM) analysis and direct sequencing. Moreover, we analyzed expression of abldelexon7 and bcr-abldelexon7 in 17 CML patients at diagnosis, 32 patients at resistance, and 20 negative controls by quantitative PCR or fragment length analysis. bcr-abldelexon7 was detected on 34 (54%) among 63 resistant patients by HRM, showing an increase in the sensitivity of screening, because only 3.2% could be detected by direct sequencing. This deletion was not associated with a point mutation (P = 0.3362). In addition, abldelexon7 was found in all tested samples with the same pattern of expression, suggesting an alternative splicing mechanism. In the bcr-abl component, ...
A PET study led by a Stony Brook University Professor indicates that overeating and weight gain contributing to onset of diabetes could be related to a deficit in reward circuits in the brain.
Anthracycline-formaldehyde conjugates: Cellular uptake, localization, toxicity, and circumvention of multidrug resistance. Journal Article ...
New drug-resistant strains of the parasite that causes malaria have been identified, is the worrying news being reported on the BBC News website. Covering the same piece of research, The Guardian outlines the ongoing scientific detective hunt in…
The resistance of an electrical conductor is the opposition to the passage of an electric current through that conductor. Resistance shares some conceptual parallels with the mechanical notion of friction. The SI unit of electrical resistance is the ohm (Ω).. An object of uniform cross section has a resistance proportional to its resistivity and length and inversely proportional to its cross-sectional area. All materials, aside from super conductors, show some resistance. The resistance of an object can be defined as. R = V/I Or. G = I/V. Where. R is the resistance. V is the voltage across. I is the current through. G is the conductance. For most materials and conditions, V and I are directly proportional to each other, and therefore R and G are constant. This proportionality is called Ohms law.. There are some cases where V and I are not directly proportional, such as a diode or battery. The I-V curve is not a straight line through the origin and Ohms law does not hold. In this instances, ...
This is a bit of a personal post because mostly it is a very public reminder to myself that drug resistance is not just a medical term. Drug resistance translates directly into increased impact on those who become very ill with influenza. This directly translates into more lives lost. So searching my heart I ask…
It depends on the level of drug resistance, which can be minor, major or somewhere in between. In general though, acquiring drug resistance means that the response to the drug or drugs to which...
Free Online Library: WHOsounds alarm on drug resistance. by Mail Today (New Delhi, India); News, opinion and commentary General interest Drug resistance Infection
Looking at the 4-hours chart, the pair traded above the 1.1020 resistance level plus the 50% Fib retracement level of the downward move from the 1.1163 high to 1.0925 low.. However, the upward move was capped by the 1.1080 and 1.1090 resistance levels. Moreover, the pair is also facing hurdles near the 100 simple moving average (red, 4-hours) and the 61.8% Fib retracement level of the downward move from the 1.1163 high to 1.0925 low.. There is also a crucial bearish trend line forming with resistance near 1.1100 on the same chart. Therefore, the pair needs to climb above the 1.1080 and 1.1100 resistance levels to continue higher.. Conversely, if EUR/USD fails to break the 1.1080 and 1.1100 resistance levels, it could start a fresh decline. An immediate support is near the 1.0980 level, below which the pair could test the 1.0950 support area.. Fundamentally, the US nonfarm payrolls report for August 2019 was released by the US Department of Labor this past Friday. The market was looking for an ...
Nichols (1987) defines resistance as, anything clients do to subvert or slow the process of therapy. In family therapy, resistance is the rule, not the exception (p. 251).. There is no debate regarding whether or not we will encounter resistance in therapy. The real questions are these: Why do we encounter resistance? Who is the culprit? Is there something which the resistance is covering?. Why do we encounter resistance?. People do not like change. We would much rather maintain homeostasis, dysfunctional or not, because it is what we know. If we were to change, this would be taking on the unknown, which can be more scary than continuing on the dysfunctional path. We have all heard that we are creatures of habit. We have also heard that it takes various amount of time, everyone has a different opinion about the length, to begin a new habit. This means three things: 1. We have to stop doing what we know, 2. We have to begin doing something different, and most of the time scary, and 3. We have ...
Drug resistance may emerge de novo when beneficial peptides are expressed by bacteria using completely random, noncoding DNA sequences
Malaria could be developing resistance to the most effective type of drug, according to the initial results of studies of patients in western Cambodia
Noting that the [r]oll-out of antiretroviral treatment for HIV in sub-Saharan Africa has been accompanied by rising rates of drug resistance, Raph ...
A tumors developing drug resistance is driven in large part by its genome, which has mechanisms to protect cancer cells from chemical attacks and
NIH Funding Opportunities and Notices in the NIH Guide for Grants and Contracts: Revision Applications for Mechanisms of Drug Resistance (R01 Clinical Trials Not Allowed) RFA-CA-19-049. NCI
Gentaur molecular products has all kinds of products like :search , Allele \ Drug Resistance pLICO_EF1a_MCS_IRES_PuroR \ Product-In-Demand for more molecular products just contact us
Utilization of Dr. Ericksons approaches can be daunting. They are both meticulously planned and rehearsed, as with his Induction for Resistant Patients, and spontaneous and intuitive, responding at t
Three years ago, Dr. Arjun Srinivasan, associate director of the U.S. Centers for Disease Control and Prevention (CDC), told PBS FRONTLINE: For a long time,
Online quality and compliance store. Buy Resistance welding - Welding current measurement for resistance welding - Part 4: Calibration system
A cell of an emf of 2V and internal resistance of .5ohm is s ending current through a tangent galvanometer of resistance 4.5 ohm .If another resistance of 95oh
putative drug resistance transporter [putative monensin resistance protein] ATGTCTGCTGATCTGGGTGCGCGGCGGTGGTGGGCCGTCGGTGCTCTCGTACTCGCCTCG ATGGTCGTGGGCTTCGATGTGACGATCCTGAGCCTGGCGTTGCCCGCCATGGCCGACGAC CTCGGCGCGAACAACGTCGAGCTGCAGTGGTTCGTGACGTCGTACACGCTGGTGTTCGCG GCCGGCATGATCCCGGCCGGCATGCTCGGTGACCGGTTCGGACGCAAGAAGGTCCTGCTC ACCGCCCTGGTGATCTTCGGTATCGCCTCGCTGGCCTGTGCCTACGCGACGTCCTCCGGC ACCTTCATCGGCGCGCGTGCGGTGCTCGGTCTGGGCGCCGCGCTGATCATGCCGACGACG CTGTCGCTGCTGCCGGTCATGTTCTCCGACGAGGAGCGGCCGAAGGCCATCGGAGCGGTG GCCGGTGCGGCGATGCTCGCCTATCCGCTCGGCCCGATCCTCGGCGGCTACCTGCTCAAC CACTTCTGGTGGGGCTCCGTCTTCCTGATCAACGTGCCGGTGGTGATCCTCGCCTTCCTC GCGGTCTCCGCCTGGCTGCCCGAGTCCAAGGCCAAGGAGGCCAAGCCGTTCGACATCGGC GGCCTGGTGTTCTCCAGCGTCGGTCTCGCCGCGCTGACCTACGGCGTGATCCAGGGCGGC GAGAAGGGCTGGACGGACGTCACCACGCTGGTGCCGTGCATCGGCGGTCTGCTCGCCCTC GTGCTGTTCGTGATGTGGGAGAAGCGGGTGGCGGACCCGCTGGTCGACCTCTCGCTGTTC CGCTCGGCCCGGTTCACCTCCGGCACCATGCTCGGCACCGTCATCAACTTCACGATGTTC GGCGTGCTCTTCACGATGCCGCAGTACTACCAGGCGGTCCTCGGCACCGACGCGATGGGC ...
It has taken 60 years for bacteria to become resistant to vancomycin; modified drug now works in three ways, making it harder for bugs to develop resistance
Scientists at the University of East Anglia are getting closer to solving the problem of antibiotic resistance. New research published today in the journal Nature reveals the mechanism by wh... Read more ...
Bitcoin price formed a base above the $37,600 level and started a fresh increase. BTC broke the key $38,500 resistance level to move into a positive zone.. The price even broke the $39,000 resistance level and settled well above the 100 hourly simple moving average. Finally, there was a break above the $40,000 resistance zone. There was also a break above a key bearish trend line with resistance near $39,000 on the hourly chart of the BTC/USD pair.. The price traded as high as $41,395 before there was a downside correction. Bitcoin traded below the $40,500 support level. There was a break below the 23.6% Fib retracement level of the recent increase from the $37,678 swing low to $41,395 high.. It is now consolidating near the $40,000 support zone. On the upside, an initial resistance is near the $40,500 level. The first key resistance is near the $40,750 level and a connecting bearish trend line.. ...
গত ২৯ এপ্রিল ২০১৭ তারিখে Antimicrobial Resistance: From Awareness to Action প্রতিপাদ্যকে সামনে রেখে পালিত হল বিশ্ব ভেটেরিনারি দিবস ২০১৭। শুধুমাত্র প্রাণিসম্পদ নয়, সমগ্র মানব গোষ্ঠির স্বাস্থ্যের কথা বিবেচনা করলে, প্রতিপাদ্যটি সময়ের একটি চরম দাবি। সরকারি অধিদপ্তরসহ স্বাস্থ্য ও চিকিৎসা ব্যবস্থার সাথে জড়িত সকল স্বায়ত্ত্বশাসিত, সরকারি-বেসরকারি প্রতিষ্ঠান, ব্যক্তি, উদ্যোক্তাসহ সকলেরই উচিত এর যথাযথ ...
If V volts are measured across a resistance of R ohms in a circuit carrying a current of I amperes, V=IR. At a certain instant, the voltage is 250 and is increasing at a rate of 4 volts/min, while the current is 0.5 AMP and is increasing at a rate of 0.01 amp/min. Find the rate of change of the resistance at that moment. ...
Crossfit resistance bands help you power through your training. Checkout our selection of resistance band sets to find the ideal fit for you, browse today.
Crossfit resistance bands help you power through your training. Checkout our selection of resistance band sets to find the ideal fit for you, browse today.
Cancer stem cells and drug resistance[edit]. A diagram illustrating the distinction between cancer stem cell targeted and ... When the tumor cells began to exhibit drug resistance, the cells were simultaneously transforming into a stem cell-like state, ... Scientists have discovered a molecule on the surface of tumors that appears to promote drug resistance-by converting the tumor ... Luckily, several existing drugs, such as Bortezomib for example, can attack this pathway and reverse the cellular ...
Multiple drug resistance[edit]. See also: Antineoplastic resistance. A major cause for the ineffectiveness of current ... the drug is released without harmful radiation or relying on a specific chemical reaction to occur and the drug can be ... A pitfall of the commonly used nano-drug delivery systems is that free drugs that are released from the nanocarriers into the ... For example, once the nanoparticle drug complex enters or is in the vicinity of the target tissue or cells, a glutathione ...
Antibacterial resistance[edit]. Multi drug resistance[edit]. Main article: Vancomycin-resistant Enterococcus ... Main article: Enterococcus § Antibacterial resistance. Combined drug therapies[edit]. According to one study combined drug ... Development of antibiotic resistance[edit]. This section needs expansion. You can help by adding to it. (January 2019) ... Resistance to vancomycin in E. faecalis is becoming more common.[14][15] Treatment options for vancomycin-resistant E. faecalis ...
... and extent of drug resistance. ... Koiuszko, S; Bialucha, A; Gospodarek, E (2007). "[The drug ... Resistance[edit]. Main article: Pneumococcal infection § Treatment. Resistant Pneumococci strains are called penicillin- ... "Critical decline in pneumococcal disease and antibiotic resistance in South Africa". NICD. Retrieved 20 July 2015.. ... Pikis, Andreas; Campos, Joseph M.; Rodriguez, William J.; Keith, Jerry M. (2001). "Optochin Resistance in Streptococcus ...
Resistance[edit]. Further information: Drug resistance. Poulin observes that the widespread prophylactic use of anthelmintic ... All of these have proven problematic, with drug resistance, insecticide resistance among mosquitoes, and repeated failure of ... Various methods of malaria prophylaxis have been tried including the use of antimalarial drugs to kill off the parasites in the ... The outcomes depend on whether the drugs decrease the chance of a helminth larva reaching adulthood. If so, natural selection ...
"Infection and Drug Resistance. 6: 215-23. doi:10.2147/idr.s36140. PMC 3848746. PMID 24348053. Retrieved 2019-06-23.. ... Drug interactions[edit]. Based on previous trial data and ongoing clinical trials, no significant drug-drug or food-drug ... However, drug-drug interactions similar to those observed with the cephalosporin class of antimicrobials and β-lactamase ... Microbial Drug Resistance. 24 (5): 563-577. doi:10.1089/mdr.2017.0266. PMID 29039729.. ...
"Infection and Drug Resistance. 8: 119-128. doi:10.2147/IDR.S66739. PMC 4440423. PMID 26028977.. ... A hexavalent (OspA) protein subunit-based vaccine candidate VLA15 was granted fast track designation by the U.S. Food and Drug ... The resistance of a genospecies of Lyme disease spirochetes to the bacteriolytic activities of the alternative complement ... disease-modifying antirheumatic drugs (DMARDs), or arthroscopic synovectomy.[30] Physical therapy is recommended for adults ...
Research foci: drug resistance; cancer genomics; tumor microenvironment; growth control in mammalian cells; transcriptional and ... In 2011, Christopher Vakoc discovers an important new drug target, BRD4, for a lethal form of Acute Myelogenous Leukemia (AML); ... In 2014, Phase 3 trials begin for drug to treat spinal muscular atrophy (SMA), a neurodegenerative disease, based on Adrian ...
"Infection and Drug Resistance. 10: 249-259. doi:10.2147/IDR.S124918. PMC 5587015. PMID 28919789.. ... Emergence of Azole Resistance in Aspergillus fumigatus and Spread of a Single Resistance Mechanism. at SciVee ... of resistance in clinical isolates.[55][56][57] Along with azoles, other anti-fungal drug classes do exist such as polyenes and ... Current noninvasive treatments used to combat fungal infections consist of a class of drugs known as azoles. Azole drugs such ...
A number of drugs have been developed to treat Plasmodium infection; however, the parasites have evolved resistance to each ... "Drug resistance in Plasmodium". Nature Reviews Microbiology. 16 (3): 156-170. doi:10.1038/nrmicro.2017.161. PMC 6371404. PMID ... "Antimalarial drug resistance: Linking Plasmodium falciparum parasite biology to the clinic". Nature Medicine. 23 (8): 917-928. ... "Molecular Genetics of Mosquito Resistance to Malaria Parasites". In Sullivan, D; Krishna, S. (eds.). Malaria: Drugs, Disease, ...
Drugs and drug resistance. 4 (3): 220-5. PMC 4266808 . PMID 25516832. doi:10.1016/j.ijpddr.2014.09.002.. ... although drug resistance is a potential problem.[104] According to Fenwick, Pfizer donated 70 million doses of drugs in 2011 to ... especially with respect to rapidly evolving drug resistance. Combining vector control and mass drug administration deemphasizes ... The U.S. Food and Drug Administration priority review voucher is an incentive for companies to invest in new drugs and vaccines ...
Dose failure (drug resistance). *Dyskinesia at peak dose (levodopa-induced dyskinesia). *Possible dopamine dysregulation: The ... Nausea, which is often reduced by taking the drug with food, although protein reduces drug absorption. L-DOPA is an amino acid ... "Lodosyn", Drugs, nd, retrieved 12 November 2012. *^ "L-dopa for RLS". Bandolier. 1 April 2007. Archived from the original on 3 ... As a drug, it is used in the clinical treatment of Parkinson's disease and dopamine-responsive dystonia. ...
"WHO , MDT and drug resistance". WHO. Retrieved 2019-07-22.. *^ Reibel, F.; Cambau, E.; Aubry, A. (2015-09-01). "Update on the ... intended to mitigate bacterial resistance.[108] Multi-drug therapy (MDT) combining all three drugs was first recommended by the ... A 3-drug regimen of rifampicin, dapsone and clofazimine is recommended for all people with leprosy, for 6 months for ... Resistance has developed to initial treatment. Until the introduction of MDT in the early 1980s, leprosy could not be diagnosed ...
"Drug resistance. Population transcriptomics of human malaria parasites reveals the mechanism of artemisinin resistance". ... Transcriptomic profiling also provides crucial information on mechanisms of drug resistance. Analysis of over 1000 isolates of ... Suzuki S, Horinouchi T, Furusawa C (December 2014). "Prediction of antibiotic resistance by gene expression profiles". Nature ... predicting antibiotic resistance, and unveiling host-pathogen immune interactions. A primary aim of this technology is to ...
"Drug Resistance". cdc.gov. Retrieved 17 February 2019. GAVI Alliance Archived 2014-08-20 at the Wayback Machine PneumoADIP ... and extent of drug resistance. In 1881, the organism, known later in 1886 as the pneumococcus for its role as a cause of ... S. pneumoniae is, in general, optochin sensitive, although optochin resistance has been observed. The recent advances in next- ... summarized evidence that induction of competence in S. pneumoniae is associated with increased resistance to oxidative stress ...
"Drug Resistance". cdc.gov. 2019-02-13. Retrieved 17 February 2019. Avery OT, Macleod CM, McCarty M (1944). "Studies on the ... resistance has been described. Susceptibility testing should be routine with empiric antibiotic treatment guided by resistance ... Tleyjeh IM, Tlaygeh HM, Hejal R, Montori VM, Baddour LM (2006). "The impact of penicillin resistance on short-term mortality in ... Other risk factors include smoking, injection drug use, Hepatitis C, and COPD. S. pneumoniae expresses different virulence ...
"Retail Meat Report" (PDF). National Antimicrobial Resistance Monitoring System. Food and Drug Safety Administration. 2012. ... "strongly indicates that cephalosporin resistance in humans is moving in lockstep with the use of the drug in poultry production ... The Food and Drug Administration. The Food and Drug Administration. Retrieved 2 February 2016. Gulli, Cathy (17 June 2009). " ... The FDA has since revised its stance on safe limits to inorganic arsenic in animal feed by stating that "any new animal drug ...
National Antimicrobial Resistance Monitoring System. Food and Drug Safety Administration. 2012. Retrieved 21 December 2015.. ... The Food and Drug Administration. The Food and Drug Administration. Retrieved 2 February 2016.. ... Antibiotic resistance. Information obtained by the Canadian Integrated Program for Antimicrobial Resistance (CIPARS) "strongly ... indicates that cephalosporin resistance in humans is moving in lockstep with the use of the drug in poultry production". ...
Prolonged use of azoles as antifungals has resulted in the emergence of drug resistance among certain fungal strains.[4] ... Vanden Bossche H, Dromer F, Improvisi I, Lozano-Chiu M, Rex JH, Sanglard D (1998). "Antifungal drug resistance in pathogenic ... "Efflux-mediated antifungal drug resistance". Clinical Microbiology Reviews. 22 (2): 291-321, Table of Contents. doi:10.1128/CMR ... Becher R, Wirsel SG (August 2012). "Fungal cytochrome P450 sterol 14α-demethylase (CYP51) and azole resistance in plant and ...
"Counteracting Drug Resistance in Melanoma". 2015. Archived from the original on 2015-02-04.. ... "GSK melanoma drugs add to tally of U.S. drug approvals". Reuters. May 30, 2013. Archived from the original on September 24, ... Drugs.com: Yervoy Archived 2011-08-09 at the Wayback Machine *^ Robert C, Thomas L, Bondarenko I, et al. (June 2011). " ... The drug's brandname is Yervoy.[147][160] Surveillance methods[edit]. Advances in high resolution ultrasound scanning have ...
Microbial Drug Resistance. 18 (3): 280-5. doi:10.1089/mdr.2012.0002. PMC 3412580. PMID 22432705. Shrivastav A, Dabrowski AN, ...
Dou QP, Li B (August 1999). "Proteasome inhibitors as potential novel anticancer agents". Drug Resistance Updates. 2 (4): 215- ... Vries EG, Verweij J (2000). "Clinical Cancer Research 2000: New Agents and Therapies". Drug Resistance Updates. 3 (4): 197-201 ... Drug Resistance Updates. 5 (6): 249-58. doi:10.1016/s1368-7646(02)00121-8. PMID 12531181. Clifford SC, Cockman ME, Smallwood AC ...
Microbial Drug Resistance. 26 (4): 311-318. doi:10.1089/mdr.2019.0260. PMID 31596673. Kshirsagar MM, Dodamani AS, Vishwakarma P ... In drug discovery labs, the disk diffusion test is performed slightly differently than in diagnostic labs. In this setting, it ... In drug discovery labs, especially bioprospecting labs, the assay is used to screen biological material (eg. plant extracts, ... is a culture-based microbiology assay used in diagnostic and drug discovery laboratories. In diagnostic labs, the assay is used ...
RATHER, P (1998). "Origins of the aminoglycoside modifying enzymes". Drug Resistance Updates. 1 (5): 285-291. doi:10.1016/s1368 ... Antimicrobial Resistance databases Zankari, E.; Hasman, H.; Cosentino, S.; Vestergaard, M.; Rasmussen, S.; Lund, O.; Aarestrup ... ResFinder is a database that captures antimicrobial resistance genes from whole-genome data sets. The database uses BLAST in ... "Acquired Antibiotic Resistance Genes: An Overview". Frontiers in Microbiology. 2: 203. doi:10.3389/fmicb.2011.00203. ISSN 1664- ...
ISBN 978-0-07-176939-6. Fox BW, Fox M (6 December 2012). Antitumor Drug Resistance. Springer Science & Business Media. pp. 199 ... ISBN 978-3-642-69490-5. Decker M (5 April 2017). Design of Hybrid Molecules for Drug Development. Elsevier Science. pp. 201-. ...
Drug Resistance Updates. 7 (3): 195-208. doi:10.1016/j.drup.2004.04.002. PMID 15296861. Whittaker, Mark; Ayscough, Andrew (2001 ... The drug is highly lipophilic and able to cross the blood brain barrier at higher doses. COL-3 accumulates in higher ... Pirard, B (2007). "Insight into the structural determinants for selective inhibition of matrix metalloproteinases". Drug ... is drug metabolism including loss of the hydroxamate zinc-binding group. These inhibitors were followed by the next group of ...
Microbial Drug Resistance. 15 (1): 1-9. doi:10.1089/mdr.2009.0856. PMID 19216682. D-alanine-D-serine+ligase at the US National ... Fines M, Perichon B, Reynolds P, Sahm DF, Courvalin P (September 1999). "VanE, a new type of acquired glycopeptide resistance ... Depardieu F, Bonora MG, Reynolds PE, Courvalin P (November 2003). "The vanG glycopeptide resistance operon from Enterococcus ... Park IS, Lin CH, Walsh CT (September 1997). "Bacterial resistance to vancomycin: overproduction, purification, and ...
Drug resistance poses a growing problem in the treatment of malaria in the 21st century, since resistance is now common against ... White, NJ (April 2004). "Antimalarial drug resistance". J. Clin. Invest. 113 (8): 1084-1092. doi:10.1172/JCI21682. PMC 385418. ... Extensively drug-resistant tuberculosis (XDR TB) was identified in Africa in 2006 and subsequently discovered to exist in 49 ... Measles is an endemic disease, meaning it has been continually present in a community, and many people develop resistance. In ...
Drug Resistance Updates. 29: 1-12. doi:10.1016/j.drup.2016.08.001. PMID 27912840. Akiyama H, Fukuda T, Tojima T, Nikolaev VO, ...
Microbial Drug Resistance. 8, 281-289 (2002). Ruiz J. Mechanisms of resistance to quinolones: target alterations, decreased ... Microbial Drug Resistance. 14 (1), 45-47 (2008). Falcone M, Mezzatesta ML, Perilli MG et al. Infections with VIM-1 metallo-beta ... Microbial Drug Resistance. 13 (1), 1-6 (2007). Daurel C, Fiant AL, Brémont S, Courvalin P, Leclercq R. Emergence of an ... Microbial Drug Resistance. 12 (4), 223-230 (2006). Yan JJ, Ko WC, Chuang CL, Wu JJ. Metallo-beta-lactamase-producing ...
... is due to insufficient insulin production from beta cells in the setting of insulin resistance.[13] Insulin ... Izzedine H, Launay-Vacher V, Deybach C, Bourry E, Barrou B, Deray G (November 2005). "Drug-induced diabetes mellitus". Expert ... However, in the setting of insulin resistance, the liver inappropriately releases glucose into the blood.[10] The proportion of ... In the early stages of insulin resistance, the mass of beta cells expands, increasing the output of insulin to compensate for ...
Viral resistance to the drug leads to the drug becoming useless since the virus evolves to have cells that are able to resist ... Currently, it is being replaced by newer drugs that are more convenient to take, less likely to promote virus resistance, and ... This fear of viral resistance caused a lot of users to be wary of the drug.[5] ... After 38 weeks, 6% of the people in the three-drug group died while 11% of the people died in the two-drug group. There were ...
Sihanouk desired independence from French rule, but after France refused his requests he called for public resistance to its ... "Pol Pot 'killed himself with drugs'". The Guardian. Retrieved 8 August 2014 ... as the most promising resistance group. He believed the Khmer Việt Minh's relationship to the Việt Minh and thus the ...
One important rehabilitation tool for muscle atrophy includes the use of functional electrical stimulation to stimulate the ... A novel class of drugs, called SARM (selective androgen receptor modulators) are being investigated with promising results. ... D.Zhang et al., Functional Electrical Stimulation in Rehabilitation Engineering: A survey, Nenyang technological University, ... regular resistance exercise, and consumption of a high-protein diet. Based upon a meta-analysis of seven randomized controlled ...
Zaki Chehab, Inside the resistance: the Iraqi insurgency and the future of the Middle East, Published by Nation Books, 2005, ... "Iran's festive drink and drugs binge". BBC World News. March 27, 2009.. ...
... motion is only due to the natural resistance of the violin string, resistance of the bow hair, and light weight of the stroke. ... and dragged détaché (détaché traîné) where smooth bow changes leave no audible gap between each note.[2] ...
... drug occupancy at a purported site of action can be inferred indirectly by competition studies between unlabeled drug and ... The advantage is a better noise profile and resistance to the streak artifacts common with FBP, but the disadvantage is higher ... Pharmacokinetics: In pre-clinical trials, it is possible to radiolabel a new drug and inject it into animals. Such scans are ... The uptake of the drug, the tissues in which it concentrates, and its eventual elimination, can be monitored far more quickly ...
To bridge control surface gaps on sailplanes (gliders), reducing profile drag. ScienceEdit. *Amateur and professional visual ... Due to its excellent heat resistance, it can remain on the package during microwave or oven heating. ... which provides sealability and improves puncture resistance. The polyethylene side of such a laminate appears dull and the ...
... allowing a degree of repositioning to minimize drag and damage, as opposed to resistance. Leaf movement like this may also ... Strong wind forces may result in diminished leaf number and surface area, which while reducing drag, involves a trade off of ... Divided and compound leaves reduce wind resistance and promote cooling.. *Hairs on the leaf surface trap humidity in dry ...
"U.S. Food and Drug Administration (FDA).. *Ebola: What You Need to Know - Scientific American articles related to Ebola; note ... with more than 1,000 cases and insecurity continuing to being the major resistance to providing an adequate response.[215][216] ... "U.S. Food and Drug Administration (FDA) (Press release). 14 October 2020. Retrieved 14 October 2020.. This article incorporates ... "U.S. Food and Drug Administration (FDA) (Press release). 20 December 2019. Retrieved 22 December 2019.. ...
"Drug Trials Snapshots: Aklief". U.S. Food and Drug Administration (FDA). 11 October 2019. Archived from the original on 19 ... Andriessen A, Lynde CW (November 2014). "Antibiotic resistance: shifting the paradigm in topical acne treatment". Journal of ... Aslam I, Fleischer A, Feldman S (March 2015). "Emerging drugs for the treatment of acne". Expert Opinion on Emerging Drugs. 20 ... Aslam I, Fleischer A, Feldman S (March 2015). "Emerging drugs for the treatment of acne". Expert Opinion on Emerging Drugs ( ...
Drug resistance is increasingly more common and presents a serious problem in persons who are immunocompromised. Prophylactic ... Oral candidiasis can be treated with topical anti-fungal drugs, such as nystatin, miconazole, Gentian violet or amphotericin B ... In recurrent oral candidiasis, the use of azole antifungals risks selection and enrichment of drug-resistant strains of candida ...
Drug risks[edit]. Filgrastim is typically dosed in the 10 microgram/kg level for 4-5 days during the harvesting of stem cells. ... This genetic trait confers resistance to HIV infection by blocking attachment of HIV to the cell. Roughly one in 1000 people of ... Immunosuppressive drugs are given for a minimum of 6-months after a transplantation, or much longer if required for the ... G-CSF drugs include filgrastim (Neupogen, Neulasta), and lenograstim (Graslopin). ...
An alcoholic drink (or alcoholic beverage) is a drink that contains the recreational drug ethanol, a type of alcohol produced ... "Ethanol Causes Acute Inhibition of Carbohydrate, Fat, and Protein Oxidation and Insulin Resistance". J. Clin. Invest. 81 (4): ... Alcohol is one of the most widely used recreational drugs in the world, with about 33% of people being current drinkers.[4] As ... Drug and Alcohol Dependence. 60 (2): 199-206. doi:10.1016/s0376-8716(99)00149-0. PMID 10940547.. ...
"Drug resistance is not directly affected by mating type locus zygosity in Candida albicans". Antimicrobial Agents and ...
Illegal - various gaseous, vaporised or aerosolized recreational drugs Medical use[edit]. Diagnostic[edit]. Various specialized ... Gases and other drugs used in anaesthesia include oxygen, nitrous oxide, helium, xenon, volatile anaesthetic agents. Medication ...
"Antifungal Resistance , Fungal Diseases , CDC". www.cdc.gov. 25 January 2019. Retrieved 10 April 2019.. ... Antiviral drug. ReferencesEdit. *^ a b Septimus, Edward J.; Schweizer, Marin L. (27 January 2016). "Decolonization in ...
People would tie a rope around the necks and drag them over to a ditch."[249] Corpses were stacked along the streets of ... Chatterjee, Partha (1986). "The Colonial State and Peasant Resistance in Bengal 1920-1947". Past & Present. 110: 169-204. doi: ... The bodies were picked over by vultures and dragged away by jackals. Sometimes this happened while the victim was still living. ... and reduced resistance to disease led to death by opportunistic infections.[233] Second, the social disruption and dismal ...
Tablets or capsules of activated carbon are used in many countries as an over-the-counter drug to treat diarrhea, indigestion, ... It is a measure of the activated carbon's resistance to attrition. It is an important indicator of activated carbon to maintain ... Such materials combine high hydrophobicity and chemical stability with electrical and thermal conductivity and can be used as ...
Robert A. Copeland (2013). Evaluation of Enzyme Inhibitors in Drug Discovery: A Guide for Medicinal Chemists and ... "Structural basis of HIV-1 resistance to AZT by excision.". Nat. Struct. Mol. Biol. 17 (10): 1202-9. PMC 2987654. PMID 20852643 ... http://books.google.com/books/about/Evaluation_of_Enzyme_Inhibitors_in_Drug.html?id=l2rMy8QNUk0C. ...
He detailed blood doping[5] as well as the performance-enhancing drugs he used while on the team.[6] The investigation and the ... The cells would be re-injected shortly before competition, boosting resistance to fatigue. If haematocrit levels (volume of red ... Fuentes stated that he supplied athletes in other sports with drugs and said: "I could identify all the samples [of blood]. If ... An investigation began into the practices of Fuentes in early 2006 by the anti-drug trafficking arm of the Spanish Guardia ...
... as the mutation to Hb-S provides the fitness benefit of malaria resistance to heterozygotes, while homozygotes have ... For drug pleiotropy, see Pleiotropy (drugs).. Simple genotype-phenotype map that only shows additive pleiotropy effects. G1, G2 ...
"Community-Acquired Pneumonia: From Common Pathogens To Emerging Resistance". Emergency Medicine Practice. 7 (12).. Unknown ... "Use of acid-suppressive drugs and risk of pneumonia: a systematic review and meta-analysis". CMAJ : Canadian Medical ...
SiC has the best oxidation resistance. Extreme heat treatment leads to greater oxidation resistance as well as improved ... Vehicles with "sharp" leading edges have significantly higher lift to drag ratios, enhancing the fuel efficiency of sustained ... "Journal of Electrical Engineering & Technology. 5 (2): 342-351. doi:10.5370/jeet.2010.5.2.342.. ... Spark plasma sintering also uses a pulsed current to generate an electrical discharge that cleans surface oxides off of the ...
... by the Assembly included ones concerning strengthening of national drug management systems to address antimicrobial resistance ... antimicrobial resistance, immunization gaps, malnutrition, air pollution, and epilepsy. Annual health awards were given by the ... economic and environmental root causes of antimicrobial resistance and other human health problems, to continue expanding ...
The first group, wanton addicts, have no second-order desire not to take the drug. The second group, "unwilling addicts", have ... a hindrance or obstacle in the form of resistance within her will which must be overcome by effort."[26] According to Robert ... The members of the second group freely desire not to take the drug, but their will is overcome by the addiction. Finally, the ... All three groups may have the conflicting first-order desires to want to take the drug they are addicted to and to not want to ...
At the Federal level, consistent with Section 341 of the Federal Food, Drug, and Cosmetic Act,[67] the Food and Drug ... Other possible gluten-free pasta ingredients may include hydrocolloids to improve cooking pasta with high heat resistance, ... "Food, Drug, and Cosmetic Act, Title 21, Chapter 9, S. IV, Sec. 341" (PDF). Retrieved 7 July 2012.. ... "State of Connecticut General Provisions, Chapter 417, Sections 21a-28 (Pure Foods and Drugs)". Archived from the original on 11 ...
Dinesh C. Sharma with a motto "to use pleasant sounds in a specific manner like drug in due course of time as green medicine".[ ... and to engage in therapy with less resistance.[19] Music therapy conducted in groups allows adolescent individuals to feel a ... Music therapy is used in some medical hospitals, cancer centers, schools, alcohol and drug recovery programs, psychiatric ...
Pancreatic cancer remains a significant health burden associated with limited patient survival and poses a major therapeutic challenge. Among cancer cells, Cancer stem cells (CSCs) are instrumental in inducing chemoresistance and metastasis in pancreatic cancer. CD133 has been identified as a CSC surface marker in several malignancies including pancreatic cancer. However, the functional role of CD133 in CSCs still not clear. The present study investigates the role of caveolar lipid raft integrity in functional properties of CD133+ CSCs. Current study showed first time that CD133 localizes to caveolar lipid rafts in pancreatic cancer cells, and associates with Caveolin1 (Cav-1) and cholesterol to form an integral signaling complex which drives the downstream processes of chemoresistance and metastasis. Further analysis showed that the integrity of the lipid-raft is crucial for maintenance of the functional properties of pancreatic CSCs, and its disruption leads to increased chemo-sensitivity to ...
Download data:Drug-resistant Salmonella serotype Typhi Pathogen Page pdf icon[PDF - 2 pages] ... homeAntibiotic / Antimicrobial Resistance (AR / AMR). *About Antibiotic Resistanceplus icon *How Antibiotic Resistance Happens ... Serve as a reference for information on antibiotic resistance. *Provide the latest U.S. antibiotic resistance burden estimates ... CDCs Antibiotic Resistance Threats in the United States, 2019 (2019 AR Threats Report) includes the latest national death and ...
... with the highest tolerable dose of anti-microbe medications may not be best for preventing the evolution of drug resistance in ... Day and Read showed that the optimal approach to combatting the evolution of drug resistance will be either to use the highest ... "Killing all of the infecting microbes obviously stops any further evolution of drug resistance, but we cant do this in every ... If a small number of microbes are already resistant to treatment, or if drug resistance arises by chance, high doses of ...
Tolerance and Resistance Cosmetics Database HCMV drug resistance mutations tool Combating Drug Resistance - An informative ... "Drug resistance develops naturally, but careless practices in drug supply and use are hastening it unnecessarily." - Center for ... The chances of drug resistance can sometimes be minimized by using multiple drugs simultaneously. This works because individual ... Antibiotic resistance Fecal bacteriotherapy Mass drug administration Multidrug resistance Pharmacoepidemiology Small multidrug ...
"What we found is that there is another form of resistance. Its not due to mutations in genes; its an epigenetic mode of drug ... Reporter colon cancer colorectal cancer Department of Cell and Developmental Biology Department of Medicine drug resistance ... Coffey and his colleagues are using the 3-D culture system to explore mechanisms of drug resistance in other colon cancer cell ... Researchers find novel mechanism of resistance to anti-cancer drugs. by Leigh MacMillan , Oct. 17, 2017, 1:33 PM. ...
Drug Abuse Resistance Education (D.A.R.E.) is an education program that seeks to prevent use of controlled drugs, membership in ... "The Social Construction of Evidence-Based Drug Prevention Programs: A Reanalysis of Data from the Drug Abuse Resistance ... Hecht, Michael; Graham, John; Elek, Elvira (2006). "The drug resistance strategies intervention: Program effects on substance ... D. stated that none of Californias drug education programs worked, including D.A.R.E. "Californias drug education programs, D ...
Resistance to antimalarial medicines is a threat to global efforts to control and eliminate malaria. Protecting the efficacy of ... Preventing and containing antimalarial drug resistance. Several factors influence the emergence and spread of drug resistant ... The Greater Mekong Subregion has long been the epicentre of antimalarial drug resistance. P. falciparum resistance to ... Countries where resistance to artemisinins or to ACT partner drugs is reported need to intensify malaria control in order to ...
The international peer-reviewed journal covering the global spread and threat of multi-drug resistant clones of major pathogens ... Microbial Drug Resistance (MDR) is an international, peer-reviewed journal that covers the global spread and threat of multi- ... Microbial Drug Resistance is under the editorial leadership of Editor Alexander Tomasz, PhD, The Rockefeller University, ... The Journal addresses the serious challenges of trying to decipher the molecular mechanisms of drug resistance. MDR provides a ...
The international peer-reviewed journal covering the global spread and threat of multi-drug resistant clones of major pathogens ...
Multiple drug resistance (MDR), multidrug resistance or multiresistance is antimicrobial resistance shown by a species of ... Drug resistance MDRGN bacteria Xenobiotic metabolism NDM1 enzymatic resistance Herbicide resistance P-glycoprotein A.-P. ... Li XZ, Nikaido H (August 2009). "Efflux-mediated drug resistance in bacteria: an update". Drugs. 69 (12): 1555-623. doi:10.2165 ... Drug+Resistance,+Multiple at the US National Library of Medicine Medical Subject Headings (MeSH) Boucher, HW, Talbot GH, ...
Hypoxia can result in drug resistance indirectly if under this condition cells more effectively detoxify the drug molecules. ... Hypoxia can be a direct cause of therapeutic resistance because some drugs and radiation require oxygen to be maximally ... Finally, the use of hypoxic cell selective cytotoxic agents as a means of addressing hypoxic drug resistance is discussed. ... is evidence that hypoxia can enhance genetic instability in tumor cells thus allowing more rapid development of drug resistance ...
Pediatric Infection: Otitis Media Therapy and Drug Resistance Part 2: Current Concepts and New Directions ... At present, we must consider the tremendous increase in the resistance to antibiotics of the main pathogens that cause AOM ( ... The concern for increased antibiotic resistance has led various investigators to examine the role of oligosaccharides and ... as well as the potential of prolonged antibiotic administration to considerably increase the resistance of these organisms. As ...
HIV drug resistance has the potential to become a serious emerging threat to the roll-out of antiretroviral treatment ... What drives HIV drug resistance?. HIV drug resistance can arise from a range of different factors, which can be split up into ... What is HIV drug resistance?. HIV drug resistance occurs when the virus starts to make changes (mutations) to its genetic make- ... 61. WHO (2017) HIV drug resistance report 2017. *62. Phillips, A. et al. (2017) Impact of HIV Drug Resistance on HIV/AIDS- ...
Resistance has emerged to all classes of antimalarial drugs except the artemisinins and is responsible for a recent increase in ... The de novo emergence of resistance can be prevented by the use of antimalarial drug combinations. Artemisinin-derivative ...
... gene amplification in drug resistance, the molecular determinants of multidrug resistance, and resistance to taxanes and ... angiogenesis cancer cytotoxicity drug drug resistance hormones imaging immunotherapy leukemia melanoma oncogenes pharmacology ... The authors review physiological resistance based tumor architecture, cellular resistance based on drug transport, epigenetic ... In Cancer Drug Resistance, leading scientists from the best academic institutions and industrial laboratories summarize and ...
... published in Nature Medicine research that looks at the information held in our DNA and what it could tell us about cancer drug ... it is envisaged that the patients disease has acquired resistance to the drug. One current theory of resistance is that a ... What is acquired resistance?. Simply speaking, when a patient is observed to be responding to a drug (for example, shrinking ... Ironically, acquired resistance to drugs emerges in the same way that the disease itself emerges - via the evolution of cell ...
... 2 March 2021 19:00-20:00, United Kingdom ... Professor Eyers will deliver an insightful lecture on our understanding of drug-resistance in human cancer cells. ...
... or primary resistance. As transmitted drug resistance increases the risk... ... Infection with an HIV strain harboring drug resistance-related mutations is referred to as transmitted drug resistance (TDR) ... Resistance Mutation Virological Failure Replicative Capacity Drug Resistance Mutation Acquire Drug Resistance These keywords ... Infection with an HIV strain harboring drug resistance-related mutations is referred to as transmitted drug resistance (TDR) or ...
A new drug that blocks a molecule that cancer cells rely on for transcribing genetic information shows promise in tackling ... In addition, some people might be resistant to one drug and sensitive to others, while others may have multi-drug resistance. ... An experimental new drug may tackle treatment resistance in cancer.. In the study paper, now published in the journal Molecular ... Cancer and drug resistance. Cancer is a group of diseases that have one thing in common: they arise because abnormal cells in ...
"Different Paths To Drug Resistance In Leishmania." Medical News Today. MediLexicon, Intl., 31 Oct. 2011. Web.. 20 May. 2019. , ... These studies increase our understanding of the process of drug resistance in Leishmania. Leishmaniasis is a disfiguring and ... "We must maintain continuous surveillance to monitor the threat from the on-going emergence of drug resistance. These studies ... "This basic biological difference in the way that drug resistance emerges in Leishmania is essential for tracking strains and ...
Studies on mechanisms of cancer drug resistance have yielded important information about how to circumvent this resistance to ... but other mechanisms of resistance including insensitivity to drug-induced apoptosis and induction of drug-detoxifying ... Mechanisms of cancer drug resistance.. Gottesman MM1.. Author information. 1. Laboratory of Cell Biology, National Cancer ... Resistance to treatment with anticancer drugs results from a variety of factors including individual variations in patients and ...
Jude finds cancer drug resistance genes and possibly how to limit their effects Article Link ... Jude finds cancer drug resistance genes and possibly how to limit their effects Article Link ... Title: Scientists Develop New Models to Accelerate Progress in Preventing Drug Resistance in Lung and Pancreas Cancers Article ... Title: Scientists Develop New Models to Accelerate Progress in Preventing Drug Resistance in Lung and Pancreas Cancers Article ...
There is enough similarity between drug-resistance genes in E. coli carried by chickens and E. coli infecting humans that the ... Is Drug Resistance in Humans Coming From Chickens?. Theres a new paper out in the CDCs journal Emerging Infectious Diseases ... The similarity of E. coli strains and predominant drug resistance genes in meat and humans provides circumstantial evidence for ... There is enough similarity between drug-resistance genes in E. coli carried by chickens and E. coli infecting humans that the ...
... and tests can fail to identify that resistance, which could help accelerate their spread, a new study finds. ... Some strains of the new H7N9 bird flu virus that appeared in China this year are resistant to antiviral drugs, ... home/infectious disease center/ infectious disease a-z list/ chinas bird flus drug resistance worries expert article ... Some strains of the new H7N9 bird flu virus that appeared in China this year are resistant to antiviral drugs, and tests can ...
... of bacteria evolving drug resistance right before your eyes. ... believe bacteria can evolve a resistance to drugs, but only ... and at some point one or more of the baby bacteria just happened to get a resistance to the drug. It was able to pass that ... Mind you, bacteria all over the place on the table were probably evolving some sort of resistance, but only the ones near the ...
... used to determine whether the HIV strain infecting an individual is resistant or has developed resistance to one or more drugs ... HIV antiretroviral drug resistance testing is used to help select a drug regimen that will likely be effective in treating a ... 1995-2012). Test ID: GHIVR HIV-1 Genotypic Drug Resistance Mutation Analysis, with Reflex to Phenotypic Drug Resistance ... is a better indicator of the level of HIV drug resistance.. HIV genotypic resistance testing cannot detect unknown resistance ...
... especially resistance to antibiotics - is a growing threat to human health, food ... the World Health Organisation reported that drug resistance - ... Drug resistance threatens the effective treatment of a growing ... In 2014, the World Health Organisation reported that drug resistance - especially resistance to antibiotics - is a growing ... The first ethical hurdle is to reach a consensus on how to characterise drug resistance. Many ethicists see it as a "collective ...
for TB, resistance in the UK to first-line drug treatments is seen in less than 8% of cases and resistance to multiple drugs is ... What is antimicrobial resistance?. Antimicrobial resistance occurs when a drug is no longer effective against an infection. ... to improve surveillance of antimicrobial resistance (resistance of all types of infections to drugs) and to measure the health ... to develop standard ways to record antibiotic resistance (resistance of bacteria to drugs) in humans and food-producing animals ...
  • CDC's Antibiotic Resistance Threats in the United States, 2019 (2019 AR Threats Report) includes the latest national death and infection estimates that underscore the continued threat of antibiotic resistance in the U.S. (cdc.gov)
  • However, the number of people facing antibiotic resistance is still too high. (cdc.gov)
  • Find the latest CDC actions to combat antibiotic resistance through its AR Solutions Initiative . (cdc.gov)
  • In 2013, CDC published the first AR Threats Report, which sounded the alarm to the danger of antibiotic resistance. (cdc.gov)
  • The development of antibiotic resistance in particular stems from the drugs targeting only specific bacterial molecules (almost always proteins). (wikipedia.org)
  • Because the drug is so specific, any mutation in these molecules will interfere with or negate its destructive effect, resulting in antibiotic resistance. (wikipedia.org)
  • At present, we must consider the tremendous increase in the resistance to antibiotics of the main pathogens that cause AOM ( particularly S pneumoniae ) and the high rate of nasopharyngeal colonization with these pathogens in infants and toddlers, as well as the potential of prolonged antibiotic administration to considerably increase the resistance of these organisms. (medscape.com)
  • The concern for increased antibiotic resistance has led various investigators to examine the role of oligosaccharides and xylitol in the prevention of AOM episodes. (medscape.com)
  • The Netherlands has one of the lowest rates of human antibiotic resistance in the world, thanks to especially stringent infection control and drug-conservation policies. (wired.com)
  • These findings won't come as a surprise to anyone who accepts - as most good science and a number of public health authorities do - that antibiotic overuse in large-scale farming creates drug-resistant organisms that affect human health. (wired.com)
  • Moreover, capping antibiotic use could lead to higher drug prices, threatening access for those who need the medication. (gulf-times.com)
  • Then, in November 2017, the Centre for Antibiotic Resistance Research (CARe) at my own university held the first-ever major symposium on the topic, bringing together leading scholars in economics, ethics, law, policy, social science, and health care. (gulf-times.com)
  • The findings are troubling because they suggest this bacteria is becoming resistant to nearly everything in our arsenal," said Ramanan Laxminarayan , the principal investigator of Extending the Cure, a project examining antibiotic resistance at the Washington, D.C. based think-tank Resources for the Future. (digitaljournal.com)
  • Now, researchers at Washington University School of Medicine in St. Louis have figured out a key step in the transmission of antibiotic resistance from one Acinetobacter bacterium to another, insight that sheds light on how antibiotic resistance spreads through a hospital or community. (news-medical.net)
  • The research indicates that the effectiveness of current antibiotics may be somewhat preserved by curtailing the spread of antibiotic-resistance genes. (news-medical.net)
  • Big plasmids, which are prone to accumulating ever more antibiotic-resistance genes, carry the genetic instructions to build a needle-like appendage to insert copies of themselves into nearby bacteria. (news-medical.net)
  • That is scary for us because the plasmids are very efficient at collecting antibiotic resistance. (news-medical.net)
  • Most Acinetobacter guard against strangers with a system that injects lethal proteins into any unrelated bacteria that approach too closely, thus reducing the changes of spreading antibiotic-resistance genes. (news-medical.net)
  • Given increasing antimicrobial resistance, we aimed to determine antibiotic susceptibility and presence of resistance genes in uropathogens in primary care, factors associated with resistance to commonly prescribed antibiotics, and effect of treatment on early symptom resolution. (asm.org)
  • Thank you for the opportunity to be here today to discuss the current state of antibiotic resistance and the need for new solutions to the current crisis. (fda.gov)
  • The decline in antibacterial drug research and development (R&D) in the private sector, at a time when serious antibiotic resistant infections are on the rise, is a tremendous public health problem, resulting in a very serious unmet medical need. (fda.gov)
  • Furthermore, the inappropriate use of antibacterial drugs can accelerate the development of antibiotic resistance. (fda.gov)
  • It is essential that we use antibiotic drugs prudently in order to preserve the effectiveness of these drugs. (fda.gov)
  • This antibiotic agent is part of the currently recommended therapy regimen for gonorrhoea and observed resistance patterns threaten its effectiveness. (eurekalert.org)
  • An interesting new study, using a combination of techniques from biology to mathematics has found that overcoming antibiotic-resistant bacterial infections could be achieved by using a three-drug cocktail, or combination of antibiotics. (digitaljournal.com)
  • The paper's lead author, Elif Tekin, a UCLA graduate student, helped to create the mathematical framework that helped the scientists to decide when adding a third antibiotic was producing new effects that two-drug combinations were not achieving. (digitaljournal.com)
  • Antibiotic resistance happens when bacteria change and become able to withstand the antibiotics used to treat the infections they cause. (cbc.ca)
  • Join the fight against antimicrobial resistance by pledging to use antibiotics responsibly and to promote awareness of antibiotic resistance. (who.int)
  • The World Health Organisation's (WHO) first global report on antibiotic resistance has revealed serious threat to public health. (thefreelibrary.com)
  • The report focusing on antimicrobial resistance, including antibiotic resistance, has said that serious threat is no longer a prediction for the future, it is happening in every region of the world. (thefreelibrary.com)
  • The report, ' Antimicrobial resistance: global report on surveillance' has revealed antibiotic resistance is apparent in seven different bacteria responsible for common, serious diseases such as bloodstream infections (sepsis), diarrhoea, pneumonia, urinary tract infections and gonorrhoea. (thefreelibrary.com)
  • Antibiotic resistance causes people to remain ill for a a longer period of time. (thefreelibrary.com)
  • A study on more than 4,500 retrospective patient samples, published today in Nature Communications, shows that Mykrobe Predictor accurately detects antibiotic resistance in two life-threatening bacterial infections: Staphylococcus aureus (one form of which causes MRSA) and tuberculosis (TB). (ox.ac.uk)
  • That's how hardy enterococci are, according to Michael Gilmore, an ophthalmologist and microbiologist who heads Harvard University's extensive program on antibiotic resistance. (voanews.com)
  • NIAID's report titled " NIAID's Antibiotic Resistance Research Framework: Current Status and Future Directions ," lays out the institute's portfolio of basic, translation and clinical research in antimicrobial resistance and outlines innovative research approaches based on the latest scientific advances. (nih.gov)
  • Any pathogen population sufficiently large is expected to harbor spontaneous drug-resistant mutants, often responsible for disease relapse after antibiotic therapy. (genetics.org)
  • Genetic diversity at antibiotic resistance loci can determine a population's capacity to cope with future challenges (i.e. second-line therapy). (genetics.org)
  • We thus revealed an unanticipated way in which the fitness effects of antibiotic resistance can affect the evolvability of pathogens surviving a drug-induced bottleneck. (genetics.org)
  • The mobility of SGI-1 coupled with the ability of various antibiotic resistance genes to be integrated and lost from the chromosomal resistance locus allows for the transfer of stable antibiotic resistance to most of the commonly used antibiotics and adaptation to new antibiotic challenges. (ingentaconnect.com)
  • According to experts, only large drug firms like AstraZeneca are partaking in antibiotic research, and there's a lack of effort in creating new antibiotics that will only be used as a last line of defense. (dailytech.com)
  • According to Sprenger, countries with the highest rates of multi-drug resistant infections also tend to be the ones with the highest antibiotic use . (dailytech.com)
  • These microorganisms employ several mechanisms in attaining multi-drug resistance: No longer relying on a glycoprotein cell wall Enzymatic deactivation of antibiotics Decreased cell wall permeability to antibiotics Altered target sites of antibiotic Efflux mechanisms to remove antibiotics Increased mutation rate as a stress response Many different bacteria now exhibit multi-drug resistance, including staphylococci, enterococci, gonococci, streptococci, salmonella, as well as numerous other Gram-negative bacteria and Mycobacterium tuberculosis. (wikipedia.org)
  • Antibiotic resistant bacteria are able to transfer copies of DNA that code for a mechanism of resistance to other bacteria even distantly related to them, which then are also able to pass on the resistance genes and so generations of antibiotics resistant bacteria are produced. (wikipedia.org)
  • However, many patients have tumors with genetic mutations that make them resistant to these anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, or the cancers develop resistance during treatment. (vanderbilt.edu)
  • Researchers seeking to understand mechanisms of intrinsic and acquired resistance have focused on gene mutations, such as activating mutations in the oncogene KRAS . (vanderbilt.edu)
  • The researchers evaluated the cells for gene mutations linked to cetuximab resistance, but they didn't find any. (vanderbilt.edu)
  • HIV drug resistance occurs when the virus starts to make changes (mutations) to its genetic make-up (RNA) that are resistant to certain HIV drugs, or classes of HIV drugs. (avert.org)
  • When antiretroviral treatment is given in inadequate levels, we are allowing for these drug resistant mutations to be selected out and multiplied to the point that drug resistant virus becomes the primary population in the viral pool. (avert.org)
  • 7 This is because some mutations affect the efficacy of different drugs within the same drug class. (avert.org)
  • Over time, due to mutations, the population of viruses in an individual may contain fewer viral strains susceptible to HIV treatment, and more strains that are drug resistant. (avert.org)
  • For some drugs, such as the NRTI lamivudine and all NNRTIs, just one mutation - notably the M184V or K103N mutations - can result in high-level drug resistance. (avert.org)
  • These cells are characterized by mutations which can be identified as "mechanisms," in clinical cancer parlance, of the developed resistance. (ibm.com)
  • Infection with an HIV strain harboring drug resistance-related mutations is referred to as transmitted drug resistance (TDR) or primary resistance. (springer.com)
  • Of concern in developed countries is the rising prevalence of mutations associated with NNRTI resistance, a drug class frequently used in first-line therapy which has a low genetic barrier for development of resistance. (springer.com)
  • In resource-limited settings (RLS), rollout of ART with limited virological monitoring frequently results in the risk of prolonged virological failure with selection and accumulation of drug resistance mutations and subsequent transmission of drug resistance. (springer.com)
  • Bennett DE et al (2009) Drug resistance mutations for surveillance of transmitted HIV-1 drug-resistance: 2009 update. (springer.com)
  • Castro H et al (2013) Persistence of HIV-1 transmitted drug resistance mutations. (springer.com)
  • When they do, random mutations in the genetic code occur, and at some point one or more of the baby bacteria just happened to get a resistance to the drug. (slate.com)
  • With genotypic resistance testing, the genetic code of the HIV a person has been infected with is analyzed to determine if there are any genetic mutations that are known to cause ART resistance. (labtestsonline.org)
  • These mutations may mean that the organism is weaker in some way, but it may also mean that the mechanism of action of a drug no longer works on it. (www.nhs.uk)
  • The research team focused on studies that included data on the presence of drug-resistant mutations in the virus, most commonly resistant to NNRTI drugs. (eurekalert.org)
  • The study authors found drug resistance to be highest in Southern Africa, where 11.1% of people beginning first-line therapy had a virus with NNRTI drug-resistant mutations, compared to 10.1% in Eastern Africa, 7.2% in Western/Central Africa, and 9.4% in Latin America. (eurekalert.org)
  • The scientists found that ABT-199 resistance was dependent on both genetic mutations and non-mutational changes. (genengnews.com)
  • two clusters had shared resistance mutations. (medscape.com)
  • But only 6 percent of H3N2 and influenza B samples tested in North America had genetic mutations giving resistance to Tamiflu, she said. (reuters.com)
  • When these drugs are administered to sickly patients, they do more harm than good-often spurring viral mutations that are resistant to the standard drugs on the market. (worldpolicy.org)
  • And the costs of additional drugs, which could potentially combat the mutations, are exorbitant. (worldpolicy.org)
  • Mutations could reduce the binding affinity of a drug to its target or render the target constitutively active. (frontiersin.org)
  • Worse yet, mutations could turn a drug from an antagonist into an agonist. (frontiersin.org)
  • In general, resistant mutations in drug targets are derived from tissue specimen of the patients that are resistant to the drug. (frontiersin.org)
  • Novel drug candidates effective against the mutated targets in experimental models are developed, and their efficacy in patients bearing such resistant mutations is further demonstrated. (frontiersin.org)
  • Mutations of cycloguanil-resistance were 13 percent. (redorbit.com)
  • Preliminary findings from research on three patients treated at Mass General were published in December 2016 in the American Association for Cancer Research journal Cancer Discovery and suggest that treatment with BGJ398 led to the acquisition of a stunning variety of secondary mutations in the same FGFR2 gene targeted by the drug. (massgeneral.org)
  • The researchers believe these secondary FGFR2 mutations are among the mechanisms that drive resistance. (massgeneral.org)
  • Molecular modeling and cell line studies built on previously published work confirmed that the secondary mutations in FGFR2 led to BGJ398 resistance-and that this resistance could be overcome with additional FGFR inhibitors that are structurally distinct from BGJ398. (massgeneral.org)
  • Variations in drug susceptibility, in the emergence and selection of specific drug resistance mutations, in viral replicative capacity and in the dynamics of resistance acquisition under ARV selective pressure are discussed. (mdpi.com)
  • The genetic mutations which allow Malaria to avoid drug treatment have been found. (thenakedscientists.com)
  • Scientists believe they could obtain the same information much faster by looking directly at the DNA sequence of the bacterium for mutations that are known to cause resistance. (ox.ac.uk)
  • Mykrobe Predictor streamlines this process by automating genome analysis, cross-checking the bacterium's DNA sequence with previous strains to look for resistance-causing mutations and presenting information about the bug in an easy-to-understand format. (ox.ac.uk)
  • However unlike standard 'snippet-based' DNA tests, Mykrobe Predictor can be rapidly updated with a simple software upgrade that allows researchers to detect new resistance mutations as they evolve. (ox.ac.uk)
  • The goal of HIV drug resistance testing is to identify mutations present within the viral population of an HIV-infected individual. (amazon.com)
  • These mutations can cause resistance to one or more drugs, so accurately identifying their presence/absence can help determine the best path for treatment. (amazon.com)
  • Detection of these mutations in the viral genome can be used to accurately predict the susceptibility of the virus to currently licensed antiviral drugs used to treat HBV infection and thus can be used to optimise the use of antiviral treatment on an individual patient basis. (imperial.ac.uk)
  • Fluoroquinolone resistance has largely been attributed to mutations occurring in the genes coding for intracellular targets of these drugs. (ingentaconnect.com)
  • As with other antiviral drugs, the target virus can develop resistant mutations, particularly when the virus circulates among people living in close quarters such as nursing homes, hospital pediatric wards and households where antiviral therapy has been used, the authors noted. (medpagetoday.com)
  • Results are aggregated by the pattern of accompanying nonpolymorphic established drug-resistance mutations. (stanford.edu)
  • Drug susceptibility results (fold-decreased susceptibility) of viruses containing one or more user-specfied mutations. (stanford.edu)
  • Users can retrieve all results on isolates containing the specified mutations or only those results with exact matches (at nonpolymorphic established drug-resistance positions) to the specified mutations. (stanford.edu)
  • Drug susceptibility results (PhenoSense assay) of viruses containing the most common patterns of mutations in the database. (stanford.edu)
  • E. coli Bacteria More Likely to Develop Resistance after Exposure to Low Levels of Antibiotics Reports a Study in Microbial Drug Resistance . (liebertpub.com)
  • In 2014, the World Health Organisation reported that drug resistance - especially resistance to antibiotics - is a growing threat to human health, food security, and "the achievements of modern medicine. (gulf-times.com)
  • When people recklessly use antibiotics to fight a common cold, when farmers use antibiotics to boost livestock productivity, or when pharmacological factories emit antibiotics into the environment to cut production costs, the bacteria that the drugs are designed to kill become immune. (gulf-times.com)
  • The more antibiotics consumed and emitted, the faster resistance develops, leading to "superbugs" that jeopardise human health, both by raising the risk of massive deadly epidemics and by compromising medical services, such as surgery and cancer treatment, that rely on effective antibiotics. (gulf-times.com)
  • WHO reported huge gaps in the global knowledge of microbial resistance - only between 35 and 92 states were able to provide any data on the use of the nine antibiotics for the seven specific infections. (www.nhs.uk)
  • investigate the proteomic mechanisms used to circumvent the effect of antibiotics by Gram-negative bacteria that do not harbor traditional genetic elements of resistance. (mcponline.org)
  • Taking a systems approach, they identify both common and drug-specific molecular pathways that facilitate decreased susceptibility to antibiotics. (mcponline.org)
  • HONOLULU (AP) - Federal researchers say a cluster of gonorrhea cases in Hawaii are the first in the nation to show resistance to the strongest antibiotics available to combat the sexually transmitted disease. (washingtontimes.com)
  • LOS ALAMOS, N.M., Dec. 4, 2017--New supercomputer simulations have revealed the role of transport proteins called efflux pumps in creating drug-resistance in bacteria, research that could lead to improving the drugs' effectiveness against life-threatening diseases and restoring the efficacy of defunct antibiotics. (eurekalert.org)
  • Some life-threatening infections do not respond to antibiotics because efflux pumps inside a particular type of infectious microbe called Gram-negative bacteria flush out antibiotics before the drugs can work. (eurekalert.org)
  • For example, perhaps the amino acid interactions that stabilize the pump structure could be targeted by drug development efforts to block pump assembly or function, thereby rendering currently defunct antibiotics effective once more. (eurekalert.org)
  • Bacterial resistance to antibiotics is increasing worldwide, leading to the resurgence of infectious diseases such as tuberculosis and typhoid fever, says the British Parliamentary Office of Science and Technology in a report published this week. (bmj.com)
  • We can look for new antibiotics, but bacteria will always find a way to develop resistance again. (news-medical.net)
  • Small plasmids, which contain resistance genes against a single but important group of antibiotics known as carbapenems, lack their own distribution tools so they invade new bacteria by tagging along with the large plasmids. (news-medical.net)
  • We need to find therapies that don't kill the bacteria but prevent it from becoming drug-resistant, so we can continue using our antibiotics into the future. (news-medical.net)
  • The emergence of drug-resistant strains of Neisseria gonorrhoeae has hampered control efforts, the researchers noted, and the extended-spectrum cephalosporins, cefixime and ceftriaxone, are currently the only available antibiotics. (medpagetoday.com)
  • In the meantime, slowing the emergence of resistance can best be done by using combinations of antibiotics, as the study authors suggest, they wrote in an accompanying commentary. (medpagetoday.com)
  • It is essential to use antibiotics judiciously to slow the development of resistance. (fda.gov)
  • If the common antibiotics stop working due to resistance, we only have very limited alternatives left to successfully treat gonorrhoea. (eurekalert.org)
  • In the study conducted by UCLA life scientists and published in the journal Royal Society Interface, it was found that a combination of three different antibiotics often overcame the bacteria's resistance, even when on their own, or even in combinations of two, the antibiotics weren't effective. (digitaljournal.com)
  • Not many scientists realize that three-drug combinations can have really beneficial effects that they would not have predicted even by studying all pairs of the antibiotics together. (digitaljournal.com)
  • We think our contribution will buy time for researchers to better leverage existing drugs and for policymakers to develop a better policy about the use of antibiotics. (digitaljournal.com)
  • Some drugs, like antibiotics, are (bought over) the counter and abused, which causes serious problems. (ipsnews.net)
  • Modern technology enabled Eric Brown's team to screen nearly 2,000 off-patent drugs, giving them the tools to uncover the pentaminate compound and test its effectiveness when combined with antibiotics in mice. (cbc.ca)
  • An existing anti-fungal drug - pentamidine - commonly used to treat pneumonia and HIV is believed to offer a solution against these superbugs, when taken in combination with antibiotics. (cbc.ca)
  • What we're talking about now is a molecule that's already a drug that can make a number of antibiotics, that are formerly not useful for the treatment of gram-negative bacteria, capable of treating this class of organisms,' said Eric Brown, lead researcher on the trial and a professor of biochemistry and biomedical science at McMaster's Mchael G. DeGroote School of Medicine. (cbc.ca)
  • This drug-resistant bacteria blocks out all antibiotics, including last resort drugs. (cbc.ca)
  • What we're talking about now is a molecule that's already a drug that can make a number of antibiotics, that are formerly not useful for the treatment of gram-negative bacteria, capable of treating this class of organisms. (cbc.ca)
  • Modern technology enabled these researchers to screen more than 500,000 compounds from nearly 2,000 off-patent drugs, giving them the tools to uncover the pentamidine compound and test its effectiveness when combined with antibiotics in mice. (cbc.ca)
  • Because of this, pseudouridimycin has no cross-resistance with many other antibiotics, meaning that it shuts down a whole different set of avenues for bacteria to proliferate. (consumeraffairs.com)
  • DRUG resistance due to irrational use of antibiotics is causing a grave concern world over. (thefreelibrary.com)
  • The results are cause for high concern, documenting resistance to antibiotics, especially " last resort" antibiotics, in all regions of the world. (thefreelibrary.com)
  • According to the report, resistance to the treatment of last resort for life- threatening infections caused by a common intestinal bacteria, Klebsiella pneumonia -- carbapenem antibiotics -- has spread to the entire world. (thefreelibrary.com)
  • A study done by Department of Pharmacology, V. P. Chest Institute and Essential Drugs and Other Medicines department of WHO, Delhi analysed the use of antibiotics in patients of respiratory tract infections. (thefreelibrary.com)
  • Scientists have developed an easy-to-use computer program that can quickly analyse bacterial DNA from a patient's infection and predict which antibiotics will work, and which will fail due to drug resistance. (ox.ac.uk)
  • The software is currently being trialled in three UK hospitals to see whether it could help speed up diagnosis of drug-resistant infections and enable doctors to better target the prescription of antibiotics. (ox.ac.uk)
  • But to find out which particular strain of bacteria is causing a patient's infection and which drugs it is resistant to, doctors must carry out drug susceptibility testing, where different antibiotics are applied to the bacteria in a petri dish to see whether they kill it. (ox.ac.uk)
  • In this study, the software was able to detect resistance to the five first-line antibiotics in over 99% of Staphylococcus aureus cases, matching the performance of traditional drug sensitivity testing. (ox.ac.uk)
  • They've found that resistance to modern antibiotics dates back millions of years. (voanews.com)
  • In a hospital setting, people are often treated with antibiotics to prevent infections, but the drugs also kill helpful microorganisms that keep enterococci under control. (voanews.com)
  • Without that check, the superbug, which is not killed off, develops resistance to the antibiotics. (voanews.com)
  • however, using antibiotics too often in humans and animals and in cases where antibiotics are not an appropriate treatment can make resistance develop more quickly. (nih.gov)
  • NIAID's research program also focuses on ways to prevent infections, including vaccines, and developing new antibiotics and novel treatments effective against drug-resistant microbes. (nih.gov)
  • Furthermore, the resistance to chloramphenicol-florfenicol and tetracyclines in DT104 isolates, is due to interaction between specific transporters for these antibiotics encoded by genes mapping to the SGI-1 and the AcrAB-TolC tripartite efflux pump. (ingentaconnect.com)
  • The potential for the use of efflux pump inhibitors to restore therapeutic efficacy to fluoroquinolones and other antibiotics offers an exciting developmental area for drug discovery. (ingentaconnect.com)
  • The European Center for Disease Prevention and Control (ECDC) has found that multi-drug resistant bacteria , or 'superbugs,' are spreading throughout Europe with resistance to even the strongest antibiotics. (dailytech.com)
  • According to Marc Sprenger, ECDC's director, rates of resistance to 'last-line' antibiotics such as carbapenems by K. pneumoniae had doubled to 15 percent in 2010 from 7 percent five years ago. (dailytech.com)
  • Experts say doctors are largely to blame for the overuse of antibiotics leading to abuse and eventually resistance. (dailytech.com)
  • As for antibiotics, horizontal transfer of phage resistance can be acquired by plasmid acquisition. (wikipedia.org)
  • If a small number of microbes are already resistant to treatment, or if drug resistance arises by chance, high doses of medication may allow resistant microbes to survive and spread by the very act of killing off drug-sensitive microbes. (psu.edu)
  • One of the main reasons drug-resistant microbes are rare is that they are in direct competition for resources with their drug-sensitive neighbors," said Read. (psu.edu)
  • High doses of medication can quickly eliminate this competition for resources, allowing drug-resistant microbes to thrive. (psu.edu)
  • When an organism is resistant to more than one drug, it is said to be multidrug-resistant. (wikipedia.org)
  • Drug-resistant traits are accordingly inherited by subsequent offspring, resulting in a population that is more drug-resistant. (wikipedia.org)
  • This protein stimulates the growth of cancer cells which are drug-resistant. (wikipedia.org)
  • Malaria in 2012 has become a resurgent threat in South East Asia and sub-Saharan Africa, and drug-resistant strains of Plasmodium falciparum are posing massive problems for health authorities. (wikipedia.org)
  • Population movement has as the species of malaria parasites that occur in a introduced resistant parasites to areas previously free given area, their susceptibility to commonly used of drug resistance. (cdc.gov)
  • Several factors influence the emergence and spread of drug resistant malaria parasites, including the number of parasites exposed to a drug, the drug concentration to which the parasites are exposed, and the simultaneous presence of other antimalarials in the blood to which the parasite is not resistant. (who.int)
  • While containment efforts to stop the spread of resistant parasites were underway, it was discovered that artemisinin resistance had emerged independently in multiple areas and that resistance to ACT partner drugs had also emerged, threatening the progress achieved in the region to date. (who.int)
  • Microbial Drug Resistance (MDR) is an international, peer-reviewed journal that covers the global spread and threat of multi-drug resistant clones of major pathogens that are widely documented in hospitals and the scientific community. (liebertpub.com)
  • As 'Treat All' is rolled-out worldwide, the emergence of drug-resistant HIV has the potential to become a major public health threat, as it limits treatment options for people living with HIV. (avert.org)
  • Many patients have drug-resistant cancers. (medicalnewstoday.com)
  • In addition, some people might be resistant to one drug and sensitive to others, while others may have multi-drug resistance. (medicalnewstoday.com)
  • With the high rate of use of antimicrobial drugs throughout the world, the emergence and spread of drug-resistant pathogens is a major threat to long-term infection control. (bcm.edu)
  • TUESDAY, July 16 (HealthDay News) -- Some strains of the new H7N9 bird flu virus that appeared in China this year are resistant to antiviral drugs , and tests can fail to identify that resistance, which could help accelerate their spread, a new study finds. (medicinenet.com)
  • Researchers analyzed viruses taken from the first person known to have H7N9 infection and found that 35 percent of them were resistant to Tamiflu ( oseltamivir ) and Relenza ( zanamivir ), which are antiviral drugs used to treat H7N9 infections. (medicinenet.com)
  • However, lab testing of the viruses failed to detect the strains that were resistant, so using lab tests to monitor the development of resistance in H7N9 would be useless, according to the authors of the study, published July 16 in the online journal mBio . (medicinenet.com)
  • Human immunodeficiency virus (HIV) genotypic antiretroviral drug resistance testing evaluates the likelihood that the HIV strain infecting an individual is resistant or has developed resistance to one or more antiretroviral therapy (ART) drugs. (labtestsonline.org)
  • Someone may be initially infected with a drug-resistant HIV strain or drug resistance may develop during treatment. (labtestsonline.org)
  • This change leads to a mixed population in the infected person's body - some microorganisms that are drug-resistant and some that are drug-sensitive. (labtestsonline.org)
  • This is called "selective pressure" because the drug "selects" and allows the proliferation of the genetic forms of the microorganism that are resistant to it. (labtestsonline.org)
  • These organisms will then reproduce with this genetic mutation and so be resistant to the drug. (www.nhs.uk)
  • Previously, the virus might become resistant to the drugs after a prolonged period of time, but now these mutated viruses that are resistant have been spread as a primary infection. (www.nhs.uk)
  • What used to be considered minor infections can become life threatening if they are resistant to the available antimicrobial drugs. (www.nhs.uk)
  • The study team also found that people starting therapy who self-report previous use of antiretroviral drugs are more likely to carry resistant virus, and are at greater risk of virological failure - that is, the risk the virus won't be adequately kept under control by the HIV treatment. (eurekalert.org)
  • When these individuals restart treatment at a later date, they are less likely to respond to therapy and may pass on the drug-resistant strains to other people," explained Professor Gupta. (eurekalert.org)
  • If no action is taken, drug resistance to NNRTIs exceeding 10% in people starting therapy could result in 890,000 more AIDS deaths and 450,000 more infections in Sub-Saharan Africa alone before 2030, as most people whose antiretroviral therapy is unsuccessful have a drug-resistant virus, according to prior research. (eurekalert.org)
  • The report's findings concurred with this broader meta-analysis' results and showed that in 6 of the 11 countries surveyed over 10% of people starting HIV treatment had drug resistant strains. (eurekalert.org)
  • Population mobility is a main factor in globalization of marked health disparity, and these linkages can be associ- public health threats and risks, specifi cally distribution of an- ated with risk for importation of drug-resistant infectious timicrobial drug-resistant organisms. (cdc.gov)
  • Human mobility is causing an increase in antimicrobial for management and control of disease in clinical and public drug-resistant organisms and drug-resistant infectious health contexts. (cdc.gov)
  • For their study, the research team created model cell lines that were resistant to ABT-199 and compared these cells to the parental cell lines that maintained drug sensitivity. (genengnews.com)
  • The good news: A type of blood pressure medication shows promise at overcoming some drug-resistant tuberculosis, at least in the laboratory. (newswise.com)
  • If first-line drugs won't work to kill TB, the person is said to have multidrug-resistant TB and doctors proceed to second-line treatments, which are usually more expensive and more toxic and take longer to work, Dr. Gumbo said. (newswise.com)
  • In Dr. Gumbo's second study, available online and in the April edition of Antimicrobial Agents and Chemotherapy , the researchers found that more people might harbor drug-resistant TB than currently believed because tests that detect the TB bacteria's resistance don't account for variations in height, weight and other factors among TB patients. (newswise.com)
  • Guidelines for testing whether a person is infected with a drug-resistant TB strain were developed more than 40 years ago. (newswise.com)
  • The TB is said to be resistant to the drug if more than 1 percent of TB still grows at that concentration. (newswise.com)
  • Dr. Gumbo's research team found that the concentrations typically used in practice are too low, leading people to think they have treatable TB, when in fact their disease might be resistant to common drugs. (newswise.com)
  • The data showed there was more than a 300 percent increase of proportion of Acinetobacter cases resistant to the drug. (digitaljournal.com)
  • In a recent press release, Stop TB reports that 15 of the 27 countries with the highest burden of multi-drug resistant tuberculosis are located in Eastern Europe. (healthmap.org)
  • On September 15 2011, WHO released an action plan to stifle the spread of drug resistant tuberculosis in the WHO defined European Region. (healthmap.org)
  • This region contains approximately 18% of the world's multi-drug resistant tuberculosis (MDR-TB) patients. (healthmap.org)
  • Hans Kluge, the regional director's special representative on multi and extensively drug resistant TB (XDR-TB) at WHO Europe says , the problem is "a man-made phenomenon resulting from inadequate treatment. (healthmap.org)
  • Research shows that DOT increases adherence to treatment, helps prevent the transmission of TB and decreases the development of drug resistant TB. (healthmap.org)
  • Multi-drug resistant tuberculosis is defined as tuberculosis that is resistant to two of the first line drugs, isoniazid and rifampicin. (healthmap.org)
  • By assessing the differential expression of kinase proteins in drug-resistant and parental breast cancer cells, we discover that elevated expression of hexokinase 2 (HK2) and the ensuing inhibition of mTOR contribute to tamoxifen resistance, suggesting HK2 as a potential target for overcoming tamoxifen resistance. (mcponline.org)
  • Currently, artemisinin treatments are the most effective way of fighting multi-drug resistant strains of malaria available. (medindia.net)
  • Twice in the past, South East Asia has made a gift, unwittingly, of drug resistant parasites to the rest of the world, in particular to Africa," the Telegraph quoted the BBC as saying. (medindia.net)
  • A villager pricks the finger of a feverish baby living on the front line of the war on drug-resistant malaria near the jungle-blanketed Thai-Myanmar border. (medindia.net)
  • At a meeting in Sydney last week, leading scientists and health experts flagged the need for tougher political leadership and regional coordination in Asia to combat malaria, with the drug-resistant strain a particular worry. (medindia.net)
  • They took medicine without a doctor's prescription so the malaria became resistant to the drugs. (medindia.net)
  • Drug-resistant cases are estimated to account for about 15 percent of the total in certain areas, according to Saw Lwin, deputy director general of Myanmar's health ministry. (medindia.net)
  • Drug-resistant tuberculosis persists as a major public health concern. (asm.org)
  • However, bacteria are adept at becoming resistant to antibacterial drugs, as highlighted by the recent identification of a patient in Pennsylvania infected with E. coli bacteria possessing the mcr-1 gene. (fda.gov)
  • We are seeing patients given the all clear who then come back for more treatment and find that they are drug resistant. (bmj.com)
  • Recent reports of extensively drug-resistant gonorrhoea strains , make it vital to understand if changes in resistance prevalence are the consequence of modifications in treatment, sexual behaviour in different sexual networks, the gonococcal strain distribution or due to other reasons. (eurekalert.org)
  • The plan outlines options to minimise the threat of drug-resistant gonorrhoea in Europe. (eurekalert.org)
  • This part also considers the alternative clinical approaches against drug failure, including non-crosss-resistant therapies, autologous bone marrow transplantation, dose-intensive therapy, and high-dose chemotherapy. (elsevier.com)
  • CHICAGO-Warmer temperatures are at least partly to blame for a surge in malaria in East Africa and the increase in drug-resistant strains of the disease, according to a University of Michigan researcher. (scientificamerican.com)
  • Instead, they say, adaptations in the parasite that make it resistant to antimalarial drugs are the key drivers. (scientificamerican.com)
  • Researchers at Harvard have come up with a novel way of studying how bacteria evolve to become drug resistant. (kottke.org)
  • Molecular models of the lung cancer drug osimertinib bound to its protein target, EGFR (left) and to drug-resistant EGFR (L718Q mutant EGFR), right. (bris.ac.uk)
  • In the drug resistant mutant, the structure of the protein changes, preventing the drug from reacting with it. (bris.ac.uk)
  • In this drug resistant mutant, a single amino acid is changed. (bris.ac.uk)
  • Unlike other drug resistant mutants, it was not at all clear how this change stops the drug from binding effectively, information potentially crucial in developing new drugs to overcome resistance. (bris.ac.uk)
  • The resistance also varies by strain, with a quarter of H1N1 flu viruses resistant in Europe and about 11 percent of H1N1 in the United States, but far fewer cases of H3N2 and influenza B viruses. (reuters.com)
  • Aid groups, the CGD report claims, failed to take into account the "invisible adversary" facing medical professionals today-the drug resistant bug. (worldpolicy.org)
  • However, parasites taken from mosquitoes themselves had very low prevalence of pyrimethamine-resistance and a high prevalence of cycloguanil-resistant mutants indicating resistance to a newer class of antimalaria drug not widely used in Zambia. (redorbit.com)
  • Surveillance for drug-resistant parasites in human blood is a major effort in malaria control. (redorbit.com)
  • The contrast raises many questions, but we suspect that the malaria parasite can bear highly host-specific drug-resistant polymorphisms, most likely reflecting very different selection preferences between humans and mosquitos. (redorbit.com)
  • Our study indicates that mosquitoes exert an independent selection on drug resistant parasites-a finding that has not previously been noticed. (redorbit.com)
  • SCANRESIST aims to prove SCO-101 to be a viable, safe, effective drug in anti-cancer drug resistant patients. (europa.eu)
  • They then ran computer simulations to see what would happen when the protein from the 'resistant' strain came in contact with drugs used to treat pneumonia. (scidev.net)
  • If further experiments confirm the results from these computer models, say the researchers, they could help design new drugs that can target resistant strains of bacteria. (scidev.net)
  • Cancers have the ability to develop resistance to traditional therapies, and the increasing prevalence of these drug resistant cancers necessitates further research and treatment development. (mdpi.com)
  • Lastly, this review concludes with a discussion on the best treatment options for existing drug resistant cancers, ways to prevent the formation of drug resistant cancers and cancer progenitor cells, and future directions of study. (mdpi.com)
  • Although the study group was small, the findings appear to indicate that there is a growing dissemination of drug-resistant strains of Aspergillus fungi. (webwire.com)
  • The four main mechanisms by which microorganisms exhibit resistance to antimicrobials are: Drug inactivation or modification: e.g., enzymatic deactivation of Penicillin G in some penicillin-resistant bacteria through the production of β-lactamases. (wikipedia.org)
  • Antimicrobial resistance is a global public health threat with resistant microorganisms reaching alarming levels in all six WHO Regions. (who.int)
  • Resistance occurs when microorganisms become resistant to antimicrobial medicines and the antimicrobials no longer work in treating the infection. (who.int)
  • A virtual panel of Candida albicans strains resistant to one or more antifungal drugs such as anidulafungin, micafungin, caspofungin, 5-flucytosine, voriconazole, itraconazole, and fluconazole, including two sensitive strains (Type and genome sequenced) as negative controls. (atcc.org)
  • Around 84,000 cases of Multi Drug Resistant (MDR)- TB were notified to WHO in 2012. (thefreelibrary.com)
  • Drug-resistant infections pose a major threat to global health and could in future mean that serious and life-threatening infections become impossible to treat. (ox.ac.uk)
  • Some of these changes make them resistant to certain drugs, meaning they are more likely to survive and pass on their resistant traits to other bacteria. (ox.ac.uk)
  • For TB, where the genetic basis for drug resistance is less well understood, Mykrobe Predictor still matched the performance of current DNA tests (which look at snippets of DNA, but not the whole sequence), detecting 82.6% of resistant infections around 5-16 weeks faster than traditional drug susceptibility testing. (ox.ac.uk)
  • A further advantage of Mykrobe is that it can identify infections where a patient's body contains a mixture of both drug-resistant and drug-susceptible bacteria. (ox.ac.uk)
  • This is important for diagnosing infections such as 'extensively drug-resistant TB' (XDR-TB), which is resistant to at least four of the core TB drugs and is considered a global threat to public health by the World Health Organisation. (ox.ac.uk)
  • WASHINGTON - Scientists are studying an ancient pathogen for clues as to how to fight a drug-resistant "superbug" in hospitals and other healthcare settings. (voanews.com)
  • Unhindered, the drug-resistant bacteria can find their way into the bloodstream or organs through wounds or the use of catheters. (voanews.com)
  • NIAID has a substantial research program to spur development of new therapeutics against drug-resistant viruses, bacteria, parasites, and fungi and to identify alternative approaches. (nih.gov)
  • NIAID supports basic, translational and clinical research on ways to prevent serious drug-resistant infections, including vaccines, monoclonal antibody therapies, and compounds that modulate innate immunity. (nih.gov)
  • Theoretically, this new approach to sequencing means that drug-resistant viruses present in less than 1% of the viruses circulating within a HIV-infected individual can be identified. (amazon.com)
  • This insight will assist in the fight against multi-drug resistant microbes, as well as contribute to theories aimed at predicting cancer evolution. (genetics.org)
  • The data showed the proportion of drug-resistant cases among heterosexuals rising above the recognized threshold of 5 percent for changing treatment recommendations. (webwire.com)
  • But drug resistant cases have increased steadily in recent years, rising first in the western United States and then among MSM nationwide. (webwire.com)
  • It makes bacteria resistant to nearly all drugs, and the ECDC reported 106 cases in 13 European countries by the end of March 2011. (dailytech.com)
  • other types include MDR viruses, parasites (resistant to multiple antifungal, antiviral, and antiparasitic drugs of a wide chemical variety). (wikipedia.org)
  • Recognizing different degrees of MDR in bacteria, the terms extensively drug-resistant (XDR) and pandrug-resistant (PDR) have been introduced. (wikipedia.org)
  • Extensively drug-resistant (XDR) is the non-susceptibility of one bacteria species to all antimicrobial agents except in two or less antimicrobial categories. (wikipedia.org)
  • Yeasts such as Candida species can become resistant under long term treatment with azole preparations, requiring treatment with a different drug class. (wikipedia.org)
  • Herpes simplex virus rarely becomes resistant to acyclovir preparations, mostly in the form of cross-resistance to famciclovir and valacyclovir, usually in immunosuppressed patients. (wikipedia.org)
  • Although surveillance for drug resistant influenza A strains has been carried out since 1991, more than a decade has passed since the last comprehensive global survey of influenza A resistance to adamantanes was published. (medpagetoday.com)
  • The similarity of E. coli strains and predominant drug resistance genes in meat and humans provides circumstantial evidence for an animal reservoir for a substantial part of ESBL genes found in humans. (wired.com)
  • Drug resistance has spread rapidly among strains of Streptococcus pneumoniae, a common cause of pneumonia and meningitis. (bmj.com)
  • Acinetobacter strains carry the genetic blueprints for drug resistance on small loops of DNA called plasmids that come in two sizes. (news-medical.net)
  • Europe is the worst-affected by strains of influenza that resist the effects of antiviral drugs, but the resistance is growing globally, they told a meeting of the Infectious Diseases Society of America. (reuters.com)
  • The simulation showed that in normal strains, the drug bound tightly to the protein. (scidev.net)
  • This, coupled with the incidence of increasing fluoroquinolone resistance in these strains increases the risk of therapeutic failure in cases of life-threatening salmonellosis. (ingentaconnect.com)
  • ATLANTA, Sept. 21-About 12% of influenza A strains worldwide have developed resistance to the most commonly used antiflu drugs, including avian flu strains found in poultry and people in Asia. (medpagetoday.com)
  • Our report has broad implications for agencies and governments planning to stockpile these drugs for epidemic and pandemic strains of influenza," said Dr. Bright and colleagues at the CDC and the Wisconsin State Laboratory of Hygiene in Madison. (medpagetoday.com)
  • In susceptible influenza strains, adamantane drugs such as amantadine and rimantadine are about 80% to 90% effective at preventing infection, and can reduce the duration of the flu by about one to five days, if they are given within 48 hours of infection. (medpagetoday.com)
  • In the intervening years, however, there have been reports of growing adamantane resistance, including H5N1 avian strains isolated from both humans and birds in southeast Asia, the authors noted. (medpagetoday.com)
  • They found that resistance to amantadine and rimantadine increased from 0.4% in 1994-1995 to 12.3% in 2003-2004 for H3N2 strains. (medpagetoday.com)
  • Global prevalence of HIV drug resistance (HIVDR) is rising, mainly due to resistance to non-nucleoside reverse transcriptase inhibitor (NNRTI) drugs - which make up the backbone of World Health Organization (WHO) first-line antiretroviral treatment regimes. (avert.org)
  • Explore this page to find out more about what drug resistance is , how it affects treatment options , drug resistance as a public health threat , the prevalence of HIVDR , responding to HIVDR , and what the future holds . (avert.org)
  • The prevalence of TDR varies among regions, risk groups, and drug classes due to different exposure to antiretroviral therapy (ART), risk behavior, and access to therapy. (springer.com)
  • Also in RLS the rise in prevalence of TDR is mostly driven by NNRTI resistance, which is of particular concern as this drug class constitutes the foundation of current first-line ART regimens and prophylaxis for prevention of mother-to-child transmission. (springer.com)
  • High prevalence of drug resistance was observed among MSM. (medscape.com)
  • Furthermore, better data (instead of case reports) are required on both the true prevalence of trypanocide resistance and its impact on the productivity of livestock. (fao.org)
  • Currently it is not known whether the increase of the number of resistance reports is owing to a higher prevalence of resistance or simply to a growing interest in drug resistance by scientists. (fao.org)
  • Public health is best served if changes are made preemptively, before an emerging resistance phenotype reaches 5% prevalence and becomes well established in sexual networks," they argued. (medpagetoday.com)
  • Despite the widespread prevalence of tumor resistance, which in many cases may be due to drug resistance, many oncologists have noted occasional dramatic responses in patients, whom they referred to informally as "exceptional responders" ( 2 ). (pnas.org)
  • Parasites found in human blood samples showed a high prevalence for pyrimethamine-resistance, which was consistent with the class of drugs widely used to treat malaria in the region. (redorbit.com)
  • It is also important that expectations of survey data generated remain realistic recognizing that drug resistance surveys can determine prevalence of resistance within certain margins of error. (who.int)
  • In addition to being scalable and more cost effective, the current approach provides greater sensitivity to detect resistance at low prevalence. (amazon.com)
  • Drug resistance has been implicated in the regularly, as well as in areas where transmission has spread of malaria to new areas and re-emergence of been largely controlled or eliminated. (cdc.gov)
  • The economics of developing or available antimalarial drugs, the distribution and new pharmaceuticals for tropical diseases, includ- efficiency of mosquito vectors, climate and other ing malaria, are such that there is a great disparity environmental conditions and the behaviour and between the public health importance of the level of acquired immunity of the exposed human disease and the amount of resources invested in populations. (cdc.gov)
  • Resistance to antimalarial medicines is a threat to global efforts to control and eliminate malaria. (who.int)
  • Further extending basic malaria interventions, including vector control, will reduce the number of parasites exposed to a drug and the risk of resistance. (who.int)
  • Countries where resistance to artemisinins or to ACT partner drugs is reported need to intensify malaria control in order to reduce the burden of the disease, and delay or prevent the spread of resistance. (who.int)
  • In areas of low transmission where antimalarial drug resistance is present, countries should target rapid elimination of falciparum malaria to limit the risk of spread and minimize the impact of resistance in the region. (who.int)
  • Resistance has emerged to all classes of antimalarial drugs except the artemisinins and is responsible for a recent increase in malaria-related mortality, particularly in Africa. (jci.org)
  • Widespread use of these drugs could roll back malaria. (jci.org)
  • A few countries have reported resistance to the first-line malaria drug called artemisinin and there are concerns that this may spread. (www.nhs.uk)
  • Artemisinin is a drug used in combination therapies against malaria. (healthmap.org)
  • Studies from 2008 and 2009 document the reduced susceptibility to the anti-malarial drug in Plasmodium falciparum , the most lethal among the malaria-causing parasites. (healthmap.org)
  • Earlier this year, the WHO launched the " Global plan for artemisinin resistance containment ", or GPARC, to protect what Dr. Margaret Chan, Director-General of the WHO, calls "our most potent weapon" against malaria. (healthmap.org)
  • Prevention methods include using insecticide spray inside houses, sleeping under insecticide treated mosquito nets, and the use of certain drugs (mainly by travelers) that interrupt malaria in the blood stream. (healthmap.org)
  • Computer models that allow the prediction of the efficacy of certain measures to delay resistance are also very useful tools as shown by Cross and Singer (1991), Hastings (1997) or Barnes, Dobson and Barger (1995) in the field of malaria and anthelmintic resistance respectively. (fao.org)
  • Malaria could be developing resistance to the most effective type of drug, according to the initial results of studies of patients in western Cambodia. (medindia.net)
  • Scientists believe that the availability of fake malaria treatments in Cambodia, often containing small amounts of the real drug, is thought to be helping nurture resistance. (medindia.net)
  • If the resistance spreads there will be a surge in cases," warned Fatoumata Nafo-Traore, director of the Roll Back Malaria Partnership, which coordinates the global fight against the disease. (medindia.net)
  • Billions of dollars of investment and a decade of progress "will probably be hijacked" if the resistance spreads to malaria-ridden Africa, said World Health Organisation regional expert Charles Delacollette. (medindia.net)
  • When previous generations of medicines lost their efficacy, infections spiked and resistance rippled out from the region through Myanmar and eventually to Africa, which sees 90 percent of worldwide malaria deaths. (medindia.net)
  • In Africa and India, close to 45 percent of available malaria drugs fail to meet quality standards. (worldpolicy.org)
  • In response to this shortcoming, the Global Fund created Affordable Medicines Facility - malaria (AMFm), which offers subsidies on quality malaria drugs. (worldpolicy.org)
  • A study conducted by researchers at the Johns Hopkins Malaria Research Institute and their Zambian colleagues detected contrasting patterns of drug resistance in malaria-causing parasites taken from both humans and mosquitoes in rural Zambia. (redorbit.com)
  • Over time, through repeated exposure to medications, the parasites can become less susceptible to drugs used to treat malaria infection, limiting their effectiveness. (redorbit.com)
  • This contrast in resistance factors was a big surprise to us," said Peter Agre, MD, an author of the study and director of the Johns Hopkins Malaria Institute. (redorbit.com)
  • If confirmed in other malaria endemic regions, it suggests an explanation for why drug resistance may appear so rapidly," said Mharakurwa. (redorbit.com)
  • KAMPALA, Jul 15 2011 (IPS) - In pharmacies in the heart of Kampala men and women line up to buy drugs that you usually need a prescription for, like Coartem, a drug used to treat malaria. (ipsnews.net)
  • Edna Nakyanzi had malaria symptoms, so she bought the antimalarial drug, Fansidar, without a prescription. (ipsnews.net)
  • When people self-medicate, they fail to take the adequate doses they need to cure malaria, which causes some to develop resistance against the drugs and hence (results in) their eventual death," said Langi. (ipsnews.net)
  • A report by the ministry of health says that in some districts resistance to malaria treatment is more than 60 percent. (ipsnews.net)
  • However, the national average of resistance to malaria treatment stands at 11.7 percent. (ipsnews.net)
  • AHMEDABAD] Scientists have identified the genetic mutation allowing the parasite that causes fatal cerebral malaria in India to resist a widely used drug. (scidev.net)
  • Malaria parasites with the mutation are not affected by chloroquine, a drug commonly used to treat the disease. (scidev.net)
  • He told delegates at last week's meeting there is increasing criticism of some of the drugs recommended for malaria treatment. (scidev.net)
  • The main problem, said White, was that scientists were wrongly assessing the effectiveness of a potential malaria drug in people after just 14 days instead of waiting for 28 days before testing it. (scidev.net)
  • The World Health Organization now recommends artemisinin - derived from the shrub Chinese wormwood - used in combination with other drugs as a malaria treatment. (scidev.net)
  • Malaria parasites in Cambodia are showing resistance to the front line drug Piperaquine making current treatment useless and putting lives at risk. (thenakedscientists.com)
  • The prime example for MDR against antiparasitic drugs is malaria. (wikipedia.org)
  • The first evolutionary force they considered is how often drug resistance arises in the microbes through genetic mutation. (psu.edu)
  • Resistance can develop when antimicrobials are used to treat an infection and a mutation or change occurs in one of the microorganism's genes. (labtestsonline.org)
  • HIV mutates frequently - even in the absence of drug treatment - but not every mutation causes resistance to antiretroviral drugs. (labtestsonline.org)
  • Resistance to antimicrobial drugs can either occur based on a characteristic of the microbe itself, mutation in the microbe or gene transfer. (healthmap.org)
  • Acquired resistance can occur by genetic mutation during treatment or by selection of preexisting genetic variants in the population. (pnas.org)
  • For instance in France, 54 percent of those tested in Paris carried the mutation that would give resistance to Tamiflu, compared to 29 percent in southeastern France. (reuters.com)
  • Mutation in drug target is a critical mechanism that results in drug resistance. (frontiersin.org)
  • There are several scenarios under which a mutation could lead to drug resistance. (frontiersin.org)
  • In another scenario, a mutation could cause disruption or aberrant interaction of a specific protein-protein interaction, resulting in drug resistance. (frontiersin.org)
  • Next, mutation-related resistance is demonstrated in a series of in vitro and in vivo models. (frontiersin.org)
  • Resistance of Streptomyces pneumoniae to drugs is caused by a genetic mutation in one of the bacterium's proteins. (scidev.net)
  • But the mutation is situated far from the region where drugs usually interact with the protein, giving scientists no clues as to how the bacterium evades the drug. (scidev.net)
  • The team found that the mutation created a tiny difference in the protein's shape, and that this was key to the bacterium's ability to resist drugs. (scidev.net)
  • The traditional way identifies a drug resistance mutation only if it is present in greater than 20% of the virus in the individual. (amazon.com)
  • Drug susceptibility results (PhenoSense assay) defined as fold-decreased susceptibility compared to wildtype of viruses containing a mutation at the user-selected position. (stanford.edu)
  • The Central Asia outbreak (CAO) clade is a branch of the Mycobacterium tuberculosis Beijing genotype that is associated with multidrug resistance, increased transmissibility, and epidemic spread in parts of the former Soviet Union. (asm.org)
  • The first two parts discuss the genetic aspects of multidrug resistance and the proteins involved in drug resistance. (elsevier.com)
  • G. W. Kaatz and S. M. Seo, "Inducible NorA-mediated multidrug resistance in Staphylococcus aureus ," Antimicrobial Agents and Chemotherapy , vol. 39, no. 12, pp. 2650-2655, 1995. (hindawi.com)
  • Multiple drug resistance (MDR), multidrug resistance or multiresistance is antimicrobial resistance shown by a species of microorganism to at least one antimicrobial drug in three or more antimicrobial categories. (wikipedia.org)
  • Drug resistance threatens the effective treatment of a growing list of communicable diseases - from bacterial infections to viral to and fungal diseases. (gulf-times.com)
  • When they exposed the bacteria to drugs commonly used to treat the disease - ethambutol and isoniazid - the bacterial cells activated a cellular mechanism that pumps each drug out of the cells. (newswise.com)
  • The researchers found that plasmids disable bacteria's self-defense systems so that plasmids can inject copies of themselves into neighboring bacteria, conferring drug resistance on the unwitting bacterial neighbors. (news-medical.net)
  • In this study, the ability to distinguish between these bacterial 'sub-populations' gave Mykrobe an advantage over conventional testing in detecting resistance to second-line TB drugs. (ox.ac.uk)
  • Bacterial drug resistance represents one of the most crucial problems in present day antibacterial chemotherapy. (ingentaconnect.com)
  • Multi-drug resistance to tuberculosis (TB) is not being adequately reported, which makes it harder to come up with a global strategy to address it. (www.nhs.uk)
  • The overall goal of monitoring drug resistance in tuberculosis is to evaluate TB programme performance and provide information which can be used to guide public health action to reduce morbidity and mortality and to improve public health. (who.int)
  • Based on the possibilities of the cloud, the team is looking to move into other microbial resistance disease lines, such as Staphylococcus aureus , tuberculosis, and Hepatitis C. Exatype is a disease-agnostic application, and the set of references and rules applied to various diseases can be altered without having to tailor computing requirements. (amazon.com)
  • The increasing evidence of decreased susceptibility to cefixime, along with treatment failures after therapy with that drug and a lack of new agents or good alternatives, "raise the very real possibility that gonorrhea could become untreatable," she said. (medpagetoday.com)
  • Data from the country's Gonococcal Resistance to Antimicrobials Surveillance Programme (GRASP) showed that the rate of decreased susceptibility to cefixime in tested isolates rose from 1.5% in 2007 to a peak of 17.1% in 2010, before dropping to 10.8% in 2011, the researchers reported. (medpagetoday.com)
  • Alongside efficacious treatments, validated and standardized drug susceptibility testing (DST) is required to improve patient care. (asm.org)
  • Decreased susceptibility of HBV to antiretroviral drugs (phenotypic drug resistance) is usually associated with sequences changes in the viral genome (genotypic drug resistance). (imperial.ac.uk)
  • Drug susceptibility results defined as fold-decreased susceptibility. (stanford.edu)
  • A rapid process of sharing resistance exists among single-celled organisms, and is termed horizontal gene transfer in which there is a direct exchange of genes, particularly in the biofilm state. (wikipedia.org)
  • Highlights include new insights into resistance to antiangiogenic therapies, oncogenes and tumor suppressor genes in therapeutic resistance, cancer stem cells, and the development of more effective therapies. (springer.com)
  • This variation in the copy numbers of chromosomes and genes provides a new dimension to monitoring the evolution of drug resistance in these parasites. (medicalnewstoday.com)
  • There's a new paper out in the CDC's journal Emerging Infectious Diseases that makes a provocative claim: There is enough similarity between drug-resistance genes in E. coli carried by chickens and E. coli infecting humans that the chickens may be the source of it. (wired.com)
  • In each set of samples, they were looking at the E. coli to see whether they harbored genes for the type of resistance known as ESBL, for 'extended-spectrum beta-lactamase,' an enzyme that denatures a category of drugs used for serious infections that occur mostly in hospitals. (wired.com)
  • Here, we report a mechanism by which cell density activates the Hippo pathway, which in turn inactivates YAP, leading to changes in the regulation of genes that control the intracellular concentrations of gemcitabine and several other US Food and Drug Administration (FDA)-approved oncology drugs. (pnas.org)
  • To address this growing problem, NIAID is funding and conducting research to better understand how microbes develop and pass on resistance genes. (nih.gov)
  • These resistance genes are assembled in a mosaic pattern, indicative of several independent recombinational events. (ingentaconnect.com)
  • Current Drug Targets aims to cover the latest and most outstanding developments on the medicinal chemistry and pharmacology of molecular drug targets e.g. disease specific proteins, receptors, enzymes, genes. (ingentaconnect.com)
  • Antimicrobial resistance and antineoplastic resistance challenge clinical care and drive research. (wikipedia.org)
  • Drug resistance has also played a significant and clinical manifestation in different parts of the role in the occurrence and severity of epidemics in world. (cdc.gov)
  • To be sure, there are solutions to the drug resistance crisis: restricted consumption, better diagnostics and disease surveillance, and expanded clinical development of new drugs are three. (gulf-times.com)
  • November 18, 2015 Doctor, Meet Resistance The origins of Resistance Open finds its roots in clinical care. (healthmap.org)
  • It covers both basic research and clinical aspects of drug resistance. (elsevier.com)
  • It covers both basic research and clinical aspects of drug resistance, and involves disciplines as diverse as molecular biology, biochemistry, cell biology, pharmacology, microbiology, preclinical therapeutics, oncology and clinical medicine. (elsevier.com)
  • A major objective of this book is to reveal unprecedented opportunities to understand and overcome drug resistance through the clinical assessment of rational therapeutic drug combinations and the use of predictive and prognostic biomarkers to enable patient stratification and tailor treatments. (springer.com)
  • A promising strategy for encouraging antibacterial drug development is the establishment of a clinical trial network that can operationalize common clinical trial protocols at a level of quality that matches the pharmaceutical industry and that can respond to future needs in an agile fashion. (fda.gov)
  • This book is divided into four parts encompassing 18 chapters that summarize the results of both preclinical and clinical research on circumvention of drug resistance. (elsevier.com)
  • The third part describes the methods for detection of P-glycoprotein and its antagonists to counter clinical drug resistance. (elsevier.com)
  • Now, a collaboration between medicinal and computational chemists and clinical oncologists has revealed exactly how subtle changes in the protein target cause drug resistance. (bris.ac.uk)
  • His collaborators, Professor Alessio Lodola and Professor Marco Mor of the Drug Design and Discovery group at the University of Parma, added: "It was an exciting experience to work closely with clinical colleagues who identified the mutant, and to help analyse its effects. (bris.ac.uk)
  • Diverse drugs targeting malignant and nonmalignant cells receive clinical approval each year from the FDA. (jci.org)
  • The drug had already passed four separate Phase I clinical trials , which were run in healthy volunteers. (europa.eu)
  • Our goal is to provide clinical proof of concept for our drugs and then to partner with a larger pharma company in order to bring our drugs to cancer patients," concludes Brünner. (europa.eu)
  • The findings represent the first time the genetic mechanisms of clinical acquired resistance to FGFR inhibition have been identified in patients. (massgeneral.org)
  • A study recently published in the journal, Clinical Infectious Diseases, discovered azole-resistance markers in 75% of a small group of aspergillosis patients who had not previously been treated with an azole. (webwire.com)
  • In findings published in May 2019 in the journal Clinical Cancer Research, Prof. Yarden, Dr. Romaniello, and their colleagues announced that they had identified a strategy for overcoming a tricky problem: the fact that many lung cancer patients, initially treated successfully, develop drug resistance and suffer from tumor regrowth. (weizmann.ac.il)
  • In short, the lack of concerted effort by governments and the pharmaceutical industry, together with the innate capacity of microbes to develop resistance at a rate that outpaces development of new drugs, suggests that existing strategies for developing viable, long-term anti-microbial therapies are ultimately doomed to failure. (wikipedia.org)
  • Our findings show the importance of improving how we monitor drug resistance, and suggest we should review which drugs are included in first-line therapies," said the study's lead author, Professor Ravindra Gupta (UCL Infection & Immunity). (eurekalert.org)
  • We propose an approach to fectively managed with the use of vaccines, antimicrobial global public health risk management that integrates popu- drugs, or newer therapies, challenges to the control of infec- lation factors with effective and timely application of policies and processes. (cdc.gov)
  • With more targeted therapies being approved each year for cancer, the development of drug resistance to these agents is a growing concern. (genengnews.com)
  • These findings suggest that "switching off" of the Hippo-YAP pathway could help to prevent or reverse resistance to some cancer therapies. (pnas.org)
  • Can understanding the genetic mechanisms driving resistance to the FGFR inhibitor BGJ398 lead to better therapies for bile duct and other cancers? (massgeneral.org)
  • Listen to Dr. Lipika Goyal discuss her research of the genetic mechanisms that drive resistance and that may lead to better therapies for bile duct and other cancers. (massgeneral.org)
  • It also describes the epigenetic modifications that can induce drug resistance and considers how such epigenetic factors may contribute to the development of cancer progenitor cells, which are not killed by conventional cancer therapies. (mdpi.com)
  • The researchers also examined tumor samples from patients with colorectal cancer who received cetuximab therapy and developed resistance to it. (vanderbilt.edu)
  • Researchers at Indiana University , commissioned by Indiana school officials in 1992, found that those who completed the D.A.R.E. program subsequently had significantly higher rates of hallucinogenic drug use than those not exposed to the program. (wikipedia.org)
  • More than 40 percent of the students told researchers they were 'not at all' influenced by drug educators or programs. (wikipedia.org)
  • For all of these reasons, ethicists, healthcare researchers, and social scientists have begun to examine how best to ensure that strategies for tackling drug resistance are ethically responsible. (gulf-times.com)
  • HIV drug resistance is approaching and exceeding 10% in people living with HIV who are about to initiate or reinitiate first-line antiretroviral therapy, according to the largest meta-analysis to date on HIV drug resistance, led by researchers at UCL and the World Health Organization (WHO) and funded by the Bill & Melinda Gates Foundation and the WHO. (eurekalert.org)
  • A collaborative study from researchers at the Moffitt Cancer Center and Dana-Farber Cancer Institute has uncovered a mechanism of drug resistance to Venetoclax ® , also known as ABT-199, a BCL-2 targeting drug commonly used to treat chronic lymphocytic leukemia and acute myeloid leukemia. (genengnews.com)
  • The researchers discovered that during ABT-199 treatment, rare subpopulations of cells lose this genetic amplification and can survive from drug treatment. (genengnews.com)
  • The researchers conducted a chemical screening of a set of small molecule inhibitors further confirmed this hypothesis by showing that combination treatment with ABT-199 and the CDK7-targeting inhibitor THZ1 prevented the emergence and maintenance of ABT-199 resistance in models of MCL and DHL. (genengnews.com)
  • Resistance was drastically reduced, however, when the researchers gave the blood-pressure drug reserpine - which is known to block this pumping action - to the TB cells before administering ethambutol and isoniazid. (newswise.com)
  • These findings provide a novel opening to interrupt the spread of drug resistance, the researchers said. (news-medical.net)
  • A change in prescribing recommendations for gonorrhea in England and Wales -- prompted by rising drug resistance -- appears to have been rewarded with success, researchers reported. (medpagetoday.com)
  • However, the new studies have shown that they are taking longer to do so than before, which, researchers say, is an early warning sign that the parasite is developing resistance. (medindia.net)
  • The researchers studied and recorded the results from every possible drug combination used to kill the bacteria, and how effective they were. (digitaljournal.com)
  • Newser) - HIV is developing a growing resistance to drugs in sub-Saharan Africa, and that has researchers worried, the BBC reports. (newser.com)
  • But a group of researchers at McMaster University claim they've discovered a new fighter against drug resistance in a surprising source. (cbc.ca)
  • This knowledge could help researchers design new drugs for the disease that kills 3.5 million people a year, mostly in developing countries. (scidev.net)
  • In Cancer Drug Resistance, leading scientists from the best academic institutions and industrial laboratories summarize and synthesize the latest discoveries concerning the changes that occur in tumor cells as they develop resistance to a wide variety of anticancer therapeutics, as well as suggest new approaches to the biology of drug resistance that may afford new therapeutic opportunities. (springer.com)
  • Scientists have discovered that a solution might lie in a new drug that tackles cancer cells differently. (medicalnewstoday.com)
  • Scientists create video of bacteria evolving drug resistance. (slate.com)
  • The scientists, who published their findings recently in Cancer Cell through an article titled " BCL2 Amplicon Loss and Transcriptional Remodeling Drives ABT-199 Resistance in B Cell Lymphoma Models ," also suggest a possible co-treatment strategy to overcome this resistance. (genengnews.com)
  • Scientists from the Universities of Bristol and Parma, Italy, have used molecular simulations to understand resistance to osimertinib - an anticancer drug used to treat types of lung cancer. (bris.ac.uk)
  • Using a range of advanced molecular simulation techniques, scientists from the Universities of Bristol and Parma, Italy, showed that the structure of the mutant protein changes in a way that stops the drug reacting and binding to it. (bris.ac.uk)
  • Scientists found a 29% increase in drug resistance per year in East Africa, while Southern Africa saw a 14% increase, they say (compared to zero change in resistance levels in the rest of the continent and Latin America). (newser.com)
  • Scientists have used large-scale computer models to identify how the organism that causes pneumonia is able to resist drugs. (scidev.net)
  • Scientists studying the enterococcus family found they developed resistance to harsh conditions some 450 million years ago, well before dinosaurs came on the scene. (voanews.com)
  • this journal will be essential reading for all pharmaceutical scientists involved in drug discovery and development. (ingentaconnect.com)
  • In the study-in which Dr. Romaniello appears as first author-the scientists concentrated on determining the most effective combination of clinically approved drugs that might overcome resistance to TKIs-pharmaceutical compounds that block the action of enzymes called tyrosine kinases. (weizmann.ac.il)
  • Looking for a way to prevent this type of cancer recurrence, the scientists turned to a selection of existing anti-cancer drugs known to block the EGFR family of receptors. (weizmann.ac.il)
  • This indicates that the scientists' combined-drug approach may eventually prove applicable to HER2 positive breast cancer as well. (weizmann.ac.il)
  • Coffey and his colleagues are using the 3-D culture system to explore mechanisms of drug resistance in other colon cancer cell lines. (vanderbilt.edu)
  • The Journal addresses the serious challenges of trying to decipher the molecular mechanisms of drug resistance. (liebertpub.com)
  • Adrian Mulholland , Professor of Chemistry at the University of Bristol, said: "This work shows how molecular simulations can reveal mechanisms of drug resistance, which can be subtle and non-obvious. (bris.ac.uk)
  • It is still unclear whether the resistance mechanism is intrinsic (i.e., it already existed in a few cells prior to therapy) or acquired (i.e., it developed de novo as a result of the treatment). (ibm.com)
  • As transmitted drug resistance increases the risk of virological failure, current guidelines recommend to perform drug resistance testing at baseline in all newly diagnosed individuals to guide the choice of antiretroviral therapy. (springer.com)
  • Treatment resistance is a huge problem in cancer therapy and a major barrier to improving survival for many patients. (medicalnewstoday.com)
  • Drug resistance is a well-known problem in the treatment of cancer, and it affects nearly every type of therapy, apart from surgery. (medicalnewstoday.com)
  • Frequently resistance is intrinsic to the cancer, but as therapy becomes more and more effective, acquired resistance has also become common. (nih.gov)
  • Our group takes full advantage of the rich facilities in the College, each filled with state-of-the-art equipment and expertise, including the Human Genome Sequencing Center , the Alkek Center for Metagenomics and Microbiome Research , the Center for Drug Discovery , the Alkek Center for Molecular Discovery (including their Metabolomics Core ), the Center for Cell and Gene Therapy , and the Cryo-Electron Microscopy Core . (bcm.edu)
  • The study, published today in The Lancet Infectious Diseases , looked at data for people who were beginning antiretroviral therapy, and found that resistance - particularly to one of the main types of first-line drug, NNRTIs - is increasing and those who exhibited drug resistance were more likely to have previously been exposed to antiretroviral drugs, often during pregnancy. (eurekalert.org)
  • Their data suggests that in some areas, 10-30% of people presenting for antiretroviral therapy have previously been exposed to antiretroviral drugs. (eurekalert.org)
  • The study, for the first time, unified genetic alteration and non-genetic adaptive response as a driving force for drug resistance evolution to therapy. (genengnews.com)
  • Development of drug resistance is a challenge in tamoxifen-based breast cancer therapy. (mcponline.org)
  • In a multivariate model, self-report of ever having been on antiretroviral therapy (ART) was associated with resistance ( P = 0.005). (medscape.com)
  • Purpose of review: Surveillance for transmitted HIV drug resistance is essential to assessing the longer term sustainability and durability of first-line antiretroviral therapy (ART). (comminit.com)
  • But at the same time, the persistent level of resistance to azithromycin across Europe is a major concern for us because it compromises the recommended dual therapy with ceftriaxone and azithromycin", explains ECDC expert Gianfranco Spiteri. (eurekalert.org)
  • Ultimately, the efficacy of cytotoxic therapy, like targeted therapy, is limited by drug resistance. (pnas.org)
  • Many studies have focused on genetic mechanisms, both intrinsic and acquired, that confer resistance to chemotherapy, as well as targeted therapy. (pnas.org)
  • By unveiling a previously unknown mechanism of resistance to anti-angiogenic therapy, our findings provide a rapidly translatable strategy to enhancing treatment outcomes. (massgeneral.org)
  • While a gene therapy approach to blocking the immunosuppressive pathway identified in the JCI study improved treatment in a mouse model of colorectal cancer, no drug targeting that pathway is currently available, leading the MGH team to search for alternatives. (massgeneral.org)
  • The analysis found a signature of precise cell types, never previously identified, that correlates with a patient's resistance to the standard therapy for Crohn's disease, an anti-inflammatory drug called a TNF inhibitor. (news-medical.net)
  • The World Health Organization (WHO), has published a report highlighting the growing global threat of drug resistance. (www.nhs.uk)
  • Yet to end the AIDS epidemic as a public health threat, minimising drug resistance will be one part of the response. (eurekalert.org)
  • For example, it may present along the reverse transcriptase enzyme, meaning the efficacy of certain drugs or drug classes can be undermined - in this example, nucleoside/nucleotide reverse transcriptase inhibitors (NRTI/NtRTI) and non-nucleoside reverse transcriptase inhibitor (NNRTI) drug classes. (avert.org)
  • The authors review physiological resistance based tumor architecture, cellular resistance based on drug transport, epigenetic changes that neutralize or bypass drug cytotoxicity, and genetic changes that alter drug target molecules by decreasing or eliminating drug binding and efficacy. (springer.com)
  • Predicting the evolution of drug resistance is fundamental to prolonging the efficacy of existing drugs and to strategically developing and deploying novel drugs. (nih.gov)
  • Because it is very unlikely that new trypanocidal drugs will be released on to the market in the near future, it is essential to try to maintain the efficacy of the currently available drugs. (fao.org)
  • Adaptive (nongenetic or regulatory) responses, such as increased expression of the therapeutic target or activation of compensatory pathways, can also influence drug efficacy over time ( 1 ). (pnas.org)
  • A Massachusetts General Hospital (MGH) research team has identified a potential strategy for improving the efficacy of angiogenesis inhibitors, drugs that help fight cancer by blocking the formation of new blood vessels. (massgeneral.org)
  • In addition, the same epigenetic mechanisms were present in other colon cancer cell lines and in head and neck cancer cell lines with both intrinsic and acquired resistance. (vanderbilt.edu)
  • The current review describes the effects of hypoxia on tumor response to a variety of anti-cancer agents and also describes progress toward therapeutically useful methods of delivering oxygen to tumors in an effort to overcome therapeutic resistance due to hypoxia. (nih.gov)
  • Yet one of the biggest remaining barriers to cancer treatment is our limited understanding of how cancer cells acquire resistance to the drugs used treat them. (ibm.com)
  • To help better understand this complex issue and potentially lay the groundwork for more effective treatment, IBM and the Broad Institute launched a research initiative in 2016 aimed at discovering the basis of cancer drug resistance. (ibm.com)
  • One current theory of resistance is that a minority of tumor cells with the ability to withstand the assault of the drug exist at low levels in the heterogenous population of cancer cells and begin to dominate the population following the treatment that is effective against the majority [4]. (ibm.com)
  • Professor Eyers will deliver an insightful lecture on our understanding of drug-resistance in human cancer cells. (rsc.org)
  • An experimental new drug may tackle treatment resistance in cancer. (medicalnewstoday.com)
  • In the study paper , now published in the journal Molecular Cancer Therapeutics , they report how the experimental drug showed promising results in animal models of both breast and colorectal cancer . (medicalnewstoday.com)
  • The drug targets a molecule that helps cancer cells to read instructions in their DNA. (medicalnewstoday.com)
  • This can happen right from the start of treatment, or because their cancer acquires resistance as treatment ensues. (medicalnewstoday.com)
  • Cancer cells and tumors have many mechanisms for promoting or enabling drug resistance and there is a growing need to find new ways to defeat them. (medicalnewstoday.com)
  • The drug at the center of the new study targets the way that cancer cells read their DNA. (medicalnewstoday.com)
  • Mechanisms of cancer drug resistance. (nih.gov)
  • Studies on mechanisms of cancer drug resistance have yielded important information about how to circumvent this resistance to improve cancer chemotherapy and have implications for pharmacokinetics of many commonly used drugs. (nih.gov)
  • Drug Resistance Updates is a bimonthly publication that contains thought-provoking reviews on important developments in drug resistance in infectious disease and cancer as well as novel drugs and strategies to overcome drug resistance. (elsevier.com)
  • Compare this to the long, dependable income stream from a diabetes medicine or a blood pressure medicine that patients often take for the rest of their lives, or the relatively high price associated with cancer and some antiviral drugs. (fda.gov)
  • The biggest challenge facing cancer medicine today is that of drug resistance, a research leader has warned. (bmj.com)
  • Paul Workman, chief executive and president of the Institute of Cancer Research, told an audience in London that drug resistance in oncology was a little known problem but one that should be the "focus of all our activity. (bmj.com)
  • He told a Westminster Health Forum event on drug access, "We have had the success stories of Herceptin, leukaemia drugs, and treatment for prostate cancer. (bmj.com)
  • But we are seeing cancer evolution and drug resistance. (bmj.com)
  • Drug Resistance as a Biochemical Target in Cancer Chemotherapy covers the proceedings of the 13th Bristol-Myers Squibb Symposium on Cancer Research, entitled ''Drug Resistance as a Biochemical Target in Cancer Chemotherapy'', hosted by the Japanese Foundation for Cancer Research in Tokyo. (elsevier.com)
  • This topic is followed by a discussion on the interactions among steroid hormones, steroid hormone receptors, antiandrogens, biological-response modifiers, and cytotoxic drugs in human breast cancer. (elsevier.com)
  • Now the challenge is to exploit this discovery in the development of novel drugs targeting EGFR mutants for cancer treatment in future. (bris.ac.uk)
  • 'L718Q mutant EGFR escapes covalent inhibition by stabilizing a non-reactive conformation of the lung cancer drug osimertinib' by D. Callegari, K. Ranaghan, C. Woods, R. Minari, M. Tiseo, M. Mor, A. Mulholland and A. Lodola in Chemical Science . (bris.ac.uk)
  • We investigate how cancer cells develop resistance to treatment and make it ineffective. (imperial.ac.uk)
  • Chemotherapy is widely used in cancer treatment, but unfortunately a high proportion of patients develop resistance and the treatment is no longer effective. (imperial.ac.uk)
  • Targeting cancer cells and nonmalignant cells unavoidably changes the tumor microenvironment, and cellular and molecular components relentlessly alter in response to drugs. (jci.org)
  • While cancer cells' dependence on glycolysis for energy production is well studied, the roles of adipocytes and lipid metabolic reprogramming in supporting cancer growth, metastasis, and drug responses are less understood. (jci.org)
  • In particular, we discuss mechanisms underlying cancer-associated adipocytes and lipid metabolic reprogramming in cancer drug resistance. (jci.org)
  • This Review highlights the impact of adipocytes and cancer lipid metabolism on cancer drug responses and discusses the emerging understanding of mechanisms underlying metabolic reprogramming in tumor responses to anticancer drugs. (jci.org)
  • Switching-off" this pathway could present an opportunity to overcome drug resistance in pancreatic cancer. (pnas.org)
  • Chemotherapy is widely used for cancer treatment, but its effectiveness is limited by drug resistance. (pnas.org)
  • We began our study of resistance with the nucleoside analog, gemcitabine, the first-line treatment for locally advanced and metastatic pancreatic cancer ( 4 ). (pnas.org)
  • Anti-cancer drug resistance is a major obstacle to efficiently treating the disease. (europa.eu)
  • One of the main sticking points in the fight against cancer is the ability for cancerous cells to resist drug treatments. (europa.eu)
  • By solving the anti-cancer drug resistance problem, the goal is to reduce cancer's impact on the global population. (europa.eu)
  • Scandion focuses on the development of drugs that interfere or block anti-cancer drug resistance. (europa.eu)
  • Our mission is to introduce novel and innovative drugs that combat anti-cancer drug resistance and thereby increase survival of cancer patients," says Nils Brünner, CEO and co-founder of Scandion Oncology and SCANRESIST project coordinator. (europa.eu)
  • SCO-101 works by specifically targeting resistance mechanisms in cancer at a molecular level. (europa.eu)
  • SCANRESIST is now taking the research to the next level, by testing the drug in cancerous patients who exhibit resistance to cancer drugs. (europa.eu)
  • The novel drug targets proteins known to be responsible in resistance to anti-cancer drugs. (europa.eu)
  • Both the SRPK1 kinase and the ABCG2 drug efflux proteins are highly active in patients with colorectal, breast and pancreatic cancer and are associated with poor patient outcome. (europa.eu)
  • The drug reverses resistance to a number of cytotoxic (toxic to cells) anti-cancer drugs and to anti-oestrogens. (europa.eu)
  • With the high number of cancer patients developing resistance to their treatment, the market potential could easily reach blockbuster potential. (europa.eu)
  • The Mass General Cancer Center's Lipika Goyal, MD, MPhil and colleagues set out to explore the molecular foundations of acquired resistance. (massgeneral.org)
  • In a follow-up to a study published earlier this year that discovered how anti-angiogenesis treatment can interfere with the immune response against colorectal cancer, the team now describes another pathway that induces an immunosuppressive tumor microenvironment, one that can be blocked with an FDA-approved drug. (massgeneral.org)
  • MicroRNAs have also been shown to affect acquired drug resistance in cancer cells and this can be used for therapeutic purposes. (wikipedia.org)
  • Despite advances in cancer treatment, the development of drug resistance remains a major issue affecting long term patient survival. (findaphd.com)
  • Work in our lab has shown that expression of cytoglobin in cancer cells alters mitochondrial function and affords protection from anti-cancer drugs including cisplatin. (findaphd.com)
  • Despite therapeutic advances, colorectal cancer (CRC) still has a 45% mortality rate, and one of the major problems is the development of acquired resistance to treatment with anticancer drugs. (findaphd.com)
  • Now, after just two years on campus, Dr. Romaniello has personally contributed to a discovery that may significantly improve drug protocols for the treatment of lung cancer. (weizmann.ac.il)
  • Prof. Yarden is an Israel Prize laureate who has made significant contributions to the understanding of cancer, which have paved the way for new treatment protocols as well as several successful anti-cancer drugs. (weizmann.ac.il)
  • This can be seen in cancerous tumors where some cells may develop resistance to the drugs used in chemotherapy. (wikipedia.org)
  • Antibacterial drugs are critically important across medicine, including in the care of premature infants and for use in surgery, chemotherapy, and organ transplantation. (fda.gov)
  • Recent evidence suggests that epigenetic change of DNA and multiple cellular pathways contribute to acquired drug resistance to chemotherapy. (medworm.com)
  • Brenner BG et al (2008) Transmission networks of drug resistance acquired in primary/early stage HIV infection. (springer.com)
  • Antimicrobial resistance occurs when a drug is no longer effective against an infection. (www.nhs.uk)
  • The infection is treatable but Neisseria gonorrhoeae keep showing high levels of azithromycin resistance according to latest results of the European Gonococcal Antimicrobial Surveillance Programme. (eurekalert.org)
  • But already resistance is being seen to Tamiflu, a pill that can be taken to treat symptoms and also to prevent infection. (reuters.com)
  • NIAID also supports research on antibacterial resistance stewardship and infection control strategies. (nih.gov)
  • NIAID is supporting the development of tests to rapidly diagnose infections and evaluate whether they are susceptible to particular antimicrobial drugs to ensure patients receive the appropriate treatment for their infection. (nih.gov)
  • The term is used in the context of resistance that pathogens or cancers have "acquired", that is, resistance has evolved. (wikipedia.org)
  • With the limited availability of antifungal drugs and the increasing incidence of opportunistic fungal infections, the emergence of drug resistance in fungal pathogens poses a serious public health concern. (nih.gov)
  • Antifungal drug resistance has been studied most extensively with the yeast Candida albicans owing to its importance as an opportunistic pathogen and its experimental tractability relative to other medically important fungal pathogens. (nih.gov)
  • Finally, there is evidence that hypoxia can enhance genetic instability in tumor cells thus allowing more rapid development of drug resistance cells. (nih.gov)
  • Simply speaking, when a patient is observed to be responding to a drug (for example, shrinking tumor size or in remission), and the disease abruptly stops responding, it is envisaged that the patient's disease has acquired resistance to the drug. (ibm.com)
  • However, many patients who initially respond to the drug eventually develop resistance and tumor recurrence. (genengnews.com)
  • CAAs provide fuel, growth factors, and cytokines and transdifferentiate into other stromal cells to alter tumor growth, metastasis, and drug responses. (jci.org)
  • In trying to understand the resistance to gemcitabine and the variable response of patients, we unexpectedly found culture conditions for pancreatic tumor cells that affected their sensitivity to the drug. (pnas.org)
  • This paper outlines the current knowledge of mechanisms that promote or enable drug resistance, such as drug inactivation, drug target alteration, drug efflux, DNA damage repair, cell death inhibition, and the epithelial-mesenchymal transition, as well as how inherent tumor cell heterogeneity plays a role in drug resistance. (mdpi.com)
  • They found that, when administered together, these compounds provide effective and long-lasting treatment that prevents the emergence of TKI resistance, forestalling tumor-regrowth. (weizmann.ac.il)
  • Resistance to treatment with anticancer drugs results from a variety of factors including individual variations in patients and somatic cell genetic differences in tumors, even those from the same tissue of origin. (nih.gov)
  • Polymer anticancer-drug conjugates are drug delivery systems in which a low molecular weight anticancer agent is covalently conjugated to a water-soluble polymeric carrier. (findaphd.com)
  • To avoid the development of ART resistance, it is recommended that individuals with HIV be treated with a combination of drugs that are from two different classes of antiretroviral drugs. (labtestsonline.org)
  • Many people develop drug resistance after being treated by antiretroviral drugs if they stop taking their medication - often due to personal reasons, difficulty accessing treatment providers, or drug supply issues that are common in low income regions. (eurekalert.org)
  • For the second year in a row, no isolates with resistance to ceftriaxone were detected in contrast to one in 2015, five in 2014 and seven in 2013. (eurekalert.org)
  • The fact that we have not seen ceftriaxone resistance among the tested isolates for two consecutive years is promising. (eurekalert.org)
  • They screened more than 7,000 isolates for specific amino acid substitutions in the M2 gene that are known to confer drug resistance. (medpagetoday.com)
  • Hypoxia can be a direct cause of therapeutic resistance because some drugs and radiation require oxygen to be maximally cytotoxic. (nih.gov)
  • Barth RE et al (2012) Accumulation of drug resistance and loss of therapeutic options precede commonly used criteria for treatment failure in HIV-1 subtype-C-infected patients. (springer.com)
  • A drug must interact with its target(s) to achieve the therapeutic effects. (frontiersin.org)
  • It is the most commonly used drug worldwide against a mosquito-borne disease that infects 216 million people and claims 655,000 lives around the globe each year. (medindia.net)
  • Thus, one way to overcome drug resistance is to develop AR inhibitors that are active against multiple AR mutants. (frontiersin.org)
  • Why Is the Study of Antimicrobial (Drug) Resistance a Priority for NIAID? (nih.gov)
  • The emergence and spread of new forms of resistance remains a concern. (cdc.gov)
  • While all drug resistance is of concern, it is particularly worrying in the case of bugs for which we have few treatment options. (digitaljournal.com)
  • Our findings concern a general adaptive response of cells that causes resistance to gemcitabine and 15 other FDA-approved cytotoxic drugs when cells are grown at high density. (pnas.org)
  • Specifically, we used computational data mining methods to examine clues held in DNA data - acquired from blood samples - to shed new light on acquired drug resistance in gastrointestinal cancers. (ibm.com)
  • A new model shows that the standard practice of treating infections with the highest tolerable dose of anti-microbial medications may not be best for preventing the evolution of drug resistance in all cases. (psu.edu)
  • There is nothing in evolutionary theory that says that the dogma of hitting infections hard with high doses of medication should be the best rule of thumb to prevent drug resistance," said Andrew Read, Evan Pugh Professor of Biology and Entomology and Eberly Professor in Biotechnology at Penn State University. (psu.edu)
  • WHO highlights that infections with E. coli and Klebsiella pneumoniae are becoming reliant on the "last resort" antibacterial drugs called carbapenems. (www.nhs.uk)
  • There is a lot of attention on MRSA, but less on infections caused by bacteria like Acinetobacter for which there are fewer drugs in the development pipeline. (digitaljournal.com)
  • Most of the current knowledge on antiretroviral (ARV) drug development and resistance is based on the study of subtype B of HIV-1, which only accounts for 10% of the worldwide HIV infections. (mdpi.com)
  • Are Infections Caused by Aspergillus Fungi Developing Drug Resistance? (webwire.com)
  • The report has further said that resistance to one of the most widely used antibacterial medicines for the treatment of urinary tract infections caused by E. Coli -- fluoroquinolones -- is widespread. (thefreelibrary.com)
  • Antimicrobial resistance is a significant public health problem in the U.S. and around the world as infections are becoming increasingly difficult to treat, especially in healthcare facilities and in people with weakened immune systems. (nih.gov)
  • In 2002, CDC recommended that fluoroquinolones not be used to treat gonorrhea infections acquired in California and Hawaii, and in 2004 that the drugs no longer be used to treat MSM with these infections. (webwire.com)
  • Lomentospora prolificans infections are often fatal because of their resistance to multiple antifungal agents. (wikipedia.org)
  • But as countries roll-out the latest 2017 World Health Organization (WHO) treatment guidelines that call for all people living with HIV to be on treatment 1 HIV drug resistance (HIVDR) has the potential to become a significant barrier to reaching the UNAIDS Fast-Track goal of ending AIDS by 2030. (avert.org)
  • In July 2017, WHO published a new HIV drug resistance report, based on drug resistance national surveys conducted in 11 countries in Africa, Asia and Latin America. (eurekalert.org)
  • The 2017 Euro-GASP results indicate that the rates of resistance to cefixime, ceftriaxone and azithromycin have remained stable when compared to recent years. (eurekalert.org)
  • In December 2019, NIAID unveiled its updated strategic approaches to address antimicrobial resistance. (nih.gov)
  • Individual organisms vary in their sensitivity to the drug used and some with greater fitness may be capable of surviving drug treatment. (wikipedia.org)
  • The trial will assess the safety and effectiveness of the drug in humans. (medicalnewstoday.com)
  • Is Drug Resistance in Humans Coming From Chickens? (wired.com)
  • As a result, when something starts to move into humans, it is easier to distinguish, because there is no 'background noise' of high rates of hospital and community drug resistance such as there are in the US. (wired.com)
  • A poll of Americans shows that an overwhelming majority of them (90 percent) believe bacteria can evolve a resistance to drugs, but only about 60 percent believe that humans evolved through natural selection. (slate.com)
  • The next step in his research, Dr. Gumbo said, is to test all the first-line drug treatments together with the pump blocker in humans. (newswise.com)
  • The most common reason for acquisition of resistance to a broad range of anticancer drugs is expression of one or more energy-dependent transporters that detect and eject anticancer drugs from cells, but other mechanisms of resistance including insensitivity to drug-induced apoptosis and induction of drug-detoxifying mechanisms probably play an important role in acquired anticancer drug resistance. (nih.gov)
  • Osimertinib is an effective anticancer drug that works in this way. (bris.ac.uk)
  • There is no available vaccine and the capacity for surveillance of resistance patterns is insufficient in some regions. (eurekalert.org)
  • Revised drug resistance surveillance guidelines will become available later this year. (who.int)
  • There are three fundamental principles of the WHO/IUATLD Global project on drug resistance surveillance. (who.int)
  • Drug resistance is monitored either through continuous surveillance by provision of diagnostic culture and DST to all TB patients, or where infrastructure is not widely available, through periodic surveys. (who.int)
  • The current study summarized surveillance for resistance to admantanes from Oct. 1994 through Mar. 2005. (medpagetoday.com)
  • Successful use of drugs has to be monitored in view of evolving patterns of resistance," they concluded. (medpagetoday.com)
  • Lina's team tested more than 2,600 samples of flu viruses from patients in Europe and found baffling patterns of this resistance that appeared to have nothing to do with actual use of Tamiflu. (reuters.com)
  • Read, and colleague Troy Day, professor of mathematics, statistics, and biology at Queen's University in Ontario, Canada, developed a very general mathematical model that quantifies the two main evolutionary forces at work in the evolution of drug resistance in disease-causing microbes. (psu.edu)
  • Killing all of the infecting microbes obviously stops any further evolution of drug resistance, but we can't do this in every case. (psu.edu)
  • by their nature, microbes are invisible to the naked eye, and the process by which they defy our drugs is even harder to visualise. (kottke.org)
  • Bacteria, fungi, and other microbes evolve over time and can develop resistance to antimicrobial drugs. (nih.gov)
  • NIAID supports basic research to understand the biology of microbes, their behavior and how they develop resistance and cause disease. (nih.gov)
  • Their findings, reported this week in Nature Medicine , suggest a strategy for overcoming this resistance. (vanderbilt.edu)
  • These findings highlight the need for improved HIV care in this high-risk population, identification of alternative regimens for PrEP, and inclusion of integrase resistance testing when selecting ART regimens for MSM in the United States. (medscape.com)
  • Recent findings: In the Asia region, many countries have conducted studies of transmitted resistance among recently HIV-infected and pre-ART patients. (comminit.com)
  • Drug Resistance in Salmonella enterica ser. (cdc.gov)
  • WASHINGTON (Reuters) - Seasonal flu viruses are developing the ability to evade influenza drugs globally, but how and why this is happening is not clear, experts told a conference on Monday. (reuters.com)
  • The World Health Organization and the U.S. Centers for Disease Control and Prevention have been collecting samples of the annual flu viruses to check them against the four available flu drugs: amantadine and rimantadine, and the newer drugs Tamiflu and Relenza. (reuters.com)
  • U.S. flu viruses developed a sudden ability to evade the effects of the older drugs amantadine and rimantadine during the 2005-2006 flu season, said Dr. Larisa Gubareva of the CDC. (reuters.com)
  • Gubareva said tests across the United States, Canada and Mexico showed very quick development of drug resistance among H1N1 viruses. (reuters.com)
  • Drug resistance occurs when viruses mutate, enabling them to evade current drug treatments. (worldpolicy.org)
  • We were alarmed to find such a dramatic increase in drug resistance in circulating human influenza viruses in recent years," said Rick A. Bright, Ph.D., of the National Center for Infectious Diseases at the CDC here in a special online edition of The Lancet . (medpagetoday.com)
  • It works by inhibiting the SRPK1 kinase and degrading the ABCG2 drug efflux pump. (europa.eu)
  • Efflux pumps are present in cells and transport several different drugs to the outside of the cell. (europa.eu)
  • The most surprising results were that SCO-101 in addition to degrading the ABCG2 drug efflux pump also specifically inhibits the SRPK1 kinase which is involved in regulation of alternative gene splicing," says Brünner. (europa.eu)
  • However, efflux by the AcrAB-TolC multi-drug efflux pump has recently been shown to directly contribute to fluoroquinolone resistance. (ingentaconnect.com)
  • Use of oral artemisinin-based monotherapy (oAMT) is considered a contributing factor to the development and spread of resistance to artemisinins. (who.int)
  • P. falciparum resistance to artemisinin is present in 5 countries of the subregion: Cambodia, the Lao People's Democratic Republic, Myanmar, Thailand and Viet Nam. (who.int)
  • But after artemisinin-defying parasites emerged on the Thai-Cambodian border about eight years ago -- and were later discovered in western Thailand, Myanmar and Vietnam -- fears are growing that the wonder drug is losing its potency. (medindia.net)
  • Ultimately, we could imagine giving cetuximab with a drug that would block Wnt - to enhance the activity of cetuximab or to prevent the emergence of resistance. (vanderbilt.edu)
  • The de novo emergence of resistance can be prevented by the use of antimalarial drug combinations. (jci.org)
  • What dose of medication is best to prevent the evolution of drug resistance? (psu.edu)
  • Day and Read showed that the optimal approach to combatting the evolution of drug resistance will be either to use the highest dose that is safe or to use the lowest dose that is effective. (psu.edu)
  • Burchell AN et al (2012) Increase in transmitted HIV drug resistance among persons undergoing genotypic resistance testing in Ontario, Canada, 2002-09. (springer.com)
  • The chemicals contained in these preparations, besides harming beneficial organisms, may intentionally or inadvertently target organisms that have the potential to develop resistance. (wikipedia.org)
  • This loss of the ABT-199 target and other cell death regulators on chromosome 18 contribute to the survival of these cell populations, which eventually can develop into drug resistance cells. (genengnews.com)
  • The studies show that some P. falciparum parasites are taking a longer time to die than previously recorded, creating a fear that drug resistance and complete treatment failure could develop. (healthmap.org)
  • Uncommonly, patients with full suppression and excellent experience will develop drug resistance , for unclear reasons, but this is also an increasingly uncommon event. (thebody.com)
  • They have been stressing the need to develop new flu drugs and also quicker and better ways to make vaccines. (reuters.com)
  • CDC is urging health departments to maintain or develop capacity to perform cultures for Neisseria gonorrhoeae and to assess any gonorrhea treatment failures for possible resistance. (webwire.com)