DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.
The genetic complement of MITOCHONDRIA as represented in their DNA.
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
The relationships of groups of organisms as reflected by their genetic makeup.
An agency of the NATIONAL INSTITUTES OF HEALTH concerned with overall planning, promoting, and administering programs pertaining to advancement of medical and related sciences. Major activities of this institute include the collection, dissemination, and exchange of information important to the progress of medicine and health, research in medical informatics and support for medical library development.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Techniques for standardizing and expediting taxonomic identification or classification of organisms that are based on deciphering the sequence of one or a few regions of DNA known as the "DNA barcode".
The intergenic DNA segments that are between the ribosomal RNA genes (internal transcribed spacers) and between the tandemly repeated units of rDNA (external transcribed spacers and nontranscribed spacers).
A plant family of the order Magnoliales, subclass Magnoliidae, class Magnoliopsida. The wood lacks water-conducting cells but has acrid sap. The leaves are gland-dotted, leathery, and smooth-margined. The flowers are small, in clusters, with two to six sepals, petals in two or more series, several stamens, and one to several carpels.
The profession of writing. Also the identity of the writer as the creator of a literary production.
An island in the Greater Antilles in the West Indies, south of Florida. With the adjacent islands it forms the Republic of Cuba. Its capital is Havana. It was discovered by Columbus on his first voyage in 1492 and conquered by Spain in 1511. It has a varied history under Spain, Great Britain, and the United States but has been independent since 1902. The name Cuba is said to be an Indian name of unknown origin but the language that gave the name is extinct, so the etymology is a conjecture. (From Webster's New Geographical Dictionary, 1988, p302 & Room, Brewer's Dictionary of Names, 1992, p132)
A plant genus in the family PINACEAE, order Pinales, class Pinopsida, division Coniferophyta. They are coniferous evergreen trees with long, flat, spirally arranged needles that grow directly from the branch.
The number of copies of a given gene present in the cell of an organism. An increase in gene dosage (by GENE DUPLICATION for example) can result in higher levels of gene product formation. GENE DOSAGE COMPENSATION mechanisms result in adjustments to the level GENE EXPRESSION when there are changes or differences in gene dosage.
Stretches of genomic DNA that exist in different multiples between individuals. Many copy number variations have been associated with susceptibility or resistance to disease.
A method for comparing two sets of chromosomal DNA by analyzing differences in the copy number and location of specific sequences. It is used to look for large sequence changes such as deletions, duplications, amplifications, or translocations.
The loss of one allele at a specific locus, caused by a deletion mutation; or loss of a chromosome from a chromosome pair, resulting in abnormal HEMIZYGOSITY. It is detected when heterozygous markers for a locus appear monomorphic because one of the ALLELES was deleted.
The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.
Genotypic differences observed among individuals in a population.
A genus of freshwater clams, in the family Corbiculidae, class BIVALVIA. It originated in Asia but was introduced in North America and is now found throughout the United States.
An order of amoeboid EUKARYOTES characterized by reticulating pseudopods and a complex life cycle with an alternation of generations. Most are less than 1mm in size and found in marine or brackish water.
The republic consists of islands that are located in the mid-Atlantic Ocean about 300 miles off the west coast of Africa. The archipelago includes 10 islands and 5 islets, divided into the windward (Barlavento) and leeward (Sotavento) groups. The capital is Praia.
A class in the phylum MOLLUSCA comprised of mussels; clams; OYSTERS; COCKLES; and SCALLOPS. They are characterized by a bilaterally symmetrical hinged shell and a muscular foot used for burrowing and anchoring.
Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
The presence of DNA from a source foreign to the sample being analysed.
The presence of organisms, or any foreign material that makes a drug preparation impure.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
The presence of an infectious agent on instruments, prostheses, or other inanimate articles.
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. The enzyme functions in the nucleolar structure and transcribes DNA into RNA. It has different requirements for cations and salts than RNA polymerase II and III and is not inhibited by alpha-amanitin. EC 2.7.7.6.
That portion of the electromagnetic spectrum immediately below the visible range and extending into the x-ray frequencies. The longer wavelengths (near-UV or biotic or vital rays) are necessary for the endogenous synthesis of vitamin D and are also called antirachitic rays; the shorter, ionizing wavelengths (far-UV or abiotic or extravital rays) are viricidal, bactericidal, mutagenic, and carcinogenic and are used as disinfectants.
The reconstruction of a continuous two-stranded DNA molecule without mismatch from a molecule which contained damaged regions. The major repair mechanisms are excision repair, in which defective regions in one strand are excised and resynthesized using the complementary base pairing information in the intact strand; photoreactivation repair, in which the lethal and mutagenic effects of ultraviolet light are eliminated; and post-replication repair, in which the primary lesions are not repaired, but the gaps in one daughter duplex are filled in by incorporation of portions of the other (undamaged) daughter duplex. Excision repair and post-replication repair are sometimes referred to as "dark repair" because they do not require light.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.
Within most types of eukaryotic CELL NUCLEUS, a distinct region, not delimited by a membrane, in which some species of rRNA (RNA, RIBOSOMAL) are synthesized and assembled into ribonucleoprotein subunits of ribosomes. In the nucleolus rRNA is transcribed from a nucleolar organizer, i.e., a group of tandemly repeated chromosomal genes which encode rRNA and which are transcribed by RNA polymerase I. (Singleton & Sainsbury, Dictionary of Microbiology & Molecular Biology, 2d ed)

In vivo expression of the nucleolar group I intron-encoded I-dirI homing endonuclease involves the removal of a spliceosomal intron. (1/10320)

The Didymium iridis DiSSU1 intron is located in the nuclear SSU rDNA and has an unusual twin-ribozyme organization. One of the ribozymes (DiGIR2) catalyses intron excision and exon ligation. The other ribozyme (DiGIR1), which along with the endonuclease-encoding I-DirI open reading frame (ORF) is inserted in DiGIR2, carries out hydrolysis at internal processing sites (IPS1 and IPS2) located at its 3' end. Examination of the in vivo expression of DiSSU1 shows that after excision, DiSSU1 is matured further into the I-DirI mRNA by internal DiGIR1-catalysed cleavage upstream of the ORF 5' end, as well as truncation and polyadenylation downstream of the ORF 3' end. A spliceosomal intron, the first to be reported within a group I intron and the rDNA, is removed before the I-DirI mRNA associates with the polysomes. Taken together, our results imply that DiSSU1 uses a unique combination of intron-supplied ribozyme activity and adaptation to the general RNA polymerase II pathway of mRNA expression to allow a protein to be produced from the RNA polymerase I-transcribed rDNA.  (+info)

p53 represses ribosomal gene transcription. (2/10320)

Induction of the tumor suppressor protein p53 restricts cellular proliferation. Since actively growing cells require the ongoing synthesis of ribosomal RNA to sustain cellular biosynthesis, we studied the effect of p53 on ribosomal gene transcription by RNA polymerase I (Pol I). We have measured rDNA transcriptional activity in different cell lines which either lack or overexpress p53 and demonstrate that wild-type but not mutant p53 inhibits cellular pre-rRNA synthesis. Conversely, pre-rRNA levels are elevated both in cells which express mutant p53 and in fibroblasts from p53 knock-out mice. Transient transfection assays with a set of rDNA deletion mutants demonstrate that intergenic spacer sequences are dispensable and the minimal rDNA promoter is sufficient for p53-mediated repression of Pol I transcription. However, in a cell-free transcription system, recombinant p53 does not inhibit rDNA transcription, indicating that p53 does not directly interfere with the basal Pol I transcriptional machinery. Thus, repression of Pol I transcription by p53 may be a consequence of p53-induced growth arrest.  (+info)

A new rapidly growing mycobacterial species, Mycobacterium murale sp. nov., isolated from the indoor walls of a children's day care centre. (3/10320)

Scotochromogenic mycobacterial isolates from water-damaged parts of indoor building materials of a children's day care centre represented a phenetically and genetically distinct group of strains. A 16S rDNA dendrogram (1243 bp) showed that the closest species to the new strain MA112/96T was Mycobacterium abscessus. Phylogenetic and phenetic analyses (100 characteristics) grouped the new isolates with M. abscessus, Mycobacterium vaccae, Mycobacterium aurum and Mycobacterium austroafricanum. Ribotyping with Pvull restriction distinguished the 5 isolates from the other 12 most closely related species by the major bands at 6.5-7 kb and 13-15 kb. The cell morphology of the new isolates was typical of mycobacteria, electron microscopy revealed a triple-layered cell wall with an irregular electron-dense outer layer. They grew at 10-37 degrees C, with no growth at 45 degrees C in 5 d. The gene encoding the secreted 32 kDa protein, specific to mycobacteria, was detected by PCR. The main whole-cell fatty acids were characterized by high tuberculostearic acid 10Me-C18:0 (17% at 28 degrees C), which increased with increasing growth temperature (22% at 37 degrees C). The other main fatty acids were C18:1 cis9 and C16:0 (21-20% each), followed by, C17:1 cis9 (14%), C16:1 cis10 (8%) and also a high amount of C20 alcohol (9%). alpha-Mycolic acids, keto-mycolates and wax esters were present (C60-C90), MK-9(H2) (90%) and MK-8(H2) were the main menaquinones. The cellular phospholipids were phosphatidylethanolamine, phosphatidylinositol, phosphatidyl inositolmannosides and diphosphatidylglycerol. Polyamine content was low. G+C content was 72.9 mol%. The new isolates are proposed as a new species, Mycobacterium murale sp. nov. The type strain is MA112/96T (= DSM 44340T).  (+info)

Treponema brennaborense sp. nov., a novel spirochaete isolated from a dairy cow suffering from digital dermatitis. (4/10320)

A novel Treponema species was isolated from an ulcerative lesion of a cow suffering from digital dermatitis (DD), a disease which causes painful ulcerations along the coronary band. Among other anaerobic bacteria, high numbers of spirochaetes have been regularly found in DD lesions. Here data are presented of a spirochaete isolated from a DD ulcer. By chemotaxonomy, protein analysis and comparative 16S rDNA sequence analysis this isolate was classified as a treponeme that differed from all Treponema species described previously. The only isolate, DD5/3T, for which the name Treponema brennaborense is proposed, is designated the type strain of the novel species. The strain is a small, highly motile spirochaete that has two periplasmic flagella, one flagellum being attached at each cell pole. Strain DD5/3T exhibits alpha-glucosidase and N-acetyl-beta-glucosaminidase activity and growth is inhibited by rabbit serum. T. brennaborense was phylogenetically most closely related (89.5% 16S rRNA similarity) to Treponema maltophilum, an oral spirochaete isolated from a periodontitis patient.  (+info)

RFLP of rRNA genes and sequencing of the 16S-23S rDNA intergenic spacer region of ammonia-oxidizing bacteria: a phylogenetic approach. (5/10320)

It has been established that 16S rRNA gene-based phylogeny gives a low resolution between members of the chemoautotrophic ammonia-oxidizing bacteria (AOB) belonging to the beta-subclass of the Proteobacteria. In this study, 12 isolates of AOB were ribotyped, and the sequences of the 16S-23S rDNA intergenic spacer region (ISR) were determined and used in a phylogenetic study. 16S and 23S rDNA ribotyping revealed that the AOB studied contain only one rrn operon per genome, in contrast to most bacteria, which have 5-10 copies of the rRNA genes per genome. It is likely that the presence of only one set of rRNA genes is related to the slow growth of the AOB. The 16S and 23S rRNA genes of the AOB were shown to be arranged in the classical way: a 16S rRNA gene, an ISR and a 23S rRNA gene. Despite the close phylogenetic relationship among the AOB, the relative location of the rRNA genes in the genome appears to vary considerably. The size of the ISR was approximately 400 bp in the Nitrosomonas isolates and 645-694 bp in the Nitrosospira isolates, suggesting a species-specific size difference in the ISR. The ISR contained two potential tRNA genes in the 5' end in all isolates studied. The similarity values between the ISR sequences of the AOB are low (42.9-96.2%) compared with the 16S rDNA sequence similarity values, and therefore the ISR sequences are valuable as a complementary phylogenetic tool in combination with 16S rRNA gene sequences. The phylogenetic analysis of the AOB based on ISR sequences confirms the 16S rRNA gene-based phylogeny but has the benefit of giving a higher resolution.  (+info)

New genus-specific primers for the PCR identification of members of the genera Pseudonocardia and Saccharopolyspora. (6/10320)

Members of the family Pseudonocardiaceae are difficult to identify on the basis of their micromorphology only. The biochemical characterization of each new isolate is a painstaking and time-consuming task which cannot always be undertaken when handling large numbers of strains as is the case in natural product screening programmes. In this study, two sets of genus-specific oligonucleotides were designed which allow rapid detection of members of the genera Pseudonocardia and Saccharopolyspora by means of PCR-specific amplification. The genus specificity of these primers was validated on a wide range of collection strains and the primers were subsequently used to study a group of 106 wild-type isolates that possessed morphological characteristics of the family. Out of this group, 51 strains could be identified as members of the genus Pseudonocardia and only nine isolates could be assigned to the genus Saccharopolyspora. The diversity indicated by whole-cell fatty acid profiles of both wild-type and reference strains was compared with that identified using the oligonucleotide primers. The partial 16S rDNA sequencing of representative wild-type strains was used to validate their genus assignment by PCR-specific amplification. This study shows the industrial usefulness of the application of these direct identification tools as well as the complementary use of two sources of data, PCR-specific amplification results and fatty acid composition, to assess the diversity of a microbial population.  (+info)

Reclassification of Brevibacterium oxydans (Chatelain and Second 1966) as Microbacterium oxydans comb. nov. (7/10320)

Phylogenetic and chemotaxonomic analyses indicate that Brevibacterium oxydans is closely related to species of the genus Microbacterium, namely Microbacterium liquefaciens, Microbacterium luteolum and Microbacterium saperdae. DNA-DNA reassociation values of less than 60% between Brevibacterium oxydans and these three Microbacterium species support the distinctness of this misclassified Brevibacterium species, which is reclassified as Microbacterium oxydans comb. nov.  (+info)

Reclassification of Brevibacterium incertum (Breed 1953) as Desemzia incerta gen. nov., comb. nov. (8/10320)

Phylogenetic analysis of 16S rDNA indicates that Brevibacterium incertum is not a member of the genus Brevibacterium but related to species of the genus Carnobacterium. Hence, Brevibacterium incertum is not a member of the class Actinobacteria but belongs to the phylogenetically defined broad Bacillus-Lactobacillus cluster. Based upon properties that taxonomically clearly distinguishes Brevibacterium incertum from species of the phylogenetic sister genus Carnobacterium, Brevibacterium incertum is reclassified as Desemzia incerta gen. nov., comb. nov.  (+info)

Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These
Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing), and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. One hundred
Strain D-14T, a brown-coloured, Gram-stain-negative, non-motile and rod-shaped bacterium, was isolated from oil-contaminated soil. It was able to grow at 20-40 °C, at pH 6.0-10.0 and at 0-1 % (w/v) NaCl concentration. Based on the 16S rRNA gene sequence analysis, strain D-14T belonged to the genus Lysobacter and was closely related to Lysobacter caeni BUT-8T (99.0 % sequence similarity), Lysobacter ruishenii CTN-1T (98.5 %), Lysobacter daejeonensis GH1-9T (98.2 %) and Lysobacter panacisoli CJ29T (97.2 %). The only respiratory quinone was ubiquinone-8. The polar lipid profile revealed the presence of phosphatidylethanolamine, phosphatidylglycerol, diphosphatidylglycerol and phosphatidyl-N-methyl-ethanolamine. The predominant fatty acids of strain D-14T were iso-C15 : 0, iso-C16 : 0, summed feature 9 (iso-C17 : 1 ω9c and/or C16 : 0 10-methyl), summed feature 3 (C16 : 1 ω7c and/or C16 : 1 ω6c), iso-C14 : 0, C11 : 0iso 3-OH, C15 : 1iso F and C16 : 0. The genomic DNA G+C content of this novel strain
The nuclear ribosomal repeats for the 18S, 5.8S, and 26S RNAs of two closely related Picea (spruce) species were characterized by restriction mapping and Southern blot hybridization. Restriction polymorphisms were identified in the IGS and ITS sequences; however, no polymorphism was species specific. As many as five different rDNA repeat units were observed in individual genomes. The repeat size for these gymnosperms ranged from a minimum of 32 kbp to greater than 40 kbp, two- to threefold larger than the typical angiosperm rDNA unit. Slot-blot hybridizations were used to determine the nuclear rDNA copy concentration. Among P. rubens individuals threefold variation was observed in the rDNA copy concentration, and among P. mariana individuals such variation was as much as sixfold. At a size greater than 32 kbp and at a concentration averaging 1.2-1.3 x 10(4) copies/pg, the rDNA constitutes approximately 4% of the total genome. Regression analysis revealed a significant relationship between copy
Vol 63: Ribosomal DNA Sequence Heterogeneity Reflects Intraspecies Phylogenies and Predicts Genome Structure in Two Contrasting Yeast Species.. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
Aruga, J., Y. S. Odaka, A. Kamiya, and H. Furuya. 2007. Dicyema Pax6 and Zic: tool-kit genes in a highly simplified bilaterian. BMC Evolutionary Biology 2007, 7:201. doi:10.1186/1471-2148-7-201. Hanelt, B., D. VanSchyndel, C. M. Adema, L. A. Lewis, E. S. Loker. 1996. The phylogenetic position of Rhopalura ophiocomae (Orthonectida) based on 18S ribosomal DNA sequence analysis. Molecular Biology and Evolution 13:1187-1191.. Horvath, P. 1997. Dicyemid mesozoans. Pages 31-38 in Embryology. Constructing the Organism. S. F. Gilbert and A. M. Raunio (eds.) Sinauer Associates, Sunderland, Mass.. Katayama, T., H. Wada, H. Furuya, N. Satoh, and M. Yamamoto. 1995. Phylogenetic position of the dycyemid Mesozoa inferred from 18S rDNA sequences. Biological Bulletin 189:81-90.. Kobayashi, M., H. Furuya, and P. W. H. Holland. 1999. Dicyemids are higher animals. Nature 401:762.. Pawlowski, J., J. I. MontoyaBurgos, J. F. Fahrni, J. Wuest, and L. Zaninetti. 1996. Origin of the Mesozoa inferred from 18S rRNA gene ...
Vol 13: Molecular identification of clinical difficult-to-identify microbes from sequencing 16S ribosomal DNA and internal transcribed spacer 2.. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
The human gastrointestinal (GI) tract contains a diverse collection of bacteria, most of which are unculturable by conventional microbiological methods. Increasingly molecular profiling techniques are being employed to examine this complex microbial community. The purpose of this study was to develop a microarray technique based on 16S ribosomal gene sequences for rapidly monitoring the microbial population of the GI tract. We have developed a culture-independent, semi-quantitative, rapid method for detection of gut bacterial populations based on 16S rDNA probes using a DNA microarray. We compared the performance of microarrays based on long (40- and 50-mer) and short (16-21-mer) oligonucleotides. Short oligonucleotides consistently gave higher specificity. Optimal DNA amplification and labelling, hybridisation and washing conditions were determined using a probe with an increasing number of nucleotide mismatches, identifying the minimum number of nucleotides needed to distinguish between perfect and
Ben Hanelt, D. Van Schyndel, C. M. Adema, L. A. Lewis, E. S. Loker. The Phylogenetic Position of Rhopaluva ophiocomae (Orthonectida) Based on 18s Ribosomal DNA Sequence Analysis. -Molecular Biology and Evolution, 1996,. 13 (9), lk 1187-1191. Veebiversioon. ...
Learn about Exubera (Insulin Human [rDNA origin]) may treat, uses, dosage, side effects, drug interactions, warnings, patient labeling, reviews, and related medications.
Aime, M. C., P. B. Matheny, D. A. Henk, E. M. Frieders, R. H. Nilsson, M. Piepenbring, D. J. McLaughlin, L. J. Szabo, D. Begerow, J. P. Sampaio, R. Bauer, M. Wei , F. Oberwinkler, and D. S. Hibbett. 2006. An overview of the higher-level classification of Pucciniomycotina based on combined analyses of nuclear large and small subunit rDNA sequences. Mycologia 98: 896 905.. Bauer, R., D. Begerow, J. Sampaio, M. Weiβ, F. Oberwinkler. 2006. The simple-septate basidiomycetes: a synopsis. Mycological Progress 5: 41 66.. Hibbett, D. S., M. Binder, J. F. Bischoff, M. Blackwell, P. F. Cannon, O. E. Eriksson, S. Huhndorf, T. James, P. M. Kirk, R. L cking, T. Lumbsch, F. Lutzoni, P. B. Matheny, D. J. Mclaughlin, M. J. Powell, S. Redhead, C. L. Schoch, J. W. Spatafora, J. A. Stalpers, R. Vilgalys, M. C. Aime, A. Aptroot, R. Bauer, D. Begerow, G. L. Benny, L. A. Castlebury, P. W. Crous, Y.-C. Dai, W. Gams, D. M. Geiser, G. W. Griffith, C. Gueidan, D. L. Hawksworth, G. Hestmark, K. Hosaka, R. A. Humber, K. ...
Redmond, N.E., Morrow, C.C., Thacker, R.W., Díaz, M.C., Boury-Esnault, N., Cárdenas, P., Hajdu, E., Lôbo-Hajdu, G., Picton, B.E., Pomponi, S.A., Kayal, E. & Collins, A.G. 2013. Phylogeny and Systematics of Demospongiae in Light of New Small-Subunit Ribosomal DNA (18S) Sequences. Integrative and Comparative Biology 53(3): 388-415. DOI: 10.1093/icb/ict078 Reference page ...
Systematic hypotheses for Ulvaceae were tested using sequences for the chloroplast gene encoding the large subunit of RUBISCO (rbc L) and nuclear small subunit ribosomal DNA (18S rDNA). Ulvaceae sensu Floyd and OKelly ...
Strange looking elevated amplification plots from ChIP-qPCR samples - posted in PCR, RT-PCR and Real-Time PCR: Hi everyone, I am hoping that you all can help as I am not an expert in qPCR. I performed a ChIP experiment to assess binding to human ribosomal gene repeats. I used primers that have been published in multiple papers and a positive ChIP control: UBF. I have attached the strange amplification plots that I get when doing a standard curve using a dilution series of 1:10 of...
背景:临床真菌引起的血流感染日益增加,其中念珠菌属引起的感染占真菌感染的90.0%以上,主要包括白色念珠菌(66.0%)、光滑念珠菌(11.2%)、热带念珠菌(7.6%)、近平滑念珠菌(5.6%)和克柔念珠菌(2.4%) 5种念珠菌,占临床念珠菌属感染的90.0%以上。目前,检测和鉴定念珠菌属/种血流感染主要依赖血培养和血清学试验,但固有的方法学缺陷难以满足临床快速、准确鉴定血流感染的需要。. 目的:分别建立念珠菌属和5种念珠菌(白色念珠菌、光滑念珠菌、近平滑念珠菌、热带念珠菌和克柔念珠菌)的real-time PCR快速检测平台,并对所建方法及其临床应用价值进行初步评价。. 方法:. 1.引物和探针设计:分别以上述5种念珠菌标准菌株的5.8S rRNA 基因(5.8S rDNA)序列和内转录间隔序列(ITS)作为参考序列,通过属、种间序列比对,在5.8S ...
Addgene NGS Result TTAATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGCTCTAGGAAGATCCAACATATCCTGGTGT GGAGTAGGGGACGCTGCTCTGACAGAGGCTCGGGGGCCTGAGCTGGCTCTGTGAGCTGGGGAGGAGGCAG ACAGCCAGGCCTTTGTCTGCAAGCAGACCTGGCAGCATTGGGCTGGCCGCCCCCCAGGGCCTCCTCTTCA TGCCCAGTGAATGACTCACCTTGGCACAGACACAATGTTCGGGGTGGGCACAGTGCCTGCTTCCCGCCGC ACCCCAGCCCCCCTCAAATGCCTTCCGAGAAGCCCATTGAGCAGGGGGCTTGCATTGCACCCCAGCCTGA CAGCCTGGCATCTTGGGATAAAAGCAGCACAGCCCCCTAGGGGCTGCCCTTGCTGTGTGGCGCCACCGGC GGTGGAGAACAAGGCTCTATTCAGCCTGTGCCCAGGAAAGGGGATCAGGGGATGCCCAGGCATGGACAGT GGGTGGCAGGGGGGGAGAGGAGGGCTGTCTGCTTCCCAGAAGTCCAAGGACACAAATGGGTGAGGGGAGA GCTCTCCCCATAGCTGGGCTGCGGCCCAACCCCACCCCCTCAGGCTATGCCAGGGGGTGTTGCCAGGGGC ACCCGGGCATCGCCAGTCTAGCCCACTCCTTCATAAAGCCCTCGCATCCCAGGAGCGAGCAGAGCCAGAG CAGGTTGGAGAGGAGACGCATCACCTCCGCTGCTCGCGGGGATCCCGCCACCATGGAGACAGACACACTC CTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACAGATCTGCCGCAGGCAGCACGCTGG ACAAAATCGCCAAAAACGGTGTGATTGTCGTCGGTCACCGTGAATCTTCAGTGCCTTTCTCTTATTACGA ...
Abstract: 对大连某城市污水处理厂活性污泥进行长期驯化,筛选得到好氧条件下以对氨基苯磺酸(4-aminobenzenesulphonate,4-ABS)为唯一碳源和能源生长的高效降解菌株W1.根据菌株W1的形态特征、生理生化特征及16S rDNA序列分析,初步鉴定为Pannonibacter菌属.通过考察生长条件对降解效果的影响,确定了该菌株降解4-ABS的优化条件为:接种量10%、 30℃、 pH 7、摇床转速150 r/min,并且在有外加碳源的情况下仍保持较高的4-ABS降解活性.在4-ABS的降解过程中,4-ABS自身含有的氨基和磺酸基会以NH+4和SO2-4的形式释放到水体中,但浓度仅为理论释放量的77.6%和91.5%,推测原因是部分释放的NH+4和SO2-4被菌株W1作为氮源和硫源利用;菌株W1可以耐受2 500 mg/L的4-ABS,且在32 ...
EXERCICES THERMODYNAMIQUE SMP S1 PDF - Exercices et problèmes corrigés de thermodynamique chimique 1 «EXERCICES ET PROBLEMES CORRIGES DE THERMODYNAMIQUE CHIMIQUE» Réalisé. collections de tout
هدف: نگرانی از وجود آفلاتوکسین در مواد غذایی و خطراتی که این سم برای سلامت انسان و حیوانات دارد، باعث پیدایش راه‌های مختلف حذف یا کاهش این سم شده است؛ از جمله این روش‌ها، کنترل زیستی قارچ توسط ریززنده‌های دیگر است. در این تحقیق از باکتری باسیلوس آمیلولیکوفاسینس جدا شده از خاک باغ پسته از باغات شهرستان دامغان به‌عنوان عامل کنترل زیستی برای مهار رشد و تولید آفلاتوکسین قارچ آسپرژیلوس پارازیتیکوس استاندارد NRRL2999 استفاده شد. مواد و روش‌ها: پس از 72 ساعت کشت باکتری در دمای 30 درجه سانتی‌گراد، مایع‌رویی آن به‌عنوان منبع ترکیبات ضد قارچی جداسازی شد. غلظت‌های
A Gram-positive, motile, round to ellipsoidal, endospore-forming, rod-shaped bacterial strain, SF-57T, was isolated from a marine solar saltern in Korea. This organism grew between 4 and 39 °C, with optimum growth at 30 °C. Strain SF-57T grew in the presence of 0·5-15·0 % NaCl, with optimum growth at 2-3 % NaCl. The peptidoglycan type of strain SF-57T was A1α linked directly through l-Lys. In strain SF-57T, menaquinone-7 (MK-7) was the predominant isoprenoid quinone and anteiso-C15 : 0 was the major fatty acid. The DNA G+C content was 41·8 mol%. Phylogenetic analyses based on 16S rRNA gene sequences showed that strain SF-57T formed a coherent cluster with Marinibacillus marinus, with a bootstrap resampling value of 100 %. The level of 16S rRNA gene sequence similarity between strain SF-57T and M. marinus DSM 1297T was 98·9 %. The mean DNA-DNA relatedness level between strain SF-57T and the type strain of M. marinus was 20·6 %. Based on phenotypic properties, phylogenetic analyses and genomic
A novel Ferrimonas species is described on the basis of phenotypic, chemotaxonomic and phylogenetic studies. Four halophilic organisms were isolated from marine sand and marine macroalgae samples by using high-pH marine agar 2216. An analysis of the nearly complete 16S rRNA gene sequences of these new isolates indicated that they were phylogenetically close (16S rRNA gene sequence similarity |99·5 %, gyrB gene sequence similarity |97·8 %), and were most closely related to Ferrimonas balearica (16S rRNA gene sequence similarity 97·1-97·3 %, gyrB gene sequence similarity 84·4-85·0 %). Chemotaxonomic data (major menaquinone MK7; major fatty acids C16 : 0 and C18 : 1 ω9c) supported the affiliation of the new isolates to the genus Ferrimonas. The results of physiological and biochemical tests allowed phenotypic differentiation of the isolates from F. balearica. It is therefore proposed that the new isolates represent a novel species with the name Ferrimonas marina sp. nov. and type strain A4D-4T (
A Gram-stain-positive, aerobic, non-motile, rod-shaped bacterium, strain 0704C9-2T, was isolated from hydrothermal sediment of the Indian Ocean. The organism grew with 0-5 % (w/v) NaCl and at 10-37 °C, with optimal growth occurring with 1 % NaCl and at 28-30 °C. Comparative 16S rRNA gene sequence analysis revealed that strain 0704C9-2T belonged to the genus Microbacterium . It exhibited highest 16S rRNA gene sequence similarity with Microbacterium testaceum DSM 20166T (98.4 %). Levels of similarity with the type strains of all other recognized species of the genus Microbacterium were less than 98.0 %. DNA-DNA hybridization experiments with strain 0704C9-2T and its closest relative, M. testaceum DSM 20166T, revealed a low reassociation value of 42.9 %. The DNA G+C content of strain 0704C9-2T was 73.3 mol%. The cell-wall peptidoglycan contained ornithine and the acyl type was glycolyl. The major whole-cell sugars were mannose, galactose, rhamnose and glucose. The major cellular fatty acids were
Nucleotide excision repair (NER) guarantees genome integrity and proper cellular functions against UV-induced DNA damage. After UV irradiation, one of the first burden cells have to cope with is a general transcriptional block caused by the stalling of RNA polymerase II (RNAP2) onto distorting UV lesions. To insure UV lesions repair specifically on transcribed genes, NER is coupled with transcription in an extremely organized pathway known as Transcription-Coupled Repair (TCR). Most of the knowledge about TCR has been gathered from RNAP2 transcription. However, in highly metabolic cells, more than 60% of total cellular transcription results from ribosomal DNA (rDNA) transcription, by the RNA polymerase I (RNAP1), which takes place in the nucleolus. Many nuclear proteins are excluded from the nucleolus and because of this some nucleolar processes cannot occur inside this structure. In order to be replicated and repaired rDNAs need to be displaced at the nucleolar periphery. Despite the importance of
A bacterial strain, B5-2(T), was isolated from an ice core drilled from Muztagh Glacier, China. Strain B5-2(T) was a Gram-stainnegative, short rod-shaped, motile by polar flagella, aerobic bacterium. The major fatty acids of strain B5-2(T) were summed feature 8 (C-18 : 1 omega 7c and/ or C-18 : 1 omega 6c) and iso-C-13 : 0. The G+C content of the DNA from strain B5-2(T) was 69.3 mol%. The predominant isoprenoid quinone of strain B5-2(T) was Q-10. The major polar lipids were phosphatidylglycerol, phosphatidylethanolamine, phosphatidylmonomethylethanolamine, phosphatidyldimethylethanolamine, phosphatidylcholine, an unidentified phospholipid and sulfoquinovosyldiacylglycerol. Comparative 16S rRNA gene sequence analysis revealed that the novel strain B5-2(T) shared highest similarity (96.7 %) with Aureimonas altamirensis S21B(T). On the basis of the results of this polyphasic study, strain B5-2(T) represents a novel species of the genus Aureimonas, for which the name Aureimonas glaciei sp. nov. is ...
The identification of mycobacteria can be a complicated, expensive, and difficult process; many laboratories are now referring uncommon organisms to laboratories that have the capability of using additional technology. Nucleic acid probes have offered laboratories the ability to rapidly and accurately identify four of the most common mycobacterial species, and they have rarely misidentified an organism (3).. A more important issue is the inaccuracy of phenotypic methods in providing a reliable and timely identification of the other mycobacteria (14). Nucleic acid sequencing of 16S rDNA has been investigated as a definitive method for the identification of many microorganisms, including mycobacteria (3, 5, 8, 11, 12, 16-18, 23), and its use is becoming more extensive. Most of the studies used a small number of organisms for evaluation or included only common species and/or the type species from culture collections.. We sought to determine whether 16S rDNA sequencing with a commercially available ...
Community Structure, Diversity, and Vertical Distribution of Archaea Revealed by 16S rRNA Gene Analysis in the Deep Sea Sediment of the Ulleung Basin, East Sea - archaeal diversity;16S rRNA gene;marine group;Ulleung Basin;East Sea;
Extremely barophilic bacteria, which we defined as bacteria that are unable to grow at pressures of less than 50 MPa but that are able to grow well at 100 MPa, were isolated from sediment obtained by means of the unmanned submersible Kaiko system from the worlds deepest ocean bottom, the Mariana Trench, Challenger Deep, at a depth of 10,898 m. One of the isolates, strain DB21MT-2, which showed optimal growth at a pressure of 70 MPa, belongs to the species S. benthica as determined based on 16S rDNA sequence comparisons and DNA-DNA hybridization analysis (Fig. 4; Table 1). This strain particularly produces EPA as a component of its membrane lipids (Table3). All of the barophilic Shewanella strains isolated from the deep sea produce EPA. Another isolate, strain DB21MT-5, which shows optimal growth at a pressure of 80 MPa, is closely related to the genusMoritella as determined based on 16S rDNA sequence comparisons; however, DNA-DNA hybridization results suggest that this strain does not belong to ...
Widdel 1981) Kuever 2006 may be the type and only species of the genus and the order GEBAproject. class represents a separate lineage within the which is only distantly related to most other members of this class. The closest relatives based on 16S rRNA gene sequence similarity values are the type strains of (87.6% sequence identity) and (87.2%) both belonging to the family within the order [9]. The most similar cloned 16S rRNA gene EUB-42 [10] shared only 95.5% sequence similarity with and was retrieved from anaerobic sludge. Strain 2st14T WYE-354 represents the only stress of this varieties obtainable from a tradition collection so far. Available data from cultivation 3rd party studies (environmental testing and genomic studies) didnt surpass 86% series similarity indicating that people of this varieties are limited to specific habitats which are undersampled generally in most conditions or are in low great quantity (status Oct 2010). The solitary genomic 16S rRNA series of stress 2st14T was ...
Bacillus tusciae Bonjour & Aragno 1994 is a hydrogen-oxidizing, thermoacidophilic spore former that lives as a facultative chemolithoautotroph in solfataras. Although 16S rRNA gene sequencing was well established at the time of the initial description of the organism, 16S sequence data were not available and the strain was placed into the genus Bacillus based on limited chemotaxonomic information. Despite the now obvious misplacement of strain T2(T) as a member of the genus Bacillus in 16S rRNA-based phylogenetic trees, the misclassification remained uncorrected for many years, which was likely due to the extremely difficult, analysis-hampering cultivation conditions and poor growth rate of the strain. Here we provide a taxonomic re-evaluation of strain T2(T) (= DSM 2912 = NBRC 15312) and propose its reclassification as the type strain of a new species, Kyrpidia tusciae, and the type species of the new genus Kyrpidia, which is a sister-group of Alicyclobacillus. The family Alicyclobacillaceae da ...
18-26S rDNA loci were mapped on chromosomes in four species of Paris, and the number and position of rDNA sites in these species were compared for analysis of the distribution of the sites. All the plants were diploids, and the genome consisted of five chromosomes, A, B, C, D and E. (1) P. polyphylla var. yunnanensis, 2n = 10 = 6m + 4t. Two 18-26S rDNA loci were detected on the short arms of C and D chromosomes; (2) P. forrestii, 2n = 10 = 6m + 4t. One locus was detected on the long arm of B chromosome, and also two loci on the short arms of C and D chromosomes; (3) P. axialis. 2n = 10 = 6m(2sat) + 4t(2sat) + 1 - 2B. Two loci were detected on the short arms of C and D chromosomes. One locus was detected in the cell with two B-chromosomes (B), but none was detected in that with only one B chromosome, indicating that rRNA gene existed on B chromsome, and an unequal division occurred during mitotic cycle of B-chromosomes. (4) P. daliensis, 2n = 10 = 4m + 2sm + 2st + 2t. One locus was detected on ...
Synonymy of A. enteropelogenes and A. trota related species A. caviae (hybridization group 4) and In conclusion, the DNA-DNA hybridization data A. sobria (hybridization group 7) (Table 1). Collec- presented in the current study clearly indicate that the tively, the new DNA-DNA hybridization data are in named taxa A. trota and A. enteropelogenes belong to perfect congruence with the above-mentioned studies the same genomic species based on the high DNA suggesting that the taxa A. enteropelogenes and relatedness determined between their type strains. In A. trota are members of the same genomic Aeromonas addition, phenotypic characterization suggested that these strains could not be separated by a single test outof 60 features and both displayed susceptibility to Phenotypically, the type strain of A. enteropelogenes ampicillin and carbenicillin. Together with previous and the type and reference strains of A. trota could not phylogenetic (Collins et al., 1993) and genotypic (Huys be separated by any ...
Background: In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results: We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed L-s-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, ...
We isolated Saccharomyces cerevisiae yeast strains that are able to carry out the second fermentation of sparkling wine from spontaneously fermenting musts in El Penedès (Spain) by specifically designed selection protocols. All of them (26 strains) showed one of two very similar mitochondrial DNA (mtDNA) restriction patterns, whereas their karyotypes differed. These strains showed high rates of karyotype instability, which were dependent on both the medium and the strain, during vegetative growth. In all cases, the mtDNA restriction pattern was conserved in strains kept under the same conditions. Analysis of different repetitive sequences in their genomes suggested that ribosomal DNA repeats play an important role in the changes in size observed in chromosome XII, whereas SUC genes or Ty elements did not show amplification or transposition processes that could be related to rearrangements of the chromosomes showing these sequences. Karyotype changes also occurred in monosporidic diploid ...
Green algae (Chlorophyta) are a morphologically heterogeneous group that is undergoing considerable revisions at present. Especially in coccoid genera, there have been striking cases of polyphyly, when species originally placed in one genus were shown to belong to up to three different classes. The coccoid chlorophycean genus Bracteacoccus Tereg was until recently considered monophyletic, but with the advent of new molecular data, it no longer appears as such. The goal of my project is to monograph the genus Bracteacoccus. I collect 18S ribosomal DNA sequences (nuclear gene) as well as rbcL sequences (chloroplast, protein-coding gene). Phylogeny obtained from the sequence data can be subsequently used as a starting point for further research: well supported clades can be examined for defining traits. Like other coccoid genera, Bracteacoccus has very simple morphology and therefore few characters to be scored. Transmission electron microscopy may provide one or several taxonomically useful ...
Green algae (Chlorophyta) are a morphologically heterogeneous group that is undergoing considerable revisions at present. Especially in coccoid genera, there have been striking cases of polyphyly, when species originally placed in one genus were shown to belong to up to three different classes. The coccoid chlorophycean genus Bracteacoccus Tereg was until recently considered monophyletic, but with the advent of new molecular data, it no longer appears as such. The goal of my project is to monograph the genus Bracteacoccus. I collect 18S ribosomal DNA sequences (nuclear gene) as well as rbcL sequences (chloroplast, protein-coding gene). Phylogeny obtained from the sequence data can be subsequently used as a starting point for further research: well supported clades can be examined for defining traits. Like other coccoid genera, Bracteacoccus has very simple morphology and therefore few characters to be scored. Transmission electron microscopy may provide one or several taxonomically useful ...
Changes in the structure and composition of a protistan community were characterized through the analysis of small-subunit ribosomal RNA gene (18S) sequences for a 3-day bottle incubation using a single sample collected in the western North Atlantic. Cloning and sequencing was used to investigate changes in perceived species richness and diversity as a consequence of environmental perturbation. The treatments included a control (unamended seawater), inorganic nutrient enrichment, and enrichment with a complex organic mixture. Five clone libraries were constructed and analyzed at the time of collection (t-0 h) and after 24 (t-24 h) and 72 (t-72 h) h for the control, and at t-72 h for the inorganic and organic enrichments, resulting in an analysis of 1,626 partial 18S rDNA sequences that clustered into 238 operational taxonomic units (OTUs). Analysis of the clone libraries revealed that protistan assemblages were highly dynamic and changed substantially at both the OTU level and higher taxonomic ...
The attached .csv file contains accession number, definition, and GenBank URL for 28 rDNA sequences: MF077637-MF077640 and MF098761 (Ca. Annandia pinicola), MF077633-MF077636 (Ca. Gillettellia cooleyia), MF077641-MF077645 (Ca. Hartigia pinicola), MF108835-MF108838 (Ca. Profftia spp.), MF098762 (Ca. Pseudomonas adelgestsugas from Taiwan), MF063340- MF063348 (Ca. Vallotia spp.).
The higher proliferation rate of cancer cells requires an increased rate of protein synthesis. Thus, cancer cells often show increased rates of ribosomal DNA (rDNA) transcription and have more ribosomes and larger nucleoli, which are nuclear structures that function in ribosome biogenesis. Neumüller et al. identified genes in yeast that, when ablated, resulted in smaller or larger nucleoli. A similar analysis in Drosophila enabled the identification of evolutionarily conserved molecular complexes that increase or decrease nucleolar size when the complex constituents were targeted by RNA interference. Understanding how cells regulate rDNA transcription could provide new therapeutic avenues for interfering with the unrestricted growth that occurs in cancer.. ...
Huisman, J.M., Sherwood, A.R. & Abbott, I.A. 2003. Morphology, reproduction, and the 18S rDNA gene sequence of Pihiella liagoraciphila gen. et sp. nov. (Rhodophyta), the so-called monosporangial discs associated with members of the Liagoraceae (Rhodophyta) and proposal of the Pihiellales ord. nov. Journal of Phycology 39: 978-987 ...
Obtaining full-length 16S rRNA gene sequences is important for generating accurate taxonomy assignments of bacteria, which normally is realized via clone library construction. However, the application of clone library has been hindered due to its limitations in sample throughput and in capturing minor populations (<1 % of total microorganisms). To overcome these limitations, a new strategy, two-step denaturing gradient gel electrophoresis (2S-DGGE), is developed to obtain full-length 16S rRNA gene sequences. 2S-DGGE can compare microbial communities based on its first-round DGGE profiles and generate partial 16S rRNA gene sequences (8-534 bp, Escherichia coli numbering). Then, strain-specific primers can be designed based on sequence information of bacteria of interest to PCR amplify their remaining 16S rRNA gene sequences (515-1541 bps, E. coli numbering). The second-round DGGE can confirm DNA sequence purity of these PCR products. Finally, the full-length 16S rRNA gene sequences can be ...
A Gram-stain-positive, aerobic, non-spore-forming, atrichous and short rod-shaped endophytic actinomycete, designated strain BGMRC 2075 , was isolated from the leaves of Kandelia candel, and was subjected to polyphasic characterization to unravel its taxonomic position. Phylogenetic analyses based on 16S rRNA gene sequences indicated that strain BGMRC 2075 belongs to the genus Nocardioides ,showing the highest 16S rRNA gene sequence similarity to Nocardioides aestuarii JC2056 (96.1 %), Nocardioides agariphilus MSL-28 (95.1 %) andNocardioides islandiensis MSL-26 (95.1 %). The predominant cellular fatty acids of strain BGMRC 2075 were iso-C16 : 0, C17 : 1ω8c and C17 : 0. The major menaquinone was MK-8(H4). The diagnostic diamino acid in the cell-wall peptidoglycan was ll-2,6-diaminopimelic acid. The predominant cell-wall sugars were composed of ribose and glucose. The polar lipid pattern contained diphosphatidylglycerol, phosphatidylglycerol, phosphatidylmethylethanolamine, phosphatidylcholine, ...
Strains VIM M 10366(T), YIM M 10378(T) and YIM M 10400(T) were isolated from marine sediments collected from the Xisha Islands in the South China Sea. All three isolates were able to grow optimally at pH 7.0, 28-37 degrees C and 0-3% (w/v) NaCl. Comparison of 16S rRNA gene sequences showed that these strains are members of the genus Streptomyces, exhibiting moderately high 16S rRNA gene sequence similarities of 97.0-98.8% to members of the most closely related Streptomyces species. Morphological characteristics, physiological characteristics and compositions of whole-cell sugars and phospholipids are consistent with the diagnostic characteristics of the genus Streptomyces, but still allowed differentiation amongst the three strains and their neighbours. Based on 16S rRNA gene sequence analysis, DNA DNA relatedness, phenotypic characteristics and chemotaxonomic data, strains VIM M 10366(T), VIM M 10378(T) and VIM M 10400(T) were identified as members of three novel species of the genus ...
A Gram-staining-positive, cocci, halotolerant bacterial strain, designated as SV-16T, was isolated from marine sediment and subjected to a polyphasic taxonomic study. The strain exhibited phenotypic properties that included chemotaxonomic characteristics consistent with its classification in the genus Salinicoccus. Growth occurs at temperatures in the range between 25-37 °C (optimum 30 °C), pH 7.0-11.0 (optimum 8.0) and at NaCl concentrations up to 25 .0 % (optimum 15.0 %). The highest level of 16S rRNA gene sequence similarity was with Salinicoccus carnicancri CrmT (98.6 %) followed by Salinicoccus halodurans W24T (96.6 %). The predominant polar lipids are diphosphatidylglycerol (DPG), phosphatidylinositol (PI) and phosphatidylglycerol (PG). The major cellular fatty acids are iso-C15: 0, anteiso-C15: 0, iso-C17: 0 and anteiso C17: 0. The draft genome of strain SV-16T consisted of 2,591,284 bp with G+C content of 48.7 mol %. On the basis of the phenotypic characteristics and genotypic ...
INTRODUCTION. The genus Bacillus is a phenotypically large, diverse collection of Gram-positive or Gram-variable staining, endospore-forming, aerobic or facultatively anaerobic, rod-shaped bacteria that have undergone considerable reclassification as advances in molecular biology have revealed a high phylogenetic heterogeneity (5, 21). The genus Bacillus and related genera are distributed widely in nature and include thermophilic, psychrophilic, acidophilic, alkalophilic and halophilic bacteria that utilize a wide range of carbon sources for heterotrophic growth or grow autotrophically.. The investigations on phylogenetic divergence of the genus Bacillus and its mesophilic and thermophilic members indicated the need for further and extensive studies to place some of these bacilli in appropriate taxonomic levels (1, 23, 21). With the accumulation of further 16S rRNA gene sequence data, Bacillus has been divided into more manageable and better-defined groups (16). According to Ludwig et al. (2007) ...
In Egypt, four species of Tilapia have been described based on morphometric, meristic and cytotaxonomical characteristics. These species are Tilapia zillii, Oreochromis niloticus, Oreochromis aureus and Sarotherodon galilaeus. The accurate identification of these fishes is complicated by the high variation in these characters,similarity among species and in some cases by the size of the fish. In this paper, we examined the use of polymerase chain reaction (PCR)and restriction fragment length polymorphisms (RFLPs) analysis of the nuclear small subunit ribosomal RNA gene (srDNA) for molecular identification of Tilapia spp. in Egypt. The present study aims to evaluate such advanced molecular biological approach for identification of Tilapia spp. Genomic DNA was extracted from the four species of Tilapia. About 2000 bp 18S ribosomal DNA was amplified by PCR using specific primers. The technique of restriction fragment length polymorphisms was used to identify the specific 18S rDNA for each species. O.
article{7225551, abstract = {A Gram-stain-positive, ovoid, lactic acid bacterium, strain LMG 27676(T), was isolated from a spoiled sous-vide-cooked rutabaga. 16S rRNA gene sequence analysis indicated that the novel strain belongs to the genus Leuconostoc, with Leuconostoc kimchii and Leuconostoc miyukkimchii as the nearest neighbours (99.1 and 98.8\% 16S rRNA gene sequence similarity towards the type strain, respectively). Phylogenetic analysis of the 16S rRNA gene, multilocus sequence analysis of the pheS, rpoA and atpA genes, and biochemical and genotypic characteristics allowed differentiation of strain LMG 27676(T) from all established species of the genus Leuconostoc. Strain LMG 27676(T) (=R-50029(T)=MHB 277(T)=DSM 27776(T)) therefore represents the type strain of a novel species, for which the name Leuconostoc rapi sp. nov. is proposed.}, author = {Lyhs, Ulrike and Snauwaert, Isabel and Pihlajaviita, Seija and De Vuyst, Luc and Vandamme, Peter}, issn = {1466-5026}, journal = {INTERNATIONAL ...
Background. 16S rRNA gene sequences are routinely assigned to operational taxonomic units (OTUs) that are then used to analyze complex microbial communities. A number of methods have been employed to carry out the assignment of 16S rRNA gene sequences to OTUs leading to confusion over which method is the most rigorous. A recent study suggested that a clustering method should be selected based on its ability to generate stable OTU assignments that do not change as additional sequences are added to the dataset. In contrast, we contend that the ability of the method to properly represent the distances between the sequences is more important. Methods. Our analysis implemented five de novo clustering algorithms including the single linkage, complete linkage, average linkage, abundance-based greedy clustering, distance-based greedy clustering, and the open and closed-reference methods. Using two previously published datasets we used the Matthews Correlation Coefficient (MCC) to assess the stability and
Looking for online definition of DNA-DNA Reassociation in the Medical Dictionary? DNA-DNA Reassociation explanation free. What is DNA-DNA Reassociation? Meaning of DNA-DNA Reassociation medical term. What does DNA-DNA Reassociation mean?
Gammaproteobacteria belonging and related to the genus Microbulbifer are an emerging group of complex carbohydrate-degrading marine bacteria. Previously, all of the representatives were placed within Microbulbifer or were unclassified. Recently, a new genus, Teredinibacter, represented by a single species, Teredinibacter turnerae, was formed to include an endosymbiotic branch of these organisms. In this study, based on 16S rRNA gene sequence similarity and phenotypic analyses, a new genus, Saccharophagus, is proposed to accommodate the most versatile marine carbohydrate degrader yet identified, Saccharophagus degradans gen. nov., sp. nov. 2-40(T) (=ATCC 43961(T)=DSM 17024(T)). S. degradans strain 2-40(T) can degrade 10 tested complex polysaccharides: agar, alginate, chitin, cellulose, fucoidan, laminarin, pectin, pullulan, starch and xylan. S. degradans 2-40(T) shares 90.5% 16S rRNA gene sequence similarity with the type strain of the Microbulbifer type species, Microbulbifer hydrolyticus ...
Among multigene families, ribosomal RNA (rRNA) genes are the most frequently studied and have been explored as cytogenetic markers to study the evolutionary history of karyotypes among animals and plants. In this report, we applied cytogenetic and genomic methods to investigate the organization of rRNA genes among cichlid fishes. Cichlids are a group of fishes that are of increasing scientific interest due to their rapid and convergent adaptive radiation, which has led to extensive ecological diversity. The present paper reports the cytogenetic mapping of the 5S rRNA genes from 18 South American, 22 African and one Asian species and the 18S rRNA genes from 3 African species. The data obtained were comparatively analyzed with previously published information related to the mapping of rRNA genes in cichlids. The number of 5S rRNA clusters per diploid genome ranged from 2 to 15, with the most common pattern being the presence of 2 chromosomes bearing a 5S rDNA cluster. Regarding 18S rDNA mapping, the
The genetic diversity of plant growth-promoting rhizobacterial (PGPR) fluorescent pseudomonads associated with the sugarcane (Saccharum officinarum L.) rhizosphere was analyzed. Selected isolates were screened for plant growthpromoting properties including production of indole acetic acid, phosphate solubilization, denitrification ability, and production of antifungal metabolites. Furthermore, 16S rDNA sequence analysis was performed to identify and differentiate these isolates. Based on 16S rDNA sequence similarity, the isolates were designated as Pseudomonas plecoglossicida, P. fluorescens, P. libaniensis, and P. aeruginosa. Differentiation of isolates belonging to the same group was achieved through different genomic DNA fingerprinting techniques, including randomly amplified polymorphic DNA (RAPD), amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic (REP), enterobacterial repetitive intergenic consensus (ERIC), and bacterial repetitive BOX elements (BOX)
Ribosomal DNA (rDNA) of plants is present in high copy number and shows variation between and within species in the length of the intergenic spacer (IGS). The 45S rDNA of flowering plants includes the 5.8S, 18S and 25S rDNA genes, the internal transcribed spacer (ITS1 and ITS2), and the intergenic spacer 45S-IGS (25S-18S). This study identified six different types of 45S-IGS, A to F, which at 363 bp, 1121 bp, 1717 bp, 1969 bp, 2036 bp and 2111 bp in length, respectively, were much shorter than the reported reference IGS sequences in B. oleracea var. alboglabra. The shortest two IGS types, A and B, lacked the transcription initiation site, non-transcribed spacer, and external transcribed spacer. Functional behavior of those two IGS types in relation to rRNA synthesis is a subject of further investigation. The other four IGSs had subtle variations in the transcription termination site, guanine-cytosine (GC) content, and number of tandem repeats, but the external transcribed spacers of these four IGSs were
Replication follows the DNA strand displacement model. DNA templated transcription, with some alternative splicing mechanism is ... Translation takes place by ribosomal shunting. The virus exits the host cell by nuclear envelope breakdown, viroporins, and ... Intermediate genes activate replication of the DNA genome by DNA strand displacement in the nucleus. Expression of L4-22K and ...
... spans about 90 million base pairs (the building material of DNA) and represents just under 3% of the total DNA in ... RPS15A: encoding protein 40S ribosomal protein S15a. *RSL1D1: encoding protein Ribosomal L1 domain-containing protein 1 ...
McCallum FS, Maden BE (1986). "Human 18 S ribosomal RNA sequence inferred from DNA sequence. Variations in 18 S sequences and ... Sylvester JE, Petersen R, Schmickel RD (1990). "Human ribosomal DNA: novel sequence organization in a 4.5-kb region upstream ... Gonzalez IL, Sylvester JE (1995). "Complete sequence of the 43-kb human ribosomal DNA repeat: analysis of the intergenic spacer ... RNA, ribosomal 1, also known as RNR1, is a human gene. "Human PubMed Reference:". National Center for Biotechnology Information ...
McCallum FS, Maden BE (1986). "Human 18 S ribosomal RNA sequence inferred from DNA sequence. Variations in 18 S sequences and ... Sylvester JE, Petersen R, Schmickel RD (1990). "Human ribosomal DNA: novel sequence organization in a 4.5-kb region upstream ... Gonzalez IL, Sylvester JE (1995). "Complete sequence of the 43-kb human ribosomal DNA repeat: analysis of the intergenic spacer ... regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits; RNR3 has a paralog, RNR1, ...
McCallum FS, Maden BE (1986). "Human 18 S ribosomal RNA sequence inferred from DNA sequence. Variations in 18 S sequences and ... RNA, ribosomal 5, also known as RNR5, is a human gene. Genes for ribosomal RNA are clustered on the short arms of chromosomes ... Sylvester JE, Petersen R, Schmickel RD (1990). "Human ribosomal DNA: novel sequence organization in a 4.5-kb region upstream ... Gonzalez IL, Sylvester JE (1995). "Complete sequence of the 43-kb human ribosomal DNA repeat: analysis of the intergenic spacer ...
2004). "ZNF143 activates gene expression in response to DNA damage and binds to cisplatin-modified DNA". Int. J. Cancer. 111 (6 ... 28S ribosomal protein S35, mitochondrial is a protein that in humans is encoded by the MRPS35 gene. Mammalian mitochondrial ... "Entrez Gene: MRPS35 mitochondrial ribosomal protein S35". Otsuki T, Ota T, Nishikawa T, et al. (2007). "Signal sequence and ... Overview of all the structural information available in the PDB for UniProt: P82673 (28S ribosomal protein S35, mitochondrial) ...
DNA-templated transcription is the method of transcription. Translation takes place by -1 ribosomal frameshifting. Once the ... Once in the cell, the viral DNA is protected from degradation by the host nucleases. The viral DNA is then circularized and ... The virus attaches to the host cell lipopolysaccharides using its terminal fibers, and ejects the viral DNA into the host ...
by 16S Ribosomal DNA Sequence Analysis". International Journal of Systematic Bacteriology. 47 (4): 921-925. doi:10.1099/ ...
Ribosomal DNA transcription is confined to the nucleolus, where about 400 copies of the 42.9-kb rDNA gene are present, arranged ... Myc is known to bind to human ribosomal DNA in order to stimulate rRNA transcription by RNA polymerase I. Two specific ... "c-Myc binds to human ribosomal DNA and stimulates transcription of rRNA genes by RNA polymerase I". Nature Cell Biology. 7 (3 ... "Integrative genomic analysis of human ribosomal DNA". Nucleic Acids Research. 39 (12): 4949-4960. doi:10.1093/nar/gkq1326. PMC ...
"Entrez Gene: MRPS6 mitochondrial ribosomal protein S6". Hattori M, Fujiyama A, Taylor TD, et al. (2000). "The DNA sequence of ... 28S ribosomal protein S6, mitochondrial is a protein that in humans is encoded by the MRPS6 gene. Mammalian mitochondrial ... This gene encodes a 28S subunit protein that belongs to the ribosomal protein S6P family. Pseudogenes corresponding to this ... Overview of all the structural information available in the PDB for UniProt: P82932 (28S ribosomal protein S6, mitochondrial) ...
DNA-templated transcription is the method of transcription. Translation takes place by -1 ribosomal frameshifting. The virus ... The injected DNA takes over the host cell's mechanisms for transcription and translation and begins to manufacture new viruses ... Genomes are linear, double-stranded DNA, around 33-244kb in length. The genome codes for 40 to 415 proteins. It has terminally ...
39S ribosomal protein L19, mitochondrial is a protein that in humans is encoded by the MRPL19 gene. Mammalian mitochondrial ... The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1". DNA Res ... "Entrez Gene: MRPL19 mitochondrial ribosomal protein L19". Nagase T, Miyajima N, Tanaka A, et al. (1995). "Prediction of the ... Graack HR, Bryant ML, O'Brien TW (2000). "Identification of mammalian mitochondrial ribosomal proteins (MRPs) by N-terminal ...
"Entrez Gene: MRPL37 mitochondrial ribosomal protein L37". Gregory SG, Barlow KF, McLay KE, et al. (2006). "The DNA sequence and ... 39S ribosomal protein L37, mitochondrial is a protein that in humans is encoded by the MRPL37 gene. Mammalian mitochondrial ... Overview of all the structural information available in the PDB for UniProt: Q9BZE1 (39S ribosomal protein L37, mitochondrial) ... Graack HR, Bryant ML, O'Brien TW (Jan 2000). "Identification of mammalian mitochondrial ribosomal proteins (MRPs) by N-terminal ...
"Entrez Gene: MRPL18 mitochondrial ribosomal protein L18". Hartley JL, Temple GF, Brasch MA (2001). "DNA cloning using in vitro ... 39S ribosomal protein L18, mitochondrial is a protein that in humans is encoded by the MRPL18 gene. Mammalian mitochondrial ... This gene encodes a 39S subunit protein that belongs to the L18P ribosomal protein family. Three polymorphic sites exist in ... Analysis of the complement of ribosomal proteins present". J Biol Chem. 276 (47): 43958-69. doi:10.1074/jbc.M106510200. PMID ...
Dna templated transcription, specifically dsdna (rt) transcription is the method of transcription. Translation takes place by ... ribosomal shunting. The virus exits the host cell by nuclear pore export, and tubule-guided viral movement. Plants serve as the ...
Using 12S ribosomal DNA sequences, Houde et al. (1997) were the first to present molecular genetic evidence of gruiform ... This was confirmed by Sibley and Ahlquist (1990) based on DNA-DNA hybridization and subsequently by Paton et al. (2003), Paton ... from the Gruiformes based on large DNA-DNA hybridization distances to other supposed Gruiformes. However, it was not until the ... One locus, i.e., mitochondrial DNA, contradicts the strict monophyly of Coronaves (Morgan-Richards et al. 2008), but phylogeny ...
... by analyses of partial 16S ribosomal DNA sequences". Applied and Environmental Microbiology. 61 (6): 2257-61. doi:10.1128/AEM. ...
... assessed by nuclear ribosomal DNA sequences (ITS)". Plant Systematics and Evolution. 262 (1-2): 1-12. doi:10.1007/s00606-006- ...
The gene used was the 16S ribosomal DNA. The names have been changed to reflect more current nomenclature used by molecular ...
Alper, I; Michel, F; Labrie, S (2011). "Ribosomal DNA Polymorphisms in the Yeast Geotrichum candidum". Fungal Biology. 115 (12 ... Species of Geotrichum can be differentiated by sequence analysis of the nuclear ribosomal large subunit (18S ribosomal RNA) or ... Sybren de Hoog, G; Smith, M. T (2004). "Ribosomal Phylogeny and Species Delimitation in Geotrichum and its Teleomorphs". ... the internal transcribed spacer region of the nuclear ribosomal RNA gene. G. candidum colonies are thin, spreading, soft, ...
... by analyses of partial 16S ribosomal DNA sequences". Applied and Environmental Microbiology. 61 (6): 2257-61. PMC 167497. PMID ...
... (Myrtaceae) inferred from nuclear ribosomal DNA" (PDF). PNAS. Retrieved 2007-06-13. CS1 maint: discouraged ...
CS1 maint: discouraged parameter (link) Hershkovitz, M.A.; Hernandez-Pellicer, C.C.; Arroyo, M.T.K. (2006). "Ribosomal DNA ...
The DNA genome, proteins, and ribosomes are retained in the reticulate body. This occurs as a result of the development cycle ... Ribosomes and ribosomal subunits are found in these bodies. Table 1. Genome features of selected Chlamydia species and strains ... A major re-description of the Chlamydiales order in 1999, using the then new techniques of DNA analysis, split three of the ... In 2009 the validity of Chlamydophila was challenged by newer DNA analysis techniques, leading to a proposal to "reunite the ...
Chloroplast and ribosomal DNA sequence analysis in 2011 supported monophyly with two clades, one of which includes some North ... For example, in 2011 using ribosomal DNA analysis of their own and a review of molecular data (such as ITS sequence analysis) ... Dracunculus (Asteraceae) based on ribosomal and chloroplast DNA sequences". Taxon. 60 (3): 691-704. doi:10.1002/tax.603006. ... of nuclear ribosomal DNA". American Journal of Botany. 85 (12): 1787-95. doi:10.2307/2446513. JSTOR 2446513. PMID 21680339. ...
Crampton A, McKay I, Barker SC (May 1996). "Phylogeny of ticks (Ixodida) inferred from nuclear ribosomal DNA". International ...
The genus Naegleria's ribosomal DNA (rDNA) consists of an extrachromosomal plasmid of which about 4000 exist in each cell. ... New species are often defined by ribosomal DNA sequences. The unicellular organism's cytoplasm has distinct separations of an ...
Villeponteau, B., and Martinson, H.G. (1987). Gamma rays and bleomycin nick DNA and reverse the DNase I sensitivity of beta- ... Heterochromatin formation promotes longevity and represses ribosomal RNA synthesis. PLoS Genetics 8, e1002473. Tsurumi, A., and ... Delineation of transcription units and developmental regulation of interspersed DNA repeats. The Journal of Biological ... Li, W.X. (2012). Global heterochromatin loss: a unifying theory of aging? Epigenetics : official journal of the DNA Methylation ...
... inferred from mitochondrial 16S ribosomal DNA sequence data". Journal of the Royal Society of New Zealand. 30 (2): 155-168. doi ... Subsequent DNA analysis suggests that New Zealand bat flies represent a distinct and ancient lineage in the superfamily ...
DNA sequencing of the ribosomal genes corrected the characterization. Another W. chondrophila strain, 2032/99, was found along ... Species in this genus have a Chlamydia-like cycle of replication and their ribosomal RNA genes are 80-90% identical to ... ribosomal genes in the Chlamydiaceae. The type species is Waddlia chondrophila strain WSU 86-1044T, which was isolated from the ...
1 DNA-Viren *1.1 Doppelsträngige DNA-Viren (dsDNA: double stranded DNA). *1.2 Einzelsträngige DNA-Viren (ssDNA: single stranded ... Orsay virus utilizes ribosomal frameshifting to express a novel protein that is incorporated into virions, in: Virology 450-451 ... Viren mit DNA-Genom bilden keine taxonomische Einheit. Doppelsträngige DNA-Viren (dsDNA: double stranded DNA)[Bearbeiten , ... Einzelsträngige DNA-Viren (ssDNA: single stranded DNA)[Bearbeiten , Quelltext bearbeiten]. Viren mit Einzelstrang-DNA-Genom ...
Among land plants, the contents of the chloroplast genome are fairly similar[8]-they code for four ribosomal RNAs, 30-31 tRNAs ... DNA replicationEdit. Leading model of cpDNA replicationEdit. Chloroplast DNA replication via multiple D loop mechanisms. ... Chloroplast DNA Interactive gene map of chloroplast DNA from Nicotiana tabacum. Segments with labels on the inside reside on ... As in prokaryotes, genes in chloroplast DNA are organized into operons.[10] Introns are common in chloroplast DNA molecules, ...
28S and 18S ribosomal DNA sequences support the monophyly of lampreys and hagfishes. Molecular Biology and Evolution 15 (12): ... Complete mitochondrial DNA of the hagfish, Eptatretus burgeri: the comparative analysis of mitochondrial DNA sequences strongly ...
The effects of model choice and mitigating bias on the ribosomal tree of life. „Molecular Phylogenetics and Evolution", 2013. ... Są to liniowe fragmenty DNA związanego z licznymi białkami, które chronią go, powielają i precyzyjnie sterują ekspresją. ...
It is building a messenger RNA molecule from a DNA helix. Part of the enzyme was made transparent so the RNA and DNA can be ... Grummt I. (1999). "Regulation of mammalian ribosomal gene transcription by RNA polymerase I.". Prog Nucleic Acid Res Mol Biol. ... With the help of some other molecules, it makes messenger RNA from a strand of a DNA. This is its main function, but it does ... Herr A.J. et al (2005). "RNA polymerase IV directs silencing of endogenous DNA". Science 308 (5718): 118-20. doi:10.1126/ ...
1 ribosomal frameshifting, viral initiation, and ribosomal skipping. The virus exits the host cell by lysis, and viroporins. ... and a poliovirus clone was the first infectious DNA clone made of an RNA virus in animals. Along with rhinovirus, poliovirus ...
For example, thermostable DNA polymerases, such as the Pfu DNA polymerase from Pyrococcus furiosus, revolutionized molecular ... Archaea were split off as a third domain because of the large differences in their ribosomal RNA structure. The particular RNA ... 2011). "UV-inducible DNA exchange in hyperthermophilic archaea mediated by type IV pili". Mol Microbiol. 82 (4): 807-17. doi: ... When the hyperthermophilic archaea Sulfolobus solfataricus[150] and Sulfolobus acidocaldarius[151] are exposed to the DNA ...
DNA damage[edit]. Marking sites of DNA damage is an important function for histone modifications. It also protects DNA from ... Hannon Bozorgmehr J (Oct 2019). "The origin of chromosomal histones in a 30S ribosomal protein". Gene. doi:10.1016/j.gene. ... Compacting DNA strands[edit]. Histones act as spools around which DNA winds. This enables the compaction necessary to fit the ... Farkas D (1996). DNA simplified: the hitchhiker's guide to DNA. Washington, D.C: AACC Press. ISBN 978-0-915274-84-0. .. ...
... based on nuclear ribosomal DNA ITS sequences" (PDF). Aliso. 22: 372-395. Retrieved 13 October 2015.. ... ramosum as assessed by random amplified polymorphic DNA (RAPD). Retrieved 14 October 2015.. in Zeder et al (2006, Chapter 10. ... "Phylogeny and biogeography of Allium (Amaryllidaceae: Allieae) based on nuclear ribosomal internal transcribed spacer and ...
It is building a messenger RNA molecule from a DNA helix. Part of the enzyme was made transparent so the RNA and DNA can be ... Grummt I. (1999). "Regulation of mammalian ribosomal gene transcription by RNA polymerase I.". Prog Nucleic Acid Res Mol Biol. ... With the help of some other molecules, it makes messenger RNA from a strand of a DNA. This is its main function, but it does ... X-ray crystallography of DNA and RNA polymerases show that, other than having a Mg2+ ion at the catalytic site, they are ...
The complete DNA sequence is known for many bacterial strains.. Shape[change , change source]. Bacteria vary widely in size and ... divided bacteria into 11 divisions based on 16S ribosomal RNA (SSU) sequences:[5][6] ... They do have DNA, and their biochemistry is basically the same as other living things. They are amongst the simplest and the ... Bacteria do not have sexes, but they do transmit DNA by several kinds of horizontal gene transfer. This is how they share ...
"Primers, 16S ribosomal DNA - François Lutzoni's Lab". lutzonilab.net. Arquivado dende o orixinal o 2012-12-27.. ... The Ribosomal Database Project[editar , editar a fonte]. The Ribosomal Database Project (RDP) é unha base de datos revisados ... Kolbert CP, Persing DH (June 1999). "Ribosomal DNA sequencing as a tool for identification of bacterial pathogens". Current ... "16S ribosomal DNA amplification for phylogenetic study". Journal of Bacteriology 173 (2): 697-703. PMC 207061. PMID 1987160. ...
protein-DNA complex. • complexo proteico. • granular component. • centrossoma. • citosol. • large ribosomal subunit. • small ... ribosomal small subunit biogenesis. • negative regulation of apoptotic process. • regulation of DNA damage response, signal ... ribosomal large subunit export from nucleus. • ribosomal small subunit export from nucleus. • rRNA export from nucleus. • cell ... ribosomal large subunit binding. • protein homodimerization activity. • ribosomal small subunit binding. • unfolded protein ...
... assessed by nuclear ribosomal DNA sequences (ITS)". Plant Systematics and Evolution. 262 (1-2): 1-12. doi:10.1007/s00606-006- ...
Monophyly of aneuploid Astragalus: Evidence from nuclear ribosomal DNA internal transcribed spacer sequences. American J. Bot. ... Evolutionary significance of the loss of the chloroplast--DNA inverted repeat in the Leguminosae subfamily Papilionoideae. ...
They do have DNA, and their biochemistry is basically the same as other living things. They are amongst the simplest and the ... divided bacteria into 11 divisions based on 16S ribosomal RNA (SSU) sequences:[8][9] ... Bacteria do not have sexes, but they do transmit DNA by several kinds of horizontal gene transfer. This is how they share ... All modern ideas start with the sequence analysis of DNA and RNA. In 1987, Carl Woese, the forerunner of the molecular ...
Rosenshine I, Tchelet R, Mevarech M. (1989). "The mechanism of DNA transfer in the mating system of an archaebacterium". ... a basin-wide ecological study using 16S ribosomal and functional genes and membrane lipids". Environ. Microbiol. 9 (4): 1001-16 ... "UV-inducible DNA exchange in hyperthermophilic archaea mediated by type IV pili". Mol Microbiol (82(4)): 807-17. PMID 21999488 ... "DNA-binding proteins and evolution of transcription regulation in the archaea". Nucleic Acids Res. 27 (23): 4658-70. PMC ...
"Three RNA cells for ribosomal lineages and three DNA viruses to replicate their genomes: a hypothesis for the origin of ... Main articles: RNA and DNA. The major difference between RNA and DNA is the presence of a hydroxyl group at the 2'-position of ... This forces an RNA double helix to change from a B-DNA structure to one more closely resembling A-DNA. ... DNA and proteins seemed the dominant macromolecules in the living cell, with RNA only aiding in creating proteins from the DNA ...
Rowan R, Powers DA (1992) Ribosomal-RNA sequences and the diversity of symbiotic dinoflagellates (zooxanthellae). Proc Natl ... Genetic variation in Symbiodinium isolates from giant clams based on random-amplified-polymorphic DNA (RAPD) patterns. Mar Bio ... ribosomal e nuclear de copia única. O uso de múltiples marcadores, xunto cunha clasificación filoxenética xerárquica ... based on small subunit rDNA and multilocus DNA fingerprinting. Mar Biol 142:233-239 ...
18S and 28S ribosomal DNA, cytochrome oxidase II, and elongation factor 1-alpha) for 128 flea taxa from around the world. The ...
"DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA". Int. J. Syst. Evol. Microbiol. 50: 1095-1102 ... Winker, S; Woese CR (1991). "A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA ... Hansmann, S; Martin W (2000). "Phylogeny of 33 ribosomal and six other proteins encoded in an ancient gene cluster that is ... Keswani, J; Whitman WB (2001). "Relationship of 16S rRNA sequence similarity to DNA hybridization in prokaryotes". Int. J. Syst ...
Dna templated transcription, specifically dsdna(rt) transcription, with some alternative splicing mechanism is the method of ... Translation takes place by ribosomal shunting. The virus exits the host cell by budding, and nuclear pore export. Birds serve ...
DNA does not leave the nucleus for various reasons. DNA is a very long molecule, and is bound in with proteins, called histones ... They are transfer RNA (tRNA) and ribosomal RNA (rRNA).. tRNA[change , change source]. Transfer RNA (tRNA) is a short molecule ... This is done by messenger RNA (mRNA). A single strand of DNA is the blueprint for the mRNA which is transcribed from that DNA ... Retrotransposons copy themselves in two stages: first from DNA to RNA by transcription, then from RNA back to DNA by reverse ...
ஆர்க்கீயாவின் ரைபோசோமிய ஆர்.என்.ஏ (ribosomal RNA) மற்றும் நகர் ரைபோகருக்காடிகள் பாக்டீரியாவில் உள்ளதை விட வேறான கட்டுமானம் ... 1983), Archaebacteria and eukaryotes possess DNA-dependent RNA polymerases of a common type, The EMBO Journal, 2(8): 1291-1294. ...
The DNA in the human Y chromosome is composed of about 59 million base pairs.[5] The Y chromosome is passed only from father to ... RPS4Y1/RPS4Y2/RPS4X (Ribosomal protein S4). *DDX3Y (helicase) similar to DDX3X on X ... James Schwartz, In Pursuit of the Gene: From Darwin to DNA, pages 170-172, Harvard University Press, 2009 ISBN 0674034910 ... Mitochondrial DNA, maternally inherited to both sons and daughters, is used in an analogous way to trace the matrilineal line.[ ...
For instance, one can start with the gene for a protein that binds a certain sequence of DNA, and, by directing an unnatural ... amino acid with a reactive side-chain into the binding site, create a new protein that cuts the DNA at the target-sequence, ...
Brown, P. O.; Bowerman, B.; Varmus, H. E.; Bishop, J. M. (1987-05-08). "Correct integration of retroviral DNA in vitro". Cell. ... Jacks, T. and Varmus, H.E. Expression of the Rous sarcoma virus pol gene by ribosomal frameshifting. Science 230:1237, 1985. ... "DNA related to the transforming gene(s) of avian sarcoma viruses is present in normal avian DNA". Nature. 260 (5547): 170-173 ... discovery of ribosomal frameshifting to make retroviral proteins (with Tyler Jacks[16]); isolation of a cellular receptor for ...
A common non-ribosomal peptide is glutathione, a component of the antioxidant defenses of most aerobic organisms.[9] Other ... DNA, RNA, etc.), or to complex macromolecular assemblies.[3] Finally, while aspects of the lab techniques applied to peptides ... Some ribosomal peptides are subject to proteolysis. These function, typically in higher organisms, as hormones and signaling ... The peptide families in this section are ribosomal peptides, usually with hormonal activity. All of these peptides are ...
This includes four ribosomal RNAs, approximately 30 tRNAs, 21 ribosomal proteins, and 4 subunits of the plastid-encoded RNA ... DNA replication[edit]. Leading model of cpDNA replication[edit]. Chloroplast DNA replication via multiple D loop mechanisms. ... Chloroplast DNA Interactive gene map of chloroplast DNA from Nicotiana tabacum. Segments with labels on the inside reside on ... Chloroplast DNA (cpDNA) is the DNA located in chloroplasts, which are photosynthetic organelles located within the cells of ...
Ribosomal DNA (rDNA) is a DNA sequence that codes for ribosomal RNA. These sequences regulate transcription initiation and ... Various types of cancers can also be born from mutations of the tandem repeats in the ribosomal DNA. Cell lines can become ... Keil RL, Roeder GS (December 1984). "Cis-acting, recombination-stimulating activity in a fragment of the ribosomal DNA of S. ... Weisburg WG, Barns SM, Pelletier DA, Lane DJ (January 1991). "16S ribosomal DNA amplification for phylogenetic study". Journal ...
Amplified rDNA (Ribosomal DNA) Restriction Analysis is the extension of the technique of RFLP (restriction fragment length ... Identification of Acinetobacter Genomic Species by Amplified Ribosomal DNA Restriction Analysis. J. Clin. Microbiol. 33:11-15. ... Overnight digestion (10-16 hours) of about 300-500 ng of amplicon DNA in a 20 μL system with 4-5 units of Restriction Enzyme ... of more than 4bp would be irrelevant with respect to a gene of approximately 1500bp such as that coding for the 16s ribosomal ...
... signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy ... 2001) Identification of DNA cis elements essential for expansion of ribosomal DNA repeats in Saccharomyces cerevisiae. Mol Cell ... forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA ... Regulation of ribosomal DNA amplification by TOR. Carmen V. Jack, Cristina Cruz, Ryan M. Hull, Markus A. Keller, Markus Ralser ...
Ribosomal DNA polymorphisms in the yeast Geotrichum candidum.. Alper I1, Frenette M, Labrie S. ... Multiple sequence alignments revealed the presence of 60 polymorphic sites, which is generally unusual for ribosomal DNA (rDNA ... We have sequenced the complete 18S, 5.8S, 26S ribosomal RNA genes and their internal transcribed spacers (ITS1) and ITS2 ...
Yamashitas team looked specifically at ribosomal DNA (rDNA) loci that contain the genes for ribosomal RNA (rRNA). These loci ... Aging Clues Found in Stem Cell Ribosomal DNA. February 14, 2018. 0 ... in which DNA copy number is rapidly expanded in the male germline of animals that are deficient in rDNA due to large rDNA ...
Redistribution of ribosomal DNA after blocking of transcription induced by actinomycin D.. Schöfer C1, Weipoltshammer K, ...
16S ribosomal DNA amplification for phylogenetic study.. W G Weisburg, S M Barns, D A Pelletier, D J Lane ... 16S ribosomal DNA amplification for phylogenetic study. Message Subject (Your Name) has forwarded a page to you from Journal of ... One pair of primers is capable of amplifying nearly full-length 16S ribosomal DNA (rDNA) from many bacterial genera; the ...
Of the 3.2 billion DNA building blocks of a human genome, ribosomal DNA accounts for only 13,000, but its puny representation ... "rDNA" stands for ribosomal DNA. Ribosomes are the roundish structures upon which the amino acids of a protein are strung ... A New Biological Aging Clock: Ribosomal DNA Posted March 28, 2019 by Ricki Lewis, PhD in Uncategorized ... For the new clock, the researchers dub the prophetic process of ribosomal DNA methylation "rDNAm." Rdamn? Im stymied. ...
Dna, ribosomal explanation free. What is Dna, ribosomal? Meaning of Dna, ribosomal medical term. What does Dna, ribosomal mean? ... Looking for online definition of Dna, ribosomal in the Medical Dictionary? ... ribosomal DNA. (redirected from Dna, ribosomal). Also found in: Dictionary. ribosomal DNA (rDNA), species of DNA present in ... ribosomal DNA. n. Abbr. rDNA. Any of various regions of DNA in eukaryotes that are transcribed into precursors of ribosomal RNA ...
In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete ... Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics ... Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were ... Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis ...
Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Conrad L. Schoch, Keith ... Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi ... Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi ... Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi ...
We determined almost complete small-subunit ribosomal DNA sequences of 50 reference strains belonging to the genera ... Phylogeny of the genus Corynebacterium deduced from analyses of small-subunit ribosomal DNA sequences Int J Syst Bacteriol. ... We determined almost complete small-subunit ribosomal DNA sequences of 50 reference strains belonging to the genera ... The variability of chemotaxonomic characteristics within the genus Corynebacterium suggests that small-subunit ribosomal DNA ...
... suggest that ribosomal DNA copy number could be used to predict which cancers will be sensitive to DNA-damaging ... Ribosomal DNA plays a critical role in healthy cells and cancer cells alike. It encodes structural components of ribosomes, the ... Cancer cells may lose copies of ribosomal DNA to enable faster proliferation, study shows. *Download PDF Copy ... The few studies that have included analysis of ribosomal DNA thus far have shown that the number of copies of the repetitive ...
Szostak, J. W., and R. Wu, 1980 Unequal crossing over in the ribosomal DNA of Saccharomyces cerevisiae. Nature 284: 426-430. ... Merker, R. J., and H. L. Klein, 2002 hpr1Δ affects ribosomal DNA recombination and cell life span in Saccharomyces cerevisiae. ... Crease, T., and M. Lynch, 1991 Ribosomal DNA variation in Daphnia pulex. Mol. Biol. Evol. 8: 620-640. ... THE ribosomal (r)DNA of metazoan animals is a large multigene family consisting of one or more arrays of tandemly repeated ...
Amplified Ribosomal DNA Restriction Analysis. Amplified Ribosomal DNA Restriction Analysis. Amplified rDNA (Ribosomal DNA) ... Other articles related to amplified ribosomal dna restriction analysis, restriction, ribosomal:. Amplified Ribosomal DNA ... Read more about Amplified Ribosomal DNA Restriction Analysis: ARDRA Rationale and Procedure ... Famous quotes containing the words analysis, restriction and/or dna:. "Ask anyone committed to Marxist analysis how many angels ...
Ribosomal DNA is the sequence of DNA that codes for ribosomal RNA. In eukaryotes, the ribosomal DNA contains a tandem repeat of ... Ribosomal RNA is a specialized RNA molecule present in the ribosome. The ribosomal RNA does not carry the code in making ... The ribosomal RNAs form two subunits, i.e. large subunit and small subunit. The large subunit serves as a ribozyme. Apart from ... Retrieved from "https://www.biology-online.org/dictionary/index.php?title=Ribosomal_DNA&oldid=100624" ...
Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs. Cytogenet ... Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs ...
We have therefore analysed E. gracilis strain Z 16S-23S spacer DNA at the nucleotide level, hoping this would allow ... The rRNA genes are located within three tandemly repeated DNA regions of approximately 5.6 kilobase pairs each6-8 and the ... Sequencing of 16S-23S spacer in a ribosomal RNA operon of Euglena gracilis chloroplast DNA reveals two tRNA genes. *L. Graf1, ... Graf, L., Kössel, H. & Stutz, E. Sequencing of 16S-23S spacer in a ribosomal RNA operon of Euglena gracilis chloroplast DNA ...
Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction.. K H Wilson, R B Blitchington, R C Greene ... Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction. Message Subject (Your Name) has forwarded a page ...
Ribosomal DNA evolution at the population level: nucleotide variation in intergenic spacer arrays of Daphnia pulex.. T J Crease ... Ribosomal DNA evolution at the population level: nucleotide variation in intergenic spacer arrays of Daphnia pulex.. T J Crease ... Ribosomal DNA evolution at the population level: nucleotide variation in intergenic spacer arrays of Daphnia pulex.. T J Crease ... Ribosomal DNA evolution at the population level: nucleotide variation in intergenic spacer arrays of Daphnia pulex. ...
Ribosomal DNA is one of the most variable regions in the human genome with respect to copy number. Despite the importance of ... Ribosomal DNA copy number may be a simple and useful indicator of whether a cancer will be sensitive to DNA damaging treatments ... Ribosomal DNA copy number loss and sequence variation in cancer PLoS Genet. 2017 Jun 22;13(6):e1006771. doi: 10.1371/journal. ... Ribosomal DNA is one of the most variable regions in the human genome with respect to copy number. Despite the importance of ...
DNA studies of 23 taxa (20 platyhelminths, 1 nemertean, Homo and Artemia) and electron-microscopic studies of the ... Human 18s ribosomal RNA sequence inferred from DNA sequence. Biochem.J. 232: 725-733.Google Scholar ... Contributions to the phylogeny of Platyhelminthes based on partial sequencing of 18S ribosomal DNA. Int. J. Parasitol. 23: 705- ... The phylogenetic relationships of Kronborgia (Platyhelminthes, Fecampiida) based on comparison of 18S ribosomal DNA sequences. ...
LUPATINI, Manoeli; MELLO, Andrea Hentz de e ANTONIOLLI, Zaida Inês. Ribosomal dna characterization of Scleroderma UFSMSc1 of ... The DNA of the Scleroderma UFSMSc1 isolate was extracted with CTAB solution. PCR reactions were carried out with the universal ...
Three DNA regions were sequenced, including the trnLintron... ... DNA sequences were used to assess the monophyly and inter- ... based on DNA sequences from ITS nuclear ribosomal DNA and plastid trnL intron and trnL-F intergenic spacers. ... including the trnL intron and the trnL-F intergenic spacer of the plastid genome and the ITS region of nuclear ribosomal DNA ( ... DNA sequences were used to assess the monophyly and inter-relationships of Miscanthus, Saccharum and related genera in the ...
Small Subunit Ribosomal DNA Suggests that the Xenophyophorean Syringammina corbicula1 is a Foraminiferan. Authors. *. JAN ...
... implying a higher complexity of evolutionary patterns in the ribosomal genes than generally recognized. Modeling the ITS1, 5.8S ...
... we present a protocol for tracing genomic DNA (gDNA) contamination in RNA samples. The presented method utilizes primers ... Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. Seyyed Hamidreza Hashemipetroudi1, Ghorbanali Nematzadeh ... of ribosomal DNA (rDNA) genes. The method is suited for reliable and sensitive detection of DNA contamination in most ... Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA. J. Vis. Exp. (131), e55451, doi:10.3791/55451 (2018). ...
However, in highly metabolic cells, more than 60% of total cellular transcription results from ribosomal DNA (rDNA) ... guarantees genome integrity and proper cellular functions against UV-induced DNA damage. After UV irradiation, one of the first ... Human Ribosomal DNA and RNA Polymerase I Fate during UV-induced DNA Repair. Molecular biology. Université de Lyon, 2017. ... Human Ribosomal DNA and RNA Polymerase I Fate during UV-induced DNA Repair ...
Sequence Analysis of the Ribosomal DNA Intergenic Spacer 1 Regions of Trichosporon Species. Takashi Sugita, Masamitsu Nakajima ... 1). Ribosomal DNA (rDNA) has been widely utilized for molecular systematics and the identification of microorganisms. The D1/D2 ... Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial ... Sequence Analysis of the Ribosomal DNA Intergenic Spacer 1 Regions of Trichosporon Species ...
How Mitochondrial DNA & Ribosomal RNA Provide Molecular Clocks Related Study Materials. *Related ... What is mitochondrial DNA?. *Why is mitochondrial DNA inherited only from mothers and not fathers? a. Mitochondria of sperm are ... The Rate of DNA Mutations. In the 1960s, three scientists proposed a theory that DNA sequences evolve at a relatively constant ... A molecular clock is a piece of DNA that accumulates random, neutral mutations at a constant pace. Ideally, the piece of DNA ...
  • Ribosomal DNA (rDNA) is a DNA sequence that codes for ribosomal RNA. (wikipedia.org)
  • The rDNA repeats have many regulatory mechanisms that keep the DNA from undergoing mutations, thus keeping the rDNA conserved. (wikipedia.org)
  • A fragment of yeast rDNA containing the 5S gene, non-transcribed spacer DNA, and part of the 35S gene has localized cis-acting mitotic recombination stimulating activity. (wikipedia.org)
  • Eukaryotic genomes contain abundant multicopy sequences, ranging from low copy segmental duplications to the giant tandem arrays found at key functional regions such as centromeres, telomeres, and the ribosomal DNA (rDNA) ( 1 ). (pnas.org)
  • Multiple sequence alignments revealed the presence of 60 polymorphic sites, which is generally unusual for ribosomal DNA (rDNA) within a given species because of the concerted evolution mechanism. (nih.gov)
  • Dr. Yamashita's team looked specifically at ribosomal DNA (rDNA) loci that contain the genes for ribosomal RNA (rRNA). (genengnews.com)
  • Further analysis indicated that the process of rDNA copy number recovery uses the same factors that are needed for a phenomenon known as rDNA magnification, in which DNA copy number is rapidly expanded in the male germline of animals that are deficient in rDNA due to large rDNA deletions. (genengnews.com)
  • Amplified rDNA (Ribosomal DNA) Restriction Analysis is the extension of the technique of RFLP (restriction fragment length polymorphism) to the gene encoding the small (16s) ribosomal subunit of bacteria. (wikipedia.org)
  • rDNA" stands for ribosomal DNA. (plos.org)
  • The rDNA of the new clock encodes those ribosomal proteins. (plos.org)
  • Another peculiarity of rDNA is that methyl groups (a carbon atom bonded to three hydrogen atoms) silence about a tenth of the repeats by binding "CpG" sites, DNA base couples of cytosine (C) next to guanine (G). Methylation is an epigenetic change to the DNA, altering gene expression but not the actual DNA sequence. (plos.org)
  • The presented method utilizes primers specific for the internal transcribed spacer region (ITS) of ribosomal DNA (rDNA) genes. (jove.com)
  • However, in highly metabolic cells, more than 60% of total cellular transcription results from ribosomal DNA (rDNA) transcription, by the RNA polymerase I (RNAP1), which takes place in the nucleolus. (archives-ouvertes.fr)
  • Ribosomal DNA (rDNA) has been widely utilized for molecular systematics and the identification of microorganisms. (asm.org)
  • Ribosomal DNA (rDNA) of plants is present in high copy number and shows variation between and within species in the length of the intergenic spacer (IGS). (mdpi.com)
  • DNA coding for rRNA) sequences with rDNA sequences of known phylogeny. (asm.org)
  • analyzed the degree of DNA-DNA relatedness versus 16S similarity for a large number of marine isolates and found that a 16S rDNA sequence similarity of ≥97% is a reasonable level for grouping bacteria into species ( 16 ). (asm.org)
  • The number of reported marine bacterioplankton bacteria has grown mostly by sequencing 16S rDNA genes from environmental DNA ( 1 , 12 , 15 , 20 ). (asm.org)
  • A portion of the 18S ribosomal DNA (rDNA) gene, the internal transcribed spacers (ITS1 and ITS2), and the 5.8S rDNA gene were polymerase chain reaction-amplified from strains and field populations of Venturia inaequalis and assessed for genetic variation. (apsnet.org)
  • RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. (biologists.org)
  • By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. (biologists.org)
  • Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. (biologists.org)
  • Ribosomal RNA genes (rDNA) have been used as valuable experimental systems in numerous studies. (muni.cz)
  • Phylogeny of R. fascians isolates obtained from Plant Clinic submissions was determined with 16S ribosomal DNA (16S rDNA) sequence analysis with sequence primers designed to amplify specific regions of R. fascians 16S rDNA. (oregonstate.edu)
  • This study focuses on the variability of chromosomal location and number of ribosomal DNA (rDNA) sites in some diploid and autotetraploid Festuca pratensis and Lolium perenne cultivars, as well as on identification of rDNA-bearing chromosomes in their triploid and tetraploid F. pratensis × L. perenne hybrids. (springer.com)
  • The rDNA loci were mapped using fluorescence in situ hybridization (FISH) with 5S and 25S rDNA probes, and the origin of parental genomes was verified by genomic in situ hybridization (GISH) with L. perenne genomicDNAas a probe, and F. pratensis genomic DNA as a block. (springer.com)
  • Ribosomal DNA (rDNA) repeats often exhibit a high level of within-species homogeneity, but intra-individual polymorphism of rDNA has been found in Camellia species. (semanticscholar.org)
  • In order to reveal the evolutionary pattern of rDNA repeats in tea [Camellia sinensis (L.) O. Kuntze], we identified the 45S rDNA loci, estimated their copy number, and cloned partial regions of them from different PCR products and from digested genomic DNA. (semanticscholar.org)
  • Dual-priming oligonucleotide primers targeted to 500 bps of the V1-V3 region of the 16S rRNA gene were used to perform fast broad-range 16S rDNA PCR and Sanger sequencing on ribosomal DNA extracted from HV tissues. (biomedcentral.com)
  • This chapter reviews the organization and genomic location of ribosomal DNA (rDNA) in both the nuclear and mitochondrial genomes of neodermatans. (edu.au)
  • Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. (biomedcentral.com)
  • To learn more about the origin and genome evolution of this ancient natural polyploid, we studied genomic and molecular organization of the Atropa belladonna ribosomal DNA (rDNA). (biomedcentral.com)
  • Tandemly arranged repeated rDNA units found in genomes of all eukaryotes contain evolutionarily conserved sequences coding for ribosomal rRNAs and more rapidly evolving intergenic spacer regions (IGS). (biomedcentral.com)
  • The restriction endonuclease HpaII was utilized to examine ribosomal RNA gene (rDNA) methylation in maize and teosinte leaf DNA. (lsu.edu)
  • We examined the methylation status of the transcribed domain of ribosomal DNA (rDNA) in 58 patients with breast cancer. (uthscsa.edu)
  • We show that in response to DNA damage, BRCA1 occupancy at the rDNA repeat is decreased and the observed BRCA1 interactions with the Pol-I transcription machinery are weakened.We propose, therefore, that there is a rDNA associated fraction of BRCA1 involved in DNA damage dependent regulation of Pol-I transcription, regulating the stability and formation of the Pol-I holoenzyme during initiation and/or elongation in response to DNA damage. (omicsdi.org)
  • The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. (uab.edu)
  • Nucleolar ribosomal DNA is tightly associated with silent heterochromatin, which is important for rDNA stability, nucleolar integration and cellular senescence. (beds.ac.uk)
  • Ribosomal DNA (rDNA) is the most transcribed genomic region and contains hundreds of tandem repeats. (prolekarniky.cz)
  • DNA damages generated in rDNA need to be efficiently and accurately repaired and rDNA repeats instability has been reported in cancer, aging and neurological diseases. (prolekarniky.cz)
  • Here, we describe that the histone demethylase JMJD6 is rapidly recruited to nucleolar DNA damage and is crucial for the relocalisation of rDNA in nucleolar caps. (prolekarniky.cz)
  • Moreover, cells deficient for JMJD6 show increased sensitivity to nucleolar DNA damage as well as loss and rearrangements of rDNA repeats upon irradiation. (prolekarniky.cz)
  • Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. (pnas.org)
  • We determined almost complete small-subunit ribosomal DNA sequences of 50 reference strains belonging to the genera Corynebacterium, Rhodococcus, and Gordona and compared these sequences with previously published sequences. (nih.gov)
  • The study, conducted in both human and mouse cells, shows that cancer genomes lose copies of repetitive sequences known as ribosomal DNA. (news-medical.net)
  • The few studies that have included analysis of ribosomal DNA thus far have shown that the number of copies of the repetitive sequences expand and contract all the time. (news-medical.net)
  • Nucleotide sequences of the small subunit ribosomal RNA-encoding gene from Opisthorchis viverrini . (springer.com)
  • DNA sequences were used to assess the monophyly and inter-relationships of Miscanthus, Saccharum and related genera in the Saccharum complex. (springer.com)
  • In the 1960s, three scientists proposed a theory that DNA sequences evolve at a relatively constant rate. (study.com)
  • Comparing the DNA sequences of the rRNA genes of many different species shows slight variations. (study.com)
  • Diversity and Inheritance of Intergenic Spacer Sequences of 45S Ribosomal DNA among Accessions of Brassica oleracea L. var. (mdpi.com)
  • DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA. (umassmed.edu)
  • All of the marine bacterioplankton-derived 16S ribosomal DNA sequences previously deposited in GenBank were reanalyzed to determine the number of bacterial species in the oceanic surface waters. (asm.org)
  • The phylogenetic position of subfamily Monotropoideae (Ericaceae) inferred from large ribosomal subunit (26S) rRNA gene DNA sequences. (thefreelibrary.com)
  • This Relationship is inferred from a maximum parsimony analysis using large ribosomal subunit (26S) rRNA gene DNA sequences. (thefreelibrary.com)
  • Phylogenetic relationships of amphibian families inferred from DNA sequences of mitochondrial 12S and 16S ribosomal RNA genes. (nii.ac.jp)
  • Genomic origin and organization of the hybrid Poa jemtlandica (Poaceae) verified by genomic in situ hybridization and chloroplast DNA sequences. (springer.com)
  • Distribution of highly repeated DNA sequences in species of the genus Secale . (springer.com)
  • Evolutionary trends of different repetitive DNA sequences during speciation in the genus Secale . (springer.com)
  • The 16S ribosomal DNA sequences of endosymbionts from the trypanosomatid protozoa (Crithidia spp. (semanticscholar.org)
  • A phylogenetic study of Gagea and Lloydia (Liliaceae) was conducted using sequences of nuclear ribosomal internal transcribed spacer (ITS) and plastid ( rpl16 intron, trnL intron, trnL-F spacer, matK and the psbA - trnH spacer) DNA regions. (oup.com)
  • Overall, with the exception of a recently diverged species complex with more than three biological species, nuclear ribosomal DNA sequences successfully circumscribed ten distinct biological species, of which two have not been described (and an additional one has not been regarded as a distinct taxonomic species) to date. (biomedcentral.com)
  • We propose that nuclear ribosomal DNA sequences contribute to reliable identification of reproductively isolated and cryptic species of Mitella . (biomedcentral.com)
  • Many studies attempting to resolve plant evolutionary relationships and/or to identify plant species using DNA sequences have assumed that intraspecific genetic diversity is usually lower than interspecific genetic diversity and that sequences derived from a species usually form a monophyletic group. (biomedcentral.com)
  • Objectives - To identify Sarcocystis neurona-specific DNA sequences in the nuclear small subunit ribosomal RNA (nss-rRNA) gene that could be used to distinguish S neurona from other closely related protozoal parasites, and to evaluate a polymerase chain reaction (PCR) test, using broad based primers and a unique species-specific probe on CSF for detection of S neurona in equids. (elsevier.com)
  • They could occur by slippage of the newly synthesized strand during DNA replication or by gene conversion. (wikipedia.org)
  • HOT1 includes an RNA polymerase I (PolI) transcription promoter that catalyzes 35S ribosomal rRNA gene transcription. (wikipedia.org)
  • A restriction enzyme having a recognition site of more than 4bp would be irrelevant with respect to a gene of approximately 1500bp such as that coding for the 16s ribosomal subunit. (wikipedia.org)
  • Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. (pnas.org)
  • Ribosomal (r)DNA undergoes concerted evolution, the mechanisms of which are unequal crossing over and gene conversion. (genetics.org)
  • Nucleotide sequence of a crustacean 18s ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs. (springer.com)
  • Aha, here is that clock idea and now we have linked it to our gene/DNA mutation idea! (study.com)
  • An approximate 1 kb DNA segment of the 26S gene was sequenced for the taxa included in this analysis. (thefreelibrary.com)
  • 2. Physical mapping of 5S and 18S-26S ribosomal RNA gene families in diploid species. (springer.com)
  • Interspecies divergence was much higher at the cox 1 mtDNA gene locus, rendering it suitable for DNA barcoding and particularly valuable in resolving closely related species. (uzh.ch)
  • Evidence for biased gene conversion in concerted evolution of ribosomal DNA. (semanticscholar.org)
  • Abundance of ribosomal RNA gene copies maintains genome integrity. (semanticscholar.org)
  • Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. (asm.org)
  • Procedures - Sequencing of the nuclear small subunit ribosomal RNA gene from a new S neurona isolate (UCD 1) was performed. (elsevier.com)
  • From this sequence, conserved DNA sequence primers were selected and an oligonucleotide probe was designed to hybridize with a unique region of the S neurona gene. (elsevier.com)
  • The present work uses a ribosomal DNA gene probe to differentiate member species of this complex. (flvc.org)
  • An analysis of human cancer genome projects uncovers a counterintuitive loss of ribosomal gene copies. (the-scientist.com)
  • Disseminated subcutaneous nocardiosis caused by Nocardia farcinica diagnosed by FNA biopsy and 16S ribosomal gene sequencing. (biomedsearch.com)
  • This was confirmed by 16S ribosomal gene sequencing. (biomedsearch.com)
  • Partial sequencing of the 18S ribosomal DNA gene of one nemertean and 13 free-living and parasitic Platyhelminthes (556 nucleotides), and of one nemertean and 20 Platyhelminthes (556 nucleotides) was used to test several hypotheses concerning the phylogenetic relationships of Platyhelminthes. (edu.au)
  • Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction. (asm.org)
  • Identification of Serratia marcescens on the basis of polymerase chain reaction-amplified ribosomal DNA spacer polymorphisms. (docphin.com)
  • Histomorphometry of plaque cross-sectional area in the proximal aortas, en face measurement of plaque area over the aortic trees, Pg 16S ribosomal DNA amplification with polymerase chain reaction, ELISA for systemic proinflammatory mediators, and immunolocalization of macrophages in the proximal aorta were performed. (ahajournals.org)
  • In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. (pnas.org)
  • Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. (pnas.org)
  • We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. (pnas.org)
  • These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. (pnas.org)
  • PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. (pnas.org)
  • 16S ribosomal DNA amplification for phylogenetic study. (asm.org)
  • 1995. Identification of Acinetobacter Genomic Species by Amplified Ribosomal DNA Restriction Analysis. (wikipedia.org)
  • Therefore, in this study, amplified ribosomal DNA restriction analysis (ARDRA) was applied to confirm the identity A. baumannii strains as well as to differentiate between the subspecies. (afpm.org.my)
  • Ribosomes are the roundish structures upon which the amino acids of a protein are strung together, following the instructions of a gene's DNA sequence. (plos.org)
  • species of DNA present in ribosomes, where it participates in protein synthesis, rather than in the nucleus. (thefreedictionary.com)
  • Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). (pnas.org)
  • The cells somehow managed to be highly proliferative, made more ribosomal RNA, and synthesized more protein, all with fewer copies of ribosomal DNA. (news-medical.net)
  • Bou Samra E, Buhagiar-Labarchède G, Machon C, Guitton J, Onclercq-Delic R, Green MR, Alibert O, Gazin C, Veaute X, Amor-Guéret M. A role for Tau protein in maintaining ribosomal DNA stability and cytidine deaminase-deficient cell survival. (umassmed.edu)
  • The Drosophila S3 ribosomal protein has important roles in both protein translation and DNA repair. (iupui.edu)
  • Its lyase activity only cleaves AP DNA by a β-elimination reaction, thus further distinguishing itself from the Drosophila S3 protein in lacking a δ-elimination activity. (iupui.edu)
  • In bovine airway smooth-muscle cells platelet-derived growth factor (PDGF) and endothelin (Et-1) stimulate sustained and comparable activation of mitogen-activated protein kinase (MAP kinase) but display very different mitogenic efficacies, with PDGF inducing 50 times more DNA synthesis than Et-1. (gla.ac.uk)
  • To examine additional signalling pathways which may be involved in this response, we investigated the role of phosphatidylinositol 3-kinase (PtdIns 3-kinase)/p70 ribosomal protein S6 kinase (p70s6k) in mediating PDGF- and Et-1-induced mitogenesis, and whether inhibition of this pathway may underly the ability of cAMP to inhibit cell proliferation. (gla.ac.uk)
  • Ribosomal protein S1 forms a wall of the tunnel between RNAP and the 30S subunit, consistent with its role in directing mRNAs onto the ribosome. (rcsb.org)
  • BACKGROUND:Ubiquitin (Ub) and Ub-like proteins (Ub-L) are critical regulators of complex cellular processes such as the cell cycle, DNA repair, transcription, chromatin remodeling, signal translation, and protein degradation. (omicsdi.org)
  • AcrIIA4, an inhibitor protein from the Listeria bacteriophage, can block DNA from binding to Cas9 during genome editing. (the-scientist.com)
  • In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. (uab.edu)
  • As a result, this DNA can provide phylogenetic information of species belonging to wide systematic levels. (wikipedia.org)
  • The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. (pnas.org)
  • Conflicting phylogenetic hypotheses for the parasitic Platyhelminthes tested by partial sequencing of 18S ribosomal RNA. (springer.com)
  • The phylogenetic position of the Aspid oboth-sea within the parasite flatworms inferred from ribosomal RNA sequence data. (springer.com)
  • With the advent of DNA sequencing technology to infer phylogenetic relationships, investigators began searching for genetic loci that were both phylogenetically informative and readily sequenced in most organisms. (peerj.com)
  • Here we report a phylogenetic investigation of restriction endonuclease site variation in the ribosomal RNA cistrons of 25 species in 14 genera of Indo-West Pacific Megachiroptera. (edu.au)
  • Ribosomal DNA evolution at the population level: nucleotide variation in intergenic spacer arrays of Daphnia pulex. (genetics.org)
  • Nucleotide variation was surveyed in 21 subrepeat arrays from the ribosomal DNA intergenic spacer of three Daphnia pulex populations. (genetics.org)
  • Three DNA regions were sequenced, including the trnL intron and the trnL-F intergenic spacer of the plastid genome and the ITS region of nuclear ribosomal DNA (nrDNA). (springer.com)
  • An automated ribosomal intergenic spacer analysis of fresh and incubated fecal DNA confirmed association between microbial fingerprinting and short chain VFAs, phenolic and sulfuric VOCs. (frontiersin.org)
  • The nuclear ribosomal small subunit has poor species-level resolution in fungi. (pnas.org)
  • Results are presented for nuclear ribosomal DNA (nrDNA) across the milkweed genus, Asclepias . (peerj.com)
  • Nuclear ribosomal DNA copies are assembled as tandem repeats at one or more loci in the genome, with each locus being known as an array. (peerj.com)
  • A nonlinear, multiple regression analysis indicated that the nuclear ribosomal DNA distances are sufficient to explain the observed pattern of F1 hybrid pollen fertility, and supplementation with chloroplast DNA distance data does not improve the explanatory power. (biomedcentral.com)
  • Individual plants of several Amelanchier taxa contain many polymorphic nucleotide sites in the internal transcribed spacers (ITS) of nuclear ribosomal DNA (nrDNA). (elsevier.com)
  • We have sequenced the complete 18S, 5.8S, 26S ribosomal RNA genes and their internal transcribed spacers (ITS1) and ITS2 regions (5126 nucleotides) from 18 G. candidum strains from various environmental niches, with a focus on dairy strains. (nih.gov)
  • Objective: The present study was conducted to evaluate the efficacy of restriction fragment length polymorphism (RFLP) analysis of PCR amplified ribosomal (r) DNA including internal transcribed spacers (ITS), as an identification tool. (aber.ac.uk)
  • However, it is known that the DNA encoding ribosomes can change simultaneously in a whole population. (pnas.org)
  • Apart from the ribosomal RNA, ribosomes also have proteins (about 40% by weight). (biology-online.org)
  • The variability of chemotaxonomic characteristics within the genus Corynebacterium suggests that small-subunit ribosomal DNA sequence analysis is probably the most straightforward method for confirming that a bacterium belongs to this genus. (nih.gov)
  • Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. (pnas.org)
  • We have therefore analysed E. gracilis strain Z 16S-23S spacer DNA at the nucleotide level, hoping this would allow identification of tRNA genes together with the processing sites of the respective primary transcripts. (nature.com)
  • Here, we present a protocol for tracing genomic DNA (gDNA) contamination in RNA samples. (jove.com)
  • Evolutionary insights into the genomic organization of major ribosomal DNA in ant chromosomes. (bvsalud.org)
  • The currently accepted 25 species of the genus Trichosporon were examined as shown in Table 1 Trichosporon DNA was extracted by the method of Makimura et al. (asm.org)
  • So the differences in the DNA of two species is directly proportional to the length of time that has passed since they shared a common ancestor (the last point in evolutionary time when they were the 'same' species). (study.com)
  • The more similar the DNA of the two species, the more closely related they are and the more recently they shared a common ancestor. (study.com)
  • 16S ribosomal DNA sequence identities of beta-proteobacterial endosymbionts in three Crithidia species. (semanticscholar.org)
  • Although DNA sequence analysis is becoming a powerful tool for identifying species, it is not easy to assess whether the observed genetic disparity corresponds to reproductive isolation. (biomedcentral.com)
  • If such species non-monophyly is common among plants, any attempt at DNA-based approaches for taxonomy would lose their relevance. (biomedcentral.com)
  • The rationale for using ribosomal DNA clones to provide such diagnostic probes to distinguish among other morphologically identical insect species is also discussed. (flvc.org)
  • The data showed that C. brunnea is a valid species that should be transferred to Ophiostoma, demonstrating that DNA data can compensate for the presumed or actual lack of morphological features lost during either long-term culturing or disintegration of holotype specimens. (umanitoba.ca)
  • Here we show that signaling pathways that sense environmental nutrients control genome change at the ribosomal DNA. (pnas.org)
  • Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. (pnas.org)
  • Of the 3.2 billion DNA building blocks of a human genome, ribosomal DNA accounts for only 13,000, but its puny representation is not in proportion to its importance. (plos.org)
  • Our results suggest that off-loading copies of ribosomal DNA could create instability in the genome that makes cells particularly susceptible to chemotherapy with DNA-damaging drugs. (news-medical.net)
  • Previous studies on budding yeast showed that whittling down the number of copies of ribosomal DNA created a genome that was very sensitive to DNA damage. (news-medical.net)
  • Ribosomal DNA is one of the most variable regions in the human genome with respect to copy number. (nih.gov)
  • Nucleotide excision repair (NER) guarantees genome integrity and proper cellular functions against UV-induced DNA damage. (archives-ouvertes.fr)
  • In this context, we investigated the contribution of ribosomal genes to genome reshuffling since they are generally located in pericentromeric or subtelomeric regions, and form repeat clusters on different chromosomes. (biomedcentral.com)
  • Redistribution of ribosomal DNA after blocking of transcription induced by actinomycin D. (nih.gov)
  • It can be stimulated in many ways including single-strand DNA breaks, mismatches, transcription, and replication. (genetics.org)
  • Post-translational modifications of histones play a key role in DNA-based processes, like transcription, by modulating chromatin structure. (prolekare.cz)
  • Histone modifications often function by recruiting effector molecules to alter the structure of chromatin in order to regulate DNA-based processes such as transcription, replication and DNA repair [1] . (prolekare.cz)
  • Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. (uab.edu)
  • The present study evaluated the function of p90 ribosomal S6 kinase (RSK) in the Drosophila circadian system. (jneurosci.org)
  • The ribosomal RNAs form two subunits, i.e. large subunit and small subunit. (biology-online.org)
  • Chloroplasts of the unicellular flagellate eukaryote Euglena gracilis contain several copies of a circular 135-140-kilobase pair DNA 1 which codes for chloroplast-specific stable RNAs (16S, 23S (refs 2, 3), 5S rRNAs 4 and tRNAs 5 ) and for an unknown number of chloroplast-specific proteins. (nature.com)
  • The ribosomal RNA does not carry the code in making proteins. (biology-online.org)
  • Using a hidden Markov model analysis based on the crystal structures of several DNA repair proteins, the enzymatic differences between Drosophila and human S3 were suggested by the absence of a conserved glutamine residue in human S3 that usually resides at the cleft of the deduced active site pocket of DNA glycosylases. (iupui.edu)
  • The translation apparatus of the mitochondria is composed of rRNAs and tRNAs encoded by the mitochondrial DNA, together with proteins synthesized in the cytoplasm. (news-medical.net)
  • These include factors required for initiation, elongation, and termination: mitochondrial ribosomal proteins (MRPs), aminoacyl-tRNA synthetases, and methionyl-tRNA transformylase. (news-medical.net)
  • Polymorphism and evolution of ribosomal DNA in tea (Camellia sinensis, Theaceae). (semanticscholar.org)
  • Broad-range sequencing of bacterial 16S ribosomal DNA represents an alternative approach for establishing the underlying organism in IE. (biomedcentral.com)
  • Consistently, dnl4 cells displayed altered fork structures at the replication fork barrier, leading us to propose an as yet unrecognized role for Dnl4 in the maintenance of ribosomal DNA stability. (unibas.ch)
  • Patterns obtained from several restriction enzymes can be used to phylogenetically characterize cultured isolates and 16s genes obtained through cloning from community DNA Vaneechoutte et al. (wikipedia.org)
  • Overnight digestion (10-16 hours) of about 300-500 ng of amplicon DNA in a 20 μL system with 4-5 units of Restriction Enzyme along with the recommended buffer at the prescribed temperature is recommended. (wikipedia.org)
  • Restriction enzyme analysis of PCR-amplified ribosomal DNA with four different enzymes proved that all isolates were C. inconspicua. (elsevier.com)
  • For three, he saw a loss of ribosomal DNA copies in the cancer cells relative to the normal cells. (news-medical.net)
  • and other types of DNA damage ( e.g. , methylation or oxidation), can stimulate recombination during mitosis. (genetics.org)
  • DNA Methylation, Chromatin Structure and Expression of Maize Ribosomal RNA Genes. (lsu.edu)
  • Using this criteria, scientists keyed in on the genes for ribosomal RNA and mitochondrial DNA. (study.com)
  • All known living organisms contain genes for ribosomal RNA (rRNA) . (study.com)
  • In this study, we examine the bacterial components of the wound bioburden using two clinical laboratory tests: traditional aerobic culturing and recently developed culture-free sequencing of bacterial 16S DNA. (biomedcentral.com)
  • Any of various regions of DNA in eukaryotes that are transcribed into precursors of ribosomal RNA. (thefreedictionary.com)
  • Mitotic recombination occurs in all eukaryotes and is intimately involved in the repair of damaged DNA ( H elleday 2003 ). (genetics.org)
  • The method is suited for reliable and sensitive detection of DNA contamination in most eukaryotes and prokaryotes. (jove.com)
  • We demonstrate that circANRIL regulates the maturation of precursor ribosomal RNA (pre-rRNA), thus controlling ribosome biogenesis and nucleolar stress. (nature.com)
  • In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. (pnas.org)
  • Ribosomal RNA is a specialized RNA molecule present in the ribosome . (biology-online.org)
  • Ribosomal DNA is an effective marker of Brassica chromosomes. (springer.com)
  • Hybridization of the wheat DNA probe revealed two major labelling sites on mitotic barley chromosomes 5I (7H) and 6I (6H), as well as several minor sites. (deepdyve.com)
  • With the human DNA probe, signals were detected in the major sites of the ribosomal genes on chromosomes 5I (7H) and 6I (6H) only when the chromosome preparations were obtained using an optimized technique with obligatory pepsin treatment followed by hybridization. (deepdyve.com)
  • Thus, this study demonstrates that physical mapping of plant chromosomes with human DNA probes that are 60 to 70% homologous to the plant genes is possible. (deepdyve.com)
  • The findings, published June 22, 2017, in PLoS Genetics, suggest that ribosomal DNA copy number could be used to predict which cancers will be sensitive to DNA-damaging chemotherapeutics. (news-medical.net)
  • Ribosomal DNA in the grasshopper Podisma pedestris: escape from concerted evolution. (semanticscholar.org)
  • Organization of replication of ribosomal DNA in Saccharomyces cerevisiae. (asm.org)
  • DNA double-strand breaks (DSB) were shown to occur at the replication fork barrier in the ribosomal DNA of Saccharomyces cerevisiae using 2D-gel electrophoresis. (unibas.ch)
  • We quantified these DSBs and show that a surprising 14% of replicating ribosomal DNA molecules are broken at the replication fork barrier in replicating wild-type cells. (unibas.ch)
  • We report here two highly reliable ribosomal DNA-based single nucleotide polymorphism (SNP) markers, CxpG2T and CxpA2d, for detecting Cx. (ajtmh.org)
  • Chromosomal polymorphism of ribosomal genes in the genus Oryza . (springer.com)
  • First author Baoshan Xu, Ph.D., a former postdoctoral research associate in the Gerton Lab now starting his own lab at Sun Yat-sen University in China, worked with Hua Li, Ph.D., to use computational methods to count the number of copies of ribosomal DNA in normal and cancer cells of 162 patients from the eight projects. (news-medical.net)
  • This time, Xu used a sophisticated technique called droplet digital PCR to count the ribosomal DNA copies in normal and cancer cells from the mice. (news-medical.net)
  • Loss of copies occurs early and is associated with hypersensitivity to DNA damage. (nih.gov)
  • The nucleosome is the basic unit of chromatin and comprises 147 base pairs of DNA wrapped around a histone octamer, which contains two copies of each of the four histones H2A, H2B, H3 and H4. (prolekare.cz)
  • Ribosomal RNA multigene loci: nomads of the Triticeae genomes. (springer.com)
  • Methods: Total cellular DNA was extracted from 26 Japanese isolates of T. tonsurans, along with several taxa of the members in the T. mentagrophytes complex, T. rubrum, T. violaceum and Epidermophyton floccosum, using a mini-preparation method. (aber.ac.uk)
  • Analysis of the distribution of nucleotide variation suggested that the populations were quite divergent, a result that is concordant with previous surveys of allozyme and mitochondrial DNA variation. (genetics.org)
  • In this lesson, we explore keeping time and dating evolution by tracking genetic mutations in our favorite molecular clocks: mitochondrial DNA and ribosomal RNA. (study.com)
  • A piece of DNA in which random, neutral mutations accumulate at a consistent rate is called a molecular clock . (study.com)
  • This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing), and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. (biomedcentral.com)
  • A few, however, are encoded by the mitochondrial DNA (mtDNA) and are produced by the mitochondrial translation machinery. (news-medical.net)
  • 7. Larsen DH, Stucki M (2015) Nucleolar responses to DNA double-strand breaks. (prolekarniky.cz)
  • 9. Harding SM, Boiarsky JA, Greenberg RA (2015) ATM Dependent Silencing Links Nucleolar Chromatin Reorganization to DNA Damage Recognition. (prolekarniky.cz)
  • 2019) Double-strand breaks in ribosomal RNA genes activate a distinct signaling and chromatin response to facilitate nucleolar restructuring and repair. (prolekarniky.cz)
  • 13. van Sluis M, McStay B (2015) A localized nucleolar DNA damage response facilitates recruitment of the homology-directed repair machinery independent of cell cycle stage. (prolekarniky.cz)
  • DNA regions that are repetitive often undergo recombination events. (wikipedia.org)
  • Six DNA regions were evaluated as potential DNA barcodes for Fungi , the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. (pnas.org)
  • The rRNA genes are located within three tandemly repeated DNA regions of approximately 5.6 kilobase pairs each 6-8 and the arrangement of the structural genes within each repeat follows the prokaryotic pattern, being 5′-16S-23S-5S-3′ (ref. 9). (nature.com)
  • The objective of this study is to evaluate generic and infrageneric circumscription of Gagea and Lloydia using DNA sequence data. (oup.com)
  • Use of partial large ribosomal sequence data to assess the relationship of C. brunnea to other Ophiostoma spp. (umanitoba.ca)
  • Ribosomal DNA polymorphisms in the yeast Geotrichum candidum. (nih.gov)
  • Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. (uab.edu)
  • The latter obstacle was circumvented by cloning and sequencing of 16S ribosomal DNAs (rDNAs) from uncultured marine microbial communities. (asm.org)
  • The 16S ribosomal DNAs (rDNAs) of two strains of Francisella tularensis and one strain of Francisella philomiragia were sequenced. (microbiologyresearch.org)
  • Lack of the H4 N-alpha acetyltransferase (Nat4) activity results specifically in increased deposition of asymmetric dimethylation of histone H4 arginine 3 (H4R3me2a) and in enhanced ribosomal-DNA silencing. (prolekare.cz)
  • This DNA fragment contains a mitotic recombination hotspot, referred to as HOT1. (wikipedia.org)
  • The differences between cereal genomes of distant taxa are characterized by large variations in their DNA content (4) and the ex. (psu.edu)