OrganismsChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesAnthropology, Education, Sociology and Social PhenomenaTechnology, Industry, AgricultureInformation ScienceHealth Care
DNA PrimersTemplates, GeneticBase SequenceHIV Reverse TranscriptaseRNA-Directed DNA PolymeraseRibonuclease HEuplotesDeoxyguanine NucleotidesMolecular Sequence DataPolymerase Chain ReactionDNA-Directed DNA PolymeraseRNADNADideoxynucleotidesDNA ReplicationTelomeraseAphidicolinDNA, Single-StrandedDNA, ViralDNA Polymerase INucleic Acid ConformationNucleotidesSubstrate SpecificityReverse Transcriptase InhibitorsKineticsRNA, ViralMutationBinding SitesEscherichia coliHIV-1Sequence Analysis, DNADNA, BacterialRandom Amplified Polymorphic DNA TechniqueSensitivity and SpecificityCloning, MolecularRNA, Transfer, LysPhylogenyAmino Acid SequenceRNA, Ribosomal, 16SSpecies SpecificityDNA, RibosomalTranscription, GeneticDNA PrimaseMethacrylatesSequence Homology, Nucleic AcidDental BondingGenes, BacterialNucleic Acid Amplification TechniquesResin CementsSequence AlignmentOligonucleotidesOligonucleotide ProbesTaq PolymeraseDNA FingerprintingRNA, MessengerDNA ProbesElectrophoresis, Agar GelDNA, PlantMicrosatellite RepeatsGenotypeRNA, BacterialDNA, ComplementaryPolymorphism, Restriction Fragment LengthNucleic Acid HybridizationDNA, FungalGenetic VariationShear StrengthReverse Transcriptase Polymerase Chain ReactionBlotting, SouthernGenetic MarkersBacterial ProteinsRestriction MappingSequence Homology, Amino AcidPolymorphism, GeneticDNA, Ribosomal SpacerRNA, Ribosomal, 18SDentin-Bonding AgentsRNA NucleotidyltransferasesGene LibraryOligodeoxyribonucleotides
DNA Primers
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Templates, Genetic
Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.
Base Sequence
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
HIV Reverse Transcriptase
A reverse transcriptase encoded by the POL GENE of HIV. It is a heterodimer of 66 kDa and 51 kDa subunits that are derived from a common precursor protein. The heterodimer also includes an RNAse H activity (RIBONUCLEASE H, HUMAN IMMUNODEFICIENCY VIRUS) that plays an essential role the viral replication process.
RNA-Directed DNA Polymerase
An enzyme that synthesizes DNA on an RNA template. It is encoded by the pol gene of retroviruses and by certain retrovirus-like elements. EC 2.7.7.49.
Ribonuclease H
A ribonuclease that specifically cleaves the RNA moiety of RNA:DNA hybrids. It has been isolated from a wide variety of prokaryotic and eukaryotic organisms as well as RETROVIRUSES.
Euplotes
A genus of ciliate protozoa having a dorsoventrally flattened body with widely spaced rows of short bristle-like cilia on the dorsal surface.
Deoxyguanine Nucleotides
Guanine nucleotides which contain deoxyribose as the sugar moiety.
Molecular Sequence Data
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Polymerase Chain Reaction
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
DNA-Directed DNA Polymerase
DNA-dependent DNA polymerases found in bacteria, animal and plant cells. During the replication process, these enzymes catalyze the addition of deoxyribonucleotide residues to the end of a DNA strand in the presence of DNA as template-primer. They also possess exonuclease activity and therefore function in DNA repair.
RNA
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
DNA
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Dideoxynucleotides
The phosphate esters of DIDEOXYNUCLEOSIDES.
DNA Replication
The process by which a DNA molecule is duplicated.
Telomerase
An essential ribonucleoprotein reverse transcriptase that adds telomeric DNA to the ends of eukaryotic CHROMOSOMES.
Aphidicolin
An antiviral antibiotic produced by Cephalosporium aphidicola and other fungi. It inhibits the growth of eukaryotic cells and certain animal viruses by selectively inhibiting the cellular replication of DNA polymerase II or the viral-induced DNA polymerases. The drug may be useful for controlling excessive cell proliferation in patients with cancer, psoriasis or other dermatitis with little or no adverse effect upon non-multiplying cells.
DNA, Single-Stranded
A single chain of deoxyribonucleotides that occurs in some bacteria and viruses. It usually exists as a covalently closed circle.
DNA, Viral
Deoxyribonucleic acid that makes up the genetic material of viruses.
DNA Polymerase I
A DNA-dependent DNA polymerase characterized in prokaryotes and may be present in higher organisms. It has both 3'-5' and 5'-3' exonuclease activity, but cannot use native double-stranded DNA as template-primer. It is not inhibited by sulfhydryl reagents and is active in both DNA synthesis and repair. EC 2.7.7.7.
Nucleic Acid Conformation
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
Nucleotides
The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)
Substrate Specificity
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Reverse Transcriptase Inhibitors
Inhibitors of reverse transcriptase (RNA-DIRECTED DNA POLYMERASE), an enzyme that synthesizes DNA on an RNA template.
Kinetics
The rate dynamics in chemical or physical systems.
RNA, Viral
Ribonucleic acid that makes up the genetic material of viruses.
Mutation
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Binding Sites
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Escherichia coli
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
HIV-1
The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.
Sequence Analysis, DNA
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
DNA, Bacterial
Deoxyribonucleic acid that makes up the genetic material of bacteria.
Random Amplified Polymorphic DNA Technique
Technique that utilizes low-stringency polymerase chain reaction (PCR) amplification with single primers of arbitrary sequence to generate strain-specific arrays of anonymous DNA fragments. RAPD technique may be used to determine taxonomic identity, assess kinship relationships, analyze mixed genome samples, and create specific probes.
Sensitivity and Specificity
Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)
Cloning, Molecular
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
RNA, Transfer, Lys
A transfer RNA which is specific for carrying lysine to sites on the ribosomes in preparation for protein synthesis.
Phylogeny
The relationships of groups of organisms as reflected by their genetic makeup.
Amino Acid Sequence
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
RNA, Ribosomal, 16S
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
Species Specificity
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
DNA, Ribosomal
DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.
Transcription, Genetic
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
DNA Primase
A single-stranded DNA-dependent RNA polymerase that functions to initiate, or prime, DNA synthesis by synthesizing oligoribonucleotide primers. EC 2.7.7.-.
Methacrylates
Acrylic acids or acrylates which are substituted in the C-2 position with a methyl group.
Sequence Homology, Nucleic Acid
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
Dental Bonding
An adhesion procedure for orthodontic attachments, such as plastic DENTAL CROWNS. This process usually includes the application of an adhesive material (DENTAL CEMENTS) and letting it harden in-place by light or chemical curing.
Genes, Bacterial
The functional hereditary units of BACTERIA.
Nucleic Acid Amplification Techniques
Laboratory techniques that involve the in-vitro synthesis of many copies of DNA or RNA from one original template.
Resin Cements
Dental cements composed either of polymethyl methacrylate or dimethacrylate, produced by mixing an acrylic monomer liquid with acrylic polymers and mineral fillers. The cement is insoluble in water and is thus resistant to fluids in the mouth, but is also irritating to the dental pulp. It is used chiefly as a luting agent for fabricated and temporary restorations. (Jablonski's Dictionary of Dentistry, 1992, p159)
Sequence Alignment
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Oligonucleotides
Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)
Oligonucleotide Probes
Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.
Taq Polymerase
A heat stable DNA-DIRECTED DNA POLYMERASE from the bacteria Thermus aquaticus. It is widely used for the amplification of genes through the process of POLYMERASE CHAIN REACTION. EC 2.7.7.-.
DNA Fingerprinting
A technique for identifying individuals of a species that is based on the uniqueness of their DNA sequence. Uniqueness is determined by identifying which combination of allelic variations occur in the individual at a statistically relevant number of different loci. In forensic studies, RESTRICTION FRAGMENT LENGTH POLYMORPHISM of multiple, highly polymorphic VNTR LOCI or MICROSATELLITE REPEAT loci are analyzed. The number of loci used for the profile depends on the ALLELE FREQUENCY in the population.
RNA, Messenger
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
DNA Probes
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
Electrophoresis, Agar Gel
Electrophoresis in which agar or agarose gel is used as the diffusion medium.
DNA, Plant
Deoxyribonucleic acid that makes up the genetic material of plants.
Microsatellite Repeats
A variety of simple repeat sequences that are distributed throughout the GENOME. They are characterized by a short repeat unit of 2-8 basepairs that is repeated up to 100 times. They are also known as short tandem repeats (STRs).
Genotype
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
RNA, Bacterial
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
DNA, Complementary
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Polymorphism, Restriction Fragment Length
Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.
Nucleic Acid Hybridization
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
DNA, Fungal
Deoxyribonucleic acid that makes up the genetic material of fungi.
Genetic Variation
Genotypic differences observed among individuals in a population.
Shear Strength
The internal resistance of a material to moving some parts of it parallel to a fixed plane, in contrast to stretching (TENSILE STRENGTH) or compression (COMPRESSIVE STRENGTH). Ionic crystals are brittle because, when subjected to shear, ions of the same charge are brought next to each other, which causes repulsion.
Reverse Transcriptase Polymerase Chain Reaction
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Blotting, Southern
A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Genetic Markers
A phenotypically recognizable genetic trait which can be used to identify a genetic locus, a linkage group, or a recombination event.
Bacterial Proteins
Proteins found in any species of bacterium.
Restriction Mapping
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
Sequence Homology, Amino Acid
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Polymorphism, Genetic
The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.
DNA, Ribosomal Spacer
The intergenic DNA segments that are between the ribosomal RNA genes (internal transcribed spacers) and between the tandemly repeated units of rDNA (external transcribed spacers and nontranscribed spacers).
RNA, Ribosomal, 18S
Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
Dentin-Bonding Agents
Cements that act through infiltration and polymerization within the dentinal matrix and are used for dental restoration. They can be adhesive resins themselves, adhesion-promoting monomers, or polymerization initiators that act in concert with other agents to form a dentin-bonding system.
RNA Nucleotidyltransferases
Enzymes that catalyze the template-directed incorporation of ribonucleotides into an RNA chain. EC 2.7.7.-.
Gene Library
A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.
Oligodeoxyribonucleotides
A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.

Activation of systemic acquired silencing by localised introduction of DNA. (1/43244)

BACKGROUND: In plants, post-transcriptional gene silencing results in RNA degradation after transcription. Among tobacco transformants carrying a nitrate reductase (Nia) construct under the control of the cauliflower mosaic virus 35S promoter (35S-Nia2), one class of transformants spontaneously triggers Nia post-transcriptional gene silencing (class II) whereas another class does not (class I). Non-silenced plants of both classes become silenced when grafted onto silenced stocks, indicating the existence of a systemic silencing signal. Graft-transmitted silencing is maintained in class II but not in class I plants when removed from silenced stocks, indicating similar requirements for spontaneous triggering and maintenance. RESULTS: Introduction of 35S-Nia2 DNA by the gene transfer method called biolistics led to localised acquired silencing (LAS) in bombarded leaves of wild-type, class I and class II plants, and to systemic acquired silencing (SAS) in class II plants. SAS occurred even if the targeted leaf was removed 2 days after bombardment, indicating that the systemic signal is produced, transmitted and amplified rapidly. SAS was activated by sense, antisense and promoterless Nia2 DNA constructs, indicating that transcription is not required although it does stimulate SAS. CONCLUSIONS: SAS was activated by biolistic introduction of promoterless constructs, indicating that the DNA itself is a potent activator of post-transcriptional gene silencing. The systemic silencing signal invaded the whole plant by cell-to-cell and long-distance propagation, and reamplification of the signal.  (+info)

Impaired translesion synthesis in xeroderma pigmentosum variant extracts. (2/43244)

Xeroderma pigmentosum variant (XPV) cells are characterized by a cellular defect in the ability to synthesize intact daughter DNA strands on damaged templates. Molecular mechanisms that facilitate replication fork progression on damaged DNA in normal cells are not well defined. In this study, we used single-stranded plasmid molecules containing a single N-2-acetylaminofluorene (AAF) adduct to analyze translesion synthesis (TLS) catalyzed by extracts of either normal or XPV primary skin fibroblasts. In one of the substrates, the single AAF adduct was located at the 3' end of a run of three guanines that was previously shown to induce deletion of one G by a slippage mechanism. Primer extension reactions performed by normal cellular extracts from four different individuals produced the same distinct pattern of TLS, with over 80% of the products resulting from the elongation of a slipped intermediate and the remaining 20% resulting from a nonslipped intermediate. In contrast, with cellular extracts from five different XPV patients, the TLS reaction was strongly reduced, yielding only low amounts of TLS via the nonslipped intermediate. With our second substrate, in which the AAF adduct was located at the first G in the run, thus preventing slippage from occurring, we confirmed that normal extracts were able to perform TLS 10-fold more efficiently than XPV extracts. These data demonstrate unequivocally that the defect in XPV cells resides in translesion synthesis independently of the slippage process.  (+info)

Overexpression of CuZn superoxide dismutase protects RAW 264.7 macrophages against nitric oxide cytotoxicity. (3/43244)

Initiation of nitric oxide (NO.)-mediated apoptotic cell death in RAW 264.7 macrophages is associated with up-regulation of mitochondrial manganese superoxide dismutase (MnSOD; SOD2) and down-regulation of cytosolic copper zinc superoxide dismutase (CuZnSOD; SOD1) at their individual mRNA and protein levels. To evaluate the decreased CuZnSOD expression and the initiation of apoptosis we stably transfected macrophages to overexpress human CuZnSOD. Individual clones revealed a 2-fold increase in CuZnSOD activity. Expression of a functional and thus protective CuZnSOD was verified by attenuated superoxide (O2(.)-)-mediated apoptotic as well as necrotic cell death. In this study we showed that SOD-overexpressing macrophages (R-SOD1-12) were also protected against NO.-initiated programmed cell death. Protection was substantial towards NO. derived from exogenously added NO donors or when NO. was generated by inducible NO synthase activation, and was evident at the level of p53 accumulation, caspase activation and DNA fragmentation. Stimulation of parent and SOD-overexpressing cells with a combination of lipopolysaccharide and murine interferon gamma produced equivalent amounts of nitrite/nitrate, which ruled out attenuated inducible NO. synthase activity during protection. Because protection by a O2(.)--scavenging system during NO. -intoxication implies a role of NO. and O2(.)- in the progression of cell damage, we used uric acid to delineate the role of peroxynitrite during NO.-elicited apoptosis. The peroxynitrite scavenger uric acid left S-nitrosoglutathione or spermine-NO-elicited apoptosis unaltered, blocking only 3-morpholinosydnonimine-mediated cell death. As a result we exclude peroxynitrite from contributing, to any major extent, to NO. -mediated apoptosis. Therefore protection observed with CuZnSOD overexpression is unlikely to stem from interference with peroxynitrite formation and/or action. Unequivocally, the down-regulation of CuZnSOD is associated with NO. cytotoxicity, whereas CuZnSOD overexpression protects macrophages from apoptosis.  (+info)

Co-expression of glutathione S-transferase with methionine aminopeptidase: a system of producing enriched N-terminal processed proteins in Escherichia coli. (4/43244)

We describe here an Escherichia coli expression system that produces recombinant proteins enriched in the N-terminal processed form, by using glutathione S-transferase cGSTM1-1 and rGSTT1-1 as models, where c and r refer to chick and rat respectively. Approximately 90% of the cGSTM1-1 or rGSTT1-1 overexpressed in E. coli under the control of a phoA promoter retained the initiator methionine residue that was absent from the mature isoenzymes isolated from tissues. The amount of initiator methionine was decreased to 40% of the expressed cGSTM1-1 when the isoenzyme was co-expressed with an exogenous methionine aminopeptidase gene under the control of a separate phoA promoter. The recombinant proteins expressed were mainly methionine aminopeptidase. The yield of cGSTM1-1 was decreased to 10% of that expressed in the absence of the exogenous methionine aminopeptidase gene. By replacing the phoA with its natural promoter, the expression of methionine aminopeptidase decreased drastically. The yield of the co-expressed cGSTM1-1 was approx. 60% of that in the absence of the exogenous methionine aminopeptidase gene; approx. 65% of the initiator methionine residues were removed from the enzyme. Under similar conditions, N-terminal processing was observed in approx. 70% of the recombinant rGSTT1-1 expressed. By increasing the concentration of phosphate in the growth medium, the amount of initiator methionine on cGSTM1-1 was decreased to 14% of the overexpressed isoenzymes, whereas no further improvement could be observed for rGSTT1-1. The initiator methionine residue does not affect the enzymic activities of either cGSTM1-1 or rGSTT1-1. However, the epoxidase activity and the 4-nitrobenzyl chloride-conjugating activity of the purified recombinant rGSTT1-1 are markedly higher that those reported recently for the same isoenzyme isolated from rat livers.  (+info)

Differential regulation of the human nidogen gene promoter region by a novel cell-type-specific silencer element. (5/43244)

Transfection analyses of the human nidogen promoter region in nidogen-producing fibroblasts from adult skin revealed multiple positive and negative cis-acting elements controlling nidogen gene expression. Characterization of the positive regulatory domains by gel mobility-shift assays and co-transfection studies in Drosophila SL2 cells unequivocally demonstrated that Sp1-like transcription factors are essential for a high expression of the human nidogen gene. Analysis of the negative regulatory domains identified a novel silencer element between nt -1333 and -1322, which is bound by a distinct nuclear factor, by using extracts from adult but not from embryonal fibroblasts. In embryonal fibroblasts, which express significantly higher amounts of nidogen mRNA as compared with adult fibroblasts, this inhibitory nidogen promoter region did not affect nidogen and SV40 promoter activities. The silencer element seems to be active only in nidogen-producing cells. Therefore this regulatory element might function in vivo to limit nidogen gene expression in response to external stimuli. However, none of the identified regulatory elements, including the silencer, contribute significantly to cell-specific expression of the human nidogen gene. Instead we provide evidence that gene expression in epidermal keratinocytes that are not producing nidogen is repressed by methylation-specific and chromatin-dependent mechanisms.  (+info)

Role of retinoid receptors in the regulation of mucin gene expression by retinoic acid in human tracheobronchial epithelial cells. (6/43244)

To investigate which retinoid receptors are critical in the regulation by all-trans-retinoic acid (RA) of the mucin genes MUC2, MUC5AC and MUC5B in cultured normal human tracheobronchial epithelial (NHTBE) cells, we used pan-RAR-, pan-RXR- and RAR- isotype (alpha, beta and gamma)-selective agonists and RARalpha- and RARgamma-selective antagonists (RAR is RA receptor and RXR is retinoid X receptor). RAR-, RARalpha- and RARgamma-selective agonists strongly induced mucin mRNAs in a dose-dependent manner, while the RARbeta-selective retinoid only weakly induced mucin gene expression at very high concentrations (1 microM). The pan-RXR-selective agonist by itself did not induce mucin gene expression, but acted synergistically with suboptimal concentrations of the pan-RAR agonist. A retinoid with selective anti-activator-protein-1 activity only marginally induced mucin gene expression. The RARalpha antagonist strongly inhibited mucin gene induction and mucous cell differentiation caused by RA and by the RARalpha- and RARgamma-selective retinoids. In contrast, the RARgamma antagonist only weakly inhibited RARalpha-selective-retinoid-induced mucin gene expression, but completely blocked mucin gene expression induced by the RARgamma-selective retinoid. Our studies indicate that RARalpha is the major retinoid receptor subtype mediating RA-dependent mucin gene expression and mucous cell differentiation, but that the RARgamma isotype can also induce mucin genes. Furthermore these studies suggest that RARbeta is probably not (directly) involved in RA-induced mucin gene expression.  (+info)

Differential regulation of vascular endothelial growth factor and its receptor fms-like-tyrosine kinase is mediated by nitric oxide in rat renal mesangial cells. (7/43244)

Under conditions associated with local and systemic inflammation, mesangial cells and invading immune cells are likely to be responsible for the release of large amounts of nitric oxide (NO) in the glomerulus. To further define the mechanisms of NO action in the glomerulus, we attempted to identify genes which are regulated by NO in rat glomerular mesangial cells. We identified vascular endothelial growth factor (VEGF) and its receptor fms-like tyrosine kinase (FLT-1) to be under the regulatory control of exogenously applied NO in these cells. Using S-nitroso-glutathione (GSNO) as an NO-donating agent, VEGF expression was strongly induced, whereas expression of its FLT-1 receptor simultaneously decreased. Expressional regulation of VEGF and FLT-1 mRNA was transient and occurred rapidly within 1-3 h after GSNO treatment. Expression of a second VEGF-specific receptor, fetal liver kinase-1 (FLK-1/KDR), could not be detected. The inflammatory cytokine interleukin-1beta mediated a moderate increase in VEGF expression after 24 h and had no influence on FLT-1 expression. In contrast, platelet-derived growth factor-BB and basic fibroblast growth factor had no effect on VEGF expression, but strongly induced FLT-1 mRNA levels. Obviously, there is a differential regulation of VEGF and its receptor FLT-1 by NO, cytokines and growth factors in rat mesangial cells.  (+info)

Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin. (8/43244)

Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.  (+info)

PCR Primer Design Tools ReviewPCR Primer Design Tools Review
This month in Alkami PCR Reviews, Lance Larka talks about free online primer design software. Featured in June are DOPE2, DoPrimer, NetPrimer, and Oligos-U-Like/Primers3. His article is at: http://www.alkami.com/reviews/rvwdsgn3.htm Our current list of primer tool links and brief descriptions that we have at http://www.alkami.com/primers/refdsgn.htm includes: * CODEHOP * DOPE2 * DoPrimer * The GPRIME Package * NetPrimer * Oligos-U-Like * Primer Design * Primer3 * Primers! * Primers! Lite * Primer Selection * STS Pipeline v1.2 * The Primer Generator * Web Primer (Stanford) * Web Primers * WWW GeneFisher * xprimer Other primer design resources are listed at http://www.alkami.com/primers/idxprmr.htm The Alkami Biosystems site, http://www.alkami.com, is a comprehensive resource for the polymerase chain reaction. We have online references that include primer design tips and tools, reagent concentrations, polymerase characteristics, PCR methods, and temperature calculations. In addition, you will find ...
http://www.bio.net/bionet/mm/methods/1999-June/075969.html
Primer Design Guide for PCR :: Learn Designing Primers for PCRPrimer Design Guide for PCR :: Learn Designing Primers for PCR
Primer Design for PCR: Primer guidelines page offers a look at the general and useful guidelines laid for designing primers for PCR reaction including Primer Tm considerations, PCR primer cross dimer values, annealing temperature and primer GC%
http://premierbiosoft.com/tech_notes/PCR_Primer_Design.html
Difference between revisions of Designing primers - OpenWetWareDifference between revisions of Designing primers - OpenWetWare
In general, primers are designed to identify specific locations within a long region of DNA, either plasmid or genomic. Primer binding sites are ideally unique within the range of DNA found in the reaction tube. Single primers are used to amplify and label DNA fragments for sequencing reactions, or as probes for Southern blots. Pairs of primers are used to delimit the range of DNA amplified during a PCR reaction. Because biological enzymes selectively add bases on the 3 end of primed double stranded DNA, the binding of the 3 end of the primer is especially important, while the 5 end of the primer can either bind or not, with relatively little effect on most uses of the primer. The binding of the 4-e 3 to the 5 end, the opposite from the DNA synthesis direction found in biological systems. Synthesis starts with a glass bead filled column containing a specific 3 base bound to the glass. Chemically activated nucleotides, termed phosphoramidites, are linked in 3 to 5 order to fabricate the ...
https://openwetware.org/wiki/?title=Designing_primers&diff=407198&oldid=288267
Designing primers - OpenWetWareDesigning primers - OpenWetWare
In general, primers are designed to identify specific locations within a long region of DNA, either plasmid or genomic. Primer binding sites are ideally unique within the range of DNA found in the reaction tube. Single primers are used to amplify and label DNA fragments for sequencing reactions, or as probes for Southern blots. Pairs of primers are used to delimit the range of DNA amplified during a PCR reaction. Because biological enzymes selectively add bases on the 3 end of primed double stranded DNA, the binding of the 3 end of the primer is especially important, while the 5 end of the primer can either bind or not, with relatively little effect on most uses of the primer. The binding of the 4-e 3 to the 5 end, the opposite from the DNA synthesis direction found in biological systems. Synthesis starts with a glass bead filled column containing a specific 3 base bound to the glass. Chemically activated nucleotides, termed phosphoramidites, are linked in 3 to 5 order to fabricate the ...
https://openwetware.org/wiki/Designing_primers
Primer3 - PCR primer design tool download | SourceForge.netPrimer3 - PCR primer design tool download | SourceForge.net
Download Primer3 - PCR primer design tool for free. Design PCR primers from DNA sequence. Widely used (190k Google hits for primer3).
https://sourceforge.net/projects/primer3/?filter=thumbs_up&source=recommended&stars=4
Primer specificityPrimer specificity
Dear All, I searched for an 18S rRNA gene of an organism on the NCBI website. I found the sequence and designed primers using the primer tool on the same website. Now, I want to check the primer specificity (i.e. can I use this primer as an identification tool to detect a specific species using PCR) and the question is: do I need to BLAST the primer sequence (both forward and reverse) or to BLAST the sequence of the amplified fragment (PCR product). Many thanks in advance. Best regards Mohammad Email: moh_aldeeb from yahoo.com Personal Website: http://sites.google.com/site/draldeebsite/ --- On Wed, 7/6/11, mnr mnr ,mnr475 from gmail.com, wrote: , From: mnr mnr ,mnr475 from gmail.com, , Subject: Blunt end cloning , To: methods from magpie.bio.indiana.edu , Date: Wednesday, July 6, 2011, 1:23 PM , Hi all. , , I have tried cloning a potential toxic gene about 1.2 kbp , into E.coli with , T7 promoter. After two months, I am still not successful. I , am now plannig , to do cloning into pUC18 vector ...
http://www.bio.net/bionet/mm/methods/2011-July/105184.html
BOMBSHELL: WHO Coronavirus PCR Test Primer Sequence is Found in All Human DNABOMBSHELL: WHO Coronavirus PCR Test Primer Sequence is Found in All Human DNA
This was important enough that I wanted to get it out immediately. My research into the NCBI database for nucleotide sequences has lead to a stunning discovery. One of the WHO primer sequences in the PCR test for SARS-CoV-2 is found in all human DNA!. The sequence CTCCCTTTGTTGTGTTGT is an 18-character primer sequence found in the WHO coronavirus PCR testing protocol document. The primer sequences are what get amplified by the PCR process in order to be detected and designated a positive test result. It just so happens this exact same 18-character sequence, verbatim, is also found on Homo sapiens chromosome 8! As far as I can tell, this means that the WHO test kits should find a positive result in all humans. Can anyone explain this otherwise?. I really cannot overstate the significance of this finding. At minimum, it should have a notable impact on test results.. ...
http://tapnewswire.com/2020/08/bombshell-who-coronavirus-pcr-test-primer-sequence-is-found-in-all-human-dna/
Oligos/Primers/Probes | Oligonukleotidy / primery / sondyOligos/Primers/Probes | Oligonukleotidy / primery / sondy
(KudoZ) English to Czech translation of Oligos/Primers/Probes: Oligonukleotidy / primery / sondy [Biochemie - Chemistry; Chem Sci/Eng (Science)].
https://www.proz.com/kudoz/english_to_czech/chemistry%3B_chem_sci_eng/2345246-oligos_primers_probes.html
Sequencing Primers and Plasmids - Molecular Biology - BioForumSequencing Primers and Plasmids - Molecular Biology - BioForum
Sequencing Primers and Plasmids - posted in Molecular Biology: Im a little confused about the notation of the sequencing primers listed on the plasmid map for Invitrogens pCR 2.1 and 4.0 used in TOPO TA cloning. Why is the forward primer 3 insertion site while the reverse primer 5 insertion. I thought it is opposite of that. Looking for some explanation. Wondering if Im looking at the map wrong, or if Im not understanding something. Link for map is below.http:...
http://www.protocol-online.org/forums/topic/28091-sequencing-primers-and-plasmids/
BOMBSHELL: WHO Coronavirus PCR Test Primer Sequence is Found in All Human DNA - NetnewscyBOMBSHELL: WHO Coronavirus PCR Test Primer Sequence is Found in All Human DNA - Netnewscy
The sequence CTCCCTTTGTTGTGTTGT is an 18-character primer sequence found in the WHO coronavirus PCR testing protocol document. The primer sequences are what get amplified by the PCR process in order to be detected and designated a positive test result. It just so happens this exact same 18-character sequence, verbatim, is also found on Homo sapiens chromosome 8! As far as I can tell, this means that the WHO test kits should find a positive result in all humans. Can anyone explain this otherwise ...
https://www.netnewscy.com/2020/08/bombshell-who-coronavirus-pcr-test.html
Free Universal Primers - Resources - GENEWIZFree Universal Primers - Resources - GENEWIZ
GENEWIZ offers a variety of free universal primers for sequencing. These free universal primers are being updated to reflect the needs of our customers. Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). If you are unsure which CLIMS system you are using, please contact our Technical Support team at 877-GENEWIZ, ext. 2. ...
https://www.genewiz.com/en/Public/Resources/Free-Universal-Primers
Primer Design with Oligo Primer Analysis Software v. 7Primer Design with Oligo Primer Analysis Software v. 7
OLIGO performs a range of functions for researchers in PCR and related technologies, enables to design consensus, multiplex and degenerate primers. Reverse translation, restriction enzyme and open reading frames analysis, oligonucleotide database, primer secondary structure, LCR, siRNA, molecular beacons and nested primers design, real time PCR, batch file processing.
http://oligo.net/index.html
kapa-sybr-fast-qpcr-kits-faq | China-Mainland | Sigma-Aldrichkapa-sybr-fast-qpcr-kits-faq | China-Mainland | Sigma-Aldrich
The reasons for primer dimer formation in an NTC are often due to multiple factors. These include: sub-optimal primer annealing temperature (often due to differences in buffering conditions between different qPCR kits), sub-optimal primer synthesis (HPLC-purified primers result in less primer dimer formation and are useful for low copy number detection), and poor primer design (using software such as Primer3 is recommended when designing primers). An alternative is to reduce the total number of cycles in a qPCR reaction if amplification of the primer dimer lies outside of the range of the experimental data eg. if the sample being tested has an average Cq of 28 cycles and contains specific product only (no primer dimer), and the NTC amplifies a primer dimer after 37 cycles, the reaction can be run for 35 cycles, rather than 40. This approach can be taken only when the sample being tested gives rise to a specific product and not a combination of specific product and primer dimer, and also when the ...
https://www.sigmaaldrich.com/china-mainland/zh/technical-documents/articles/biology/roche/kapa-sybr-fast-qpcr-kits-faq.html
RT-PCR primer design - PCR, RT-PCR and Real-Time PCR - BioForumRT-PCR primer design - PCR, RT-PCR and Real-Time PCR - BioForum
RT-PCR primer design - posted in PCR, RT-PCR and Real-Time PCR: Hi, I want to ask about how to design primer for RT-PCR. Specifically, i want to design primer based on the human mRNA encoding the c-myc, p53, caspase-3 and bcl-2 gene. I have no clue where to start and what to do... thank you..
http://www.protocol-online.org/forums/topic/26015-rt-pcr-primer-design/
BLAST - PCR Primers Design - DnaTube.com - Scientific Video and Animation SiteBLAST - PCR Primers Design - DnaTube.com - Scientific Video and Animation Site
( http://www.abnova.com ) - Primer-BLAST was developed to help users make primers that are specific to the input PCR template. It uses Primer3 to design PCR primers and then submits them to BLAST...
https://www.dnatube.com/video/4439/BLAST--PCR-Primers-Design
gel extraction | Open Notebook Science Networkgel extraction | Open Notebook Science Network
Gel Layout:. Lane 1 - Hyperladder 1. Lanes 2-6 = 5′ RACE Library. Lane 2 - nGSP1 (5′ RACE primer). Lane 3 - nGSP2 (3′ RACE primer). Lane 4 - Neg. Control (no RACE primers). Lane 5 - Neg. Control (nGSP1, no Universal primer). Lane 6 - Neg. Control (nGSP2, no Universal primer). Lane 7 - Empty. Lanes 8-12 = 3′ RACE Library. Lane 8 - nGSP1 (5′ RACE primer). Lane 9 - nGSP2 (3′ RACE primer). Lane 10 - Neg. Control (no RACE primers). Lane 11 - Neg. Control (nGSP1, no Universal primer). Lane 12 - Neg. Control (nGSP2, no Universal primer). First of all, we see the appropriate response of each primer only producing amplicons in their respective libraries (i.e. 5′ primer only works in 5′ RACE library). This simply confirms that the primers were designed correctly. Secondly, our negative controls are clean. Thirdly, we get distinct bands from both primers. The bands marked with blue arrows in the image above were excised and purified using Ultrafree DA spin columns (Millipore). These ...
http://onsnetwork.org/blog/tag/gel-extraction/
DNA-Methylated/Non-methylated Control DNA & Primer Set-Genemed Synthesis Inc.DNA-Methylated/Non-methylated Control DNA & Primer Set-Genemed Synthesis Inc.
Methylated/Non-methylated Control DNA & Primer Set DNA ZD5101-2 Methylated/Non-methylated Control DNA & Primer Set DNA ZD5101-2
http://genemedsyn.com/ccpc1054-6003-methylated-non-methylated-control-dna-26-primer-set-dna-zd5101-2.htm
Designing Primers for Targeted MutagenesisDesigning Primers for Targeted Mutagenesis
Now that my lab is fully equipped, Im taking on rotation students. Unfortunately, with the pandemic, its harder to have one-on-one meetings where I can sit down and walk the new students through every method. Furthermore, why repeat teaching the same thing to multiple students when I can just make an initial written record that everyone can reference and just ask me questions about? Thus, heres my instructional tutorial on how I design primers in the lab.. First, its good to start out by making a new benchling file for whatever youre trying to engineer. If youre just making a missense mutation, then you can start out by copying the map for the plasmid youre going to use as a template. Today, well be mutating a plasmid called G619C_AttB_hTrim-hCPSF6(301-358)-IRES-mCherry-P2A-PuroR to encode the F321N mutation the CPSF6 region. This should abrogate the binding of this peptide to the HIV capsid protein. Eventually every plasmid in the lab gets a unique identifier based on the order it ...
http://www.matreyeklab.com/designing-primers-for-targeted-mutagenesis/644/
EMBOSS: eprimer32EMBOSS: eprimer32
Pick PCR primers and hybridization oligos Version: EMBOSS:6.6.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall The sequence from which to choose primers. The sequence must be presented 5 to 3 [-outfile] outfile [*.eprimer32] Whitehead primer3_core program output file Additional (Optional) qualifiers (* if not always prompted): -[no]primer toggle [Y] Tell Eprimer32 to pick primer(s) * -task menu [1] Tell Eprimer32 what task to perform. Legal values are 1: Pick PCR primers, 2: Pick forward primer only, 3: Pick reverse primer only, 4: No primers needed. (Values: 1 (Pick PCR primers); 2 (Pick forward primer only); 3 (Pick reverse primer only); 4 (No primers needed)) -hybridprobe toggle [N] An internal oligo is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification. * -mishyblibraryfile infile Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library ...
http://emboss.sourceforge.net/apps/release/6.6/emboss/apps/eprimer32.html
EMBOSS: eprimer3EMBOSS: eprimer3
Picks PCR primers and hybridization oligos Version: EMBOSS:6.4.0.0 Standard (Mandatory) qualifiers: [-sequence] seqall The sequence from which to choose primers. The sequence must be presented 5 to 3 [-outfile] outfile [*.eprimer3] Whitehead primer3_core program output file Additional (Optional) qualifiers (* if not always prompted): -[no]primer toggle [Y] Tell EPrimer3 to pick primer(s) * -task menu [1] Tell EPrimer3 what task to perform. Legal values are 1: Pick PCR primers, 2: Pick forward primer only, 3: Pick reverse primer only, 4: No primers needed. (Values: 1 (Pick PCR primers); 2 (Pick forward primer only); 3 (Pick reverse primer only); 4 (No primers needed)) -hybridprobe toggle [N] An internal oligo is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification. * -mishyblibraryfile infile Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather ...
http://emboss.sourceforge.net/apps/release/6.4/emboss/apps/eprimer3.html
Bacterial identification - PCR primers - unknown targetBacterial identification - PCR primers - unknown target
Dear all, I obtained the job and need to identify presence of some bacteria in clinical samples by PCR with species/strain specific primers. The primers are already available in the lab, but the person who designed/find/order the primers were not available in the lab anymore and nobody knows the details. Therefore, I know primer sequences, the names of the strains, but I do not know the target (genome, 16S, ...), the size of the amplicon - actually I have no data to check the PCR result... I tried to blast them, but only one pair is found on the NCBI. How to find the target sequences, can anyone help me. Are there are softwares or databases for blasting the bacterial genome/transcriptome? ...
https://www.biostars.org/p/139343/
Bio::PrimerDesigner - search.cpan.orgBio::PrimerDesigner - search.cpan.org
use Bio::PrimerDesigner; my $pd = Bio::PrimerDesigner-,new; # # Define the DNA sequence, etc. # my $dna = CGTGC...TTCGC; my $seqID = sequence 1; # # Define design parameters (native primer3 syntax) # my %params = ( PRIMER_NUM_RETURN =, 2, PRIMER_SEQUENCE_ID =, $seqID, SEQUENCE =, $dna, PRIMER_PRODUCT_SIZE =, 500-600 ); # # Or use input aliases # %param = ( num =, 2, id =, $seqID, seq =, $dna, sizerange =, 500-600 ); # # Design primers # my $results = $pd-,design( %params ) or die $pd-,error; # # Make sure the design was successful # if ( !$results-,left ) { die No primers found\n, $results-,raw_data; } # # Get results (single primer set) # my $left_primer = $results-,left; my $right_primer = $results-,right; my $left_tm = $results-,lefttm; # # Get results (multiple primer sets) # my @left_primers = $results-,left(1..3); my @right_primers = $results-,right(1..3); my @left_tms = $results-,lefttm(1..3 ...
http://search.cpan.org/~smckay/Bio-PrimerDesigner-0.07/lib/Bio/PrimerDesigner.pm
DNA Primer Color Studio Professional | COLORSTUDIOMAKEUPDNA Primer Color Studio Professional | COLORSTUDIOMAKEUP
Color Studio Professional most advanced primer ever. Created for skin repair and conditioning giving flawless results with any foundation.The DNA primer is a silky cream primer that contains a mix of anti-blemish and focused whitening agents that...
https://www.colorstudiopro.com/collections/flat-30-off-primers-and-liquid-foundations/products/dna-primer
ACTR1B - PCR Primer Pair - SYBR | PrimePCR | Bio-RadACTR1B - PCR Primer Pair - SYBR | PrimePCR | Bio-Rad
This is the amplicon context sequence in accordance with the minimum information for the publication of real-time quantitative PCR experiements (MIQE) guidelines. For more details, please refer to the following publication, Primer Sequence Disclosure: A Clarification of the MIQE Guidelines. ...
https://www.bio-rad.com/en-us/prime-pcr-assays/assay/qbtacid0012154-primepcr-sybr-green-assay-actr1b-cow
actr10 - PCR Primer Pair - SYBR | PrimePCR | Bio-Radactr10 - PCR Primer Pair - SYBR | PrimePCR | Bio-Rad
This is the amplicon context sequence in accordance with the minimum information for the publication of real-time quantitative PCR experiements (MIQE) guidelines. For more details, please refer to the following publication, Primer Sequence Disclosure: A Clarification of the MIQE Guidelines. ...
http://www.bio-rad.com/en-us/prime-pcr-assays/assay/qdrecid0017928-primepcr-sybr-green-assay-actr10-zebrafish
What concentration should be used for the sequencing primer in pyrosequencing? - QIAGENWhat concentration should be used for the sequencing primer in pyrosequencing? - QIAGEN
Usually the sequencing primer is used at 0.3µM in annealing buffer but some assays might require additional optimization of the sequencing primer concentration.. For PyroMark Q24 and PyroMark Q96 MD the final concentration of the sequencing primer is 0.3µM and for PyroMark Q96 ID 0.4µM ...
https://www.qiagen.com/kg/resources/faq?id=b55cb74a-cf83-437e-b5b0-5c3f47294d16&lang=en
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction | BMC Bioinformatics | Full TextPrimer-BLAST: A tool to design target-specific primers for polymerase chain reaction | BMC Bioinformatics | Full Text
Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-13-134/tables/2
Reverse Transcription TechnologyReverse Transcription Technology
There are three choices of RT primer: oligo(dT), random primers, or a gene-specific primer. The priming strategy has a strong impact on the workflow applied, since each priming method has prerequisites and consequences.. Oligo(dT) priming is used to receive full-length copies of the mRNA. For cDNA library construction or cDNA labeling applications, oligo(dT) primers are almost always used to prime cDNA synthesis. Anchored oligo(dT)18 primers are designed to bind at the beginning of the poly(A) tail (rather than randomly within the often long tail) to generate full-length cDNAs. This avoids mispriming and unnecessary reverse transcription of the long poly(A) tail. Since the 5´ ends of long mRNAs are often underrepresented in cDNA mixtures, this primer is preferred for most applications.. However, if the message is long or does not have a poly(A) tail (as with prokaryotic mRNA), then random hexamer primers are used. Random hexamer primers bind throughout the entire length of RNA, ensuring reverse ...
https://lifescience.roche.com/en_cn/articles/reverse-transcription-technology.html
QuantiTect Primer Assays are bioinformatically validated, genomewide primer sets. What does bioinformatically validated mean?...QuantiTect Primer Assays are bioinformatically validated, genomewide primer sets. What does bioinformatically validated mean?...
For each QuantiTect Primer Assay, we retrieve the sequence of the target gene from curated databases and exclude SNP regions from assay design.. We then use our proprietary algorithm to design assays that amplify RNA sequences only (i.e., at least one primer overlaps a splice site), provided that information on the position of splice sites is available. The assays are designed to provide optimal performance with QuantiFast and QuantiTect SYBR Green Kits. After assay design, we validate randomly selected QuantiTect Primer Assays using real-time RT-PCR to check their compatibility with various real-time cyclers. Both two-step and one-step RT-PCR are carried out. Successful amplification of the target is indicated by the following factors: high sensitivity, high efficiency, high specificity (i.e., a single peak in melting curve analysis), and no primer-dimers in the no-template control (NTC). To find a QuantiTect Primer Assay for your target gene of interest, please visit our GeneGlobe data ...
https://www.qiagen.com/mx/resources/faq?id=78cdbde6-8cc0-4bbb-bb08-54b90ca5a934&lang=en
Plus itPlus it
Despite the many methodological options available for mutation detection, the choice is limited, by the necessity to ensure the highest sensitivity of detection for all types of changes while keeping costs and time of analysis within a reasonable limit. The present study extends to large and complex genes, like BRCA1, the applications of the FAMA method using large PCR amplicons (up to 1.4 kb). A key feature of this diagnostic strategy is the robust and economical two-step procedure for strand-specific labeling of PCR products using chimeric oligonucleotides and universal fluorescent primers (Fig. 1)⇓ . This labeling method is cost-effective, because it requires only one set of universal fluorescent primers, and allows reproducible amplification of all exons and splice sites of BRCA1 using homogeneous PCR conditions.. In the blind-test screening for changes in exon 11 (Table 2)⇓ different kinds of mutations and polymorphisms (various microdeletions/insertions involving 1 to 11 nucleotides as ...
http://clincancerres.aacrjournals.org/content/7/6/1638
Thermo Scientific™ M13/pUC sequencing primer (-20), 17-mer 10uM, 6nmol Unlabeled Oligonucleotides and Primers | Fisher...Thermo Scientific™ M13/pUC sequencing primer (-20), 17-mer 10uM, 6nmol Unlabeled Oligonucleotides and Primers | Fisher...
Thermo Scientific™ M13/pUC sequencing primer (-20), 17-mer 10uM, 6nmol Unlabeled Oligonucleotides and Primers Oligonucleotides
https://www.fishersci.ie/shop/products/fermentas-m13-puc-20-17-mer5-d-3-sequencing-primers/10744311
DNASTAR - PrimerSelect Tutorials - Primer Design Software, Primer Analysis Software | DNASTARDNASTAR - PrimerSelect Tutorials - Primer Design Software, Primer Analysis Software | DNASTAR
Lasergenes PrimerSelect offers the best in advanced primer design software, enabling you to design and analyze primers for PCR, sequencing, probe hybridization and transcription.
http://www.dnastar.com/t-tutorials-primerselect.aspx
Working with PCRWorking with PCR
Note: Optimal annealing temperatures are often higher than the Tm of the primers (approximately +5 to +10°C) and have to be determined empirically. For both primers, the Tm should be similar.. Bases that do not hybridize to the template may be added at the 5´ end of a primer (e.g., for introducing restriction sites into the amplification product). Primer concentrations between 0.1 and 0.6 µM are generally optimal. Higher primer concentrations may promote mispriming and accumulation of nonspecific product. Lower primer concentrations may be exhausted before the reaction is completed, resulting in lower yields of desired product.. Note: For some systems, a higher primer concentration (up to 1 µM) may improve results. When testing new primers, always include a positive control reaction with a template that has been tested for function in PCR. This control shows whether the primers are working. The Human Genomic DNA from Roche is a good control template for evaluation of human primer ...
https://lifescience.roche.com/global_en/articles/Wworking-with-pcr.html
molecular genetics - Choosing PCR conditions - Biology Stack Exchangemolecular genetics - Choosing PCR conditions - Biology Stack Exchange
You need to first build an initial protocol and then optimize it.. The most important to determine the conditions is the polymerase used. Some polymerases work at higher or lower temperatures and will work faster or slower. Find the default protocol from the polymerase seller and this will give you a good idea where to start.. The second most important is the primers used. Depending on the GC % in the primers and their length, the times or temperature of each step will change, or if you prefer will need to be Optimized. The length of the DNA fragments will also determine the length of the cycles. Most polymerase sellers will includes steps to optimize the reaction depending on the quantity of DNA used, primer length and other parameters. For more information: Designing primers: Taq DNA polymerase protocol example:. Optimizing PCR ...
https://biology.stackexchange.com/questions/52875/choosing-pcr-conditions
Nested PCR: Principle and Applications - Learn Microbiology OnlineNested PCR: Principle and Applications - Learn Microbiology Online
The first set of primers is designed to anneal to sequences upstream from the second set of primers, whereas the second set of primers is situated internally or nested with respect to the first set of primers. First set of primers also called outer primers amplify a large fragment of the gene which is used as a template in the second round of PCR that targets a smaller region of the amplicon using the second set of primers also known as inner primers or nested primers. The traditional approach to nested PCR was to perform a number of PCR cycles using first set of primers, and then open the reaction vessel and add the second, nested, set of primers to run second PCR cycle. The major problem with this approach is amplicon contamination in the laboratory and a consequential loss of specificity of the assay. To address this issue single-tube nested PCR (STNPCR) reactions have been developed, wherein both sets of primers are added to the initial reaction vessel and an extended PCR is performed. ...
https://microbeonline.com/nested-pcr-principle-applications/
Primer time: a rollercoaster ride through metabarcoding PCR primer design - BiocoenosisPrimer time: a rollercoaster ride through metabarcoding PCR primer design - Biocoenosis
Now more than ever, PCR has become a household name akin to Harry Potter or Gandalf the Grey, and in most cases no less mysterious nor magical. Whilst the distillation of molecular magic that is PCR has been invaluable (despite controversy) for screening your swabs, spit and other bodily fluids for COVID-19, it is also…
https://biocoenosis.org/2021/03/29/primer-time/
BIRCH - Designing PCR primers to amplify a gene from genomic DNABIRCH - Designing PCR primers to amplify a gene from genomic DNA
Further examination of the map shows that all of the reverse primers start at about the same place within the promoter region (~299,000), and the length differences are primarily due to choice of the forward primer, in the 3 downstream region of the gene. Since we are mostly interested in maximizing the promoter region, well choose Primer Pair 3 for further work. To save the sequence of the PCR product, along with its gene annotation, mouse over the map for Primer Pair 3 to bring up the menu shown above, and click on GenBank view. The GenBank view will appear in a new tab or window ...
http://home.cc.umanitoba.ca/~psgendb/tutorials/NCBI/PrimerBlast/PrimerBlast.html
BIRCH - Designing PCR primers to amplify a gene from genomic DNABIRCH - Designing PCR primers to amplify a gene from genomic DNA
Further examination of the map shows that all of the reverse primers start at about the same place within the promoter region (~299,000), and the length differences are primarily due to choice of the forward primer, in the 3 downstream region of the gene. Since we are mostly interested in maximizing the promoter region, well choose Primer Pair 3 for further work. To save the sequence of the PCR product, along with its gene annotation, mouse over the map for Primer Pair 3 to bring up the menu shown above, and click on GenBank view. The GenBank view will appear in a new tab or window ...
http://home.cc.umanitoba.ca/~psgendb/birchhomedir/BIRCHDEV/public_html/tutorials/NCBI/PrimerBlast/PrimerBlast.html
BiSearch: Primer Design and Search ToolBiSearch: Primer Design and Search Tool
BiSearch software is composed of two basic algorithms. The first one is a primer design algorithm the second one is a search with the selected primers through genomic sequences to find potential non-specific PCR products.
http://bisearch.enzim.hu/?m=search
Efficient and Specific Detection of Salmonella in Food Samples Using a stn-Based Loop-Mediated Isothermal Amplification MethodEfficient and Specific Detection of Salmonella in Food Samples Using a stn-Based Loop-Mediated Isothermal Amplification Method
BioMed Research International is a peer-reviewed, Open Access journal that publishes original research articles, review articles, and clinical studies covering a wide range of subjects in life sciences and medicine. The journal is divided into 55 subject-specific sections.
https://www.hindawi.com/journals/bmri/2015/356401/abs/
Development of a Loop-Mediated Isothermal Amplification Method for Rapid Diagnosis of Avian and Animal Chlamydiosis | Center...Development of a Loop-Mediated Isothermal Amplification Method for Rapid Diagnosis of Avian and Animal Chlamydiosis | Center...
Chlamydiae are implicated in a variety of clinically and economically important diseases in livestock and companion animals. These bacteria are associated with abortion, conjunctivitis, encephalomyelitis, enteritis, pneumonia, and polyarthritis in ruminants. Infection with these bacteria is the most common cause of abortion in sheep and goats and also causes zoonotic infection in humans which, in pregnant women, can result in spontaneous abortion.
https://ag.umass.edu/cafe/nifa-planned-research-initiatives/development-of-loop-mediated-isothermal-amplification-method
IJMS | Free Full-Text | Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping...IJMS | Free Full-Text | Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping...
The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based
http://www.mdpi.com/1422-0067/13/3/2951/xml
RAPD Primer Design from Metagenomes 1.0 - RAPD Primer Design from Metagenomes (RPD-M) scans metagenome sequences identifying...RAPD Primer Design from Metagenomes 1.0 - RAPD Primer Design from Metagenomes (RPD-M) scans metagenome sequences identifying...
RAPD Primer Design from Metagenomes RPDM scans metagenome sequences identifying and determining relative frequency of candidate primers for Random Amplification of Polymorphic DNA RAPD assays
http://www.filetransit.com/view.php?id=215312
Species-specific PCR primers for identification of the sibling species Chironomus plumosus (Linnaeus, 1758) and Chironomus...Species-specific PCR primers for identification of the sibling species Chironomus plumosus (Linnaeus, 1758) and Chironomus...
Applicability of the polymerase chain reaction (PCR) with species-specific primers to obtaining molecular markers for identification of the sibling species of Chironomus plumosus group - C. plumosus and C. balatonicus - has been estimated. The nucleotide sequences of internal transcribed spacer (ITS) from the locus encoding ribosomal RNA (rRNA) were used as the source for designing the species-specific primers. The primers allowing for identification of C. plumosus and C. balatonicus were constructed. One primer pair (plu107F/plu363R) gives the PCR product MAR2, specific of C. plumosus, and the other (bal86F/plu363R), the PCR product MAR6, specific of C. balatonicus. The testing involving 18 species of the genus Chironomus confirmed the specificity of the primers. The results suggest that the PCR with species-specific primers is promising for construction of molecular markers for identification not only of these two, but also of other Chironomus species.. doi: 10.5324/fn.v31i0.1381.. Published ...
https://www.ntnu.no/ojs/index.php/fauna_norvegica/article/view/1381
Frontiers | Evaluation of Nucleic Acid Isothermal Amplification Methods for Human Clinical Microbial Infection Detection |...Frontiers | Evaluation of Nucleic Acid Isothermal Amplification Methods for Human Clinical Microbial Infection Detection |...
Battling infection is a major healthcare objective. Untreated infections can rapidly evolve toward the condition of sepsis in which the body begins to fail and resuscitation becomes critical and tenuous. Identification of infection followed by rapid antimicrobial treatment are primary goals of medical care, but precise identification of offending organisms by current methods is slow and broad spectrum empirical therapy is employed to cover most potential pathogens. Current methods for identification of bacterial pathogens in a clinical setting typically require days of time, or a four- to eight-hour growth phase followed by DNA extraction, purification and PCR-based amplification. We demonstrate rapid (70-120 minutes) genetic diagnostics methods utilizing loop-mediated isothermal amplification (LAMP) to test for 15 common infection pathogen targets, called the Infection Diagnosis Panel (In-Dx). The method utilizes filtration to rapidly concentrate bacteria in sample matrices with lower bacterial loads
https://www.frontiersin.org/articles/10.3389/fmicb.2017.02211/full
Random Primer DNA Labeling KitRandom Primer DNA Labeling Kit
The Random Primer DNA Labeling Kit, Version 2 is designed for radioactive labeling for hybridization probes. Probe labeling can label DNA with [32P]-alpha-, [35S]-alpha- or [3H]-alpha-dCTP. This random primer DNA labeling kit is based on a modified method by Feinberg and Vogelstein and utilizes random oligonucleotide primers and cloned exonuclease-free E.coli DNA polymerase I, Klenow fragment. Using primers that are 9-mer and longer and exonuclease-free enzyme results in higher labeling efficiency and longer probes. This probe labeling method overcomes many of the disadvantages of conventional nick translation procedures while producing hybridization probes from very small amounts of DNA (10 to 20 ng). The Radioactive Labeling for Hybridization Probes kit can also be used to label DNA fragments that are embedded in low-melting temperature agarose gel slices.. ...
http://www.clontech.com/US/Products/Molecular_Biology_Tools/DNA_Labeling_Kits/Random_Primer_DNA_Labeling_Kit
Molecular identification of some Hoplolaimus species from the USA based on duplex PCR, multiplex PCR and PCR-RFLP analysis » ...Molecular identification of some Hoplolaimus species from the USA based on duplex PCR, multiplex PCR and PCR-RFLP analysis » ...
Two different molecular approaches, a multiplex PCR and PCR-RFLP of ITS-rDNA, were developed for the identification of Hoplolaimus species. DNA sequences of H. columbus, H. galeatus, H. concaudajuvencus, H. magnistylus, H. seinhorsti and three undescribed Hoplolaimus species were used to design species-specific primers. Three reverse species-specific PCR primers for H. columbus, H. galeatus and H. magnistylus were developed using the ITS1 region exhibiting interspecific variation. Three species-specific PCR primers in combination with the forward primer, Hoc-1f, produced distinct amplicons of 580 bp for H. columbus, 120 bp for H. galeatus and 340 bp for H. magnistylus. We successfully identified each of three species by multiplex PCR when all three were mixed in a single PCR reaction. Restriction enzyme digests of the PCR amplicon using HaeIII and RsaI permitted discrimination of H. columbus, H. galeatus, H. magnistylus, H. concaudajuvencus, H. sp. 1, H. sp. 2 and H. sp. 3 from each other. These results
http://booksandjournals.brillonline.com/content/journals/10.1163/156854109x447042
Australian Researchers Use Isothermal Amplification Method to Detect Salmonella Subtypes | GenomeWebAustralian Researchers Use Isothermal Amplification Method to Detect Salmonella Subtypes | GenomeWeb
Researchers showed how an isothermal amplification technique could detect S. enterica serovars from culture by targeting specific gene markers.
https://www.genomeweb.com/pcr/australian-researchers-use-isothermal-amplification-method-detect-salmonella-subtypes
Gene Detection Systems Introduction - Gene LinkGene Detection Systems Introduction - Gene Link
GenemerTM Products. The GenemerTM product line is PCR based. The product includes a specific primer pair for gene or mutation specific amplification. Genemer products are available for the gene fragment and disorders listed. Specialized optimized conditions may be required for certain triple repeat disorder amplifications. The GenemerTM kit is a complete easy-to-use kit for reliable genotyping of a gene fragment. The product includes a specific primer pair for gene or mutation specific amplification, optimized buffers and dNTPs and in most cases, control DNA. These kits contain specialized and optimized conditions that are required for amplification of large repeats in certain triple repeat disorder amplifications. Gene Link recommends these GenemerTM kits for researchers who have not established their own optimized amplification conditions. GenemerTM kits are also available for conventional radioactive-based detection methods. A Radioactive component is not present in these kits. Gene Link ...
http://www.genelink.com/gds/GDSintro.asp
Enhanced E. coli for the production of fatty acids and method of producing the same - Patent applicationEnhanced E. coli for the production of fatty acids and method of producing the same - Patent application
17138DNAArtificial SequenceSequence source PCR primer, 38 bases 1catgcatggg atccaacttg ctagacgcaa atatcgca 38239DNAArtificial SequenceSequence source PCR primer, 39 bases 2catgcatgcc cgggtcatga ttcttctttg atcatcacg 39328DNAArtificial SequenceSequence source PCR primer, 28 bases 3caccttctct tacgaatgtt tcgttggc 28439DNAArtificial SequenceSequence source PCR primer, 39 bases 4catgcatgcc cgggtcatga ttcttctttg atcatcacg 39539DNAArtificial SequenceSequence source PCR primer, 39 bases 5catgcatggg atccaactta ctggataaag aaagccgtt 39624DNAArtificial SequenceSequence source PCR primer, 24 bases 6tcaggcttct tcaatacaga ttgc 24737DNAArtificial SequenceSequence source PCR primer, 37 bases 7catgcatggg atccttcagc ttcgaactca gtaccga 37824DNAArtificial SequenceSequence source PCR primer, 24 bases 8tcaggcttct tcaatacaga ttgc 24928DNAArtificial SequenceSequence source PCR primer, 28 bases 9caccaacttg ctagacgcaa atatcgca 281024DNAArtificial SequenceSequence source PCR primer, 24 bases 10tcaggcttct tcaatacaga ttgc ...
http://www.patentsencyclopedia.com/app/20130177989
RT² qPCR Primer Assay for Rat Pou2f2RT² qPCR Primer Assay for Rat Pou2f2
The RT² qPCR Primer Assay is the most reliable SYBR® Green-based quantitative real-time PCR assay for gene expression analysis. Our experimentally verified design algorithm yields gene-specific qPCR assays characterized by uniform and high PCR efficiencies and standardized amplification conditions. Every RT² Primer Assay is subjected to rigorous experimental verification. Single product amplification of the correct size and high PCR efficiency are guaranteed when using the appropriate RT² qPCR Master Mixes. The uniform PCR amplification efficiencies and PCR conditions of the RT² qPCR Primer Assays provide an accurate and scalable solution for multiple gene expression analyses. Browse Primer Assays By Gene ...
http://www.sabiosciences.com/primerinfo.php?pcatn=PPR50009A
RT² qPCR Primer Assay for Mouse Pou6f1RT² qPCR Primer Assay for Mouse Pou6f1
The RT² qPCR Primer Assay is the most reliable SYBR® Green-based quantitative real-time PCR assay for gene expression analysis. Our experimentally verified design algorithm yields gene-specific qPCR assays characterized by uniform and high PCR efficiencies and standardized amplification conditions. Every RT² Primer Assay is subjected to rigorous experimental verification. Single product amplification of the correct size and high PCR efficiency are guaranteed when using the appropriate RT² qPCR Master Mixes. The uniform PCR amplification efficiencies and PCR conditions of the RT² qPCR Primer Assays provide an accurate and scalable solution for multiple gene expression analyses. Browse Primer Assays By Gene ...
http://www.sabiosciences.com/primerinfo.php?pcatn=PPM04485A
Author: Saisuk, W. / Publication Year: 2019 - PubAg Search ResultsAuthor: Saisuk, W. / Publication Year: 2019 - PubAg Search Results
Biological RNA generally comprises secondary structure motifs which cause a problem for target RNA detection by isothermal amplification methods. The complexity of the secondary structures makes RNA targets inaccessible for probe hybridization, resulting in decreased sensitivity and selectivity. This is particularly important because the hybridization step of the isothermal amplification method re ...
https://pubag.nal.usda.gov/?f%5Bpublication_year_rev%5D%5B%5D=7981-2019&per_page=20&q=%22Saisuk%2C+W.%22&search_field=author
Phi X 174Phi X 174
Primosomes gives RNA primers for DNA synthesis to strands. ΦX174 is closely related to other microviridae, especially the NC ... The phi X 174 (or ΦX174) bacteriophage is a single-stranded DNA (ssDNA) virus that infects Escherichia coli, and the first DNA- ... The DNA is ejected through a hydrophilic channel at the 5-fold vertex. It is understood that H protein resides in this area but ... Nobel prize winner Arthur Kornberg used ΦX174 as a model to first prove that DNA synthesized in a test tube by purified enzymes ...
https://en.wikipedia.org/wiki/Phi_X_174
Mung bean nucleaseMung bean nuclease
Excision of gene coding sequences from genomic DNA. "BRENDA: 3.1.30.1". Eun, HM (1996). "Nucleases". Enzymology primer for ... An excess of the enzyme is required to degrade double-stranded DNA or RNA and DNA-RNA hybrids, and in this case, AT-rich ... Nuclease MB is a specific DNA and RNA exo-endonuclease which will degrade single-stranded extensions from the ends of DNA and ... The enzyme degrades single-stranded DNA or RNA to nucleoside 5'-monophosphates, but does not digest double-stranded DNA, double ...
https://en.wikipedia.org/wiki/Mung_bean_nuclease
Enterobacter cloacaeEnterobacter cloacae
DNA polymorphisms amplified by arbitrary primers are useful genetic markers. Nucleic Acids Research. 18, 6531-6535 (1990). ... as well as on DNA-DNA hybridization assays and phenotypic characterizations. The type strain EN-119T was isolated from ... On the basis of DNA relatedness, both organisms could be included in a single taxon. However, the CDC enteric group 69 was ... 8, 281-289 (2002). Ruiz J. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase ...
https://en.wikipedia.org/wiki/Enterobacter_cloacae
Fumio TajimaFumio Tajima
Tajima, Fumio (January 1983). "MATHEMATICAL STUDIES ON THE EVOLUTIONARY CHANGE OF DNA SEQUENCES". Texas Medical Center ... Cutter, Asher D. (2019). A Primer of Molecular Population Genetics. Oxford University Press. p. 164. ISBN 9780198838944. ...
https://en.wikipedia.org/wiki/Fumio_Tajima
History of wildlife tracking technologyHistory of wildlife tracking technology
A genetic marker is a gene or DNA sequence with a known location on a chromosome that can be used to identify individuals or ... the development and use of evolutionarily conserved sets of PCR primers. the use of microsatellite loci that vary among ... The marker could be a short DNA sequence, such as a sequence surrounding a single base-pair change, known as a single ... the development of advanced DNA sequencing techniques. Many things utilized for studying larger organisms has not been possible ...
https://en.wikipedia.org/wiki/History_of_wildlife_tracking_technology
Sequence-related amplified polymorphismSequence-related amplified polymorphism
"DNA Polymorphisms Amplified by Arbitrary Primers Are Useful as Genetic Markers". Nucleic Acids Research. 18 (22): 6531-6535. ... Books Kidwell, K. K.; Osborn, T. C. (1992). "Simple Plant DNA Isolation Procedures". In Beckman, J. S.; Osborn, T. C. (eds.). ... Doyle, J. J.; Doyle, J. L. (1987). "A Rapid DNA Isolation Procedure for Small Quantities of Fresh Leaf Tissue". Phytochemical ... Sharma, R.; Mahla, R. H.; Mohapatra, T.; Bhargava, C. S.; Shama, M. M. (2003). "Isolating Plant Genomic DNA Without Liguid ...
https://en.wikipedia.org/wiki/Sequence-related_amplified_polymorphism
Sequence-controlled polymerSequence-controlled polymer
"Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase". Science. 239 (4839): 487-491. Bibcode: ... DNA, based on A-T, C-G base pairs, are formed in well-aligned sequences. Through precise sequences of DNA, 20 amino acids are ... At first, taking DNA or RNA as templates, scientists developed a series of peptide nucleic acid (PNA)-based polymers, without ... In nature, DNA, RNA, proteins and other macromolecules can also be recognized as sequence-controlled polymers for their well- ...
https://en.wikipedia.org/wiki/Sequence-controlled_polymer
Variants of PCRVariants of PCR
Two sets of primers are used in two successive reactions. In the first PCR, one pair of primers is used to generate DNA ... January 1988). "Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase". Science. 239 (4839): 487-91 ... Two amplifications are then carried out on the bisulfite-treated DNA: One primer set anneals to DNA with cytosines ( ... uses a recombinase to specifically pair primers with double-stranded DNA on the basis of homology, thus directing DNA synthesis ...
https://en.wikipedia.org/wiki/Variants_of_PCR
Arbuscular mycorrhizaArbuscular mycorrhiza
... more on AM fungal specific primers below) 2 μl template DNA PCR: Run on an MWG AG Biotech Primus 96 Plus thermocycler 15 ... "Kruger" primers yielded relatively higher diversity parameters than other comparable primers (LSU, ITS2) "Kruger" primers ... primer utilizes the partial SSU and the ITS. Currently, there is no consensus as to which primers or primer sets, being used ... and repeatable primers or primer sets. Currently there are four common AM fungal specific markers/primers used in genetic ...
https://en.wikipedia.org/wiki/Arbuscular_mycorrhiza
Thermal cyclerThermal cycler
The thermal cycler (also known as a thermocycler, PCR machine or DNA amplifier) is a laboratory apparatus most commonly used to ... This is particularly useful when testing suitable annealing temperatures for PCR primers. Weier, HU; Gray, JW (Jul-Aug 1988). " ... The earliest thermal cyclers were designed for use with the Klenow fragment of DNA polymerase I. Since this enzyme is destroyed ... Later, the PCR process was adapted to the use of thermostable DNA polymerase from Thermus aquaticus, which greatly simplified ...
https://en.wikipedia.org/wiki/Thermal_cycler
Tom Brown (chemist)Tom Brown (chemist)
He is best known for his contribution in the field of DNA Repair, DNA Click chemistry, and in the application of Molecular ... In collaboration with AstraZeneca, they invented Scorpion Primers system, a fluorescence-based real-time PCR method that can ... In early part of his academic career, Brown studied base-pair mismatch and DNA repair. Later he worked on the mutagenic effect ... Leonard, GA; Thomson, J; Watson, WP; Brown, T (December 1990). "High-resolution structure of a mutagenic lesion in DNA". PNAS. ...
https://en.wikipedia.org/wiki/Tom_Brown_(chemist)
Recombinase polymerase amplificationRecombinase polymerase amplification
Finally, the strand displacing polymerase begins DNA synthesis where the primer has bound to the target DNA. By using two ... for rapid detection of viral genomic DNA or RNA, pathogenic bacterial genomic DNA, as well as short length aptamer DNA. The ... "Rapid PCR". Dna.utah.edu. Retrieved 2014-06-21. CS1 maint: discouraged parameter (link) "PCR primers work using standard RPA ... Recombinases are capable of pairing oligonucleotide primers with homologous sequence in duplex DNA. SSB bind to displaced ...
https://en.wikipedia.org/wiki/Recombinase_polymerase_amplification
Nested polymerase chain reactionNested polymerase chain reaction
The target DNA undergoes the first run of polymerase chain reaction with the first set of primers, shown in green. The ... Conventional PCR requires primers complementary to the termini of the target DNA. The amount of product from the PCR increases ... A commonly occurring problem is primers binding to incorrect regions of the DNA, giving unexpected products. This problem ... Polymerase chain reaction itself is the process used to amplify DNA samples, via a temperature-mediated DNA polymerase. The ...
https://en.wikipedia.org/wiki/Nested_polymerase_chain_reaction
Functional genomicsFunctional genomics
The ENCODE (Encyclopedia of DNA elements) project is an in-depth analysis of the human genome whose goal is to identify all the ... A primer of genome science (3rd ed.). Sunderland, MA: Sinauer Associates. Pevsner J (2009). Bioinformatics and functional ... Microarrays measure the amount of mRNA in a sample that corresponds to a given gene or probe DNA sequence. Probe sequences are ... Proteins formed by the translation of the mRNA (messenger RNA, a coded information from DNA for protein synthesis) play a major ...
https://en.wikipedia.org/wiki/Functional_genomics
Apis mellifera macedonicaApis mellifera macedonica
"Primer directed enzymatic amplification of DNA with thermostable DNA polymerase". Science. 239 (238): 487-491. doi:10.1126/ ... Cite journal requires ,journal= (help) Lynch, M.; Crease, T.J. (1990). "The Analysis of Population Survey Data of DNA sequence ... and Cyprus analyzing mitochondrial DNA segments and finding differences in enzymatic restrictions, resulting in Apis mellifera ...
https://en.wikipedia.org/wiki/Apis_mellifera_macedonica
Multilocus sequence typingMultilocus sequence typing
It is based on the fact that mitochondrial DNA (mtDNA) or some parts of the ribosomal DNA cistron have relatively fast mutation ... Primer sequences and protocols can be accessed electronically. It is reproducible and scalable. MLST is automated, combines ... But these DNA banding-based subtyping methods do not provide meaningful evolutionary analyses. Despite PFGE being considered by ... MLST should not be confused with DNA barcoding. The latter is a taxonomic method that uses short genetic markers to recognize ...
https://en.wikipedia.org/wiki/Multilocus_sequence_typing
Twisted intercalating nucleic acidTwisted intercalating nucleic acid
Certain configurations have been shown to stabilize Watson-Crick antiparallel duplex DNA. TINA-DNA primers have been shown to ... stabilizes Hoogsteen triplex DNA formation from double-stranded DNA (dsDNA) and TFOs. Its ability to twist around a triple bond ... Diagnostic assays using DNA hybridization are limited by the dissociation of antiparallell duplex helices. This can be improved ... Studies show that the greatest increase in stability occurred when intercalating primers were used at the 3' and 5' ends. ...
https://en.wikipedia.org/wiki/Twisted_intercalating_nucleic_acid
Overlap extension polymerase chain reactionOverlap extension polymerase chain reaction
To splice two DNA molecules, special primers are used at the ends that are to be joined. For each molecule, the primer at the ... To insert a mutation into a DNA sequence, a specific primer is designed. The primer may contain a single substitution or ... The duplex is denatured and the second primer anneals to the newly formed DNA strand, containing sequence from the first primer ... Once both DNA molecules are extended in such a manner, they are mixed and a PCR is carried out with only the primers for the ...
https://en.wikipedia.org/wiki/Overlap_extension_polymerase_chain_reaction
Clinical metagenomic sequencingClinical metagenomic sequencing
The whole DNA and/or RNA is sequenced with this approach using universal primers. The resultant mNGS reads can be assembled ... RNA/DNA extraction: the DNA and the RNA of the sample is extracted by using an extraction kit. If there is a strong previous ... In future, mNGS of cell-free DNA from liquid biopsy sample, such as plasma, might be useful for the identification of early ... It should, however, be noted that since no primers or probes are used in untargeted method, the majority of the reads ...
https://en.wikipedia.org/wiki/Clinical_metagenomic_sequencing
Sthenoteuthis oualaniensisSthenoteuthis oualaniensis
Xu, L., Huang, Q., Xu, S., Wang, X., Zhang, P., Xu, L., & Du, F. (2017). A new set of primers for COI amplification from ... purpleback flying squid (Sthenoteuthis oualaniensis). Mitochondrial DNA Part B: Resources, 2(2), 439-443. https://doi.org/ ...
https://en.wikipedia.org/wiki/Sthenoteuthis_oualaniensis
Digital polymerase chain reactionDigital polymerase chain reaction
"Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase". Science. 239 (4839): 487-491. Bibcode: ... Digital PCR can detect rare sequences such as HIV DNA in patients with HIV, and DNA from fecal bacteria in ocean and other ... This was achieved by diluting DNA samples from a normal human cell line with DNA from a mutant line having a homozygous ... primers, and a PCR master mix, which contains DNA polymerase, dNTPs, MgCl2, and reaction buffers at optimal concentrations. ...
https://en.wikipedia.org/wiki/Digital_polymerase_chain_reaction
ThermostabilityThermostability
"Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase". Science. 239 (4839): 487-91. Bibcode: ... This resistance to high temperature allows for DNA polymerase to elongate DNA with a desired sequence of interest with the ... Thermostable enzymes such as Taq polymerase and Pfu DNA polymerase are used in polymerase chain reactions (PCR) where ... temperatures of 94 °C or over are used to melt apart DNA strands in the denaturation step of PCR. ...
https://en.wikipedia.org/wiki/Thermostability
Polony sequencingPolony sequencing
... end of both unextended forward ePCR primers and the RDV segment of template DNA. The cap that being use is an amino group that ... DNA molecules with a length of 1 kb are selected by loading on the 6% TBE PAGE gel. In the next step, the DNA molecules are ... This protocol begins by randomly shearing the tested genomic DNA into a tight size distribution. The sheared DNA molecules are ... The end repair treatment converts any damaged or incompatible protruding ends of DNA to 5'-phosphorylated and blunt-ended DNA, ...
https://en.wikipedia.org/wiki/Polony_sequencing
Rous sarcoma virusRous sarcoma virus
4S RNA is the primer for RSV and 70S RNA serves as the template for DNA synthesis. Reverse transcriptase, an RNA-dependent DNA ... RSV is a class VI enveloped virus with a positive sense RNA genome having a DNA intermediate. RSV has four genes: gag - encodes ... Dahlberg JE, Sawyer RC, Taylor JM, Faras AJ, Levinson WE, Goodman HM, Bishop JM (May 1974). "Transcription of DNA from the 70S ... As with all retroviruses, it reverse transcribes its RNA genome into cDNA before integration into the host DNA. RSV was ...
https://en.wikipedia.org/wiki/Rous_sarcoma_virus
Thermal shift assayThermal shift assay
January 1988). "Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase". Science. 239 (4839): 487-91 ... Moreau MJ, Schaeffer PM (December 2013). "Dissecting the salt dependence of the Tus-Ter protein-DNA complexes by high- ... Thermostable proteins are often more useful than their non-thermostable counterparts, e.g., DNA polymerase in the polymerase ...
https://en.wikipedia.org/wiki/Thermal_shift_assay
HyperthermophileHyperthermophile
"Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase". Science. 239 (4839): 487-91. Bibcode: ...
https://en.wikipedia.org/wiki/Hyperthermophile
EpigenomicsEpigenomics
The DNA hybridization technique used in DNA assays, in which radioactive probes were used to map and identify DNA sequences, ... Gibson G, Muse SV (2009). A primer of Genome Science (3rd ed.). Sunderland: Sinaeur Associates. ISBN 978-0-87893-236-8. Russell ... The cellular processes of transcription, DNA replication and DNA repair involve the interaction between genomic DNA and nuclear ... Chromatin packaging of DNA varies depending on the cell cycle stage and by local DNA region. The degree to which chromatin is ...
https://en.wikipedia.org/wiki/Epigenomics
CoccidioidomycosisCoccidioidomycosis
With specific nucleotide primers, C.immitis DNA can be amplified by polymerase chain reaction (PCR). It can also be detected in ... C. immitis and C. posadasii cannot be distinguished on cytology or by symptoms, but only by DNA PCR. An indirect demonstration ...
https://en.wikipedia.org/wiki/Coccidioidomycosis
RNase H-dependent PCRRNase H-dependent PCR
1) The 5' DNA section, equivalent in length and melting temperature (Tm) requirements to a standard PCR primer, is extended ... This removes the block, allowing for the DNA polymerase to extend off of the primers. The cycling of the PCR reaction continues ... rhPCR primers are designed so that after cleavage by the RNase H2 enzyme, the Tm of the primers are still greater than the ... In rhPCR, the primers are designed with a removable amplification block on the 3' end. Amplification of the blocked primer is ...
https://en.wikipedia.org/wiki/RNase_H-dependent_PCR
Thermus aquaticusThermus aquaticus
1988). "Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase". Science. 239 (4839): 487-91. ... DNA polymerase was first isolated from T. aquaticus in 1976. The first advantage found for this thermostable (temperature ... It is the source of the heat-resistant enzyme Taq DNA polymerase, one of the most important enzymes in molecular biology ... The first polymerase enzyme isolated from T. aquaticus in 1974 was a DNA-dependent RNA polymerase, used in the process of ...
https://en.wikipedia.org/wiki/Thermus_aquaticus
Pirej - Wikipedija, prosta enciklopedijaPirej - Wikipedija, prosta enciklopedija
Je odličen primer neoklasične arhitekture tega območja. Po odločilnem obdobju za Grčijo leta 1912-1922 je Pirej doživel ... pristanišče je bilo tudi dopolnjeno in posodobljeno s poglabljanjem dna, gradnjo Kraljevega pristanišča, Trumba Pier, in ...
https://sl.wikipedia.org/wiki/Pirej
Hermafrodit - Wikipedija, prosta enciklopedijaHermafrodit - Wikipedija, prosta enciklopedija
Primer so ustnače[1]. Pri sesalcih[uredi , uredi kodo]. Pri višjih vretenčarjih lahko pojav razdelimo na genetsko pogojen - ... Vzrok je kritični izbris 11,7-kb elementa DNA, ki vsebuje predvsem ponavljajoča zaporedja. Interseksualnost je recesivna dedna ... Primer je oranžna klovnovska ribica (Amphiprion ocellaris), ki zivi v majhnih skupinah z eno samico. Če ta pogine, eden od ...
https://sl.wikipedia.org/wiki/Hermafrodizem
Svinčev(II) oksid - Wikipedija, prosta enciklopedijaSvinčev(II) oksid - Wikipedija, prosta enciklopedija
S kislinami tvori Pb2+ soli, ki nastanejo preko klastrov, na primer [Pb6O(OH)6]4+. Z močnimi bazami tvori soli plumbite:[8] ... Zmes PbO in glicerina se strdi v trden vodoodporen cement, ki se je včasih uporabljal za tesnenje stranic in dna akvarijev in ...
https://sl.wikipedia.org/wiki/Svinčev
Fluorescence in situ hybridizationFluorescence in situ hybridization
Repetitive DNA sequences must be blocked by adding short fragments of DNA to the sample. The probe is then applied to the ... Bacterial FISH probes are often primers for the 16s rRNA region. FISH is widely used in the field of microbial ecology, to ... Preparation and hybridization process - DNA[edit]. Scheme of the principle of the FISH Experiment to localize a gene in the ... Preparing DNA probes for one species and performing FISH with this probe allows one to visualize the distribution of this ...
https://en.wikipedia.org/wiki/Fluorescence_in_situ_hybridization
AmelogeninAmelogenin
Two bands of DNA, at 106bps and 112bps, are resolved if both the AMELX and AMELY versions of the gene are present (i.e. the ... Mutation in regions of AMELY intron 1 commonly used as primer annealing sites may disable PCR amplification. A 6bp insertion to ... sample is from a male) or one band of DNA, at 106bps, if the AMELX version only is present (i.e. the sample is from a female).[ ...
https://en.wikipedia.org/wiki/Amelogenin
Bioinformática, a enciclopedia libreBioinformática, a enciclopedia libre
2004). Geometric Morphometrics for Biologists: A Primer. Academic Press. ISBN 0127784608.. *↑ Meijer, G. A.; et al. (1997). " ... 1993) A Hidden Markov Model that finds genes in E. coli DNA ... Circular SV40 DNA Molecules Containing Lambda Phage Genes and ... "PRIMER: Genomics and Its Impact on Science and Society: The Human Genome Project and Beyond" (pdf) (en inglés). Consultado o 1 ... "DNA sequencing with chain-terminating inhibitors". Proceedings of National Academy of Sciences 74 (12). ...
https://gl.wikipedia.org/wiki/Bioloxía_computacional
PicornavirusPicornavirus
Virus RNA polymerases use VPg as primer. VPg as primer uses both minus and plus strand RNA synthesis. Picornavirus replication ... and a poliovirus clone was the first infectious DNA clone made of an RNA virus in animals. Along with rhinovirus, poliovirus ... end that is used as a primer for transcription by RNA polymerase.This primer is called VPg genome range between 2-3 kb. VPg ... The VPgpUpUOH primer is transferred to the 3' end of the RNA template for elongation, which can continue by addition of ...
https://en.wikipedia.org/wiki/Picornavirus
Cell biologyCell biology
For this process the cell goes through the steps of the cell cycle and development which involves cell growth, DNA replication ... "Science Primer".. *^ "Cell Biology , Learn Science at Scitable". www.nature.com. Retrieved 2018-06-10 ... DNA replication, damage and repair - are considered to be the interphase portion of the cycle. While the M phase (mitosis and ...
https://en.m.wikipedia.org/wiki/Cell_biology
ARNr 16S, a enciclopedia libreARNr 16S, a enciclopedia libre
"Primers, 16S ribosomal DNA - François Lutzoni's Lab". lutzonilab.net. Arquivado dende o orixinal o 2012-12-27.. ... O par cebador ou primer máis común foi concibido por Weisburg et al.[5] e denomínase actualmente 27F e 1492R; porén, para ... James, Greg (15 May 2018). "Universal Bacterial Identification by PCR and DNA Sequencing of 16S rRNA Gene". PCR for Clinical ... Kolbert CP, Persing DH (June 1999). "Ribosomal DNA sequencing as a tool for identification of bacterial pathogens". Current ...
https://gl.wikipedia.org/wiki/ARNr_16S
RetrovirusRetrovirus
The 3' end includes 3 regions, which are PPT (polypurine tract), U3, and R. The PPT is a primer for plus-strand DNA synthesis ... This DNA can be incorporated into host genome as a provirus that can be passed on to progeny cells. The retrovirus DNA is ... PBS (primer binding site) consists of 18 bases complementary to 3' end of tRNA primer. L region is an untranslated leader ... It has been speculated that the RNA to DNA transcription processes used by retroviruses may have first caused DNA to be used as ...
https://en.wikipedia.org/wiki/SsRNA-RT_virus
Sitosina Bahasa Melayu, ensiklopedia bebasSitosina Bahasa Melayu, ensiklopedia bebas
Sitosina (C) merupakan salah satu daripada bes nitrogen dalam DNA dan RNA bersama adenina, guanina dan timina serta urasil ... 4.45 (sekunder), 12.2 (primer)[1] Kerentanan magnetik (χ). -55.8·10−6 cm3/mol ...
https://ms.wikipedia.org/wiki/Sitosina
RNA worldRNA world
Main articles: RNA and DNA. The major difference between RNA and DNA is the presence of a hydroxyl group at the 2'-position of ... The longest primer extension performed by a ribozyme polymerase was 20 bases.[29] In 2016, researchers reported the use of in ... This forces an RNA double helix to change from a B-DNA structure to one more closely resembling A-DNA. ... DNA and proteins seemed the dominant macromolecules in the living cell, with RNA only aiding in creating proteins from the DNA ...
https://en.wikipedia.org/wiki/RNA_world
Amyotrophic lateral sclerosisAmyotrophic lateral sclerosis
Disease Primers. 3 (17071): 17071. doi:10.1038/nrdp.2017.71. PMID 28980624.. *^ a b c d e f g h i j k l m n o p q r s t u v van ... The zebrafish has transparent embryos that can be injected with DNA or RNA and has a lifespan of up to two years.[79] Induced ...
https://en.wikipedia.org/wiki/Lou_Gehrig's_disease
Ubikinon - Wikipedija, prosta enciklopedijaUbikinon - Wikipedija, prosta enciklopedija
Primer: Študija na 23 pacientih s kroničnim srčnim popuščanjem. Kontrolna skupina je prejemala 100 mg CoQ10 4 tedne. VO2 in od ... CoQ10 je prav tako zelo učinkovit pri zaščiti celic (keratinocitov) pred oksidativnimi poškodbami DNA, ki so inducirane z ... Signifikantno je upadla oksidativna poškodba DNA v keratinocitih. Ubikinon lahko upočasni izgubo hialuronske kisline in vpliva ... pri MPTP modelnih miših ter zmanjšala lipidno peroksidacijo in oksidativne poškodbe DNA v striatumu pri podganah z 3- ...
https://sl.wikipedia.org/wiki/Ubikinon
Atlantski ocean - Wikipedija, prosta enciklopedijaAtlantski ocean - Wikipedija, prosta enciklopedija
Pelagični sedimenti, ki vsebujejo ostanke organizmov, ki so se potopili do dna oceana, vključujejo rdeče gline in globigerine, ... Več lokalnih posebnih vremenskih primerov je mogoče najti kot je na primer Azorski anticiklon, Benguelski tok in Nor'easter. ... Zajema večino oceanskega dna in sega v debelini od 60-3.300 metrov, so najdebelejši v konvergenčnih pasovih, predvsem na ... Glavna značilnost batimetrije (meritve oceanskega dna) je podmorsko gorovje imenovano Srednjeatlantski hrbet. [3] Ta sega od ...
https://sl.m.wikipedia.org/wiki/Atlantski_ocean
铂 - 维基百科，自由的百科全书铂 - 维基百科，自由的百科全书
順鉑，又稱順式-二氯二氨合鉑(II)，是含鉑(II)、呈平面正方形結構的化療藥物。同類藥物還包括卡鉑（Carboplatin）和奧沙利鉑。這些化合物能夠交叉鏈接DNA，並通過相似的反應路徑產生烷化劑，殺死細胞。[37] ... Platinum primer. Diamond Cutters International. [2011-06-18].. *^ Unknown Facts
https://zh.wikipedia.org/wiki/鉑
Plant virusPlant virus
3% require a reverse transcriptase enzyme to convert between RNA and DNA. 17% of plant viruses are ssDNA and very few are dsDNA ... 2001). "In vivo analysis of the TSWV cap-snatching mechanism: single base complementarity and primer length requirements". The ...
https://en.wikipedia.org/wiki/Plant_virus
Category:Bioinformatics softwareCategory:Bioinformatics software
Primer Premier. *List of software for protein model error verification. *List of protein secondary structure prediction ... Comparison of DNA melting prediction software. *COMPLEAT (Bioinformatics tool). *Computational Resource for Drug Discovery ...
https://en.wikipedia.org/wiki/Category:Bioinformatics_software
Minimal residual diseaseMinimal residual disease
DNA-based tests[edit]. These are based on detecting a leukaemic specific DNA sequence. Generally this is achieved through the ... From this sequence, PCR primers are designed that will only amplify the specific leukemic clone from the patient. ... Both the DNA and RNA based tests require that a pathologist examine the bone marrow to determine which leukaemic specific ... The DNA sequence chosen may contribute to the genesis of the leukaemia, or may simply be linked to it. ...
https://en.wikipedia.org/wiki/Minimal_residual_disease
Biologija - Wikipedija, prosta enciklopedijaBiologija - Wikipedija, prosta enciklopedija
Na primer, zaporedje DNK, ki kodira insulin za človeka, prav tako kodira inzulin, če ga vstavimo v druge organizme, kot so to ... Eden od njih so primerjave zaporedij DNA, kjer sodeluje z molekularno biologijo in genomiko, po drugi pa s primerjavo fosilov ...
https://sl.wikipedia.org/wiki/Biologija
ChikungunyaChikungunya
RT-PCR using nested primer pairs is used to amplify several chikungunya-specific genes from whole blood, generating thousands ... a nonstructural protein that degrades RBP1 and turns off the host cell's ability to transcribe DNA.[51] NS2 interferes with the ...
https://en.wikipedia.org/wiki/Chikungunya_vaccine
Anti-nuclear antibodyAnti-nuclear antibody
The 60kDa DNA/RNA binding protein and 52kDa T-cell regulatory protein are the best characterised antigens of anti-Ro antibodies ... by R. A. (2000). Immunofluorescence in clinical immunology : a primer and atlas. Basel [u.a.]: Birkhäuser. ISBN 978-3764361822 ... Presence of high DNA-binding and low C3 levels have been shown to have extremely high predictive value (94%) for the diagnosis ... Anti-double stranded DNA (anti-dsDNA) antibodies are highly associated with SLE. They are a very specific marker for the ...
https://en.wikipedia.org/wiki/Anti-nuclear_antibody
Gibson assemblyGibson assembly
SGI-DNA Gibson Assembly Cloning Guide. *Gibson Assembly Primer Design Tool. *Gibson Assembly Site Directed Mutagenesis Primer ... The DNA polymerase incorporates nucleotides to fill in any gaps.. *The DNA ligase covalently joins the DNA of adjacent segments ... It requires that the DNA fragments contain ~20-40 base pair overlap with adjacent DNA fragments. These DNA fragments are mixed ... This DNA assembly method has many advantages compared to conventional restriction enzyme/ligation cloning of recombinant DNA. ...
https://en.wikipedia.org/wiki/Gibson_assembly
HepadnaviridaeHepadnaviridae
... and DNA-dependent-DNA-polymerase activity (used to create cccDNA from pdsDNA in the first step of the replication cycle). ... or 4-nucleotide primer.[5] Most hepadnaviruses will only replicate in specific hosts, and this makes experiments using in vitro ... Based on the presence of viral genomes in bird DNA it appears that the Hepatoviruses evolved ,82 million years ago.[6] Birds ... HBV was identified as a new DNA virus in the 1960s, followed a couple of decades later by the discovery of the flavivirus ...
https://en.wikipedia.org/wiki/Hepadnaviridae
Asma bahasa Indonesia, ensiklopedia bebasAsma bahasa Indonesia, ensiklopedia bebas
Gejala klasiknya adalah sesak nafas, mengi, and rasa berat di dada.[41] Walaupun gejala tersebut adalah gejala primer asma,[75] ... terwariskan selain adanya hubungan dengan urutan DNA) dan lingkungan hidup yang berubah.[27] ...
https://id.wikipedia.org/wiki/Asthma
Single cell sequencingSingle cell sequencing
... random primers and DNA polymerase from bacteriophage phi29. In 30 degree isothermal reaction, DNA is amplified with included ... as well as the limited amount of DNA extracted from a single cell. Due to scant amounts of DNA, accurate analysis of DNA poses ... Single-cell genome (DNA) sequencing[edit]. Single-cell DNA genome sequencing involves isolating a single cell, amplifying the ... Single-cell DNA methylome sequencing quantifies DNA methylation. There are several known types of methylation that occur in ...
https://en.wikipedia.org/wiki/Single_cell_sequencing?source=post_page---------------------------
Transkripsi (genetik) bahasa Indonesia, ensiklopedia bebasTranskripsi (genetik) bahasa Indonesia, ensiklopedia bebas
Di sini, yang dimaksud adalah mengubah "teks" DNA menjadi RNA. Sebenarnya, yang berubah hanyalah basa nitrogen timina di DNA ... Hasil transkripsi yaitu berkas RNA yang masih "mentah" yang disebut mRNA primer.[7] Di dalamnya terdapat fragmen berkas untuk ... TAC pada berkas DNA). Berkas DNA yang ditempel oleh RNA polimerase disebut sebagai berkas templat, sementara berkas pasangannya ... Intensitas transkripsi ditentukan oleh keadaan di sejumlah bagian tertentu pada DNA. Ada bagian yang disebut suppressor yang ...
https://id.wikipedia.org/wiki/Transkripsi_
Adenozin trifosfat - Wikipedija, prosta enciklopedijaAdenozin trifosfat - Wikipedija, prosta enciklopedija
Sinteza DNA in RNA[uredi , uredi kodo]. V vseh znanih organizmih so deoksiribonukleotidi, ki so sestavni del DNA, sintetizirani ... V nekaterih protozojih kot so na primer kinetoplastidi, poteka proces v specializiranih organelih, imenovanih glikosomi. Med ... ATP je glavni vir energije za večino celičnih procesov vključujoč sintezo makromolekul (DNA in RNA in proteinov). ATP ima tudi ... Proces je podoben pri biosintezi DNA, kjer je ATP reduciran do deoksiribonukleotida, preden je vgrajen v nukleinsko kislino. ...
https://sl.wikipedia.org/wiki/Adenozin_trifosfat
GentrificationGentrification
In the Brookings Institution report Dealing with Neighborhood Change: A Primer on Gentrification and Policy Choices (2001), ... "City Hall's 'Density Hawks' Are Changing L.A.'s DNA". LA Weekly. Archived from the original on 16 April 2008.. ... "Dealing with Neighborhood Change: A Primer on Gentrification and Policy Choices". The Brookings Institution Center on Urban ...
https://en.m.wikipedia.org/wiki/Gentrification
Zinc finger inhibitorZinc finger inhibitor
As zinc fingers are known to be involved in m-RNA regulation, reverse transcription, protection of synthesized viral DNA, ... In its lifetime, NCp7 facilitates the unwinding of tRNA, acts as a primer for reverse transcription, chaperones nucleic acids ... and DNA replication. If these zinc ejectors unintentionally bind to the wrong zinc finger domains they have the potential to ...
https://en.wikipedia.org/wiki/Zinc_finger_inhibitor
PCR amplification of megabase DNA with tagged random primers (T-PCR). - PubMed - NCBIPCR amplification of megabase DNA with tagged random primers (T-PCR). - PubMed - NCBI
PCR amplification of megabase DNA with tagged random primers (T-PCR).. Grothues D1, Cantor CR, Smith CL. ...
https://www.ncbi.nlm.nih.gov/pubmed/8464718?dopt=Abstract
Additonal protocol-Alkali hydrolysis of BAC DNA before random-primer labellingAdditonal protocol-Alkali hydrolysis of BAC DNA before random-primer labelling
Breaking (shearing) DNA by Alkali Hydrolysis Suitable for BAC clones before labelling using random-primer (random priming, ... 300 ng DNA + 6.5 ul 4M NaOH made up to 155 ul, final NaOH 200 mM ... autoclaving of syringing the DNA requires too much volume). ...
https://www.le.ac.uk/biology/phh4/pralkhyd.htm
Patent US5350672 - Specific DNA primers and method to use same detect Eperythrozoon suis - Google PatentsPatent US5350672 - Specific DNA primers and method to use same detect Eperythrozoon suis - Google Patents
The present invention provides these E. suis primers and a method to use these primers in a PCR protocol to provide a highly ... suis specific primers in PCR with DNA from swine blood increases the sensitivity of current DNA hybridization protocols for ... These primers are capable of effectively hybridizing and serving as primers for the thermostable DNA polymerase used in the ... Saiki, Randall K., Primer Directed Enzymatic Amplification of DNA With a Thermostable DNA Polymerase, Science 239:487 491 (1988 ...
http://www.google.com/patents/US5350672?dq=552685
Template and primer requirements for DNA Pol θ-mediated end joining | PNASTemplate and primer requirements for DNA Pol θ-mediated end joining | PNAS
Template and primer requirements for DNA Pol θ-mediated end joining Message Subject (Your Name) has sent you a message from ... Template and primer requirements for DNA Pol θ-mediated end joining. Peng He and Wei Yang ... Polθ requires a minimum of 2 bp and optimally 4 bp between a template/primer pair for efficient and processive DNA synthesis. ... DNA Pol θ shares structural homology with the high-fidelity replicases, and its polymerase domain (Polθ) has been shown to ...
https://www.pnas.org/content/115/30/7747.short?rss=1
BIRCH - Designing PCR primers to amplify a gene from genomic DNABIRCH - Designing PCR primers to amplify a gene from genomic DNA
... region are shown in the Forward primer and Reverse Primer boxes.. In the Primer Parameters section, we set the Minimum PCR ... those primers are. Therefore, you need to make a special note of the primer data from the Primer-BLAST results.. ... see the sequences of the primers, as well as other data on the PCR primers. For comparison, results for Primer pairs 2 and 3 ... How does Primer-BLAST work?. The search for primers is essentially a 2-step process:. 1. Use the Primer3 program to design ...
http://home.cc.umanitoba.ca/~psgendb/birchhomedir/BIRCHDEV/public_html/tutorials/NCBI/PrimerBlast/PrimerBlast.html
Pre-synthesized DNA Primers & Oligos | Thermo Fisher Scientific - USPre-synthesized DNA Primers & Oligos | Thermo Fisher Scientific - US
... including random primers and hexamers, oligo (dT) primers, and sequencing primers. These products are commonly used in a ... Learn about the different pre-synthesized DNA primers and oligos that are available, ... pre-designed DNA primers and oligos. These products include random primers, Oligo (dT) primers, gene specific primers for ... Sequencing primers. Short RNA or DNA oligonucleotides are often used as primers in PCR reactions to amplify a specific target ...
https://www.thermofisher.com/us/en/home/life-science/oligonucleotides-primers-probes-genes/other-dna-primers-oligos.html
PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA SequencesPCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences
In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete ... Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis ... These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete ... Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics ...
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0035887
Plasmid DNA Sequencing with Universal Primers - Molecular BiologyPlasmid DNA Sequencing with Universal Primers - Molecular Biology
Big peaks for a short time, then nothing - too much DNA.. Nothing - bad primer, loss of DNA, bad cycling conditions.. If your ... Plasmid DNA Sequencing with Universal Primers - (Mar/08/2007 ). Hi all, Ive been having some trouble with sequencing. The gene ... The next important thing the amount of DNA and Big Dye terminator in used. The amount of DNA I use is about 400- 500ng.. ... The DNA has to be the cleanest you can possibly get it to be. No RNA , no proteins, removal of phenol must be complete, if your ...
http://www.protocol-online.org/biology-forums/posts/25311.html
What are the general recommendations for designing primers for bisulfite-treated/deaminated DNA? | NEBWhat are the general recommendations for designing primers for bisulfite-treated/deaminated DNA? | NEB
We recommend designing long (~26-35) oligonucleotide primers to amplify bisulfite treated/deaminated DNA. Because bisulfite DNA ... Home FAQs What are the general recommendations for designing primers for bisulfite-treated/deaminated DNA? ... Note that since the DNA strands are no longer complementary after bisulfite-treatment/deamination, an individual primer set ... The first primer should be designed to anneal to the converted target sequence. The second primer should be designed to anneal ...
https://www.neb.com/faqs/2019/07/03/what-are-the-general-recommendations-for-designing-primers-for-bisulfite-treated-deaminated-dna
TAIL-PCR primer design cloning Ecker and Alonso T-DNA linesTAIL-PCR primer design cloning Ecker and Alonso T-DNA lines
... vijay at ust.hk vijay at ust.hk Mon Sep 2 04:29:48 EST 2002 *Next ... Would anyone please suggest me the three primers for the TAIL reactions or the protocol from their own lab. Here is the vector ... student working now to clone a T-DNA insertion mutant of Cis-cinnamic acid.The mutant is isolated from Ecker and Alonso ... insertional line CS75100.I would like to design the primers for both Left and Right borders of the vector pROK2 for TAIL-PCR. ...
http://www.bio.net/hypermail/arabidopsis/2002-September/009240.html
A GoTaq® PCR Primer: From Basic to RT-qPCR DNA AmplificationA GoTaq® PCR Primer: From Basic to RT-qPCR DNA Amplification
... primer annealing and primer extension (Figure 1). The initial step denatures the target DNA by heating it to 94°C or higher. ... serving as primers for the DNA polymerase. Finally, the synthesis of new DNA begins as the reaction temperature is raised to ... and the DNA polymerase can extend the annealed primers to produce primer dimer, which often appears as a diffuse band of ... A typical amplification reaction includes target DNA, a thermostable DNA polymerase, two oligonucleotide primers, ...
https://www.promega.com/resources/pubhub/a-gotaq-pcr-primer-from-basic-to-rtqpcr-dna-amplification/
Custom DNA Primers 0413 | Thermo Fisher ScientificCustom DNA Primers 0413 | Thermo Fisher Scientific
Our custom DNA oligos are made to your specifications, with rigorous quality control and quick turnaround. They can be used in ...
https://www.thermofisher.com/us/en/home/products-and-services/product-types/primers-oligos-nucleotides/custom-dna-primers-v2.html
Molecular basis for stool-based DNA tests for colorectal cancer: a primer for clinicians. - PubMed - NCBIMolecular basis for stool-based DNA tests for colorectal cancer: a primer for clinicians. - PubMed - NCBI
Molecular basis for stool-based DNA tests for colorectal cancer: a primer for clinicians.. Boland CR1. ... Tumor cells and DNA are shed into the fecal stream, and uniquely mutated genes can be identified that would indicate the likely ...
https://www.ncbi.nlm.nih.gov/pubmed/12439394?dopt=Abstract
designing MSP primers (dimers NOOOOOOOO!) - DNA Methylation and Epigenetics - BioForumdesigning MSP primers (dimers NOOOOOOOO!) - DNA Methylation and Epigenetics - BioForum
These primers are going to be the death of me. Im using MethPrimer to design them, but the primer dimer problem is endless, ... Is there ever a point where you just deal with primer dimers? I saw some posts about formamide but wasnt sure if it applied. ... posted in DNA Methylation and Epigenetics: designing MSP for a USF site in my gene of interest. ... Primer dimmer is a big issue for MSP or any bisulfite based PCR because the low sequence complexity of the modified DNA. You ...
http://www.protocol-online.org/forums/topic/19394-designing-msp-primers-dimers-noooooooo/
Primer-DNA RNA? - Biology-OnlinePrimer-DNA RNA? - Biology-Online
... relating to PCR-DNA amlification it refers to the DNA primer. First of all why is this the case - DNA relpication:RNA primer, ... No DNA polymerase can. But they could start with DNA primers if such thing was available (and they do when repairing DNA). When ... DNA primer? Secondly when I look at the definition for a primer - it states that it is an RNA stand...so whats with the DNA ... RNA primers could be used but they are unstable and Rnases are frequent and really hard to get rid of, while DNA is easy to ...
https://www.biology-online.org/biology-forum/viewtopic.php?t=6738
Molecular Expressions Microscopy Primer: Specialized Microscopy Techniques - Hoffman Modulation Contrast Photomicrography...Molecular Expressions Microscopy Primer: Specialized Microscopy Techniques - Hoffman Modulation Contrast Photomicrography...
This page illustrates high molecular weight calf thymus DNA in a liquid crystalline phase viewed under a combination of crossed ... Liquid Crystalline DNA. DNA undergoes a series of liquid crystalline phase transitions when it is compressed in vivo into ... DNA is a very unusual molecule that is shaped like a very long piece of string. The diameter of the DNA molecule is about 25-30 ... In addition, it is important to the cell to be able to access the DNA molecule for the purposes of genetic control, routine ...
http://micro.magnet.fsu.edu/primer/techniques/hoffmangallery/dna.html
DNA Typing of HLA-B by PCR with Primer Mixes Utilizing Sequence-Specific Primers - Digital LibraryDNA Typing of HLA-B by PCR with Primer Mixes Utilizing Sequence-Specific Primers - Digital Library
This technique involves a one-step PCR reaction utilizing genomic DNA and sequence-specific primers to determine the ... specificity of each allele and to produce a larger primer data base ideal for serological analysis. The application of this ... Chiu, Angela Chen-Yen. DNA Typing of HLA-B by PCR with Primer Mixes Utilizing Sequence-Specific Primers, thesis, August 1997; ... DNA Typing of HLA-B by PCR with Primer Mixes Utilizing Sequence-Specific Primers ...
https://digital.library.unt.edu/ark:/67531/metadc278947/
DNA Labeling Kit | Random Primer Labeling | Bca PolymeraseDNA Labeling Kit | Random Primer Labeling | Bca Polymerase
BcaBEST DNA Labeling Kit. The BcaBEST DNA Labeling Kit is a novel random primer labeling system that uses longer primers (9- ... Unlike E. coli Klenow fragment or modified T7 DNA polymerase, Bca polymerase allows stable polymerization of DNA even for ... Lambda DNA digested with Hind III, 25 ng/µL). Note. The kit name has been changed from "Ladderman Labeling Kit" to "BcaBEST ... In general, probes with specific activities of ,109 dpm/mg DNA obtained with [32P]-alpha-dCTP (~3,000 Ci/mmol, 111 TBq/mmol). ...
http://www.clontech.com/US/Products/Molecular_Biology_Tools/DNA_Labeling_Kits/BcaBEST_DNA_Labeling_Kit?sitex=10020:22372:US&PEBCL1=IPwiIWVjaZbDgsjOGnqSa6Q7En&PEBCL1_pses=ZGD0C841FF463C3B06A164080927654D55F899C9FC37833A59758DBC4DB995F955CE98372B8B526686B340FC9E7FADB7B573D6A82857DD65A7
A Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in MonocotyledonsA Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in Monocotyledons
Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding ( ... we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also ... Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of ... Chloroplast DNA Is the Subject Area "Chloroplast DNA" applicable to this article? Yes. No. ...
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0019954
Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase | SciencePrimer-directed enzymatic amplification of DNA with a thermostable DNA polymerase | Science
Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. By RK Saiki, DH Gelfand, S Stoffel, SJ ... Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. By RK Saiki, DH Gelfand, S Stoffel, SJ ... Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase Message Subject. (Your Name) has forwarded a ... A thermostable DNA polymerase was used in an in vitro DNA amplification procedure, the polymerase chain reaction. The enzyme, ...
https://science.sciencemag.org/content/239/4839/487?ijkey=9fef8d162f545ea502a7a97e414773d58eb58ac8&keytype2=tf_ipsecsha
DNA (PCR, Real Time PCR): Primers and Oligonucleotides | Scientist SolutionsDNA (PCR, Real Time PCR): Primers and Oligonucleotides | Scientist Solutions
Home/ Forums/ DNA (PCR, Real Time PCR): Primers and Oligonucleotides. DNA (PCR, Real Time PCR): Primers and Oligonucleotides. ... PCR primers for mycoplasma 16S rRNA gene? (Page: 1, 2, 3, 4) by Jason King » Fri, 11/20/2009 - 12:30 194. by Rahul Date. Sat, ... Exon exon junction primers for RT-PCR by Haritha » Sat, 08/17/2013 - 02:39 2. by elhamzeinali. Wed, 02/10/2016 - 06:19 ... Long Primers not working? by Crystal Ramirez » Tue, 06/14/2016 - 11:51 8. by Ivan Delgado. Thu, 06/16/2016 - 13:10 ...
http://scientistsolutions.com/forums/dna-pcr-real-time-pcr-primers-and-oligonucleotides
Primer-BLAST | DNA Sequencing Software - Sequencher from Gene Codes CorporationPrimer-BLAST | DNA Sequencing Software - Sequencher from Gene Codes Corporation
Primer-BLAST. You are here. Home » Products » Sequencher » Sequencher Features » Connections » Primer-BLAST ... Your new primers are automatically tagged with a GenBank style feature key that makes them easier to see in an alignment. The ... Use Primer-BLAST to analyze sequences and check specificity.. Parallelize your analyses - use several different sets of ... If you want to learn more about Primer-BLAST, check out the Sequencher Connections tutorial. ...
http://www.genecodes.com/sequencher-features/connections/primer-blast
Use of single-primer DNA amplifications in genetic studies of peanut ( Arachis hypogaea L.) | SpringerLinkUse of single-primer DNA amplifications in genetic studies of peanut ( Arachis hypogaea L.) | SpringerLink
A recent approach to detecting genetic polymorphism involves the amplification of genomic DNA using single primers of arbitrary ... Use of single-primer DNA amplifications in genetic studies of peanut (Arachis hypogaea L.). ... Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV: DNA polymorphisms amplified by arbitrary primers are useful as ... A recent approach to detecting genetic polymorphism involves the amplification of genomic DNA using single primers of arbitrary ...
https://link.springer.com/article/10.1007%2FBF00034958
Photo-cleavable nucleotides for primer free enzyme mediated DNA synthesis - Organic & Biomolecular Chemistry (RSC Publishing)Photo-cleavable nucleotides for primer free enzyme mediated DNA synthesis - Organic & Biomolecular Chemistry (RSC Publishing)
OH with a photolabile protecting group which can temporarily cease DNA strand growth and can smoothly reinitia ... Photo-cleavable nucleotides for primer free enzyme mediated DNA synthesis A. S. Mathews, H. Yang and C. Montemagno, Org. Biomol ... The synthesised nucleotides are employed for terminating and reinitiating template-less DNA synthesis, using primer independent ... The use of this photolabile nucleotide in one step stop-start DNA synthesis is a novel strategy towards the precise assembly of ...
https://pubs.rsc.org/en/content/articlelanding/2016/ob/c6ob01371f
Cytomegalovirus DNA detection of an immediate early protein gene with nested primer oligonucleotidesCytomegalovirus DNA detection of an immediate early protein gene with nested primer oligonucleotides
The primers sequences were from EcoRI J fragment of Ad169. The first primer set was selected to amplify a 242 bp fragment and ... Cytomegalovirus DNA detection of an immediate early protein gene with nested primer oligonucleotides J Virol Methods. 1991 May; ... The first primer set was selected to amplify a 242 bp fragment and the next primer set was nested within the first and ... With the single PCR system it was possible to detect 100 fg HCMV DNA but with double PCR 5-10 fg were detectable. Specific ...
https://pubmed.ncbi.nlm.nih.gov/1651946/?dopt=Abstract
particleshop - Primers, 16s Ribosomal DNA - François Lutzonis Labparticleshop - Primers, 16s Ribosomal DNA - François Lutzoni's Lab
Antibodies / Assay Kits / Biology Cells / cDNA / Clia Kits / Culture Cells / Devices / DNA / DNA Templates / DNA Testing / ... Copyright © 2020 Primers, 16s Ribosomal DNA - François Lutzonis Lab - OnePress theme by FameThemes ...
https://www.lutzonilab.net/tag/particleshop/
Mitochondrial DNA Sequencing Primers<...Mitochondrial DNA Sequencing Primers<...
Mitochondrial DNA Sequencing Primers mtDNA sequencing is useful in evolutionary studies, single nucleotide polymorphism (SNP) ... within the D-loop region of human mitochondrial DNA (mtDNA). ...
https://www.trilinkbiotech.com/products-services/sequencing-reagents/mitochondrial-dna-sequencing-primers.html
Fluidigm | FAQ | How should I store my targeted DNA sequencing library prep assay primers?Fluidigm | FAQ | How should I store my targeted DNA sequencing library prep assay primers?
How should I store my targeted DNA sequencing library prep assay primers?. Primer pools are stable for up to one year at -20 °C ...
https://www.fluidigm.com/faq/ts-09
DNA from the Beginning - An animated primer of 75 experiments that made modern genetics.DNA from the Beginning - An animated primer of 75 experiments that made modern genetics.
This animated primer features the work of over 100 scientists and researchers. ... DNA from the Beginning is organized around key concepts.. The science behind each concept is explained by: animation, image ...
http://www.dnaftb.org
Using primers after DNA modification - Biology Forum | Biology-Online Dictionary, Blog & ForumUsing primers after DNA modification - Biology Forum | Biology-Online Dictionary, Blog & Forum
... working with 3 commerical primers and control experimental DNA samples. I use the methylated specific PCR procedure and then ... I think my main problem is the primers not working correctly. When u make your master mix , how much DNA and primer do u put ... what differs the primers from eachother and are they complementary to the DNA? How do u combine the primers? ... What do u suggest the correct amount of DNA , Primer, and wat type of TAQ would u suggest i use? im currently using Hot start ...
https://biology-online.org/biology-forum/viewtopic.php?f=1&t=6891&p=46661
SequencesSynthesisGenomicAmplificationAmplifyNucleotidesSpecificityOligonucleotidesDouble strandedSingle strandedGeneReplicationUniversal PrimersStrandPairsGenesMitochondrial DNAAssayOligosGeneticReal TimSpecies-specific primersProbes and primersGeneticsMoleculeDetectionQPCR primerKlenowMolecularStrandsSequencingOkazakiPolymerasesProbeDuplexDetectBasesReactionsGenomesClade-specificPolymerase alpha-primase complexComplementaryHybridizationThermostable DNA polymeraseLocus-specificMutationsCalled DNA polymeraseSpecificDesignResultsChloroplast DNAEnzymeVitroGenomeReaction
Sequences35
  • More particularly, the invention is concerned with the identification of E. suis DNA sequences that can be used to probe for E. suis genomic DNA. (google.com)
  • The primers are designated to hybridize with sequences that flank the target DNA. (google.com)
  • Using oligonucleotides with distinct sequences, we find that with Mg 2+ and physiological salt concentrations, human Polθ has no terminal transferase activity and requires a minimum of 2 bp and optimally 4 bp between a template/primer pair for DNA synthesis. (pnas.org)
  • In practice, if the goal was to clone a PCR fragment, one could either add suitable restriction sites to these primer sequences before synthesis of the primers, or after PCR, ligate cloning adaptors to the blunt-end PCR fragments. (umanitoba.ca)
  • These are short oligodeoxyribonucleotides with random base sequences (usually [d(N)6]) and are commonly referred to as random primers or hexamers. (thermofisher.com)
  • DNA oligos produced by GenScript's state-of-the-art oligo-synthesizer have substantial purity with low truncated sequences. (genscript.com)
  • Single-copy genomic sequences were amplified by a factor of more than 10 million with very high specificity, and DNA segments up to 2000 base pairs were readily amplified. (sciencemag.org)
  • Use Primer-BLAST to analyze sequences and check specificity. (genecodes.com)
  • Southern EM: Detection of specific sequences among DNA fragments separated by gel electrophoresis. (springer.com)
  • The primers sequences were from EcoRI J fragment of Ad169. (nih.gov)
  • Examination of other primers reported for the PCR of kDNA from various species of Leishmania showed that six of seven were homologous to human DNA sequences. (ajtmh.org)
  • The tool will help to design PCR primers containing the required overlap sequences. (neb.com)
  • NEBuilder Assembly Tool can be used to design primers for your NEBuilder HiFi or Gibson Assembly reactions based on entered fragment sequences and the polymerase being used for amplification. (neb.com)
  • The procedure involves microdissection of the region of interest, amplification of the DNA by PCR using a primer designed to prime the synthesis nonspecifically, labeling of the amplified DNA using the random primer method, and screening of a standard library with the probe to identify and isolate clones carrying sequences homologous to the dissected region. (nih.gov)
  • BACKGROUND: DNA sequences and immunoreactivity associated with Simian virus 40 transforming factors, large T and small t antigens (SV40LTAg), suggestive of an aetiopathogenetic link have been identified in fresh frozen tissue of a high proportion of recent cases of pleural mesotheliomas from the United States, Italy and Germany. (bmj.com)
  • The diversity of sequences within a sample that can be detected by universal primers is often compromised by high concentrations of some DNA templates. (uio.no)
  • If the DNA within the sample contains a small number of sequences in relatively high concentrations, then less concentrated sequences are often not amplified because the PCR favours the dominant DNA types. (uio.no)
  • These results indicate that (i) plus-strand primer cleavage and translocation are distinct steps that can be dissociated by mutation, (ii) lesions in sequences not included in the primer can severely inhibit primer translocation, and (iii) elongation of such untranslocated primers is responsible for the variable quantities of linear DNA that are found in all hepadnaviral stocks. (asm.org)
  • We have previously demonstrated recombinational rescue of primer binding site (PBS)-impaired Akv murine leukemia virus-based vectors involving initial priming on endogenous viral sequences and template switching during cDNA synthesis to obtain PBS complementarity in second-strand transfer of reverse transcription (Mikkelsen et al. (asm.org)
  • The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. (byu.edu)
  • By the PCR-SSCP method using these primers, we screened genomic DNA sequences of colorectal cancers for mutations of the Smad2 gene. (oup.com)
  • Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. (mcw.edu)
  • This can be achieved by covalently linking short, unique "barcode" DNA segments to genomic DNA samples, for instance through incorporation of barcode sequences in PCR primers. (biomedcentral.com)
  • Although several strategies have been described to insure that barcode sequences are unique and robust to sequencing errors, these have not been integrated into the overall primer design process, thus potentially introducing bias into PCR amplification and/or sequencing steps. (biomedcentral.com)
  • In contrast, proper design of barcoded primers requires careful consideration of how the inclusion of barcode sequences (and any other required sequences e.g., the "A" and "B" sequences required by the 454 GS-FLX platform) may impact the specificity, sensitivity, and overall efficiency of primer-dependent steps of the workflow. (biomedcentral.com)
  • Barcodes are evaluated within the context of other sequences contained in the forward and reverse PCR primers in order to cull potentially problematic sequences (e.g., due to inhibitory homopolymers, potential hairpins or heteroduplex formation between primers). (biomedcentral.com)
  • These are short sequences of DNA that repeat from five to fifty times. (biotechprimer.com)
  • Replication origins are composed of special sequences of DNA that are recognized by replication initiator proteins, which bind to the origin sequences and then help to assemble other proteins required for DNA replication at these sites. (encyclopedia.com)
  • First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. (biomedcentral.com)
  • FSTs are short DNA sequences, which flank the T-DNA insertion site and contain genome sequence information adjacent to the insertion site. (biomedcentral.com)
  • Their sequences can be compared to the A. thaliana genome sequence using BLAST [ 8 ] to predict the insertion position(s) of the T-DNA in a given line. (biomedcentral.com)
  • Affinity Plus DNA & RNA Oligonucleotides and Affinity Plus Ultramer DNA Oligonucleotides are custom, single-stranded and duplexed sequences that contain locked nucleic acid (LNA) bases. (idtdna.com)
  • Oligo pools are individually synthesized single-stranded DNA sequences that range from 40 to 350 bases. (idtdna.com)
  • List of species/sequences used to design reverse primer A246. (wiley.com)
  • Primers are small DNA sequences that are designed to start DNA replication in a laboratory technique called polymerase chain reaction, or PCR, to amplify c. (reference.com)
Synthesis31
  • Polθ requires a minimum of 2 bp and optimally 4 bp between a template/primer pair for efficient and processive DNA synthesis. (pnas.org)
  • In addition to our custom synthesis options for oligos, primers, probes, and genes, Thermo Fisher Scientific offers a selection of other high-quality, pre-designed DNA primers and oligos. (thermofisher.com)
  • These primers are suitable for DNA synthesis using Klenow fragments with DNA templates or for cDNA synthesis using reverse transcriptase with mRNA templates. (thermofisher.com)
  • GenScript, as the largest gene synthesis provider in the USA, provides affordable custom modified DNA oligos and RNA oligos . (genscript.com)
  • We also provide unmodified DNA oligo synthesis for large-scale orders only (at least 96 DNA Oligos). (genscript.com)
  • GenScript provides modified DNA oligos with flexible synthesis scales for your individual research needs. (genscript.com)
  • In DNA replication, RNA primers are sythesized by an RNA polymerase which can start the synthesis of a nucleic acid with just a template and no primer. (biology-online.org)
  • The synthesised nucleotides are employed for terminating and reinitiating template-less DNA synthesis, using primer independent Terminal Deoxynucleotidyl Transferase (TdT) enzyme. (rsc.org)
  • The use of this photolabile nucleotide in one step stop-start DNA synthesis is a novel strategy towards the precise assembly of dNTPs with the potential to reinforce present technologies. (rsc.org)
  • Discontinuous DNA synthesis iv). (scribd.com)
  • These studies indicate that primer-DNA functions during both initiation and elongation stages of SV40 DNA synthesis. (asm.org)
  • Mutations affecting hepadnavirus plus-strand DNA synthesis dissociate primer cleavage from translocation and reveal the origin of linear viral DNA. (asm.org)
  • Plus-strand DNA synthesis initiates at DR2 on minus-strand DNA, using as a primer a short, DR1-containing oligoribonucleotide derived by cleavage and translocation from the 5' end of pregenomic RNA. (asm.org)
  • Correct removal of RNA primers of Okazaki fragments during lagging-strand DNA synthesis is a critical process for the maintenance of genome integrity. (asm.org)
  • By use of the same forced recombination system, we have now found recombinant proviruses of different structures, suggesting that PBS knockout vectors may be rescued through initial priming on endogenous virus RNA, read-through of the mutated PBS during minus-strand synthesis, and subsequent second-strand transfer mediated by the R-U5 complementarity of the plus strand and the extended minus-strand DNA acceptor template. (asm.org)
  • DNA synthesis is initiated from the 3′ end of a host-derived tRNA matching the 18-nucleotide primer binding site (PBS) located downstream from the U5 region. (asm.org)
  • After transfer of weak- or strong-stop DNA, minus-strand DNA synthesis advances toward the 5′ end of the RNA template. (asm.org)
  • Plus-strand synthesis, which is primed from a purine-rich RNA fragment upstream from the U3 region ( 18 , 28 , 45 , 46 ), is believed to proceed until the first modified tRNA nucleotide is reached, leading to regeneration of the PBS matching the primer tRNA ( 48 , 56 ). (asm.org)
  • Such recombinational rescue mechanisms may include template shifting during minus- or plus-strand DNA synthesis and may be influenced by the character of the two strand transfers of reverse transcription ( 39 , 59 , 66 ). (asm.org)
  • DNA-Methylated/Non-methylated Control DNA & Primer Set-Genemed Synthesis Inc. (genemedsyn.com)
  • Dual mode of interaction of DNA polymerase epsilon with proliferating cell nuclear antigen in primer binding and DNA synthesis. (uzh.ch)
  • Proliferating cell nuclear antigen can interact with DNA polymerase epsilon on linear DNA templates, even in the absence of other auxiliary factors (replication factor C, replication protein A), and thereby stimulate its primer recognition and DNA synthesis. (uzh.ch)
  • However, for stimulation of DNA polymerase epsilon DNA synthesis, exclusively the C-terminal side appears to be sufficient. (uzh.ch)
  • In this study, we have examined the physiological involvement of these proteins in DNA synthesis and cell proliferation. (biologists.org)
  • When exponentially growing human HeLa cells are exposed to antisense phosphorothioate oligodeoxynucleotides to annexin II, ongoing DNA synthesis is reduced. (biologists.org)
  • These experiments indicate that annexin II and PGK may have a physiological role in DNA synthesis and cell cycle progression, and represent the first physiological role for annexin II monomer in cells. (biologists.org)
  • Akiyama BM, Parks JW, Stone MD. The telomerase essential N-terminal domain promotes DNA synthesis by stabilizing short RNA-DNA hybrids. (ucdenver.edu)
  • The separation of the two template strands and the synthesis of new daughter DNA molecules creates a moving "replication fork" (Figure 2), in which, double-stranded DNA is continually unwound and copied. (encyclopedia.com)
  • They only synthesis double stranded DNA from single stranded DNA. (scienceprimer.com)
  • The third step occurs in the next cycle, when a single strand of the product of step II is used as a template to which fresh primers anneal leading to synthesis of more PD product. (wikipedia.org)
  • Although DNA polymerases used in PCR are most active around 70 °C, they have some polymerizing activity also at lower temperatures, which can cause DNA synthesis from primers after annealing to each other. (wikipedia.org)
Genomic15
  • In many cases the quickest way to clone a gene is to amplify it by PCR from genomic DNA, and clone the PCR product. (umanitoba.ca)
  • To demonstrate the process of finding a gene in a genomic sequence, designing PCR primers for the gene, and retrieving the expected PCR product that would be generated using those primers. (umanitoba.ca)
  • Primer-BLAST lists the accession number of the genomic scaffold, and the coordinates of the selected region are shown in the Forward primer and Reverse Primer boxes. (umanitoba.ca)
  • This technique involves a one-step PCR reaction utilizing genomic DNA and sequence-specific primers to determine the specificity of each allele and to produce a larger primer data base ideal for serological analysis. (unt.edu)
  • A recent approach to detecting genetic polymorphism involves the amplification of genomic DNA using single primers of arbitrary sequence. (springer.com)
  • Two peanut cultivars, 25 unadapted germplasm lines of A. hypogaea , the wild allotetraploid progenitor of cultivated peanut ( A. monticola ), A. glabrata (a tetraploid species from section Rhizomatosae ), and 29 diploid wild species of Arachis were evaluated for variability using primers of arbitrary sequence to amplify segments of genomic DNA. (springer.com)
  • Genomic and kinetoplastderived DNA probes as well as species complex-specific kinetoplast-derived polymerase chain reaction (PCR) primers have been successful for parasite identification in epidemiologic and taxonomic studies. (ajtmh.org)
  • Are primers available that only detect mitochondrial DNA encoded genes and not nuclear genomic DNA encoded genes? (qiagen.com)
  • Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum. (uni-muenchen.de)
  • Mutation analysis of the Smad2 gene in human colon cancers using genomic DNA and intron primers. (oup.com)
  • Advances in automated DNA sequencing technology have greatly increased the scale of genomic and metagenomic studies. (biomedcentral.com)
  • Here, we explore whether microfluidic qPCR (MFQPCR) is a viable high-throughput alternative for functional gene quantification, by evaluating the efficiency, specificity and sensitivity of 29 established and 12 newly designed primer pairs targeting taxonomic, nitrogen-cycling, and hydrocarbon degradation genes in genomic DNA soil extracts, under three different sets of MFQPCR assay conditions. (frontiersin.org)
  • We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. (biomedcentral.com)
  • It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. (biomedcentral.com)
  • In bisulfite conversion-based PCR methods, genomic DNA is treated with bisulfite to convert non-methylated cytosine to uracil by deamination while leaving methylated cytosine unaffected. (biomedcentral.com)
Amplification30
  • PCR amplification of megabase DNA with tagged random primers (T-PCR). (nih.gov)
  • 4. A double stranded DNA amplification product having the DNA sequence set out in SEQ ID NO: 3 on one strand and SEQ ID NO: 4 on the other strand. (google.com)
  • This invention provides a specific DNA probe and describes its use in a primer directed amplification assay for E. suis. (google.com)
  • By this technique, selective enrichment of a specific DNA sequence can be achieved by exponential amplification of the target sequence. (google.com)
  • To facilitate PCR amplification, pairs of oligonucleotide primers may be employed as described in U.S. Pat. (google.com)
  • A thermostable DNA polymerase was used in an in vitro DNA amplification procedure, the polymerase chain reaction. (sciencemag.org)
  • The dominant behavior of the markers prevented the differentiation of heterozygotes from homozygotes with certainty, limiting the usefulness of arbitrary primer amplification products as markers in the construction of a genetic linkage map in peanut. (springer.com)
  • Caetano-Anolles G, Bassam BJ, Gresshof PM: DNA amplification fingerprinting using very short arbitrary oligonucleotide primers. (springer.com)
  • This suggests that specific amplification by double PCR is sensitive and can be used for rapid detection of HCMV DNA in cases with activated infection. (nih.gov)
  • TriLink mitoPrimers™ allow standard amplification of hypervariable region 1 (HV1) and hypervariable region 2 (HV2) within the D-loop region of human mitochondrial DNA (mtDNA). (trilinkbiotech.com)
  • Southern blotting and sequencing of polymerase chain reaction (PCR) products confirmed the specificity of kinetoplast DNA (kDNA) amplification from tissue fluid from healthy skin, whereas the PCR with monocytes also amplified a human sequence of a size similar (718 basepairs) to the expected kDNA product (750 basepairs), resulting in false-positive results. (ajtmh.org)
  • Amplification of the human art3fact from monocyte DNA was confirmed using the primer B2 alone. (ajtmh.org)
  • These findings underscore the importance of exploiting sequencing, bioinformatics, and DNA probes to refine molecular amplification techniques and to validate the performance of primers when used for new applications. (ajtmh.org)
  • Diagnosis of new world leishmaniasis: specific detection of species of the Leishmania braziliensis complex by amplification of kinetoplast DNA. (ajtmh.org)
  • Simian virus 40 large T antigen (SV40LTAg) primer specific DNA amplification in human pleural mesothelioma tissue. (bmj.com)
  • Primers for the amplification and sequencing of DNA fragments from chloroplast genes and non-coding regions are provided to facilitate molecular phylogenetic studies aimed at building a tree-of-life for the Asteraceae. (utexas.edu)
  • We have developed a strategy where a universal PCR simultaneously amplifies DNA from food items present in DNA purified from stomach samples, while the predator's own DNA is blocked from amplification by the addition of a modified predator-specific blocking primer. (uio.no)
  • The prey template then showed strong PCR amplification where none was detectable without the addition of blocking primer. (uio.no)
  • As a result, the DNA polymerase amplifies the PD, leading to competition for PCR reagents, thus potentially inhibiting amplification of the DNA sequence targeted for PCR amplification. (wikipedia.org)
  • I have read online here that including a single primer will result in linear amplification but I think there should be no amplification at all. (stackexchange.com)
  • I was wondering what would happen if there is only one primer and I think theoretically there should be no amplification. (stackexchange.com)
  • There would be no amplification but we will get n copies of single stranded DNA after n cycles and the only double stranded DNA with started with but with a new complementary strand. (stackexchange.com)
  • Therefore, with one primer you linear amplification of say x40 times the original number of molecules you started with, whie with two primers you get exponential (~2 40 ) amplification. (stackexchange.com)
  • You right that with one primer, the amplification is neglectable, almost invisible. (stackexchange.com)
  • In particular, primer concentrations have to be adjusted to assure an even amplification of all targeted DNA fragments. (wiley.com)
  • These were then used to balance the amplification success for the different targets and to subsequently determine the sensitivity of each primer pair in the multiplex PCR. (wiley.com)
  • 3. In the current multiplex assay, this approach led to an even amplification success for all seven targeted DNA fragments. (wiley.com)
  • Primer Probe Hybridization: There is always the possibility of the primer hybridizing to the probe element, this will lead to linearization of the probe in an amplification-independent manner causing significant, target-independent fluorescence. (biosyn.com)
  • This kit contains primer pairs for the amplification of four regions: two primer pairs for detecting mtDNA and two primer pairs for detecting nDNA. (takarabio.com)
  • This set contains primer pairs for the amplification of four regions: two primer pairs for the detection of mtDNA and two primer pairs for the detection of nDNA. (takarabio.com)
Amplify11
  • Short RNA or DNA oligonucleotides are often used as primers in PCR reactions to amplify a specific target or to directly sequence a specific genetic region of interest ( Sanger sequencing ). (thermofisher.com)
  • We recommend designing long (~26-35) oligonucleotide primers to amplify bisulfite treated/deaminated DNA. (neb.com)
  • Note that since the DNA strands are no longer complementary after bisulfite-treatment/deamination, an individual primer set will only amplify one strand of the target sequence. (neb.com)
  • In addition, the method was used to amplify and detect a target DNA molecule present only once in a sample of 10(5) cells. (sciencemag.org)
  • The first primer set was selected to amplify a 242 bp fragment and the next primer set was nested within the first and amplified a 146 bp fragment. (nih.gov)
  • The most common molecular strategies for estimating taxonomic composition depend upon PCR with universal primers that amplify an orthologous DNA region from a range of species. (uio.no)
  • Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. (byu.edu)
  • These primers will not amplify pseudogenes. (takarabio.com)
  • As the primers are human-specific and will not amplify DNA from mice, human mtDNA content can be monitored in induced pluripotent stem (iPS) cells or other cells cultured with feeder cells of mouse origin. (takarabio.com)
  • Each primer is specifically designed and will not amplify pseudogenes. (takarabio.com)
  • As the primers are human-specific and will not amplify DNA from mice, human mtDNA content can be monitored in iPS cells or other cells cultured with feeder cells of mouse origin. (takarabio.com)
Nucleotides10
  • Although B1 was not homologous to any human DNA sequence, B2 showed homology to a human chromosome 2 intergenic region (AC010878) at positions 35,881-36,599, which are spaced 718 nucleotides apart. (ajtmh.org)
  • the HIV RT primer-template complex has a half-life of 1.7±1.0 min, incorporating nucleotides at a maximum rate of 3.5 nucleotides (nt) per second (average speed 1.4±0.4 nt/sec). (umd.edu)
  • These fragments, measuring about 200 nucleotides (nt) in eukaryotes, are primed by DNA polymerase alpha/primase with a short oligoribonucleotide of 7 to 14 residues. (asm.org)
  • DNA nucleotides have a direction, in the same way that an arrow has a head and a tail. (encyclopedia.com)
  • The two strands of DNA run in opposite directions, and are wound around each other in a double helix, with the strands held together by hydrogen bonds between paired bases of the nucleotides (A pairs with T, and G pairs with C). (encyclopedia.com)
  • During the process of DNA replication, the strands are unwound by an enzyme called DNA helicase, and a new strand of DNA is synthesized on each of the old ( template ) strands by an enzyme called DNA polymerase, which joins incoming nucleotides together in a sequence that is determined by the sequence of nucleotides present in the template strand. (encyclopedia.com)
  • They do this by adding individual nucleotides to the 3-prime hydroxl group of a strand of DNA. (scienceprimer.com)
  • Dependence on energy from the phosphates linked to the 5-prime carbon of the incoming nucleotides means that DNA polymerase can only extend DNA strands by adding nucleotides to the 3-prime end of a DNA strand. (scienceprimer.com)
  • One approach to prevent PDs consists of physical-chemical optimization of the PCR system, i.e. changing the concentrations of primers, magnesium chloride, nucleotides, ionic strength and temperature of the reaction. (wikipedia.org)
  • The primers are based on standard DNA nucleotides, added one or a few pentabase modifications. (pentabase.com)
Specificity4
  • Longer primers will also increase specificity. (neb.com)
  • However, the lack of a species DNA probe or PCR primer set, their relatively poor availability, and unknown comparative sensitivity and specificity have precluded their routine and widespread use as identification tools in many laboratories. (ajtmh.org)
  • This study addresses this problem for 28 different random amplified polymorphic DNA (RAPD)-PCR primers that have been assessed regarding their sensitivity, specificity, and reliability for distinguishing each of four closely related New World Leishmania species. (ajtmh.org)
  • Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. (biomedcentral.com)
Oligonucleotides2
  • Using oligonucleotides comprised solely of purines or pyrimidines, we find that human Polθ is a bona fide template-dependent DNA polymerase and has no terminal transferase activity under physiological conditions. (pnas.org)
  • Discrimination amongst Leishmania by polymerase chain reaction and hybridization with small subunit ribosomal DNA derived oligonucleotides. (ajtmh.org)
Double stranded13
  • The human immunodeficiency virus (HIV) polymerase, reverse transcriptase (RT), uses a single-stranded RNA template to create double-stranded DNA during the course of the viral life cycle. (umd.edu)
  • Replication of double-stranded DNA is an asymmetric process. (asm.org)
  • Retroviruses harbor a diploid single-stranded RNA genome which constitutes the source for generation of double-stranded DNA by reverse transcription. (asm.org)
  • The first step is a change in the conformation of the initiator protein, which causes limited "melting" (that is, the separation of the two strands) of the double-stranded DNA next to the initiator binding site, thus exposing single-stranded regions of the template (Figure 1). (encyclopedia.com)
  • The starting point is a a stretch of single stranded DNA which is double stranded for at least part of its length. (scienceprimer.com)
  • In the polymerase chain reaction the double stranded stretch is created by attaching short DNA primers. (scienceprimer.com)
  • In quantitative PCR, PDs may be detected by melting curve analysis with intercalating dyes, such as SYBR Green I, a nonspecific dye for detection of double-stranded DNA. (wikipedia.org)
  • They can be divided between those that have two strands of DNA in their genome, called double-stranded DNA (dsDNA) viruses, and those that have one strand of DNA in their genome, called single-stranded DNA (ssDNA) viruses. (wikipedia.org)
  • DNA viruses constitute two Baltimore groups: Group I: double-stranded DNA viruses, and Group II: single-stranded DNA viruses. (wikipedia.org)
  • The first Baltimore group of DNA viruses are those that have a double-stranded DNA genome. (wikipedia.org)
  • However, because the genome is single-stranded, it is first made into a double-stranded form by a DNA polymerase upon entering a host cell. (wikipedia.org)
  • The new ssDNA may be packaged into virions or replicated by a DNA polymerase to form a double-stranded form for transcription or continuation of the replication cycle. (wikipedia.org)
  • According to Wikipedia, DNA polymerases then start to copy each strand of the original double-stranded DNA. (reference.com)
Single stranded3
  • The single-stranded DNA binding protein of T7 overcomes this inhibition. (harvard.edu)
  • What will be present after 40 cycles are 40 single stranded DNAs and only one DNA of interest. (stackexchange.com)
  • After deamination with bisulfite, DNA complementary is lost, resulting in single-stranded DNA. (biomedcentral.com)
Gene13
  • These products include random primers , Oligo (dT) primers , gene specific primers for sequencing, forward and reverse sequencing primers and kits, and the MegaPlex RT Primers and Megaplex Primer Pools developed for assessing expression profiles. (thermofisher.com)
  • The gene I want is about 1.8kbp, but I've got nothing reliable after 2 trials with the primers I designed. (protocol-online.org)
  • PCR primers for mycoplasma 16S rRNA gene? (scientistsolutions.com)
  • The Enzymology Primer for Recombinant DNA Technology includes information not usually found in the brief descriptions given in most books on recombinant DNA methodology and gene cloning. (textbookx.com)
  • Targeted DNA Seq Library assays are designed to human species for targets with an associated RefSeq ID, gene name, target sequence or genome coordinate. (fluidigm.com)
  • Gene 6 protein of bacteriophage T7 has 5′-3′-exonuclease activity specific for duplex DNA. (harvard.edu)
  • 3′-extensions generated during degradation of duplex DNA by the exonuclease activity of gene 6 protein are inhibitory to further degradation of the 5′-terminus by the exonuclease activity of gene 6 protein. (harvard.edu)
  • Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. (byu.edu)
  • In this study, we designed 11 sets of intron-based primers to examine the entire coding region of the Smad2 gene. (oup.com)
  • Direct DNA sequencing of human immunodeficiency virus type 1 (HIV-1) pol and env gene regions was characterized for accuracy and precision. (bcm.edu)
  • Quantitative PCR uses DNA-complexing fluorophores and real-time detection to quantify the number of gene copies present in an individual reaction and is currently the gold-standard of gene quantification. (frontiersin.org)
  • Deoxyribonucleic acid (DNA) is a special code of instructions that makes up a gene and tells it what to do. (dnadietplan.com)
  • A gene is a section of DNA made from a specific combination of bases. (dnadietplan.com)
Replication24
  • In my text relating to DNA replication it refers to the RNA primer. (biology-online.org)
  • Initiation of DNA replication iii). (scribd.com)
  • Spontaneous mutations in DNA replication iii). (scribd.com)
  • Primer-DNA formation during simian virus 40 DNA replication in vitro. (asm.org)
  • Studies of simian virus 40 (SV40) DNA replication in vitro have identified a small (approximately 30-nucleotide) RNA-DNA hybrid species termed primer-DNA. (asm.org)
  • Herein, we present an investigation of the stages at which primer-DNA functions during SV40 DNA replication in vitro. (asm.org)
  • At all time points, primer-DNA is synthesized from templates for lagging-strand DNA replication. (asm.org)
  • Recently, RNase H(35), the Saccharomyces cerevisiae homologue of mammalian RNase HI, was identified and its possible role in DNA replication was proposed (P. Frank, C. Braunshofer-Reiter, and U. Wintersberger, FEBS Lett. (asm.org)
  • Moreover, evidence from the bovine system suggests that the activity of the large RNase HI correlates with DNA replication whereas that of the small RNase HII correlates with transcription ( 7 ). (asm.org)
  • Mitochondrial DNA polymerase Gamma (Pol G) is the single polymerase responsible for replication and repair of mitochondrial DNA. (jbsdonline.com)
  • Primer recognition proteins (PRP) are cofactors for DNA polymerase alpha and may have a role in lagging-strand DNA replication. (biologists.org)
  • DNA replication is said to be semiconservative because each of the two identical daughter molecules contains one of the two parental template strands paired with a new strand. (encyclopedia.com)
  • DNA replication begins (initiates) at special sites called origins of DNA replication. (encyclopedia.com)
  • Eukaryotic DNAs each contain multiple replication origins, spaced at intervals of approximately 100,000 base pairs (100 kilobase pairs, or 100 kb) along the length of the DNA. (encyclopedia.com)
  • The bacterial replication initiator protein is called the dna A protein. (encyclopedia.com)
  • The timing of DNA replication is regulated by controlling the assembly of complexes at replication origins. (encyclopedia.com)
  • Replication initiation is triggered by the activation of the helicase and primase, and the subsequent recruitment of DNA polymerase. (encyclopedia.com)
  • Browse other questions tagged pcr dna-replication primer or ask your own question . (stackexchange.com)
  • ssDNA RCR is initiated by an endonuclease that bonds to and cleaves the positive strand, allowing a DNA polymerase to use the negative strand as a template for replication. (wikipedia.org)
  • What is the role of DNA polymerase in DNA replication? (reference.com)
  • DNA polymerases work directionally: They begin the replication process at the 3' end of the molecule and work towards the 5' end of the molecule. (reference.com)
  • Why is DNA replication important? (reference.com)
  • DNA replication is important because it creates a second copy of DNA that must go into one of the two daughter cells when a cell divides. (reference.com)
  • DNA replication is a method of making many copies of DNA. (reference.com)
Universal Primers1
  • one annealing inhibiting primer overlapping with the 3' end of one of the universal primers, another annealing inhibiting primer also having an internal modification of five dI molecules making it a dual priming oligo, and a third elongation arrest primer located between the two universal primers. (uio.no)
Strand21
  • DNA Pol θ-mediated end joining (TMEJ) is a microhomology-based pathway for repairing double-strand breaks in eukaryotes. (pnas.org)
  • In line with its TMEJ function, Polθ has limited strand-displacement activity, and the efficiency and extent of primer extension are similar with or without a downstream duplex. (pnas.org)
  • The second primer should be designed to anneal to the extension product of the first primer, not the opposite template strand, as would be the case in traditional PCR. (neb.com)
  • These nucleotide analogues are modified by capping the 3′-OH with a photolabile protecting group which can temporarily cease DNA strand growth and can smoothly reinitiate the growth by the photodecomposition of the protecting group and setting the 3′-OH of dNTPs free to propagate. (rsc.org)
  • they are 3 different primers that cleave 3 different genes from the DNA strand. (biology-online.org)
  • The flap endonuclease activity provides a mechanism by which RNA-terminated Okazaki fragments, displaced by the lagging strand DNA polymerase, are processed. (harvard.edu)
  • The initial product of reverse transcription, minus-strand DNA, contains two copies of a short direct repeat (DR) sequence, termed DR1 and DR2. (asm.org)
  • To clarify the sequence requirements for plus-strand primer cleavage and translocation, we have constructed mutants of the duck hepatitis B virus bearing base changes in or around the DR1 sequence in the primer. (asm.org)
  • Before the nascent Okazaki fragments are ligated to form a continuous lagging strand, the short RNA primers must be removed by an enzyme exhibiting RNase H activity. (asm.org)
  • The resulting minus-strand strong-stop DNA is in turn transferred to the 3′ end of either one of the copackaged RNAs. (asm.org)
  • This first-strand transfer (or jump) is facilitated by the complementarity of the terminal R regions and furthermore by the reverse transcriptase RNase H-mediated degradation of 5′ R and U5 RNA in the RNA-DNA hybrid generated ( 3 , 11 , 29 , 40 , 57 ). (asm.org)
  • Minus-strand DNA molecules shorter than strong-stop DNA (designated weak-stop DNA) are occasionally generated by premature termination and strand transfer ( 2 , 20 , 21 , 26 , 44 , 58 , 67 ), indicating that R-region homologies shorter than the entire length of R are sufficient for transfer to occur. (asm.org)
  • The complementarity of the plus-strand 3′ PBS obtained by copying the tRNA primer and the minus-strand 3′ PBS mediates the second-strand transfer ( 1 , 10 ), and, finally, plus- and minus-strand syntheses are completed. (asm.org)
  • In DNA strands, the head is the 3 ′ ("three prime") end of the strand, and the tail is the 5 ′ ("five prime") end. (encyclopedia.com)
  • The process uses a complementary , single strand of DNA as a template. (scienceprimer.com)
  • DNA polymerase uses the bases of the longer strand as a template. (scienceprimer.com)
  • During strand elongation, two phosphates are cleaved from the incoming nucleotide triphosphate and the resulting nucleotide monophosphate is added to the DNA strand. (scienceprimer.com)
  • Removing two phosphates from the incoming nucleotide and bonding the remaining phosphate to the oxygen on the 3' carbon of the existing strand maintains the repeating sugar-phosphate-sugar-phosphate pattern that makes up the backbone of each DNA polymer. (scienceprimer.com)
  • Sequencing simply means the exact order of the bases in a strand of DNA. (dnadietplan.com)
  • Scaffold DNAs, Staple Strand Oligos, and Folding Kits for DNA origami self-assembly. (idtdna.com)
  • Wikipedia states that DNA polymerase does not replicate each DNA strand perfectly. (reference.com)
Pairs9
  • These design issues have motivated the creation of a computer program, barcrawl , for automated design of barcoded primer pairs. (biomedcentral.com)
  • Without curation, commonly-used qPCR primer pairs yielded an extreme range of reaction efficiencies (25.9-100.1%), but when conditions were optimized, MFQPCR produced copy-number estimates comparable to traditional qPCR. (frontiersin.org)
  • Autosomal DNA is found in the pairs of autosomal chromosomes numbered one through 22. (biotechprimer.com)
  • citation needed] Primer-design software uses algorithms that check for the potential of DNA secondary structure formation and annealing of primers to itself or within primer pairs. (wikipedia.org)
  • Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). (biomedcentral.com)
  • MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. (biomedcentral.com)
  • We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. (biomedcentral.com)
  • Using the four primer pairs in this set for real-time PCR, relative quantification of mtDNA is determined from the difference in Ct values for mtDNA and nDNA. (takarabio.com)
  • The primer pairs in this set are compatible with Terra qPCR Direct TB Green Premix or TB Green Premix Ex Taq II (Tli RNaseH Plus) . (takarabio.com)
Genes9
  • Tumor cells and DNA are shed into the fecal stream, and uniquely mutated genes can be identified that would indicate the likely presence of a neoplasm in the gastrointestinal tract. (nih.gov)
  • MFQPCR will particularly suit studies targeting multiple clade-specific functional genes, or when primer design is informed by previous knowledge of the environment. (frontiersin.org)
  • Before a cell divides, DNA must be precisely copied, or "replicated," so that each of the two daughter cells can inherit a complete genome, the full set of genes present in the organism. (encyclopedia.com)
  • DNA sequence similarities present in such related genes can cause trouble, e.g. when molecularly analysing mutant alleles of these genes. (biomedcentral.com)
  • Genes are made of DNA. (dnadietplan.com)
  • Human genes vary in size from a few hundred to more than 2 million DNA bases. (dnadietplan.com)
  • SNPs are most often found in the DNA between genes and have no effect on health or development. (dnadietplan.com)
  • The epigenome is made of chemical compounds and proteins that attach to DNA and determine when genes are switched on or off. (dnadietplan.com)
  • however, the applicability for comparisons between taxa or different multiple-copy genes was limited owing to the unknown number of template molecules present per total DNA. (wiley.com)
Mitochondrial DNA7
  • Mitochondrial DNA (mtDNA) is found in tiny compartments called mitochondria that convert sugar to energy in cells. (biotechprimer.com)
  • Mitochondrial DNA can help trace maternal ancestry. (biotechprimer.com)
  • Autosomal DNA is all the genetic material that is not found in the sex chromosomes and in mitochondrial DNA. (biotechprimer.com)
  • What is mitochondrial DNA? (reference.com)
  • We each receive half of our DNA from our mothers (called mitochondrial DNA) and half from our fathers (called Y-chromosome DNA). (healthcentral.com)
  • The Human Mitochondrial DNA (mtDNA) Monitoring Primer Set is designed to quantify the relative number of copies of human mitochondrial DNA (mtDNA) by real-time PCR, using nuclear DNA (nDNA) content as a standard. (takarabio.com)
  • This allows the Human Mitochondrial DNA (mtDNA) Monitoring Primer Set to be used in drug discovery applications where iPS cells are used as a source of differentiated liver cells, since hepatocytes have a higher ratio of mtDNA to nuclear DNA than pluripotent cells. (takarabio.com)
Assay4
  • The present invention provides these E. suis primers and a method to use these primers in a PCR protocol to provide a highly sensitive diagnostic assay for early signs of an E. suis infection. (google.com)
  • Pools of pre-designed primers can help generate comprehensive expression profiles, especially where assay sensitivity is critically important. (thermofisher.com)
  • How should I store my targeted DNA sequencing library prep assay primers? (fluidigm.com)
  • What species and targets do you design Targeted DNA Sequencing Library Prep assay primers to? (fluidigm.com)
Oligos2
  • Long, high-quality DNA oligos up 200 bases. (idtdna.com)
  • DNA oligos up to 120 bases manufactured by an exclusive production process to minimize oligonucleotide crosstalk. (idtdna.com)
Genetic13
  • In addition, it is important to the cell to be able to access the DNA molecule for the purposes of genetic control, routine cellular maintenance, and reproduction. (fsu.edu)
  • Use of single-primer DNA amplifications in genetic studies of peanut ( Arachis hypogaea L. (springer.com)
  • Enzymes are indispensable tools in recombinant DNA technology and genetic engineering. (textbookx.com)
  • Primers are used extensively in genetic and molecular biology techniques. (mcw.edu)
  • By comparing genetic markers from mtDNA and Y chromosomal DNA with those of indigenous peoples from various parts of the world, it's possible to estimate where your ancestors hailed from way back when. (biotechprimer.com)
  • Imagine that a small percentage, say 10 percent, of a woman's DNA contained genetic markers indicating Mongolian ancestry. (biotechprimer.com)
  • DNA is the carrier of genetic information. (encyclopedia.com)
  • In a breed, genetic diversity is the variation in DNA that results in the differences in traits from individual to individual. (game-dog.com)
  • A very common method of assessing genetic diversity from DNA data is by computing heterozygosity. (game-dog.com)
  • If a change in a DNA sequence happens in less than 1 percent of people, then the genetic variation is called a pathogenic variant or mutation. (dnadietplan.com)
  • The University of Illinois at Chicago explains that DNA must replicate itself so that during cell division, both daughter cells receive the same genetic in. (reference.com)
  • Your saliva and your cheek cells contain DNA, which carries the genetic information the companies require for their analyses. (healthcentral.com)
  • I asked the president-elect of the National Society of Genetic Counselors, Erica Ramos, for some clarifications about the accuracy of the DNA ancestry test kits. (healthcentral.com)
Real Tim3
  • Developers of software for real time PCR primer design, TaqMan, molecular beacons, DNA microarray analysis, drawing restriction plasmid maps, gateway cloning experiments, protein interaction network and functional genomics. (abc-directory.com)
  • Primer design tools for PCR, real time PCR & microarrays, dual labeled probe design such as TaqMan , molecular beacons and FRET. (abc-directory.com)
  • The absolute detection limit of the real-time PCR method was 0.025 ng DNA, and the relative detection limit was 0.002% (w/w) of positive samples. (nature.com)
Species-specific primers2
  • The present paper describes a set of species-specific primers designed to detect the presence of P. spumarius DNA in soil arthropod fauna generalist predators' gut which can reveal candidate species for the pest's biological control. (mdpi.com)
  • In this study, species-specific primers and probes were designed from the mitochondrial cytb (cytochrome b) fragment for identification and quantification of bovine ingredient in commercial meat products. (nature.com)
Probes and primers1
  • PentaBase is providing probes and primers worldwide every day. (pentabase.com)
Genetics3
  • An animated primer of 75 experiments that made modern genetics. (dnaftb.org)
  • The ability to decode genetics at modest expense allowed the DNA testing industry to develop. (biotechprimer.com)
  • Given how complex genetics can be, DNA ancestry tests today should mostly be done for curiosity's sake rather than for definitive results. (healthcentral.com)
Molecule8
  • DNA is a very unusual molecule that is shaped like a very long piece of string. (fsu.edu)
  • The diameter of the DNA molecule is about 25-30 Angstroms (about a billionth of an inch) while the length can exceed a thousand microns (0.025 inch) in some organisms. (fsu.edu)
  • One of the major problems of molecular biology is how this giant molecule can be packaged into a cell or virus that is far smaller than the length of the DNA molecule. (fsu.edu)
  • In eukaryotes , the DNA molecules that make up the genome are packaged with proteins into chromosomes, each of which contains a single linear DNA molecule. (encyclopedia.com)
  • Chemical modification: in this method a small molecule is covalently bound to the side chain of an amino acid in the active site of the DNA polymerase. (wikipedia.org)
  • In the middle of each cell, the DNA molecule is packaged into threadlike structures called chromosomes. (dnadietplan.com)
  • Scorpion Primers is a highly sensitive, sequence specific dual labeled hairpin, uni-probe that combines a target specific PCR primer and a target specific DNA probing sequence in a single molecule design. (biosyn.com)
  • When an organism begins the process of cellular division, an enzyme called helicase pulls apart the two sides of the DNA molecule. (reference.com)
Detection4
  • Detection of DNA in specimens comprising body fluids of tissues can be difficult because of the small quantity of DNA present or because of the presence in the specimen of other interfering materials, including DNA from a different source. (google.com)
  • The presence of an oncogenic HPV DNA may be a diagnostic marker for the detection of cytologically negative smears. (bmj.com)
  • METHODS: The test was an original multiplex labelled PCR-EIA for the detection and typing of oncogenic and non-oncogenic HPV using three consensus sequence primers within the oncogenic E6/E7 ORF. (bmj.com)
  • Bisulfite-based methods and methylation-sensitive restriction enzyme-based PCR (MSRE-PCR) methods have been widely used for detection of DNA methylation. (biomedcentral.com)
QPCR primer1
  • If any help is needed qPCR primer design for Scorpions Primers/Probes or the combination of dyes, please do not hesitate to contact our scientific support that will be happy to help you. (biosyn.com)
Klenow3
  • Unlike E. coli Klenow fragment or modified T7 DNA polymerase, Bca polymerase allows stable polymerization of DNA even for templates with high GC content containing highly structured regions. (clontech.com)
  • This random primer DNA labeling kit is based on a modified method by Feinberg and Vogelstein and utilizes random oligonucleotide primers and cloned exonuclease-free E.coli DNA polymerase I, Klenow fragment. (clontech.com)
  • DNA polymerase I (Klenow), to selectively and tightly bind primer-template complexes. (umd.edu)
Molecular7
  • Molecular basis for stool-based DNA tests for colorectal cancer: a primer for clinicians. (nih.gov)
  • The photomicrograph below depicts high molecular weight calf thymus DNA at concentrations approaching 650 milligrams/milliliter. (fsu.edu)
  • This is a particular problem in molecular diet studies, where predator DNA is often present in great excess of food-derived DNA. (uio.no)
  • We employed molecular techniques such as enzyme kinetics, footprinting, and photo-crosslinking to characterize the binding pocket of Pol G and to establish a model for the DNA path through the holoenzyme. (jbsdonline.com)
  • Background: The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. (byu.edu)
  • Restricted maximum likelihood (REML) analysis of molecular clone reconstruction experiments using a primer-walking strategy showed that the BODIPY and BODIPY energy-transfer (BET) dye primers sets were significantly more accurate in quantitating heterogenous base mixtures than the fluorescein/rhodamine dye primers. (bcm.edu)
  • The unique properties of Scorpions Primers enabled reliable probe design with stronger signals, shorter reaction times and better discrimination power than other bi-molecular system. (biosyn.com)
Strands2
  • DNA polymerases can not create new strands of DNA. (scienceprimer.com)
  • Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. (biomedcentral.com)
Sequencing10
  • Choose from our list of commonly used sequencing primers to initiate your sequencing projects. (thermofisher.com)
  • Our new NEBNext® Ultra™ II FS DNA Library Prep Kit with novel fragmentation reagent meets the dual challenge of generating high quality next gen sequencing libraries from ever-decreasing input amounts AND simple scalability. (neb.com)
  • Environmental DNA Sequencing Primers for Eutardigrades and Bdelloid Ro" by Byron J. Adams, Jeremy Whiting et al. (byu.edu)
  • Quantitation of mixed-base populations of HIV-1 variants by automated DNA sequencing with BODIPY dye-labeled primers. (bcm.edu)
  • Taken together, these results show that BODIPY and BET direct DNA sequencing can accurately and precisely characterize complex mixed-base populations. (bcm.edu)
  • Barcrawl is a software program that facilitates the design of barcoded primers, for multiplexed high-throughput sequencing. (biomedcentral.com)
  • This paper describes the functions implemented by barcrawl and bartab and presents a proof-of-concept case study of both programs in which barcoded rRNA primers were designed and validated by high-throughput sequencing. (biomedcentral.com)
  • begingroup$ PCR with a single primer is similar to DNA sequencing, except you don't have labeled terminal monomers to stop the reaction. (stackexchange.com)
  • Upon a user request, T2 plants of the respective line are grown and the insertion site prediction is confirmed at GABI-Kat by PCR with an insertion site-specific primer and a T-DNA border primer, followed by sequencing of the amplicon. (biomedcentral.com)
  • Synthesized from clonally purified DNA and sequence-verified via next generation sequencing. (idtdna.com)
Okazaki1
  • Results of additional experiments suggesting a precursor-product relationship between formation of primer-DNA and Okazaki fragments are presented. (asm.org)
Polymerases5
  • In addition to discriminating against base pair mismatches, DNA polymerases exhibit a high degree of selectivity for deoxyribonucleotides over ribo- or dideoxynucleotides. (rcsb.org)
  • This suggests a shared sequence preference that might be present in all Family A DNA polymerases, derived from a common ancestor. (umd.edu)
  • DNA polymerases are the enzymes that replicate DNA in living cells. (scienceprimer.com)
  • According to the National Center for Biotechnology Information, the primary role of DNA polymerases is to replicate the DNA of an organism, accurately and efficiently, during cell division. (reference.com)
  • The National Center for Biotechnology Information explains that there are many different types of DNA polymerases. (reference.com)
Probe5
  • With this kit, random primer labeling via thermostable Bca polymerase is accomplished in 10 minutes, resulting in high yields of labeled DNA probe. (clontech.com)
  • This probe labeling method overcomes many of the disadvantages of conventional nick translation procedures while producing hybridization probes from very small amounts of DNA (10 to 20 ng). (clontech.com)
  • These primers doe not require enzymatic cleavage of the probe duing PCR cycling. (biosyn.com)
  • What is a DNA probe used for? (reference.com)
  • This technique is based on the specific hybridization of a probe, which was designed for a certain species, with the DNA in the samples to be analyzed. (nature.com)
Duplex2
  • A point mutation at the terminal nucleotide of DR1 has a striking phenotype: normal levels of duplex viral DNA are produced, but nearly all of the DNA is linear rather than circular. (asm.org)
  • rather, it is extended in situ to generate duplex linear DNA. (asm.org)
Detect4
  • The collection of MegaPlex RT Primers and Megaplex Primer Pools significantly enhance the ability to detect microRNAs expressed at low levels with as low as 1 ng of input total RNA. (thermofisher.com)
  • With the single PCR system it was possible to detect 100 fg HCMV DNA but with double PCR 5-10 fg were detectable. (nih.gov)
  • We evaluated the Leishmania Viannia -specific primers B1-B2 to detect Leishmania in normal skin and peripheral blood monocytes of patients with active cutaneous leishmaniasis. (ajtmh.org)
  • DNA-EIA to detect high and low risk HPV genotypes in cervical lesions with E6/E7 primer mediated multiplex PCR. (bmj.com)
Bases3
  • Yield guarantee only for unmodified DNA oligo of 15-60 bases in length. (genscript.com)
  • As its name implies, a PD consists of two primer molecules that have attached (hybridized) to each other because of strings of complementary bases in the primers. (wikipedia.org)
  • Any one of the four DNA bases can be substituted for another - for example, an A instead of a T or a T instead of a C. (dnadietplan.com)
Reactions1
  • Would anyone please suggest me the three primers for the TAIL reactions or the protocol from their own lab. (bio.net)
Genomes3
  • Welsh J, McClelland M: Fingerprinting genomes using PCR with arbitrary primers. (springer.com)
  • Hepadnaviruses replicate their circular DNA genomes via reverse transcription of an RNA intermediate. (asm.org)
  • The genomes of bacterial cells ( prokaryotes ), which lack a nucleus, are typically circular DNA molecules that associate with special structures in the cell membrane. (encyclopedia.com)
Clade-specific1
  • Conclusion: The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. (byu.edu)
Polymerase alpha-primase complex1
  • Initial experiments indicated that T antigen and the polymerase alpha-primase complex are required to form primer-DNA. (asm.org)
Complementary3
  • what differs the primers from eachother and are they complementary to the DNA? (biology-online.org)
  • If this construct is stable enough, the DNA polymerase will bind and extend the primers according to the complementary sequence (step II in the figure). (wikipedia.org)
  • HANDS (Homo-Tag Assisted Non-Dimer System): a nucleotide tail, complementary to the 3' end of the primer is added to the 5' end of the primer. (wikipedia.org)
Hybridization4
  • The use of E. suis specific primers in PCR with DNA from swine blood increases the sensitivity of current DNA hybridization protocols for determining whether swine are infected with E. suis prior to the development of any clinical symptoms. (google.com)
  • The Random Primer DNA Labeling Kit, Version 2 is designed for radioactive labeling for hybridization probes. (clontech.com)
  • The Radioactive Labeling for Hybridization Probes kit can also be used to label DNA fragments that are embedded in low-melting temperature agarose gel slices. (clontech.com)
  • Hybridization studies indicate that primer-DNA is initially formed in the origin region and is subsequently synthesized in regions distal to the origin. (asm.org)
Thermostable DNA polymerase1
  • The BcaBEST DNA Labeling Kit is a novel random primer labeling system that uses longer primers (9-mers) and Bca BEST polymerase, a thermostable DNA polymerase isolated from Bacillus caldotenax . (clontech.com)
Locus-specific2
  • Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. (biomedcentral.com)
  • Although the tool was initially designed for the analysis of T-DNA insertion mutants, it can be used for any experiment that requires locus-specific primers for the A. thaliana genome. (biomedcentral.com)
Mutations1
  • Other mutations just 3' to DR1 similarly affect primer translocation, although with differing efficiencies. (asm.org)
Called DNA polymerase1
  • In prokaryotes, the particular form of the enzyme is called DNA polymerase III. (encyclopedia.com)
Specific13
  • 2. A synthetic oligonucleotide useful in detecting early Eperythrozoon suis infected blood by specifically priming an eperythrozoon specific polymerase chain reaction having the DNA sequence TCTTCAACTCTTCCTATGGA (SEQ ID NO: 1). (google.com)
  • CONCLUSIONS: Our data provide evidence for the association of SV40LTAg primer specific DNA with human pulmonary mesothelioma in the British population. (bmj.com)
  • Generally, RNases H are defined as ribonucleotide-specific endonucleases, cleaving the RNA portion of RNA-DNA/DNA or RNA/DNA duplexes. (asm.org)
  • Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. (biomedcentral.com)
  • Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. (biomedcentral.com)
  • Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. (biomedcentral.com)
  • In such cases, the prediction of the correct insertion site must include careful sequence analyses on the one hand and a paralog specific primer design for experimental confirmation of the prediction on the other hand. (biomedcentral.com)
  • It is easy to use and also able to design amplimers with two genome-specific primers as required for genotyping segregating families of insertion mutants when looking for homozygous offspring. (biomedcentral.com)
  • The insertion of T-DNA in the plant genome occurs almost randomly [ 4 - 6 ], and different methods for the identification of insertion sites in specific lines have been established. (biomedcentral.com)
  • If 99.9 percent of people have a G base in a specific DNA sequence and 0.1 percent have a C base, it's called a mutation. (dnadietplan.com)
  • A SuPrimer can be made shorter than a standard primer and thereby be more specific in it's binding to a target sequence. (pentabase.com)
  • Results showed that the primers and probes were highly specific for bovine ingredient in meat products. (nature.com)
  • The direct-to-consumer DNA ancestry test kits use a process called genotyping to find variants in specific areas of the DNA, which in turn can be linked to certain ancestral groups and ethnic regions, physical traits, and health conditions. (healthcentral.com)
Design16
  • Therefore, if we want a larger PCR product that includes the flanking regions, we have to choose a larger region to be used for primer design. (umanitoba.ca)
  • Because bisulfite DNA is often damaged, it is most helpful to design targets between 150-500 bp. (neb.com)
  • Computer programs such as MethPrimer, methBLAST or BiSearch can be used to design or analyze primers. (neb.com)
  • student working now to clone a T-DNA insertion mutant of Cis-cinnamic acid.The mutant is isolated from Ecker and Alonso insertional line CS75100.I would like to design the primers for both Left and Right borders of the vector pROK2 for TAIL-PCR. (bio.net)
  • I'm using MethPrimer to design them, but the primer dimer problem is endless, but With such a high content of A's and T's I'm drowning. (protocol-online.org)
  • You can design and try several sets of primers that cover the same region, and optimize your PCR conditions. (protocol-online.org)
  • Can I Use other primer design tools such as SnapGene for Gibson Assembly, to design primers for NEBuilder HiFi DNA Assembly? (neb.com)
  • Tools which design "Gibson" primers may not allow the design of primers that take advantage of this ability of NEBuilder HiFi. (neb.com)
  • Though it it is possible to use other tools, NEB recommends using our free tool, NEBuilder Assembly Tool, because it can design primers that consider the vector ends generated by a restriction enzyme digestion. (neb.com)
  • PCR Primer Design focuses on primer design, which is critical to both the efficiency and the accuracy of the PCR. (springer.com)
  • In PCR Primer Design, authors describe basic approaches for PCR primer design in addition to specialized methods. (springer.com)
  • Because DNA ligation is relatively sequence-independent, the design of barcoded adapters using the ligated adapter strategy is straightforward. (biomedcentral.com)
  • To overcome this limitation, other methods aim to reduce the formation of PDs only, including primer design, and use of different PCR enzyme systems or reagents. (wikipedia.org)
  • A newly developed primer design tool that takes paralogous regions into account was developed to streamline the confirmation process for paralogs. (biomedcentral.com)
  • An automatic online primer design tool that incorporates experience from the in-house confirmation of T-DNA insertion lines has been made available. (biomedcentral.com)
  • Design PCR primers from DNA sequence. (sourceforge.net)
Results10
  • With bad results from multiple trials of different primer sets, I'd be looking at template purity issues, though it's a tough call with out seeing the trace. (protocol-online.org)
  • The best results are typically seen when using each primer at a final concentration of 0.5 µM in the reaction. (neb.com)
  • Using primers that are 9-mer and longer and exonuclease-free enzyme results in higher labeling efficiency and longer probes. (clontech.com)
  • RESULTS: PCR positivity with the SV primer set was restricted to four of the nine cases of mesothelioma. (bmj.com)
  • Results: The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. (byu.edu)
  • Using 1 primer will results in amplifying the original sequence in each cycle in a linear fashion: the primer will guide a single run of the polymerase. (stackexchange.com)
  • It's hard to turn on a TV today without seeing an ad hawking direct-to-consumer DNA ancestry tests, and I was as curious as anyone about what my results might be. (healthcentral.com)
  • It turns out that all three DNA ancestry test kits produced fairly uniform results: I found out I am largely Northern and Western European (Scandinavian, Finnish and Irish) and a quarter Ashkenazi Jewish. (healthcentral.com)
  • The bottom line: The DNA ancestry test kit results are best guesses (although my little experiment showed that the three companies I chose are all playing in the same ballpark). (healthcentral.com)
  • More tests will undoubtedly follow, and physicians are concerned about the accuracy of the testing, how to counsel patients about their DNA reports, and how well people will understand the results. (healthcentral.com)
Chloroplast DNA1
  • Is the Subject Area "Chloroplast DNA" applicable to this article? (plos.org)
Enzyme2
  • Here we present 10 high resolution crystal structures and enzyme kinetic analyses of Bacillus DNA polymerase I large fragment variants complexed with deoxy-, ribo-, and dideoxynucleotides and a DNA substrate. (rcsb.org)
  • Slow release of magnesium: DNA polymerase requires magnesium ions for activity, so the magnesium is chemically separated from the reaction by binding to a chemical compound, and is released into the solution only at high temperature Non-covalent binding of inhibitor: in this method a peptide, antibody or aptamer are non-covalently bound to the enzyme at low temperature and inhibit its activity. (wikipedia.org)
Vitro1
Genome5
  • Also, flanking-sequence-tag (FST) based predictions of T-DNA insertion positions are often located within paralogous regions of the genome. (biomedcentral.com)
  • SNPs appear normally throughout a person's DNA and account for about 90 percent of variation in the human genome. (dnadietplan.com)
  • A DNA virus is a virus that has a genome made of deoxyribonucleic acid (DNA) that is replicated by a DNA polymerase. (wikipedia.org)
  • Viruses that have a DNA genome that is replicated through an RNA intermediate by a reverse transcriptase are separately considered reverse transcribing viruses and are assigned to the kingdom Pararnavirae in the realm Riboviria. (wikipedia.org)
  • Lastly, some dsDNA viruses are replicated as part of a process called replicative transposition whereby a viral genome in a host cell's DNA is replicated to another part of a host genome. (wikipedia.org)
Reaction7
  • How much DNA is in each reaction? (protocol-online.org)
  • I percipitate my 10ul reaction sample by first diluting it with 90ul of sterile distiled water and 1ul Pellet paint (basically coloured dextran that helps pulls down the DNA into a nice colour pellet). (protocol-online.org)
  • We conclude that, while the nanoliter reaction volumes, rapid thermocycling and one-size-fits-all reaction conditions of MFQPCR necessitates more stringent primer selection criteria than is commonly applied in soil microbial ecology, the ability to quantify up to 96 targets in 96 samples makes MFQPCR a valuable tool for monitoring shifts in functional community abundances. (frontiersin.org)
  • A primer dimer (PD) is a potential by-product in the polymerase chain reaction (PCR), a common biotechnological method. (wikipedia.org)
  • Because primers are designed to have low complementarity to each other, they may anneal (step I in the figure) only at low temperature, e.g. room temperature, such as during the preparation of the reaction mixture. (wikipedia.org)
  • Several methods have been developed to prevent PDs formation until the reaction reaches working temperature (60-70 °C), and these include initial inhibition of the DNA polymerase, or physical separation of reaction components reaction until the reaction mixture reaches the higher temperatures. (wikipedia.org)
  • However, this procedure has several limitations, like low multiplexing capability, the inability to discriminate between 5-methylcytosine and 5-hydroxymethylcyosine, the degradation of DNA during bisulfite treatment, high experimental time, and the possibility of incomplete conversion under not ideal reaction parameters. (biomedcentral.com)
Discovery of potential genes contributing to the biosynthesis of short-chain fatty acids and lactate in gut microbiota from...
Discovery of potential genes contributing to the biosynthesis of short-chain fatty acids and lactate in gut microbiota from... (nature.com)
Multiple drug resistance and biocide resistance in Escherichia coli environmental isolates from hospital and household settings...
Multiple drug resistance and biocide resistance in Escherichia coli environmental isolates from hospital and household settings... (link.springer.com)
Plus it
Plus it (jneurosci.org)
PCR Primer Design | SpringerLink
PCR Primer Design | SpringerLink (link.springer.com)
Systematics of the Dendropsophus leucophyllatus species complex (Anura: Hylidae): Cryptic diversity and the description of two...
Systematics of the Dendropsophus leucophyllatus species complex (Anura: Hylidae): Cryptic diversity and the description of two... (journals.plos.org)
Development of a real-time PCR assay for the identification and quantification of bovine ingredient in processed meat products ...
Development of a real-time PCR assay for the identification and quantification of bovine ingredient in processed meat products ... (nature.com)
Frontiers | TaGW2, a Good Reflection of Wheat Polyploidization and Evolution | Plant Science
Frontiers | TaGW2, a Good Reflection of Wheat Polyploidization and Evolution | Plant Science (frontiersin.org)
Enhancement of bleomycin production in Streptomyces verticillus through global metabolic regulation of N -acetylglucosamine and...
Enhancement of bleomycin production in Streptomyces verticillus through global metabolic regulation of N -acetylglucosamine and... (link.springer.com)
Sensory deprivation in Staphylococcus aureus | Nature Communications
Sensory deprivation in Staphylococcus aureus | Nature Communications (nature.com)
BioInteractive Search Results | HHMI BioInteractive
BioInteractive Search Results | HHMI BioInteractive (hhmi.org)
Evolutionary Dynamics of the Genomic Region Around the Blast Resistance Gene Pi-ta in AA Genome Oryza Species | Genetics
Evolutionary Dynamics of the Genomic Region Around the Blast Resistance Gene Pi-ta in AA Genome Oryza Species | Genetics (genetics.org)
Gene placement and competition control T cell receptor γ variable region gene rearrangement | JEM
Gene placement and competition control T cell receptor γ variable region gene rearrangement | JEM (jem.rupress.org)
Frontiers | Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia...
Frontiers | Prophage Rs551 and Its Repressor Gene orf14 Reduce Virulence and Increase Competitive Fitness of Its Ralstonia... (frontiersin.org)
SKOS Simple Knowledge Organization System Primer
SKOS Simple Knowledge Organization System Primer (w3.org)
When paddling a canoe upstream, it is wisest to travel | bartleby
When paddling a canoe upstream, it is wisest to travel | bartleby (bartleby.com)
A crate of mass 45.0 kg is being transported on the | bartleby
A crate of mass 45.0 kg is being transported on the | bartleby (bartleby.com)
A vaccination works by _______. a. curing a disease | bartleby
A vaccination works by _______. a. curing a disease | bartleby (bartleby.com)
Scorpions Primers, Scorpion Probes
Scorpions Primers, Scorpion Probes (biosyn.com)
Discovery of nucleotide polymorphisms in the Musa gene pool by Ecotilling | SpringerLink
Discovery of nucleotide polymorphisms in the Musa gene pool by Ecotilling | SpringerLink (link.springer.com)
CiteSeerX - Citation Query Nearest-neighbor thermodynamics of internal A.C mismatches in DNA: sequence dependence and pH...
CiteSeerX - Citation Query Nearest-neighbor thermodynamics of internal A.C mismatches in DNA: sequence dependence and pH... (citeseer.ist.psu.edu)
Template and primer requirements for DNA Pol θ-mediated end joining | PNAS
Template and primer requirements for DNA Pol θ-mediated end joining | PNAS (pnas.org)
NEBNext® Ultra™ II DNA Library Prep with Sample Purification Beads | NEB
NEBNext® Ultra™ II DNA Library Prep with Sample Purification Beads | NEB (neb.com)
Frontiers | Insertion/Deletion Within the KDM6A Gene Is Significantly Associated With Litter Size in Goat | Genetics
Frontiers | Insertion/Deletion Within the KDM6A Gene Is Significantly Associated With Litter Size in Goat | Genetics (frontiersin.org)
WHO EMRO | Characterization of Bacillus anthracis spores isolates from soil by biochemical and multiplex PCR analysis | Volume...
WHO EMRO | Characterization of Bacillus anthracis spores isolates from soil by biochemical and multiplex PCR analysis | Volume... (emro.who.int)
Molecular Tools for Screening Biodiversity | SpringerLink
Molecular Tools for Screening Biodiversity | SpringerLink (link.springer.com)
Biotechnology: An Illustrated Primer | Wiley
Biotechnology: An Illustrated Primer | Wiley (wiley.com)
RCSB PDB - 5VU6: TNA polymerase binary complex with primer/template duplex
RCSB PDB - 5VU6: TNA polymerase binary complex with primer/template duplex (rcsb.org)
Category:DNA - Wikimedia Commons
Category:DNA - Wikimedia Commons (commons.wikimedia.org)