A change from planar to elliptic polarization when an initially plane-polarized light wave traverses an optically active medium. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Any of the covalently closed DNA molecules found in bacteria, many viruses, mitochondria, plastids, and plasmids. Small, polydisperse circular DNA's have also been observed in a number of eukaryotic organisms and are suggested to have homology with chromosomal DNA and the capacity to be inserted into, and excised from, chromosomal DNA. It is a fragment of DNA formed by a process of looping out and deletion, containing a constant region of the mu heavy chain and the 3'-part of the mu switch region. Circular DNA is a normal product of rearrangement among gene segments encoding the variable regions of immunoglobulin light and heavy chains, as well as the T-cell receptor. (Riger et al., Glossary of Genetics, 5th ed & Segen, Dictionary of Modern Medicine, 1992)
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Determination of the spectra of ultraviolet absorption by specific molecules in gases or liquids, for example Cl2, SO2, NO2, CS2, ozone, mercury vapor, and various unsaturated compounds. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
Measurement of the intensity and quality of fluorescence.
Disruption of the non-covalent bonds and/or disulfide bonds responsible for maintaining the three-dimensional shape and activity of the native protein.
Unstriated and unstriped muscle, one of the muscles of the internal organs, blood vessels, hair follicles, etc. Contractile elements are elongated, usually spindle-shaped cells with centrally located nuclei. Smooth muscle fibers are bound together into sheets or bundles by reticular fibers and frequently elastic nets are also abundant. (From Stedman, 25th ed)
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Processes involved in the formation of TERTIARY PROTEIN STRUCTURE.
Deoxyribonucleic acid that makes up the genetic material of viruses.
Disruption of the secondary structure of nucleic acids by heat, extreme pH or chemical treatment. Double strand DNA is "melted" by dissociation of the non-covalent hydrogen bonds and hydrophobic interactions. Denatured DNA appears to be a single-stranded flexible structure. The effects of denaturation on RNA are similar though less pronounced and largely reversible.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Circular duplex DNA isolated from viruses, bacteria and mitochondria in supercoiled or supertwisted form. This superhelical DNA is endowed with free energy. During transcription, the magnitude of RNA initiation is proportional to the DNA superhelicity.
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
A rigorously mathematical analysis of energy relationships (heat, work, temperature, and equilibrium). It describes systems whose states are determined by thermal parameters, such as temperature, in addition to mechanical and electromagnetic parameters. (From Hawley's Condensed Chemical Dictionary, 12th ed)
The rate dynamics in chemical or physical systems.
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
Vertical transmission of hereditary characters by DNA from cytoplasmic organelles such as MITOCHONDRIA; CHLOROPLASTS; and PLASTIDS, or from PLASMIDS or viral episomal DNA.
Spectroscopic method of measuring the magnetic moment of elementary particles such as atomic nuclei, protons or electrons. It is employed in clinical applications such as NMR Tomography (MAGNETIC RESONANCE IMAGING).
A single chain of deoxyribonucleotides that occurs in some bacteria and viruses. It usually exists as a covalently closed circle.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A strong organic base existing primarily as guanidium ions at physiological pH. It is found in the urine as a normal product of protein metabolism. It is also used in laboratory research as a protein denaturant. (From Martindale, the Extra Pharmacopoeia, 30th ed and Merck Index, 12th ed) It is also used in the treatment of myasthenia and as a fluorescent probe in HPLC.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
A trypanocidal agent and possible antiviral agent that is widely used in experimental cell biology and biochemistry. Ethidium has several experimentally useful properties including binding to nucleic acids, noncompetitive inhibition of nicotinic acetylcholine receptors, and fluorescence among others. It is most commonly used as the bromide.
A process leading to shortening and/or development of tension in muscle tissue. Muscle contraction occurs by a sliding filament mechanism whereby actin filaments slide inward among the myosin filaments.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
The method of measuring the dispersion of an optically active molecule to determine the relative magnitude of right- or left-handed components and sometimes structural features of the molecule.
A non-aqueous co-solvent that serves as tool to study protein folding. It is also used in various pharmaceutical, chemical and engineering applications.
The region between the sharp indentation at the lower third of the STOMACH (incisura angularis) and the junction of the PYLORUS with the DUODENUM. Pyloric antral glands contain mucus-secreting cells and gastrin-secreting endocrine cells (G CELLS).
The process by which a DNA molecule is duplicated.
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
The reformation of all, or part of, the native conformation of a nucleic acid molecule after the molecule has undergone denaturation.
The measurement of the amplitude of the components of a complex waveform throughout the frequency range of the waveform. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.
Differential thermal analysis in which the sample compartment of the apparatus is a differential calorimeter, allowing an exact measure of the heat of transition independent of the specific heat, thermal conductivity, and other variables of the sample.
A group of 13 or more deoxyribonucleotides in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.
A group of pathogens comprising the smallest known agents of infectious disease. They are unencapsulated and are capable of replicating autonomously in susceptible cells. Positively identified viroids composed of single-stranded RNA have been isolated from higher plants, but the existence of DNA viroids pathogenic to animals is suspected.
The motor activity of the GASTROINTESTINAL TRACT.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
An essential amino acid that is necessary for normal growth in infants and for NITROGEN balance in adults. It is a precursor of INDOLE ALKALOIDS in plants. It is a precursor of SEROTONIN (hence its use as an antidepressant and sleep aid). It can be a precursor to NIACIN, albeit inefficiently, in mammals.
One of two ganglionated neural networks which together form the ENTERIC NERVOUS SYSTEM. The myenteric (Auerbach's) plexus is located between the longitudinal and circular muscle layers of the gut. Its neurons project to the circular muscle, to other myenteric ganglia, to submucosal ganglia, or directly to the epithelium, and play an important role in regulating and patterning gut motility. (From FASEB J 1989;3:127-38)
The art or process of comparing photometrically the relative intensities of the light in different parts of the spectrum.
Proteins prepared by recombinant DNA technology.
The segment of LARGE INTESTINE between the CECUM and the RECTUM. It includes the ASCENDING COLON; the TRANSVERSE COLON; the DESCENDING COLON; and the SIGMOID COLON.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
A movement, caused by sequential muscle contraction, that pushes the contents of the intestines or other tubular organs in one direction.
Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.
Presence of warmth or heat or a temperature notably higher than an accustomed norm.
Separation of particles according to density by employing a gradient of varying densities. At equilibrium each particle settles in the gradient at a point equal to its density. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Viruses whose nucleic acid is DNA.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Electrophoresis in which agar or agarose gel is used as the diffusion medium.
The sum of the weight of all the atoms in a molecule.
Fastening devices composed of steel-tantalum alloys used to close operative wounds, especially of the skin, which minimizes infection by not introducing a foreign body that would connect external and internal regions of the body. (From Segen, Current Med Talk, 1995)
Proteins found in any species of bacterium.
The characteristic three-dimensional shape of a molecule.
A common name used for the genus Cavia. The most common species is Cavia porcellus which is the domesticated guinea pig used for pets and biomedical research.
The homogeneous mixtures formed by the mixing of a solid, liquid, or gaseous substance (solute) with a liquid (the solvent), from which the dissolved substances can be recovered by physical processes. (From Grant & Hackh's Chemical Dictionary, 5th ed)
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
A continuous circle of peptide bonds, typically of 2-3 dozen AMINO ACIDS, so there is no free N- or C-terminus. They are further characterized by six conserved CYSTEINE residues that form CYSTINE KNOT MOTIFS.
The diversion of RADIATION (thermal, electromagnetic, or nuclear) from its original path as a result of interactions or collisions with atoms, molecules, or larger particles in the atmosphere or other media. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
A class of organic compounds which contain an anilino (phenylamino) group linked to a salt or ester of naphthalenesulfonic acid. They are frequently used as fluorescent dyes and sulfhydryl reagents.
A family of very small viruses containing circular, single-stranded DNA and possessing no envelope. The modes of transmission are not known.
Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.
Enzymes which catalyze the hydrolases of ester bonds within DNA. EC 3.1.-.
The distal and narrowest portion of the SMALL INTESTINE, between the JEJUNUM and the ILEOCECAL VALVE of the LARGE INTESTINE.
NMR spectroscopy on small- to medium-size biological macromolecules. This is often used for structural investigation of proteins and nucleic acids, and often involves more than one isotope.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The extent to which an enzyme retains its structural conformation or its activity when subjected to storage, isolation, and purification or various other physical or chemical manipulations, including proteolytic enzymes and heat.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
A compound formed in the liver from ammonia produced by the deamination of amino acids. It is the principal end product of protein catabolism and constitutes about one half of the total urinary solids.
Centrifugation with a centrifuge that develops centrifugal fields of more than 100,000 times gravity. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
The genetic complement of a BACTERIA as represented in its DNA.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
The complete genetic complement contained in a DNA or RNA molecule in a virus.
Higher-order DNA and RNA structures formed from guanine-rich sequences. They are formed around a core of at least 2 stacked tetrads of hydrogen-bonded GUANINE bases. They can be formed from one two or four separate strands of DNA (or RNA) and can display a wide variety of topologies, which are a consequence of various combinations of strand direction, length, and sequence. (From Nucleic Acids Res. 2006;34(19):5402-15)
Spectrophotometry in the infrared region, usually for the purpose of chemical analysis through measurement of absorption spectra associated with rotational and vibrational energy levels of molecules. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
The muscular membranous segment between the PHARYNX and the STOMACH in the UPPER GASTROINTESTINAL TRACT.
An alkaloid, originally from Atropa belladonna, but found in other plants, mainly SOLANACEAE. Hyoscyamine is the 3(S)-endo isomer of atropine.
A highly neurotoxic polypeptide from the venom of the honey bee (Apis mellifera). It consists of 18 amino acids with two disulfide bridges and causes hyperexcitability resulting in convulsions and respiratory paralysis.
Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.
An organ of digestion situated in the left upper quadrant of the abdomen between the termination of the ESOPHAGUS and the beginning of the DUODENUM.
A spectroscopic technique in which a range of wavelengths is presented simultaneously with an interferometer and the spectrum is mathematically derived from the pattern thus obtained.
The ability of a protein to retain its structural conformation or its activity when subjected to physical or chemical manipulations.
Viruses whose host is Escherichia coli.
The location of the atoms, groups or ions relative to one another in a molecule, as well as the number, type and location of covalent bonds.
The phenomenon whereby compounds whose molecules have the same number and kind of atoms and the same atomic arrangement, but differ in their spatial relationships. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 5th ed)
The process by which two molecules of the same chemical composition form a condensation product or polymer.
Two ganglionated neural plexuses in the gut wall which form one of the three major divisions of the autonomic nervous system. The enteric nervous system innervates the gastrointestinal tract, the pancreas, and the gallbladder. It contains sensory neurons, interneurons, and motor neurons. Thus the circuitry can autonomously sense the tension and the chemical environment in the gut and regulate blood vessel tone, motility, secretions, and fluid transport. The system is itself governed by the central nervous system and receives both parasympathetic and sympathetic innervation. (From Kandel, Schwartz, and Jessel, Principles of Neural Science, 3d ed, p766)
Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
The physiologic or functional barrier to GASTROESOPHAGEAL REFLUX at the esophagogastric junction. Sphincteric muscles remain tonically contracted during the resting state and form the high-pressure zone separating the lumen of the ESOPHAGUS from that of the STOMACH. (Haubrich et al, Bockus Gastroenterology, 5th ed., pp399, 415)
A basic science concerned with the composition, structure, and properties of matter; and the reactions that occur between substances and the associated energy exchange.
Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.
Conformational transitions of the shape of a protein to various unfolded states.
Enzymes that catalyze the hydrolysis of the internal bonds and thereby the formation of polynucleotides or oligonucleotides from ribo- or deoxyribonucleotide chains. EC 3.1.-.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Chromatography on non-ionic gels without regard to the mechanism of solute discrimination.
A family of iminourea derivatives. The parent compound has been isolated from mushrooms, corn germ, rice hulls, mussels, earthworms, and turnip juice. Derivatives may have antiviral and antifungal properties.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
The composition, conformation, and properties of atoms and molecules, and their reaction and interaction processes.
Chemical groups containing the covalent disulfide bonds -S-S-. The sulfur atoms can be bound to inorganic or organic moieties.
A technique of closing incisions and wounds, or of joining and connecting tissues, in which staples are used as sutures.
A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Viruses whose hosts are bacterial cells.
The protein components of a number of complexes, such as enzymes (APOENZYMES), ferritin (APOFERRITINS), or lipoproteins (APOLIPOPROTEINS).
The measurement of the quantity of heat involved in various processes, such as chemical reactions, changes of state, and formations of solutions, or in the determination of the heat capacities of substances. The fundamental unit of measurement is the joule or the calorie (4.184 joules). (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.
The type species of the genus MICROVIRUS. A prototype of the small virulent DNA coliphages, it is composed of a single strand of supercoiled circular DNA, which on infection, is converted to a double-stranded replicative form by a host enzyme.
Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.
An aminoperhydroquinazoline poison found mainly in the liver and ovaries of fishes in the order TETRAODONTIFORMES, which are eaten. The toxin causes paresthesia and paralysis through interference with neuromuscular conduction.
Viruses parasitic on plants higher than bacteria.
The study of MAGNETIC PHENOMENA.
The chemical and physical integrity of a pharmaceutical product.
A mammalian neuropeptide of 10 amino acids that belongs to the tachykinin family. It is similar in structure and action to SUBSTANCE P and NEUROKININ B with the ability to excite neurons, dilate blood vessels, and contract smooth muscles, such as those in the BRONCHI.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
The concentration of osmotically active particles in solution expressed in terms of osmoles of solute per liter of solution. Osmolality is expressed in terms of osmoles of solute per kilogram of solvent.
Procedures by which protein structure and function are changed or created in vitro by altering existing or synthesizing new structural genes that direct the synthesis of proteins with sought-after properties. Such procedures may include the design of MOLECULAR MODELS of proteins using COMPUTER GRAPHICS or other molecular modeling techniques; site-specific mutagenesis (MUTAGENESIS, SITE-SPECIFIC) of existing genes; and DIRECTED MOLECULAR EVOLUTION techniques to create new genes.
Use of electric potential or currents to elicit biological responses.
Particles consisting of aggregates of molecules held loosely together by secondary bonds. The surface of micelles are usually comprised of amphiphatic compounds that are oriented in a way that minimizes the energy of interaction between the micelle and its environment. Liquids that contain large numbers of suspended micelles are referred to as EMULSIONS.
A parasexual process in BACTERIA; ALGAE; FUNGI; and ciliate EUKARYOTA for achieving exchange of chromosome material during fusion of two cells. In bacteria, this is a uni-directional transfer of genetic material; in protozoa it is a bi-directional exchange. In algae and fungi, it is a form of sexual reproduction, with the union of male and female gametes.
The superior portion of the body of the stomach above the level of the cardiac notch.
Enzymes that catalyze the release of mononucleotides by the hydrolysis of the terminal bond of deoxyribonucleotide or ribonucleotide chains.
Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.
Catalyze the joining of preformed ribonucleotides or deoxyribonucleotides in phosphodiester linkage during genetic processes. EC 6.5.1.
The reconstitution of a protein's activity following denaturation.
Liquids that dissolve other substances (solutes), generally solids, without any change in chemical composition, as, water containing sugar. (Grant & Hackh's Chemical Dictionary, 5th ed)
Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.
Established cell cultures that have the potential to propagate indefinitely.
Agents that are capable of inserting themselves between the successive bases in DNA, thus kinking, uncoiling or otherwise deforming it and therefore preventing its proper functioning. They are used in the study of DNA.
Elements of limited time intervals, contributing to particular results or situations.
Change brought about to an organisms genetic composition by unidirectional transfer (TRANSFECTION; TRANSDUCTION, GENETIC; CONJUGATION, GENETIC, etc.) and incorporation of foreign DNA into prokaryotic or eukaryotic cells by recombination of part or all of that DNA into the cell's genome.
A plant genus of the family RUBIACEAE. Some species are used as an ingredient in Chinese and African traditional medicines. Members contain kalata B1, a macrocyclic peptide.
A left-handed double helix of DNA. Its name derives from its narrow zigzag structure that is the least twisted and thinnest form of DNA. Z-DNA forming regions within the GENOME may play an important role in GENE EXPRESSION REGULATION.
A representation, generally small in scale, to show the structure, construction, or appearance of something. (From Random House Unabridged Dictionary, 2d ed)
The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.
The property of emitting radiation while being irradiated. The radiation emitted is usually of longer wavelength than that incident or absorbed, e.g., a substance can be irradiated with invisible radiation and emit visible light. X-ray fluorescence is used in diagnosis.
The study of PHYSICAL PHENOMENA and PHYSICAL PROCESSES as applied to living things.
Proteins found in any species of virus.
An anionic surfactant, usually a mixture of sodium alkyl sulfates, mainly the lauryl; lowers surface tension of aqueous solutions; used as fat emulsifier, wetting agent, detergent in cosmetics, pharmaceuticals and toothpastes; also as research tool in protein biochemistry.
Double-stranded DNA of MITOCHONDRIA. In eukaryotes, the mitochondrial GENOME is circular and codes for ribosomal RNAs, transfer RNAs, and about 10 proteins.
A DNA virus that closely resembles human hepatitis B virus. It has been recovered from naturally infected ducks.
The deductive study of shape, quantity, and dependence. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
The area covering the terminal portion of ESOPHAGUS and the beginning of STOMACH at the cardiac orifice.
A bone fixation technique using an external fixator (FIXATORS, EXTERNAL) for lengthening limbs, correcting pseudarthroses and other deformities, and assisting the healing of otherwise hopeless traumatic or pathological fractures and infections, such as chronic osteomyelitis. The method was devised by the Russian orthopedic surgeon Gavriil Abramovich Ilizarov (1921-1992). (From Bull Hosp Jt Dis 1992 Summer;52(1):1)
An inhibitor of nitric oxide synthetase which has been shown to prevent glutamate toxicity. Nitroarginine has been experimentally tested for its ability to prevent ammonia toxicity and ammonia-induced alterations in brain energy and ammonia metabolites. (Neurochem Res 1995:200(4):451-6)
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
The characteristic 3-dimensional shape and arrangement of multimeric proteins (aggregates of more than one polypeptide chain).
The physical characteristics and processes of biological systems.
A family of recombinases initially identified in BACTERIA. They catalyze the ATP-driven exchange of DNA strands in GENETIC RECOMBINATION. The product of the reaction consists of a duplex and a displaced single-stranded loop, which has the shape of the letter D and is therefore called a D-loop structure.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The relationships of groups of organisms as reflected by their genetic makeup.
Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.
That portion of the electromagnetic spectrum immediately below the visible range and extending into the x-ray frequencies. The longer wavelengths (near-UV or biotic or vital rays) are necessary for the endogenous synthesis of vitamin D and are also called antirachitic rays; the shorter, ionizing wavelengths (far-UV or abiotic or extravital rays) are viricidal, bactericidal, mutagenic, and carcinogenic and are used as disinfectants.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
The genetic complement of MITOCHONDRIA as represented in their DNA.
A species of POLYOMAVIRUS originally isolated from Rhesus monkey kidney tissue. It produces malignancy in human and newborn hamster kidney cell cultures.
Analysis of the intensity of Raman scattering of monochromatic light as a function of frequency of the scattered light.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.
That portion of the electromagnetic spectrum in the visible, ultraviolet, and infrared range.
Computer-based representation of physical systems and phenomena such as chemical processes.
Any method used for determining the location of and relative distances between genes on a chromosome.
A type of scanning probe microscopy in which a probe systematically rides across the surface of a sample being scanned in a raster pattern. The vertical position is recorded as a spring attached to the probe rises and falls in response to peaks and valleys on the surface. These deflections produce a topographic map of the sample.
The thermodynamic interaction between a substance and WATER.
Peptides whose amino and carboxy ends are linked together with a peptide bond forming a circular chain. Some of them are ANTI-INFECTIVE AGENTS. Some of them are biosynthesized non-ribosomally (PEPTIDE BIOSYNTHESIS, NON-RIBOSOMAL).
Proteins conjugated with deoxyribonucleic acids (DNA) or specific DNA.
Devices for accelerating protons or electrons in closed orbits where the accelerating voltage and magnetic field strength varies (the accelerating voltage is held constant for electrons) in order to keep the orbit radius constant.
A class of cell surface receptors for tachykinins that prefers neurokinin A; (NKA, substance K, neurokinin alpha, neuromedin L), neuropeptide K; (NPK); or neuropeptide gamma over other tachykinins. Neurokinin-2 (NK-2) receptors have been cloned and are similar to other G-protein coupled receptors.
A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).
The smooth muscle coat of the uterus, which forms the main mass of the organ.
Artificial, single or multilaminar vesicles (made from lecithins or other lipids) that are used for the delivery of a variety of biological molecules or molecular complexes to cells, for example, drug delivery and gene transfer. They are also used to study membranes and membrane proteins.
The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
That phase of a muscle twitch during which a muscle returns to a resting position.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
A technique applicable to the wide variety of substances which exhibit paramagnetism because of the magnetic moments of unpaired electrons. The spectra are useful for detection and identification, for determination of electron structure, for study of interactions between molecules, and for measurement of nuclear spins and moments. (From McGraw-Hill Encyclopedia of Science and Technology, 7th edition) Electron nuclear double resonance (ENDOR) spectroscopy is a variant of the technique which can give enhanced resolution. Electron spin resonance analysis can now be used in vivo, including imaging applications such as MAGNETIC RESONANCE IMAGING.
The temperature at which a substance changes from one state or conformation of matter to another.
Proteins obtained from ESCHERICHIA COLI.
External devices which hold wires or pins that are placed through one or both cortices of bone in order to hold the position of a fracture in proper alignment. These devices allow easy access to wounds, adjustment during the course of healing, and more functional use of the limbs involved.
DNA TOPOISOMERASES that catalyze ATP-independent breakage of one of the two strands of DNA, passage of the unbroken strand through the break, and rejoining of the broken strand. DNA Topoisomerases, Type I enzymes reduce the topological stress in the DNA structure by relaxing the superhelical turns and knotted rings in the DNA helix.
The heritable modification of the properties of a competent bacterium by naked DNA from another source. The uptake of naked DNA is a naturally occuring phenomenon in some bacteria. It is often used as a GENE TRANSFER TECHNIQUE.
A low-energy attractive force between hydrogen and another element. It plays a major role in determining the properties of water, proteins, and other compounds.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
A basic enzyme that is present in saliva, tears, egg white, and many animal fluids. It functions as an antibacterial agent. The enzyme catalyzes the hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrin. EC 3.2.1.17.
A conjugated protein which is the oxygen-transporting pigment of muscle. It is made up of one globin polypeptide chain and one heme group.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
Enzymes that catalyze the incorporation of deoxyribonucleotides into a chain of DNA. EC 2.7.7.-.
The voltage differences across a membrane. For cellular membranes they are computed by subtracting the voltage measured outside the membrane from the voltage measured inside the membrane. They result from differences of inside versus outside concentration of potassium, sodium, chloride, and other ions across cells' or ORGANELLES membranes. For excitable cells, the resting membrane potentials range between -30 and -100 millivolts. Physical, chemical, or electrical stimuli can make a membrane potential more negative (hyperpolarization), or less negative (depolarization).

H5 Histone and DNA-relaxing enzyme of chicken erythrocytes. Interaction with superhelical DNA. (1/2047)

The interaction of closed circular duplex DNA with the lysine-rich H5 histone fraction of avian erythrocytes has been studied. H5, like H1 histone, interacts preferentially with superhelical DNA. The extent of interaction increases with increasing negative or positive superhelicity. Salt-extracted lysine-rich histones show the same specificity for interaction with superhelices as do acid-extracted preparations. Chicken erythrocyte nuclei contain DNA-relaxing enzyme. This enzyme is extracted from the nuclei at lower salt concentrations than those required to extract H1 and H5 histones and is, therefore, probably a function of a protein distinct from H1 and H5 histones.  (+info)

Telomeric repeats on small polydisperse circular DNA (spcDNA) and genomic instability. (2/2047)

Small polydisperse circular DNA (spcDNA) is a heterogeneous population of extrachromosomal circular molecules present in a large variety of eukaryotic cells. Elevated amounts of total spcDNA are related to endogenous and induced genomic instability in rodent and human cells. We suggested spcDNA as a novel marker for genomic instability, and speculated that spcDNA might serve as a mutator. In this study, we examine the presence of telomeric sequences on spcDNA. We report for the first time the appearance of telomeric repeats in spcDNA molecules (tel-spcDNA) in rodent and human cells. Restriction enzyme analysis indicates that tel-spcDNA molecules harbor mostly, if not exclusively, telomeric repeats. In rodent cells, tel-spcDNA levels are higher in transformed than in normal cells and are enhanced by treatment with carcinogen. Tel-spcDNA is also detected in some human tumors and cell lines, but not in others. We suggest, that its levels in human cells may be primarily related to the amount of the chromosomal telomeric sequences. Tel-spcDNA may serve as a unique mutator, through specific mechanisms related to the telomeric repeats, which distinguish it from the total heterogeneous spcDNA population. It may affect telomere dynamics and genomic instability by clastogenic events, alterations of telomere size and sequestration of telomeric proteins.  (+info)

Functional analysis of mutations conferring lamivudine resistance on hepatitis B virus. (3/2047)

Two patterns of mutation are commonly observed in the polymerase gene of lamivudine [(-)2'-deoxy-3'-thiacytidine]-resistant hepatitis B virus (HBV). The M539I substitution in the conserved YMDD motif occurs independently of other changes, whereas the M539V substitution is associated with an additional upstream change (L515M). These mutations were introduced into a common background and their effects on HBV DNA replication and lamivudine resistance studied. The L515M and M539V mutations provided only partial resistance while the M539I mutation conferred a high degree of lamivudine resistance. The combination of the L515M and M539V mutations gave an intermediate level of replication competence, compared with either mutation alone, and increased resistance to lamivudine. This probably accounts for these two mutations always being observed together. The M539I mutation reduced replication competence.  (+info)

An endonuclease from mouse cells specific for single-stranded DNA. (4/2047)

An endonuclease with a molecular weight of about 70000 (5-6S) was extensively purified from mouse ascites cells. The enzyme specifically attacks single-stranded DNA which is degraded mainly to oligonucleotides, with 5-10 residues. Supercoiled covalently closed circular phage DNA is converted to the linear relaxed form. The enzyme activity is highly sensitive to salt and can be stimulated by reagents lowering the dielectric constant of the buffer such as dimethylsulfoxide and glycerol.  (+info)

Survey of extrachromosomal DNA found in the filamentous cyanobacteria. (5/2047)

Cleared lysates of 13 species of filamentous cyanobacteria were examined for the presence of extrachromosomal DNA by using agarose gel electrophoresis and ethidium bromide staining. Seven of the 13 species contained extrachromosomal covalently closed circular DNA, and all but 1 species contained multiple elements. There was no correlation between the presence of extrachomosomal DNA and either the range of metabolic activities found in the cyanobacteria or the differentiated cell types or structures elaborated by the morphologically complex filamentous cyanobacteria.  (+info)

Restriction endonucleases: general survey procedure and survey of gliding bacteria. (6/2047)

Among 120 strains of gliding bacteria which were screened for restriction endonucleases, 27 were found positive. Additionally, three strains carried enzymes able to release the supercoiled state of closed circular DNA. By using a new rapid method, restriction endonuclease activity was released by stirring about 0.5 g of cells (fresh weight) in a motor-driven glass homogenizer in buffer containing Triton X-101, ethylenediaminetetraacetic acid, and mercaptoethanol. A yield from 60 to 80% of the total activity present in the cells was obtained with minimal destruction of the cells. The enzyme activity in the crude extract was measured semi-quantitatively by digestion of DNA and subsequent separation of the fragments on an agarose slab gel. The method appears to be generally applicable for the extraction of restriction endonucleases from gram-negative bacteria on an analytical scale and in a modified form for large-scale preparation of restriction enzymes.  (+info)

Identification of a novel GC-rich 113-nucleotide region to complete the circular, single-stranded DNA genome of TT virus, the first human circovirus. (7/2047)

The sequence data (H. Okamoto et al., Hepatol. Res. 10:1-16, 1998) of a newly discovered single-stranded DNA virus, TT virus (TTV), showed that it did not have the terminal structure typical of a parvovirus. Elucidation of the complete genome structure was necessary to understand the nature of TTV. We obtained a 1.0-kb amplified product from serum samples of four TTV carriers by an inverted, nested long PCR targeted for nucleotides (nt) 3025 to 3739 and 1 to 216 of TTV. The sequence of a clone obtained from serum sample TA278 was compared with those registered in GenBank. The complete circular TTV genome contained a novel sequence of 113 nt (nt 3740 to 3852 [=0]) in between the known 3'- and 5'-end arms, forming a 117-nt GC-rich stretch (GC content, 90.6% at nt 3736 to 3852). We found a 36-nt stretch (nt 3816 to 3851) with an 80.6% similarity to chicken anemia virus (CAV) (nt 2237 to 2272 of M55918), a vertebrate circovirus. A putative SP-1 site was located at nt 3834 to 3839, followed by a TATA box at nt 85 to 90, the first initiation codon of a putative VP2 at nt 107 to 109, the termination codon of a putative VP1 at nt 2899 to 2901, and a poly(A) signal at nt 3073 to 3078. The arrangement was similar to that of CAV. Furthermore, several AP-2 and ATF/CREB binding sites and an NF-kappaB site were arranged around the GC-rich region in both TTV and CAV. The data suggested that TTV is circular and similar to CAV in its genomic organization, implying that TTV is the first human circovirus.  (+info)

Effects of mutations in DNA repair genes on formation of ribosomal DNA circles and life span in Saccharomyces cerevisiae. (8/2047)

A cause of aging in Saccharomyces cerevisiae is the accumulation of extrachromosomal ribosomal DNA circles (ERCs). Introduction of an ERC into young mother cells shortens life span and accelerates the onset of age-associated sterility. It is important to understand the process by which ERCs are generated. Here, we demonstrate that homologous recombination is necessary for ERC formation. rad52 mutant cells, defective in DNA repair through homologous recombination, do not accumulate ERCs with age, and mutations in other genes of the RAD52 class have varying effects on ERC formation. rad52 mutation leads to a progressive delocalization of Sir3p from telomeres to other nuclear sites with age and, surprisingly, shortens life span. We speculate that spontaneous DNA damage, perhaps double-strand breaks, causes lethality in mutants of the RAD52 class and may be an initial step of aging in wild-type cells.  (+info)

Nucleos(t)ide analogues that inhibit hepatitis B virus (HBV) DNA replication are typically used as monotherapy for chronically infected patients. Treatment with a nucleos(t)ide analogue eliminates most HBV DNA replication intermediates and produces a gradual decline in levels of covalently closed circular DNA (cccDNA), the template for viral RNA synthesis. It remains uncertain if levels of cccDNA decline primarily through hepatocyte death, or if loss also occurs during hepatocyte mitosis. To determine if cccDNA survives mitosis, growing ducklings infected with duck hepatitis B virus (DHBV) were treated with the nucleoside analogue, Entecavir. Viremia was suppressed at least 10{sup 5}-fold, during a period when average liver mass increased 23-fold. Analysis of the data suggested that if cccDNA synthesis was completely inhibited, at least 49% of cccDNA survived hepatocyte mitosis. However, there was a large duck-to-duck variation in cccDNA levels, suggesting that low level cccDNA synthesis may ...
Residual hepatitis B virus (HBV) DNA can be detected following the resolution of acute HBV infection. Our previous work using duck hepatitis B virus (DHBV) infected ducks, indicated that ~80% of residual DHBV DNA in the liver is in the covalently closed circular DNA (cccDNA) form, suggesting that viral DNA synthesis is suppressed. The current study asked more directly if maintenance of residual DHBV cccDNA is dependent upon ongoing viral DNA synthesis. Ducks that recovered from acute DHBV infection were divided into 2 groups and treated with the antiviral drug, Entecavir (ETV), or placebo. No major differences in the stability of cccDNA or levels of residual cccDNA were observed in liver biopsy tissues taken 95 days apart from ETV treated and placebo control ducks. The data suggest that residual DHBV cccDNA is highly stable and present in a cell population with a rate of turnover similar to normal, uninfected hepatocytes.
The three PCR fragments were purified from agarose gels (Qiaex II kit, Qiagen, France), quantified by nanodrop spectrophotometer, mixed on an equimolar basis (100 ng final) and subjected to 35 cycles of amplification with the outer primers A1tsens, 5′GACAGCCCGTCTGTGCCTTCTCATGAC and C2trev, 5′ACGTCAGTAACTCCACAGTAGCAGG using the above PCR conditions. Primers A1t and C2t corresponded to primers A1 and C2 and were shortened respectively by 5 and 7 nucleotides 3′ of the primer to avoid amplification of HBVayw plasmid. As can be seen from Fig. 1b, a 410 bp fragment was readily obtained from the mixture of the 123, 136 and 274 bp fragments. The 410 bp outer PCR products were cloned using the TOPO TA cloning kit (Invitrogen) and individual clones sequenced.. As can be seen in Fig. 1c, all of the 164 sequences were recombinants where coloured circles represent the mutations introduced into the primers. Thirteen of the sixteen possible recombinants were found with frequencies ranging from 0.6 to ...
In tumor specimens such as those from neuroblastoma, ovarian, and lung carcinoma patients, the prevalence of extrachromosomal circular DNA molecules harboring amplified genes has been well established. In some cases, the amplified genes have been identified as oncogenes, and their increased expression appears to contribute to the maintenance and progression of the malignancy. The aim of this study was to investigate the effect of fractionated radiation treatment, given in daily doses similar to those administered clinically, on the stability of extrachromosomal circular DNA molecules in cancer cells. Our studies were conducted with multidrug-resistant KB cells, which harbor extrachromosomal copies of the multidrug resistance gene (MDR1) almost exclusively on circular DNA molecules of ∼750 and 1500 kb pairs. This size range is representative of extrachromosomal circular DNA molecules that have been shown to harbor amplified oncogenes in vivo. Exponentially growing MDR KB cells were exposed to ...
In order to generate a tube system of low resistance, sieve elements lose most of their cellular components such as the nucleus, cytoskeleton, ribosomes, tonoplast etc.. Mature sieve elements contain structural phloem specific proteins (P-proteins), mitochondria, ER, and sieve elements plastids.. In plants, sieve tube cells lose their nuclei at maturity (just like our RBCs), and thus lose their chromosomal DNA, but they dont lose their mitochondria.. In eukaryotic cells Wikipedia has divided extrachromosomal DNA into three parts based on where it is seen (I guess):. ...
Dr. Bhupesh Prusty and his associates in Professor Thomas Rudels laboratory at Biozentrum University have presented additional evidence that shortened telomeres can cause the release and possible activation of integrated HHV-6. Their work has previously shown that Chlamydia trachomatis infection activates ciHHV-6 and induces the formation of extra-chromosomal viral DNA in ciHHV-6 cells. In an article published by PLoS Genetics this month, Dr. Prusty expands on the theory that a transient shortening of telomeric ends (whether induced via Chlamydia infection or otherwise) may subsequently lead to increased telomeric circle formation and incomplete reconstitution of circular viral genomes containing single viral direct repeats, supporting a t-circle based mechanism for ciHHV-6 activation. Click here to read the abstract.. Chromosomally integrated HHV-6 (ciHHV-6) is found in 0.8 to 0.85% of normal controls in the US and the UK, but the prevalence in patient populations is much higher. HHV-6 can be ...
Synonyms for Circular DNA in Free Thesaurus. Antonyms for Circular DNA. 2 synonyms for DNA: deoxyribonucleic acid, desoxyribonucleic acid. What are synonyms for Circular DNA?
Biegeleisen, K. (2002) Topologically Non-Linked Circular Duplex DNA. |i|Bulletin of Mathematical Biology|/i|, 64, 589- 609. |br /| |a href=http://dx.doi.org/10.1006/bulm.2002.0288 target=_blank|http://dx.doi.org/10.1006/bulm.2002.0288|/a|
of) the genome?. C. Multiple Choice Questions. Instructions: Select the single best answer to each of the questions given below. Each question is worth one mark, for a total of 30 marks.. 1. A zygote contains the ________ complement of chromosomes.. a. haploid. b. diploid. c. polyploid. d. spermatogenesis. e. none of these. 2. How is the nucleoid of a bacterial cell replicated?. a. The linear DNA molecule is replicated from multiple origins of replication bidirectionally.. b. The linear DNA molecule is replicated from one origin of replication bidirectionally.. c. The circular DNA molecule is replicated from multiple origins of replication bidirectionally.. d. The circular DNA molecule is replicated from one origin of replication bidirectionally.. e. The circular DNA molecule is replicated from one origin of replication unidirectionally.. 3. Some cats have calico coats. These result from. a. polygenic inheritance.. b. epistasis.. c. pleiotropy.. d. inactivation of the X chromosome.. e. ...
VERMILLION, S.D. -- Keith Weaver, Ph.D., Professor in the Division of Basic Biomedical Sciences, received the 2007 Presidents Award for Research Excellence in the Established Faculty category.. Dr. Weavers research interests are in the field of microbiology, specifically bacterial genetics and plasmids. Bacterial plasmids are small circular DNA molecules that are replicated and inherited within cells, separately from the chromosome. Plasmids are important because of their involvement in the spread of antibiotic resistance in disease-causing bacteria. They often carry genes important in the pathogenesis of bacterial infections.Dr. Weaver is interested in how these important genetic determinants are replicated, inherited, and transmitted by bacteria. Throughout his seventeen years as a faculty member at The U., Dr. Weaver has obtained grant support from the National Institutes of Health, the National Science Foundation, and other sources. He has published 36 referred publications and is ...
Plasmid is a small circular DNA molecule that is commonly found in bacteria. Plasmids often carry genes that are beneficial for bacterial survival.
Dark circles under the eyes tell us about the health of an individual. They are produced due to overstrain, after an illness or an allergy. They can also be the result of undernourishment. But these dark circles do not produce any harm to the body. So anybody with dark circles should not worry about them. In fact, sometimes theyre not even an indication of physical problems. Dark circles can be aggravated by fatigue, allergies, overexposure to the sun, menstruation or pregnancy. But theyre usually hereditary; if your parents have them, there are more chances that you do, too have them. Dark circles are the result of the engorged blood vessels under your eyes. Because the skin under eyes is thinner than skin anywhere else on body, therefore blood vessels there are more noticeable, especially in fair skinned persons. Usually, dark circles are caused by hyper pigmentation of melanin, the substance that gives color to the skin. In western countries, the kidneys are related to the adrenal glands ...
Human mitochondria maintain a small circular DNA that encodes several subunits of the proteins involved in oxidative phosphorylation as well as ribosomal and tr...
By NewBeauty Editors. Did you know that dark circles are not caused by a lack of sleep but by blood that pools in the vessels close to the skin? Dark circles are the result of blood that pools in the... Read More ...
Due to its high nuclease resistance and improved stability in biological fluids, circular DNA (cDNA) has been used to fabricate an intracellular mRNA sensing platform. cDNA has turned out to be a good option for highly efficient biosensing and therapeutics in living biological systems.
Nucleoid: DNA in prokaryotes isnt organized quite the same as in eukaryotes. Rather than being organized in a distinct, membrane-bound portion of the cell, prokaryotes organize their DNA in what is considered the nucleoid. You can think of the nucleoid as a membrane-less compartment where the organisms DNA is found. Although in the diagram I have drawn a single linear DNA molecule, prokaryotes have a diversity of types of DNA, from single circular DNA to multiple linear and circular DNA molecules ...
Next, the DNA primer is extended all 28 URSULA SCHULTZ ET AL. the way to the 50 -end of the pgRNA template, yielding a complete (À)-DNA strand with a short terminal redundancy. 2. Concomitantly with (À)-DNA synthesis, the RNA template is degraded by the RNase H activity of P protein, except for a 50 -terminal oligonucleotide whose 30 -end consists of the 50 -copy of DR1. 3. For relaxed circular DNA formation, the RNA oligonucleotide is transferred to the third copy of the direct repeat, DR2, located shortly upstream of DR1*, where it serves as a conventional primer for (þ)-strand DNA synthesis (second template switch), which then proceeds to the 50 -end of the (À)-DNA, generating a short terminal redundancy. The phosphorylated and nonphosphorylated forms of L are designated P35 and P36, respectively. A minor form of L, occasionally detected at approximately 37 kDa, may result from phosphorylation at additional Ser and Thr sites in preS. , 1993). , 1993; Grgacic and Anderson, 1994) originate ...
We have identified tens of thousands of short extrachromosomal circular DNAs (microDNA) in mouse tissues as well as mouse and human cell lines. These microDNAs are 200 to 400 base pairs long, are derived from unique nonrepetitive sequence, and are enriched in the 5′-untranslated regions of genes, exons, and CpG islands. Chromosomal loci that are enriched sources of microDNA in the adult brain are somatically mosaic for microdeletions that appear to arise from the excision of microDNAs. Germline microdeletions identified by the Thousand Genomes project may also arise from the excision of microDNAs in the germline lineage. We have thus identified a previously unknown DNA entity in mammalian cells and provide evidence that their generation leaves behind deletions in different genomic loci.. ...
It is well known that genomic materials (long DNA chains) of living organisms are often packed compactly under extreme confining conditions using macromolecular self-assembly processes but the general DNA packing mechanism remains an unsolved problem. It has been proposed that the topology of the packed DNA may be used to study the DNA packing mechanism. For example, in the case of (mutant) bacteriophage P4, DNA molecules packed inside the bacteriophage head are considered to be circular since the two sticky ends of the DNA are close to each other. The DNAs extracted from the capsid without separating the two ends can thus preserve the topology of the (circular) DNAs. It turns out that the circular DNAs extracted from bacteriophage P4 are non-trivially knotted with very high probability and with a bias toward chiral knots. In order to study this problem using a systematic approach based on mathematical modeling, one needs to introduce a DNA packing model under extreme volume confinement ...
Two different kinds of genetic material exist: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Cells use DNA for their long-term information storage. The biological information contained in an organism is encoded in its DNA sequence.[3] RNA is used for information transport (e.g., mRNA) and enzymatic functions (e.g., ribosomal RNA). Transfer RNA (tRNA) molecules are used to add amino acids during protein translation.. Prokaryotic genetic material is organized in a simple circular DNA molecule (the bacterial chromosome) in the nucleoid region of the cytoplasm. Eukaryotic genetic material is divided into different,[3] linear molecules called chromosomes inside a discrete nucleus, usually with additional genetic material in some organelles like mitochondria and chloroplasts (see endosymbiotic theory).. A human cell has genetic material contained in the cell nucleus (the nuclear genome) and in the mitochondria (the mitochondrial genome). In humans the nuclear genome is divided into 46 linear ...
Numerous novel episomal DNA-sequences related to single-stranded circular DNA viruses have been isolated from milk, bovine sera as well as from different human pathological biopsies (Funk et al.; Gunst et al.; Lamberto et al.; Whitley et al.; all Genome Announc. (2014) 2(4); Falida et al.; Genome Announc. (2017) 5(17)). The high degree of homology between isolates from milk, bovine sera and human tissue or serum points at the consumption of bovine meat or dairy products as potential route of transmission. The global epidemiology of some common cancers (e.g. colon and breast cancer) could suggest a zoonotic origin of these conditions (zur Hausen and de Villiers, 2015; zur Hausen, Bund and de Villiers, 2017 ...
to find the area of a cylinder you have to draw the net which consists of just a rectangle and two circles. find the area the rectangle: LxW or length times width. finding the area of the two circles: PIr sqaured or PI times the radius squared, pi is just a number and is usually 3.142 but can be used as just 3, diameter is the line that goes directly throught the centre of the circle from one edge of the circle to another. because both of the circles are the same size the area of them is the same add it all up: now you just have to add the area of the rectangle and the area of the two circles, giving you the surface area ...
The appearance of dark circles makes you look tired, dull and might be mistaken to be feeling sad. In most cases, the dark circles are formed due to the veins under the skin of the eyes. As the skin around this region is thinner, the veins are more visible.
Avebury is a village in Wiltshire, famous for its neolithic stone circle. The henge and stone circles are thought to have been constructed from about 2500 BC to 2000 BC, and the nearly circular bank ditch, which is almost a mile in circumference, encloses a much later mediaeval village, with a Saxon church and Elizabethan country manor. Many of the stones are missing or buried, having been considered evil by the local during mediaeval times, they were toppled or broken up, many of which to be revealed and restored in the 1930s by the famous archaeologist Alexander Keillor. The village and henge lie at the centre of one of the most exciting megalithic landscapes in the world, with the remains of two prehistoric processional avenues of stones leading from the circle, leading to other nearby prehistoric points of interest such as West Kennett Long Barrow and Silbury Hill.
Avebury is a village in Wiltshire, famous for its neolithic stone circle. The henge and stone circles are thought to have been constructed from about 2500 BC to 2000 BC, and the nearly circular bank ditch, which is almost a mile in circumference, encloses a much later mediaeval village, with a Saxon church and Elizabethan country manor. Many of the stones are missing or buried, having been considered evil by the local during mediaeval times, they were toppled or broken up, many of which to be revealed and restored in the 1930s by the famous archaeologist Alexander Keillor. The village and henge lie at the centre of one of the most exciting megalithic landscapes in the world, with the remains of two prehistoric processional avenues of stones leading from the circle, leading to other nearby prehistoric points of interest such as West Kennett Long Barrow and Silbury Hill.
often dark circles are a result of hereditary factors.So if someone in your family are experiencing this problem, it is likely that you will sooner or later it will also be affected.In that case, if the dark circles have arisen because of heredity, there is very little likelihood that you will be able to get rid of this problem.Most likely, you will be able to slightly lighten the circles.. Beauticians recommend using cream for eyelids.Eye Cream will help reduce wrinkles and actively moisturize the delicate skin around the eyes.It is important to use such creams, which include vitamins E and A, which helps skin resist environmental hazards.Also, it is useful to use a corrective tone means.But in any case, do not use the compact powder as a masking agent - so the circles will become even more noticeable.. ...
Dark circles refer to the discoloration of the skin under the eye, also known as dark shadows or dark rings. Dark circles are common in bo ...
Data information: Groups were compared by Kruskal-Wallis test and Dunns post hoc test. Bars and whiskers are median and interquartile range, and circles are individual values. Exact P‐values poly‐GP (A): ND‐CON vs. c9FTD: P = 0.0477; PD vs. AD: P = 0.0053; ND‐CON vs. c9ALS: P = 0.0483; ND‐CON vs. C9‐F1: P = 0.0236; NonC9‐F1 vs. c9FTD: P = 0.0365; NonC9‐F1 vs. c9ALS: P = 0.0334; NonC9‐F1 vs. C9‐F1: P = 0.0194; sALS vs. c9FTD: P = 0.0006; sALS vs. c9ALS: P = 0.0007; sALS vs. C9‐F1: P = 0.0003; sFTD vs. c9FTD, sFTD vs. c9ALS, sFTD vs. C9‐F1, PD vs. c9FTD, PD vs. c9ALS, and PD vs. C9‐F1: P , 0.0001. Exact P‐values pNfH (C): PD vs. C9‐F1: P = 0.0121; PD vs. NonC9‐F1: P = 0.0261; sALS vs. ND‐CON: P = 0.0103; C9‐F1 vs. AD: P = 0.0334; ND‐CON vs. c9ALS: P = 0.0142; NonC9‐F1 vs. c9ALS, C9‐F1 vs. c9ALS, sALS vs. C9‐F1, and sALS vs. NonC9‐F1: P , 0.0001. Exact P‐values NfL (D): sFTD vs. C9‐F1: P = 0.0013; sFTD vs. NonC9‐F1: P = 0.0038; PD vs. C9‐F1: P ...
A corollary of this approach is that not only should you avoid saying Ill only have sex if its infinitely safe, but you also need to not say if I got the herp, that would be infinitely bad. You cant designate it as a moral failing or a sign that youre a disgusting or stupid person--you just happened to win the Virus Lottery, thats all. Youre going to suffer some negative consequences, but you arent going to be ruined. (Ive noticed that some sex-positive circles are actually terribly judgey when it comes to the subjects of STDs and unwanted pregnancies, as if someone with these is not only shamefully irresponsible, but somehow an affront to sex-positivity itself. Sex couldnt possibly be positive and also sometimes harmful!) The fact that I dont have the herp means that Im lucky, not that Ive been doing everything right. And--whether youre a virgin or a streetwalker--you too. The amount of luck you needed might be different, but it was some. Nobody can say I didnt need luck ...
Diesen Titel erhalten Sie in einer Bibliothek! Times and seasons. [Beverly LaHaye; Terri Blackstock] -- Cathy Flahertys marriage is put on hold when her teenaged son is arrested for selling marijuana. Her friends from Cedar Circle are supportive but face problems of their own.
As for TnGBS element, ISLre2 is inserted 15 bp upstream the -35 box of typical sigmaA promoters. An extrachromosomal circular form of the IS have been amplified by PCR ...
Still, wild relatives can be hard to work can you help me do my homework with and produce a decrease yield. A number of them were found to be connected with leaf developmental stages. For this, the term genome shouldnt be utilised as a synonym of chromosome. The enzymes involved with translation are ribozymes. They can exist either as single cells or compose a multicellular body known as a mycelium.. I am able to assure you, well be changed. Instead, he was not normal.. The procedure by which mRNA directs protein synthesis with the help of tRNA is known as translation. The p53 protein includes three domains. The protein microarray is just one of several immune parameters were assessing. In addition, prokaryotes frequently have abundant plasmids, which are shorter, circular DNA molecules that might just contain one or a couple of genes and frequently carry traits like antibiotic resistance. There are many kinds of RNA that may be transcribed including mRNA, rRNA and tRNA. As an example, ...
The DNA in prokaryotes is contained in a central area of the cell called the nucleoid, which is not surrounded by a nuclear membrane. Many prokaryotes also carry small, circular DNA molecules called plasmids, which are distinct from the chromosomal DNA and can provide genetic advantages in specific environments ...
The mitochondrial genome is a circular DNA molecule which is distinct from the nuclear genome. In humans, its about 16 kb long and encodes 37 genes.
The mitochondrial genome is a circular DNA molecule which is distinct from the nuclear genome. In humans, its about 16 kb long and encodes 37 genes.
For the first attempt (my prototype of sorts), I was concentrating so hard on the actual act of joining that I accidentally joined to the wrong picot! Oops. I didnt discover this until thr﻽ee rings and three chains were already done. Oh well, this was a practice piece so I kept going. Following along with the video (see link above) I used a picot gauge as she suggested in the video to make the large picot for joining to the button. However, I discovered too late that the picot was actually a bit too small and so made the motif turn out oval-shaped instead of round. I was almost done with the prototype when I realized I had not joined the last ring on both sides, which brings the piece into a closed circle. Gently, I tried to pull it out.... no luck! Cut bait! Start over!!! Im so glad I did. Another lesson learned ...
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
The pGLO plasmid is a small circular piece of DNA that contains the gene to produce green fluorescent protein in the model organism. Within the pGLO plasmid, the gene that codes for GFP is typically...
n. 1) a geometric element that has position but no extension 2) the precise location of something; a spatially limited location 3) a brief version of the essential meaning of something 4) an isolated fact that is considered separately from the whole; detail; item 5) a specific identifiable position in a continuum or series or especially in a process; degree; level; stage 6) an instant of time; point in time 7) the object of an activity 8) a V shape; tip; peak 9) a distinct part that can be specified separately in a group of things that could be enumerated on a list; item 10) a very small circular shape; dot 11) the unit of counting in scoring a game or contest 12) a promontory extending out into a large body of water 13) a style in speech or writing that arrests attention and has a penetrating or convincing quality or effect 14) an outstanding characteristic; spot 15) sharp end 16) any of 32 horizontal directions indicated on the card of a compass; compass point 17) the dot at the left of a decimal
Hepatitis B virus (HBV) infection of hepatocytes begins by binding to its cellular receptor sodium taurocholate cotransporting polypeptide (NTCP), followed by the internalization of viral nucleocapsid into the cytoplasm. The viral relaxed circular (rc) DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc) DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s) that fills the gap in the plus strand of rcDNA remains to be determined. Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s) responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV ...
Covalently closed circular DNA molecules were isolated from Plasmodium falciparum total DNA by isopycnic centrifugation in CsCl gradients containing either ethidium bromide or 2,6-diamidino-2-phenylindole. The circular molecules had an average contour length of 11.1 +/- 0.5 micron, similar to the analogous molecules previously isolated from the simian malaria parasite P. knowlesi. Both circular molecules shared considerable sequence homology and conserved restriction sites. The nucleotide sequence of one 936 bp fragment of the P. falciparum molecule was determined and identified, by a data base homology search, as part of a mitochondrial small rRNA subunit, thus confirming the mitochondrial origin of the circular DNAs of both malarial species.. ...
The geological survey conducted at Arkenu circular structures gave us the opportunity to verify in the field the reliability of the suggested hypothesis related to an impact origin. The presence of a fragment of a carapace of a syenitic stock, and related veins, in the Arkenu 1 structure associated with extensive hydrothermal alteration is a key factor for establishing its genesis and evolution. It is quite surprising that the outcrop of this intrusive had never been reported before, as one can easily walk onto it in the northeastern sector of the structures bottom. Moreover, the presence of massive magnetite horizons associated with hydrothermal veins and breccias (bearing apatite veinlets) somehow similar to the mineral ore of Magnetita Pedernales (northern Chile; cf. Grez et al. 1991) suggests that this structure is related to complex endogenous processes. The origin of such deposits has been a strongly debated issue since their discovery: initially interpreted as the most typical examples ...
Get information, facts, and pictures about Circular DNA at Encyclopedia.com. Make research projects and school reports about Circular DNA easy with credible articles from our FREE, online encyclopedia and dictionary.
BioAssay record AID 502675 submitted by ChEMBL: Induction of DNA cleavage activity in Escherichia coli pBR322 assessed as supercoiled circular form after 10 mins by gel electrophoresis in presence of 0.1 M NaN3 solution.
What is Dot Blot: similar technique as western blotting for detecting proteins in samples that are spotted through circular templates directly onto the membrane.. General Methods & Techniques. Antigen-Antibody Specific Applications. Virological Applications. Tumor, Disease & Diagnostic Applications. Dot Blot Definition - A technique for detecting, analyzing, and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular templates directly onto the membrane or paper substrate (source: NDI Foundation).. Protocols, troubleshooting and tips for successful dot blotting - Dot blot is a technique for detecting and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular templates directly onto the membrane or paper substrate. Antigens may be applied directly to nitocellulose membrane ...
A molecular clone containing the complete sequence of a mitochondrial circular plasmid-like DNA (the R plasmid) isolated from the date-palm variety V3DP was used as a probe in Southern analyses of mitochondrial DNA prepared from other varieties. Another circular structure (the S plasmid) was detected in some of these varieties, and sequenced from variety V2DP. It appears that the R plasmid could have arisen from the S plasmid by an intermolecular recombination event at a set of 26-bp imperfect short direct repeats.
1. Equal circles are those the diameters of which are equal, or the radii of which are equal.. 2. A straight line is said to touch a circle which, meeting the circle and being produced, does not cut the circle.. 3. Circles are said to touch one another which, meeting one another, do not cut one another.. 4. In a circle straight lines are said to be equally distant from the centre when the perpendiculars drawn to them from the centre are equal.. 5. And that straight line is said to be at a greater distance on which the greater perpendicular falls.. 6. A segment of a circle is the figure contained by a straight line and a circumference of a circle.. 7. An angle of a segment is that contained by a straight line and a circumference of a circle.. 8. An angle in a segment is the angle which, when a point is taken on the circumference of the segment and straight lines are joined from it to the extremities of the straight line which is the base of the segment, is contained by the straight lines so ...
Chloroplast has different shapes and structures. Its diameter is about 4 - 6 μm. It appears heterogenous structure under light microscope. It has small granule like structure called Grana. These grana are embedded in the matrix. The chloroplast shows three main components under electron microscope. These are Envelop, Stroma, Thylakoid and Granum.. The Envelop: the envelop is the outer covering of the chloroplast. It formed inner membrane extends inward, at some places, the inner membrane is in continuous with the thylakoids. This contact is used for transfer of material into and out of the chloroplast to cytosol. Inner membrane also contains small amounts of carotenoids.. Stroma: Stroma is the fluid that surrounds the thylakoids. It covers most of the volume of the chloroplast. It is gel like substance. It contains about 50% of the chloroplast proteins. It contains proteins, some ribosomes and small circular DNA. Calvin Cycle or dark reaction takes place in stroma. The Carbon Dioxide is fixed ...
Molecular mechanism of DNA replication. Two distinct Polymerases - a and d, appear to function at the eukaryotic growing fork.Polymerase d (pol. Before replication can start, the DNA has to be made available as a template. This process is called semiconservative replication because one of the old strands is conserved in the new DNA double helix. Notes # Replication of Circular DNA Molecules: Circular DNA molecules occur in both prokaryotes and eukaryotes. Next lesson. DNA replication would not occur without enzymes that catalyze various steps in the process. However, the interaction of the initiation proteins with the ds-DNA is more complex. RNA polymerase requires a number of helper proteins to bind to DNA and initiate RNA Eukaryotic DNA replication, also reviewed in more detail in Chapter 3, Features of Host Cells: Cellular and Molecular Biology Review, is also carried out by DNA polymerases and other proteins within the nucleus. In eukaryotes, the situation is different in a number of ...
TY - JOUR. T1 - Bleomycin-induced Alkaline-labile Damage and Direct Strand Breakage of PM2 DNA. AU - Lloyd, R. Stephen. AU - Haidle, Charles W.. AU - Hewitt, Roger R.. PY - 1978/10. Y1 - 1978/10. N2 - Bleomycin-induced breakage of an isolated covalently closed circular DNA from bacteriophage PM2 was assayed fluorometrically after agarose gel electrophoresis and staining with ethidium bromide. When bleomycin-damaged DNA was assayed under neutral conditions, there was a decrease in the amount of Form I DNA and a simultaneous increase in both Forms II and III of DNA. However, when the damage was assayed under nondenaturing alkaline conditions, there was a greater decrease in the amount of Form I DNA and a corresponding increase in both Forms II and III DNA compared with neutral conditions. Approximately one alkaline-labile site was formed for every single-strand break introduced. The rate of formation of Form III DNA was found to be approximately twice as fast when measured under alkaline ...
One of the disadvantages of circular plasmids and chromosomes is their high sensitivity to rearrangements caused by homologous recombination. Odd numbers of crossing-over occurring during or after replication of a circular replicon result in the formation of a dimeric molecule in which the two copies of the replicon are fused. If they are not converted back to monomers, the dimers of replicons may fail to correctly segregate at the time of cell division. Resolution of multimeric forms of circular plasmids and chromosomes is mediated by site-specific recombination, and the enzymes that catalyze this type of reaction fall into two families of proteins: the serine and tyrosine recombinase families. Here we give an overview of the variety of site-specific resolution systems found on circular plasmids and chromosomes.
There is a fairly closed circle between culture, language, meaning, and truth such that the world of a given culture is a world understood in terms of the meanings produced in that culture. Medicine is, in fact, a subculture of a powerful type and has its own language and understanding of the range of illnesses that affect human beings. So how does medicine get at the truth of people and their ills in such a way as to escape its own limited constructions? There is a way out of the closed circle implicit in the idea of a praxis and the engagement with reality that is central to it and the further possibility introduced by Jacques Lacan that signification is never comprehensive in relation to the subjects encounter with the real. I will explore both of these so as to develop a conception of truth that is apt for the knowledge that arises in the clinic.
Jonathon Coes The Rotters Club (published 2001) was always intended to be Book 1 of a larger story, and Book 2, The Closed Circle has only recently come out. It is a page-turner no doubt (I read it very quickly), but that only takes it within the provinces of an insubstantial beach read, and disappointingly it rarely strays outside, demonstrating but a shadow of the authors proven ability. To be fair it does manage to show some virtuosity in the variety of views and immersive voices, and for a Coe obssesive thats enough to make it a worth-while read. But it is an easy read - and whether you think thats negative criticism or not will determine whether you like this book.. The book definitley does lack for Coes trademark structured gags though. Where the missing footnote in The House of Sleep recalled some of the wittier Ronnie Barker monologues (specifically the Answering the Question Before last Mastermind sketch), Closed Circle degenerates into the song medley where the Ronnies have ...
Biol. and Kool,E.T. (1996) Rolling circle DNA synthesis: small circular oligonucleotides as efficient templates for DNA polymerases. Therefore, we have successfully used error-prone RCA to introduce mutations that altered the substrate specificity of β-lactamase, indicating the applicability of this method for in vitro evolution experiments.Table 5.Mutations of the Genemorph Ii Random Mutagenesis Kit This method permits rapid preparation of randomly mutated plasmid libraries, and will enable the wider adoption of random mutagenesis.NOTE: In the PDF version of this article initially published online, the publication These values were lower than that obtained under error-free conditions (38 000), indicating that increasing the concentration of MnCl2 decreased the numbers of colonies. J., 276, 269-270. [PMC free article] [PubMed]14. Natl Acad. http://parasys.net/error-prone/error-prone-pcr-taq.php An example of in vitro mutagenesis with EMS in which a PCR-amplified gene was subjected to reaction ...
The genome of Simian Virus 40 (SV40) is a covalently closed circular DNA duplex with about 5200 nucleotide pairs. Based on physiological studies and mapping of temperature-sensitive and deletion...
D-loop replication is a proposed process by which circular DNA like chloroplasts and mitochondria replicate their genetic material. An important component of understanding D-loop replication is that many chloroplasts and mitochondria have a single circular chromosome like bacteria instead of the linear chromosomes found in eukaryotes. However, many chloroplasts and mitochondria have a linear chromosome, and D-loop replication is not important in these organelles. Also, not all circular genomes use D-loop replication as the process of replicating its genome. In many organisms, one strand of DNA in the plasmid comprises heavier nucleotides (relatively more purines: adenine and guanine). This strand is called the H (heavy) strand. The L (light) strand comprises lighter nucleotides (pyrimidines: thymine and cytosine). Replication begins with replication of the heavy strand starting at the D-loop (also known as the control region). A D-loop is a short portion in circular DNA that has three strands ...
A litter circle is a sizable pattern created by the flattening of litter such as clay-based (clumping/non-clumping), crystal or natural and biodegradable cat litter. Litter circles are also referred to as litter formations, because they are not always circular in shape. Litter circles have become the subject of speculation by various paranormal and anomalistic investigators…
The Well uses Mediderma products as a safe, non-surgical effective chemical peel treatment for dark circles.. The peel us specifically developed for use in the delicate eye area, brightening the skin by lifting the pigmentation. You may be offered a combination therapy comprising tear trough filler and IV therapy to achieve best results. Dark circles are notoriously difficult to treat and require patience and dedication. With the appropriate lifestyle changes and a bespoke treatment plan combining the most effective and cutting edge procedures we have achieved great results in helping to reduce dark circles.. Indications for Dark Circles Treatement. The skin under the eyes is the most pigmented and thinnest of the face. With ageing, the pigmentation of this region can increase and become darker.. The skin under the eyes is the most pigmented and thinnest of the face. With ageing the pigmentation of this region can increase and become darker. In addition ageing results in the development of fine ...
Dark circles or under eye circles are common beauty complaint. Men and women experience dark circles under their eyes at one time or another.
The extant autograph manuscript of the Genealogia Deorum of Boccaccio is illustrated by thirteen genealogical trees, designed certainly and drawn in all probability by Boccaccio himself. At the top of each tree is a large circle, in which is written the name of a divinity. From this circle descends a stem which now expands into other lesser circles, now sends forth leaves, and now branches, which in their turn expand into circles and send forth leaves and lesser branches. In the center of each circle or leaf a name is written. The circles are used for those divinities whose progeny is represented in the same tree; the leaves, for divinities whose progeny is not represented. In the circles the words qui genuit [ie. who fathered] follow each masculine name, and the words quae peperit [ie. who bore] each feminine name. Similar trees certainly appeared in the earlier lost autograph, from which all the apograph manuscripts are derived; and similar trees appear in several apographs, and in the fourth ...
On the plan must be present not only walls, but doors windows. Need to draw it in such detail that there is no doubt that it shows your apartment (Think in advance how it will look a picture, sketch). Once you have drawn a plan, it must be circle the three circles. Circles are held in a clockwise direction from larger to smaller (see Fig. 1). Fig. 1. On the left shows the back of the amulet (the plan shows an apartment), to the right - the front of square Lo Shu. Next Step - Drawing Lo Shu square on the reverse side of the paper. Initially drawn square, divided into 9-Th cells with the same, then in each cell fit figure. The figures entered in the order 1, 2, 3, etc. Settle down in the end, they must as shown in Fig. 1. Try to put the plan and the square of the Lo-shu, a sheet of paper without corrections. Step Four. Charging the amulet. Charge the amulet can be mentally, putting him in a certain mental images. To do this you need to concentrate the image of the square with the numbers and ...
This piece was created using mens ties and tells its story using Morse Code. One of the lawyers who gave me his ties told me in retirement he hoped to never wear another tie. Any square that has a triangle in it has no code. The squares with circles and squares on them stand for a letter of Morse Code. The square shapes are dashes and the circles are dots. I am sending you the message Wishing you peace and harmony ...
The 2 curves components to the left are entries for the 2 curves defining the dome. The next 2 define the zones which are manually defined as holes in the dome.. The vb script is customized from David Ruttens one and generates a circle packing, centers of circles are used for voronoi. Voronois cells are then filtered and simplified to generate cutting shapes. ...
Natura Bissés The Cure Collection counteracts the damaging effects of pollution and environmental stress, and this sheer tinted cream adapts to suit any tone, evening out imperfections with a lightweight, natural coverage. The dual-action formula protects and nourishes the skin, leaving it plumped and replenished - lines and wrinkles appear visibly reduced while shadows and dark circles are blurred and softened. - Water resistant properties for all-day wear and hydration - SPF20 UVA/UVB solar protection - Fermentus Glaciarum Extract boosts production of key collagen types I and III insuring youthful elasticity and fullness
The IMFs Anne Krueger was reported to have asked the same question of everyone she met when she was in Brasilia on Dec. 1: Do you know anything about [Argentinas new Finance Minister] Felisa Miceli? Where she came from, and where shes going? An O Globo political columnist on Dec. 3 pointedly described Miceli as possibly the Dilma Rousseff of the land of Kirchner, a reference to President Lula da Silvas head of cabinet, Dilma Rouseff, whose attack against her own governments austerity economic policy on Nov. 9 ignited a firestorm in Brazil which has yet to subside.. Financier circles are not so worried about Dilma Rousseff per se, as they are about the steady weakening of their iron grip on Brazils successive governments. Day after day, the so-called expansionist faction within the Lula government demands a change in policy.. On Dec. 1, Vice President Jose Alencar attacked the governments economic policy for the third time in a week, this time in a way calculated to draw the military ...
Married to Medicine Los Angeles will give viewers a look into the elite and fast paced lives of five successful women, including doctors and doctors wives living in Los Angeles. With an incredibly small and exclusive African American medical community to lean on, these women share a special bond. However, when circles are this tight, its only a matter of time before paths and personalities collide. From juggling bustling careers and family life, to shifting rivalries and evolving friendships, one thing remains constant...they are all married to medicine.
Gail, first of all, THANK YOU. Your wisdom is ilanauvble. And so is your sense of humor!! Strangling an anaconda omg LMFAO so hard my husband actually addressed me to ask what was so funny. I have made icing so stiff that it gave me carpal tunnel, so I totally know what you mean. So thank you for the laughs, and thank you so much for the tutorial. Circles are damned hard but I thought I was all alone. You were lucky to have the cookie monster. It is so generous of you to share the tips Posted by Irfan at October 22, 2012 02:28 PM ...
SELECTIVE AMPLIFICATION OF OVERLAPPING AMPLICONS | METHODS AND COMPOSITIONS FOR LABELING TARGETS | DNA DETECTION METHOD AND DNA DETECTION DEVICE | ROLLING CIRCLE AMPLIFICATION METHOD | METHOD AND DEVICE FOR DETECTING MOLECULES OR PARTICLES USING FRACTIONALIZED VOLUMES |
BEAMing allows the one-to-one conversion of a population of DNA fragments into a population of beads. We used rolling circle amplification to increase the number of copies bound to such beads by more than 100-fold. This allowed enumeration of mutant and wild-type sequences even when they were presen …
I decided to make use of the existing 12 concrete pier with power outlets which is halfway between the main observatory dome and the storage building. This has a good view of every direction except the north, which is blocked by large trees over the BBQ deck. Using this site saves the expense of creating a new pier and underground power lines to a new site. It also makes the best use of our existing building site pad by not blocking access to the storage or main dome buildings. It was clearly the logical place. Our POD will have one computer bay, which will be on the north side of the circular structure. Over this will be constructed the PZT - POD zenith tray - which allows the rollers on the bottom of the dome to roll the dome completely off the walls and recess it towards the north. There is a 16 diameter circle at the axis of the dome which permanently blocks a piece of sky. To avoid this, the PZT must be used. Ive offset the axis of the dome from the concrete telescope pier so that the ...
Supplementary MaterialsFigure S1: Expression of ITGAV, effect on viability and proliferation. UM-UC-3 and RT-4 cells were measured using the Alexa Fluor 488 annexin V/Dead Cell LDN-214117 Apoptosis Kit (Invitrogen). In addition, UM-UC-3 luc2 and RT-4 cells were seeded into a 6-well plate and exposed to a concentration series of GLPG0187 (0C500 ng/ml). 48 h after incubation, cells were harvested and processed for annexin V/PI staining. The percentage of viable (AnnexinV?/PI?), LDN-214117 dead (PI+/AnnexinV?), and total apoptotic cells (AnnexinV+) are shown (G). Proliferation rate (mitochondrial activity as assessed with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (optical density at 490 nm)) in the 2 2 v kd clones (respectively closed circles and triangles) and NT (open circles) UM-UC3luc2 (H) and RT-4 (I) cells. The effects of GLPG0187 treatment on proliferation rate of UM-UC-3luc2 (J) and RT-4 cells (K) after 24, 48 and 72 h of treatment was assessed with ...
This usually occurs as a focal or multifocal event and may be seen as an aging change in rats. Glandular dilation usually involves multiple glands, and the dilatation is often irregular in profile (i.e., not a well-circumscribed circular structure). Glandular cysts (see Stomach, Glandular stomach, Glands - Cyst) are usually solitary, larger, and lined by attenuated epithelium ...
I need to describe prokaryotic and eukaryotic chromosomes. I think I got prokaryotic the circular DNA molecule of prokaryotic organisms, containing the majority of the genes for the cell. I cant seem to define eukaryotic can u help ...
环形RNA研究历史1>最早的环形RNA分子在20世纪70年代于RNA病毒中发现。(Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures) 2>2012年,斯坦福大学和霍华德休斯医学研究所的科学家们发表在
Dot blot is a technique can be used as a semiqualitative method for rapid screening of a large number of samples. It is for detecting, analyzing, and identifying proteins, similar to the western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular templates directly onto the membrane. - Dot Blot - AbVideo™ - Support - Abnova
Scaly circular patches - What causes non itchy red scaly circular patches on arms, legs and back, but is not psoriasis? Skin on circular patches usually hardens and falls off Please see. Please see your dermatologist for evaluation and to discuss treatment options. Its not possible to tell because there are many diseases that look the same.
Contents:(1) 1.2 oz container of mixed print waxWhat you need:You will need mico-fiber lint free cloths. NOTE: Any other cloth or rag will create lint that will be permanently embedded into your print surface. For Use on: To be used on Analogue fiber matte, and all 19th century alternative photographic prints made with cotton rag paper. Not to be used with digital images.. Application: To apply A&P print wax, dip your finger or edge of the cloth into the wax. No need to heat the wax before application. Apply a small amount of wax and gently rub the wax into the surface using small circular motion until the entire print is coated. Once the print is completely coated with wax, use a clean micro fiber cloth and gently buff and polish the wax into the surface using small circles until an appropriate sheen is achieved. Before you finish use long straight horizontal or vertical strokes to achieve consistency of sheen on the surface. You may do more then one coat but it may not be needed. Be sure to ...
Contents:(1) 1.2 oz container of mixed print waxWhat you need:You will need mico-fiber lint free cloths. NOTE: Any other cloth or rag will create lint that will be permanently embedded into your print surface. For Use on: To be used on Analogue fiber matte, and all 19th century alternative photographic prints made with cotton rag paper. Not to be used with digital images.. Application: To apply A&P print wax, dip your finger or edge of the cloth into the wax. No need to heat the wax before application. Apply a small amount of wax and gently rub the wax into the surface using small circular motion until the entire print is coated. Once the print is completely coated with wax, use a clean micro fiber cloth and gently buff and polish the wax into the surface using small circles until an appropriate sheen is achieved. Before you finish use long straight horizontal or vertical strokes to achieve consistency of sheen on the surface. You may do more then one coat but it may not be needed. Be sure to ...
P1: This tip is a large opened circle. You can create a swirl like we did below or you can make small circular dots with the tip. P2: This is also a star tip, however, it has a very wide diameter center. It is one of the largest tips in the entire set, so it will be easy to find. It was used to create this layered petal look, but you can also create a giant swirl. This tip is great if you are decorating jumbo cupcakes.. P3: This tip is a five point star, however, it is larger and the star part of the tip is slanted, creating a rose-like, flower effect. It was used to create a swirl. This is a great design to add a leaf too, using the leaf piping tip.. P4: This tip is an eight point star, and was used to make several little star dots. This would also make for a beautiful multi-lined swirled, do to the 8 points the piping tip has.. P5: This is another five point star, however, it is much slimmer and not slanted. This tip was used to create a swirl.. ...
Follicular Unit Extraction (FUE) This type of hair restoration has a unique foot hold in this industry. Just to keep things simple yet complex the original FUE was using a very large circular punch to remove a group of follicles... that being several groups of follicular units (simple)... from the donor area. This old school technology was used in the 1990s.
DNA replication. Computer artwork of a DNA (deoxyribonucleic acid) molecule replicating. DNA is composed of two strands twisted into a double helix. Before replication the strands separate from each other. Each strand then acts as a template for the formation of a new DNA molecule. This is known as semiconservative replication. DNA contains sections called genes, which encode the bodys genetic information. - Stock Image G110/0860
Single stranded closed circular DNA. Many begomoviruses have a bipartite genome: this means that the genome is segmented into ... Briddon RW, Patil BL, Bagewadi B, Nawaz-ul-Rehman MS, Fauquet CM (2010). "Distinct evolutionary histories of the DNA-A and DNA- ... referred to as DNA A and DNA B) that are packaged into separate particles. Both segments are generally required for successful ... The DNA A segment typically encodes five to six proteins including replication protein Rep, coat protein and transport and/or ...
A virus has either a DNA or an RNA genome and is called a DNA virus or an RNA virus, respectively. The vast majority of viruses ... Viral genomes are circular, as in the polyomaviruses, or linear, as in the adenoviruses. The type of nucleic acid is irrelevant ... The escaped DNA could have come from plasmids (pieces of naked DNA that can move between cells) or transposons (molecules of ... DNA viruses The genome replication of most DNA viruses takes place in the cell's nucleus. If the cell has the appropriate ...
V. cholerae has two circular DNA. One DNA produces the cholera toxin (CT), a protein that causes profuse, watery diarrhea ( ... V. cholerae has two circular chromosomes, together totalling 4 million base pairs of DNA sequence and 3,885 predicted genes. ... and a conserved DNA binding protein that acts as a ratchet to reel DNA into the cytoplasm. There are two models of genetic ... V. cholerae contains a genomic island of pathogenicity and is lysogenized with phage DNA. That means that the genes of a virus ...
Circular. Segmented. Life cycle[edit]. Viral replication is nuclear. DNA-templated transcription is the method of transcription ... Polydnavirus DNA is Integrated in the DNA of Its Parasitoid Wasp Host-article from the Proceedings of the National Academy of ... Genomes are circular and segmented, composed of multiple segments of double-stranded, superhelical DNA packaged in capsid ... "Polydnavirus DNA is integrated in the DNA of its parasitoid wasp host". Proceedings of the National Academy of Sciences. 88 (21 ...
Pennisi, Elizabeth (2017-06-09). "Circular DNA throws biologists for a loop". Science. 356 (6342): 996. doi:10.1126/science. ... "Non-Chromosomal DNA Drives Tumor Evolution". The Scientist Magazine®. Retrieved 2019-02-01. Wu, Sihan; Turner, Kristen M.; ... Prior to 2017, extrachromosomal DNA was thought to be a rare, but interesting event in cancer (1.4% of tumors), of unclear ... Zimmer, Carl (2019-11-20). "Scientists Are Just Beginning to Understand Mysterious DNA Circles Common in Cancer Cells". The New ...
Circular No.03/2012, CBSE/ACAD/DIR (TRG)/2012 dated 11.04.2012 ). It is also available in Hindi, Bengali,Bhasa Indonesian and ... "Be unique: Dr APJ Abdul Kalam to youth , Latest News & Updates at Daily News & Analysis". dna. 18 January 2012. Retrieved 26 ... "Book Review: Junglezen Sheru , Latest News & Updates at Daily News & Analysis". dna. 25 May 2014. Retrieved 26 June 2017. "TOI ... Devgan, Kavita (25 May 2014). "Book Review: Junglezen Sheru". DNA India. Retrieved 3 January 2021. Samarpan. Living Hinduism : ...
Genomes are circular, around 6.1kb in length. Viral replication is cytoplasmic. Entry into the host cell is achieved by pilus- ... DNA-templated transcription is the method of transcription. The virus exits the host cell by bacteria lysis. Various species of ...
Topology and Physics of Circular DNA (First ed.). Boca Raton, FL. p. 49. ISBN 978-1138105058. OCLC 1014356603. Dennis, Mark R ... Ribbon theory is a strand of mathematics within topology that has seen particular application as regards DNA. Link is the ... Bollobás-Riordan polynomial Knots and graphs Knot theory DNA supercoil Möbius strip Adams, Colin (2004), The Knot Book: An ...
... es have a circular, single-stranded DNA genome. The genome is negative-sense. Postweaning multisystemic wasting ... DNA loads in serum of healthy and postweaning multisystemic wasting syndrome (PMWS) affected pigs" (PDF). Vet. Microbiol. 152 ( ...
Genomes are circular, around 190kb in length. The genome has 160 open reading frames. Viral replication is nuclear. DNA- ...
Bowden, DW; Modrich, P (Jun 10, 1985). "In vitro maturation of circular bacteriophage P2 DNA. Purification of ter components ... Phage P2 has a double stranded DNA genome packaged in an icosahedral capsid with a diameter of 60 nanometers that is connected ... Besides cox, the early operon contains two other genes which are essential for P2 DNA replication, genes A and B. Replication ... The genome of bacteriophage P2 is 33,592 bp of double-stranded, linear DNA with cohesive ends (accession number AF063097). The ...
Genomes are circular, around 130-160kb in length. The genome codes for 190 to 230 proteins. Viral replication is cytoplasmic. ... DNA-templated transcription is the method of transcription. Bacteria serve as the natural host. Transmission routes are passive ...
Genomes are circular, around 372kb in length. The genome has 457 open reading frames. Dna templated transcription is the method ... The genomes of these viruses are double-stranded DNA. Amoeba are often hosts, but there is evidence that they are found in ... It is a member of the nucleocytoplasmic large DNA viruses clade. Group: dsDNA Order: Pimascovirales Family: Marseilleviridae ...
Genomes are circular. DNA-templated transcription is the method of transcription. Aeropyrum pernix archaea serve as the natural ...
Genomes are circular. Viral replication is nuclear. DNA-templated transcription is the method of transcription. The virus exits ...
Genomes are circular, around 100kb in length. The genome codes for 100 proteins. Viral replication is cytoplasmic. Entry into ... DNA-templated transcription is the method of transcription. Bacteria serve as the natural host. Transmission routes are passive ...
Genomes are circular, around 124kb in length. The genome has 108 open reading frames. Viral replication is nuclear. DNA- ...
Genomes are circular, around 62kb in length. The genome has 72 open reading frames. Viral replication is cytoplasmic. Entry ... DNA-templated transcription is the method of transcription. Diverse species of hyperthermophilic archaea from the order ...
Genomes are circular, around 4.5kb in length. Viral replication is cytoplasmic. Entry into the host cell is achieved by pilus- ... Dna templated transcription is the method of transcription. The virus exits the host cell by bacteria lysis. Bdellovibrio ...
Genomes are circular, around 20kb in length. DNA-templated transcription is the method of transcription. Sulfolobus ...
The circular DNA sequence is 16,661 base pairs long. Within the order Odonata it is one of the largest mitogenomes to be ... Mitochondrial DNA Part B. 2 (2): 640-641. doi:10.1080/23802359.2017.1375879. Stoks, Robby; Janssens, Lizanne (2013). "Fitness ...
DNA templated transcription is the method of transcription. The virus exits the host cell by nuclear pore export, and tubule- ... Genomes are multipartite with 6 to 8 circular segments. Genome size is around 81 kb in totsl. Viral replication is nuclear. ...
Supercoiled circular DNA in crown gall inducing Agrobacterium strains. J. Mol. Biol. 86:109-27 Van Montagu, Marc (2011). "It is ...
Failure of the incoming DNA to form a circular molecule; Post-circularisation, the circular molecule is wrong for maintenance, ... The failure of incoming DNA to form circular molecules; 2. circularization takes place, but the circular molecule fails to take ... any DNA transfer from bacterial donor to recipients cells that fails to establish the incoming DNA as part of the hereditary ... Genes that are located on the corresponding part of the DNA can express in the recipient cells. Rieger, Michaelis, and Green, ...
All BPVs have a circular double-stranded DNA genome of 7.3-8.0 kb. The genetic organisation of those BPVs which have been ... All BPVs have a circular double-stranded DNA genome. Infection causes warts (papillomas and fibropapillomas) of the skin and ... Human papillomavirus DNA has been detected in around 18% of squamous cell carcinomas of the oesophagus, and there is an ... Bovine papillomaviruses (BPV) are a paraphyletic group of DNA viruses of the subfamily Firstpapillomavirinae of ...
Genomes are circular, around 20kb in length. The virons consist of a coat, a core, a nucleocapsid, and projecting fibers at the ... DNA-templated transcription is the method of transcription. Sulfolobus newzealandicus serve as the natural host. Prangishvili, ...
... s can be either linear or circular pieces of DNA. By minimizing the amount of unnecessary genetic information on ... The minimum constituent parts of a chromosome (centromere, telomeres, and DNA replication sequences) are assembled by using ... the chromosome and including the basic components necessary for DNA replication (centromere, telomeres, and replication ...
Genomes are circular and segmented, around 6.0-20kb in length. Viral replication is nuclear. DNA-templated transcription is the ...
The population of circular rDNA is decreased in embryos, indicative of the circular rDNA migrating to linear DNA, as was shown ... are extrachromosomal circular DNA (eccDNA), are self replicating sequences of ribosomal DNA (rDNA) found in a strain of yeast, ... Circular extrachromosomal DNA are not only found in yeast but other eukaryotic organisms. A regulated formation of eccDNA in ... ISBN 978-1-4020-6753-2. Cohen S, Yacobi K, Segal D (June 2003). "Extrachromosomal circular DNA of tandemly repeated genomic ...
Mavirus is a 19,000 kb circular double stranded DNA virus. Maviral infection reduces host cell death by interfering with CroV ... This is the most extensive DNA repair machinery that has yet been observed in a virus. It is also the first virus to be found ... CroV has one of the largest genomes of all marine viruses known, consisting of ~730,000 base pairs of double-stranded DNA. ... CroV is distantly related to Mimivirus and belongs to a group of viruses known as Nucleocytoplasmic large DNA viruses. CroV is ...
The genome of S. pneumoniae is a closed, circular DNA structure that contains between 2.0 and 2.1 million base pairs depending ... Competence in S. pneumoniae is induced by DNA-damaging agents such as mitomycin C, fluoroquinolone antibiotics (norfloxacin, ... The ability of S. pneumoniae to repair the oxidative DNA damages in its genome, caused by this host defense, likely contributes ... For a bacterium to bind, take up, and recombine exogenous DNA into its chromosome, it must enter a special physiological state ...
DNA studies also suggest an unknown degree of interbreeding between Homo sapiens sapiens and Homo sapiens denisova.[27] ... Evidence from canine DNA collected by Robert K. Wayne suggests that dogs may have been first domesticated in the late Middle ... Chimpanzees are the closest to humans genetically, sharing more than 96% of their DNA code with humans, and their digestive ...
... has long been thought to have a circular structure, but some evidence suggests that chloroplast DNA more ... DNA replicationEdit. Leading model of cpDNA replicationEdit. Chloroplast DNA replication via multiple D loop mechanisms. ... Chloroplast DNA Interactive gene map of chloroplast DNA from Nicotiana tabacum. Segments with labels on the inside reside on ... As in prokaryotes, genes in chloroplast DNA are organized into operons.[10] Introns are common in chloroplast DNA molecules, ...
The Caulobacter CB15 genome has 4,016,942 base pairs in a single circular chromosome encoding 3,767 genes.[7] The genome ... In Caulobacter cells, replication of the chromosome involves about 2 million DNA synthesis reactions for each arm of the ... "DnaA couples DNA replication and the expression of two cell cycle master regulators". The EMBO Journal. 25 (2): 346-56. doi ... The longest subsystem cascade is DNA replication. ...
The circular design, with walls coming out from the centre, created wedge shaped 'airing yards' where prisoners would be ... DNA testing also established another complete skull believed to be Kelly's was not in fact his.[18][20] ...
The examination of preserved museum specimens has found Borrelia DNA in an infected Ixodes ricinus tick from Germany that dates ... The host inflammatory response to the bacteria in the skin causes the characteristic circular EM lesion.[61] Neutrophils, ... Except for one study in Europe,[229] much of the data implicating lizards is based on DNA detection of the spirochete and has ... Polymerase chain reaction (PCR) tests for Lyme disease have also been developed to detect the genetic material (DNA) of the ...
This light cannot pass back through the circular polarizer because its chirality has changed (e.g. from right circular ... A circular polarizer laminated to a surface can be used to eliminate reflections.[14][15] The polarizer transmits light with ... one chirality ("handedness") of circular polarization. Light reflected from the surface after the polarizer is transformed into ...
Genomes are circular, around 8kb in length. Viral replication is nuclear. Entry into the host cell is achieved by attachment of ... Dna templated transcription, with some alternative splicing mechanism is the method of transcription. The virus exits the host ...
"Biochemical Method for Inserting New Genetic Information into DNA of Simian Virus 40: Circular SV40 DNA Molecules Containing ... 1993) A Hidden Markov Model that finds genes in E. coli DNA ... "The DNA sequence of human chromosome 22". Nature 402 (402). ... "DNA sequencing with chain-terminating inhibitors". Proceedings of National Academy of Sciences 74 (12). ... "Nucleotide sequence of bacteriophage λ DNA". Journal of Molecular Biology 162 (4). Arquivado dende o orixinal o 02 de decembro ...
The genome of MAP strain K-10 was sequenced in 2005 and found to consist of a single circular chromosome of 4,829,781 base ... "Mycobacterium paratuberculosis DNA in Crohn's disease tissue". Gut. 33 (7): 890-6. doi:10.1136/gut.33.7.890. PMC 1379400. PMID ...
Cylindrospermopsin is toxic to liver and kidney tissue and is thought to inhibit protein synthesis and to covalently modify DNA ... In a cyclic peptide, the ends link to form a stable circular chain. In mammals this stability makes them resistant to the ...
For example, thermostable DNA polymerases, such as the Pfu DNA polymerase from Pyrococcus furiosus, revolutionized molecular ... Circular chromosomes, similar translation and transcription to Eukarya. Circular chromosomes, unique translation and ... Archaea usually have a single circular chromosome,[129] with as many as 5,751,492 base pairs in Methanosarcina acetivorans,[130 ... 2011). "UV-inducible DNA exchange in hyperthermophilic archaea mediated by type IV pili". Mol Microbiol. 82 (4): 807-17. doi: ...
... spans about 90 million base pairs (the building material of DNA) and represents just under 3% of the total DNA in ... Circular chromosome/Linear chromosome. *Extra chromosome (or accessory chromosome). *Supernumerary chromosome. *A chromosome/B ...
DNA damage[edit]. Marking sites of DNA damage is an important function for histone modifications. It also protects DNA from ... Circular chromosome/Linear chromosome. *Extra chromosome (or accessory chromosome). *Supernumerary chromosome. *A chromosome/B ... Compacting DNA strands[edit]. Histones act as spools around which DNA winds. This enables the compaction necessary to fit the ... Farkas D (1996). DNA simplified: the hitchhiker's guide to DNA. Washington, D.C: AACC Press. ISBN 978-0-915274-84-0. .. ...
They are composed of a C-terminal ligand-binding region, a core DNA-binding domain (DBD) and an N-terminal domain that contains ... circular dichroism, and dual polarisation interferometry. Computer simulations of the dynamic behavior of receptors have been ... The core region has two zinc fingers that are responsible for recognizing the DNA sequences specific to this receptor. The N ...
"DNA India. 2 May 2015.. *^ "外務省: ご案内- ご利用のページが見つかりません" (PDF). www.mofa.go.jp.. ... Mahdi Elmandjra, 1986[158][circular reference]. *Percival Hall-Thompson (
"Ancient DNA may reveal origin of the Philistines". 3 July 2019.. *^ "Remains of Minoan fresco found at Tel Kabri"; "Remains Of ... In the floor of the hall is a circular hearth paved with pebbles, as is typical in Mycenaean megaron hall buildings; other ... DNA was extracted from the skeletons for archaeogenetic population analysis.[83] The Leon Levy Expedition, which has been going ... "Ancient DNA reveals the roots of the Biblical Philistines". Nature. 571 (7764): 149. 4 July 2019. doi:10.1038/d41586-019-02081- ...
Another version with a variable perimeter working zone is the circular trough in which the monolayer is located between two ... 2002). DNA-Modified nanocrystalline diamond thin-films as stable, biologically active substrates. Nature Materials, 1(4), 253-7 ...
The specific DNA sequence in the MCM6 gene helps control whether the LCT gene is turned on or off.[19] At least several ... circular reference] ... DNA analysis in February 2012 revealed that Ötzi was lactose ... The accumulation of epigenetic factors, primarily DNA methylation, in the extended LCT region, including the gene enhancer ... The procedure consists of extracting and amplifying DNA from the sample, following with a hybridation protocol in a strip. ...
http://www.merck.com/product/usa/pi_circulars/p/pneumovax_23/pneumovax_pi.pdf ... DNA vaccination. *Inactivated vaccine. *Live vector vaccine *Attenuated vaccine. *Heterologous vaccine. *Subunit/component / ...
Circular chromosome/Linear chromosome. *Extra chromosome (or accessory chromosome). *Supernumerary chromosome. *A chromosome/B ... Extrachromosomal DNA *Plasmid. *List of organisms by chromosome count. *List of chromosome lengths for various organisms ...
Xenoma circular ADN asociado con histonas[50][51] Membrana celular que contén lípidos con enlace éter ... Rosenshine I, Tchelet R, Mevarech M. (1989). "The mechanism of DNA transfer in the mating system of an archaebacterium". ... As arqueas xeralmente teñen un só cromosoma circular,[119] cun tamaño que vai desde 5.751.492 pares de bases en Methanosarcina ... "UV-inducible DNA exchange in hyperthermophilic archaea mediated by type IV pili". Mol Microbiol (82(4)): 807-17. PMID 21999488 ...
... of the technique of homologous recombination of transgenic DNA with genomic DNA, a much more reliable method of altering animal ... all of them are circular! You can never find a final cause, since you must always ask one question more: "What caused that ... He won the Nobel Prize in Physiology or Medicine in 1993 for the discovery of introns in eukaryotic DNA and the mechanism of ... Nadrian Seeman (1945-): American nanotechnologist and crystallographer known for inventing the field of DNA nanotechnology.[316 ...
Main articles: RNA and DNA. The major difference between RNA and DNA is the presence of a hydroxyl group at the 2'-position of ... circular structure, which assures complete replication without genomic tags;. *structural periodicity, which permits modular ... This forces an RNA double helix to change from a B-DNA structure to one more closely resembling A-DNA. ... DNA and proteins seemed the dominant macromolecules in the living cell, with RNA only aiding in creating proteins from the DNA ...
As described in the applications section, spectrophotometry can be used in both qualitative and quantitative analysis of DNA, ... Circular dichroism spectroscopy. *Coherent anti-Stokes Raman spectroscopy. *Cold vapour atomic fluorescence spectroscopy ... Spectrophotometry is an important technique used in many biochemical experiments that involve DNA, RNA, and protein isolation, ...
"Biochemical method for inserting new genetic information into DNA of Simian Virus 40: circular SV40 DNA molecules containing ... DNA baru diperoleh dengan mengisolasi dan menyalin materi genetik dari induk menggunakan metode DNA rekombinan atau sintesa DNA ... "Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA". ... Molekul DNA rekombinan pertama dibuat oleh Paul Berg pada tahun 1972 dengan menggabungkan DNA virus monyet SV40 dengan virus ...
In the 2003 PBS programme African American Lives, Bishop T.D. Jakes had his DNA analyzed; his Y chromosome showed[dubious - ... Circular stacks continued, till it reached the top. The structures were temples for the god Ala/Uto, who was believed to reside ...
Genomes are circular, around 3.2kb in length. The genome codes for 7 proteins. Viral replication is nucleo-cytoplasmic. ... Dna templated transcription, specifically dsdna(rt) transcription, with some alternative splicing mechanism is the method of ...
doi:10.1089/dna.1986.5.315. PMID 3755672.. *^ Sparkes RS, Simon M, Cohn VH, Fournier RE, Lem J, Klisak I, Heinzmann C, Blatt C ... Circular dichroism shows that normal PrPC has 43% alpha helical and 3% beta sheet content, whereas PrPSc is only 30% alpha ... negative regulation of sequence-specific DNA binding transcription factor activity. • negative regulation of T cell receptor ...
... double-stranded DNA). It may be between 5 and 500 kilo base pairs long with either circular or linear arrangement. ... DNA does not leave the nucleus for various reasons. DNA is a very long molecule, and is bound in with proteins, called histones ... This is done by messenger RNA (mRNA). A single strand of DNA is the blueprint for the mRNA which is transcribed from that DNA ... Retrotransposons copy themselves in two stages: first from DNA to RNA by transcription, then from RNA back to DNA by reverse ...
... technique for finding unknown DNA flanking known DNA Effect of circular DNA on gel electrophoresis Cyclic nucleotide Cyclic ... Circular DNA is DNA that forms a closed loop and has no ends. Examples include: Plasmids, mobile genetic elements cccDNA, ... Chloroplast DNA (cpDNA), and that of other plastids Extrachromosomal circular DNA (eccDNA) Inverse polymerase chain reaction ( ... Circular RNA Cyclic peptide This disambiguation page lists articles associated with the title Circular DNA. If an internal link ...
Extrachromosomal circular DNA (eccDNA) are circular DNA found in human, plant and animal cells in addition to chromosomal DNA. ... The circular shape of ecDNA differs from the linear structure of chromosomal DNA in meaningful ways that influence cancer ... "Circular DNA Throws Gene Regulation for a Loop". Cancer Discovery. 10 (2): 170. February 2020. doi:10.1158/2159-8290.CD-ND2019- ... Unlike typical chromosomes, they are composed of circular fragments of DNA, up to only a few million base pairs in size and ...
Make research projects and school reports about Circular DNA easy with credible articles from our FREE, online encyclopedia and ... and pictures about Circular DNA at Encyclopedia.com. ... see also DNA; DNA databanks; DNA fingerprint; DNA mixtures, ... replicative DNA polymerase,. DNA polymerase III. DNA polymerase δ (two subunits). proofreading exonuclease. DNA polymerase ε ( ... One required function of DNA polymerase σ is the synthesis of the RNA primers for DNA synthesis. The precise role of DNA ...
Cancer development is associated with the gradual accumulation of DNA defects over time. Thus, cancer is considered an age- ... DNA sequencing also revealed the process by which specific DNA sections separate from a chromosome to form circular DNA before ... DNA, DNA Damage, DNA Sequencing, Genetic, Genetic Information, Genetics, Genome, Hematology, Medicine, Neuroblastoma, Oncology ... now reveal that mysterious rings of DNA known as extrachromosomal circular DNA can contribute to cancer development in children ...
... circular DNA template which lacks an RNA polymerase promoter sequence. The RNA synthesis is performed by combining a circular ... The present invention provides methods for synthesis and therapeutic use of DNA and RNA oligonucleotides and analogs. RNA ... DNA control, 100 ng circular DNA and 1 μg of cellular DNA; DNA, DNA alone (without transfection reagent); untransfected cell, ... Circular DNA vectors for synthesis of RNA and DNA. US6368802. May 11, 2000. Apr 9, 2002. University Of Rochester. Circular DNA ...
These circular RNAs are formed from the intron regions inside a gene that were once thought to be nothing but junk DNA.1 ... A recent news story emerged regarding sequencing ancient human DNA found in bones thought to be about 4,000 years old. The DNA ... Tomkins, J. Circular RNAs Increase Cell Bio-Complexity. Creation Science Update. Posted on icr.org April 5, 2013, accessed ... Circular Intronic Long Noncoding RNAs. Molecular Cell. 51: 792-806.. * Yang, L. et al. 2011. Genomewide characterization of non ...
The vast majority of the molecules are circular, with the remaining molecules being in the linear form, as determined by ... The M13mp18 Single-Stranded DNA is a circular molecule, purified from the M13mp18 phage. ... FAQ: Is the M13mp18 Single-Stranded DNA (N4040S) circular or linear?. The M13mp18 Single-Stranded DNA is a circular molecule, ... Home FAQs Is the M13mp18 Single-Stranded DNA (N4040S) circular or linear? ...
In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid ( ... Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single ... stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other ... than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a ...
The present invention provides a circular dumbbell oligodeoxynucleotide (CDODN) comprising two loop structures and a stem ... In either a linear or circular DNA molecule, discrete elements are referred to as being "upstream" or 5′ of the "downstream" or ... In brief, the DNA probes such as AP-1 and mismatched decoy ODN were labeled as primers. The protein-DNA binding reaction was ... In brief, the DNA probes such as those for E2F and mutated ODN were labeled as primers using [γ-32P]ATP and T4 polynucleotide ...
... on Shapeways. Learn more before you buy, or discover other cool products ... Order an awesome pair of earrings for your geeky/bio friends! DNA plasmid! ...
... as well as circular DNA allow the study of these molecules in vitro and in vivo. Improvements in DNA and RNA oligonucleotide ... synthesis methods enabled the production of long single-stranded DNA (ssDNA) and circular DNA, such as catenanes, chain-like ... Synthetic long single-stranded and circular DNA. Synthetic long single-stranded DNA (ssDNA) as well as circular DNA allow ... DNA catenanes are topoisomers of circular DNA molecules. Two or more DNA rings held together noncovalently such that one DNA ...
DNA may undergo conformational changes to B-form, A-form, Z-form, quadruplexes, triplexes and other structures as a result of ... Here we review the recent CD spectroscopic studies of the induction of DNA conformational changes by different ligands, which ... These studies show that CD spectroscopy is a powerful technique to monitor DNA conformational changes resulting from drug ... Circular dichroism (CD) spectroscopy is an optical technique that measures the difference in the absorption of left and right ...
Circular DNA Plasmid in the Phytopathogenic Fungus Alternaria alternata: Its Temperature-Dependent Curing and Association with ... Circular DNA Plasmid in the Phytopathogenic Fungus Alternaria alternata: Its Temperature-Dependent Curing and Association with ... Circular DNA Plasmid in the Phytopathogenic Fungus Alternaria alternata: Its Temperature-Dependent Curing and Association with ... Circular DNA Plasmid in the Phytopathogenic Fungus Alternaria alternata: Its Temperature-Dependent Curing and Association with ...
This paper presents a sensitive method called Circle-Seq for purifying extrachromosomal circular DNA (eccDNA). The method ... Several circular DNA purification techniques exploit the structural differences between chromosomes and circular DNA. For ... ø29 polymerase enriched for circular DNA over linear DNA. Most linear chromosomal DNA was removed from samples after 29 hr ... Repeated findings of ASP3-1, COS111, CUP1, RSC30, HXT6, HXT7 genes on circular DNA in both S288c and CEN.PK suggests that DNA ...
Topology and Physics of Circular DNA (1992) von Alexander Vologodskii - Englische E-Books aus der Kategorie Medizin günstig bei ... CIRCULAR DNA AND SUPERCOILING. THE CIRCULAR FORM OF DNA. The Discovery of Circular DNA. The Topological Aspect of Inter-Strand ... KINETICS OF THE FORMATION OF NONCANONICAL STRUCTURES IN CIRCULAR DNA. THE USE OF CIRCULAR DNA IN STUDIES OF THE DOUBLE HELIX ... Topology and Physics of Circular DNA presents comprehensive coverage of the physical properties of circular DNA. The author ...
Hepadnavirus envelope proteins regulate covalently closed circular DNA amplification.. J Summers, P M Smith, A L Horwich ... Hepadnavirus envelope proteins regulate covalently closed circular DNA amplification. Message Subject (Your Name) has forwarded ... Cells infected by this mutant accumulated higher levels of viral covalently closed, circular DNA (cccDNA) than those infected ... duck hepatocytes were infected with a mutant duck hepatitis B virus defective in envelope protein but competent for viral DNA ...
To the Editor: Circular replication initiation protein (Rep)-encoding single-stranded DNA (ssDNA) (CRESS-DNA) genomes are found ... Phan TG, Mori D, Deng X, Rajindrajith S, Ranawaka U, Fan Ng TF, Small circular single stranded DNA viral genomes in unexplained ... Novel Single-Stranded DNA Circular Viruses in Pericardial Fluid of Patient with Recurrent Pericarditis On This Page ... Novel Single-Stranded DNA Circular Viruses in Pericardial Fluid of Patient with Recurrent Pericarditis. Emerging Infectious ...
60 APPLIED LIFE SCIENCES; COVALENCE; DNA; DNA REPLICATION; DUCKS; HEPATITIS; LIVER; MITOSIS; NUCLEOSIDES; PLANT GROWTH; RNA; ... Title: Duck hepatitis B virus covalently closed circular DNA appears to survive hepatocyte mitosis in the growing liver ... Journal Article: Duck hepatitis B virus covalently closed circular DNA appears to survive hepatocyte mitosis in the growing ... Highlights: • The hepatitis B virus nuclear template is covalently closed circular DNA (cccDNA). • cccDNA was studied during ...
Specifically, we show that levels of integrated HIV DNA are much lower in elite suppressors compared to other patients on and ... We conclude that measuring integration of HIV DNA in patient samples may provide a surrogate measure of viral burden in these ... We show that 2-LTR circles, comprised of DNA that is replication incompetent, are much more common in elite suppressors. Thus, ... Here we show that measuring the level of integrated HIV DNA in this patient population provides valuable information regarding ...
Notify me of updates to Investigation of Radiation-Induced Damages in DNA Structure by Circular Dichroism and UV Absorption ... Investigation of Radiation-Induced Damages in DNA Structure by Circular Dichroism and UV Absorption Spectroscopy pp. 301-320. $ ... We attempted to segregate the described damages in DNA structure and studied the influence of DNA ionic surroundings on the ... secondary structure of irradiated DNA is destabilized stronger in MgCl2 solutions. Also we have investigated the DNA spectral ...
Complete Genome Sequence of a New Circular DNA Virus from Grapevine. Björn Krenz, Jeremy R. Thompson, Marc Fuchs, Keith L. ... Complete Genome Sequence of a New Circular DNA Virus from Grapevine. Björn Krenz, Jeremy R. Thompson, Marc Fuchs, Keith L. ... Complete Genome Sequence of a New Circular DNA Virus from Grapevine. Björn Krenz, Jeremy R. Thompson, Marc Fuchs, Keith L. ... Complete Genome Sequence of a New Circular DNA Virus from Grapevine Message Subject (Your Name) has forwarded a page to you ...
Mutations in mitochondrial DNA (mtDNA) have been an essential cause of numerous diseases, making their identification ... Bis-PNA Gamma-PNA Mitochondrial DNA Circular double-stranded DNA Electrokinetic sensor ... A rapid bioanalytical tool for detection of sequence-specific circular DNA and mitochondrial DNA point mutations. ... The probes are capable of invading the double-stranded circular DNA and forming a stable triplex structure. Thus, this method ...
However, some DNA molecules are circular, which you can imagine creating by taking a linear strand of DNA and joining the end ... The use of circular DNA in the lab brings up an interesting computational problem though, which is how to store it in the ... These circular DNA molecules are called plasmids and are usually hundreds or thousands of base pairs long. They are most ... We wanted to do the same for circular DNA, but then the question arose, which rotation of the string do we store a hash for? An ...
1] that underwound DNA mini-rings migrate slower than overwound DNA mini-rings in EDTA solution. Motivated with the novel ... It gives a model of a supercoiled DNA mini-ring consisting of DNA double strands. Here, the topology of the whole molecule such ... as the linking number (Lk) of the double DNA strands is conserved in time. By introducing the bending rigidity, we have found ... suggest that the numerical observations should explain the different migration sppeds between the underwound and overwound DNA ...
In this work we use absorbance, circular dichroism (CD), and two Ultrafast photoinduced energy and charge transfer ... The sugar-phosphate backbone of DNA near single-stranded (ss)-double-stranded (ds) junctions likely fluctuates within a broad ... Measuring local conformations and conformational disorder of (Cy3)2 dimer labeled DNA fork junctions using absorbance, circular ... Measuring local conformations and conformational disorder of (Cy3)2 dimer labeled DNA fork junctions using absorbance, circular ...
... circular DNA (cDNA) has been used to fabricate an intracellular mRNA sensing platform. cDNA has turned out to be a good option ... Circular DNA: a stable probe for highly efficient mRNA imaging and gene therapy in living cells J. Li, J. Zhou, T. Liu, S. Chen ... Circular DNA: a stable probe for highly efficient mRNA imaging and gene therapy in living cells ... Due to its high nuclease resistance and improved stability in biological fluids, circular DNA (cDNA) has been used to fabricate ...
Circular and linear plasmids of Lyme disease spirochetes have extensive homology: characterization of a repeated DNA element.. ... Circular and linear plasmids of Lyme disease spirochetes have extensive homology: characterization of a repeated DNA element. ... Circular and linear plasmids of Lyme disease spirochetes have extensive homology: characterization of a repeated DNA element. ... Circular and linear plasmids of Lyme disease spirochetes have extensive homology: characterization of a repeated DNA element. ...
Visualization of circular plasmid DNA unwinding using immobilized PcrA. Cy3B-bioPcrA was used together with RepD and 3094-bp ... By tethering either DNA or PcrA to a microscope coverslip surface, unwinding of both linear and natural circular plasmid DNA by ... By tethering either DNA or PcrA to a microscope coverslip surface, unwinding of both linear and natural circular plasmid DNA by ... gkt194-F7: Visualization of circular plasmid DNA unwinding using immobilized PcrA. Cy3B-bioPcrA was used together with RepD and ...
The results in this study provide information that can be used to improve electrophoretic separations of circular DNA, an ... circular DNA was investigated using microscopic measurements of individual molecules stained with a fluorescent dye. Three open ... The velocity and average length of the 52.5 kbp open circles and 48.5 kbp linear DNA were measured during electrophoresis in ... The velocity increased when the agarose concentrations were lowered, but the average length of the open-circle DNA (during ...
Circular dichroism spectroscopy. Circular dichroism (CD) spectroscopy of 1.5 µM ml 1 DNA strand concentration in 100 mMl 1 ... Circular dichroism. Circular dichroism spectra revealed that the network made up of oligomers C+D showed more helicity (15 m°) ... The DNA strand concentration was 1.5 µM ml 1 and oligonucleotides were dissolved in 100 mMl 1 sodium chloride, 5 mMl 1 ... Native PAGE was performed with samples at a DNA strand concentration of 1 µM ml 1, pre-heated to 80°C, and incubated at room ...
  • The ecDNA chromatin architecture lacks the higher-order compaction that is present on chromosomal DNA and is among the most accessible DNA in the entire cancer genome. (wikipedia.org)
  • Before a cell divides, DNA must be precisely copied, or "replicated," so that each of the two daughter cells can inherit a complete genome, the full set of genes present in the organism. (encyclopedia.com)
  • In eukaryotes , the DNA molecules that make up the genome are packaged with proteins into chromosomes, each of which contains a single linear DNA molecule. (encyclopedia.com)
  • Single-stranded DNA (ssDNA) occurs naturally as a transient intermediate during genome maintenance processes. (biosyn.com)
  • Genome maintenance is vital during DNA replication, repair, and recombination. (biosyn.com)
  • This genome displayed a typical GcV architecture, with a 2,264-nt circular DNA molecule carrying a capsid gene on 1 strand and 2 genes on the opposite strand, which coded for Rep1 (involved in replication initiation) and Rep2 (involved in replication termination), respectively. (cdc.gov)
  • Geminiviruses are plant viruses with geminate icosahedral particles and a circular single-stranded DNA genome, among other features. (asm.org)
  • The sugar-phosphate backbone of DNA near single-stranded (ss)-double-stranded (ds) junctions likely fluctuates within a broad distribution of conformations to permit the proper binding of genome regulatory proteins that function at these sites. (rsc.org)
  • TWINKLE adopts a hexameric ring-shaped structure that must load on the closed circular mtDNA genome. (nih.gov)
  • The viral relaxed circular (rc) DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc) DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. (physiciansweekly.com)
  • The paper, Rapid Amplification of Plasmid and Phage DNA Using Phi29 DNA Polymerase and Multiply-Primed Rolling Circle Amplification, published in the June issue of Genome Research 11:1095-1099, describes a rapid, scalable method for the amplification of circular DNA directly from bacterial cells or from viral plaques, generating high quality templates for use in DNA sequencing, probe generation or cloning. (freethesaurus.com)
  • Papillomaviruses are nonenveloped DNA viruses 55 nm in diameter with an icosahedral capsid enclosing a double-stranded, circular DNA genome of 7,900 base pairs. (freethesaurus.com)
  • The replication of HBV involves the production of covalently closed circular DNA (cccDNA) from the HBV genome through the repair of virion relaxed circular DNA (rcDNA) in the virion. (biomedcentral.com)
  • DNA-restructuring activities of RecQ-family helicases play key roles in genome maintenance. (nature.com)
  • Papillomaviruses are small and complex viruses with circular DNA genome that belongs to the Papillomavirus family, which comprises at least 39 genera. (usda.gov)
  • Circularization of genomic DNA is observed across eukaryotic species, in a range of different cell types, and from all parts of the genome. (usda.gov)
  • Another commented, "It basically opens a new field and a new way of thinking about DNA and about how dynamic the genome is . (evolutionnews.org)
  • The viral genomes were related in size and genome organization to vertebrate circoviruses and plant geminiviruses but with a different location for the stem-loop structure involved in rolling circle DNA replication. (umn.edu)
  • Most DNA in an individual genome is found in chromosomes but DNA found outside the nucleus also serves important biological functions. (wikipedia.org)
  • Two of the other three nonstructural proteins, E1 and E2, are involved in DNA replication and transcription of the viral genome. (health-e-nc.org)
  • Accurate DNA segregation is essential for genome transmission. (pubmedcentralcanada.ca)
  • Extrachromosomal circular DNA (eccDNA) are circular DNA found in human, plant and animal cells in addition to chromosomal DNA. (wikipedia.org)
  • An international team of researchers, led by Charité - Universitätsmedizin Berlin and the Memorial Sloan Kettering Cancer Center in New York, now reveal that mysterious rings of DNA known as extrachromosomal circular DNA can contribute to cancer development in children. (news-medical.net)
  • It is for this reason that they are referred to as extrachromosomal circular DNA. (news-medical.net)
  • This paper presents a sensitive method called Circle-Seq for purifying extrachromosomal circular DNA (eccDNA). (jove.com)
  • Previously, we observed the presence of small extrachromosomal circular DNA (eccDNA), called microDNA, in the nuclei of mammalian tissues and cell lines. (aacrjournals.org)
  • London, Dec 17 (PTI) Mysterious rings of DNA -- known as extrachromosomal circular DNA -- may contribute to cancer development in children, according to a study which may lead to better diagnosis methods for pediatric cancer. (yahoo.com)
  • Not to be confused with bacterial chromosomes, which are often circular, nor with circular RNA transcripts, these circular DNA loops, formally called "extrachromosomal circular DNA" or eccDNA, are just now coming to the attention of molecular biologists. (evolutionnews.org)
  • But another population of DNA, called extrachromosomal circular DNA, is shaped like a circle, with no loose ends, and exists independently of linear DNA. (hotstarshop.com)
  • Do sieve tube cells have any extrachromosomal circular DNA at maturity? (stackexchange.com)
  • Sieve tube cells have mitochondrial extrachromosomal DNA at maturity, but I'm not sure about the existence of extrachromosomal circular DNA in these circumstances. (stackexchange.com)
  • DNA plasmid! (shapeways.com)
  • We found the presence of plasmid DNA in strain T88-56 of the Japanese pear pathotype of Alternaria alternata , which causes black spot of certain cultivars of Japanese pear by producing host-specific AK-toxin. (genetics.org)
  • The plasmid, designated pAAT56, was identified to be an ∼5.4-kilobase (kb) circular molecule by electron microscopic observation and restriction endonuclease mapping. (genetics.org)
  • Herein, we developed a sensitive PCR-free electrokinetic-based sensor combined with a customized bis-peptide nucleic acid (bis-PNA) and gamma-PNA (γ-PNA) probes immobilized on beads, for the detection of mtDNA point mutations and sequence-specific supercoiled plasmid DNA at the picomolar range. (springer.com)
  • ORF-A, ORF-B, and ORF-D are homologous to three ORFs on a recently described 8.3-kb circular plasmid of Borrelia afzelii Ip21 that are flanked by similar IRs (J. J. Dunn, S. R. Buchstein, L.-L. Butler, S. Fisenne, D. S. Polin, B. N. Lade, and B. J. Luft, J. Bacteriol. (asm.org)
  • Monomeric PcrA helicase processively unwinds plasmid lengths of DNA in the presence of the initiator protein RepD. (nih.gov)
  • By tethering either DNA or PcrA to a microscope coverslip surface, unwinding of both linear and natural circular plasmid DNA by PcrA/RepD was followed in real-time using total internal reflection fluorescence microscopy. (nih.gov)
  • The single-molecule data show that PcrA, in combination with RepD, can unwind plasmid lengths of DNA in a single run, and that PcrA is active as a monomer. (nih.gov)
  • Visualization of circular plasmid DNA unwinding using immobilized PcrA. (nih.gov)
  • The F-plasmid encodes, amongst other things, for the F-pilus protein pilin , that allows the formation of the pilus necessary for DNA transfer. (stackexchange.com)
  • Two examples demonstrate the application of this technique: mapping of a gene-specific ~6 kb plasmid onto an unusually small, ~55 kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-κB2 locus. (biomedcentral.com)
  • plasmid using EcoRI-PvuI (New Britain Biolabs) [16 17 Briefly HepG2 cells were seeded at a density of 2-3 mil cells in 100-mm-diameter Petri dishes and transfected twenty four hours later with 0.5 μg to at least one 1 μg of digested HBV DNA. (cura-cancer.com)
  • Circular bacterial plasmids are classified according to the special functions that the genes encoded on the plasmid provide. (wikipedia.org)
  • Plasmid DNA vaccines are genetically engineered to contain a gene which encodes for an antigen or a protein produced by a pathogenic virus, bacterium or other parasite. (wikipedia.org)
  • Addgene: Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. (addgene.org)
  • We propose the name NUPAVs (nuclear sequences of plasmid and viral origin) for these objects, by analogy to NUMTs (nuclear copies of mitochondrial DNA) and NUPTs (nuclear copies of plastid DNA, in plants) of organellar origin. (asm.org)
  • We propose that this region was formed by the capture of plasmid and viral sequences by the same mechanism that captures mitochondrial DNA to form NUMTs ( 43 , 65 ). (asm.org)
  • 59 ) reported the sequences of two regions of nuclear DNA from Zygosaccharomyces rouxii that were highly similar to parts of the 2μm-like plasmid pSR1 from that species, but rearranged. (asm.org)
  • Among these, 105 strains had a double-stranded RNA (dsRNA), 28 had a linear dsDNA plasmid, and 53 had a circular DNA plasmid of the 2μm family. (asm.org)
  • 37 ) surveyed 70 "wild" strains of Saccharomyces (mostly S. cerevisiae ) for the presence of five extrachromosomal elements (2μm DNA plasmid, L-A and L-BC helper RNA viruses, and W and T RNA entities) and found each element to be present in between 1 and 38 of the strains, with 1 strain even containing all five elements simultaneously. (asm.org)
  • Indeed, structural information is only available for two type Ia plasmid CBPs, P1 ParB and RP4 KorB, and their complexes with DNA ( 14-17 ). (pubmedcentralcanada.ca)
  • The plasmid pE10 is a pBR322-derived plasmid carrying a 4.5 kb rice (Oryza sativa L.) repeated DNA sequence. (unipv.it)
  • 167422 FT /organism="Burkholderia multivorans ATCC 17616" FT /plasmid="pBMUL01" FT /strain="ATCC 17616" FT /mol_type="genomic DNA" FT /db_xref="taxon:395019" FT gene complement(2. (univ-lyon1.fr)
  • E2348/69" FT /plasmid="pMAR2" FT /strain="E2348/69" FT /serotype="O127:H6" FT /mol_type="genomic DNA" FT /db_xref="taxon:574521" FT CDS _ pept 275. (univ-lyon1.fr)
  • The M13mp18 Single-Stranded DNA is a circular molecule, purified from the M13mp18 phage. (neb.com)
  • It is well known that ionizing radiation causes modification and destruction of nitrogenous bases in DNA molecule. (novapublishers.com)
  • Here, the topology of the whole molecule such as the linking number (Lk) of the double DNA strands is conserved in time. (newton.ac.uk)
  • Cole, K., Gaigalas, A. och Åkerman, B. (2006) Single-molecule measurements of trapped and migrating circular DNA during electrophoresis in agarose gels . (chalmers.se)
  • CIRCLING LUPUS A three-dimensional image of a circular RNA reveals several places where the normally single-stranded molecule forms double strands. (sciencenews.org)
  • A team of Israeli and German scientists have discovered a protein-encoding function for circular RNA - a kind of molecule that is highly active in brain cells and could play an important role in aging and neurodegenerative diseases. (jpost.com)
  • Unlike all other known RNA, this molecule forms a closed loop, and, therefore, was labeled circular RNAs (circRNAs). (jpost.com)
  • The circular DNA architecture facilitates the integration of multiple functional elements into a single molecule: Aptameric target recognition, nucleic acid hybridization specificity and rolling circle amplification. (edu.au)
  • Specifically, we use fluorescence microscopy and custom single-molecule tracking algorithms to measure center-of-mass transport and time-varying conformational changes of single DNA molecules diffusing in in vitro composite networks of actin and microtubules. (aps.org)
  • Small Molecule Binding to DNA. (wiley.com)
  • One of those Cas genes is fused to a reverse transcriptase, an enzyme that uses an RNA molecule to produce DNA encoding the same information - in other words, it transcribes RNA back into DNA. (nanowerk.com)
  • The linear plasmids of prokarykotes are found either containing a hairpin loop or a covalently bonded protein attached to the telomeric ends of the DNA molecule. (wikipedia.org)
  • 1. A method of enzymatically ligating DNA substrates comprising intermolecularly ligating between ends of said substrate or intramolecularly ligating two ends of one DNA molecule by a DNA ligase in the presence of a sufficiently high concentration of a non-specific, volume-excluding polymer which does not specifically interact with the DNA substrate, the DNA ligase or the DNA product, to obtain an increased ligation rate. (google.es)
  • A repeated chromosomal DNA sequence is amplified as a circular extrachromosomal molecule in rice (Oryza sativa L. (unipv.it)
  • In fact, pE10 hybridizes exclusively with unfractionated DNA from leaf protoplasts, while it recognizes predominantly an extrachromosomal DNA molecule (ECD) of about 45 kb and its multiples in the case of protoplasts from cultured cells. (unipv.it)
  • Insensitivity to the action of the exonuclease Bal31 suggests that the molecule is circular. (unipv.it)
  • abstract = "The amount of breakage induced by bleomycin in closed-circular DNA from bacteriophage PM2 was investigated under various reaction conditions. (elsevier.com)
  • abstract = "Multivalent circular aptamers or 'captamers' have recently been introduced through the merger of aptameric recognition functions with the basic principles of DNA nanotechnology. (edu.au)
  • Unlike typical chromosomes, they are composed of circular fragments of DNA, up to only a few million base pairs in size and contain no centromere or telomere. (wikipedia.org)
  • ecDNA are thought to be produced through double-strand breaks in chromosomes or over replication of DNA in an organism. (wikipedia.org)
  • Chromosomes are threadlike structures of DNA and protein found in the nucleus of most living cells, and carry genetic information in the form of genes. (yahoo.com)
  • The current study, published in the journal Nature Genetics, probed into enigmatic rings of DNA that is not present in the chromosomes. (yahoo.com)
  • For decades biologists have known of mysterious rings of DNA in the nuclei of some human cells , interspersed among the linear chromosomes. (evolutionnews.org)
  • The DNA molecules that make up the genes and chromosomes in our cells are rope-like strands, free at both ends and shaped like a twisted ladder, or helix. (hotstarshop.com)
  • The DNA sequence of this element is related to a 29 bp repeat present in the subtelomeric region of VSG-bearing chromosomes of T. brucei. (cgiar.org)
  • Vibrio cholerae is known to have two circular chromosomes. (stackexchange.com)
  • Circular DNA also circumvents the Hayflick limit (thus allowing it to be "immortal"), which is the number of times a cell population can divide before it stops, presumably due to the shortening of telomeres , the sequences at the end of the chromosomes. (stackexchange.com)
  • The replicase genes of these viruses were most closely related to those of the much smaller (∼1 kb) plant nanovirus circular DNA chromosomes. (umn.edu)
  • In fact, many other types of regulatory RNAs are also coded into the same DNA space on chromosomes as the protein-coding genes themselves. (icr.org)
  • Eukaryotic DNAs each contain multiple replication origins, spaced at intervals of approximately 100,000 base pairs (100 kilobase pairs, or 100 kb) along the length of the DNA. (encyclopedia.com)
  • The generation of circular DNAs is a relatively unrecognized type of genomic structural variation, but recent findings point to a possible role of circular DNAs in the movement of transposable elements. (usda.gov)
  • The study, published online recently in the journal G3: Genes, Genomes and Genetics , found that different cell varieties harbor different sets of circular DNAs. (hotstarshop.com)
  • Tissue-specific and age-related variations in repetitive sequences of mouse extrachromosomal circular DNAs. (biomedsearch.com)
  • The presented graphical representation is available for visualizing characterizations of a single DNA sequence and identifying similarities and differences among several DNAs. (hindawi.com)
  • Chloroplast DNAs are circular, and are typically 120,000-170,000 base pairs long. (wikipedia.org)
  • It was also confirmed that the sequences of cytoplasmic DNA was different from nuclear DNA in the same organism, showing that cytoplasmic DNAs are not simply fragments of nuclear DNA. (wikipedia.org)
  • The first step is a change in the conformation of the initiator protein, which causes limited "melting" (that is, the separation of the two strands) of the double-stranded DNA next to the initiator binding site, thus exposing single-stranded regions of the template (Figure 1). (encyclopedia.com)
  • The separation of the two template strands and the synthesis of new daughter DNA molecules creates a moving "replication fork" (Figure 2), in which, double-stranded DNA is continually unwound and copied. (encyclopedia.com)
  • Compared to double-stranded DNA (dsDNA), the structure of ssDNA is very flexible and usually does not form well-defined secondary structures. (biosyn.com)
  • The probes are capable of invading the double-stranded circular DNA and forming a stable triplex structure. (springer.com)
  • Further, this bioanalytical tool can open up a new paradigm in clinical settings for the screening of double-stranded circular nucleic acids with a single-base mismatch specificity in a rapid and sensitive manner. (springer.com)
  • Supercoils refer to the DNA structure in which double-stranded circular DNA twists around each other. (freethesaurus.com)
  • Incoming partly double stranded hepatitis B virus (HBV) DNA genomes are completed by the viral polymerase generating relaxed circular DNA (rcDNA). (biomedcentral.com)
  • The HRDC domain of human Bloom's syndrome (BLM) helicase was shown to interact with the RecA core, raising the possibility that it may affect the coupling between ATP hydrolysis, translocation along single-stranded (ss)DNA and/or unwinding of double-stranded (ds)DNA. (nature.com)
  • Polyomaviruses (PyVs), belonging to the family Polyomaviridae, are a group of small, nonenveloped, double-stranded, circular DNA viruses widely distributed in the vertebrates. (usda.gov)
  • These are called plasmids and are double stranded molecules of DNA that can replicate autonomously. (stackexchange.com)
  • This DNA or RNA may be single or double-stranded. (angelfire.com)
  • Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. (nature.com)
  • These circular RNAs (circRNAs) do not retain the exon order defined by their genomic sequence and are thought to originate from non-canonical splicing of a 5′ splice site to an upstream 3′ splice site 4 . (nature.com)
  • The research, reported April 25 in Cell , raises "an intriguing possibility that introduction of certain circRNAs can dampen autoimmunity associated with lupus, suggesting circular RNA as a therapeutic strategy," says Howard Chang, a geneticist at Stanford University who was not involved in the work. (sciencenews.org)
  • NEW YORK (GenomeWeb) - A team led by researchers at the University of Michigan has catalogued and started characterizing circular RNAs (circRNAs) found across cancer types, including proposed circRNA markers in the urine of prostate cancer patients. (genomeweb.com)
  • Circular RNAs (circRNAs) are a new class of RNAs can be used as biomarkers in clinical blood samples. (bioportfolio.com)
  • Circular RNAs (circRNAs) are class of non-coding RNAs formed by back-splicing events as loops, and could be found in all types of organisms. (bioportfolio.com)
  • Circular RNAs (circRNAs) have been identified as important regulators in regulating cancer progression. (bioportfolio.com)
  • Recently, circular RNAs (circRNAs) attract much attention due to their potential vital functions in multiple human diseases, including cancer. (bioportfolio.com)
  • Mounting evidence has displayed critical roles of circular RNAs (circRNAs) in multiple cancers. (portlandpress.com)
  • Recent studies reveal that circular RNAs (circRNAs) are a novel class of abundant, stable and ubiquitous noncoding RNA molecules in animals. (biomedcentral.com)
  • Circular RNAs (circRNAs) are non-coding RNA molecules, and these are differentially expressed in various diseases, including cancer, suggesting that circRNAs can regulate certain diseases. (frontiersin.org)
  • Circular RNAs (circRNAs) are a special class of non-coding RNA molecules that do not have a 5′ terminus cap and a 3′ terminus poly (A) tail. (frontiersin.org)
  • eccDNA originate from chromosomal DNA and can be from 50 base pairs to several mega-base pairs in length and encode regulatory elements and several full genes. (wikipedia.org)
  • These newly discovered circular RNAs-embedded inside the non-coding segments of genes-continue to reveal the amazing complexity of the genetic code that exists in multiple overlapping layers of information. (icr.org)
  • With the rapid development of synthetic biology, the demand for assembling multiple DNA (genes) fragments into a large circular DNA structure in one step has dramatically increased. (biomedcentral.com)
  • The linear assembly combined with CAT strategy method can be regarded as a general strategy to enhance the efficiency of most existing circular DNA construction technologies and could be used in construction of a metabolic pathway consisting of multiple genes. (biomedcentral.com)
  • During that process, DNA instructions in genes are copied into RNA. (sciencenews.org)
  • In both the worm and the human cells, the researchers observed circles that were copies of coding regions on chromosomal DNA, regions that contain genes for making specific proteins. (hotstarshop.com)
  • However, this newly characterized type forms loops and circles and are encoded by DNA information that, in many cases, actually overlaps with protein-coding genes. (icr.org)
  • Recent advances in sequencing and in mapping RNA reads to reference genomes have revealed that thousands of genes express also covalently closed circular RNAs. (springer.com)
  • [11] Each minicircle contains one to three genes, [11] but blank plasmids, with no coding DNA , have also been found. (wikipedia.org)
  • Naturally occurring circular plasmids can be modified to contain multiple resistance genes and several unique restriction sites, making them valuable tools as cloning vectors in biotechnology applications. (wikipedia.org)
  • Even if they've got independent genes from their hosts, they're not considered to become independent living.This simplified figure depicts a bacterium?s chromosomal DNA in pink and plasmids in blue. (odooproject.com)
  • Considering the fact that plasmids are so tiny, they usually only possess a couple of genes using a unique functionality (versus a large amount of noncoding DNA). (odooproject.com)
  • iv) complexities of eukaryotic transcription may generate other non-canonical transcripts, such as lariats and fusion genes, in which corresponding reads similar to circular junctions may lead to false discoveries. (biomedcentral.com)
  • By further database searches, we show that this phenomenon is not unique to V. polyspora but that about 40% of the sequenced genomes of Saccharomycotina species contain integrated copies of genes from DNA plasmids or RNA viruses. (asm.org)
  • Replication origins are composed of special sequences of DNA that are recognized by replication initiator proteins, which bind to the origin sequences and then help to assemble other proteins required for DNA replication at these sites. (encyclopedia.com)
  • Two more proteins, DNA helicase and DNA primase, then join the complex. (encyclopedia.com)
  • CD spectroscopy is very sensitive to the secondary structure of polypeptides and proteins and thus has been employed in many different fields, such as investigation of the proteins' secondary structure and spectral studies of DNA [ 2 - 5 ]. (mdpi.com)
  • Hepadnavirus envelope proteins regulate covalently closed circular DNA amplification. (asm.org)
  • They can coexist with genomic DNA in the same organism, and the organism will (usually) express the proteins that the plasmids' circular DNA codes for, so they are good to test the changes with. (ginkgobioworks.com)
  • Circular RNAs are a type of noncoding RNA, which do not make proteins but may have other jobs ( SN: 5/13/19, p. 22 ). (sciencenews.org)
  • They also have exponentially more potential configurations than do DNA or proteins , and that makes them much harder to synthesize in the lab , says Peter Seeberger, a biochemist at the Max Planck Institute of Colloids and Interfaces in Munich, Germany. (evolutionnews.org)
  • Sequences encoding proteins distantly related to the replicase protein of single-stranded circular DNA viruses were identified. (umn.edu)
  • Here, we investigate the effect that cytoskeletal proteins have on the transport properties of linear and circular DNA. (aps.org)
  • Optical Rotary Dispersion and Circular Dichroism of Proteins. (wiley.com)
  • Interaction of DNA with Zinc Finger Proteins. (wiley.com)
  • Compared to prokaryotes, eukaryotic genomes are compartmentalized in a nucleus, whereby DNA is functionally organized in chromatin by spooling around histone proteins and forming nucleosomes. (springer.com)
  • The HBV covalently closed circular DNA (cccDNA) is organized like a mini-chromosome in the nuclei of infected hepatocytes by histone and nonhistone proteins. (cura-cancer.com)
  • Despite this, a crucial and shared function of these proteins is the formation of a so-called partition complex by binding to their centromere DNA, which typically consists of multiple tandem repeats. (pubmedcentralcanada.ca)
  • 5. The CDODN of claim 1, which stem structure additionally comprises nucleotide sequences capable of binding the DNA-binding domain of two or more transcription factors. (freepatentsonline.com)
  • Furthermore, the repeated DNA element as defined by the IRs is present in opposite orientations relative to the flanking sequences on the B31 and Ip21 plasmids. (asm.org)
  • The application of such techniques for the assembly of high-resolution physical maps, however, is quite inefficient because the genomic templates contain mostly non-target DNA sequences. (biomedcentral.com)
  • CRISPR arrays are capable of storing short sequences of DNA, known as 'spacers', originating from a pathogen. (nanowerk.com)
  • Among all the representations following Hamori's idea, the most worthy to mention is that in the year 2000, Randić and cooperators [ 5 ] constructed a new model of DNA sequences which was also based on a path in 3D space. (hindawi.com)
  • The above models were all based on individual nucleotides such that it was easy to inspect compositions and distributions of four bases directly, but difficult to dinucleotides or trinucleotides in DNA sequences. (hindawi.com)
  • Primary duck hepatocytes were infected with a mutant duck hepatitis B virus defective in envelope protein but competent for viral DNA synthesis. (asm.org)
  • Cells infected by this mutant accumulated higher levels of viral covalently closed, circular DNA (cccDNA) than those infected by wild-type virus. (asm.org)
  • Three contigs were of viral origin (viral first hit, E-value ≤1E-03), all belonging to the ssDNA circular viruses. (cdc.gov)
  • Treatment with a nucleos(t)ide analogue eliminates most HBV DNA replication intermediates and produces a gradual decline in levels of covalently closed circular DNA (cccDNA), the template for viral RNA synthesis. (osti.gov)
  • Viral burden quantification in ES patients has been limited to measurements of total DNA in PBMC, and estimates of Infectious Units per Million cells (IUPM). (plos.org)
  • Our findings suggest that measuring integration provides a better surrogate of viral burden than total HIV DNA in ES patients. (plos.org)
  • Here we show that measuring the level of integrated HIV DNA in this patient population provides valuable information regarding the mechanisms involved in viral control. (plos.org)
  • We conclude that measuring integration of HIV DNA in patient samples may provide a surrogate measure of viral burden in these and other patients with HIV. (plos.org)
  • Following translocation to the nucleus, the gaps are repaired by the host repair system to generate covalently closed circular DNA (cccDNA), the template for the HBV pregenome and viral mRNAs. (biomedcentral.com)
  • The persistence in the liver of residual duck hepatitis B virus covalently closed circular DNA is not dependent upon new viral DNA synthesis. (semanticscholar.org)
  • Our previous work using duck hepatitis B virus (DHBV) infected ducks, indicated that ~80% of residual DHBV DNA in the liver is in the covalently closed circular DNA (cccDNA) form, suggesting that viral DNA synthesis is suppressed. (semanticscholar.org)
  • Inverse PCR was used to amplify and sequence multiple small circular DNA viral genomes. (umn.edu)
  • In addition to DNA found outside the nucleus in cells, infection of viral genomes also provides an example of extrachromosomal DNA. (wikipedia.org)
  • nevertheless, didn't prevent amplification of viral DNA in the differentiated mobile compartment. (health-e-nc.org)
  • The viral nucleic acid reprograms the cell's DNA. (angelfire.com)
  • The hepatitis B virus nuclear template is covalently closed circular DNA (cccDNA). (osti.gov)
  • Virus DNA replication and new cccDNA synthesis were inhibited with Entecavir. (osti.gov)
  • Low level virus DNA synthesis may contribute to survival of cccDNA through mitosis. (osti.gov)
  • Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s) that fills the gap in the plus strand of rcDNA remains to be determined. (physiciansweekly.com)
  • Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s) responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV infection. (physiciansweekly.com)
  • We found that DNA polymerase κ (POLK), a Y-family DNA polymerase with maximum activity in non-dividing cells, substantially contributes to cccDNA formation during de novo HBV infection. (physiciansweekly.com)
  • The impact of PCR recombination towards the amplification of this cccDNA specific target was explored by mixing three marked, yet overlapping HBV DNA fragments. (biomedcentral.com)
  • The amplification HBV cccDNA is akin to DNA shuffling. (biomedcentral.com)
  • In contrast to bacterial plasmids or mitochondrial DNA, ecDNA are chromatinized, containing high levels of active histone marks, but a paucity of repressive histone marks. (wikipedia.org)
  • These circular DNA molecules are called plasmids and are usually hundreds or thousands of base pairs long. (ginkgobioworks.com)
  • Circular and linear plasmids of Lyme disease spirochetes have extensive homology: characterization of a repeated DNA element. (asm.org)
  • We have cloned three copies of a repeated DNA segment from Borrelia burgdorferi sensu stricto strain B31, present on both circular and linear plasmids of this and other B. burgdorferi sensu lato strains. (asm.org)
  • The helicase PcrA unwinds DNA during asymmetric replication of plasmids, acting with an initiator protein, in our case RepD. (nih.gov)
  • In prokaryotes, nonviral extrachromosomal DNA is primarily found in plasmids whereas in eukaryotes extrachromosomal DNA is primarily found in organelles. (wikipedia.org)
  • Extrachromosomal DNA exists in prokaryotes outside the nucleoid region as circular or linear plasmids. (wikipedia.org)
  • Circular bacterial plasmids are also the basis for the production of DNA vaccines. (wikipedia.org)
  • The linear plasmids which contain a protein that has been covalently attached to the 5' end of the DNA strands are known as invertrons and can range in size from 9 kb to over 600 kb consisting of inverted terminal repeats. (wikipedia.org)
  • These types of linear plasmids represent the largest class of extrachromosomal DNA as they are not only present in certain bacterial cells, but all linear extrachromosomal DNA molecules found in eukaryotic cells also take on this invertron structure with a protein attached to the 5' end. (wikipedia.org)
  • In addition to their mitochondrial genomes, yeast species contain a variety of other extranuclear DNA and RNA elements, including viruses and plasmids. (asm.org)
  • The partition machinery of low copy number plasmids represent excellent model systems to study DNA segregation at a detailed atomic level because they are composed of just three components: a centromere DNA site, a partition NTPase and a centromere-binding protein (CBP) ( 1-3 ). (pubmedcentralcanada.ca)
  • The genomes of bacterial cells ( prokaryotes ), which lack a nucleus, are typically circular DNA molecules that associate with special structures in the cell membrane. (encyclopedia.com)
  • Circular replication initiation protein (Rep)-encoding single-stranded DNA (ssDNA) (CRESS-DNA) genomes are found in diverse group II virus families, which all possess a conserved Rep-encoding gene and a nonenveloped icosahedral capsid, except geminiviruses, which have twinned particles ( 1 ). (cdc.gov)
  • Li M, Schönberg A, Schaefer M, Schroeder R, Nasidze I, Stoneking M. Detecting heteroplasmy from high-throughput sequencing of complete human mitochondrial DNA genomes. (springer.com)
  • Is the DNA circular or linear in the genomes found from C. elegans and C. reinhardtii? (dissertationhelpservice.org)
  • The post Is the DNA circular or linear in the genomes found from C. elegans and C. reinhardtii? (dissertationhelpservice.org)
  • We discovered that cells harboring E5 mutant genomes shown a quantitative decrease in the percentage of suprabasal cells going through DNA GM 6001 supplier synthesis, in comparison to cells filled with WT HPV16 DNA. (health-e-nc.org)
  • It is well known that the nuclear genomes of most eukaryotes contain integrated fragments of organellar DNA called NUMTs (nuclear copies of mitochondrial DNA) and NUPTs (nuclear copies of plastid DNA, in plants) ( 26 , 29 , 44 , 45 , 57 ). (asm.org)
  • Nucleos(t)ide analogues that inhibit hepatitis B virus (HBV) DNA replication are typically used as monotherapy for chronically infected patients. (osti.gov)
  • DNA Polymerase κ Is a Key Cellular Factor for the Formation of Covalently Closed Circular DNA of Hepatitis B Virus. (physiciansweekly.com)
  • Residual hepatitis B virus (HBV) DNA can be detected following the resolution of acute HBV infection. (semanticscholar.org)
  • The bacterial replication initiator protein is called the dna A protein. (encyclopedia.com)
  • Another example is the protein Trex1 which is the major 3'-DNA exonuclease in mammalian cells. (biosyn.com)
  • The protein appears to play a DNA-editing role in DNA replication or gap-filling during DNA repair. (biosyn.com)
  • In most studies of single molecules, DNA or protein molecules are immobilized to a surface and are often mobilized with fluorophores or tethers to allow observations. (biosyn.com)
  • Visualization was achieved using a fluorescent single-stranded DNA-binding protein. (nih.gov)
  • Mitochondrial DNA replication is performed by a simple machinery, containing the TWINKLE DNA helicase, a single-stranded DNA-binding protein, and the mitochondrial DNA polymerase γ. (nih.gov)
  • The role models for the protein and DNA structures in the N-terminal domain are taken from the comparable role models for protein and DNA in the protamine-DNA complex in sperm cells. (oalib.com)
  • The WHD mediates protein-DNA and protein-protein interactions and has been shown to facilitate DNA unwinding and contribute to substrate recognition 10 . (nature.com)
  • Here we report upon a property specific to circular DNA aptamers: Their intrinsic compatibility with a highly sensitive protein detection method termed the 'proximity extension' assay. (edu.au)
  • We specifically quantify DNA diffusion coefficients, degrees of anomalous diffusion, and conformational changes within protein networks of varying concentrations and polymerization states. (aps.org)
  • Protein-DNA Interactions. (wiley.com)
  • Though chloroplast DNA is not associated with true histones , [16] in red algae , a histone-like chloroplast protein (HC) coded by the chloroplast DNA that tightly packs each chloroplast DNA ring into a nucleoid has been found. (wikipedia.org)
  • Applying such approaches, we have identified five novel circular replication-associated protein (Rep)-encoding single-stranded (CRESS) DNA viruses from Poaceae and Apiaceae plant from South Africa and New Zealand. (elsevier.com)
  • SopB is a multidomain protein, which like P1 ParB contains an all-helical DNA-binding domain that is flexibly attached to a compact (β 3 -α) 2 dimer-domain. (pubmedcentralcanada.ca)
  • The vast majority of the molecules are circular, with the remaining molecules being in the linear form, as determined by agarose gel electrophoresis. (neb.com)
  • Wong L-JC, Chen T-J, Tan D-J. Detection of mitochondrial DNA mutations using temporal temperature gradient gel electrophoresis. (springer.com)
  • In gel electrophoresis it was observed in Ref. [1] that underwound DNA mini-rings migrate slower than overwound DNA mini-rings in EDTA solution. (newton.ac.uk)
  • The velocity and average length of the 52.5 kbp open circles and 48.5 kbp linear DNA were measured during electrophoresis in the agarose gels. (chalmers.se)
  • The velocity increased when the agarose concentrations were lowered, but the average length of the open-circle DNA (during electrophoresis) did not significantly change with agarose gel concentrations. (chalmers.se)
  • We showed before that long linear DNA molecules containing single-strand interruptions and undergoing pulsed-field gel electrophoresis (PFGE) tend to break into subfragments (electrophoretic nick instability). (usda.gov)
  • Analysis of the extent of breakage, by alkaline band centrifugation and agarose gel electrophoresis, yielded quite different results from those previously reported for the breakage of closed-circular SV40 DNA by bleomycin. (elsevier.com)
  • Restriction analysis of tagged NR-element DNA, unusual migration patterns during pulsed field gel electrophoresis (PFGE) and CsCl/ethidium bromide equilibrium centrifugation demonstrates that the NR-element represents circular DNA. (cgiar.org)
  • The analysis of practically intact chromosomal rice DNA molecules by pulsed field gel electrophoresis has now shown that the amplification is associated with the appearance of extrachromosomal molecules. (unipv.it)
  • Analysis of restriction endonuclease products with both standard horizontal and pulsed field gel electrophoresis suggest that the extrachromosomal DNA, and its chromosomal counterpart, is composed of tandemly repeated units of about 7 kb. (unipv.it)
  • Is the Subject Area "DNA viruses" applicable to this article? (plos.org)
  • People with lupus have lower than normal levels of circular RNAs , triggering an immune reaction meant to fight viruses, biochemist Lingling Chen of the Shanghai Institute of Biochemistry and Cell Biology and her colleagues discovered. (sciencenews.org)
  • Because the viruses have characteristics of both animal and plant viruses, we named them chimpanzee stool-associated circular viruses (ChiSCV). (umn.edu)
  • The Reps and the CPs putatively encoded by these five novel viruses share low to moderate degrees of similarity (22.1 - 44.6%) with other CRESS DNA viruses. (elsevier.com)
  • Human papillomaviruses (HPVs) are small circular DNA viruses that cause warts. (health-e-nc.org)
  • During the process of DNA replication, the strands are unwound by an enzyme called DNA helicase, and a new strand of DNA is synthesized on each of the old ( template ) strands by an enzyme called DNA polymerase, which joins incoming nucleotides together in a sequence that is determined by the sequence of nucleotides present in the template strand. (encyclopedia.com)
  • Replication initiation is triggered by the activation of the helicase and primase, and the subsequent recruitment of DNA polymerase. (encyclopedia.com)
  • In prokaryotes, the particular form of the enzyme is called DNA polymerase III. (encyclopedia.com)
  • RNA oligonucleotides are synthesized using a small, circular DNA template which lacks an RNA polymerase promoter sequence. (google.com)
  • The RNA synthesis is performed by combining a circular single-stranded oligonucleotide template with an effective RNA polymerase and at least two types of ribonucleotide triphosphate to form an RNA oligonucleotide multimer comprising multiple copies of the desired RNA oligonucleotide sequence. (google.com)
  • The scientists also discovered that the ciRNAs promoted gene function by associating with the transcription machinery that copies DNA into RNA (RNA polymerase II). (icr.org)
  • In addition, mitochondrial RNA polymerase is required for primer formation at the origins of DNA replication. (nih.gov)
  • Splicing is often tightly coupled to transcription by RNA polymerase II that proceeds in 5′ → 3′ along DNA template. (springer.com)
  • Double minute ecDNAs are fragments of extrachromosomal DNA, which were originally observed in a large number of human tumors including breast, lung, ovary, colon, and most notably, neuroblastoma. (wikipedia.org)
  • There is however, a potentially confounding issue in that PCR can generate larger targets from collections of small DNA fragments, a phenomenon known as PCR recombination. (biomedcentral.com)
  • Primers incorporated mutations (underlined) to distinguish PCR fragments from input HBVayw DNA. (biomedcentral.com)
  • The company's core technology platform is based on the discoveries of extrachromosomal DNA and their involvement in driving copy number amplification of oncogenes in cancer. (wikipedia.org)
  • The method encompasses column purification, removal of remaining linear chromosomal DNA, rolling-circle amplification and high-throughput sequencing. (jove.com)
  • Ultrasensitive detection of single nucleotide polymorphism in human mitochondrial DNA utilizing ion-mediated cascade surface-enhanced Raman spectroscopy amplification. (springer.com)
  • The extrachromosomal DNA represents about 1% of total rice DNA and its level of amplification is not affected by the different phases of growth in culture. (unipv.it)
  • In contrast to the previously discovered circular RNAs composed of spliced-gene exons and functioning primarily as miRNA (micro RNA) sponges in the cell cytoplasm, ciRNAs act as transcriptional enhancers in the nucleus. (icr.org)
  • 3 In fact, ciRNAs are primarily localized to the nucleus, which contains the cell's genomic DNA, where they enhance gene expression. (icr.org)
  • That DNA, called chromosomal DNA, is found in each cell's nucleus and contains genetic instructions needed to carry out biological functions. (hotstarshop.com)
  • In this study we describe the presence of circular DNA in the nucleus of Trypanosoma brucei. (cgiar.org)
  • Do you know an alive plant cell that has no nucleus and no other DNA simultaneously? (stackexchange.com)
  • Extrachromosomal DNA is any DNA that is found outside the nucleus of a cell. (wikipedia.org)
  • Cytoplasmic DNA is less methylated than DNA found within the nucleus. (wikipedia.org)
  • Southern blot analysis showed that pAAT56 DNA had no homology with either nuclear or mitochondrial DNA. (genetics.org)
  • Mutations in mitochondrial DNA (mtDNA) have been an essential cause of numerous diseases, making their identification critically important. (springer.com)
  • The authors thank Shiyu Luo from Dr. Huang's group for the generous help on mitochondrial DNA preparation. (springer.com)
  • Mitochondrial DNA mutations in human disease. (springer.com)
  • Melton T, Nelson K. Forensic mitochondrial DNA analysis: two years of commercial casework experience in the United States. (springer.com)
  • Meierhofer D, Mayr JA, Ebner S, Sperl W, Kofler B. Rapid screening of the entire mitochondrial DNA for low-level heteroplasmic mutations. (springer.com)
  • A new method for analysis of mitochondrial DNA point mutations and assess levels of heteroplasmy. (springer.com)
  • Analysis of mitochondrial DNA in microfluidic systems. (springer.com)
  • Sun L, Hu N, Peng J, Chen L, Weng J. Ultrasensitive detection of mitochondrial DNA mutation by graphene oxide/DNA hydrogel electrode. (springer.com)
  • Chang C-M, Chiu L-F, Wang P-W, Shieh D-B, Lee G-B. A microfluidic system for fast detection of mitochondrial DNA deletion. (springer.com)
  • Chang C-M, Chiu L-F, Wei Y-H, Shieh D-B, Lee G-B. Integrated three-dimensional system-on-chip for direct quantitative detection of mitochondrial DNA mutation in affected cells. (springer.com)
  • Age-dependent covalent DNA alterations (I-compounds) in rat liver mitochondrial DNA. (biomedsearch.com)
  • Mitochondrial DNA is a main source of this extrachromosomal DNA in eukaryotes. (wikipedia.org)
  • The mitochondria present in eukaryotic cells contain multiple copies of mitochondrial DNA referred to as mtDNA which is housed within the mitochondrial matrix. (wikipedia.org)
  • The ideal goal is loss of covalently closed circular DNA and loss of surface antigen" from a patient's liver cells, "but I don't think that this has been achieved in 3 years of treatment with adefovir," he said. (freethesaurus.com)
  • A subtype of eccDNA, such as ecDNA, ribosomal DNA locus (Extrachromosomal rDNA circle), and double minutes have been associated with genomic instability. (wikipedia.org)
  • eccDNA derived from chromosomal genomic sequence, first discovered in the nuclei of cells, are detected in the circulation, are longer than linear cell-free DNA, and are released from normal tissue and tumors into the circulation. (aacrjournals.org)
  • The present invention provides a circular dumbbell oligodeoxynucleotide (CDODN) comprising two loop structures and a stem structure, wherein the stem structure comprises a nucleotide sequence capable of binding the DNA-binding domain of a transcriptional factor. (freepatentsonline.com)
  • The present invention also provides a method for treating and/or preventing a disease or disorder related to such a transcriptional factor, comprising administering to the subject a therapeutically effective amount of a CDODN comprising two loop structures and a stem structure, wherein the stem structure comprises a nucleotide sequence capable of binding the DNA-binding domain of the transcriptional factor. (freepatentsonline.com)
  • 9. The CDODN of claim 6, which stem structure additionally comprises a nucleotide sequence capable of binding the DNA-binding domain of another transcription factor. (freepatentsonline.com)
  • A novel circular DNA virus sequence is reported from grapevine. (asm.org)
  • A DNA virus belonging to the genus Badnavirus , family Caulimoviridae , was recently detected in grapevine by deep sequencing ( 8 ), but this is the first report of a geminivirus sequence in grapevine. (asm.org)
  • It was demonstrated that the anticancer polyaromatic drug BAPSQ intercalates into DNA basepairs with its long direction perpendicular to both the DNA helix axis and the base pair long axis and induces larger conformational changes in CpG containing octanucleotide I CRE than in its reverse sequence, octanucleotide II. (brillonline.com)
  • Circular dichroism (CD) studies of Ru and Rh in [poly(dA-dT)]_2, mixed-sequence calf thymus DNA, and [poly(dG-dC)]_2 as a function of loading indicate that the largest perturbations to the CD signal occur upon initial addition of DNA, with no subsequent systematic variation. (caltech.edu)
  • The linear assembly combined with CAT method was demonstrated to increase the overall construction efficiency by 3-4 times for both the traditional ligation and for the new in vitro recombination-based assembly methods including recombinant DNA, Golden Gate, SLIC (Sequence and Ligation Independent Cloning) and Gibson Isothermal Assembly. (biomedcentral.com)
  • As part of the study, the researchers applied advanced techniques to analyse the chemical structure and sequence of these mysterious DNA molecules using leading bioinformatics algorithms. (yahoo.com)
  • The scientists hoped to cast light on the mechanisms of this gene-environment interaction by comparing modifications of the DNA sequence of victims who had not become ill with that of those who had. (genengnews.com)
  • Decisive for victims of childhood abuse, however, is that the stress-induced epigenetic changes can only occur if their DNA has a specific sequence. (genengnews.com)
  • Spacers are separated from each other by short identical DNA sequence called direct repeats, just like pearls on a string. (nanowerk.com)
  • This paper constructed a novel injection from a DNA sequence to a 3D graph, named circular helix-like curve (CHC). (hindawi.com)
  • Structures have shown that despite a lack of sequence homology, both the small type II and Ib CBPs contain ribbon-helix-helix (RHH) DNA-binding folds ( 10-13 ). (pubmedcentralcanada.ca)
  • Tomkins, J. Circular RNAs Increase Cell Bio-Complexity . (icr.org)
  • The present invention provides methods for synthesis and therapeutic use of DNA and RNA oligonucleotides and analogs. (google.com)
  • The RNA synthesis is performed by combining a circular single-stranded. (google.com)
  • Improvements in DNA and RNA oligonucleotide synthesis methods enabled the production of long single-stranded DNA (ssDNA) and circular DNA, such as catenanes, chain-like molecules. (biosyn.com)
  • The synthesis of DNA catenanes, chain-like DNA molecules, allows the study of the secondary structure of these molecules. (biosyn.com)
  • We also show that the mitochondrial replication machinery can assemble on a closed circular DNA template and efficiently elongate a DNA primer in a manner that closely resembles initiation of mtDNA synthesis in vivo. (nih.gov)
  • cells to aid DNA synthesis. (health-e-nc.org)
  • Circular dichroism (CD) spectroscopy is an optical technique that measures the difference in the absorption of left and right circularly polarized light. (mdpi.com)
  • These studies show that CD spectroscopy is a powerful technique to monitor DNA conformational changes resulting from drug binding and also shows its potential to be a drug-screening platform in the future. (mdpi.com)
  • To reveal the amount of some of these damages we applied circular dichroism and UV absorption spectroscopy. (novapublishers.com)
  • In this work we use absorbance, circular dichroism (CD), and two-dimensional fluorescence spectroscopy (2DFS) to study the local conformations and conformational disorder within chromophore-labeled DNA constructs. (rsc.org)
  • This is the first report of DNA stem-loops self-assembled by 'foot-loop' interactions into either two-dimensional strings or three-dimensional spirals, distinguished by circular dichroism spectroscopy. (scielo.org.za)
  • Circular dichroism (CD) spectroscopy of 1.5 µ M ml 1 DNA strand concentration in 100 mMl 1 sodium chloride, 5 mMl 1 magnesium chloride, and 10 mMl 1 sodium cacodylate, at pH 7.0 in a 1 ml jacketed quartz cuvette, was performed in a Jasco J-810 spectropolarimeter with ten accumulations per scan. (scielo.org.za)
  • The present study deals with an investigation of metal ion induced DNA condensation by means of Vibrational Circular Dichroism spectroscopy (VCD). (jbsdonline.com)
  • In contrast to ECD, the combination of VCD and IR absorption spectroscopy not only enabled the observation of DNA condensation, but also the determination of DNA secondary structure upon condensation in the same experiment. (jbsdonline.com)
  • Circular dichroism spectroscopy (CD) is an essential analytical technique used to analyze chirality in molecules through their optical activity. (jascoinc.com)
  • Circular dichroism spectroscopy is a technique where the difference in the absorption of left and right circularly polarized light in optically active substances is measured. (jascoinc.com)
  • In DNA strands, the head is the 3 ′ ("three prime") end of the strand, and the tail is the 5 ′ ("five prime") end. (encyclopedia.com)
  • The two strands of DNA run in opposite directions, and are wound around each other in a double helix, with the strands held together by hydrogen bonds between paired bases of the nucleotides (A pairs with T, and G pairs with C). (encyclopedia.com)
  • DNA replication is said to be semiconservative because each of the two identical daughter molecules contains one of the two parental template strands paired with a new strand. (encyclopedia.com)
  • That's a good first approximation, and it's basically how we store linear strands of DNA molecules for things like a gene. (ginkgobioworks.com)
  • It gives a model of a supercoiled DNA mini-ring consisting of DNA double strands. (newton.ac.uk)
  • These constructs employ dimers of the fluorescent chromophore Cy3 that are site-specifically incorporated into the sugar-phosphate backbones of DNA strands at ss-ds DNA fork junctions. (rsc.org)
  • Some circular RNAs are predicted to have stretches that pair with other parts of the same RNA to make double strands (straight portions). (sciencenews.org)
  • Producing the first detailed map of circular DNA, the scientists have shed new unanticipated insights on long standing questions in the field of cancer genetics. (news-medical.net)
  • A completely new category of circular RNAs has been discovered, adding another layer of amazing complexity to human genetics. (icr.org)
  • The ecDNA notation encompasses all forms of the large gene-containing extrachromosomal DNA found in cancer cells. (wikipedia.org)
  • These circular RNAs are formed from the intron regions inside a gene that were once thought to be nothing but junk DNA. (icr.org)
  • In these newly discovered circular intronic RNAs (ciRNA), the introns are excised from the initial gene transcript into smaller RNA molecules to form circles that enhance the gene's transcription. (icr.org)
  • Circular dichroism (CD) spectra of complexes of 4-benzylaminopyrimido[4′,5′ :4,5]selenolo(2,3-b)quinoline (BAPSQ) with octanucleotide I (d(TGACGTCA)), which is the cAMPresponsive element (CRE) in gene promoters, and its inverse d(ACTGCAGT) (octanucleotide II) have been measured over a range of drug/DNA ratios. (brillonline.com)
  • The analysis of DNA methylation and MTase activities is very important in the early clinical diagnosis of cancer, on purposes of providing insights into the mechanism of gene repression and developing novel drugs of treating methylation-related diseases. (usda.gov)
  • Circular DNA can also facilitate horizontal gene transfer such as Hfr mediated conjugation. (stackexchange.com)
  • It is now certain that circular RNAs are important functional components of gene regulation, and there are different categories of circular RNAs. (icr.org)
  • In order to carry out processes such as gene transcription and cell replication, DNA must diffuse through a highly crowded cellular environment. (aps.org)
  • Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. (biomedcentral.com)
  • The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements. (biomedcentral.com)
  • Chloroplast DNA Interactive gene map of chloroplast DNA from Nicotiana tabacum . (wikipedia.org)
  • This technique has been widely employed in the studies of nucleic acids structures and the use of it to monitor conformational polymorphism of DNA has grown tremendously in the past few decades. (mdpi.com)
  • DNA may undergo conformational changes to B-form, A-form, Z-form, quadruplexes, triplexes and other structures as a result of the binding process to different compounds. (mdpi.com)
  • The phenomenon of supercoiling, its geometric and topological analysis, and the formation of noncanonical structures in circular DNA under the influence of supercoiling are emphasized. (exlibris.ch)
  • The capability of RecQ helicases to process complex DNA structures is associated with a conserved domain architecture shared by Ec RecQ, human BLM and WRN enzymes, as well as at least one RecQ homolog in almost all investigated organisms ( Fig. 1 ) 10 . (nature.com)
  • Specifically, the triggered reversible reconfiguration of the catenane or rotaxane structures provides a means to yield new DNA switches and to use them as dynamic scaffolds for controlling chemical functions and positioning functional cargoes. (usda.gov)
  • To understand the myriad functions of SopB, we determined a series of SopB-DNA crystal structures. (pubmedcentralcanada.ca)
  • Both specific and non-specific SopB-DNA bridging structures were observed. (pubmedcentralcanada.ca)
  • Structures were determined separately for the KorB HTH-containing DNA-binding domain and the C-terminal dimer-domain, which has an SH3-like fold ( 15 , 16 ). (pubmedcentralcanada.ca)
  • At the same time both of them result in the same changes in DNA CD spectra: the decrease in intensity. (novapublishers.com)
  • Circular dichroism spectra revealed that the network made up of oligomers C+D showed more helicity (15 m°) than oligomers A+B (13 m°) at 272 nm ( Fig. 3a ), as expected. (scielo.org.za)
  • It has been known for a long time that at certain conditions so called psi -type DNA condensation occurs, which can be easily determined by Electronic CD (ECD) due to appearance of large characteristic ECD spectra (1). (jbsdonline.com)
  • A drastic intensity increase of VCD spectra as well as several other characteristic changes similar to that observed in ECD occurred during DNA condensation induced by Cr(3+) ions, indicating VCD's ability to detect psi-type DNA condensation. (jbsdonline.com)
  • Chloroplast DNA ( cpDNA ) is the DNA located in chloroplasts, which are photosynthetic organelles located within the cells of some eukaryotic organisms. (wikipedia.org)
  • Prior to 2017, extrachromosomal DNA was thought to be a rare, but interesting event in cancer (1.4% of tumors), of unclear biological significance. (wikipedia.org)
  • We show that it is possible to directly distinguish between circular and linear DNA molecules by measuring the emission intensity from the DNA. (chalmers.se)
  • If this type of DNA damage is left to accumulate over many years, affected cells may lose control over cell division and growth. (news-medical.net)
  • Working alongside a team of scientists led by Dr. Richard Koche from the Memorial Sloan Kettering Cancer Center and other international partners, the groups of researchers were able to show that rings of DNA can cause disruption of our cells' genetic information, which can contribute to cancer development. (news-medical.net)
  • Trex1 binds to ssDNA in mammalian cells, where it removes mismatched 3'-terminal deoxyribonucleotides at DNA strand breaks. (biosyn.com)
  • Superhelicity of Circular DNA Isolated from Cells. (exlibris.ch)
  • There appears to be no significant difference in the level of total HIV DNA between cells from ES patients and patients on HAART. (plos.org)
  • We observed 36 HIV-infected patients to evaluate whether the presence of tandem 2-long terminal repeat circular unintegrated HIV-1 DNA (2-LTR) in peripheral blood mononuclear cells (PBMC) at baseline was associated with acceleration of HIV disease. (ovid.com)
  • Scientists have known for decades that cells produce circular RNAs at low levels while making messenger RNAs, or mRNAs. (sciencenews.org)
  • According to the researchers, a range of external factors such as tobacco smoke and radiation, may cause damage to the DNA within cells. (yahoo.com)
  • In plants, sieve tube cells lose their nuclei at maturity (just like our RBCs), and thus lose their chromosomal DNA, but they don't lose their mitochondria. (stackexchange.com)
  • 6. The method of claim 1, wherein the DNA substrate is a DNA fragment comprising the digestion product of DNA and a DNA restriction enzyme. (google.es)
  • DNA sequencing also revealed the process by which specific DNA sections separate from a chromosome to form circular DNA before reintegrating into the chromosome at a different location. (news-medical.net)
  • Here we show that circular antisense non-coding RNA in the INK4 locus ( circANRIL ), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. (nature.com)
  • Bacteria avoids this problem altogether by using a circular chromosome. (stackexchange.com)
  • To expand a little bit the other answer, I would also add that bacteria can have other (usually circular) DNA segments aside from their main chromosome. (stackexchange.com)
  • Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. (biomedcentral.com)
  • Here we review the recent CD spectroscopic studies of the induction of DNA conformational changes by different ligands, which includes metal derivative complex of aureolic family drugs, actinomycin D, neomycin, cisplatin, and polyamine. (mdpi.com)
  • Our results suggest that this approach may be applied generally to understand local backbone conformation and conformational disorder at ss-ds DNA fork junctions. (rsc.org)
  • We here observe the unfolding of confined DNA from the circular to linear configuration as a light-induced double-strand break occurs, characterize the dynamics, and compare the equilibrium conformational statistics of linear and circular configurations. (chalmers.se)
  • We determine the role that DNA topology as well as cytoskeletal filament rigidity (actin vs microtubules) has on DNA transport and conformational states. (aps.org)
  • Topology and Physics of Circular DNA presents comprehensive coverage of the physical properties of circular DNA. (exlibris.ch)
  • The combination of consistent theoretical analysis and detailed treatment of major experimental approaches make Topology and Physics of Circular DNA an important reference volume for biophysicists, biochemists, molecular biologists, and researchers and students who want to expand their understanding of circular DNA. (exlibris.ch)
  • Given the primacy of DNA as central information-storing nucleic acid, which is organized, transcribed as well as translated in a 5′ → 3′ polarized fashion, it came as a surprise that not all mRNAs contain exons in their colinear 5′ → 3′ arrangement. (springer.com)
  • Carcinogenesis 13:637-642), we used supercoiled circular DNA from bacteriophage fX 174 as the target substrate in a highly sensitive assay to evaluate ROS-dependent damage from insoluble forms of nickel in comparison to similarly treated ROFA. (freethesaurus.com)
  • The rate of blunt-end ligation of DNA substrate by T4 DNA ligase is particularly affected, with a product shift from closed. (google.es)
  • The rate of blunt-end ligation of DNA substrate by T4 DNA ligase is particularly affected, with a product shift from closed circular species to linear oligomers. (google.es)
  • 3. The method of claim 2, wherein the DNA substrate has blunt-ended termini. (google.es)
  • 7. The method of claim 1, wherein the DNA substrate is a complementary pair of deoxyribooligonucleotides at least eight base pairs in length. (google.es)
  • 9. The method of claim 1, wherein the DNA substrate is a mixture of a DNA fragment and a complementary pair of deoxyribooligonucleotides. (google.es)
  • A method for preparing linear oligomers of duplex DNA comprising enzymatically ligating duplex DNA substrate end to end in the presence of a sufficiently high concentration of a non-specific volume-excluding polymer to promote intermolecular ligation. (google.es)
  • Extrachromosomal DNA Extrachromosomal rDNA circle Selfish genetic elements Double minute Paulsen T, Kumar P, Koseoglu MM, Dutta A (April 2018). (wikipedia.org)
  • DNA is the carrier of genetic information. (encyclopedia.com)
  • The results in this study provide information that can be used to improve electrophoretic separations of circular DNA, an important form of genetic material and commonly used to clone DNA. (chalmers.se)
  • The detection of linear fetal DNA in cell-free DNA (cfDNA) from the blood of a pregnant woman for identifying genetic abnormalities in the fetus has also been a success ( 1-3 ). (aacrjournals.org)
  • While cancer is associated with the gradual accumulation of defects in the genetic material Deoxyribonucleic Acid (DNA) over time, and is considered an age-related disease, the researchers, including those from the Charite - Universitatsmedizin Berlin in Germany, sought to know why children develop the malignant disease. (yahoo.com)
  • However, the current study noted that extrachromosomal DNA can disrupt the genetic information, contributing to cancer development. (yahoo.com)
  • A 50-year-old lab technique is helping researchers better understand circular DNA, a lesser-known and poorly understood cousin of the linear version commonly associated with life's genetic blueprint. (hotstarshop.com)
  • In order to establish circular DNA as a biomarker for disease, we first have to have a method for reliably and cleanly separating circular DNA out of a sample, purifying it, so that we know what we are studying is just the circles, without other genetic materials mixed in," she said. (hotstarshop.com)
  • In their evolutionary mindset, scientists first thought that these circular RNAs were genetic accidents or experimental artifacts. (icr.org)
  • Depending on genetic predisposition, childhood trauma can leave permanent epigenetic marks on the DNA," explains Torsten Klengel, M.D., one of the study authors. (genengnews.com)
  • This genetic information is recorded in a specific stretch of DNA known as a CRISPR array - a process called acquisition. (nanowerk.com)
  • Using CRISPR, researchers showed that a region some used to label "junk DNA" has a major role in a rare genetic disorder. (pnas.org)
  • The in-depth characterization of GSDMB AS and backsplicing profiles led us to the identification of an exonic circular RNA (ecircRNA) as well as of novel GSDMB in-frame and out-of-frame isoforms. (mdpi.com)
  • Circ-UBR5: An exonic circular RNA and novel small nuclear RNA involved in RNA splicing. (bioportfolio.com)
  • 1 And now scientists can add ciRNAs to the ever-growing list of functional DNA found in introns, creating a picture of complexity in the cell that will certainly increase in time. (icr.org)
  • Synthetic long single-stranded DNA (ssDNA) as well as circular DNA allow functional studies in vitro and in vivo. (biosyn.com)
  • Here we identify a molecular effector mechanism of circular ANRIL ( circANRIL) using proteomic screening, bioinformatics and functional studies. (nature.com)
  • Interlocked circular DNA nanostructures, e.g., catenanes or rotaxanes, provide functional materials within the area of DNA nanotechnology. (usda.gov)
  • Therefore, we discuss a functional connection between the occurrence of this circular DNA and subtelomeric recombination events in T. brucei. (cgiar.org)
  • The existence of chloroplast DNA was identified biochemically in 1959, [1] and confirmed by electron microscopy in 1962. (wikipedia.org)
  • Chloroplast DNA has long been thought to have a circular structure, but some evidence suggests that chloroplast DNA more commonly takes a linear shape. (wikipedia.org)
  • [12] Over 95% of the chloroplast DNA in corn chloroplasts has been observed to be in branched linear form rather than individual circles. (wikipedia.org)
  • [15] They are usually packed into nucleoids which can contain several identical chloroplast DNA rings. (wikipedia.org)
  • In primitive red algae , the chloroplast DNA nucleoids are clustered in the center of a chloroplast, while in green plants and green algae , the nucleoids are dispersed throughout the stroma . (wikipedia.org)
  • Genomic features of gemycircularviruses HV-GcV1 and HV-GcV2 and of a novel circular single-stranded DNA (ssDNA) virus, HV-CV1, including hairpin structure and predicted open reading frames. (cdc.gov)
  • 2 Branched networks that result from ligating three-way junctions of DNA together have been reported. (scielo.org.za)
  • According to the researchers' findings, each tissue sample contained on average 5,000 circular DNA copies. (news-medical.net)
  • Each chloroplast contains around 100 copies of its DNA in young leaves, declining to 15-20 copies in older leaves. (wikipedia.org)
  • The second DNA assembly technique is in vitro recombination method based on single-strand overhangs generated by single-strand exonucleases or incomplete PCR (Polymer Chain Reaction), typically represented by OE-PCR (Overlap Extension-PCR). (biomedcentral.com)
  • Sometimes, introns and the other pieces of the original RNA get "back-spliced" into a closed loop of circular RNA. (sciencenews.org)