Cysteine Dioxygenase: An enzyme that catalyzes the conversion of L-CYSTEINE to 3-sulfinoalanine (3-sulfino-L-alanine) in the CYSTEINE metabolism and TAURINE and hypotaurine metabolic pathways.Dioxygenases: Non-heme iron-containing enzymes that incorporate two atoms of OXYGEN into the substrate. They are important in biosynthesis of FLAVONOIDS; GIBBERELLINS; and HYOSCYAMINE; and for degradation of AROMATIC HYDROCARBONS.Cysteine: A thiol-containing non-essential amino acid that is oxidized to form CYSTINE.Oxygenases: Oxidases that specifically introduce DIOXYGEN-derived oxygen atoms into a variety of organic molecules.Taurine: A conditionally essential nutrient, important during mammalian development. It is present in milk but is isolated mostly from ox bile and strongly conjugates bile acids.Amino Acids, SulfurSulfinic Acids: Any of the monobasic inorganic or organic acids of sulfur with the general formula RSO(OH). (From McGraw Hill Dictionary of Scientific and Technical Terms, 4th ed)4-Hydroxyphenylpyruvate Dioxygenase: An enzyme that catalyzes the conversion of 4-hydroxyphenylpyruvate plus oxygen to homogentisic acid and carbon dioxide. EC 1.13.11.27.Sulfhydryl Compounds: Compounds containing the -SH radical.Catechol 2,3-Dioxygenase: Catalyzes the oxidation of catechol to 2-hydroxymuconate semialdehyde in the carbazole and BENZOATE degradation via HYDROXYLATION pathways. It also catalyzes the conversion of 3-methylcatechol to cis, cis-2-hydroxy-6-oxohept-2,4-dienoate in the TOLUENE and XYLENE degradation pathway. This enzyme was formerly characterized as EC 1.13.1.2.Protocatechuate-3,4-Dioxygenase: An enzyme that catalyzes the oxidation of protocatechuate to 3-carboxy-cis-cis-muconate in the presence of molecular oxygen. It contains ferric ion. EC 1.13.11.3.Ferrous Compounds: Inorganic or organic compounds that contain divalent iron.Catechol 1,2-Dioxygenase: An enzyme that catalyzes the oxidation of catechol to muconic acid with the use of Fe3+ as a cofactor. This enzyme was formerly characterized as EC 1.13.1.1 and EC 1.99.2.2.Carboxy-Lyases: Enzymes that catalyze the addition of a carboxyl group to a compound (carboxylases) or the removal of a carboxyl group from a compound (decarboxylases). EC 4.1.1.Tryptophan Oxygenase: A dioxygenase with specificity for the oxidation of the indoleamine ring of TRYPTOPHAN. It is a LIVER-specific enzyme that is the first and rate limiting enzyme in the kynurenine pathway of TRYPTOPHAN catabolism.Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Homogentisate 1,2-Dioxygenase: A mononuclear Fe(II)-dependent oxygenase, this enzyme catalyzes the conversion of homogentisate to 4-maleylacetoacetate, the third step in the pathway for the catabolism of TYROSINE. Deficiency in the enzyme causes ALKAPTONURIA, an autosomal recessive disorder, characterized by homogentisic aciduria, OCHRONOSIS and ARTHRITIS. This enzyme was formerly characterized as EC 1.13.1.5 and EC 1.99.2.5.Laboratory Animal Science: The science and technology dealing with the procurement, breeding, care, health, and selection of animals used in biomedical research and testing.Education, Veterinary: Use for general articles concerning veterinary medical education.Nonheme Iron Proteins: Proteins, usually acting in oxidation-reduction reactions, containing iron but no porphyrin groups. (Lehninger, Principles of Biochemistry, 1993, pG-10)Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Pentanones: 5-carbon straight-chain or branched-chain ketones.Cysteic Acid: Beta-Sulfoalanine. An amino acid with a C-terminal sulfonic acid group which has been isolated from human hair oxidized with permanganate. It occurs normally in the outer part of the sheep's fleece, where the wool is exposed to light and weather.Search Engine: Software used to locate data or information stored in machine-readable form locally or at a distance such as an INTERNET site.Databases, Genetic: Databases devoted to knowledge about specific genes and gene products.Computer Security: Protective measures against unauthorized access to or interference with computer operating systems, telecommunications, or data structures, especially the modification, deletion, destruction, or release of data in computers. It includes methods of forestalling interference by computer viruses or so-called computer hackers aiming to compromise stored data.Confidentiality: The privacy of information and its protection against unauthorized disclosure.Privacy: The state of being free from intrusion or disturbance in one's private life or affairs. (Random House Unabridged Dictionary, 2d ed, 1993)Portal Vein: A short thick vein formed by union of the superior mesenteric vein and the splenic vein.Software: Sequential operating programs and data which instruct the functioning of a digital computer.Indoleamine-Pyrrole 2,3,-Dioxygenase: A dioxygenase with specificity for the oxidation of the indoleamine ring of TRYPTOPHAN. It is an extrahepatic enzyme that plays a role in metabolism as the first and rate limiting enzyme in the kynurenine pathway of TRYPTOPHAN catabolism.Cell Adhesion: Adherence of cells to surfaces or to other cells.Oncogenes: Genes whose gain-of-function alterations lead to NEOPLASTIC CELL TRANSFORMATION. They include, for example, genes for activators or stimulators of CELL PROLIFERATION such as growth factors, growth factor receptors, protein kinases, signal transducers, nuclear phosphoproteins, and transcription factors. A prefix of "v-" before oncogene symbols indicates oncogenes captured and transmitted by RETROVIRUSES; the prefix "c-" before the gene symbol of an oncogene indicates it is the cellular homolog (PROTO-ONCOGENES) of a v-oncogene.Cell Adhesion Molecules: Surface ligands, usually glycoproteins, that mediate cell-to-cell adhesion. Their functions include the assembly and interconnection of various vertebrate systems, as well as maintenance of tissue integration, wound healing, morphogenic movements, cellular migrations, and metastasis.Vascular Cell Adhesion Molecule-1: Cytokine-induced cell adhesion molecule present on activated endothelial cells, tissue macrophages, dendritic cells, bone marrow fibroblasts, myoblasts, and myotubes. It is important for the recruitment of leukocytes to sites of inflammation. (From Pigott & Power, The Adhesion Molecule FactsBook, 1993, p154)Period Circadian Proteins: Circadian rhythm signaling proteins that influence circadian clock by interacting with other circadian regulatory proteins and transporting them into the CELL NUCLEUS.Intercellular Adhesion Molecule-1: A cell-surface ligand involved in leukocyte adhesion and inflammation. Its production is induced by gamma-interferon and it is required for neutrophil migration into inflamed tissue.Neural Cell Adhesion Molecules: Cell adhesion molecule involved in a diverse range of contact-mediated interactions among neurons, astrocytes, oligodendrocytes, and myotubes. It is widely but transiently expressed in many tissues early in embryogenesis. Four main isoforms exist, including CD56; (ANTIGENS, CD56); but there are many other variants resulting from alternative splicing and post-translational modifications. (From Pigott & Power, The Adhesion Molecule FactsBook, 1993, pp115-119)Oxidoreductases Acting on Sulfur Group Donors: Oxidoreductases with specificity for oxidation or reduction of SULFUR COMPOUNDS.Peroxiredoxins: A family of ubiquitously-expressed peroxidases that play a role in the reduction of a broad spectrum of PEROXIDES like HYDROGEN PEROXIDE; LIPID PEROXIDES and peroxinitrite. They are found in a wide range of organisms, such as BACTERIA; PLANTS; and MAMMALS. The enzyme requires the presence of a thiol-containing intermediate such as THIOREDOXIN as a reducing cofactor.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Bromelains: Protein-digesting and milk-clotting enzymes found in PINEAPPLE fruit juice and stem tissue. Enzymes from the two sources are distinguished as fruit bromelain and stem bromelain. This enzyme was formerly listed as EC 3.4.22.4.Bibliometrics: The use of statistical methods in the analysis of a body of literature to reveal the historical development of subject fields and patterns of authorship, publication, and use. Formerly called statistical bibliography. (from The ALA Glossary of Library and Information Science, 1983)Publications: Copies of a work or document distributed to the public by sale, rental, lease, or lending. (From ALA Glossary of Library and Information Science, 1983, p181)Publishing: "The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.Research: Critical and exhaustive investigation or experimentation, having for its aim the discovery of new facts and their correct interpretation, the revision of accepted conclusions, theories, or laws in the light of newly discovered facts, or the practical application of such new or revised conclusions, theories, or laws. (Webster, 3d ed)Biomedical Research: Research that involves the application of the natural sciences, especially biology and physiology, to medicine.PubMed: A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.Neurology: A medical specialty concerned with the study of the structures, functions, and diseases of the nervous system.Organic Chemicals: A broad class of substances containing carbon and its derivatives. Many of these chemicals will frequently contain hydrogen with or without oxygen, nitrogen, sulfur, phosphorus, and other elements. They exist in either carbon chain or carbon ring form.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Sensitivity and Specificity: Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Real-Time Polymerase Chain Reaction: Methods used for detecting the amplified DNA products from the polymerase chain reaction as they accumulate instead of at the end of the reaction.

Effects of nonsulfur and sulfur amino acids on the regulation of hepatic enzymes of cysteine metabolism. (1/64)

To determine the role of nonsulfur vs. sulfur amino acids in regulation of cysteine metabolism, rats were fed a basal diet or diets supplemented with a mixture of nonsulfur amino acids (AA), sulfur amino acids (SAA), or both for 3 wk. Hepatic cysteine-sulfinate decarboxylase (CSDC), cysteine dioxygenase (CDO), and gamma-glutamylcysteine synthetase (GCS) activity, concentration, and mRNA abundance were measured. Supplementation with AA alone had no effect on any of these measures. Supplementation of the basal diet with SAA, with or without AA, resulted in a higher CDO concentration (32-45 times basal), a lower CSDC mRNA level (49-64% of basal), and a lower GCS-heavy subunit mRNA level (70-76%). The presence of excess SAA and AA together resulted in an additional type of regulation: a lower specific activity of all three enzymes was observed in rats fed diets with an excess of AA and SAA. Both SAA and AA played a role in regulation of these three enzymes of cysteine metabolism, but SAA had the dominant effects, and effects of AA were not observed in the absence of SAA.  (+info)

Human cysteine dioxygenase gene: structural organization, tissue-specific expression and downregulation by phorbol 12-myristate 13-acetate. (2/64)

The organization of the human cysteine dioxygenase (CDO) gene was found to be similar to its rat counterpart, and the location of the introns in the protein structure was identical to the rat CDO gene. The major transcription start site, identified by primer extension, was located 260 bp upstream from the ATG codon. The sequence of the 5'-immediate upstream region was highly conserved between the human and rat CDO genes. The putative promoter region contained a TATA-box-like sequence, and many putative cis-acting elements including HNF5, GRE, TRE, CRE, CArG box, ARE, MBS, and NF-kB. A Northern blot analysis revealed that CDO mRNA was strongly expressed in the liver and placenta, and weakly in the heart, brain and pancreas. CDO mRNA was also detected in human hepatoblastoma HepG2 cells. The CDO mRNA level in HepG2 cells was decreased after 2 h and reached a minimum 6 h-8 h after a phorbol 12-myristate 13-acetate (PMA) treatment, and then gradually returned to the basal level.  (+info)

C/EBPbeta, when expressed from the C/ebpalpha gene locus, can functionally replace C/EBPalpha in liver but not in adipose tissue. (3/64)

Knockout of C/EBPalpha causes a severe loss of liver function and, subsequently, neonatal lethality in mice. By using a gene replacement approach, we generated a new C/EBPalpha-null mouse strain in which C/EBPbeta, in addition to its own expression, substituted for C/EBPalpha expression in tissues. The homozygous mutant mice C/ebpalpha(beta/beta) are viable and fertile and show none of the overt liver abnormalities found in the previous C/EBPalpha-null mouse line. Levels of hepatic PEPCK mRNA are not different between C/ebpalpha(beta/beta) and wild-type mice. However, despite their normal growth rate, C/ebpalpha(beta/beta) mice have markedly reduced fat storage in their white adipose tissue (WAT). Expression of two adipocyte-specific factors, adipsin and leptin, is significantly reduced in the WAT of C/ebpalpha(beta/beta) mice. In addition, expression of the non-adipocyte-specific genes for transferrin and cysteine dioxygenase is reduced in WAT but not in liver. Our study demonstrates that when expressed from the C/ebpalpha gene locus, C/EBPbeta can act for C/EBPalpha to maintain liver functions during development. Moreover, our studies with the C/ebpalpha(beta/beta) mice provide new insights into the nonredundant functions of C/EBPalpha and C/EBPbeta on gene regulation in WAT.  (+info)

Cysteine regulates expression of cysteine dioxygenase and gamma-glutamylcysteine synthetase in cultured rat hepatocytes. (4/64)

Rat hepatocytes cultured for 3 days in basal medium expressed low levels of cysteine dioxygenase (CDO) and high levels of gamma-glutamylcysteine synthetase (GCS). When the medium was supplemented with 2 mmol/l methionine or cysteine, CDO activity and CDO protein increased by >10-fold and CDO mRNA increased by 1.5- or 3.2-fold. In contrast, GCS activity decreased to 51 or 29% of basal, GCS heavy subunit (GCS-HS) protein decreased to 89 or 58% of basal, and GCS mRNA decreased to 79 or 37% of basal for methionine or cysteine supplementation, respectively. Supplementation with cysteine consistently yielded responses of greater magnitude than did supplementation with an equimolar amount of methionine. Addition of propargylglycine to inhibit cystathionine gamma-lyase activity and, hence, cysteine formation from methionine prevented the effects of methionine, but not those of cysteine, on CDO and GCS expression. Addition of buthionine sulfoximine to inhibit GCS, and thus block glutathione synthesis from cysteine, did not alter the ability of methionine or cysteine to increase CDO. GSH concentration was not correlated with changes in either CDO or GCS-HS expression. The effectiveness of cysteine was equivalent to or greater than that of its precursors (S-adenosylmethionine, cystathionine, homocysteine) or metabolites (taurine, sulfate). Taken together, these results suggest that cysteine itself is an important cellular signal for upregulation of CDO and downregulation of GCS.  (+info)

The aetiology of idiopathic Parkinson's disease. (5/64)

Agents potentially involved in the aetiology of idiopathic Parkinson's disease are discussed. These include factors regulating dopaminergic neurogenesis (Nurr 1, Ptx-3, and Lmx1b) and related proteins, together with genes involved in familial Parkinson's disease (alpha synuclein, parkin, and ubiquitin carboxy terminal hydroxylase L1), and endogenous and environmental agents.  (+info)

Enzymes and metabolites of cysteine metabolism in nonhepatic tissues of rats show little response to changes in dietary protein or sulfur amino acid levels. (6/64)

In liver, cysteine dioxygenase (CDO), cysteinesulfinate decarboxylase (CSD), and gamma-glutamylcysteine synthetase (GCS) play important regulatory roles in the metabolism of cysteine to sulfate, taurine and glutathione. Because glutathione is released by the liver and degraded by peripheral tissues that express gamma-glutamyl transpeptidase, some peripheral tissues may be exposed to relatively high concentrations of cysteine. Rats were fed diets that contained low, moderate or high concentrations of protein or supplemental cysteine or methionine for 2 wk, and CDO, CSD and GCS activities, concentrations and mRNA levels and the concentrations of cysteine, taurine and glutathione were measured in liver, kidney, lung and brain. All three enzymes in liver responded to the differences in dietary protein or sulfur amino acid levels, but only CSD in kidney and none of the three enzymes in lung and brain responded. Renal CSD activity was twice as much in rats fed the low protein diet as in rats fed the other diets. Changes in renal CSD activity were correlated with changes in CSD concentration. Some significant differences in cysteine concentration in kidney and lung and glutathione and taurine concentrations in kidney were observed, with higher concentrations in rats fed higher levels of protein or sulfur amino acids. In liver, the changes in cysteine level were consistent with cysteine-mediated regulation of hepatic CDO activity, and changes in taurine level were consistent with predicted changes in cysteine catabolism due to the changes in cysteine concentration and CDO activity. Changes in renal and lung cysteine, taurine or glutathione concentrations were not associated with a similar pattern of change in CDO, CSD or GCS activity. Overall, the results confirm the importance of the liver in the maintenance of cysteine homeostasis.  (+info)

Functional characterization and regulation of the taurine transporter and cysteine dioxygenase in human hepatoblastoma HepG2 cells. (7/64)

We investigated the characterization and the regulation of TAUT (taurine transporter) and CDO (cysteine dioxygenase), one of the key enzymes of taurine biosynthesis, in human hepatoblastoma HepG2 cells. The activity of TAUT in the HepG2 cells was evaluated by means of a sodium- and chloride-dependent high-affinity transport system, the characteristics of which were similar to those of the beta amino-acid-specific taurine transport system described previously for various tissues [Uchida, Kwon, Yamauchi, Preston, Marumo and Handler (1992) Proc. Natl. Acad. Sci. U.S.A. 89, 8230-8234; Ramamoorthy, Leibach, Mahesh, Han, Yang-Feng, Blakely and Ganapathy (1994) Biochem. J. 300, 893-900; and Satsu, Watanabe, Arai and Shimizu (1997) J. Biochem. (Tokyo) 121, 1082-1087]. By culturing in a hypertonic medium, the intracellular taurine content of HepG2 cells was markedly increased. Under hypertonic conditions, the activity of TAUT was up-regulated, and the results of the kinetic analysis suggested that this up-regulation was associated with an increase in the amount of TAUT. The expression level of TAUT mRNA was markedly higher than that of the control cells. The expression level of CDO mRNA was also up-regulated under the hypertonic conditions. Culturing the cells in a taurine-rich medium resulted in both the activity of TAUT and the expression level of TAUT mRNA being down-regulated in HepG2 cells. On the other hand, the expression level of CDO mRNA was not affected under a taurine-rich condition. The present results show that both TAUT and CDO were co-operatively regulated in response to hypertonicity, but did not co-operatively respond to the change in extracellular taurine concentration. Generally, the TAUT and taurine biosynthetic enzymes have independent regulatory systems, but under certain conditions, they could be regulated in harmony with each other.  (+info)

Cysteine is the metabolic signal responsible for dietary regulation of hepatic cysteine dioxygenase and glutamate cysteine ligase in intact rats. (8/64)

Cysteine, rather than a precursor or metabolite of cysteine, appears to mediate the upregulation of cysteine dioxygenase (CDO) and the downregulation of glutamate cysteine ligase (GCL) in cultured primary rat hepatocytes. However, similar experiments in intact rats have not been performed to confirm in vivo that changes in hepatic cysteine levels are associated with the regulation of CDO or GCL activity. Therefore, rats were fed a low protein basal diet (100 g casein/kg diet) with or without supplemental sulfur amino acids (8 g cystine, 9 g homocystine or 10 g methionine/kg diet) and with or without propargylglycine (PPG, 1 mmol/kg), an irreversible inhibitor of cystathionine gamma-lyase. Rats were fed the assigned diet for 2 full days and up until the mid-point of the dark cycle on d 3, at which time they were killed for collection of liver. Rats fed the PPG-containing diets had hepatic cystathionine gamma-lyase activities that were approximately 16% of the uninhibited level. PPG treatment reduced CDO activity by 50 and 54%, increased GCL activity by 41 and 61% and lowered total cysteine concentration by 33 and 64% in liver of the homocystine and methionine-supplemented groups, respectively, but not in the cystine-supplemented groups or unsupplemented groups. Glutathione levels were not affected by PPG treatment in any groups. These experiments are consistent with a role for cysteine, rather than a precursor or metabolite of cysteine, in the metabolic signaling responsible for diet-induced regulation of CDO and GCL.  (+info)

*Cysteine dioxygenase

... cysteine sulfinate) by incorporation of dioxygen. Cysteine sulfinic acid lies at a branch-point in cysteine catabolism, where ... Cysteine dioxygenase (CDO, CAS number: 37256-59-0) is a mammalian non-heme iron enzyme that catalyzes the conversion of L- ... cysteine dioxygenase)". Biochimica et Biophysica Acta. 422 (2): 273-9. doi:10.1016/0005-2744(76)90138-8. PMID 2307. Chai SC, ... "Structure and mechanism of mouse cysteine dioxygenase". Proceedings of the National Academy of Sciences of the United States of ...

*Cysteine dioxygenase type 1

Dominy JE, Hwang J, Stipanuk MH (2007). "Overexpression of cysteine dioxygenase reduces intracellular cysteine and glutathione ... Cysteine dioxygenase type 1 is a protein that in humans is encoded by the CDO1 gene. GRCh38: Ensembl release 89: ...

*Sulfinic acid

The enzyme cysteine dioxygenase converts cysteine into the corresponding sulfinite. One product of this catabolic reaction is ...

*Dioxygenase

... cysteine accumulation and cysteine dioxygenase deficiency in the globus pallidus". Ann. Neurol. 18 (4): 482-489. doi:10.1002/ ... non-heme iron dioxygenases are catechol dioxygenases and 2-oxoglutarate (2OG)-dependent dioxygenases. The catechol dioxygenases ... Two dioxygenases, 1H-3-hydroxy-4-oxo-quinoline 2,4-dioxygenase (QDO) and 1H-3-hydroxy-4-oxoquinaldine 2,4-dioxygenase (HDO), ... 3-dioxygenase (TDO) or indoleamine 2,3-dioxygenase (IDO), which are heme dioxygenases that utilize iron coordinated by a heme B ...

*Hypotaurine

... cysteine is first oxidized to its sulfinic acid, catalyzed by the enzyme cysteine dioxygenase. Cysteine sulfinic acid, in turn ... Hypotaurine is derived from cysteine (and homocysteine). In mammals, the biosynthesis of hypotaurine from cysteine occurs in ...

*Taurine

In this pathway, cysteine is first oxidized to its sulfinic acid, catalyzed by the enzyme cysteine dioxygenase. Cysteine ... cysteine dioxygenase, and cysteine sulfinic acid decarboxylase. Hypotaurine is then oxidized to taurine as described above. ... Taurine is derived from cysteine. Mammalian taurine synthesis occurs in the pancreas via the cysteine sulfinic acid pathway. ... Prematurely born infants are believed to lack the enzymes needed to convert cystathionine to cysteine, and may, therefore, ...

*Cystathionine

The cystathionine is then used by the cystathionine gamma-lyase CTH, cysteine dioxygenase CDO, and cysteine sulfinic acid ... Alternately the Cysteine from the cystathionine gamma-lyase CTH gene enzyme can be used by the glutamate-cysteine ligase GCL ... Cystathionine is an intermediate in the synthesis of cysteine. Cystathionine is produced by the transsulfuration pathway which ... It is then cleaved into cysteine and α-ketobutyrate by cystathionine gamma-lyase (lower reaction). Harris Ripps, Wen Shen (2012 ...

*Insect based pet food

This requirement is based off the low enzymatic action of cysteine dioxygenase and cysteine sulphinic acid decarboxylase within ...

*List of MeSH codes (D08)

2-dioxygenase MeSH D08.811.682.690.416.305 --- catechol 2,3-dioxygenase MeSH D08.811.682.690.416.319 --- cysteine dioxygenase ... 2-oxoglutarate 5-dioxygenase MeSH D08.811.682.690.708.673 --- procollagen-proline dioxygenase MeSH D08.811.682.690.708.715 --- ... 4-hydroxyphenylpyruvate dioxygenase MeSH D08.811.682.690.416.333 --- indoleamine-pyrrole 2,3-dioxygenase MeSH D08.811.682.690. ... glutamate-cysteine ligase MeSH D08.811.464.259.850.500 --- glutathione synthase MeSH D08.811.464.263.200 --- amino acyl-trna ...

*List of EC numbers (EC 1)

3-dioxygenase EC 1.13.11.18: sulfur dioxygenase EC 1.13.11.19: cysteamine dioxygenase EC 1.13.11.20: cysteine dioxygenase EC ... 2-dioxygenase EC 1.13.11.38: 1-hydroxy-2-naphthoate 1,2-dioxygenase EC 1.13.11.39: biphenyl-2,3-diol 1,2-dioxygenase EC 1.13. ... 2-dioxygenase EC 1.13.11.2: catechol 2,3-dioxygenase EC 1.13.11.3: protocatechuate 3,4-dioxygenase EC 1.13.11.4: gentisate 1,2- ... 6-dioxygenase EC 1.13.11.10: 7,8-dihydroxykynurenate 8,8a-dioxygenase EC 1.13.11.11: tryptophan 2,3-dioxygenase EC 1.13.11.12: ...

*Rosemary Waring

61 111-124 (2002) Wilkinson, L.J. and Waring, R.H., "Cysteine dioxygenase: modulation of expression in human cell lines by ...

*CDO

... may refer to: CDO (company), a Filipino food company Cysteine dioxygenase, an enzyme CDO, trade name of chlordiazepoxide ...

*Cysteine sulfinic acid

... cysteine is oxidized to cysteine sulfinic acid , catalyzed by the enzyme cysteine dioxygenase. Cysteine sulfinic acid, in turn ... Cysteine sulfinic acid is derived from cysteine. In the cysteine sulfinic acid pathway, ... Cysteine sulfinic acid is an amino acid containing a sulfinic acid functional group. It is a white solid that is soluble in ... It is an intermediate in cysteine metabolism. It is not a coded amino acid, but is produced post-translationally. ...

*Aromatic-ring-hydroxylating dioxygenases

In the [Fe2S2] center, Fe1 is coordinated by two cysteine residues (Cys-81 and Cys-101) while Fe2 is coordinated by Nδ atoms of ... In the phthalate 4,5-dioxygenase system, phthalate dioxygenase reductase (PDR) has the same function. PDR is a single protein ... "Structure of an aromatic-ring-hydroxylating dioxygenase - naphthalene 1,2-dioxygenase". Structure. 6 (5): 571-586. doi:10.1016/ ... Aromatic-ring-hydroxylating dioxygenases (ARHD) incorporate two atoms of dioxygen (O2) into their substrates in the ...

*Ferredoxin

They are proteins of around one hundred amino acids with four conserved cysteine residues to which the 2Fe-2S cluster is ... In hydroxylating bacterial dioxygenase systems, they serve as intermediate electron-transfer carriers between reductase ... Most contain at least one conserved domain, including four cysteine residues that bind to a [Fe4S4] cluster. In Pyrococcus ... phthalate dioxygenase reductase (C-terminal), succinate dehydrogenase iron-sulphur protein (N-terminal), and methane ...

*Metalloprotein

In these proteins, the zinc ion is usually coordinated by pairs of cysteine and histidine side-chains. There are two types of ... Bioinorganic chemistry Biometal Coenzyme Cofactor Dioxygenase Hemoproteins Metalloproteinase Ribozyme Deoxyribozyme Siderophore ... The active site contains an iron ion coordinated by the sulfur atoms of four cysteine residues forming an almost regular ... Especially important are the imidazole substituent in histidine residues, thiolate substituents in cysteine residues, and ...

*EGF-like domain

Several cysteine residues within this sequence form disulfide bridges. cbEGF-like domains show no significant structural ... Both modifications are catalyzed by the dioxygenase Asp/Asn-beta-hydroxylase, and are unique to EGF domains in eukaryotes. ... The EGF-like domain includes 6 cysteine residues which in the epidermal growth factor have been shown to form 3 disulfide bonds ...

*Chromosome 7 (human)

... scavenger receptor cysteine rich family member with 4 domains STEAP1: six transmembrane epithelial antigen of the prostate 1 ... 2-oxoglutarate 5-dioxygenase 3 POM121: POM121 transmembrane nucleoporin POP7: ribonuclease P protein subunit p20 PPP1R17: ...

*Chromosome 12 (human)

Cysteine and glycine-rich protein 2 DDX23: DEAD-box helicase 23 DDX47: DEAD-box helicase 47 DHH: Desert hedgehog protein DPPA3 ... 4-hydroxyphenylpyruvate dioxygenase IFFO1: encoding protein Intermediate filament family orphan 1 KANSL2: encoding protein KAT8 ... or cysteine) peptidase inhibitor, clade A, member 3F SLC8B1: solute carrier family 8 member B1 TBC1D15: encoding protein TBC1 ...

*Arachidonate 5-lipoxygenase

... which bind the sulfur of cysteine's thio (i.e. SH) residue in the tripeptide glutamate-cysteine-glycine to carbon 6 of LTA4 ... ALOX5's dioxygenase activity adds a hydroperoxyl (i.e. HO2) residue to arachidonic acid (i.e. 5Z,8Z,11Z,14Z-eicosatetraenoic ...

*Rieske protein

... aromatic-ring-hydroxylating dioxygenases (phthalate dioxygenase, benzene, naphthalene and toluene 1,2-dioxygenases) and ... One iron atom of the Rieske [Fe2S2] cluster in the domain is coordinated by two cysteine residues and the other is coordinated ... cluster in that one of the two Fe atoms is coordinated by two histidine residues rather than two cysteine residues. They have ... X-ray structure of Rieske-type ferredoxin associated with biphenyl dioxygenase from Burkholderia cepacia PDB: 1G8J​ - X-ray ...

*Sulfur metabolism

The amino acids cysteine and methionine are used by the body to make glutathione. Excess cysteine and methionine are oxidized ... Sulfur oxidizers utilize enzymes such as Sulfide:quinone reductase, sulfur dioxygenase and sulfite oxidase to oxidize sulfur ... Animals obtain sulfur from cysteine and methionine in the protein that they consume. Sulfur is the third most abundant mineral ... From the sulfide they form the amino acids cysteine and methionine, sulfur lipids, and other sulfur compounds. ...

*Cystamine

de Toranzo, E.G.D.; Marzi, A.; Castro, J.A. (1981). "Effects of cysteine and cystamine on the carbon tetrachloride induced ... Cysteamine is then oxidized to hypotaurine, this is done by the enzyme dioxygenase. The now formed hypotaurine is finally ...

*Hemoglobin

NO binds reversibly to a specific cysteine residue in globin; the binding depends on the state (R or T) of the hemoglobin. The ... The latter reaction is a remnant activity of the more ancient nitric oxide dioxygenase function of globins. Carbon dioxide ...

*Chromosome 1 (human)

Cysteine and glycine rich protein 1 DDX59: DEAD-box helicase 59 DPT: Dermatopontin DISC2, long non-coding RNA DUSP10 (1q41) ... 2-oxoglutarate 5-dioxygenase 1 PRMT6: Protein arginine methyltransferase 6 PSRC1: Proline/serine-rich coiled-coil protein 1 ... Sperm mitochondrial-associated cysteine-rich protein SMG7: nonsense mediated mRNA decay factor SMYD3 (1q44) SPG23 SPRR1A: ...

*Cinnamoyl-CoA reductase

... but evidence suggests that a cysteine residue may play the role of thiolate proton donor. Phylogenomic analysis indicates that ... "Scopoletin is biosynthesized via ortho-hydroxylation of feruloyl CoA by a 2-oxoglutarate-dependent dioxygenase in Arabidopsis ...
Cysteine dioxygenase (CDO) is a mononuclear ferrous enzyme located at a branch-point in cysteine metabolism and catalyzes the oxidation of L-cysteine using both atoms of dioxygen. Although several studies have attempted to characterize the enzyme kinetically, efforts have been thwarted by the apparent inactivation of the purified protein. Publication of the three-dimensional structure of several mammalian CDO enzymes revealed two unusual structural attributes that had previously not been identified in other mononuclear ferrous-dependent enzymes. The metal center of CDO is bound by a facial triad composed entirely of histidine residues in contrast to the previously ubiquitous 2-His/1-carboxylate facial triad found in other ferrous-dependent enzymes. Interestingly, a covalent linkage between Cys93 and Tyr157 was found near the metal center in the active site. The purpose of these studies is to probe the cause of inactivation of purified CDO and to determine how the 3-His facial triad and Cys-Tyr ...
Initiates several important metabolic pathways related to pyruvate and several sulfurate compounds including sulfate, hypotaurine and taurine. Critical regulator of cellular cysteine concentrations. Has an important role in maintaining the hepatic concentation of intracellular free cysteine within a proper narrow range ...
Global antibody supplier and research reagent supplier to the life science community. Find antibodies and reagents all backed by our Guarantee+.
A potential biomarker [homocysteine] tHcy for PhIP exposure, in our susceptibility to or protection from all kinds of disease between: homocysteine in alternate bodies permutation of the first body. That lowering the plasma homocysteine concentration improves the Pyrroles (natural product CJ-12662 OMIM)/ADO-pharmacology and cognitive function in healthy older people. Co-modulators responsible for the metabolism of Xenobiotics [ cruciferous vegetable] with PhIP. Histidine and methionine residues on the protein surface bind to surface but only the p-cymene complex can gain entry to the crevice containing the free cysteine thiolate and induce oxidation to sulfinate. Many biological effects controlled by taurine biosynthetic enzymes cysteine dioxygenase (CDO) and cysteine sulfinate decarboxylase ((CSD) and taurine transporter (TauT). Cu (Copper) deficiency does not affect body taurine status. Cu non-specifically bound copper catalysis conversion of sulfite to sulfate* via sulfite oxidase (SO) was ...
Complete information for CDO1 gene (Protein Coding), Cysteine Dioxygenase Type 1, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
TY - JOUR. T1 - Impaired metabolomics of sulfur-containing substances in rats acutely treated with carbon tetrachloride. AU - Kim, Sun Ju. AU - Kwon, Do Young. AU - Choi, Kwon Hee. AU - Choi, DalWoong. AU - Kim, Young Chul. PY - 2008/12/1. Y1 - 2008/12/1. N2 - Impairment of hepatic metabolism of sulfur-containing amino acids has been known to be linked with induction of liver injury. We determined the early changes in the transsulfuration reactions in liver of rats challenged with a toxic dose of CCl4 (2 mmol/kg, ip). Both hepatic methionine concentration and methionine adenosyltransferase activity were increased, but S-adenosylmethionine level did not change. Hepatic cysteine was increased significantly from 4 h after CCl4 treatment. Glutathione (GSH) concentration in liver was elevated in 4̃8 h and then returned to normal in accordance with the changes in glutamate cysteine ligase activity. Cysteine dioxygenase activity and hypotaurine concentration were also elevated from 4 h after the ...
#ORF IDProtein NameSource OrganismMWAssay cytoplasmic dynein light chainM. musculus unknown protein At1g A. thaliana thioredoxin h1A. thaliana12673 Spec assay following NADPH/insulin-DS redox reaction zinc finger proteinH. sapiens unknown heme-binding proteinC. merolae16474Red-colored from heme binding 62361unknown protein At1g A. thaliana unknown protein At3g A. thaliana thioredoxin-like proteinA. thaliana allene oxide cyclase variant1A. thaliana allene oxide cyclase variant2A. thaliana cysteine dioxygenase 1M. musculus23026HLPC assay for cysteine sulfinic acid formation 12605phosphataseA. thaliana24537pNPP phosphatase assay Enhanced C3 green fluorescent proteinA. victoria26748Green/fluorescent TEV proteaseTobacco etch virus26922Fluoresence anisotropy-based protease assay Pre-mRNA processing factor 24S. cerevisiae27223Gel mobility shift assay sarcosine dimethylglycine methyltransferaseG. sulphuraria33324 Coupled spec. assay following deamination of adenine glyoxylate/hydroxypyruvate reductaseH.
Close The Infona portal uses cookies, i.e. strings of text saved by a browser on the users device. The portal can access those files and use them to remember the users data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser. ...
The CDO Server uses hsqldb as a default. To change this to mysql (or another database) change the properties inside the cdo-server.xml file in the org.eclipse.emf.cdo.examples.hibernate.server/config. The file contains a commented block for mysql, change the url/passwords etc. to fit it to your situation. Note that for mysql and most other databases Hibernate will not create the database itself for you. So you need to manually create a database and set the database name in the url in the cdo-server.xml. As a next step create your own junit test case in the org.eclipse.emf.cdo.examples.hibernate.client project, extend the BaseTest class in that same plugin. You can also try the standard CDO View. ...
The CDO Server uses hsqldb as a default. To change this to mysql (or another database) change the properties inside the cdo-server.xml file in the org.eclipse.emf.cdo.examples.hibernate.server/config. The file contains a commented block for mysql, change the url/passwords etc. to fit it to your situation. Note that for mysql and most other databases Hibernate will not create the database itself for you. So you need to manually create a database and set the database name in the url in the cdo-server.xml. As a next step create your own junit test case in the org.eclipse.emf.cdo.examples.hibernate.client project, extend the BaseTest class in that same plugin. You can also try the standard CDO View. ...
See which CDOs exchanged pieces with other CDOs through our interactive feature that reveals the incestuous nature of Wall Streets CDO business.
According to the study, the first enzyme catalyzes the reaction, which adds two oxygen atoms to the first amino acid of the ERF protein. This first amino acid at the N-terminus (also known as amino terminus) of ERFs is cysteine. The Flashman lab proved that a plant cysteine oxidase (PCO) catalyzes this oxidation and that this oxidation occurs in a single step. So far, this PCO is the first discovered plant cysteine dioxygenase.. The oxidation of the cysteine to cysteine sulfinic acid tags the ERF protein for the attack by the second enzyme. The lab headed by Nico Dissmeyer identified the second enzyme as arginine transferase. The arginine transferase recognizes the cysteine sulfinic acid residue as its substrate and adds one arginine molecule to the N-terminus of the ERF protein.. Proteins with arginine at their N-terminus often have a extremely short life span because their N-terminus marks them for degradation. The proteasome related enzymes recognize the arginine at the end of the ERFs and ...
Thus, the two substrates of this enzyme are L-cysteine and [[[enzyme]-cysteine]], whereas its two products are L-alanine and [[[enzyme]-S-sulfanylcysteine]]. This enzyme belongs to the family of transferases, specifically the sulfurtransferases, which transfer sulfur-containing groups. The systematic name of this enzyme class is L-cysteine:[enzyme cysteine] sulfurtransferase. Other names in common use include IscS, NIFS, NifS, SufS, and cysteine desulfurylase. This enzyme participates in thiamine metabolism. ...
Autor: Riemenschneider, A. et al.; Genre: Zeitschriftenartikel; Im Druck veröffentlicht: 2005; Keywords: arabidopsis thaliana|br/|cysteine|br/|desulfhydrase|br/|h2s|br/|o-acetyl-l-serine|br/|acetylserine thiol lyase|br/|arabidopsis-thaliana|br/|brassica-oleracea|br/|atmospheric h2s|br/|sulfur source|br/|protein|br/|plants|br/|mitochondrial|br/|sulfide|br/|biosynthesis; Titel: Impact of elevated H2S on metabolite levels, activity of enzymes and expression of genes involved in cysteine metabolism
This review summarizes the recent discovery of the cupin superfamily (from the Latin term "cupa," a small barrel) of functionally diverse proteins that initially were limited to several higher plant proteins such as seed storage proteins, germin (an oxalate oxidase), germin-like proteins, and auxin-binding protein. Knowledge of the three-dimensional structure of two vicilins, seed proteins with a characteristic beta-barrel core, led to the identification of a small number of conserved residues and thence to the discovery of several microbial proteins which share these key amino acids. In particular, there is a highly conserved pattern of two histidine-containing motifs with a varied intermotif spacing. This cupin signature is found as a central component of many microbial proteins including certain types of phosphomannose isomerase, polyketide synthase, epimerase, and dioxygenase. In addition, the signature has been identified within the N-terminal effector domain in a subgroup of bacterial AraC ...
A green and efficient adsorbent for adsorption of palladium ions was prepared from 2,3-dialdehyde cellulose (DAC) originating from nanocellulose from the green algae Cladophora. The DAC was functional
Many of the ADCs currently in clinical and preclinical development are based on LDs that are present in either brentuximab-vedotin (auristatins) or T-DM1 (maytansinoids; refs. 1, 2). The TI of the current ADCs on the market is limited and does indicate the need for new-generation LDs with greater benefit/safety ratios. We have developed a LD technology based on the highly potent cytotoxic duocarmycin class of compounds that is bound in an inactive form to a cleavable linker that is highly stable in human plasma but sensitive to proteases in the tumor. We have evaluated this technology by profiling a HER2-targeting ADC, SYD983, based on the mAb trastuzumab and vc-seco-DUBA, one of our new generation LDs.. SYD983 was selected as the best performing ADC from a series of related ADCs profiled in a Lead Optimization program. Because conjugation occurs randomly on cysteine residues, SYD983 has a theoretical DAR distribution encompassing DAR0, 2, 4, 6, and 8 species. Higher DAR species (DAR6 and DAR8) ...
CHORDC1 - CHORDC1 (untagged)-Human cysteine and histidine-rich domain (CHORD) containing 1 (CHORDC1), transcript variant 2 available for purchase from OriGene - Your Gene Company.
Your shown homocysteine pathway is way too simple. Especially the production of the neuromodulator H2S from excess sulfur amino acids is not shown. In the last years many more enzymes and reactions have been discovered. I have summarized human sulfur amino acid metabolism in reactome.org, so please use this link to discover all the details and new papers. Ill also append some of the relevant papers below.. Brosnan, JT, Brosnan, ME The sulfur-containing amino acids: an overview 2006 J Nutr PMID 16702333. Remethylation of homocysteine to methionine can also happen using betaine as a methyl donor. This reaction is also part of choline catabolism.. Li, F, Feng, Q, Lee, C, Wang, S, Pelleymounter, LL, Moon, I, Eckloff, BW, Wieben, ED, Schaid, DJ, Yee, V, Weinshilboum, RM Human betaine-homocysteine methyltransferase (BHMT) and BHMT2: common gene sequence variation and functional characterization 2008 Mol Genet Metab PMID 18457970. Bearden, SE, Beard RS, Jr, Pfau, JC Extracellular transsulfuration ...
Glutathione, present in low millimolar concentrations in most cells, constitutes the chief water-soluble intracellular oxidant scavenger, protecting the membranes, DNA and proteins of oxidatively stressed tissues. (Ascorbate is likewise of importance in this regard.) It also opposes the proinflammatory/proapoptotic signalling effects of hydrogen peroxide, both by enabling the degradation of this compound via glutathione peroxidase and by working with glutaredoxin to promote the restoration of sulfenic acids to sulfhydryl form.36-40 As we have seen, it can also oppose IL-1β-induced inflammation via its inhibitory impact on NSMase-2. A further role of glutathione is to aid excretion of relatively hydrophobic compounds via conjugation reactions catalysed by glutathione-S-transferases.41. Intracellular cysteine availability is rate limiting for glutathione synthesis, such that increased cysteine levels boost this synthesis.42 N-acetylcysteine (NAC) is a venerable nutraceutical which acts as a ...
Patients with certain neurodegenerative disorders such as Parkinsons disease and dementia show excessive accumulation of iron in the brain. It has been postulated that these iron deposits damage neurons by inducing oxidative stress, but whether they are a cause or consequence of the disease process is unclear.. Curtis et al. report that the causative mutation in a family with adult-onset basal ganglia disease lies in a gene encoding a subunit of ferritin, a protein that functions in both storage and detoxification of iron. In a study of patients with Hallervorden-Spatz syndrome, an early-onset neurodegenerative disorder, Zhou et al. find that the culprit gene encodes pantothenate kinase (PANK), an essential regulatory enzyme in coenzyme A biosynthesis. The disease-associated mutations in PANK might alter iron levels in the brain indirectly through effects on cysteine levels. Further studies of these new disease genes will be needed to understand the role iron metabolism plays in ...
But hey, nobodyd asked me to yak on about this, so Ill just let these folks share with you folks instead - in the latest episode of "Toy Geeks: Behind The Counter" with the continued "Road To Comic-Con" - featuring Sarah Jo Marks from DKE Toys introducing their SDCC-Exclusives (which Ive featured #onTOYSREVIL, actually) - all of which (except for one) are glorious "APPROPO-TOYS"! (Hey, at the very least its become a new label/tag on the TOYSREVIL-blog, innit?) ...
The mission of the Messens lab is to establish a detailed functional and structural view on the mode of action of the proteins involved in surviving oxidative stress by exploring the electron transfer redox pathways that tightly control sulfur oxygen signaling through reversible switch mechanisms on cysteines and methionines in pathogenic Actinomycetes and plants. Several oxidoreductase proteins, which successively pass on electrons via complex intra- and intermolecular cascades using thiol-disulfide chemistry, are involved. We want to understand how redox-regulated checkpoints are embedded into a variety of metabolic pathways and how cells rapidly switch between distinct catabolic or anabolic processes, protect particularly vulnerable intermediates, and activate survival pathways in response to oxidative stress. Ultimately, we want to translate our knowledge back to the cell or the crop, so that we can cure infectious diseases or design crops that survive extreme conditions.. ...
where to buy tinidazole The HIE funding that has contributed to staff wages for 3 years comes to an end in September 2013, and all the CDOs have been asked what they consider their top achievements are. The list from Corinne includes:. http://shellystearooms.com/ - At least £69,500 additional grant funding brought into Westray through applications written by the CDO for WDT and several other community groups. source link - doing the groundwork with DSL to set up the successful loan management partnership;. - being part of the process of the trust obtaining Unit 1;. - contributing strongly to improving the communications with the community through the website and Whats on contributions (which started with a very small CDO column). - keeping focussed on the need to be accountable with PEG and grant processes. - More recently, my continued liaison with Orkney College has helped WDT get things moving in the Learning Centre (including the promise of new computers from Orkney College!). - as the ...
Dhe, ndërsa ata po bisedonin për këto gjëra,vetë Jezusi u shfaq në mes tyre dhe u tha: "Paqja me ju!Luka 24;36. Selam alejkum = Paqja qoftë me ju .E njëjta përshëndetje si për të krishterë, edhe për muslimanë...... NJË ZOT.....NJË MESAZH Kush nuk gjen arsye te buzeqeshe ne jeten e tij, le ti mbylle syte per dhjete minuta, qe te kuptoje se vetem drita e syve meriton buzeqeshjen me te gjate. Sa i cuditshem eshte njeriu, kur ben dua, mendon se Allahu eshte afer. Ndersa kur ben mekat, mendon se Allahu eshte larg! Asnje fabrike nuk prodhon kyc pa celes. Ai qe te krijoi ty sigurisht qe per cdo problem ka krijuar dhe nje "celes".Per cdo semundje, Zoti ka caktuar dhe ilacin.Zoti u ndihmofte te gjeni celesin e cdo problemi! Jeta eshte nje treg i madh,qe ti ben pazar ne te e merr cfare deshiron. Por mos harro se ke per te paguar cmimin per cdo gje qe ke marre. ...
The main benefits of cysteine include the prevention of cancer growths in some of the bodys tissues, the treatment of poisoning...
A calpain (/ˈkælpeɪn/; EC 3.4.22.52, EC 3.4.22.53) is a protein belonging to the family of calcium-dependent, non-lysosomal cysteine proteases (proteolytic enzymes) expressed ubiquitously in mammals and many other organisms. Calpains constitute the C2 family of protease clan CA in the MEROPS database. The calpain proteolytic system includes the calpain proteases, the small regulatory subunit CAPNS1, also known as CAPN4, and the endogenous calpain-specific inhibitor, calpastatin. The history of calpain originates in 1964, when calcium-dependent proteolytic activities caused by a "calcium-activated neutral protease" (CANP) were detected in brain, lens of the eye and other tissues. In the late 1960s the enzymes were isolated and characterised independently in both rat brain and skeletal muscle. These activities were caused by an intracellular cysteine protease not associated with the lysosome and having an optimum activity at neutral pH, which clearly distinguished it from the cathepsin family ...
Hydrated encysted embryos of the brine shrimp Artemia franciscana have the ability to withstand years in anaerobic sea water using metabolic strategies that enable them to inactivate all cell metabolic activities and then to resume development when placed in aerobic sea water. However, this unique characteristic of Artemia franciscana embryos is lost during a very short period, at the embryonic­larval transition period of development, coincident with the appearance of prenauplius larvae. Thus, while encysted embryos show complete inhibition of proteolysis over at least 4 years under anoxia, control of this activity, together with resistance to anoxia, is lost in newly hatched nauplius larvae after only a few days in anaerobic sea water. In contrast to encysted embryos, young larvae in anaerobic sea water produce large amounts of lactic acid, which reaches a concentration of nearly 50 mmol l-1 within 12 h of incubation. The accumulated lactic acid is believed to reduce the intracellular pH ...
California sometime this year could be the latest state to hire a chief data officer (CDO). The recommendation is part of pending legislation.
Dhe, ndërsa ata po bisedonin për këto gjëra,vetë Jezusi u shfaq në mes tyre dhe u tha: "Paqja me ju!Luka 24;36. Selam alejkum = Paqja qoftë me ju .E njëjta përshëndetje si për të krishterë, edhe për muslimanë...... NJË ZOT.....NJË MESAZH Kush nuk gjen arsye te buzeqeshe ne jeten e tij, le ti mbylle syte per dhjete minuta, qe te kuptoje se vetem drita e syve meriton buzeqeshjen me te gjate. Sa i cuditshem eshte njeriu, kur ben dua, mendon se Allahu eshte afer. Ndersa kur ben mekat, mendon se Allahu eshte larg! Asnje fabrike nuk prodhon kyc pa celes. Ai qe te krijoi ty sigurisht qe per cdo problem ka krijuar dhe nje "celes".Per cdo semundje, Zoti ka caktuar dhe ilacin.Zoti u ndihmofte te gjeni celesin e cdo problemi! Jeta eshte nje treg i madh,qe ti ben pazar ne te e merr cfare deshiron. Por mos harro se ke per te paguar cmimin per cdo gje qe ke marre. ...
GenBank) Acireductone dioxygenase; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase; DHK-MTPene dioxygenase; Acireductone ...
Detect and quantitate human cysteine rich angiogenic inducer 61 (CYR61) in serum and cell culture medium using a homogeneous AlphaLISA no-wash assay.
[80 Pages Report] Check for Discount on Global L- Cysteine Market Data Survey Report 2025 report by HeyReport. Summary Cysteine (abbreviated as Cys or C) is an a-...
References for Abcams Recombinant rat FGF9 protein (ab78476). Please let us know if you have used this product in your publication
putative 3,5-dihydroxyphenylacetyl-CoA 1,2-dioxygenase [hydroxyacyl-dehydrogenase] GTGACCACGGATTCCCCGACGCTGTCGCTTTCGCCGGGGCTCGACCATCGAGCCCTGGCG AAGGCGGCACAGCGTGTCGACGAGCTGCTCGACGGGTTGCCGTCGCCCTCGGCCAGGACG CCCGCGCAGCGTGAGGCCGCGTCCTCGGCGCTGGACGAGATCAGGGCGGCGCGGACGGAG TACGTGGAAGCGCACGCCGAGGAGATCTACGACCGGCTCACCGACGGCCGCACCCGCTAT CTACGCCTCGACGAACTCGTCCGGGCCGCCGCGTCGGCCTATCCCGGCCTGGTGCCCACG GAGGCGCAGATGGCGGCCGAGCGGTCCCGACGGCAGGCGGAGAAGGAAGGCCGTGAGATC GATCAGGGCATTTTCCTGCGCGGGATCCTGAGCGCGCCGAAAGCCGGGCCGCATCTGCTC GACGCCATGCTCAGGCCCACCGCCAGGGCGCTGGAGCTGCTGCCGGAGTTCGTCGAGACC GGTGTGGTGCGGATGGAGGCCGCCTCCCTGGAGCGCCGTGACGGCGTCGCGTACCTGACC CTGTGCCGGGACGACTGCCTGAACGCCGAGGACGCCCAGCAGGTCGACGACATGGAGACC GCGGTCGATCTGGCGCTGCTCGACCCGGCCGTCCGGGTGGGGATGCTGCGGGGCGGCGTG ATGAGCCATCCCCGGTACGCGGGGCGCCGGGTGTTCTGCGCGGGGATCAACCTCAAGAAG CTGAGTTCGGGCGACATCCCGCTCGTCGATTTCCTCCTGCGGCGGGAATTGGGCTATATC CACAAGATCGTGCGCGGGGTGGCCACGGACGGTTCGTGGCGAGCACGGGTGATCGACAAG CCCTGGCTGGCGGCCGTCGATTCCTTCGCCATCGGGGGCGGGGCCCAGCTCCTGCTGGTC ...
Graphical abstract: Layer-stack hexagonal cadmium oxide (CdO) micro-rods were prepared. - Highlights: • Novel hexagonal layer-stack structure CdO micro-rods were synthesized by a thermal evaporation method. • The pre-oxidation, vapor pressure and substrate nature play a key role on the formation of CdO rods. • The formation mechanism of CdO micro-rods was explained. - Abstract: Novel layer-stack hexagonal cadmium oxide (CdO) micro-rods were prepared by pre-oxidizing Cd granules and subsequent thermal oxidation under normal atmospheric pressure. X-ray diffraction (XRD) and scanning electron microscopy (SEM) were performed to characterize the phase structure and microstructure. The pre-oxidation process, vapor pressure and substrate nature were the key factors for the formation of CdO micro-rods. The diameter of micro-rod and surface rough increased with increasing of thermal evaporation temperature, the length of micro-rod increased with the increasing of evaporation time. The formation of ...
Title: Pharmacological Modulation of Caspase Activation. VOLUME: 4 ISSUE: 4. Author(s):Ute Fischer and Klaus Schulze-Osthoff. Affiliation:Institute of Molecular Medicine, University of Dusseldorf, Building 23.12, Universitatsstr. 1, D-40225Dusseldorf, Germany.. Keywords:apoptosis, caspase, smac, inhibitor, therapy. Abstract: Deregulation of apoptosis resulting either in inappropriate loss or accumulation of cells is a major cause of many severe pathological conditions such as cancer, autoimmune diseases, microbial infections and degenerative disorders. Consequently, great interest has emerged in devising therapeutic strategies for intervening with cell death, either in a pro- or antiapoptotic direction. Among the different apoptosis-based drug targets, caspases, a family of intracellular cysteine proteases are most promising candidates, because they form the central core of the apoptotic machinery that coordinate cell death from various signals. Inappropriate cell death can be efficiently ...
It has been suggested that taurine, hypotaurine and their metabolic precursors (cysteic acid, cysteamine and cysteinesulphinic acid) might act as antioxidants in vivo. The rates of their reactions with the biologically important oxidants hydroxyl radical (.OH), superoxide radical (O2.-), hydrogen peroxide (H2O2) and hypochlorous acid (HOCl) were studied. Their ability to inhibit iron-ion-dependent formation of .OH from H2O2 by chelating iron ions was also tested. Taurine does not react rapidly with O2.-, H2O2 or .OH, and the product of its reaction with HOCl is still sufficiently oxidizing to inactivate alpha 1-antiproteinase. Thus it seems unlikely that taurine functions as an antioxidant in vivo. Cysteic acid is also poorly reactive to the above oxidizing species. By contrast, hypotaurine is an excellent scavenger of .OH and HOCl and can interfere with iron-ion-dependent formation of .OH, although no reaction with O2.- or H2O2 could be detected within the limits of our assay techniques. ...
Read "Efficient, solvent-free synthesis of acridinediones catalyzed by CdO nanoparticles, Research on Chemical Intermediates" on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
Jora Gill has moved from a career as a CTO to become the first Chief Digital Officer (CDO) of the well respected business newspaper The Economist.
DKE TOYS PRESS: "Special Ed Toys has a very special set of figures just in time for election season. The classic good vs evil political fight is on. This one is a little more cut and dry compared to real life. Set comes with two customized 3.75" figures on card." ...
Hello and welcome to our scrap blog. My names Foxy, I am 39 years of age and I live in Pennsylvania. I am a mother of 2 lovely girls ages 10 and 22, and a Proud Grandmother to a beautiful Little Girl Braylin . I Love working in psp and decided to start Digital Scrapping and then it turned into a addiction. I hope you all like what I Create and come back again. ...
Hello and welcome to our scrap blog. My names Foxy, I am 39 years of age and I live in Pennsylvania. I am a mother of 2 lovely girls ages 10 and 22, and a Proud Grandmother to a beautiful Little Girl Braylin . I Love working in psp and decided to start Digital Scrapping and then it turned into a addiction. I hope you all like what I Create and come back again. ...
References for Abcams Recombinant rat CHM protein (ab91070). Please let us know if you have used this product in your publication
This discussion is about Optimistic Concurrency Control technique implemented in CDO and how it can be customized to suit our needs. ...
This discussion is about Optimistic Concurrency Control technique implemented in CDO and how it can be customized to suit our needs. ...
Apoptosis is a highly conserved process which can be triggered by a broad range of physiological and pathological conditions. Recent evidence suggests that most proapoptotic stimuli induce the activation of a family of intracellular cysteine proteases called caspases ((1), (2)). These proteases are synthesized as inactive proenzymes which, upon proteolytic cleavage at aspartate residues, form an active complex composed of two heterodimeric subunits. Caspases lead to the proteolysis of a number of cellular substrates, a process which finally results in the apoptotic collapse of the cell.. One of the best-defined apoptotic pathways is mediated by the death receptor CD95 (APO-1/Fas; references (3)-(5)). Triggering of CD95 by its natural ligand CD95L or agonistic antibodies induces the formation of a death-inducing signaling complex (DISC) consisting of the adaptor protein Fas-associated death domain protein (FADD [MORT-1]) and procaspase-8 (FADD-like IL-1β-converting enzyme [FLICE, Mch5]) ...
The present studies are based on the premise that pulmonary injury, during periods of hypoxia, ischemia, and reperfusion, may be due to increased production of reactive oxygen species, including the superoxide anion (02--), hydroxyl radical (-OH), and hydrogen peroxide (H202), and on the premise that this injury can be ameliorated by antioxidant pre-treatment. The sulfur-containing (β-amino acids, taurine and its precursor, hypotaurine, have been shown indirectly to possess antioxidant properties by several investigators. The mechanism(s) by which taurine and hypolaurine exert their antioxidant effects has(have) remained unclear despite many years of intensive study, as does the precise physiological role for these two β-amino acids. The goals of the present study were: 1) to evaluate the effects of taurine and hypolaurine in experiments that model biochemical events which are believed to be important components of oxidative pulmonary injury; 2) to assess the potential antioxiodant ability ...
Shop Flavanone 3-dioxygenase ELISA Kit, Recombinant Protein and Flavanone 3-dioxygenase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Perform reliable qPCR with Bio-Rads pre-validated CDO1 primer pair, for the Human genome. Designed for SYBR Green-based detection.
Hello and welcome to our scrap blog. My names Foxy, I am 39 years of age and I live in Pennsylvania. I am a mother of 2 lovely girls ages 10 and 22, and a Proud Grandmother to a beautiful Little Girl Braylin . I Love working in psp and decided to start Digital Scrapping and then it turned into a addiction. I hope you all like what I Create and come back again. ...
This enzyme catalyses a step in the pathway of phenylpropanoid compounds degradation. It catalyses the insertion of both atoms of molecular oxygen into positions 2 and 3
TY - JOUR. T1 - Relationship between L-tryptophan uptake and L-tryptophan, 2,3-dioxygenase activity in rat hepatocytes. AU - Saito, Kuniaki. AU - Ohta, Y.. AU - Nagamura, Y.. AU - Sasaki, E.. AU - Ishiguro, I.. PY - 1990/2/7. Y1 - 1990/2/7. N2 - The relationship between L-tryptophan uptake and tryptophan 2,3-dioxygenase activity in hepatocytes was examined and compared with the change of hepatic L-leucine, L-phenylalanine, and L-tyrosine uptakes using isolated hepatocytes of rats in which the oxygenase was induced with L-tryptophan or hydrocortisone. In L-tryptophan- or hydrocortisone-treated rat hepatocytes, the rate of L-tryptophan uptake into hepatocytes via the saturable high-affinity transport component significantly increased but the hepatic uptake rate of L-leucine did not change at all. In hydrocortisone-treated rat hepatocytes, a little stimulated hepatic uptake of L-phenylalanine or L-tyrosine was observed. In the stimulated hepatic uptake of L-tryptophan via the high-affinity ...
Gamma glutamyl transpeptidase (GGT) is a transferase, which is of great importance in sustaining intracellular cysteine and glutathione levels. The abnormal expression of GGT is significantly associated with features of many metabolic syndromes (e.g., hepatocellular carcinoma). Therefore, it is essential to develop methods to detect GGT so as to monitor the physiological or pathological phenomena related to this species. In this work, by making use of a complex formed by Cu2+ and glutathione, which may exhibit excellent voltammetric response, we have proposed a novel potential electrochemical method for the detection of the enzyme. Results show that in the presence of GGT, the formation of Cu2+-glutathione complex on a working electrode will be disrupted, resulting in greatly depressed electrochemical signals. The primary method exhibits some advantages, such as it being fast, cost-efficient, and conveniently operated. It also has the potential to be further developed as an effective method in the
In this work, a three-dimensional mesoporous polymeric graphitic-C3N4/polyaniline/CdO (mpg-C3N4/PANI/CdO) nanocomposite was prepared as follows: C3N4 was synthesized via a green and one-step electrochemical method and then, step-by-step, C3N4, PANI, and CdO were electrochemically synthesized on the electrode
T0070907 was identified as a potent and selective PPARgamma antagonist. With an apparent binding affinity (concentration at 50% inhibition of [(3)H]rosiglitazone binding or IC(50)) of 1 nm, T0070907 covalently modifies PPARgamma on cysteine 313 in helix 3 of human PPARgamma2. T0070907 blocked PPARgamma function in both cell-based reporter gene and adipocyte differentiation assays. T0070907 is a novel tool for the study of PPARgamma/RXRalpha heterodimer function.
Shop Kanamycin B dioxygenase ELISA Kit, Recombinant Protein and Kanamycin B dioxygenase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
DKE TOYS PRESS: "Artist Mark Todds first ever toy and first ever sculpture is a take on our furry friend. His original was molded and then cast in resin and hand painted by Mark as well. The card back is comprised of 2 riso graph prints on front and back for that very indie zine feel. 3.75" scale carded figure. Only 30 made and each is signed and numbered." ...
Sulfonamides are any amide of a sulfonic acid, i.e., RS(=O)2NR′2. Sulfinamides are amides of sulfinic acid and contain a sulfur-oxygen double bond and a sulfur-nitrogen single bond.
CT Tag for the amazing Ladyhawwk Designs using a very elegant Christmas IB kit she made. This is such a stunningly beautiful kit, the candles are lit, the tree is up, all ready to christen it with the glory of the holiday season. This kit is very elegant in its shades of red, gold, and white, and can be purchased exclusively at CDO here. I tagged this kit with the wonderful tube that inspired it, such a perfect match to it! You can purchase Sonias wonderful art tubes at CDO here as well ...
... ราคา 590 ใน ทางการแพทย์มีการใช้ในเรื่องการลดการเกิดเสมหะ แก้พิษ Overdose ของความเป็นพิษในยาพราราเซทตามอล
TY - JOUR. T1 - Hypotaurine is an energy-saving hepatoprotective compound against ischemia-reperfusion injury of the rat liver. AU - Sakuragawa, Tadayuki. AU - Hishiki, Takako. AU - Ueno, Yuki. AU - Ikeda, Satsuki. AU - Soga, Tomoyoshi. AU - Yachie-Kinoshita, Ayako. AU - Kajimura, Mayumi. AU - Suematsu, Makoto. PY - 2010/3. Y1 - 2010/3. N2 - Metabolome analyses assisted by capillary electrophoresis-mass spectrometry (CE-MS) have allowed us to systematically grasp changes in small molecular metabolites under disease conditions. We applied CE-MS to mine out biomarkers in hepatic ischemia-reperfusion. Rat livers were exposed to ischemia by clamping of the portal inlet followed by reperfusion. Metabolomic profiling revealed that 1 contents of taurine in liver and plasma were significantly increased. Of interest is an elevation of hypotaurine, collectively suggesting significance of hypotaurine/taurine in post-ischemic responses. Considering the anti-oxidative capacity of hypotaurine, we examined if ...
More than 90 participants attended the 9th Advancia International Seminar, which was held in Prague, Czech Republic. Advancia is the Scientific and Technical Community, gathering scientists and nutritionists to share research progresses on sulphur amino acids.
Indoleamine 2,3-dioxygenase/IDO products available through Novus Biologicals. Browse our Indoleamine 2,3-dioxygenase/IDO product catalog backed by our Guarantee+.
Indoleamine 2,3 Dioxygenase 1 (Indoleamine Pyrrole 2,3 Dioxygenase 1 or IDO1 or EC 1.13.11.52) - Pipeline Review, H1 2017 with 85 pages available at USD 3500 for single User PDF at ReportsWeb research database.
Anti-Methylcytosine dioxygenase TET1 Antibody is a Rabbit Polyclonal Antibody for detection of Methylcytosine dioxygenase TET1 also known as tet oncogene 1 & has been validated in WB, ChIP-seq. Find MSDS or SDS, a COA, data sheets and more information.
Thank you for your interest in spreading the word about Biochemical Journal.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
SiliaBond® Cysteine (Si-Cys) is the silica bound equivalent of the amino acid Cysteine. By attaching the molecule to the backbone via the amino group, the thiol group remains free and accessible for higher metal scavenging efficiency.

Spectroscopic and kinetic investigation of two unusual structural features found in eukaryotic cysteine dioxygenaseSpectroscopic and kinetic investigation of two unusual structural features found in eukaryotic cysteine dioxygenase

Cysteine dioxygenase (CDO) is a mononuclear ferrous enzyme located at a branch-point in cysteine metabolism and catalyzes the ... Spectroscopic and kinetic investigation of two unusual structural features found in eukaryotic cysteine dioxygenase. View/. ... Purified CDO in the resting state was capable of binding L-cysteine but incapable of binding nitric oxide; however, when ... Consistent with the oxidation, purified CDO displayed no activity beyond the background oxidation of L-cysteine. Activity was ...
more infohttps://etd.auburn.edu/handle/10415/2012

Cysteine dioxygenase type 1Cysteine dioxygenase type 1

Methylated cysteine dioxygenase-1 gene promoter in the serum is a potential biomarker for hepatitis B virus-related ... Frequent inactivation of cysteine dioxygenase type 1 contributes to survival of breast cancer cells and resistance to ... Degradation of cysteine and homocysteine 9 Organosulfur biosynthesis; taurine biosynthesis; hypotaurine from L-cysteine: step 1 ... Involvement of the Cys-Tyr cofactor on iron binding in the active site of human cysteine dioxygenase.. ...
more infohttps://pharos.nih.gov/idg/targets/Q16878

Cysteine dioxygenase - WikipediaCysteine dioxygenase - Wikipedia

... cysteine sulfinate) by incorporation of dioxygen. Cysteine sulfinic acid lies at a branch-point in cysteine catabolism, where ... Cysteine dioxygenase (CDO, CAS number: 37256-59-0) is a mammalian non-heme iron enzyme that catalyzes the conversion of L- ... cysteine dioxygenase)". Biochimica et Biophysica Acta. 422 (2): 273-9. doi:10.1016/0005-2744(76)90138-8. PMID 2307. Chai SC, ... "Structure and mechanism of mouse cysteine dioxygenase". Proceedings of the National Academy of Sciences of the United States of ...
more infohttps://en.wikipedia.org/wiki/Cysteine_dioxygenase

RCSB PDB - Protein Feature View 









 - Cysteine dioxygenase - O32085 (CDOA BACSU)RCSB PDB - Protein Feature View - Cysteine dioxygenase - O32085 (CDOA BACSU)

The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
more infohttp://www.rcsb.org/pdb/protein/O32085

Cysteine dioxygenase type 1 - WikipediaCysteine dioxygenase type 1 - Wikipedia

Dominy JE, Hwang J, Stipanuk MH (2007). "Overexpression of cysteine dioxygenase reduces intracellular cysteine and glutathione ... Cysteine dioxygenase type 1 is a protein that in humans is encoded by the CDO1 gene. GRCh38: Ensembl release 89: ...
more infohttps://en.wikipedia.org/wiki/Cysteine_dioxygenase_type_1

Measurement of Cysteine Dioxygenase Activity and Protein Abundance - Current ProtocolsMeasurement of Cysteine Dioxygenase Activity and Protein Abundance - Current Protocols

... dependent thiol dioxygenase that uses molecular oxygen to oxidize the sulfhydryl group of cysteine to generate 3‐sulfinoalanine ... The amount of cysteine dioxygenase may be measured by immunoblotting. Upon SDS‐PAGE, cysteine dioxygenase can be separated into ... Cysteine dioxygenase is an iron (Fe2+)-dependent thiol dioxygenase that uses molecular oxygen to oxidize the sulfhydryl group ... Overexpression of cysteine dioxygenase reduces intracellular cysteine and glutathione pools in HepG2/C3A cells. Am. J. Physiol ...
more infohttp://www.currentprotocols.com/WileyCDA/CPUnit/refId-tx0615.html

An iron-oxygen intermediate formed during the catalytic cycle of cysteine dioxygenase  -ORCAAn iron-oxygen intermediate formed during the catalytic cycle of cysteine dioxygenase -ORCA

Cysteine dioxygenase is a key enzyme in the breakdown of cysteine, but its mechanism remains controversial. A combination of ... An iron-oxygen intermediate formed during the catalytic cycle of cysteine dioxygenase. Chemical Communications- Royal Society ... An iron-oxygen intermediate formed during the catalytic cycle of cysteine dioxygenase ...
more infohttp://orca-mwe.cf.ac.uk/92437/

CDO1 Gene - GeneCards | CDO1 Protein | CDO1 AntibodyCDO1 Gene - GeneCards | CDO1 Protein | CDO1 Antibody

Cysteine Dioxygenase Type 1, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The ... cysteine dioxygenase-1,cytosolic,expressed in liver *CDO1. UniProtKB/Swiss-Prot CatalyticActivity: L-cysteine + O(2) = 3- ... Why do cysteine dioxygenase enzymes contain a 3-His ligand motif rather than a 2His/1Asp motif like most nonheme dioxygenases? ... Overexpression of cysteine dioxygenase reduces intracellular cysteine and glutathione pools in HepG2/C3A cells. (PMID: 17327371 ...
more infohttp://www.genecards.org/cgi-bin/carddisp.pl?gene=CDO1

SPIN1 promotes tumorigenesis by blocking the uL18 (universal large ribosomal subunit protein 18)-MDM2-p53 pathway in human...SPIN1 promotes tumorigenesis by blocking the uL18 (universal large ribosomal subunit protein 18)-MDM2-p53 pathway in human...

Cysteine dioxygenase 1 is a metabolic liability for non-small cell lung cancer Yun Pyo Kang et al. ... Cysteine dioxygenase 1 is a metabolic liability for non-small cell lung cancer ...
more infohttps://elifesciences.org/articles/31275

Linking Crystallographic Model and Data Quality | ScienceLinking Crystallographic Model and Data Quality | Science

Crystal structure of mammalian cysteine dioxygenase. A novel mononuclear iron center for cysteine thiol oxidation. J. Biol. ... collected for a cysteine-bound complex of cysteine dioxygenase (CDO); the EXP data have an average intensity about 7% as strong ... A putative Fe2+-bound persulfenate intermediate in cysteine dioxygenase. Biochemistry 47, 11390 (2008). doi:10.1021/bi801546n ...
more infohttp://science.sciencemag.org/content/336/6084/1030?ijkey=fa6333ba2e62e1735adc3f06642aba0db8d137d9&keytype2=tf_ipsecsha

Gene InfoGene Info

MF] cysteine dioxygenase activity *[MF] ferrous iron binding *[MF] iron ion binding *[MF] metal ion binding *[MF] ... BP] L-cysteine catabolic process *[BP] L-cysteine catabolic process to taurine *[BP] L-cysteine metabolic process *[BP] ...
more infohttps://cgap.nci.nih.gov/Genes/GeneInfo?ORG=Mm&CID=241056&LLNO=12583

GO Gene ListGO Gene List

Cysteine dioxygenase 1, cytosolic. NM_033037. Gene Info. Cited1. Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy- ... Serine (or cysteine) peptidase inhibitor, clade A, member 3F. NM_001168294. NM_001033335. NM_001168295. Gene Info. ... Serine (or cysteine) peptidase inhibitor, clade A, member 1A. NM_001252569. NM_009243. Gene Info. ... Serine (or cysteine) preptidase inhibitor, clade A, member 1B. NM_009244. Gene Info. ...
more infohttps://cgap.nci.nih.gov/Genes/GoGeneQuery?PAGE=1&ORG=Mm&GOID=1901652

EC 1.13.11EC 1.13.11

... 18 sulfur dioxygenase. EC 1.13.11.19 cysteamine dioxygenase. EC 1.13.11.20 cysteine dioxygenase. EC 1.13.11.21 now ... cysteine dioxygenase. Reaction: L-cysteine + O2 = 3-sulfinoalanine. For diagram click here.. Other name(s): cysteine oxidase. ... EC 1.13.11.1 catechol 1,2-dioxygenase. EC 1.13.11.2 catechol 2,3-dioxygenase. EC 1.13.11.3 protocatechuate 3,4-dioxygenase. EC ... Other name(s): 3,4-dihydroxyphenylacetic acid 2,3-dioxygenase; HPC dioxygenase; homoprotocatechuate 2,3-dioxygenase;3,4- ...
more infohttps://www.qmul.ac.uk/sbcs/iubmb/enzyme/EC1/1311.html

Davis I[au] - PubMed - NCBIDavis I[au] - PubMed - NCBI

Cleavage of a carbon-fluorine bond by an engineered cysteine dioxygenase.. Li J, Griffith WP, Davis I, Shin I, Wang J, Li F, ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed?cmd=search&term=Davis+I%5Bau%5D&dispmax=50

Tissue expression of ADO - Summary - The Human Protein AtlasTissue expression of ADO - Summary - The Human Protein Atlas

2-aminoethanethiol dioxygenase (HGNC Symbol). Entrez gene summary. Human thiol dioxygenases include cysteine dioxygenase (CDO; ... GO:0047800 [cysteamine dioxygenase activity]. GO:0051213 [dioxygenase activity]. GO:0055114 [oxidation-reduction process]. ... MIM 603943) and cysteamine (2-aminoethanethiol) dioxygenase (ADO; EC 1.13.11.19). CDO adds 2 oxygen atoms to free cysteine, ... 2-aminoethanethiol dioxygenase. Protein classi. Protein class the gene product belongs to according to selected gene lists. ...
more infohttp://www.proteinatlas.org/ENSG00000181915-ADO/tissue

When Air is in Short Supply - Shedding light on plant stress reactions when oxygen runs shortWhen Air is in Short Supply - Shedding light on plant stress reactions when oxygen runs short

So far, this PCO is the first discovered plant cysteine dioxygenase.. The oxidation of the cysteine to cysteine sulfinic acid ... Therefore, the ERF transcription factors as well as the plant cysteine dioxygenases play an important role as oxygen sensor in ... Metabolism »acid »anaerobic »cell nucleus »cysteine »enzyme »enzymes »genes »stress reactions »stress response »transcription ... Further reports about: , Metabolism , acid , anaerobic , cell nucleus , cysteine , enzyme , enzymes , genes , stress reactions ...
more infohttp://www.innovations-report.com/html/reports/life-sciences/when-air-is-in-short-supply-shedding-light-on-plant-stress-reactions-when-oxygen-runs-short.html

Frontiers | Editorial: Quantum Mechanical/Molecular Mechanical Approaches for the Investigation of Chemical Systems - Recent...Frontiers | Editorial: Quantum Mechanical/Molecular Mechanical Approaches for the Investigation of Chemical Systems - Recent...

Faponle, A. S., Seebeck, F. P., and de Visser, S. P. (2017). Sulfoxide synthase versus cysteine dioxygenase reactivity in a ... of molecular hydrogen to the catalytically active Ni-atom as well as the associated proton transfer to nearby terminal cysteine ...
more infohttps://www.frontiersin.org/articles/10.3389/fchem.2018.00357/full

Find Research Outputs
             - Johns Hopkins UniversityFind Research Outputs - Johns Hopkins University

Ding, J., Davis-Plourde, K. L., Sedaghat, S., Tully, P. J., Wang, W., Phillips, C., Pase, M. P., Himali, J. J., Gwen Windham, B., Griswold, M., Gottesman, R., Mosley, T. H., White, L., Guðnason, V., Debette, S., Beiser, A. S., Seshadri, S., Ikram, M. A., Meirelles, O., Tzourio, C. & 1 others, Launer, L. J., Jan 2020, In : The Lancet Neurology. 19, 1, p. 61-70 10 p.. Research output: Contribution to journal › Article ...
more infohttps://jhu.pure.elsevier.com/en/publications/?page=1&ordering=publicationYearThenTitle&descending=true&showAdvanced=false&allConcepts=true&inferConcepts=true&originalSearch=&improvedLayoutOrganisationUuid=
  • Prognostic Significance of Promoter DNA Hypermethylation of cysteine dioxygenase 1 (CDO1) Gene in Primary Breast Cancer. (nih.gov)
  • Methylated cysteine dioxygenase-1 gene promoter in the serum is a potential biomarker for hepatitis B virus-related hepatocellular carcinoma. (nih.gov)
  • The spectrum of CDO expressed in cell lysate was consistent with Fe(II) and the lysate displayed considerable catalytic activity for cysteine oxidation. (auburn.edu)
  • Consistent with the oxidation, purified CDO displayed no activity beyond the background oxidation of L-cysteine. (auburn.edu)
  • Male mice that lack cysteine dioxygenase (CDO) were previously found to be infertile. (naturalnews.com)
  • This hypothesis includes also another class of RSS, i.e. the products of cysteine transformations: hydrogen sulfide (H 2 S) and sulfane sulfur-containing compounds. (bioscirep.org)
  • Cysteine is synthesized from serine through different pathways in different organism groups. (genome.jp)