Cyclophilins: A family of peptidyl-prolyl cis-trans isomerases that bind to CYCLOSPORINS and regulate the IMMUNE SYSTEM. EC 5.2.1.-Cyclophilin A: A 17-KDa cytoplasmic PEPTIDYLPROLYL ISOMERASE involved in immunoregulation. It is a member of the cyclophilin family of proteins that binds to CYCLOSPORINE.Peptidylprolyl Isomerase: An enzyme that catalyzes the isomerization of proline residues within proteins. EC 5.2.1.8.Immunophilins: Members of a family of highly conserved proteins which are all cis-trans peptidyl-prolyl isomerases (PEPTIDYLPROLYL ISOMERASE). They bind the immunosuppressant drugs CYCLOSPORINE; TACROLIMUS and SIROLIMUS. They possess rotamase activity, which is inhibited by the immunosuppressant drugs that bind to them.Amino Acid Isomerases: Enzymes that catalyze either the racemization or epimerization of chiral centers within amino acids or derivatives. EC 5.1.1.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Cyclosporine: A cyclic undecapeptide from an extract of soil fungi. It is a powerful immunosupressant with a specific action on T-lymphocytes. It is used for the prophylaxis of graft rejection in organ and tissue transplantation. (From Martindale, The Extra Pharmacopoeia, 30th ed).Mitochondrial ADP, ATP Translocases: A class of nucleotide translocases found abundantly in mitochondria that function as integral components of the inner mitochondrial membrane. They facilitate the exchange of ADP and ATP between the cytosol and the mitochondria, thereby linking the subcellular compartments of ATP production to those of ATP utilization.Mitochondrial Membrane Transport Proteins: Proteins involved in the transport of specific substances across the membranes of the MITOCHONDRIA.Sirtuin 3: A sirtuin family member found primarily in MITOCHONDRIA. It is a multifunctional enzyme that contains a NAD-dependent deacetylase activity that is specific for HISTONES and a mono-ADP-ribosyltransferase activity.Antibodies: Immunoglobulin molecules having a specific amino acid sequence by virtue of which they interact only with the ANTIGEN (or a very similar shape) that induced their synthesis in cells of the lymphoid series (especially PLASMA CELLS).Rabbits: The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.Antibody Specificity: The property of antibodies which enables them to react with some ANTIGENIC DETERMINANTS and not with others. Specificity is dependent on chemical composition, physical forces, and molecular structure at the binding site.Antibodies, Monoclonal: Antibodies produced by a single clone of cells.Antibodies, Viral: Immunoglobulins produced in response to VIRAL ANTIGENS.Antibodies, Bacterial: Immunoglobulins produced in a response to BACTERIAL ANTIGENS.Antibody Formation: The production of ANTIBODIES by proliferating and differentiated B-LYMPHOCYTES under stimulation by ANTIGENS.Antibodies, Neutralizing: Antibodies that reduce or abolish some biological activity of a soluble antigen or infectious agent, usually a virus.Exome: That part of the genome that corresponds to the complete complement of EXONS of an organism or cell.Electroporation: A technique in which electric pulses of intensity in kilovolts per centimeter and of microsecond-to-millisecond duration cause a temporary loss of the semipermeability of CELL MEMBRANES, thus leading to ion leakage, escape of metabolites, and increased uptake by cells of drugs, molecular probes, and DNA.HIV-1: The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.Stress, Mechanical: A purely physical condition which exists within any material because of strain or deformation by external forces or by non-uniform thermal expansion; expressed quantitatively in units of force per unit area.Virus Replication: The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Cell Adhesion: Adherence of cells to surfaces or to other cells.Endothelium, Vascular: Single pavement layer of cells which line the luminal surface of the entire vascular system and regulate the transport of macromolecules and blood components.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Hepacivirus: A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.Tacrolimus Binding Proteins: A family of immunophilin proteins that bind to the immunosuppressive drugs TACROLIMUS (also known as FK506) and SIROLIMUS. EC 5.2.1.-Antiviral Agents: Agents used in the prophylaxis or therapy of VIRUS DISEASES. Some of the ways they may act include preventing viral replication by inhibiting viral DNA polymerase; binding to specific cell-surface receptors and inhibiting viral penetration or uncoating; inhibiting viral protein synthesis; or blocking late stages of virus assembly.Viral Nonstructural Proteins: Proteins encoded by a VIRAL GENOME that are produced in the organisms they infect, but not packaged into the VIRUS PARTICLES. Some of these proteins may play roles within the infected cell during VIRUS REPLICATION or act in regulation of virus replication or VIRUS ASSEMBLY.Proline: A non-essential amino acid that is synthesized from GLUTAMIC ACID. It is an essential component of COLLAGEN and is important for proper functioning of joints and tendons.Myocardial Reperfusion Injury: Damage to the MYOCARDIUM resulting from MYOCARDIAL REPERFUSION (restoration of blood flow to ischemic areas of the HEART.) Reperfusion takes place when there is spontaneous thrombolysis, THROMBOLYTIC THERAPY, collateral flow from other coronary vascular beds, or reversal of vasospasm.Reperfusion Injury: Adverse functional, metabolic, or structural changes in ischemic tissues resulting from the restoration of blood flow to the tissue (REPERFUSION), including swelling; HEMORRHAGE; NECROSIS; and damage from FREE RADICALS. The most common instance is MYOCARDIAL REPERFUSION INJURY.Myocardial Ischemia: A disorder of cardiac function caused by insufficient blood flow to the muscle tissue of the heart. The decreased blood flow may be due to narrowing of the coronary arteries (CORONARY ARTERY DISEASE), to obstruction by a thrombus (CORONARY THROMBOSIS), or less commonly, to diffuse narrowing of arterioles and other small vessels within the heart. Severe interruption of the blood supply to the myocardial tissue may result in necrosis of cardiac muscle (MYOCARDIAL INFARCTION).Myocytes, Cardiac: Striated muscle cells found in the heart. They are derived from cardiac myoblasts (MYOBLASTS, CARDIAC).Political Systems: The units based on political theory and chosen by countries under which their governmental power is organized and administered to their citizens.HSP70 Heat-Shock Proteins: A class of MOLECULAR CHAPERONES found in both prokaryotes and in several compartments of eukaryotic cells. These proteins can interact with polypeptides during a variety of assembly processes in such a way as to prevent the formation of nonfunctional structures.Myocardial Infarction: NECROSIS of the MYOCARDIUM caused by an obstruction of the blood supply to the heart (CORONARY CIRCULATION).Heat-Shock Proteins: Proteins which are synthesized in eukaryotic organisms and bacteria in response to hyperthermia and other environmental stresses. They increase thermal tolerance and perform functions essential to cell survival under these conditions.

Two distinct regions of cyclophilin B are involved in the recognition of a functional receptor and of glycosaminoglycans on T lymphocytes. (1/501)

Cyclophilin B is a cyclosporin A-binding protein exhibiting peptidyl-prolyl cis/trans isomerase activity. We have previously shown that it interacts with two types of binding sites on T lymphocytes. The type I sites correspond to specific functional receptors and the type II sites to sulfated glycosaminoglycans. The interactions of cyclophilin B with type I and type II sites are reduced in the presence of cyclosporin A and of a synthetic peptide mimicking the N-terminal part of cyclophilin B, respectively, suggesting that the protein possesses two distinct binding regions. In this study, we intended to characterize the areas of cyclophilin B involved in the interactions with binding sites present on Jurkat cells. The use of cyclophilin B mutants modified in the N-terminal region demonstrated that the 3Lys-Lys-Lys5 and 14Tyr-Phe-Asp16 clusters are probably solely required for the interactions with the type II sites. We further engineered mutants of the conserved central core of cyclophilin B, which bears the catalytic and the cyclosporin A binding sites as an approach to localize the binding regions for the type I sites. The enzymatic activity of cyclophilin B was dramatically reduced after substitution of the Arg62 and Phe67 residues, whereas the cyclosporin A binding activity was destroyed by mutation of the Trp128 residue and strongly decreased after modification of the Phe67 residue. Only the substitution of the Trp128 residue reduced the binding of the resulting cyclophilin B mutant to type I binding sites. The catalytic site of cyclophilin B therefore did not seem to be essential for cellular binding and the cyclosporin A binding site appeared to be partially involved in the binding to type I sites.  (+info)

Evidence that cyclophilin-A protects cells against oxidative stress. (2/501)

Cyclophilin-A is the cytosolic isoform of a family of peptidylproline cis-trans-isomerases that bind cyclosporin A. This study investigates the role of cyclophilin-A in necrotic cell death, induced by 'chemical ischaemia' and by t-butylhydroperoxide. An 18-mer antisense phosphorothioate oligodeoxynucleotide was used to target a translated region of cyclophilin-A mRNA in rat neonatal cardiomyocytes. After a 24 h exposure to the oligonucleotide, the amount of cyclophilin-A in the cells was decreased by at least 93% as judged by immunological and enzymic criteria. For the enzyme assays, peptidyl proline cis-trans-isomerase activity was measured fluorimetrically in small (10 microl) volumes of cell extract. Immunoblots were developed with a polyclonal anti-cyclophilin-A antibody after sample isoelectric focusing and SDS/PAGE. Cyclophilin-A suppression had no effect on cyanide-plus-2-deoxyglucose-induced cell death. However, cyclophilin-A-suppressed cells were markedly more sensitive to t-butylhydroperoxide. Cyclosporin A conferred some resistance to the peroxide in both types of cell, but protection was greater in cyclophilin-A-suppressed cells, where cyclosporin A increased the survival time 2-fold. It is concluded that two cyclophilin isoforms are involved, in quite different ways, in peroxide-induced cell death. Cyclophilin-A has a protective role. Another isoform, possibly mitochondrial cyclophilin-D, has a deleterious role, such that blockade by cyclosporin A leads to protection.  (+info)

Polypeptide flux through bacterial Hsp70: DnaK cooperates with trigger factor in chaperoning nascent chains. (3/501)

A role for DnaK, the major E. coli Hsp70, in chaperoning de novo protein folding has remained elusive. Here we show that under nonstress conditions DnaK transiently associates with a wide variety of nascent and newly synthesized polypeptides, with a preference for chains larger than 30 kDa. Deletion of the nonessential gene encoding trigger factor, a ribosome-associated chaperone, results in a doubling of the fraction of nascent polypeptides interacting with DnaK. Combined deletion of the trigger factor and DnaK genes is lethal under normal growth conditions. These findings indicate important, partially overlapping functions of DnaK and trigger factor in de novo protein folding and explain why the loss of either chaperone can be tolerated by E. coli.  (+info)

The mitochondrial permeability transition pore and its role in cell death. (4/501)

This article reviews the involvement of the mitochondrial permeability transition pore in necrotic and apoptotic cell death. The pore is formed from a complex of the voltage-dependent anion channel (VDAC), the adenine nucleotide translocase and cyclophilin-D (CyP-D) at contact sites between the mitochondrial outer and inner membranes. In vitro, under pseudopathological conditions of oxidative stress, relatively high Ca2+ and low ATP, the complex flickers into an open-pore state allowing free diffusion of low-Mr solutes across the inner membrane. These conditions correspond to those that unfold during tissue ischaemia and reperfusion, suggesting that pore opening may be an important factor in the pathogenesis of necrotic cell death following ischaemia/reperfusion. Evidence that the pore does open during ischaemia/reperfusion is discussed. There are also strong indications that the VDAC-adenine nucleotide translocase-CyP-D complex can recruit a number of other proteins, including Bax, and that the complex is utilized in some capacity during apoptosis. The apoptotic pathway is amplified by the release of apoptogenic proteins from the mitochondrial intermembrane space, including cytochrome c, apoptosis-inducing factor and some procaspases. Current evidence that the pore complex is involved in outer-membrane rupture and release of these proteins during programmed cell death is reviewed, along with indications that transient pore opening may provoke 'accidental' apoptosis.  (+info)

Import and processing of heart mitochondrial cyclophilin D. (5/501)

Cyclophilins are a family of cyclosporin-A-binding proteins which catalyse rotation about prolyl peptide bonds. A mitochondrial isoform in mammalian cells, cyclophilin D, is a component of the permeability transition pore that is formed by the adenine nucleotide translocase and the voltage-dependent anion channel at contact sites between the inner and outer membrane. This study investigated the submitochondrial location of cyclophilin D by following the fate of radiolabelled protein following import. Precursor [(35)S]cyclophilin D was expressed in vitro from a PCR-generated cDNA. The precursor was imported by rat heart mitochondria and processed in a single step to a 21-kDa protein that was identical (SDS/PAGE) to an in vitro expressed mature protein and a cyclophilin D purified from rat heart mitochondria. No further modification of the mature protein could be demonstrated. Fractionation of mitochondria following import established that cyclophilin D locates only to the matrix. It is concluded that cyclophilin D binding to the permeability transition pore must occur at the inner face of the mitochondrial inner membrane.  (+info)

Cyclophilin B binding to platelets supports calcium-dependent adhesion to collagen. (6/501)

We have recently reported that cyclophilin B (CyPB), a secreted cyclosporine-binding protein, could bind to T lymphocytes through interactions with two types of binding sites. The first ones, referred to as type I, involve interactions with the conserved domain of CyPB and promote the endocytosis of surface-bound ligand, while the second type of binding sites, termed type II, are represented by glycosaminoglycans (GAG). Here, we further investigated the interactions of CyPB with blood cell populations. In addition to lymphocytes, CyPB was found to interact mainly with platelets. The binding is specific, with a dissociation constant (kd) of 9 +/- 3 nmol/L and the number of sites estimated at 960 +/- 60 per cell. Platelet glycosaminoglycans are not required for the interactions, but the binding is dramatically reduced by active cyclosporine derivatives. We then analyzed the biologic effects of CyPB and found a significant increase in platelet adhesion to collagen. Concurrently, CyPB initiates a transmembranous influx of Ca(2+) and induces the phosphorylation of the P-20 light chains of myosin. Taken together, the present results demonstrate for the first time that extracellular CyPB specifically interacts with platelets through a functional receptor related to the lymphocyte type I binding sites and might act by regulating the activity of a receptor-operated membrane Ca(2+) channel.  (+info)

A cyclophilin B gene encodes antigenic epitopes recognized by HLA-A24-restricted and tumor-specific CTLs. (7/501)

We have studied Ags recognized by HLA class I-restricted CTLs established from tumor site to better understand the molecular basis of tumor immunology. HLA-A24-restricted and tumor-specific CTLs established from T cells infiltrating into lung adenocarcinoma recognized the two antigenic peptides encoded by a cyclophilin B gene, a family of genes for cyclophilins involved in T cell activation. These two cyclophilin B peptides at positions 84-92 and 91-99 induced HLA-A24-restricted CTL activity against tumor cells in PBMCs of leukemia patients, but not in epithelial cancer patients or in healthy donors. In contrast, the modified peptides at position 2 from phenylalanine to tyrosine, which had more than 10 times higher binding affinities to HLA-A24 molecules, could induce HLA-A24-restricted CTL activity against tumor cells in PBMCs from leukemia patients, epithelial cancer patients, or healthy donors. PHA-activated normal T cells were resistant to lysis by the CTL line or by these peptide-induced CTLs. These results indicate that a cyclophilin B gene encodes antigenic epitopes recognized by CTLs at the tumor site, although T cells in peripheral blood (except for those from leukemia patients) are immunologically tolerant to the cyclophilin B. These peptides might be applicable for use in specific immunotherapy of leukemia patients or that of epithelial cancer patients.  (+info)

Adenine nucleotide translocase-1, a component of the permeability transition pore, can dominantly induce apoptosis. (8/501)

Here, we describe the isolation of adenine nucleotide translocase-1 (ANT-1) in a screen for dominant, apoptosis-inducing genes. ANT-1 is a component of the mitochondrial permeability transition complex, a protein aggregate connecting the inner with the outer mitochondrial membrane that has recently been implicated in apoptosis. ANT-1 expression led to all features of apoptosis, such as phenotypic alterations, collapse of the mitochondrial membrane potential, cytochrome c release, caspase activation, and DNA degradation. Both point mutations that impair ANT-1 in its known activity to transport ADP and ATP as well as the NH(2)-terminal half of the protein could still induce apoptosis. Interestingly, ANT-2, a highly homologous protein could not lead to cell death, demonstrating the specificity of the signal for apoptosis induction. In contrast to Bax, a proapoptotic Bcl-2 gene, ANT-1 was unable to elicit a form of cell death in yeast. This and the observed repression of apoptosis by the ANT-1-interacting protein cyclophilin D suggest that the suicidal effect of ANT-1 is mediated by specific protein-protein interactions within the permeability transition pore.  (+info)

*Cyclophilin

Other cyclophilins have similar structures to cyclophilin A. The cyclosporin-cyclophilin A complex inhibits a calcium/ ... Cyclophilin A is a cytosolic and highly abundant protein. The protein belongs to a family of isozymes, including cyclophilins B ... J&J targets degenerative diseases in cyclophilin inhibitor partnership. Dan Stanton. 08-Dec-2015 Cyclophilins at the US ... Cyclophilin D, which is located in the matrix of mitochondria, is only a modulatory, but may or may not be a structural ...

*PPIB

As a cyclophilin, PPIB binds the immunosuppressive drug CsA to form a CsA-cyclophilin complex, which then targets calcineurin ... Mikol V, Kallen J, Walkinshaw MD (1994). "X-ray structure of a cyclophilin B/cyclosporin complex: comparison with cyclophilin A ... "Human cyclophilin B: a second cyclophilin gene encodes a peptidyl-prolyl isomerase with a signal sequence". Proc Natl Acad Sci ... As a cyclophilin, PPIB binds cyclosporin A (CsA) and can be found within in the cell or secreted by the cell. PPIB is the ...

*PPIC

As a cyclophilin, PPIC binds the immunosuppressive drug CsA to form a CsA-cyclophilin complex, which then targets calcineurin ... Depletion of these two cyclophilins lead to hyperoxidation of the ER. In the brain, PPIC complexes with cyclophilin C- ... Like other cyclophilins, PPIC forms a β-barrel structure with a hydrophobic core. This β-barrel is composed of eight anti- ... Yao Q, Li M, Yang H, Chai H, Fisher W, Chen C (Mar 2005). "Roles of cyclophilins in cancers and other organ systems". World ...

*PPIF

As a cyclophilin, PPIF binds the immunosuppressive drug CsA to form a CsA-cyclophilin complex, which then targets calcineurin ... Thus, cyclophilins may function in cardioprotection during ischemia-reperfusion injury. Currently, cyclophilin expression is ... Like other cyclophilins, PPIF forms a β-barrel structure with a hydrophobic core. This β-barrel is composed of eight anti- ... It has also been referred to as, but should not be confused with, cyclophilin D (CypD), which is encoded by the PPID gene. As a ...

*Peptidylprolyl isomerase D

As a cyclophilin, PPID binds the immunosuppressive drug CsA to form a CsA-cyclophilin complex, which then targets calcineurin ... Thus, cyclophilins may function in cardioprotection during ischemia-reperfusion injury. Currently, cyclophilin expression is ... Peptidylprolyl isomerase D (cyclophilin D), also known as PPID, is an enzyme which in humans is encoded by the PPID gene on ... Like other cyclophilins, PPID forms a β-barrel structure with a hydrophobic core. This β-barrel is composed of eight anti- ...

*PPIE (gene)

As a cyclophilin, PPIE also binds the immunosuppressive drug CsA to form a CsA-cyclophilin complex, which then targets ... Thus, cyclophilins may function in cardioprotection during ischemia-reperfusion injury. Currently, cyclophilin expression is ... Peptidylprolyl isomerase E (cyclophilin E), also known as PPIE, is an enzyme which in humans is encoded by the PPIE gene on ... Wang Z, Liu X, Zhao Z, Xu C, Zhang K, Chen C, Sun L, Gao GF, Ye X, Liu W (2011). "Cyclophilin E functions as a negative ...

*Peptidylprolyl isomerase A

... cyclophilin A)". Haendler B, Hofer E (Jul 1990). "Characterization of the human cyclophilin gene and of related processed ... Like other cyclophilins, PPIA forms a β-barrel structure with a hydrophobic core. This β-barrel is composed of eight anti- ... Yao Q, Li M, Yang H, Chai H, Fisher W, Chen C (Mar 2005). "Roles of cyclophilins in cancers and other organ systems". World ... Peptidylprolyl isomerase A (PPIA), also known as cyclophilin A (CypA) or rotamase A is an enzyme that in humans is encoded by ...

*Basigin

... is a type I integral membrane receptor that has many ligands, including the cyclophilin (CyP) proteins Cyp-A and CyP-B ... Yurchenko V, O'Connor M, Dai W, Guo H, Toole B, Sherry B, Bukrinsky M (2001). "CD147 is a signaling receptor for cyclophilin B ... 2002). "Active site residues of cyclophilin A are crucial for its signaling activity via CD147". J. Biol. Chem. 277 (25): 22959 ... 2001). "CD147 is a signaling receptor for cyclophilin B". Biochem. Biophys. Res. Commun. 288 (4): 786-8. doi:10.1006/bbrc. ...

*CLK1

Nestel FP, Colwill K, Harper S, Pawson T, Anderson SK (1997). "RS cyclophilins: identification of an NK-TR1-related cyclophilin ...

*PPIG (gene)

"RS cyclophilins: identification of an NK-TR1-related cyclophilin". Gene. 180 (1-2): 151-5. doi:10.1016/S0378-1119(96)00436-2. ... Lin CL, Leu S, Lu MC, Ouyang P (2004). "Over-expression of SR-cyclophilin, an interaction partner of nuclear pinin, releases SR ... "Entrez Gene: PPIG peptidylprolyl isomerase G (cyclophilin G)". Lin, Chun Lun; Leu Steve; Lu Ming Chu; Ouyang Pin (Aug 2004). " ... 2004). "The human nuclear SRcyp is a cell cycle-regulated cyclophilin". J. Biol. Chem. 279 (21): 22322-30. doi:10.1074/jbc. ...

*PRPF3

Horowitz DS, Kobayashi R, Krainer AR (Dec 1997). "A new cyclophilin and the human homologues of yeast Prp3 and Prp4 form a ... Horowitz DS, Lee EJ, Mabon SA, Misteli T (Feb 2002). "A cyclophilin functions in pre-mRNA splicing". The EMBO Journal. 21 (3): ... a nuclear cyclophilin". The Journal of Biological Chemistry. 275 (11): 7439-42. doi:10.1074/jbc.275.11.7439. PMID 10713041. ... "Crystal structure of a complex between human spliceosomal cyclophilin H and a U4/U6 snRNP-60K peptide". Journal of Molecular ...

*RANBP2

Ferreira PA, Nakayama TA, Pak WL, Travis GH (Oct 1996). "Cyclophilin-related protein RanBP2 acts as chaperone for red/green ... Ferreira PA, Yunfei C, Schick D, Roepman R (Sep 1998). "The cyclophilin-like domain mediates the association of Ran-binding ... Yi H, Friedman JL, Ferreira PA (Nov 2007). "The cyclophilin-like domain of Ran-binding protein-2 modulates selectively the ... Ferreira PA, Hom JT, Pak WL (Sep 1995). "Retina-specifically expressed novel subtypes of bovine cyclophilin". The Journal of ...

*PPIL2

This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved ... 2005). "Cell surface expression of CD147/EMMPRIN is regulated by cyclophilin 60". J. Biol. Chem. 280 (30): 27866-71. doi: ... "Entrez Gene: PPIL2 peptidylprolyl isomerase (cyclophilin)-like 2". Wang BB, Hayenga KJ, Payan DG, Fisher JM (1996). " ... 2010). "Structural and biochemical characterization of the human cyclophilin family of peptidyl-prolyl isomerases". PLoS Biol. ...

*PPIL3

This gene encodes a member of the cyclophilin family. Cyclophilins catalyze the cis-trans isomerization of peptidylprolyl imide ... Huang LL, Zhao XM, Huang CQ, Yu L, Xia ZX (Mar 2005). "Structure of recombinant human cyclophilin J, a novel member of the ... "Entrez Gene: PPIL3 peptidylprolyl isomerase (cyclophilin)-like 3". Gerdin AK (2010). "The Sanger Mouse Genetics Programme: high ... cyclophilin)-like gene (PPIL3) from human fetal brain". Cytogenetics and Cell Genetics. 92 (3-4): 231-6. doi:10.1159/000056909 ...

*PPIL1

This gene is a member of the cyclophilin family of peptidylprolyl isomerases (PPIases). The cyclophilins are a highly conserved ... "Entrez Gene: PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1". Tripodis N, Mason R, Humphray SJ, et al. (1999). "Physical ... expression and chromosomal mapping of a novel cyclophilin-related gene (PPIL1) from human fetal brain". Cytogenet Cell Genet. ...

*Cis-trans isomerase

Examples include photoisomerase and immunophilins such as cyclophilin. cis-trans-Isomerases at the US National Library of ...

*PPIL4

This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved family, ... 2002). "Molecular cloning, structure and expression of a novel nuclear RNA-binding cyclophilin-like gene (PPIL4) from human ... cyclophilin)-like 4". Zeng L, Zhou Z, Xu J, et al. ( ...

*Alisporivir

It inhibits cyclophilin A. Alisporivir is not immunosuppressive. It is being researched for potential use in the treatment of ... Alisporivir (INN), or Debio 025, DEB025, (or UNIL-025) is a cyclophilin inhibitor. Its structure is reminiscent of, and ... April 2008). "Inhibition of human immunodeficiency virus type 1 replication in human cells by Debio-025, a novel cyclophilin ... December 2008). "Debio 025, a cyclophilin binding molecule, is highly efficient in clearing HCV replicon containing cells, ...

*Immunophilins

FKBP-12 and cyclophilins both share in common peptide-prolyl isomerase activity. Peptide bonds within proteins can exist in ... For these drugs in particular, known immunophilins such as cyclophilin catalyze the cis-trans isomerization of peptide bonds, ... These two families are "cyclosporin-binding cyclophilins (CyPs)" and "FK506-binding proteins (FKBPs)". However, there are also ...

*FKBP

... which binds cyclophilin. Both the FKBP-tacrolimus complex and the cyclosporin-cyclophilin complex inhibit a phosphatase called ... Along with cyclophilin, FKBPs belong to the immunophilin family. FKBP12 is notable in humans for binding the immunosuppressant ... FKBP, or FK506 binding protein, is a family of proteins that have prolyl isomerase activity and are related to the cyclophilins ... Liu J, Farmer JD, Lane WS, Friedman J, Weissman I, Schreiber SL (August 1991). "Calcineurin is a common target of cyclophilin- ...

*Calcium modulating ligand

When bound to cyclophilin B, cyclosporin A binds and inactivates the key signaling intermediate calcineurin. The protein ... Bram RJ, Crabtree GR (1994). "Calcium signalling in T cells stimulated by a cyclophilin B-binding protein". Nature. 371 (6495 ... Tovey SC, Bootman MD, Lipp P, Berridge MJ, Bram RJ (2000). "Calcium-modulating cyclophilin ligand desensitizes hormone-evoked ... Guo S, Lopez-Ilasaca M, Dzau VJ (2005). "Identification of calcium-modulating cyclophilin ligand (CAML) as transducer of ...

*Methods used to study memory

The Role of Cyclophilin D in learning and memory. Brush, F. Robert. (2003). Selection for Differences in avoidance Learning: ...

*Ciclosporin

The resulting ciclosporin/cyclophilin complex inhibits the phosphatase activity of calcineurin which in turn is required for ... It does this by forming a complex with cyclophilin to block the phosphatase activity of calcineurin that in turn decreases the ... It does this by binding to cyclophilin, a multifunctional protein that facilitates protein folding, acts as a protein chaperone ... Ciclosporin prevents the dephosphorylation of NF-AT by binding to cyclophilin. It also inhibits lymphokine production and ...

*OPN1MW

Ferreira PA, Nakayama TA, Pak WL, Travis GH (1996). "Cyclophilin-related protein RanBP2 acts as chaperone for red/green opsin ...

*FKBP1A

Yang WM, Inouye CJ, Seto E (Jun 1995). "Cyclophilin A and FKBP12 interact with YY1 and alter its transcriptional activity". The ... a peptidylprolyl cis-trans isomerase distinct from cyclophilin". Proceedings of the National Academy of Sciences of the United ...
Hepatic fibrosis can result as a pathological response to nonalcoholic steatohepatitis (NASH). Cirrhosis, the late stage of fibrosis, has been linked to poor survival and an increased risk of developing hepatocellular carcinoma, with limited treatment options available. Therefore, there is an unmet …
A critical role of Cyclophilins, mostly Cyclophilin A (CyPA), in the replication of HCV is supported by a growing body of in vitro and in vivo evidence. CyPA probably interacts directly with nonstructural protein 5A to exert its effect, through its peptidyl-prolyl isomerase activity, on maintaining the proper structure and function of the HCV replicase. The major proline substrates are located in domain II of NS5A, centered around a
Restoration of blood flow after myocardial infarction (MI), surgery or fibrinolytic therapy is necessary, but can lead to cardiomyocyte dysfunction within a generalised condition commonly known as "reperfusion injury". The role of cyclophilins, heat shock proteins (HSP), and the mitochondrial chaperone complex (MCC), was studied in this pathological condition. In vitro and in vivo models were used to replicate conditions of ischaemia/reperfusion (IR) injury. H9c2 and COS-7 cell lines were employed in nitric oxide (NO) donor and transfection applications. Experimental protocols were used to determine mitochondrial membrane potential (MMP), mitochondrial morphology, protein expression, enzyme activity and cell damage in these models. No difference was observed in activity or expression in cyclophilin or expression of the MCC in any of the models. It was noted that in the in vitro model, cell death was predominantly necrotic with only a minority of cells undergoing apoptosis, and as the degree of ...
TY - JOUR. T1 - Novel approach to inhibit asthma-mediated lung inflammation using Anti-CD147 intervention. AU - Gwinn, William M.. AU - Damsker, Jesse M.. AU - Falahati, Rustom. AU - Okwumabua, Ifeanyi. AU - Kelly-Welch, Ann. AU - Keegan, Achsah D.. AU - Vanpouille, Christophe. AU - Lee, James J.. AU - Dent, Lindsay A.. AU - Leitenberg, David. AU - Bukrinsky, Michael I.. AU - Constant, Stephanie L.. PY - 2006/10/1. Y1 - 2006/10/1. N2 - Extracellular cyclophilins have been well described as chemotactic factors for various leukocyte subsets. This chemotactic capacity is dependent upon interaction of cyclophilins with the cell surface signaling receptor CD147. Elevated levels of extracellular cyclophilins have been documented in several inflammatory diseases. We propose that extracellular cyclophilins, via interaction with CD147, may contribute to the recruitment of leukocytes from the periphery into tissues during inflammatory responses. In this study, we examined whether extracellular ...
A validated positive silencing control targeting the Cyclophilin B (PPIB) gene in human, mouse, or rat cell lines. Useful for determination of optimal RNAi experimental conditions
The mitochondrial permeability transition pore (PTP) has been established as an important mediator of ischemia-reperfusion-induced cell death. The matrix protein cyclophilin D (CypD) is the best known regulator of PTP opening. Therefore, the authors hypothesized that isoflurane, by inhibiting the re...
Cyclophilin B, 0.1 ml. PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides.
Research and training opportunities are available in a laboratory of the National Research Council of Italy for a postgraduate or postdoctoral student in the field of molecular parasitology. The laboratory is about to be relocated near Rome, in a multidisciplinary research complex comprising a European facility for the study of mouse mutants and four research groups of the EMBL. The proposed project is based on the study of cyclophilins (cyclosporin binding proteins) of the human parasites belonging to the genus Schistosoma. Molecular cloning and biochemical studies of schistosome cyclophilins are already under way in the host laboratory. An interest in cyclophilins is due to their likely role in mediating the antiparasitic effects of cyclosporin A and its derivatives. Supervision and research facilities will be provided to students who have been successful in applying to the Training and Mobility of Researchers Programme of the European Community (see the call for proposals under ...
Retraction of: J. Cell Sci. 123, 4117-4127. This article has been retracted at the request of the corresponding author, John G. Pastorino.. This notice updates and replaces a recent Expression of Concern, published on 15 February 2016.. Journal of Cell Science was alerted to potential blot duplication and reuse in the following five papers published in Journal of Cell Science by John G. Pastorino:. Sirtuin-3 deacetylation of cyclophilin D induces dissociation of hexokinase II from the mitochondria Nataly Shulga, Robin Wilson-Smith and John G. Pastorino J. Cell. Sci. (2010) 123, 894-902. Ethanol sensitizes mitochondria to the permeability transition by inhibiting deacetylation of cyclophilin-D mediated by sirtuin-3 Nataly Shulga and John G. Pastorino J. Cell. Sci. (2010) 123, 4117-4127. GRIM-19-mediated translocation of STAT3 to mitochondria is necessary for TNF-induced necroptosis Nataly Shulga and John G. Pastorino J. Cell. Sci. (2012) 125, 2995-3003. Sirtuin-3 modulates Bak- and Bax-dependent ...
Polyclonal antibody for Cyclophilin B/PPIB detection. Host: Rabbit.Size: 100μg/vial. Tested applications: IHC-P. Reactive species: Human. Cyclophilin B/PPIB information: Molecular Weight: 23743 MW; Subcellular Localization: Endoplasmic reticulum lumen. Me
ProSpecs Cyclophilins include: Cyclophilin-A Human Recombinant, Cyclophilin-B Human Recombinant, Cyclophilin-D Human Recombinant
The spliceosome is a complex and dynamic collection of RNA and proteins that removes introns from precursor mRNA transcripts. Alterations in the splicing machin...
Cyclophilin C-associated protein (CyCAP) has been proposed as the endogenous equivalent of the immunosuppressant drug, cyclosporin A. It competes with cyclosporin A for binding to cyclophilin C. It is also known as lectin, galactoside-binding, soluble, 3 binding protein (Lgals3bp); Cyp-C-associated protein, 90K, Ppicap, and MAC-2BP. CyCAP expression has been reported in brain, kidney, macrophage cells, dermal fibroblasts, and keratinocytes. Roles for CyCAP have been reported in wound healing and macrophage activation via association with nuclear factor of activated T-cells (NFAT).. ...
Cyclophilin C-associated protein (CyCAP) has been proposed as the endogenous equivalent of the immunosuppressant drug, cyclosporin A. It competes with cyclosporin A for binding to cyclophilin C. It is also known as lectin, galactoside-binding, soluble, 3 binding protein (Lgals3bp); Cyp-C-associated protein, 90K, Ppicap, and MAC-2BP. CyCAP expression has been reported in brain, kidney, macrophage cells, dermal fibroblasts, and keratinocytes. Roles for CyCAP have been reported in wound healing and macrophage activation via association with nuclear factor of activated T-cells (NFAT).. ...
Debio: 1347-201: A phase 2 basket study of the oral selective pan-FGFR inhibitor Debio 1347 in subjects with solid tumors harboring a fusion of FGFR1, FGFR2 or FGFR3 The FUZE Clinical Trial
SEBake PF can be used to strengthen the dough, improve dough mixing tolerance & machinability, as well as to enhance the gas retention capacity of the dough.. ...
A stable, fluorescent positive control suitable for RNAi experiments in human, mouse, or rat cells Silences the Cyclophilin B gene and is labeled with DY-547
Author Summary Cyclophilins are proteins that catalyze the isomerization of prolines, interconverting this structurally important amino acid between cis and trans isomers. Although there are 17 cyclophilins in the human genome, the function of most cyclophilin isoforms is unknown. At least some members of this protein family are of interest for clinically relevant drug design, as they are targets of the drug cyclosporin, which is used as an immunosuppressant to treat patients following organ transplantation. The absence of a comprehensive picture of the similarities and differences between the different members of this protein family precludes effective and specific drug design, however. In the current study we undertake such a global structure∶function analysis. Using biochemical, structural, and computational methods we characterize the human cyclophilin family in detail and suggest that there is a previously overlooked region of these enzymes that contributes significantly to isoform diversity. We
Author Summary Cyclophilins are proteins that catalyze the isomerization of prolines, interconverting this structurally important amino acid between cis and trans isomers. Although there are 17 cyclophilins in the human genome, the function of most cyclophilin isoforms is unknown. At least some members of this protein family are of interest for clinically relevant drug design, as they are targets of the drug cyclosporin, which is used as an immunosuppressant to treat patients following organ transplantation. The absence of a comprehensive picture of the similarities and differences between the different members of this protein family precludes effective and specific drug design, however. In the current study we undertake such a global structure∶function analysis. Using biochemical, structural, and computational methods we characterize the human cyclophilin family in detail and suggest that there is a previously overlooked region of these enzymes that contributes significantly to isoform diversity. We
eng] Cyclophilin-D (CyP-D) is a peptidyl prolyl cis/trans isomerase located in the mitochondrial matrix of mammalian cells. The subcellular localization of the protein is determined by the presence of a mitochondrial targeting presequence. In the first part of this work, we characterized human CyP-D presequence allowing the protein translocation into mitochondria. We showed that the 16 first amino acid of the presequence are necessary and sufficient to form a functional presequence and to address hCyP-D into mitochondria. One of the main physiological roles of CyP-D is to activate the mitochondrial permeability transition pore (mPTP) opening. The mPTP is a protein complex formed during oxidative stress and leading to cell necrosis. Thus, CyP-D may be considered as a necrosis inductor. Nevertheless, several studies have also shown that CyP-D exhibits a protective role toward apoptosis induced by oxidative stress. However, the mechanism implicated in the cellular protection conferred by CyP-D is ...
Numerous mechanisms have been suggested for how bacterial toxins kill susceptible mammalian cells. Several recent studies demonstrated the importance of mitochondrial targeting of toxins produced by H. pylori, C. difficile, and S. aureus to mitochondria (56). In these cases toxin-mediated cell death was caspase independent and did not result in typical PTPs in the MOM (14, 18).. Previously, we reported that M. haemolytica LKT induces apoptosis of BL-3 cells in a caspase-9-dependent manner and that in mitochondria isolated from LKT-intoxicated BL-3 cells there was gross damage to the MOM (4). Based on these observations, we hypothesized that LKT is transported into the cell and binds directly to mitochondria. In the present study, we first demonstrated that full-length LKT protein could be identified in purified mitochondrial lysates from LKT-treated BL-3 cells (Fig. 1A). Transfection of anti-LKT antibodies into BL-3 cells prevented binding of LKT to mitochondria. Confocal microscopy and flow ...
Mitochondrial permeability transition pore component cyclophilin D distinguishes nigrostriatal dopaminergic death paradigms in the MPTP mouse model of Parkinsons disease Academic Article ...
PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding. Involved in regulation of the mitochondrial permeability transition pore (mPTP). It is proposed that its association with the mPTP is masking a binding site for inhibiting inorganic phosphate (Pi) and promotes the open probability of the mPTP leading to apoptosis or necrosis; the requirement of the PPIase activity for this function is debated. In cooperation with mitochondrial TP53 is involved in activating oxidative stress-induced necrosis. Involved in modulation of mitochondrial membrane F(1)F(0) ATP synthase activity and regulation of mitochondrial matrix adenine nucleotide levels. Has anti-apoptotic activity independently of mPTP and in cooperation with BCL2 inhibits cytochrome c-dependent apoptosis.
Recombinant Peptidylprolyl Isomerase B (Cyclophilin B) (PPIB) Peptide. Species: Human. Source: Escherichia coli (E. coli). Order product ABIN934947.
An absorbent structure made at least in part from a superabsorbent material having a retention capacity (CRC) as determined by a Centrifuge Retention Capacity Test of at least about 25 g/g and a free swell gel bed permeability (GBP) as determined by a Free Swell Gel Bed Permeability Test of at least 575 10−9 cm2. In another embodiment, the absorbent structure is made at least in part from a superabsorbent material having a retention capacity (CRC) as determined by a Centrifuge Retention Capacity Test of at least about 25 g/g, an absorbency under load (AUL) at 0.9 psi as determined by an Absorbency Under Load Test of at least 18 and a free swell gel bed permeability (GBP) as determined by a Free Swell Gel Bed Permeability Test of at least about 350 10−9 cm2.
The mechanism by which cyclosporin A (CsA) inhibits vaccinia virus (VV) replication is still unclear. The present study addresses the question of whether CsA-binding proteins named cyclophilins (Cyps) are involved in the anti-VV activity of CsA. Six CsA analogues were analysed, and their affinity for Cyps in VV-infected BSC-40 cells and their potency as inhibitors of VV replication were evaluated. It was demonstrated that analogues with strong Cyp-binding activity, such as CsC, CsG and [MeAla6]CsA, also exhibit a strong antiviral effect. In contrast, drugs with low ([MeBm2t1]CsA and CsH) or no ([MeLeu11]CsA) affinity for Cyps show poor or no antiviral activity. The data obtained suggest a correlation between the ability of CsA to block VV replication and Cyp binding activity, and indicate the involvement of Cyps in the VV replicative cycle. They also suggest that the anti-VV action of CsA may occur by a pathway distinct from that involved in the immunosuppressive effect of the drug.
Drug-induced mitochondrial dysfunction has been implicated in many types of organ toxicity, including liver and intestine. The induction of the mitochondrial permeability transition (mPT) has been seen as a mechanism of this toxicity. The mitochondrial matrix protein cyclophilin D (CypD) is a key regulator of the mPT, lending itself as a potential target for therapeutic intervention. The overall aim of this research project is to explore the mPT as a potential mediator of drug-induced mitochondrial toxicity in intestine and liver. Small intestinal ulceration is a frequent and serious adverse effect associated with the use of non-steroidal anti-inflammatory drugs. Mitochondria have been implicated in ulcer development. We have shown that inhibition of the mPT pore by pharmacologic blockade of CypD resulted in significant protection from diclofenac injury in cultured enterocytes and a 70% reduction in intestinal ulcers in mice. Furthermore, Ppif-/- (the gene encoding CypD) mice show 80% ulcer reduction
This gene is a member of the cyclophilin family of peptidylprolyl isomerases. The cyclophilins are a highly conserved family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. [provided by RefSeq, Jul 2008 ...
Redesigning an FKBP-ligand interface to generate chemical dimerizers with novel specificity. Proc Natl Acad Sci U S A (1998) 3.88 The immunophilin FK506-binding protein modulates Ca2+ release channel closure in rat heart. J Physiol (1997) 2.01 Inhibition of human immunodeficiency virus type 1 replication in human cells by Debio-025, a novel cyclophilin binding agent. Antimicrob Agents Chemother (2008) 1.46 Hair growth modulation by topical immunophilin ligands: induction of anagen, inhibition of massive catagen development, and relative protection from chemotherapy-induced alopecia. Am J Pathol (1997) 1.17 Rectification of skeletal muscle ryanodine receptor mediated by FK506 binding protein. Biophys J (1995) 1.10 A role for FKBP52 in Tau protein function. Proc Natl Acad Sci U S A (2010) 1.07 FKBP12 is a critical regulator of the heart rhythm and the cardiac voltage-gated sodium current in mice. Circ Res (2011) 0.99 From nature to the laboratory and into the clinic. Bioorg Med Chem (2008) 0.95 ...
Astrocytes extend highly branched processes that form functionally isolated microdomains, facilitating local homeostasis by redistributing ions, removing neurotransmitters, and releasing factors to influence blood flow and neuronal activity. Microdomains exhibit spontaneous increases in calcium (Ca2+), but the mechanisms and functional significance of this localized signaling are unknown. By developing conditional, membrane-anchored GCaMP3 mice, we found that microdomain activity that occurs in the absence of inositol triphosphate (IP3)-dependent release from endoplasmic reticulum arises through Ca2+ efflux from mitochondria during brief openings of the mitochondrial permeability transition pore. These microdomain Ca2+ transients were facilitated by the production of reactive oxygen species during oxidative phosphorylation and were enhanced by expression of a mutant form of superoxide dismutase 1 (SOD1 G93A) that causes astrocyte dysfunction and neurodegeneration in amyotrophic lateral sclerosis ...
The participation of mitochondria in cellular and neuronal Ca2+ homeostatic networks is now well accepted. Yet, critical tests of specific mitochondrial pathways in neuronal Ca2+ responses have been hampered because the identity of mitochondrial proteins that must be integrated within this dynamic system remain uncertain. One putative pathway for Ca2+ efflux from mitochondria exists through the formation of the permeability transition pore (PTP) that is often associated with cellular and neuronal death. Here, we have evaluated neuronal Ca2+ dynamics and the PTP in single adult neurons in wild-type mice and those missing cyclophilin D (CyPD), a key regulator of the PTP. Using high-resolution time-lapse imaging, we demonstrate that PTP opening only follows simultaneous activation with two physiological stimuli that generate critical threshold levels of cytosolic and mitochondrial Ca2+. Our results are the first to demonstrate CyPD-dependent PTP opening in normal neuronal Ca2+ homeostatic ...
Calcium modulating ligand (CAMLG or CAML), also known as calcium-modulating cyclophilin ligand, is a signalling protein recognized by the TNF receptor TACI. The immunosuppressant drug cyclosporin A blocks a calcium-dependent signal from the T-cell receptor (TCR) that normally leads to T-cell activation. When bound to cyclophilin B, cyclosporin A binds and inactivates the key signaling intermediate calcineurin. The protein encoded by this gene functions similarly to cyclosporin A, binding to cyclophilin B and acting downstream of the TCR and upstream of calcineurin by causing an influx of calcium. This integral membrane protein appears to be a new participant in the calcium signal transduction pathway, implicating cyclophilin B in calcium signaling, even in the absence of cyclosporin. CAMLG has been shown to interact with TNFRSF13B. GRCh38: Ensembl release 89: ENSG00000164615 - Ensembl, May 2017 GRCm38: Ensembl release 89: ENSMUSG00000021501 - Ensembl, May 2017 "Human PubMed Reference:". "Mouse ...
To characterize the cellular action mechanism of Debio 0507, we compared the major DNA adducts formed by Debio 0507- and oxaliplatin-treated HCT116 human colon carcinoma cells by a combination of inductively coupled plasma mass spectrometry (ICP-MS) and ultraperformance liquid chromatography mass spectrometry (UPLC-MS/MS). HCT116 cells were treated with IC50 doses of Debio 0507 or oxaliplatin for 3 days. Total cellular Pt-DNA adducts were determined by ICP-MS. The DNA was digested, and the major Pt-DNA adducts formed by both drugs were characterized by UPLC/MS/MS essentially as described previously for cisplatin (Baskerville-Abraham et al. in Chem Res Toxicol 22:905-912, 2009). The Pt level/deoxynucleotide was 7.4/104 for DNA from Debio 0507-treated cells and 5.5/104 for oxaliplatin-treated cells following a 3-day treatment at the IC50 for each drug. UPLC-MS/MS in the positive ion mode confirmed the major Pt-DNA adducts formed by both drugs were dach-Pt-d(GpG) (904.2 m/z → 610 m/z and 904.2 m/z →
References for Abcams Recombinant human Cyclophilin 40 protein (ab78815). Please let us know if you have used this product in your publication
Rescue and Role of Complex I in Myocardial Ischemic Injury: Members of the Bcl-2 family function at the mitochondrial outer membrane to regulate programmed cell death, or apoptosis. Bax and Bak are multi-domain pro-apoptotic members of the family, but their activity is directly or indirectly regulated by proteins of the BH3-only subfamily (Bcl-2 relatives that only share homology in domain 3). We are interested in Bid, a BH3-only protein that is proteolytically activated during ischemia/reperfusion and targets the mitochondria to initiate apoptosis. Mitochondria can promote necrotic cell death through a second pathway involving a mysterious entity known as the Mitochondrial Permeability Transition Pore, which includes cyclophilin D and other components that are the subject of intense investigation. We hypothesize that the electron transfer Complex I may be a part of the pore and may be regulated by Complex I. We have developed a cell-permeable therapeutic protein that can protect the heart ...
This project will analyze the effects of life-long physical activity on brain function in Alzheimer disease (AD) and aging with special reference to mitochondrial-mediating mechanisms. Behavioral tests, mitochondrial bioenergetics endpoints (oxygen consumption, transmembrane potential) and calcium movements will be performed. Markers of oxidative damage, mitochondrial dynamics, apoptosis and antioxidants, including Bax/Bcl2, SIRT3, p66Shc, MnSOD, aconitase, carbonyls, PGC-1a, Mfn, Drp 1, Fis-1, caspase 3/9 activities, and the mitochondrial permeability transition pore regulators F(1)F(0) ATP-synthase c subunit, ANT and cyclophilin D will be measured. With this project funded by FCT (PTDC/DTP/DES/1246/2012), important contributions to understand the mitochondrial mechanisms associated with the role of exercise to mitigate age- and AD-related brain dysfunction will be provided. Depending on the data obtained, it may be suggested that an active life-style during life course reduces brain ...
70147 (prev NZ4213969); b Timaru 14 May 23; Wanganui Collegiate; farmer - E A Hall, Bellwood, Timaru. NZ Army/TF 13½ mths; RNZAF Levin as Aircrafthand (ADU) 31 Oct 42, Taieri 4 Dec 42, Ashburton 9 Dec 42, Milson 2 Apr 43, remust as Aircrew u/t & ITW 29 Apr 43, remust as Airman Pilot u/t 24 Jun 43, 2EFTS 26 Jun 43, 1SFTS 28 Aug 43, Pilots Badge [wef 1.11.43] & Comm 23 Dec 43, OSI 31 Dec 43, CFS 15 Jan 44, 2EFTS (Tiger Moth) as FI 14 Mar 44, 3EFTS (Tiger Moth) as FI 19 Aug 44 [att CFS for Harvard conv 21 Oct-13 Nov], 2OTU (P-40) 25 Nov 44, CCU (Corsair) 5 Feb 45, 16 Sqn (Corsair) 12 Mar 45, with Sqn to Pacific 1 Apr 45, rtd with Sqn to NZ 23 Jun 45, with Sqn to Pacific 13 Aug 45, rtd with Sqn to NZ 4 Nov 45, 14 Sqn (Corsair) 1 Dec 45, emb with Sqn on light fleet HMS Glory for Japan 8 Mar 46, arr 26 Mar 46, SSComm 1 Apr 46, rtd to NZ 21 Apr 47, SSComm 1 Apr 47, 41 Sqn (Dakota) 30 May 47, Whenuapai for admin duties 6 Jun 47 [Adj from 27 Jun, att Army Sch Trentham 4-10 Feb 48], CFS (various a/c ...
Background:. Since the introduction of cisplatin, carboplatin and oxaliplatin, several new generations of platinum analogues have been developed as candidates for chemotherapy. DEBIO 0507/NC-4016 is a DACH-Platin Polymeric Micelle. The main objectives of this project were to assess pharmacokinetic (PK) profile of DEBIO 0507 and evaluate its efficacy in preclinical studies against a broad spectrum of experimental tumors including syngenic, xenogenic tumor models and a cisplatin-resistant cell line.. Methods:. PK and biodistribution studies were conducted in multiple matrices (blood, tumor, liver, spleen, kidneys and pancreas) collected in mice bearing C38 mouse colon carcinoma and treated with a single IV injection of DEBIO 0507 at 2 mg Pt/kg.. Antitumor activity of DEBIO 0507 intravenously injected every 4, 7 or 14 days at different doses was investigated in C38 mouse colon carcinoma bearing C57BL/6 mice. Antitumor effect of DEBIO 0507 was also assessed in a panel of human tumor xenografted in ...
Activated carbons were characterized texturally and chemically before and after treatment, using surface area determination in the BET model, Boehm titration, TPR, DRX and immersion calorimetry. The adsorption capacity and the kinetics of sulphur compound removal were determined by gas chromatography. It was established that the propanethiol retention capacity is dependent on the number of oxygenated groups generated on the activated carbon surface and that activated carbon modified with CuO at 0.25 M shows the highest retention of propanethiol. Additionally is proposed a mechanism of decomposition of propenothiol with carbon-copper system.
|p|Mextra|sup|®|/sup| Superabsorbent addresses three of the important features of a superabsorbent dressing. High absorption capacity|sup|1,2,|/sup| high retention capacity|sup|1|/sup| and excellent conformability|sup|3|/sup|.  Mex
NOVEL RNAi THERAPEUTIC FOR TREATMENT OF HEPATITIS C INFECTION - Small interfering RNAs (siRNAs) or small hairpin RNA (shRNAs) and compositions comprising same are provided that specifically target human cyclophilin A (CyPA) to effectively inhibit Hepatitis C(HCV) infection in a cell. Such siRNA and shRNAs may have a length of from about 19 to about 29 contiguous nucleotides corresponding to a specific region of human cyclophilin A (CyPA) cDNA of from about nucleotide 155 to about nucleotide 183 having particular potency against CyPA and HCV. Such siRNA and shRNAs may be formulated as naked compositions or as pharmaceutical compositions. DNA polynucleotides, plasmids, and viral or non-viral vectors are also provided that encode siRNA or shRNA molecules, which may be delivered directly to cells or in combination with known delivery agents, such as lipids, polymers, encapsulated lipid particles, such as liposomes. Methods for treating, managing inhibiting, preventing, etc., HCV infection using such ...
Lausanne, Switzerland (ots/PRNewswire) - - Debio 1450, oral/IV FabI inhibitor active against all Staphylococcus species has received Fast Track designation for ABSSSI (acute...
This work has been made available to the staff and students of the University of Sydney for the purposes of research and study only. It constitutes material that is held by the University for the purposes of reporting for HERDC and the ERA. This work may not be downloaded, copied and distributed to any third party ...
[liste de diffusion pappso-tools] (/mailinglist)Réseaux nationaux en protéomique [Réseau des Plateformes Protéomiques dIle de France] (http://pappso.inra.fr/ppif) [Réseau MassProt’ INRA : huit plateaux de spectrométrie de masse en France] (http://massprot.
ウサギ・ポリクローナル抗体 ab3562 交差種: Ms,Rat,Rb,Chk,Cow,Hu,NHuPrm 適用: WB,IP,IHC-P,IHC-Fr,ICC,Flow Cyt,ICC/IF…Cyclophilin…
Shop Inactive peptidyl-prolyl cis-trans isomerase ELISA Kit, Recombinant Protein and Inactive peptidyl-prolyl cis-trans isomerase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
ppiase, cyp37, peptidyl-prolyl, cis-trans, isomerase, cyp37, chloroplastic, PPIase CYP37 | peptidyl-prolyl cis-trans isomerase CYP37, chloroplastic, P82869, ABF57273.1, AS10 1589
Gentaur molecular products has all kinds of products like :search , GenWay \ Peptidyl-prolyl cis-trans isomerase H - EC 5.2.1.8; PPIase H; Rotamase H; U-snRNP-associated cyclophilin SnuCyp-20; USA-CYP; Small nuclear ribonucleoprotein particle-specific cyclophilin H; CypH \ 10-288-21963F for more molecular products just contact us
Intracellular pH must be kept close to neutrality to be compatible with cellular functions, but the mechanisms of pH homeostasis and the responses to intracellular acidification are mostly unknown. In the plant Arabidopsis thaliana, we found that intracellular acid stress generated by weak organic acids at normal external pH induces expression of several chaperone genes, including ROF2, which encodes a peptidyl-prolyl cis-trans isomerase of the FK506-binding protein class. Loss of function of ROF2, and especially double mutation of ROF2 and the closely related gene ROF1, results in acid sensitivity. Over-expression of ROF2 confers tolerance to intracellular acidification by increasing proton extrusion from cells. The activation of the plasma membrane proton pump (H+-ATPase) is indirect: over-expression of ROF2 activates K+ uptake, causing depolarization of the plasma membrane, which activates the electrogenic H+ pump. The depolarization of ROF2 over-expressing plants explains their tolerance to ...
In the hours and days following acute CNS injury, a secondary wave of events is initiated that exacerbate spinal tissue damage and neuronal cell death. A potential mechanism driving these secondary events is opening of the mitochondrial permeability transition pore (mPTP) and subsequent release of several cell death proteins. Previous studies have shown that inhibition of cyclophilin D(CypD), the key regulating component in mPTP opening, was protective against insults that induce necrotic cell death. We therefore hypothesized that CypD-null mice would show improved functional and pathological outcomes following spinal cord injury (SCI) and traumatic brain injury (TBI). Moderate and severe spinal contusion was produced in wild-type (WT) and CypD-null mice at the T-10 level using the Infinite Horizon impactor. Changes in locomotor function were evaluated using the Basso Mouse Scale (BMS) at 3 days post-injury followed by weekly testing for 4 weeks. Histological assessment of tissue sparing and lesion
PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides (By similarity).
Objective: A mechanism of mitochondrial injury during ischemia/reperfusion is Ca2+-induced opening of the mitochondrial permeability transition pore (mPTP). We examined whether cyclosporine A (CsA), an mPTP inhibitor, could benefit resuscitation in a rat model of cardiac arrest. We also assessed whether CsA prevents Ca2+ mediated mPTP opening in isolated mitochondria using a swelling assay.. Methods: VF was induced and left untreated for 10 mins. Resuscitation was attempted by 8 mins of chest compression and defibrillation, observing the rats for 360 mins post-resuscitation (PR). Rats were randomized to receive 10 mg/kg CsA (n=6) or vehicle (n=3) before inducing VF or 10 mg/kg CsA (n=6) or vehicle (n=3) before starting chest compression. CsA treated and vehicle treated subgroups were pooled for the analysis. Four rats not subjected to cardiac arrest served as sham. Mitochondrial NAD+ levels in hearts harvested after the PR interval served as indirect marker of mPTP opening. Mitochondria isolated ...
In the present study, we investigated the involvement of the mitochondrial permeability transition pore (PTP) in nitric oxide (NO)-induced plant cell death. NO donors such as sodium nitroprusside (SNP) and S-nitroso-N-acetylpenicillamine inhibited growth and caused death in suspension-cultured cells of Citrus sinensis. Cells treated with SNP showed chromatin condensation and fragmentation, characteristic of apoptosis. SNP caused loss of the mitochondrial membrane electrical potential, which was prevented by cyclosporin A (CsA), a specific inhibitor of PTP formation. CsA also prevented the nuclear apoptosis and subsequent Citrus cell death induced by NO. These findings indicate that mitochondrial PTP formation is involved in the signaling pathway by which NO induces apoptosis in cultured Citrus cells. (C) 2002 Federation of European Biochemical Societies. Published by Elsevier Science B.V. All rights reserved ...
The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It is thought to mediate calcineurin inhibition. It also interacts functionally with mature hetero-oligomeric progesterone receptor complexes along with the 90 kDa heat shock protein and P23 protein. This gene has been found to have multiple polyadenylation sites. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009 ...
This project is supported by the Canadian Institutes of Health Research (award #111062), Alberta Innovates - Health Solutions, and by The Metabolomics Innovation Centre (TMIC), a nationally-funded research and core facility that supports a wide range of cutting-edge metabolomic studies. TMIC is funded by Genome Alberta, Genome British Columbia, and Genome Canada, a not-for-profit organization that is leading Canadas national genomics strategy with funding from the federal government. Maintenance, support, and commercial licensing is provided by OMx Personal Health Analytics, Inc. Designed by Educe Design & Innovation Inc. ...
Hereditäre equine dermale Asthenie (HERDA) ist eine autosomal rezessive Hautkrankheit, die vor allem junge Quarter Horses und verwandte Rassen betrifft. Die Symptome sind charakterisiert durch leichte Verletzbarkeit und erhöhte Dehnbarkeit der Haut, meist in der Satelllage. Die Prognose ist vorsichtig zu stellen, denn die Pferde können nicht normal zum Reiten eingesetzt werden und müssen oft euthanasiert werden. Beim Quarter Horse ist HERDA mit einer Mutation im Cyclophilin B Gen (PPIB) assoziiert. Cyclophilin B ist ein Enzym, welches für die Tripelhelixbildung von Kollagen wichtig ist. Wir beschreiben hier eine Schweizer Jährlings-Stute mit Symptomen von HERDA, aber ohne Mutation im PPIB Gen und bei der auch Ehlers-Danlos Typ IV, Typ VI, Typ VIIA, Typ VIIB und Typ VIIC (Dermatosparaxis) als ätiologische Ursache ausgeschlossen werden konnten.. Schlüsselwörter: Hereditäre equine regionale dermale Asthenie,Warmblutfohlen,rezessive Hautkrankheit,Kollagen. ...
Autori: Bogdan Bancia Editorial: 2009.. Rezumat:. The three-dimensional structure determination of proteins represents an important step towards understanding their biological function and thus their roles in living organisms. Using a combination of multidimensional NMR techniques three different biomolecules were analyzed in the present study, E. coli peptidyl - prolyl cis-trans isomerase PpiB, proinsulin connecting peptide and DnaG-C. 15N-HSQC spectra were recorded of PpiB which had been expressed without further purification in a cell-free expression system with amino acid selective isotope labelling. Comparison of spectra before and after ultrafiltration indicated that labelled metabolic by-products are of low molecular weight. Therefore, the labelled protein signals are easily distinguished from those of metabolites. The structure analysis of the proinsulin connecting peptide included the assignment of 1H, 13C and 15N NMR resonances using 2D NMR, measurement of T1 (1H) relaxation times and ...
Mitochondria play an important role in energy production, Ca2+ homeostasis and cell death. In recent years, the role of the mitochondria in apoptotic and necrotic cell death has attracted much attention. In apoptosis and necrosis, the mitochondrial permeability transition (mPT), which leads to disru …
We have previously shown that pre-treatment with our novel cyclophilin (Cyp) inhibitor, MM284, could prevent disease in the animal model of biliary atresia (BA) by decreasing SMAD phosphorylation and TIMP-4 and MMP-7 expression. We hypothesized that MM284 treatment after viral infection would be similarly effective, and in vitro MM284 could prevent Cyp stimulation of hepatic stellate cells (HSCs). Newborn Balb/c mice were randomized to receive an intraperitoneal injection with saline control or rhesus rotavirus (RRV) within 24 hours of birth. Animals receiving RRV were further randomized to receive either 20mg/kg i.p of MM284 or control vehicle starting day of life 2, and then thrice weekly. Mice treated with MM284 were normal weight, had an approximately five-fold decrease in TIMP-4 and a tenfold decrease in MMP7 mRNA expression when compared to RRV mice. SMAD2/3 phosphorylation in the HSC lysates revealed a significant 1.5-fold increase after CypA treatment relative to untreated cells which ...
Activation of the mitochondrial permeability transition pore (PTP) clearly plays a key role in some of the most wide-spread and therapeutically challenging huma...
Peptidyl-prolyl Cis-trans Isomerase (cyclophilin); Catalyzes The Cis-trans Isomerization Of Peptide Bonds N-terminal To Proline Residues; Plays A Role In Determining Prion Variants; Binds To Hsp82p And Contributes To Chaperone Activity; Protein Abundance Increases In Response To DNA Replication Stress
Cyclophilin H / PPIH, 0.5 mg. Cyclophilin H (also known as peptidylpropyl isomerase H, PPIH) is a member of peptidyl-propyl cis-trans isomerase (PPIase) family, which catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides
Mitochondrial dysfunction in heart failure includes greater susceptibility to mitochondrial permeability transition (MPT), which may worsen cardiac function and decrease survival. Treatment with a mixture of the n3 polyunsaturated fatty acids (n3 PUF
Cyclophilin (Cyp) A has been reported to be overexpressed in the majority of cancer cells, including hepatocellular carcinoma (HCC). However, the biological functions of CypA in HCC are far from being understood. To determine the biological functions of CypA in HCC, the present study screened human fetal liver complementary DNA for proteins interacting with CypA using the yeast two-hybrid system. A nuclear protein, serine/arginine-rich (SR)-25, was isolated as a novel CypA-binding protein that is distinct from those previously described in the literature. Binding assays and co-immunoprecipitation confirmed the physical association between CypA and SR-25. The present study demonstrated that CypA may interact with SR-25 through its peptidyl-prolyl isomerase domain. In addition, CypA may induce the expression of SR-25 in Hep3B cells. The messenger RNA levels of CypA and SR-25 in HCC indicated that there was a significant correlation between the expression of CypA and the expression of SR-25 in HCC. It can
Cyclophilin D (referred to as HsCypD) was obtained from the freshwater pearl mussel (Hyriopsis schlegelii). The full-length cDNA was 2 671 bp, encoding a protein consisting of 367 amino acids. HsCypD was determined to be a hydrophilic intracellular protein with 10 phosphorylation sites and four tetratricopeptide repeat (TPR) domains, but no signal peptide. The core sequence region YKGCIFHRIIKDFMVQGG is highly conserved in vertebrates and invertebrates. Phylogenetic tree analysis indicated that CypD from all species had a common origin, and HsCypD had the closest phylogenetic relationship with CypD from Lottia gigantea ...
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
ContraVir is a biopharmaceutical company focused on the development and commercialization of targeted antiviral therapies with a specific focus on developing a potentially curative therapy for hepatitis B virus (HBV). The Company is developing two novel anti-HBV compounds with complementary mechanisms of action. TXL™ currently in Phase 2, is designed to deliver high intrahepatic concentrations of TFV, while minimizing off-target side-effects caused by high levels of circulating TFV. CRV431, the other anti-HBV compound, is a next-generation cyclophilin inhibitor with a unique structure that increases its potency and selective index against HBV. ContraVir is also developing Valnivudine™, an orally available nucleoside analogue prodrug; Valnivudine™ is currently in Phase 3 for the treatment of herpes zoster. In addition to direct antiviral activity, Phase 2 data suggest that Valnivudine™ has the potential to reduce the incidence of debilitating shingles-associated pain known as ...
A new collaboration agreement has been signed between the Swedish company NeuroVive Pharmaceutical AB and Karolinska Institutet, Stockholm in order to develop NeuroVives cyclophilin inhibitor compound NV556 for the treatment of mitochondrial myopathy, an area of high unmet medical need of new and e...
Attempts have been made to reveal the survival strategies of the two forms ofTrianthema portulacastrum. These morphs, vizrubra andflava, do not show any remarkable difference in their morphology, phenology and water relations. Metabolically,rubra form is more hardy thanflava form, because of lesser water loss, higher water retention capacity, high protein content and higher levels of proline accumulation at different stages of plant growth. Seed germination studies revealed the presence of hard seed coatedness in both morphs, being more in theflava form.
The fibrous webs described herein may be incorporated into the filter media and filter elements. Fiber webs can show high dust retention capacity. The fibrous web may also show a low thickness. The fibrous webs may be sufficiently flexible and / or deformable so that they may comprise a series of bends (also known as flutes) that are processed and extend along the cross machine direction.
Manufactured from thick and %100 pure cotton fibres for reproducible results without any harm to the samples.. Offers high temperature resistance up to 550 °C , high mechanical strenght and excellent retention capacity.. Controlled dimentional accuracy guarantess excellent fitting to the extractors body. Also suitable for extrating solid or liquid samples from the gasses.. ...
TNF receptor-associated protein 1 (TRAP1), the main mitochondrial member of the heat shock protein (HSP) 90 family, is induced in most tumor types and is involved in the regulation of proteostasis in the mitochondria of tumor cells through the control of folding and stability of selective proteins, such as Cyclophilin D and Sorcin. Notably, we have recently demonstrated that TRAP1 also interacts with the regulatory protein particle TBP7 in the endoplasmic reticulum (ER), where it is involved in a further extra-mitochondrial quality control of nuclear-encoded mitochondrial proteins through the regulation of their ubiquitination/degradation. Here we show that TRAP1 is involved in the translational control of cancer cells through an attenuation of global protein synthesis, as evidenced by an inverse correlation between TRAP1 expression and ubiquitination/degradation of nascent stress-protective client proteins. This study demonstrates for the first time that TRAP1 is associated with ribosomes and ...
Meier, Jeremy A. and Hyun, Moonjung and Cantwell, Marc and Raza, Ali and Mertens, Claudia and Raje, Vidisha and Sisler, Jennifer and Tracy, Erin and Torres-Odio, Sylvia and Gispert, Suzana and Shaw, Peter E. and Baumann, Heinz and Bandyopadhyay, Dipankar and Takabe, Kazuaki and Larner, Andrew C. (2017) Stress-induced dynamic regulation of mitochondrial STAT3 and its association with cyclophilin D reduces mitochondrial ROS production. Science Signaling, 10 (472). eaag2588. ISSN 1937-9145 ...
Peptidyl-prolyl isomerases (PPIases) are a well conserved class of enzymes found throughout nature in microorganisms, plants and animals. They are characterized by their ability to catalyze the conversion of cis- and trans- peptidyl-proline bonds in proteins and consequently are able to exert control over target protein structure and function.
... ,The MitoPT kit is used in conjunction with your existing apoptosis protocols. Grow your cells in culture and induce apoptosis according to your existing procedure (also reserve a non-induced population of cells as a negative control). Once you have induced apoptosis in your cells, add the 1X MitoPT,biological,biology supply,biology supplies,biology product
The physiological roles of immunophilins are unclear, but many possess peptidyl-prolyl isomerase (PPIase) activity, and they have been found in all organisms examined to date, implying that they are involved in fundamental, protein-folding processes. The chloroplast thylakoid lumen of the higher plant Arabidopsis thaliana contains up to 16 immunophilins (five cyclophilins and 11 FKBPs), but only two of them, AtCYP20-2 and AtFKBP13, have been found to be active PPIases, indicating that the other immunophilins in this cellular compartment may have lost their putative PPIase activities. To assess this possibility, we characterized two independent Arabidopsis knockout lines lacking AtCYP20-2 in enzymological and quantitative proteomic analyses. The PPIase activity in thylakoid lumen preparations of both mutants was equal to that of corresponding wild-type preparations, and comparative two-dimensional difference gel electrophoresis analyses of the lumenal proteins of the mutants and wild type showed ...
One of the rate-limiting steps in protein folding has been shown to be the cis-trans isomerization of proline residues, which is catalyzed by a range of peptidylprolyl cis-trans isomerases. To characterize the interaction between model peptides and the periplasmic peptidylprolyl cis-trans isomerase SurA from E. coli, we employed a chemical cross-linking strategy that has been used previously to elucidate the interaction of substrates with other folding catalysts. The interaction between purified SurA and model peptides was significant in that it showed saturation and was abolished by denaturation of SurA; however the interaction was independent of the presence of proline residues in the model peptides. From results obtained by limited proteolysis we conclude that an N-terminal fragment of SurA, comprising 150 amino acids that do not contain the active sites involved in the peptidylprolyl cis-trans isomerization, is essential for the binding of peptides by SurA. This was confirmed by probing the ...
TY - JOUR. T1 - The mitochondrial permeability transition from in vitro artifact to disease target. AU - Bernardi, Paolo. AU - Krauskopf, Alexandra. AU - Basso, Emy. AU - Petronilli, Valeria. AU - Blalchy-Dyson, Elizabeth. AU - Di Lisa, Fabio. AU - Forte, Michael. PY - 2006/5. Y1 - 2006/5. N2 - The mitochondrial permeability transition pore is a high conductance channel whose opening leads to an increase of mitochondrial inner membrane permeability to solutes with molecular masses up to ≈1500 Da. In this review we trace the rise of the permeability transition pore from the status of in vitro artifact to that of effector mechanism of cell death. We then cover recent results based on genetic inactivation of putative permeability transition pore components, and discuss their meaning for our understanding of pore structure. Finally, we discuss evidence indicating that the permeability transition pore plays a role in pathophysiology, with specific emphasis on in vivo models of disease.. AB - The ...
TY - JOUR. T1 - Is cyclophilin involved in the immunosuppressive and nephrotoxic mechanism of action of cyclosporin A?. AU - Sigal, N. H.. AU - Dumont, F.. AU - Durette, P.. AU - Siekierka, John. AU - Peterson, L.. AU - Rich, D. H.. AU - Dunlap, B. E.. AU - Staruch, M. J.. AU - Melino, M. R.. AU - Koprak, S. L.. AU - Williams, D.. AU - Witzel, B.. AU - Pisano, J. M.. PY - 1991/1/1. Y1 - 1991/1/1. N2 - In this report we have approached two questions relating to the mechanism of action of cyclosporin A (CsA). First, we address whether the major cytosolic protein for CsA, cyclophilin, is directly involved in mediating the immunosuppressive activity of this drug, and, in particular, whether inhibition of this proteins peptidyl-prolyl cis-trans isomerase (PPIase) activity results in inhibition of murine T cell activation. Second, we ask whether the nephrotoxicity observed with CsA is related to inhibition of PPIase-dependent pathways in cells other than lymphocytes. Using a series of 61 cyclosporin ...
TY - JOUR. T1 - FKB1 encodes a nonessential FK 506-binding protein in Saccharomyces cerevisiae and contains regions suggesting homology to the cyclophilins. AU - Wiederrecht, G.. AU - Brizuela, L.. AU - Elliston, K.. AU - Sigal, N. H.. AU - Siekierka, J. J.. PY - 1991/2/21. Y1 - 1991/2/21. N2 - FK 506, a powerful immunosuppressant that blocks allograft rejection by preventing T-cell activation, binds to an 11-kDa protein called the FK 506-binding protein (FKBP). Like cyclophilin, a cytosolic protein that binds another immunosuppressant, cyclosporin A, FKBP possesses peptidylprolyl cis-trans isomerase activity. We have isolated a genomic clone encoding the yeast FKBP (FKB1). The gene encodes a protein of 114 amino acids having a calculated M(r) of 12,158. Disruption of the gene shows that FKB1 is not essential for growth. A search of translated nucleic acid data bases revealed bacterial FKBP homologs in Neisseria meningiditis and Pseudomonas aeruginosa. Comparison of the conserved amino acids in ...
The thermoplastic polymeric base materials for use herein furthermore can comprise from 5% to 90%, or from 10% to 85%, or from 15% to 70%, or preferably from 30% to 65% by weight of a suitable compatible plasticiser or a blend of suitable compatible plasticizers. Suitable plasticizers for use in the present invention generally can include any conventional plasticizers which decrease hardness and modulus, enhance pressure sensitive tack and reduce melt and solution viscosity h may be desirable that the plasticizer be water soluble or water dispersible or alternatively be a wax-like substance such as polyethylene or polypropylene glycol, glycerin, glycerol and its esters, butylene glycol or sorbitol. Other plasticizers suitable for use in the present invention may be esters of sucrose; phthalate plasticizers such as dioctyl phthalate and butyl benzyl phthalate (e. g., Santicizer 160 from Monsanto), benzoate plasticizers such as 1,4-cyclohexane dimethanol dibenzoate (e.g., Benzoflez 352 from ...
Cyclophilin antibody for detecting human peptidyl-prolyl cis-trans isomerase A. Validated on up to 12 cell lysates for western blotting. Try a trial size today.
PIN1 was recently identified as a peptidyl-prolyl cis-trans isomerase (PPIase). It binds to and isomerizes specific pSer/Thr-Pro motifs and catalytically induces conformational changes after phosphorylation. PIN1 plays an important role in several ce
Mono- and Stereopictres of 5.0 Angstrom coordination sphere of Sodium atom in PDB 2poc: The Crystal Structure Of Isomerase Domain of Glucosamine-6-Phosphate Synthase From Candida Albicans
The permeability transition pore (PTP) is a mysterious structure that induces cell death by increasing the permeability of the inner mitochondrial membrane (IMM) to ions and soluble molecules. In 2015, the F1FO‐ATPase was identified as being involved in forming the PTP in eukaryotes [1]. Two hypotheses were put forward to explain the mechanism of PTP opening, both of which involve the mitochondrial F1FO‐ATPase: the channel forms within the c‐ring [2] or results from the conformational changes of F1FO‐ATPase dimers [3]. F1FO‐ATPase is a multisubunit enzyme at the cristae edges of the IMM that either synthesizes (forward reaction) or hydrolyses ATP (reverse reaction) in the catalytic hydrophilic F1 domain while translocating H+ through the c‐ring in the hydrophobic FO domain.. The first hypothesis by Alavian and colleagues proposes that the PTP channel is created within the c‐ring of the FO subunit by Ca2+‐dependent extrusion of the extrinsic F1 domain from the membrane‐embedded ...
An absorbent article comprises a backsheet and an absorbent layer, where the absorbent layer comprises a support substrate and a superabsorbent polymer composition positioned adjacent to the substrate. The absorbent layer may also include an additional substrate, and the article may additionally include a topsheet. The superabsorbent polymer composition comprises a water-soluble ionic polymer capable of sufficient non-radiative crosslinking within about 10 minutes at a temperature of about 120 C. or less to reach an absorbent capacity of at least 1 g/g as measured by the Centrifuge Retention Capacity Test. In addition, the absorbent layer is restretched. The result is an absorbent article which exhibits improved performance as well as greater comfort and confidence among the user.
Number 2. Energizing and regenerating the skins protective layer - with its high content of omega 3 and 6 fatty acids, hemp oil has composition thats similar to skin lipids. With this in mind, it makes it an excellent natural moisturizer and emollient. This is used most especially for tired, dehydrated or dry skin as well as nails. This is capable of increasing the skin elasticity and even the water retention capacity in the tissues. Pure hemp oil can be used to treat dry hair and it is usually included in various hair products like hair conditioners. Number 3. Ideal for vegans - it can be tricky for vegans to get the right balance of omega 3 and 6 fatty acids but the good thing is, hemp oil has optimal ratio of such acids. Number 4. Good for diabetics - hemp oil can be an excellent food additive for those who are suffering from diabetes mainly because of the low sugar and carbohydrate content. The nutrients present in such help in moderating the levels of blood sugar in the body. Number 5. ...
To find and calibrate a robust and reliable computational protocol for mapping conformational space of medium-sized molecules, exhaustive conformational sampling has been carried out for the series of seven macrocyclic compounds of varying ring size and one acyclic analogue. While five of them were taken from the MD/LLMOD/force-field study by Shelley and coworkers (J. Chem. Inf. MODEL: 2014, 54, 2680), three represent potential macrocyclic inhibitors of human cyclophilin A. The free energy values (GDFT/COSMO-RS) for all conformers of each compound were obtained by the composite protocol based on the in vacuo quantum mechanics (DFT-D3 method in a large basis set), standard gas-phase thermodynamics and the COSMO-RS solvation model (QM+COSMO-RS ...
2KFW: The interaction of the Escherichia coli protein SlyD with nickel ions illuminates the mechanism of regulation of its peptidyl-prolyl isomerase activity.
PIs: Dr Sean Davidson, Dr Robert Bell. The Hatter Cardiovascular Institute as part of the Institute of Cardiovascular Sciences at University College London is an internationally renowned research centre which undertakes clinical and basic research investigating ways to protect the heart from the damaging effects of an acute myocardial infarction. Its particular areas of interest includes the pathophysiology of cardioprotection in the setting of diabetes, ischaemia/reperfusion injury, molecular aspects of adaptation to ischaemic injury and myocardial conditioning in both the basic and clinical arena. In the basic research setting, the HCI was instrumental is identifying the signalling pathways including the RISK pathway as well as the role of the mitochondrial permeability transition pore (MPTP) in cardioprotection. In the clinical setting the HCI was the first to demonstrate the phenomenon of preconditioning in patients and the first to undertake a multicenter outcome study of remote ...
Lausanne, Switzerland (ots/PRNewswire) - Debiopharm presents preclinical results for 2 anti-cancer targeted therapies Debio 1143 and Debio 1347 Debiopharm International SA...
The nonparametric Mann-Whitney U test was used to assess the difference in the geometric mean titers (GMTs) of anti-HHV8 IgG between the HHV8 mono-infection and co-infection groups. Triglyceride (TG) was measured with a Triglyceride kit (Wako, Tokyo, Japan) according to the manufacturers instructions. Differences were considered significant when p ≤ 0.05. Results from phylogenetic analyses suggest networks of HCV transmission among these men. Next we assessed dose-dependency of ODN 320, with concentrations ranging from 10 to 320 nM. Ind. Studies were rated as low, moderate or high risk of bias.. SDC2-specific monoclonal antibody (2965) was from R&D Systems. siRNA target sequences were: AAGGGTTCCTGCTTTCACAGA for CypA; AAGGTGGAGAGAGCACCAAGACA for CypB; GTGACATCACCACTGGAGATG for CypC; AACCTGCTAAATTGTGCGTTA for CypD; and AATTCTCCGAACGTGTCACGT for control. These seven helicase motifs essentially form the motor which converts the chemical energy derived from ATP hydrolysis into a mechanical force ...
Gentaur molecular products has all kinds of products like :search , Prospecbio \ CD3 \ ANT-144 for more molecular products just contact us
Mitochondrial Permeability Transition (MPT) is reported as the mechanism of acetaminophen induced hepatic damage, however, rat models are resistant to acetaminophen induced toxicity. The occurrence and degree of mitochondrial permeability transition after treatment with 400 mg kgG1 of acetaminophen in albino Wistar rats were assessed. Animals were randomly distributed into seven groups; control, 12, 24, 36, 48, 60 and 72 h based on varying time (in hour) post acetaminophen prior to sacrifice after treatment. Mitochondrial Membrane Permeability Transition (MMPT) pore opening and mitochondrial cytochrome c release were estimated. Opening of MMPT pore and cytochrome c release were observed in 12, 24, 36 and 72 h, when compared with the control group. Liver function and histological results indicated no liver damage. It is concluded that toxic dose of acetaminophen induced mitochondrial permeability transition in rat hepatic tissues without leading to necrotic damage suggesting that rat hepatic ...
A CDDP resistant SK-Hep1 HCC cell line was established in the present study. The resistant cells showed an increase of 13.76 folds in the resistance to CDDP as compared to parent SK-Hep1 cells. The resistant cells also highly expressed MDR1 and had decreased expression of apoptotic protein Bax.. MDR1 expression has been considered to be associated with the resistance to adriamycin and vincristine, but not to cisplatin[10,11]. However, the MDR1 was over-expressed in myelogenous leukemia cells[12] and HCC cell lines [13] after CDDP treatment. Recent studies showed that HCC expressed MRP1, MDR1, MRP3 and breast cancer resistance protein (BCRP/ABCG2), and these proteins render cancer cells to be a MDR phenotype [14,15]. In the present study, MDR1 was significantly up-regulated in CDDP -resistant SK-Hep1 cells, suggesting that MDR1 is also involved in the resistance of cancer cells to CDDP.. The regulatory effects of ATR and CsA on the CDDP-induced cytotoxicity were examined in the resistant cells. ...
Although the precise molecular composition of the MPTP is currently undergoing investigation, its core components are thought to be the adenine nucleotide translocase (ANT) located in the inner mitochondrial membrane and cyclophilin D, a peptidyl prolyl cis-trans isomerase that interacts with ANT.129 Other components may include VDAC and the peripheral benzodiazepine receptor, which are located in the outer mitochondrial membrane. In healthy mitochondria, the close association of VDAC and ANT create a macromolecular complex that shuttles adenine nucleotides between the ATP-producing matrix and ATP-consuming cytosol. MPTP opening can be triggered under stress conditions, however, by increases in Ca2+, oxidative stress, depletion of adenine nucleotides, increases in inorganic phosphate, and depolarization of the inner mitochondrial membrane, stimuli that operate during ischemia-reperfusion.129 Although proapoptotic (Bax and Bak) and antiapoptotic (Bcl-2 and Bcl-xL) Bcl-2 proteins have been ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Autori: Abdelkrim Azzouz, Alina-Violeta Ursu, Denisa Nistor, Tudor Sajin, Elias Assaad, René Roy. Editorial: Thermochimica Acta (ISSN 0040-6031), Volume 496, Issues 1-2, p.45-49, 2009.. Rezumat:. Organoclays with improved affinity towards carbon dioxide were obtained via montmorillonite intercalation with polyol and amino dendrimers having respectively hydroxyl or amino groups that act as adsorbing sites. Measurements through thermal programmed desorption (TPD) show that higher amounts of CO2 than predicted by stoichiometry were retained by polyol organoclays, suggesting that more than one CO2 molecule adsorb on each OH group. The latter displayed optimal base properties tailored for: (i) improved retention capacity of CO2 by increasing their number; (ii) easy consecutive gas release upon slight heating owing to their weak basicity. Unlike amines, polyols display sufficiently weak basicity to exert only physical interaction towards carbon dioxide molecules. The reversible CO2 ...
TY - JOUR. T1 - Mitochondria. T2 - FKBP38 and mitochondrial degradation. AU - Shirane, Michiko. AU - Nakayama, Keiichi. PY - 2014/1/1. Y1 - 2014/1/1. N2 - FK506-binding protein 38 (FKBP38) is a membrane chaperone that is localized predominantly to mitochondria and contains a COOH-terminal tail anchor. FKBP38 also harbors an FKBP domain that confers peptidyl-prolyl cis-trans isomerase activity, but it differs from other FKBP family members in that this activity is dependent on the binding of Ca2+-calmodulin. FKBP38 inhibits apoptosis by recruiting the anti-apoptotic proteins Bcl-2 and Bcl-xL to mitochondria. Mice deficient in FKBP38 die soon after birth manifesting a defect in neural tube closure that results in part from unrestrained apoptosis. We recently found that FKBP38 and Bcl-2 translocate from mitochondria to the endoplasmic reticulum during mitophagy, a form of autophagy responsible for the elimination of damaged mitochondria. FKBP38 and Bcl-2 thus escape the degradative fate of most ...
A database search of the ASK1 sequence outside its kinase domain showed that a short amino acid sequence in the NH2-terminal part contains a motif for an FK506-binding protein (FKBP)-type peptidyl-prolyl cis-trans isomerase, of which the functional importance is unknown (Fig. 1A). The kinase domain of ASK1 has sequence similarity with members of the MAPKKK family including MEKK1 (30.0%) in mammal and SSK2 (32.3%) and STE11 (30.4%) in Saccharomyces cerevisiae. Phylogenetic comparison suggested that ASK1 is distantly related to RAF-1, KSR1, TAK1, and TPL-2 mammalian MAPKKKs but most closely related to the SSK2 or SSK22 family of yeast MAPKKKs, which are upstream regulators of yeast HOG1 MAPK (13).. Despite differences in the overall structures of ASK1 and SSK2 or SSK22 (13), it was of interest to examine whether ASK1 might act as a functional kinase in yeast and thereby complement the loss of SSK2 or SSK22. We used yeast strain TM257-H1 (ssk2Δ ssk22Δ sho1Δ) (13, 14), which grows in a normal YPD ...
FIG. 1. The SAHH gene is a Myc target gene. (A) P493-6 cells were incubated with doxycycline (Dox) to inhibit exogenous Myc expression or vehicle control (veh). Rat1A fibroblasts, primary MEFs, and IMECs were infected with retroviruses to express vector control, MycWT, or MycΔMBII, and pools of cells were drug selected. Primary murine T cells were incubated with IL-2, IL-7, and IL-15 for 24 h. Rat1A cells were incubated with a control siRNA (con si; cyclophilin B siRNA) or an siRNA directed against Myc (Myc si) for 24 h. Western blotting was performed to detect SAHH, Myc, β-tubulin, or POLR2A expression, as loading controls. (B) RNA was extracted from the cell lines indicated, and RT-PCR was performed to detect SAHH mRNA levels relative to GAPDH (or 18S rRNA for P493-6). Prim., primary. (C) In the IMEC lines indicated, SAHH mRNA was detected by RT-PCR (black bars) and m7G (cap-methylated) SAHH mRNA was detected by anti-m7G IP followed by RT-PCR (gray bars). (D) Rat fibroblasts expressing the ...
Staphylococcus aureus is a Gram-positive bacterium causing many kinds of infections from mild respiratory tract infections to life-threatening states as sepsis. It produces many toxins and has a remarkable ability to acquire resistance to antimicrobial drugs. Many S. aureus strains have acquired resistance to commonly used antibiotics and some strains are becoming multi-resistant. Methicillin-resistant strain of Staphylococcus aureus (MRSA) is the principal cause of severe nosocomial infections which can be fatal to compromised patients. Whole genome sequencing of two MRSA strains in 2001 was regarded as a way to find targets for novel antibiotics against infections caused by MRSA [1].. PrsA protein is found ubiquitously in Gram-positive bacteria, including S. aureus [Swiss-Prot:P60747], but not in Gram-negative ones [2, 3]. By sequence homology PrsA contains a parvulin-type peptidyl-prolyl cis-trans isomerase (PPIase) domain and flanking N- and C-terminal domains. PPIases are enzymes that ...
Induction of mitochondrial permeability transition (MPT) and cytosolic translocation of cytochrome C are considered essential components of the apoptotic pathway. Hence, there is the realization that mitochondrial- specific drugs could have potential for use as chemotherapeutic agents to trigger apoptosis In tumor cells. Recently, we showed that photoproducts of merocyanine 540 (pMC540) induced tumor cell apoptosis. In this study, we focused on identifying mitochondrial-specific compounds from pMC540 and studied their apoptotic potential. One purified fraction, C5, induced a drop In mitochondrial transmembrane potential and cytosolic translocation of cytochrome C in HL60 human leukemia cells. Moreover, the addition of C5 to purified rat liver mitochondria induced MPT as indicated by mitochondrial matrix swelling, which was completely inhibited by cyclosporin A, an inhibitor of the inner-membrane pore. Supernatant of C5-treated mitochondria showed a dose-dependent increase in cytochrome C, which ...

Peptidylprolyl Isomerase B (Cyclophilin B) (PPIB) (AA 26-216) Peptide</span...Peptidylprolyl Isomerase B (Cyclophilin B) (PPIB) (AA 26-216) Peptide</span...

Cyclophilin B) (PPIB) Peptide. Species: Human. Source: Escherichia coli (E. coli). Order product ABIN934947. ... Peptidylprolyl Isomerase B (Cyclophilin B) (PPIB) (AA 26-216) Peptide Peptidylprolyl Isomerase B (Cyclophilin B) (PPIB) (AA 26- ... Cyclophilin B protein has been used in SDS PAGE and may be suitable for use in other assays to be determined by the end user. ... Peptidylprolyl Isomerase B (Cyclophilin B) (PPIB) show synonyms for this antigen * cypb ...
more infohttp://www.antibodies-online.com/peptide/934947/Peptidylprolyl+Isomerase+B+Cyclophilin+B+PPIB+AA+26-216+peptide/

PLOS Biology: Structural and Biochemical Characterization of the Human Cyclophilin Family of Peptidyl-Prolyl IsomerasesPLOS Biology: Structural and Biochemical Characterization of the Human Cyclophilin Family of Peptidyl-Prolyl Isomerases

Although there are 17 cyclophilins in the human genome, the function of most cyclophilin isoforms is unknown. At least some ... Using biochemical, structural, and computational methods we characterize the human cyclophilin family in detail and suggest ... Author Summary Cyclophilins are proteins that catalyze the isomerization of prolines, interconverting this structurally ...
more infohttp://journals.plos.org/plosbiology/article/comments?id=10.1371/journal.pbio.1000439&imageURI=info:doi/10.1371/journal.pbio.1000439.g004

PLOS Biology: Structural and Biochemical Characterization of the Human Cyclophilin Family of Peptidyl-Prolyl IsomerasesPLOS Biology: Structural and Biochemical Characterization of the Human Cyclophilin Family of Peptidyl-Prolyl Isomerases

Although there are 17 cyclophilins in the human genome, the function of most cyclophilin isoforms is unknown. At least some ... Using biochemical, structural, and computational methods we characterize the human cyclophilin family in detail and suggest ... Author Summary Cyclophilins are proteins that catalyze the isomerization of prolines, interconverting this structurally ...
more infohttp://journals.plos.org/plosbiology/article/authors?id=10.1371/journal.pbio.1000439&imageURI=info:doi/10.1371/journal.pbio.1000439.g006

Characterization of the redox state of human cyclophilin-D and its interactions with peroxiredoxin 5

 | DIAL.pr - BOREALCharacterization of the redox state of human cyclophilin-D and its interactions with peroxiredoxin 5 | DIAL.pr - BOREAL

Characterization of the redox state of human cyclophilin-D and its interactions with peroxiredoxin 5. Prom. : Knoops, Bernard. ... eng] Cyclophilin-D (CyP-D) is a peptidyl prolyl cis/trans isomerase located in the mitochondrial matrix of mammalian cells. The ... Characterization of the redox state of human cyclophilin-D and its interactions with peroxiredoxin 5 Primary tabs. *Détail( ... Home» Characterization of the redox state of human cyclophilin-D and its interactions with peroxiredoxin 5 ...
more infohttps://dial.uclouvain.be/pr/boreal/object/boreal:20884

The intriguing Cyclophilin A-HIV-1 Vpr interaction: prolyl cis/trans isomerisation catalysis and specific binding | BMC...The intriguing Cyclophilin A-HIV-1 Vpr interaction: prolyl cis/trans isomerisation catalysis and specific binding | BMC...

Votteler J, Wray V, Schubert U: Role of cyclophilin A in HIV replication. Future Virol 2007, 2: 65-78. 10.2217/17460794.2.1.65 ... Ardon O, Zimmermann ES, Andersen JL, DeHart JL, Blackett J, Planelles V: Induction of G 2 Arrest and Binding to Cyclophilin A ... The intriguing Cyclophilin A-HIV-1 Vpr interaction: prolyl cis/trans isomerisation catalysis and specific binding. ... Franke EK, Yuan HEH, Luban J: Specific incorporation of cyclophilin A into HIV-1 virions. Nature 1994, 372: 359-362. 10.1038/ ...
more infohttps://bmcstructbiol.biomedcentral.com/articles/10.1186/1472-6807-10-31

The Mitochondrial Death Pathway and Cardiac Myocyte Apoptosis | Circulation ResearchThe Mitochondrial Death Pathway and Cardiac Myocyte Apoptosis | Circulation Research

It has been shown, however, that AIF interacts with cyclophilin A to degrade DNA, and the peptidyl prolyl cis-trans isomerase ... D denotes cyclophilin D. B, Bax-VDAC model. In healthy cells (left), VDAC functions as a component of the nucleotide exchange ... AIF and cyclophilin A cooperate in apoptosis-associated chromatinolysis. Oncogene. 2004; 23: 1514-1521. ... located in the inner mitochondrial membrane and cyclophilin D, a peptidyl prolyl cis-trans isomerase that interacts with ANT. ...
more infohttp://circres.ahajournals.org/content/95/10/957.full

Peptidyl-prolyl isomerases | CypralisPeptidyl-prolyl isomerases | Cypralis

The cyclophilin inhibitors on the market or in development are non-selective between the four common cyclophilin isoforms A, B ... several cyclophilin inhibitors are in clinical development for the treatment of viral infections as the host cell cyclophilin A ... Cyclophilin D has been recognized as an excellent molecular target for several years [1] but until recently, achieving sub-type ... A role for cyclophilin D in modulating MPTP in models of Alzheimers disease was indicated when the learning deficiency of ...
more infohttp://www.cypralis.com/technology/peptidyl-prolyl-isomerases-ppiases

PPIase CYP37 | peptidyl-prolyl cis-trans isomerase CYP37, chlorPPIase CYP37 | peptidyl-prolyl cis-trans isomerase CYP37, chlor

Cyclophilin (CYP37) represents the homologous component of the AtCYP38. The first complex immunophilin protein identified from ... AS10 1607 , Anti-CYP38 , cyclophilin 38, peptidyl-prolyl cis-trans isomerase, smaller pack size. AS10 1618 , Anti-CYP38 , ... Synthetic peptide (amino acids 277 - 290) specific for chloroplast cyclophilin from Arabidopsis thaliana (At3g15520) (P82869). ...
more infohttp://www.agrisera.com/en/artiklar/plantalgal-cell-biology/photosynthesis-/proteases/ppiase-cyp37-peptidyl-prolyl-cis-trans-isomerase-cyp37-chloroplastic-.html

Cyclophilin - WikipediaCyclophilin - Wikipedia

Other cyclophilins have similar structures to cyclophilin A. The cyclosporin-cyclophilin A complex inhibits a calcium/ ... Cyclophilin A is a cytosolic and highly abundant protein. The protein belongs to a family of isozymes, including cyclophilins B ... J&J targets degenerative diseases in cyclophilin inhibitor partnership. Dan Stanton. 08-Dec-2015 Cyclophilins at the US ... Cyclophilin D, which is located in the matrix of mitochondria, is only a modulatory, but may or may not be a structural ...
more infohttps://en.wikipedia.org/wiki/Cyclophilin

Cyclophilin | SpringerLinkCyclophilin | SpringerLink

Rotamase The first cyclophilin (Cyp/PPIases: EC 5.2.1.8) was isolated more than three decades ago as an... ... Cyclophilin-like domain (CLD); Immunophilin; Peptidyl prolyl cis trans isomerase; PPIase; ... The single domain cyclophilin has a single cyclophilin-like domain (CLD), whereas multidomain cyclophilins also possess ... Cyclophilin D interacts with Bcl2 and exerts an anti-apoptotic effect. J Biol Chem. 2009;284:9692-9.CrossRefPubMedPubMedCentral ...
more infohttps://link.springer.com/referenceworkentry/10.1007/978-1-4614-6438-9_101549-1

4J5B: Human Cyclophilin D Complexed With An Inhibitor4J5B: Human Cyclophilin D Complexed With An Inhibitor

PEPTIDYL-PROLYL CIS-TRANS ISOMERASE F, MITOCHONDRIAL1-(4-Aminobenzyl)-3-(2-{(2r)-2-[2-(Methylsulfanyl)phenyl]pyrrolidin-1-Yl}-2-Oxoethyl)urea
more infohttps://www.ncbi.nlm.nih.gov/Structure/pdb/4J5B

Cyclophilin | ProSpecCyclophilin | ProSpec

Cyclophilin-A Human Recombinant, Cyclophilin-B Human Recombinant, Cyclophilin-D Human Recombinant ... Humans are thought to have around 16 of these cyclophilins.. Cyclophilin Function. The Cyclosporin Cyclophilin A complex ... About Cyclophilin:. Cyclophilins are known for their ability to bind ciclosporin, which is used to suppress rejection after a ... Cyclophilin Structure. Cyclophilin A has a beta barrel structure (two alpha helices and a beta sheet). There is usually a ...
more infohttps://www.prospecbio.com/cyclophilin

Anti-Cyclophilin A antibody (ab41684) | AbcamAnti-Cyclophilin A antibody (ab41684) | Abcam

Rabbit polyclonal Cyclophilin A antibody validated for WB, IHC, ICC/IF and tested in Human, Mouse and Rat. Referenced in 21 ... Belongs to the cyclophilin-type PPIase family. PPIase A subfamily.. Contains 1 PPIase cyclophilin-type domain. ... All lanes : Anti-Cyclophilin A antibody (ab41684) at 1 µg/ml. Lane 1 : HeLa (Human epithelial carcinoma cell line) Whole Cell ... Synthetic peptide conjugated to KLH derived from within residues 100 to the C-terminus of Human Cyclophilin A. Read Abcams ...
more infohttp://www.abcam.com/cyclophilin-a-antibody-ab41684.html?productWallTab=Questions

Anti-Cyclophilin 40 antibody (ab3562) | AbcamAnti-Cyclophilin 40 antibody (ab3562) | Abcam

Rabbit polyclonal Cyclophilin 40 antibody validated for WB, IP, IHC, ICC, Flow Cyt, ICC/IF and tested in Human, Mouse, Rat and ... Belongs to the cyclophilin-type PPIase family. PPIase D subfamily.. Contains 1 PPIase cyclophilin-type domain.. Contains 3 TPR ... Detects cyclophilin 40 (CyP 40) from Human and Rat tissues and cells. This antibody does not cross-react with CyPA. ... Tissues were then probed at a dilution of 1/100 with a rabbit polyclonal antibody recognizing Cyclophilin D (ab3562) or without ...
more infohttp://www.abcam.com/cyclophilin-40-antibody-ab3562.html

Cyclophilin C Antibodies: Novus BiologicalsCyclophilin C Antibodies: Novus Biologicals

Browse our Cyclophilin C Antibody catalog backed by our Guarantee+. ... Our Cyclophilin C Antibodies can be used in a variety of model species: Human. Use the list below to choose the Cyclophilin C ... Alternate Names for Cyclophilin C Antibodies. anti-Cyclophilin C antibody, anti-PPIC antibody, anti-CYPCMGC3673 antibody, anti- ... Cyclophilin C Antibodies. We offer Cyclophilin C Antibodies for use in common research applications: ELISA, ...
more infohttps://www.novusbio.com/primary-antibodies/cyclophilin-c?related_diseases=Venous%20Thrombosis&facet_conjugate=DyLight%20680

Recombinant human Cyclophilin F protein (ab79186) ProtocolsRecombinant human Cyclophilin F protein (ab79186) Protocols

There are no specific protocols for Recombinant human Cyclophilin F protein (ab79186). Please download our general protocols ...
more infohttps://www.abcam.com/recombinant-human-cyclophilin-f-protein-ab79186-protocols.html

cyclophilin a Protocols and Video...'cyclophilin a' Protocols and Video...

... cyclophilin a include A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype ... Cyclophilin A: A 17-KDa cytoplasmic Peptidylprolyl isomerase involved in immunoregulation. It is a member of the cyclophilin ...
more infohttps://www.jove.com/keyword/cyclophilin+a

Accell Cyclophilin B Control siRNAAccell Cyclophilin B Control siRNA

Validated positive control siRNA targeting the Cyclophilin B (PPIB) housekeeping gene in human, mouse, or rat Accell siRNA ... Accell Cyclophilin B Control siRNA Accell Cyclophilin B Control siRNA. Validated Accell positive controls provide a reliable ... Accell Cyclophilin B Control siRNA is modified with patent-pending Accell modification pattern to enable uptake by difficult-to ... Accell Cyclophilin B Control siRNA is validated, highly reliable positive control for delivery and RNAi efficiency. ...
more infohttps://horizondiscovery.com/en/products/gene-modulation/knockdown-reagents/controls/PIFs/Accell-Cyclophilin-B-Control-siRNA

Accell Green Cyclophilin B Control siRNAAccell Green Cyclophilin B Control siRNA

... is a fluorescent control reagent that provides highly reliable qualitative assessment ... SH-SY5Y cells were treated with 1 µM Accell Red Cyclophilin B Control siRNA in Accell delivery media. (Red fluorescence = ... In addition, it acts as a positive control targeting Cyclophilin B. Also known as peptidylprolyl isomerase B (PPIB), ... Accell Green Cyclophilin B Control siRNA. siRNA for difficult-to-transfect cells ...
more infohttps://horizondiscovery.com/products/gene-modulation/knockdown-reagents/controls/PIFs/Accell-Green-Cyclophilin-B-Control-siRNA

anti-Cyclophilin 40 antibody  | GeneTexanti-Cyclophilin 40 antibody | GeneTex

Anti-Cyclophilin 40 pAb (GTX25902) is tested in Human, Mouse, Rat, Amphibians samples. 100% Ab-Assurance. ... Cyclophilin 40 antibody (ribosomal protein S2 pseudogene 53) for GSA, WB. ... Proteins that bind FK506 are termed FK506 Binding Proteins (FKBPs) and those that bind cyclosporin A are called cyclophilins ( ... 601753, Cyclophilin40, MGC33096, CYP-40, PPID, CYPD, 5481, CYP40, Cyclophilin 40, Q08752, CYP 40. ...
more infohttp://www.genetex.com/Cyclophilin-D-antibody-GTX25902.html

Cyclophilin G Antibody | SCBT - Santa Cruz BiotechnologyCyclophilin G Antibody | SCBT - Santa Cruz Biotechnology

Buy cyclophilin g antibodies from Santa Cruz Biotechnology, Inc. Monoclonal antibodies are available to most protein immunogens ... Additional Cyclophilin Antibodies including Cyclophilin E, Cyclophilin F, CyPA, CyPB and Cyclophilin 40 ... Cyclophilin G Antibodies. Santa Cruz Biotechnology, Inc. offers a broad range of Cyclophilin G antibodies. Select Cyclophilin G ... View detailed Cyclophilin G antibody specifications by linking to the specific product blocks. Select appropriate Cyclophilin G ...
more infohttps://www.scbt.com/browse/cyclophilin-g-Anticuerpos/_/N-uvwhdx

Viruses  | Free Full-Text | Cyclophilin Inhibitors as a Novel HCV Therapy | NotesViruses | Free Full-Text | Cyclophilin Inhibitors as a Novel HCV Therapy | Notes

... mostly Cyclophilin A (CyPA), in the replication of HCV is supported by a growing body of in vitro and in vivo evidence. CyPA ...
more infohttp://www.mdpi.com/1999-4915/2/8/1621/notes

Peptidylprolyl Isomerase B (Cyclophilin B) (PPIB) AntikörperPeptidylprolyl Isomerase B (Cyclophilin B) (PPIB) Antikörper

These findings establish cyclophilin C as an ER cyclophilin, demonstrate the novel involvement of cyclophilins B and C in ER ... cyclophilin B , peptidylprolyl isomerase B , peptidylprolyl isomerase B (cyclophilin B) , PPIase B , peptidyl-prolyl cis-trans ... anti-Peptidylprolyl Isomerase A (Cyclophilin A)-Like 4G Antikörper * anti-Peptidylprolyl Isomerase A (Cyclophilin A)-Like 4A ... Zusätzlich bieten wir Ihnen Peptidylprolyl Isomerase B (Cyclophilin B) Kits (62) und Peptidylprolyl Isomerase B (Cyclophilin B ...
more infohttps://www.antikoerper-online.de/abstract/Peptidylprolyl+Isomerase+B+

Cyclophilin E antibody | acris-antibodies.comCyclophilin E antibody | acris-antibodies.com

Cyclophilin E (transcript variant 1). Not available. Recombinant protein of human peptidylprolyl isomerase E (cyclophilin E) ( ... Cyclophilin E (transcript variant 1). Not available. Recombinant protein of human peptidylprolyl isomerase E (cyclophilin E) ( ... Alternative names for Cyclophilin E antibody. PPIase E, Rotamase E, PPIE, CYP33, Cyclophilin-33, Peptidyl-prolyl cis-trans ... Cyclophilin E (transcript variant 4). Not available. Purified recombinant protein of Homo sapiens peptidylprolyl isomerase E ( ...
more infohttps://www.acris-antibodies.com/target/cyclophilin-e-antibody.htm

anti-Cyclophilin B antibody [2B10]  | GeneTexanti-Cyclophilin B antibody [2B10] | GeneTex

Anti-Cyclophilin B mAb (GTX34135) is tested in Human, Mouse, Rat samples. 100% Ab-Assurance. ... Cyclophilin B antibody [2B10] (peptidylprolyl isomerase B) for WB. ... Cyclophilin B Mouse Monoclonal Antibody (2B10) detects endogenous levels of Cyclophilin B. ... Storage Conditions: Cyclophilin B antibody [2B10]. Storage Buffer. Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% ...
more infohttp://www.genetex.com/Cyclophilin-B-antibody-2B10-GTX34135.html
  • Cyclophilin A (CYPA) is the first member of the cyclophilins to be identified in mammals. (biovendor.com)
  • Cyclophilin A (CypA) is the main member of the immunophilin superfamily that has peptidyl-prolyl cis-trans isomerase activity. (mdpi.com)
  • More recently, host-derived cyclophilin A (CyPA) has been shown to be incorporated into HIV-1 virions and its incorporation essential for viral infectivity. (pnas.org)
  • The finding that cyclophilin A (CyPA), a cellular protein that binds cyclosporin A (CsA) and possesses peptidyl-prolyl cis-trans isomerase activity ( 1 , 2 ), is specifically incorporated into HIV-1 virions through interactions with the Gag polyprotein ( 3 , 4 ) and is required for effective infection ( 5 - 8 ) raised a number of interesting questions about the biology of this phenomenon. (pnas.org)
  • Because cyclophilins can control protein folding by catalyzing peptidyl-prolyl isomerization ( 9 , 10 ), it has been proposed that CyPA may modify the conformation of capsid antigen (CA), a Gag polyprotein cleavage product that binds CyPA ( 11 ), thus promoting uncoating of the virion and formation of the pre-integration complex (PIC) ( 6 ). (pnas.org)
  • Other cyclophilins have similar structures to cyclophilin A. The cyclosporin-cyclophilin A complex inhibits a calcium/calmodulin-dependent phosphatase, calcineurin, the inhibition of which is thought to suppress organ rejection by halting the production of the pro-inflammatory molecules TNF alpha and interleukin 2. (wikipedia.org)
  • Cyclophilin D is thought to regulate the opening of the pore because cyclosporin A, which binds to CyP-D, inhibits the pore opening. (wikipedia.org)
  • Accell Cyclophilin B Control siRNA is validated, highly reliable positive control for delivery and RNAi efficiency. (horizondiscovery.com)
  • Accell Cyclophilin B Control siRNA is modified with patent-pending Accell modification pattern to enable uptake by difficult-to-transfect cells. (horizondiscovery.com)
  • Accell Green Cyclophilin B Control siRNA is a fluorescent control reagent that provides highly reliable qualitative assessment of Accell siRNA uptake as determined by fluorescent microscopy to evaluate cytoplamic localization of the dye-labeled Accell siRNA or FACS analysis to determine general uptake. (horizondiscovery.com)
  • Cyclophilins are involved in a myriad of physiological cellular processes, such as protein trafficking and maturation, receptor complex stabilization, apoptosis, receptor. (springer.com)
  • Cyclophilin-40 has a cellular role in the aryl hydrocarbon receptor signaling. (springer.com)
  • Cyclophilins are found in all cells of all organisms studied, in both prokaryotes and eukaryotes. (biovendor.com)
  • It is also associated with viral infections.In eukaryotes, cyclophilins localize ubiquitously to many cell and tissue types. (wikipedia.org)
  • The first cyclophilin (Cyp/PPIases: EC 5.2.1.8) was isolated more than three decades ago as an intracellular receptor of the immunosuppressive drug cyclosporine A (CsA) from the bovine thymocyctes (Handschumacher et al. (springer.com)
  • Cyclophilins also have varying degrees of affinity for the immunosuppressive drug Cyclosporine A (CsA), a cyclic 11-amino-acid peptide produced by fungus Tolypocladium infantum. (biovendor.com)
  • The protein belongs to a family of isozymes, including cyclophilins B and C, and natural killer cell cyclophilin-related protein. (wikipedia.org)
  • Cyclophilin A is also known to be recruited by the Gag polyprotein during HIV-1 virus infection, and its incorporation into new virus particles is essential for HIV-1 infectivity. (wikipedia.org)
  • Chapman DC, Stocki P, DB W. Cyclophilin C participates in the US2-mediated degradation of major histocompatibility complex class I molecules. (springer.com)
  • The Cyclophilin A-CD147 complex promotes the proliferation and homing of multiple myeloma cells. (nih.gov)
  • Allain F, Vanpouille C, Carpentier M, Slomianny MC, Durieux S, Spik G. Interaction with glycosaminoglycans is required for cyclophilin B to trigger integrin-mediated adhesion of peripheral blood T lymphocytes to extracellular matrix. (springer.com)
  • These results suggest that CyP-40 cyclophilins play a general role in Hsp90-dependent signal transduction pathways under normal growth conditions. (sciencemag.org)
  • Thus, cyclophilins may function in cardioprotection during ischemia-reperfusion injury. (wikipedia.org)
  • Cpr6 and Cpr7, the Saccharomyces cerevisiae homologs of cyclophilin-40 (CyP-40), were shown to form complexes with Hsp90, a protein chaperone that functions in several signal transduction pathways. (sciencemag.org)