A gram-negative, facultatively chemoautotrophic bacterium, formerly called Wautersia eutropha, found in water and soil.
A genus of gram-negative, aerobic, rod-shaped bacteria, in the family BURKHOLDERIACEAE, that are mobile by means of peritrichous FLAGELLA. The genus was formerly called Wautersia and species in this genus were formerly in the genus RALSTONIA.
A common parasite of humans in the moist tropics and subtropics. These organisms attach to villi in the small intestine and suck blood causing diarrhea, anorexia, and anemia.
Benzoic acid or benzoic acid esters substituted with one or more chlorine atoms.
Phenols substituted with one or more chlorine atoms in any position.
A colorless, syrupy, strongly acidic liquid that can form detergents with oleic acid.
An herbicide with irritant effects on the eye and the gastrointestinal system.
A genus of intestinal parasite worms which includes one of the most important hookworms of man, NECATOR AMERICANUS. The only other known species, N. suillus, has been recovered from pigs.
A family of gram negative, aerobic, non-sporeforming, rod-shaped bacteria.
Infection of humans or animals with hookworms of the genus NECATOR. The resulting anemia from this condition is less severe than that from ANCYLOSTOMIASIS.
A species of gram-negative rod-shaped bacteria found ubiquitously and formerly called Comamonas acidovorans and Pseudomonas acidovorans. It is the type species of the genus DELFTIA.
A plant genus of the family FABACEAE that contains kukulkanin, a CHALCONE.
Polymers of organic acids and alcohols, with ester linkages--usually polyethylene terephthalate; can be cured into hard plastic, films or tapes, or fibers which can be woven into fabrics, meshes or velours.
Elimination of ENVIRONMENTAL POLLUTANTS; PESTICIDES and other waste using living organisms, usually involving intervention of environmental or sanitation engineers.
Proteins found in any species of bacterium.
Infection of humans or animals with hookworms of the genus ANCYLOSTOMA. Characteristics include anemia, dyspepsia, eosinophilia, and abdominal swelling.
A genus of nematode intestinal parasites that consists of several species. A. duodenale is the common hookworm in humans. A. braziliense, A. ceylonicum, and A. caninum occur primarily in cats and dogs, but all have been known to occur in humans.
A plant genus in the family VITACEAE, order Rhamnales, subclass Rosidae. It is a woody vine cultivated worldwide. It is best known for grapes, the edible fruit and used to make WINE and raisins.
A phylum of fungi which have cross-walls or septa in the mycelium. The perfect state is characterized by the formation of a saclike cell (ascus) containing ascospores. Most pathogenic fungi with a known perfect state belong to this phylum.
A superfamily of nematode parasitic hookworms consisting of four genera: ANCYLOSTOMA; NECATOR; Bunostomum; and Uncinaria. ANCYLOSTOMA and NECATOR occur in humans and other mammals. Bunostomum is common in ruminants and Uncinaria in wolves, foxes, and dogs.
The ash, dust, gases, and lava released by volcanic explosion. The gases are volatile matter composed principally of about 90% water vapor, and carbon dioxide, sulfur dioxide, hydrogen, carbon monoxide, and nitrogen. The ash or dust is pyroclastic ejecta and lava is molten extrusive material consisting mainly of magnesium silicate. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Infection of humans or animals with hookworms other than those caused by the genus Ancylostoma or Necator, for which the specific terms ANCYLOSTOMIASIS and NECATORIASIS are available.
A genus of gram-negative, aerobic, rod-shaped bacteria. Organisms in this genus had originally been classified as members of the PSEUDOMONAS genus but overwhelming biochemical and chemical findings indicated the need to separate them from other Pseudomonas species, and hence, this new genus was created.
A strong dibasic acid with the molecular formula H2SeO4. Included under this heading is the acid form, and inorganic salts of dihydrogen selenium tetraoxide.

Analysis of 4-phosphopantetheinylation of polyhydroxybutyrate synthase from Ralstonia eutropha: generation of beta-alanine auxotrophic Tn5 mutants and cloning of the panD gene region. (1/200)

The postulated posttranslational modification of the polyhydroxybutyrate (PHA) synthase from Ralstonia eutropha by 4-phosphopantetheine was investigated. Four beta-alanine auxotrophic Tn5-induced mutants of R. eutropha HF39 were isolated, and two insertions were mapped in an open reading frame with strong similarity to the panD gene from Escherichia coli, encoding L-aspartate-1-decarboxylase (EC 4.1.1.15), whereas two other insertions were mapped in an open reading frame (ORF) with strong similarity to the NAD(P)+ transhydrogenase (EC 1.6.1.1) alpha 1 subunit, encoded by the pntAA gene from Escherichia coli. The panD gene was cloned by complementation of the panD mutant of R. eutropha Q20. DNA sequencing of the panD gene region (3,312 bp) revealed an ORF of 365 bp, encoding a protein with 63 and 67% amino acid sequence similarity to PanD from E. coli and Bacillus subtilis, respectively. Subcloning of only this ORF into vectors pBBR1MCS-3 and pBluescript KS- led to complementation of the panD mutants of R. eutropha and E. coli SJ16, respectively. panD-encoded L-aspartate-1-decarboxylase was further confirmed by an enzymatic assay. Upstream of panD, an ORF with strong similarity to pntAA from E. coli, encoding NAD(P)+ transhydrogenase subunit alpha 1 was found; downstream of panD, two ORFs with strong similarity to pntAB and pntB, encoding subunits alpha 2 and beta of the NAD(P)+ transhydrogenase, respectively, were identified. Thus, a hitherto undetermined organization of pan and pnt genes was found in R. eutropha. Labeling experiments using one of the R. eutropha panD mutants and [2-14C]beta-alanine provided no evidence that R. eutropha PHA synthase is covalently modified by posttranslational attachment of 4-phosphopantetheine, nor did the E. coli panD mutant exhibit detectable labeling of functional PHA synthase from R. eutropha.  (+info)

3-Hydroxylaminophenol mutase from Ralstonia eutropha JMP134 catalyzes a Bamberger rearrangement. (2/200)

3-Hydroxylaminophenol mutase from Ralstonia eutropha JMP134 is involved in the degradative pathway of 3-nitrophenol, in which it catalyzes the conversion of 3-hydroxylaminophenol to aminohydroquinone. To show that the reaction was really catalyzed by a single enzyme without the release of intermediates, the corresponding protein was purified to apparent homogeneity from an extract of cells grown on 3-nitrophenol as the nitrogen source and succinate as the carbon and energy source. 3-Hydroxylaminophenol mutase appears to be a relatively hydrophobic but soluble and colorless protein consisting of a single 62-kDa polypeptide. The pI was determined to be at pH 4.5. In a database search, the NH2-terminal amino acid sequence of the undigested protein and of two internal sequences of 3-hydroxylaminophenol mutase were found to be most similar to those of glutamine synthetases from different species. Hydroxylaminobenzene, 4-hydroxylaminotoluene, and 2-chloro-5-hydroxylaminophenol, but not 4-hydroxylaminobenzoate, can also serve as substrates for the enzyme. The enzyme requires no oxygen or added cofactors for its reaction, which suggests an enzymatic mechanism analogous to the acid-catalyzed Bamberger rearrangement.  (+info)

Metabolic engineering of poly(3-hydroxyalkanoates): from DNA to plastic. (3/200)

Poly(3-hydroxyalkanoates) (PHAs) are a class of microbially produced polyesters that have potential applications as conventional plastics, specifically thermoplastic elastomers. A wealth of biological diversity in PHA formation exists, with at least 100 different PHA constituents and at least five different dedicated PHA biosynthetic pathways. This diversity, in combination with classical microbial physiology and modern molecular biology, has now opened up this area for genetic and metabolic engineering to develop optimal PHA-producing organisms. Commercial processes for PHA production were initially developed by W. R. Grace in the 1960s and later developed by Imperial Chemical Industries, Ltd., in the United Kingdom in the 1970s and 1980s. Since the early 1990s, Metabolix Inc. and Monsanto have been the driving forces behind the commercial exploitation of PHA polymers in the United States. The gram-negative bacterium Ralstonia eutropha, formerly known as Alcaligenes eutrophus, has generally been used as the production organism of choice, and intracellular accumulation of PHA of over 90% of the cell dry weight have been reported. The advent of molecular biological techniques and a developing environmental awareness initiated a renewed scientific interest in PHAs, and the biosynthetic machinery for PHA metabolism has been studied in great detail over the last two decades. Because the structure and monomeric composition of PHAs determine the applications for each type of polymer, a variety of polymers have been synthesized by cofeeding of various substrates or by metabolic engineering of the production organism. Classical microbiology and modern molecular bacterial physiology have been brought together to decipher the intricacies of PHA metabolism both for production purposes and for the unraveling of the natural role of PHAs. This review provides an overview of the different PHA biosynthetic systems and their genetic background, followed by a detailed summation of how this natural diversity is being used to develop commercially attractive, recombinant processes for the large-scale production of PHAs.  (+info)

CDC group IV c-2: a new Ralstonia species close to Ralstonia eutropha. (4/200)

CDC group IV c-2, an environmental gram-negative bacillus recently proposed for inclusion in the genus Ralstonia, has been isolated in several human infections. Biochemical characterization and 16S ribosomal DNA (rDNA) sequencing with phylogenetic analysis were used to characterize eight clinical isolates and four type strains. Other typing tools, such as pulsed-field gel electrophoresis (PFGE) and randomly amplified polymorphic DNA (RAPD) analysis, were also used. PFGE typing of clinical isolates was unsuccessful because the DNA was degraded, and RAPD analysis was poorly discriminatory. In contrast, the type strains were clearly distinguished with both PFGE and RAPD analysis. All of the 16S rDNA sequences were identical. Comparison of the 16S rDNA sequences to the GenBank sequences showed that they were consistent with CDC group IV c-2 belonging to the genus Ralstonia. The closest matches were obtained with Ralstonia eutropha. However, four differences in 32 biochemical tests separated R. eutropha from CDC group IV c-2, which suggests that CDC group IV c-2 is a new species of the genus Ralstonia.  (+info)

Chemoselective nitro group reduction and reductive dechlorination initiate degradation of 2-chloro-5-nitrophenol by Ralstonia eutropha JMP134. (5/200)

Ralstonia eutropha JMP134 utilizes 2-chloro-5-nitrophenol as a sole source of nitrogen, carbon, and energy. The initial steps for degradation of 2-chloro-5-nitrophenol are analogous to those of 3-nitrophenol degradation in R. eutropha JMP134. 2-Chloro-5-nitrophenol is initially reduced to 2-chloro-5-hydroxylaminophenol, which is subject to an enzymatic Bamberger rearrangement yielding 2-amino-5-chlorohydroquinone. The chlorine of 2-amino-5-chlorohydroquinone is removed by a reductive mechanism, and aminohydroquinone is formed. 2-Chloro-5-nitrophenol and 3-nitrophenol induce the expression of 3-nitrophenol nitroreductase, of 3-hydroxylaminophenol mutase, and of the dechlorinating activity. 3-Nitrophenol nitroreductase catalyzes chemoselective reduction of aromatic nitro groups to hydroxylamino groups in the presence of NADPH. 3-Nitrophenol nitroreductase is active with a variety of mono-, di-, and trinitroaromatic compounds, demonstrating a relaxed substrate specificity of the enzyme. Nitrosobenzene serves as a substrate for the enzyme and is converted faster than nitrobenzene.  (+info)

Earthworm egg capsules as vectors for the environmental introduction of biodegradative bacteria. (6/200)

Earthworm egg capsules (cocoons) may acquire bacteria from the environment in which they are produced. We found that Ralstonia eutropha (pJP4) can be recovered from Eisenia fetida cocoons formed in soil inoculated with this bacterium. Plasmid pJP4 contains the genes necessary for 2,4-dichlorophenoxyacetic acid (2,4-D) and 2, 4-dichlorophenol (2,4-DCP) degradation. In this study we determined that the presence of R. eutropha (pJP4) within the developing earthworm cocoon can influence the degradation and toxicity of 2,4-D and 2,4-DCP, respectively. The addition of cocoons containing R. eutropha (pJP4) at either low or high densities (10(2) or 10(5) CFU per cocoon, respectively) initiated degradation of 2,4-D in nonsterile soil microcosms. Loss of 2,4-D was observed within the first week of incubation, and respiking the soil with 2,4-D showed depletion within 24 h. Microbial analysis of the soil revealed the presence of approximately 10(4) CFU R. eutropha (pJP4) g-1 of soil. The toxicity of 2,4-DCP to developing earthworms was tested by using cocoons with or without R. eutropha (pJP4). Results showed that cocoons containing R. eutropha (pJP4) were able to tolerate higher levels of 2,4-DCP. Our results indicate that the biodegradation of 2, 4-DCP by R. eutropha (pJP4) within the cocoons may be the mechanism contributing to toxicity reduction. These results suggest that the microbiota may influence the survival of developing earthworms exposed to toxic chemicals. In addition, cocoons can be used as inoculants for the introduction into the environment of beneficial bacteria, such as strains with biodegradative capabilities.  (+info)

A novel Sinorhizobium meliloti operon encodes an alpha-glucosidase and a periplasmic-binding-protein-dependent transport system for alpha-glucosides. (7/200)

The most abundant carbon source transported into legume root nodules is photosynthetically produced sucrose, yet the importance of its metabolism by rhizobia in planta is not yet known. To identify genes involved in sucrose uptake and hydrolysis, we screened a Sinorhizobium meliloti genomic library and discovered a segment of S. meliloti DNA which allows Ralstonia eutropha to grow on the alpha-glucosides sucrose, maltose, and trehalose. Tn5 mutagenesis localized the required genes to a 6.8-kb region containing five open reading frames which were named agl, for alpha-glucoside utilization. Four of these (aglE, aglF, aglG, and aglK) appear to encode a periplasmic-binding-protein-dependent sugar transport system, and one (aglA) appears to encode an alpha-glucosidase with homology to family 13 of glycosyl hydrolases. Cosmid-borne agl genes permit uptake of radiolabeled sucrose into R. eutropha cells. Analysis of the properties of agl mutants suggests that S. meliloti possesses at least one additional alpha-glucosidase as well as a lower-affinity transport system for alpha-glucosides. It is possible that the Fix+ phenotype of agl mutants on alfalfa is due to these additional functions. Loci found by DNA sequencing to be adjacent to aglEFGAK include a probable regulatory gene (aglR), zwf and edd, which encode the first two enzymes of the Entner-Doudoroff pathway, pgl, which shows homology to a gene encoding a putative phosphogluconolactonase, and a novel Rhizobium-specific repeat element.  (+info)

Mutational analysis of the cbb operon (CO2 assimilation) promoter of Ralstonia eutropha. (8/200)

PL promoters direct the transcription of the duplicated cbb operons from the facultative chemoautotroph Ralstonia eutropha H16. The operons encode most enzymes of the Calvin-Benson-Bassham carbon reduction cycle required for CO2 assimilation. Their transcription depends on the activator protein CbbR. Structure-function relationships in the cloned chromosomal promoter region were analyzed by site-directed mutagenesis. PL was altered in its presumed hexameric -35 and/or -10 box or in the spacer region between the boxes to achieve a greater or lesser resemblance to the structure of the sigma70 consensus promoter of Escherichia coli. PL::lacZ transcriptional fusions of various promoter variants were assayed in transconjugant strains of R. eutropha as well as in corresponding cbbR deletion mutants. Mutations increasing the similarity of the -35 and/or -10 box to the consensus sequence stimulated PL activity to various extents, whereas mutations deviating from the consensus decreased the activity. The length of the spacer region also proved to be critical. The conversion of the boxes, either individually or simultaneously, into the consensus sequences resulted in a highly active PL. All improved PL mutants, however, retained the activation under inducing or derepressing growth conditions, although the full-consensus promoter was nearly constitutive. They were also activated in the cbbR mutants. The activity of the overlapping, divergently oriented cbbR promoter was less affected by the mutations. The half- and full-consensus PL mutants were comparably active in E. coli. Two major conclusions were drawn from the results: (i) the location and function of PL were verified, and (ii) indirect evidence was obtained for the involvement of another regulator(s), besides CbbR, in the transcriptional control of the R. eutropha cbb operons.  (+info)

Ralstonia eutropha strain E2 (previously Alcaligenes sp.) is a phenol-degrading bacterium expressing phenol-oxygenating activity with a low Ks (the apparent half-saturation constant in Haldane's equation) and an extremely high KSI (the apparent inhibition constant). To identify the molecular basis for these novel cellular kinetic properties, a 9.5 kb DNA fragment that allowed Pseudomonas aeruginosa PAO1c (Phl- Cat+) to grow on phenol as the sole carbon source was cloned from strain E2 into plasmid pRO1614. PAO1c harbouring this plasmid (designated pROE217) transformed phenol to catechol, indicating that this fragment contains gene(s) for phenol hydroxylase. The cloned genes consist of eight complete ORFs, designated poxRABCDEFG. The products are homologous to those of dmpRKLMNOPQ of Pseudomonas sp. CF600, sharing 30--65% identity: this suggests that the phenol hydroxylase is a multicomponent enzyme. The kinetic constants for phenol-oxygenating activity of PA01c(pROE217) were determined, and these
Ralstonia eutropha H16 is a facultatively autotrophic hydrogen-oxidizing bacterium capable of producing polyhydroxybutyrate (PHB)-based bioplastics. As PHBs physical properties may be improved by incorporation of medium-chain-length fatty acids (MCFAs), and MCFAs are valuable on their own as fuel and chemical intermediates, we engineered R. eutropha for MCFA production. Expression of UcFatB2, a medium-chain-length-specific acyl-ACP thioesterase, resulted in production of 14 mg/L laurate in wild-type R. eutropha. Total fatty acid production (22 mg/L) could be increased up to 2.5-fold by knocking out PHB synthesis, a major sink for acetyl-CoA, or by knocking out the acyl-CoA ligase fadD3, an entry point for fatty acids into β-oxidation. As ΔfadD3 mutants still consumed laurate, and because the R. eutropha genome is predicted to encode over 50 acyl-CoA ligases, we employed RNA-Seq to identify acyl-CoA ligases upregulated during growth on laurate. Knockouts of the three most highly upregulated acyl-CoA
EIIANtr is a member of a truncated phosphotransferase (PTS) system that serves regulatory functions and exists in many Proteobacteria in addition to the sugar transport PTS. In Escherichia coli, EIIANtr regulates K+ homeostasis through interaction with the K+ transporter TrkA and sensor kinase KdpD. In the β-Proteobacterium Ralstonia eutropha H16, EIIANtr influences formation of the industrially important bioplastic poly(3-hydroxybutyrate) (PHB). PHB accumulation is controlled by the stringent response and induced under conditions of nitrogen deprivation. Knockout of EIIANtr increases the PHB content. In contrast, absence of enzyme I or HPr, which deliver phosphoryl groups to EIIANtr, has the opposite effect. To clarify the role of EIIANtr in PHB formation, we screened for interacting proteins that co-purify with Strep-tagged EIIANtr from R. eutropha cells. This approach identified the bifunctional ppGpp synthase/hydrolase SpoT1, a key enzyme of the stringent response. Two-hybrid and far-Western
An intracellular D(-)-3-hydroxybutyrate (3HB)-oligomer hydrolase gene from Ralstonia eutropha (formerly Alcaligenes eutrophus) H16 was cloned, sequenced, and characterized. As a hybridization probe to screen restriction digests of chromosomal DNA, an extracellular 3HB-oligomer hydrolase gene from Ra …
TY - JOUR. T1 - Microbial production of ethanol from acetate by engineered Ralstonia eutropha. AU - Lee, Hye Mi. AU - Jeon, Bo Young. AU - Oh, Min-Kyu. PY - 2016/6/1. Y1 - 2016/6/1. N2 - This study was performed to produce ethanol from acetate using a genetically engineered Ralstonia eutropha. In order to genetically modify R. eutropha H16, phaCAB operon encoding metabolic pathway genes from acetyl-CoA to polyhydroxybutyrate (PHB) was deleted and adhE encoding an alcohol dehydrogenase from Escherichia coli was overexpressed for conversion of acetyl-CoA to ethanol. The resulting strain produced ethanol up to 170 mg/L when cultivated in minimal media supplemented with 5 g/L of acetate as a sole carbon source. Growth and ethanol production were optimized by adjusting nitrogen source (NH4Cl) content and repetitive feeding of acetate into the bacterial culture, by which the ethanol production was reached to approximately 350 mg/L for 84 h.. AB - This study was performed to produce ethanol from ...
Thank you for sharing this Journal of Bacteriology article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
Sulfur is an essential element for life and the metabolism of organic sulfur compounds plays an important role in the global sulfur cycle. Sulfur occurs in various oxidation states ranging from +6 in sulfate to -2 in sulfide (H2S). Sulfate reduction can occur in both an energy consuming assimilatory pathway and an energy producing dissimilatory pathway. The assimilatory pathway, which is found in a wide range of organisms, produces reduced sulfur compounds for the biosynthesis of S-containing amino acids and does not lead to direct excretion of sulfide. In the dissimilatory pathway, which is restricted to obligatory anaerobic bacterial and archaeal lineages, sulfate (or sulfur) is the terminal electron acceptor of the respiratory chain producing large quantities of inorganic sulfide. Both pathways start from the activation of sulfate by reaction with ATP to form adenylyl sulfate (APS). In the assimilatory pathway [MD:M00176] APS is converted to 3-phosphoadenylyl sulfate (PAPS) and then reduced ...
Glycolysis is the process of converting glucose into pyruvate and generating small amounts of ATP (energy) and NADH (reducing power). It is a central pathway that produces important precursor metabolites: six-carbon compounds of glucose-6P and fructose-6P and three-carbon compounds of glycerone-P, glyceraldehyde-3P, glycerate-3P, phosphoenolpyruvate, and pyruvate [MD:M00001]. Acetyl-CoA, another important precursor metabolite, is produced by oxidative decarboxylation of pyruvate [MD:M00307]. When the enzyme genes of this pathway are examined in completely sequenced genomes, the reaction steps of three-carbon compounds from glycerone-P to pyruvate form a conserved core module [MD:M00002], which is found in almost all organisms and which sometimes contains operon structures in bacterial genomes. Gluconeogenesis is a synthesis pathway of glucose from noncarbohydrate precursors. It is essentially a reversal of glycolysis with minor variations of alternative paths [MD:M00003 ...
General Information: This strain (ATCC 17699; H16), formerly Alcaligenes eutrophus was originally isolated from sludge. Cupriavidus necator also known as Ralstonia eutropha is a soil bacterium with diverse metabolic abilities. Strains of this organism are resistant to high levels of copper or are able to degrade chloroaromatic compounds such as halobenzoates and nitrophenols making them useful for bioremediation. Other strains have been studied for their ability to produce polyhydroxybutyrates which have industrial application. Another strain is able to attack other bacteria and fungi when nutrients in the soil are low. ...
General Information: This strain (ATCC 17699; H16), formerly Alcaligenes eutrophus was originally isolated from sludge. Cupriavidus necator also known as Ralstonia eutropha is a soil bacterium with diverse metabolic abilities. Strains of this organism are resistant to high levels of copper or are able to degrade chloroaromatic compounds such as halobenzoates and nitrophenols making them useful for bioremediation. Other strains have been studied for their ability to produce polyhydroxybutyrates which have industrial application. Another strain is able to attack other bacteria and fungi when nutrients in the soil are low. ...
The chemoautotrophic bacterium Ralstonia eutropha can utilize H2/CO2 for growth under aerobic conditions. While this microbial host has great potential to be engineered to produce desired compounds (beyond polyhydroxybutyrate) directly from CO2, little work has been done to develop genetic part libraries to enable such endeavors. We report the development of a toolbox for the metabolic engineering of Ralstonia eutropha H16. We have constructed a set of broad-host-range plasmids bearing a variety of origins of replication, promoters, 5 mRNA stem-loop structures, and ribosomal binding sites. Specifically, we analyzed the origins of replication pCM62 (IncP), pBBR1, pKT (IncQ), and their variants. We tested the promoters PBAD, T7, Pxyls/PM, PlacUV5, and variants thereof for inducible expression. We also evaluated a T7 mRNA stem-loop structure sequence and compared a set of ribosomal binding site (RBS) sequences derived from Escherichia coli, R. eutropha, and a computational RBS design tool. Finally, we
Acetic acid, a potential growth inhibitor, commonly occurs in lignocellulosic hydrolysates. The growth of Cupriavidus necator DSM 545 and production of poly(3-hydroxybutyrate) (PHB) by this bacterium in a glucose-based medium supplemented with various initial concentrations of acetic acid are reported. The bacterium could use both glucose and acetic acid to grow and produce PHB, but acetic acid inhibited growth once its initial concentration exceeded 0.5 g/L. As acetic acid is an unavoidable contaminant in hydrolysates used as sugar sources in commercial fermentations, a mathematical model was developed to describe its impact on growth and the production of PHB ...
Liquefied wood (LW) prepared in a microwave process was applied as a novel; inexpensive precursor feedstock for incorporation of (R)-3-hydroxyvalerate (3HV) into polyhydroxyalkanoate (PHA) biopolyesters in order to improve the biopolyesters material quality; Cupriavidus necator was applied as microbial production strain. For proof of concept, pre-experiments were carried out on a shake flask scale using different mixtures of glucose and LW as carbon source. The results indicate that LW definitely acts as a 3HV precursor, but, at the same time, displays toxic effects on C. necator at concentrations exceeding 10 g/L. Based on these findings, PHA biosynthesis under controlled conditions was performed using a fed-batch feeding regime on a bioreactor scale. As major outcome, a poly(3HB-co-0.8%-3HV) copolyester was obtained displaying a desired high molar mass of Mw = 5.39 × 105 g/mol at low molar-mass dispersity (ĐM of 1.53), a degree of crystallinity (Xc) of 62.1%, and melting temperature Tm (176.3 °C)
JMP Training is pleased to announce a new live web class. JMP Software: Analysis of Attribute Data has been updated for JMP version 7 and has been
This webcast is for JMP Clinical users. See examples of how to use JMP Clinical to examine adverse events, abnormal findings and drug efficacy indicators to help expedite the review, analysis and reporting of clinical trials.
Gentaur molecular products has all kinds of products like :search , QED \ PHAP III \ 11084 for more molecular products just contact us
购买我们的PHAP1肽。Ab6240为封闭肽并经过Blocking实验验证。 Abcam提供免费的实验方案,操作技巧及专业的支持。中国80%以上现货。
Product comparison of LeEco Le 2 vs Lenovo Phab on Pricebaba. A complete comparison with photos, price, specifications and shopping research.
The unlocked Lenovo Phab 2 Pro serves as more of a showcase for Google Tango than a case for augmented reality, but the future looks promising, and the phone is solid in its own right.
Compara i cellulari Motorola One Vision Plus, ZTE Axon 9 Pro, Meizu Pro 6 Plus, Motorola Moto Z, ZTE Axon Pro, Lenovo Phab2 Pro, vivo Y70 e scopri tutte le differenze.
The Tango-enabled Lenovo Phab 2 Pro, diminutive ZTE Axon 7 Mini and OG Moto Z are quite old, but theyre still compelling at these new all-time low prices.
Compara i cellulari ZTE Axon 9 Pro, Meizu Pro 6 Plus, Motorola Moto Z, ZTE Axon Pro, Lenovo Phab2 Pro, vivo Y51s e scopri tutte le differenze.
This online statistics course is comprised of seven modules, totaling about 30 hours of self-paced learning, and includes videos, demonstrations and exercises.
TY - JOUR. T1 - NiFe hydrogenase active site biosynthesis. T2 - Identification of Hyp protein complexes in Ralstonia eutropha. AU - Jones, Anne K.. AU - Lenz, Oliver. AU - Strack, Angelika. AU - Buhrke, Thorsten. AU - Friedrich, Bärbel. PY - 2004/10/26. Y1 - 2004/10/26. N2 - Biosynthesis of the NiFe hydrogenase active site is a complex process involving the action of the Hyp proteins: HypA-HypF. Here we investigate the mechanism of NiFe site biosynthesis in Ralstonia eutropha by examining the interactions between HypC, HypD, HypE, and HypF1. Using an affinity purification procedure based on the Strep-tag, II, we purified HypC and HypE from different genetic backgrounds as complexes with other hydrogenase-related proteins and characterized them using immunological analysis. Copurification of HypC and HoxH, the active site-containing subunit of the soluble hydrogenase in R. eutropha, from several different genetic backgrounds suggests that this complex forms early in the maturation process. With ...
Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRNA(Ala). Also edits incorrectly charged Ser-tRNA(Ala) and Gly-tRNA(Ala) via its editing domain.
Herein, autotrophic metabolism of Cupriavidus necator H16 growing on CO2, H2 and O2 gas mixture was analyzed by metabolic pathway analysis tools, specifically elementary mode analysis (EMA) and flux balance analysis (FBA). As case studies, recombinant strains of C. necator H16 for the production of short-chain (isobutanol) and long-chain (hexadecanol) alcohols were constructed and examined by a combined tools of EMA and FBA to comprehensively identify the cells metabolic flux profiles and its phenotypic spaces for the autotrophic production of recombinant products. The effect of genetic perturbations via gene deletion and overexpression on phenotypic space of the organism was simulated to improve strain performance for efficient bioconversion of CO2 to products at high yield and high productivity. EMA identified multiple gene deletion together with controlling gas input composition to limit phenotypic space and push metabolic fluxes towards high product yield, while FBA identified target gene
A common active site of polyhydroxyalkanoate synthase from Bacillus cereus YB-4 is involved in polymerization and alcoholysis reactionsA common active site of polyhydroxyalkanoate synthase from Bacillus cereus YB-4 is involved in polymerization and alcoholysis reactions ...
In 1995, bacteria was confronted with five cases of nosocomial bacteremia, we found that pulsed-field gel electrophoresis could not distinguish between the isolates and that randomly amplified polymorphic DNA analysis was poorly discriminatory. In this study, we used PCR-ribotyping and PCR-restriction fragment length polymorphism analysis of the spacer 16S-23S ribosomal DNA (rDNA); both methods were unable to differentiate R. paucula isolates. Eighteen strains belonging to other Ralstonia species (one R. eutropha strain, six R. pickettii strains, three R. solanacearum strains, and eight R. gilardii strains) were also tested by PCR-ribotyping, which failed to distinguish between the four species. The 16S-23S rDNA intergenic spacer of R. paucula contains the tRNAIle and tRNAAla genes, which are identical to genes described for R. pickettii and R. solanacearum. [1 ...
Called Ralstonia eutropha H16, the bacterium uses electricity to fixate carbon dioxide into alcohols (which are merely carbon, oxygen, and hydrogen arranged in a different order). In theory the hydrogen atoms could be produced by solar panels, but for safety reasons the team instead created formic acid using electricity. The bacteria feasts on the formic acid to produce the combustible alcohol. ...
A team at University of California Los Angeles (UCLA) have genetically engineered a microorganism that converts carbon dioxide into isobutanol and 3-methyl-1-butanol, both of which could be used as a fuel source for cars, or other combustion engines. Called Ralstonia eutropha H16, the bacterium uses...
View more ,The class II PHA (polyhydroxyalkanoate) synthases [PHAMCL synthases (medium-chain-length PHA synthases)] are mainly found in pseudomonads and catalyse synthesis of PHAMCLs using CoA thioesters of medium-chain-length 3-hydroxyfatty acids (C6-C14) as a substrate. Only recently PHAMCL synthases from Pseudomonas oleovorans and Pseudomonas aeruginosa were purified and in vitro activity was achieved. A threading model of the P. aeruginosa PHAMCL synthase PhaC1 was developed based on the homology to the epoxide hydrolase (1ek1) from mouse which belongs to the α/β-hydrolase superfamily. The putative catalytic residues Cys-296, Asp-452, His-453 and His-480 were replaced by site-specific mutagenesis. In contrast to class I and III PHA synthases, the replacement of His-480, which aligns with the conserved base catalyst of the α/β-hydrolases, with Gln did not affect in vivo enzyme activity and only slightly in vitro enzyme activity. The second conserved histidine His-453 was then replaced by ...
2PIM: Crystal structure of Phenylacetic acid degradation-related protein (YP_298971.1) from Ralstonia eutropha JMP134 at 2.20 A resolution
The gene encoding a 4-hydroxybutyryl-Co A transferase has been isolated from bacteria and integrated into the genome of bacteria also expressing a polyhydroxyalkanoate synthase, to yield an improved p
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
An amazing example of R being used sucessfully in combination (and not is isolation) with other enterprise software is the add-ins functionality of JMP and its R integration. See the following JMP add-ins which use R http://support.sas.com/demosdownloads/downarea_t4.jsp?productID=110454&jmpflag=Y JMP Add-in: Multidimensional Scaling using R This add-in creates a new menu command under the Add-Ins Menu in…
A resource for JMP software users. Start or join a conversation to solve a problem or share tips and tricks with other JMP users. Read blog posts,
JMP statistical discovery software from SAS is the tool of choice for scientists, engineers and other data explorers in almost every industry and government sector. WebAssigns JMP Statistics Question Bank presents real life examples using the JMP interactive applet to display the data. Students then use the applet to answer a series of questions. This question bank covers most introductory statistics topics and features simulations, solutions and question feedback ...
Mono- and Stereopictres of 5.0 Angstrom coordination sphere of Iron atom in PDB 1yfy: Crystal Structure of 3-Hydroxyanthranilate-3,4-Dioxygenase From Ralstonia Metallidurans Complexed With 3-Hydroxyanthranilic Acid
In order to facilitate the large-scale preparation of active class II polyhydroxyalkanoate (PHA) synthase, we constructed a vector pT7-7 derivative that contains a modified phaC1 gene encoding a PHA synthase from Pseudomonas aeruginosa possessing six N-terminally fused histidine residues. Overexpression of this phaC1 gene under control of the strong Ø10 promoter was achieved in Escherichia coli BL21(DE3). The fusion protein was deposited as inactive inclusion bodies in recombinant E. coli, and contributed approx. 30% of total protein. The inclusion bodies were purified by selective solubilization, resulting in approx. 70-80% pure PHA synthase, then dissolved and denatured by 6M guanidine hydrochloride. The denatured PHA synthase was reversibly immobilized on a Ni2+-nitrilotriacetate-agarose matrix. The matrix-bound fusion protein was refolded by gradual removal of the chaotropic reagent. This procedure avoided the aggregation of folding intermediates which often decreases the efficiency of ...
A single-nucleotide substitution in phasin gene leads to enhanced accumulation of polyhydroxyalkanoate (PHA) in Escherichia coli harboring Aeromonas caviae PHA biosynthetic operonA single-nucleotide substitution in phasin gene leads to enhanced accumulation of polyhydroxyalkanoate (PHA) in Escherichia coli harboring Aeromonas caviae PHA biosynthetic operon ...
Recently MALDI-TOF mass spectrum analysis has been considered an easy and discriminatory tool for identification of bacterial species (Lista et al., 2011). The results of MALDI-TOF mass spectrum analysis of the eight suspected isolates matched with that of the 16S rDNA sequence analysis. The four isolates DRDEBPS1001, DRDEBPS1002, DRDEBPS1003 and DRDEBPS1004 were confirmed as B. pseudomallei on the basis of score values 2.601, 2.099, 2.362 and 2.047. The other four isolates had been biochemically suspected but not supported by both the PCRs were also identified by MALDI-TOF spectrum analysis as Cupriavidus necator and Enterobacter cloacae with score value of 2.112, 2.122 and 2.341, 2.241 respectively, confirming the results of the 16S analysis.. The isolation of B. pseudomallei from soil is very complex as the presence of large numbers of closely related soil microflora interferes with its recovery although use of Ashdown broth and agar for the isolation of B. pseudomallei from soil samples ...
A newly isolated mutation (Gln508Leu) and a combination of it with previously discovered beneficial mutations in polyhydroxyalkanoate synthase 1 from Pseudomonas sp. 61-3 were found to enhance the production of poly(3-hydroxybutyrate) [P(3HB)] and poly(3HB-co-3-hydroxyalkanoate)s in recombinant Esch …
Previous studies (24, 31) that investigated the effect of PhaP on PHB accumulation in recombinant E. coli carrying pha from C. necator have shown an increase in polymer accumulation and a higher number of smaller PHA granules in strains carrying phaP. York et al. (31) reported a 100% increase in polymer production in 105-h flask cultures in LB containing 2% glucose. We analyzed the effect of phaP of Azotobacter sp. strain FA8 on PHB accumulation and bacterial growth in recombinant E. coli carrying the pha-synthesizing genes from this strain. As expected, the cells carrying PhaP accumulated more polymer. When the effect of PhaP on cell growth was first analyzed in flask cultures grown in minimal medium with lactose, no differences were observed, but when cells were grown in conditions in which higher cell densities were achieved, those carrying phaP grew more and accumulated more PHB. When cultures were grown in a bioreactor using glycerol, the differences observed were greater. The increase in ...
3-hydroxybutyric acid) (PHB) is the most commonly produced polyhydroxyalkanoate formed naturally inside many genera of bacteria and archaea when nutrients are limited and a carbon-source is available in excess. These water-insoluble biopolyester spherical beads in the size range of 20-800 nm can be recombinantly produced by insertion of the required PHB biosynthesis genes into alternative bacterial hosts and then culturing the organisms under suitable conditions. A gene fusion can also be made to enable production of PHB beads which display the selected proteins abundantly at the surface of the bead. Vaccines are needed which stimulate cell-mediated immunity and are effective at reducing intracellular infections such as tuberculosis, neosporosis and many viral infections. These diseases are responsible for a huge burden to human and animal health. Particulate vaccines target antigen presenting cells and cellular immune responses to protein antigens are enhanced when particulate vaccines are ...
Supplier of Metals, Alloys, Ceramics, Polymers, Compounds, Intermetallics & Composites for research & industrial markets. View our small quantity catalog.
putative poly(3-hydroxybutyrate) depolymerase [polyhydroxybutyrate depolymerase] ATGCAGCCGCCGCCGTTCCGGGGAATCCTCACCCCGCTGTTCCCCCTCTCCTCCTCGCCG CCGGTCGGGTCGTTGTCGCGTCCGGGACGGCGGGGGGTGCTCACCCGTCTCGTGGCCGTC GTGGCCCTCGTACTCGGAGCGGCCCTGCTCGGCCCGGCGCCGACGGCCCACGCCGCGGCG GGCCTGGCCAAGCCCGGTCTGACCAAGGCGGACCTGACCGAGGTCGCGGACTTCGGCACG AACCCGGGCCGGCTGAACATGTACGTCTACCGGCCCGCGTCCCTGCCCGCGGAGCCGGCG GTGGTGTTCGCCCTGCACGGTTGCACCCAGGACGCCCAGGGCTACGCCGACAACTCCGGC CTGCTCTCATTCGCGGACCGCTATGGCTTCCTGCTCGTGTTCGCCGAGACCACGTCGTCG AACAACGCGAACAGGTGCTTCAACTGGTTCCAGAGCAGCGACAACCGCAGGGGCCAGGGC GAAGCCGCGTCGATCCGGCAGATGGCCGCTCACACCGTCTCCGCCTACGGCGCGGACCCC CAGCGCACCTACATCACCGGGCTGTCCGCCGGCGGTGCCATGACGTCGGTGATGCTCGCC ACCTATCCGGACGTCTTCCAGGCCGGCGCGGTCGTCGCCGGCCTGCCCTTCGGCTGTGCC ACCGACGTCAGCAGCGCGTACCTGTGCATGAACCCCGGGACCGACCTGACCGCGGACCAG TGGGCGCGGCGGGTCCGTGACGGCTACCCCTCGTGGTCGGGCCCGTGGCCGCGCGTGGCC ATCTGGCACGGCGACAAGGACACCACCGTCGCGCCGCGCAACGCCGACGAGTTGCGCGAC CAGTGGACCGCTGTGCACGGCGTGTCCCAGACGCCGGACCGTACCTCGGTGATCGGCCCG ...
In previous situations the hydrocarbons were degraded only to form biomass and CO2. It is interesting to see how much product could be made from hydrocarbons. PHB is a polymer of polyhydroxybutyrate. The production pathway of PHB is well known. PHB is a solid product which is easy to recover in the down stream process. The pathway is displayed in figure 12. The lumped reaction was implemented in CNA as; 2 acetyl-CoA + NADPH -, (R)-3-hydroxybutanoyl-CoA the polymerization reaction just consumes (R)-3-hydroxybutanoyl-CoA, because a solid has no concentration in the liquid and therefore does not need to fulfill the steady-state condition. There are limiting factors to this reaction, but those are not considered in this analysis. ...
In previous situations the hydrocarbons were degraded only to form biomass and CO2. It is interesting to see how much product theoretically could be made from hydrocarbons. PHB is a polymer of polyhydroxybutyrate. The production pathway of PHB is well known. PHB is a solid product which is easy to recover in the down stream process. The pathway is displayed in figure 12. The lumped reaction was implemented in CNA as; 2 acetyl-CoA + NADPH -, (R)-3-hydroxybutanoyl-CoA the polymerization reaction just consumes (R)-3-hydroxybutanoyl-CoA, because a solid has no concentration in the liquid and therefore does not need to fulfill the steady-state condition. There are limiting factors to this reaction, but those are not considered in this analysis. ...
Note: JMP perpetual license is only available as a 32-bit version.. CPU:. 32-bit: x86 class processor; 64-bit*: x64 processor. RAM**:. 32-bit systems: 1 GB minimum, 2 GB or more recommended; 64-bit systems*: 4 GB or more recommended. Drive Space:. 1 GB (plus up to 250 MB for additional software below, if not already installed). Browser:. Internet Explorer 11.0 or greater, newer browsers highly recommended for viewing JMP Help and JMP Interactive HTML output. Recommended Display:. True (32-bit or more) color with resolution of 1024x768 or greater; video card with hardware accelerated 2D and 3D drivers recommended. Database:. UNICODE compliant ODBC 3.5 or higher (required only if connecting to database)***. Additional Required Software (included with JMP installer):. Microsoft .NET Framework 4.6. ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Figure 1: Characterization of mesenchymal stem cells and hOXR1 expression in hOXR1-MSCs. (A) Fibroblast-like spindle shape of MSCs are shown. (B) MSCs transduced with human OXR1 and GFP. (C) Human OXR1 mRNA expression level in MSCs by QPCR. (D) Human OXR1 protein expression in MSCs by western blot ...
Hyperthermophilic, sulfur-metabolizing organism. Cells are irregular spheres with a glycoprotein envelope and monopolar flagella. They grow between 60 and 95 degrees Celsius but their optimum is 83 degrees Celsius. They can be either organoheterotrophic using a variety of carbon and energy sources or they can also be lithoautotrophic using hydrogen, thiosulphate and carbon dioxide. (HAMAP: ARCFU ...
See microbial metabolism (hydrogen oxidation). These bacteria include Hydrogenobacter thermophilus, Cupriavidus necator, and ...
"Sulfoacetate is degraded via a novel pathway involving sulfoacetyl-CoA and sulfoacetaldehyde in Cupriavidus necator H16". The ...
These include 4-toluene sulfonate which may be transported by the TsaS of Cupriavidus necator (TC# 2.A.102.1.1), sulfolactate ... Weinitschke, S; Denger, K; Cook, AM; Smits, TH (September 2007). "The DUF81 protein TauE in Cupriavidus necator H16, a sulfite ... Weinitschke, S; Denger, K; Cook, AM; Smits, TH (September 2007). "The DUF81 protein TauE in Cupriavidus necator H16, a sulfite ... Cysteate-nitrogen assimilation by Cupriavidus necator H16 with excretion of 3-sulfolactate: a patchwork pathway". Archives of ...
Jugder BE, Welch J, Braidy N, Marquis CP (2016-07-26). "Construction and use of a Cupriavidus necator H16 soluble hydrogenase ...
PHB is produced by microorganisms (such as Cupriavidus necator, Methylobacterium rhodesianum or Bacillus megaterium) apparently ...
... system from Pseudomonas putida for orthogonal gene expression control in Escherichia coli and Cupriavidus necator". Scientific ...
"An analysis of the changes in soluble hydrogenase and global gene expression in Cupriavidus necator ( Ralstonia eutropha ) H16 ...
To produce PHA, a culture of a micro-organism such as Cupriavidus necator is placed in a suitable medium and fed appropriate ... including Cupriavidus necator and Alcaligenes latus (PHB). Poly (HA MCL) from hydroxy fatty acids with medium chain lengths ...
Hydrogen-oxidizing organisms, such as Cupriavidus necator (formerly Ralstonia eutropha), often inhabit oxic-anoxic interfaces ...
... including Cupriavidus necator and Alcaligenes latus (PHB). mcl-PHA from hydroxy fatty acids with medium chain lengths including ... Cuprividus necator). Specific types of PHAs include poly-3-hydroxybutyrate (PHB), polyhydroxyvalerate (PHV) and ...
"Production of poly-3-hydroxybutyrate by Cupriavidus necator fromcorn syrup: statisticalmodeling and optimization of biomass ...
It is also found in the NorA protein from Cupriavidus necator, this protein is a regulator of response to nitric oxide, which ...
... moved into the genus Cupriavidus after 16S rRNA gene sequencing revealed it to be most closely related to Cupriavidus necator. ... Cupriavidus gilardii is a Gram-negative, aerobic, motile, oxidase-positive bacterium from the genus Cupriavidus and the family ... "Cupriavidus necator gen. nov., sp. nov.: a nonobligate bacterial predator of bacteria in soil". Int J Syst Bacteriol. 37 (4): ... Cupriavidus gilardii may be resistant to multiple antibiotic agents; carbapenem-resistant C. gilardii has been found in stool ...
... is a Gram-negative soil bacterium of the class Betaproteobacteria. Cupriavidus necator has gone through a ... To better characterize the lifestyle of C. necator, the genomes of two strains have been sequenced. Cupriavidus necator can use ... necator. Because C. necator was named in 1987 far before the name change to R. eutropha and W. eutropha, the name C. necator ... Cupriavidus necator is a hydrogen-oxidizing bacterium ("knallgas" bacterium) capable of growing at the interface of anaerobic ...
Cupriavidus species, including C. metallidurans, are well characterised in the field of microbe-metal interactions, and are ... Both the species C. necator and C. metallidurans (when not distinguished as separate species) were originally classified in the ... Vandamme, Peter; Coenye, Tom (2004-11-01). "Taxonomy of the genus Cupriavidus: a tale of lost and found". International Journal ... metal transporting P1-type ATPases and a chemiosmotic antiporter efflux system similar to CzcCBA of Cupriavidus metallidurans. ...
... including Cupriavidus necator and Alcaligenes latus (PHB).. *mcl-PHA from hydroxy fatty acids with medium chain lengths ... Cuprividus necator). Specific types of PHAs include poly-3-hydroxybutyrate (PHB), polyhydroxyvalerate (PHV) and ...
PHB is produced by microorganisms (such as Cupriavidus necator, Methylobacterium rhodesianum or Bacillus megaterium) apparently ...
Cupriavidus necator is a Gram-negative soil bacterium of the class Betaproteobacteria. Cupriavidus necator has gone through a ... To better characterize the lifestyle of C. necator, the genomes of two strains have been sequenced. Cupriavidus necator can use ... necator. Because C. necator was named in 1987 far before the name change to R. eutropha and W. eutropha, the name C. necator ... Cupriavidus necator is a hydrogen-oxidizing bacterium ("knallgas" bacterium) capable of growing at the interface of anaerobic ...
Homologous recombination - Cupriavidus necator N-1 [ Pathway menu , Organism menu , Pathway entry , Download KGML , Show ...
The crystal structure of Cupriavidus necator nitrate reductase in oxidized and partially reduced states.. Coelho C1, González ... The periplasmic nitrate reductase (NapAB) from Cupriavidus necator is a heterodimeric protein that belongs to the dimethyl ... necator might work at unexpectedly high redox potentials when compared to all periplasmic nitrate reductases studied to date. ...
Cupriavidus sp. SK-4. Cupriavidus sp. NH9. Cupriavidus sp. IDO. Cupriavidus necator (strain ATCC 43291 / DSM 13513 / N-1) ( ... Cupriavidus necator (strain ATCC 43291 / DSM 13513 / N-1) (Ralstonia eutropha). Cupriavidus sp. SK-4. Cupriavidus sp. NH9. ... Cupriavidus sp. SK-3. Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337) (Ralstonia eutropha). Cupriavidus ... Cupriavidus sp. SK-3. Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337) (Ralstonia eutropha). Cupriavidus ...
Ubiquinone and other terpenoid-quinone biosynthesis - Cupriavidus necator N-1 [ Pathway menu , Organism menu , Pathway entry , ...
Cupriavidus sp. IDO. Cupriavidus basilensis. Cupriavidus sp. amp6. Cupriavidus sp. SK-3. Cupriavidus necator (Alcaligenes ... Cupriavidus sp. NH9. Cupriavidus sp. amp6. Cupriavidus basilensis. Cupriavidus oxalaticus. Cupriavidus sp. SK-3. Cupriavidus sp ... Cupriavidus necator (strain ATCC 43291 / DSM 13513 / N-1) (Ralstonia eutropha). Ralstonia pickettii DTP0602. Cupriavidus sp. SK ... Cupriavidus necator (strain ATCC 43291 / DSM 13513 / N-1) (Ralstonia eutropha). Ralstonia pickettii DTP0602. Cupriavidus ...
... necator during batch growth at both the population and single-cell levels. PHB accumulation began in the early stages of ... can be formed in large amounts in Cupriavidus necator and is important for the industrial production of biodegradable plastics ... Tao Z, Peng L, Zhang P, Li Y-Q, Wang G. Probing the Kinetic Anabolism of Poly-Beta-Hydroxybutyrate in Cupriavidus necator H16 ... Poly-beta-hydroxybutyrate (PHB) can be formed in large amounts in Cupriavidus necator and is important for the industrial ...
Cupriavidus necator H850, and Pseudomonas pseudoalcaligenes KF707 are bacterial strains able to mineralize biphenyl and to co- ... Cupriavidus necator H850, and Pseudomonas pseudoalcaligenes KF707 are bacterial strains able to mineralize biphenyl and to co- ... Strain Cupriavidus necator RW112 (DSM 13439) had been constructed earlier in a similar manner (Wittich and Wolff, 2007). ... Keywords: Cupriavidus necator RW112, Burkholderia xenovorans RW118, Pseudomonas pseudoalcaligenes RW120, genetic engineering, ...
... given its closer phylogenetic affiliation to the genus Cupriavidus than to the genus Ralstonia. Unfortunately, both recent ... Moriuchi et al reported a comprehensive reclassification of bacterial strains from the genera Cupriavidus and Ralstonia based ... Complete Genome Sequence of 3-Chlorobenzoate-Degrading Bacterium Cupriavidus necator NH9 and Reclassification of the Strains of ... the Genera Cupriavidus and Ralstonia Based on Phylogenetic and Whole-Genome Sequence Analyses ...
Cupriavidus necator JMP134 is a model for chloroaromatics biodegradation, capable of mineralizing 2,4-D, halobenzoates, ... Cupriavidus necator JMP134 is a model for chloroaromatics biodegradation, capable of mineralizing 2,4-D, halobenzoates, ... of aromatic compounds degradation from the genome of the amazing pollutant-degrading bacterium Cupriavidus necator JMP134 FEMS ... Almost all the main ring-cleavage pathways for aromatic compounds are found in C. necator: the beta-ketoadipate pathway, with ...
... produced by Cupriavidus necator H16. In the present study, molecular characterisation of the SH operon, responsible for ... necator H16 cells. Here we report the first successful fluorescent reporter system to study PSH promoter activity in C. necator ... C. necator H16 (Cupriavidus necator, DSM 428) was routinely cultivated heterotrophically in minimal medium FGN as described in ... Wild-type (wt), DSM 428 (Cupriavidus necator). DSMZ. H16:: gfp Recombinant strain containing gfp fusion vector, derivative of ...
Purchase Recombinant Cupriavidus necator Probable intracellular septation protein A(H16_A1516). It is produced in Yeast. High ... Recombinant Cupriavidus necator Probable intracellular septation protein A(H16_A1516). Recombinant Cupriavidus necator Probable ... Recombinant Cupriavidus necator Probable intracellular septation protein A(H16_A1516),E.coli. ... Recombinant Cupriavidus necator Probable intracellular septation protein A(H16_A1516),Mammalian cell. ...
In this study, the native 3-HP metabolism of Cupriavidus necator was investigated and manipulated as it represents a promising ... When testing C. necator for its tolerance towards 3-HP, it was noted that it could utilise the compound as the sole source of ... necator H16. The created triple ∆mmsA1∆mmsA2∆mmsA3 knock-out strain represents an ideal chassis for autotrophic 3-HP production ... Cupriavidus necator genes involved on 3-HP degradation (a) and the C3 metabolic network (b). a Putative operons involved in 3- ...
... moved into the genus Cupriavidus after 16S rRNA gene sequencing revealed it to be most closely related to Cupriavidus necator. ... Cupriavidus gilardii is a Gram-negative, aerobic, motile, oxidase-positive bacterium from the genus Cupriavidus and the family ... "Cupriavidus necator gen. nov., sp. nov.: a nonobligate bacterial predator of bacteria in soil". Int J Syst Bacteriol. 37 (4): ... Cupriavidus gilardii may be resistant to multiple antibiotic agents; carbapenem-resistant C. gilardii has been found in stool ...
Cupriavidus necator Makkar and Casida (ATCC® 17699D-5™) ATCC® Number: 17699D-5™ Strain Designations: Genomic DNA from ... Cupriavidus metallidurans (Goris et al.) Vandamme and Coenye (ATCC® 43123D-5™) ATCC® Number: 43123D-5™ Strain Designations: ...
Cupriavidus necator strain LMG 1202 DNA gyrase subunit B (gyrB) gene, partial cds. LMG 1202 ... Cupriavidus necator isolates are able to fix nitrogen in symbiosis with different legume species ...
Cupriavidus necator strain LMG 1201 DNA gyrase subunit B (gyrB) gene, partial cds. LMG 1201 ... Cupriavidus necator partial qnorB gene for nitric oxide reductase QnorB. LMG 1201 ... Cupriavidus necator nirS gene for nitrite reductase, strain LMG 1201. LMG 1201 ... Cupriavidus necator isolates are able to fix nitrogen in symbiosis with different legume species ...
Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337). Loading... P30299 Phosphoenolpyruvate-protein ...
The results indicate that LW definitely acts as a 3HV precursor, but, at the same time, displays toxic effects on C. necator at ... necator; thus, the produced biopolyester is expected to be more suitable for polymer processing purposes. ... Cupriavidus necator was applied as microbial production strain. For proof of concept, pre-experiments were carried out on a ... Cupriavidus necator was applied as microbial production strain. For proof of concept, pre-experiments were carried out on a ...
CC Cupriavidus necator megaplasmid pHG1, complete sequence. CC 1..36860 annotated by Ensembl Genomes CC -!- ANNOTATIONS ORIGIN: ... OC Bacteria; Proteobacteria; Betaproteobacteria; Burkholderiales; OC Burkholderiaceae; Cupriavidus. OX NCBI_TaxID=381666; RN [0 ...
Genus: Cupriavidus/Ralstonia/Wautersia Genus and Species. Synonyms and strains: 1. Cupriavidus necator ...
UV mutagenesis of Cupriavidus necator for extracellular production of (R)-3-hydroxybutyric acid. ...
Species: Cupriavidus necator [TaxId:106590]. Gene: YP_295714.1. Database cross-references and differences (RAF-indexed): * ... Species: Cupriavidus necator [TaxId:106590]. Gene: YP_295714.1. Database cross-references and differences (RAF-indexed): * ...
Cupriavidus necator is a Gel Electrophoresis Polymerase Chain Reaction GFP Correlation BioBrick Production Results Retrieved ... coli and in Cupriavidus necator. In order to develop an optimal PHB detection system, we focused on the identification of the ...
Cupriavidus necator H16 uses flavocytochrome c-sulfide dehydrogenase to oxidize self-produced and added sulfide. Appl Environ ... FisR activates σ54-dependent transcription of sulfide-oxidizing genes in Cupriavidus pinatubonensis JMP134. Mol Microbiol, 105 ...
One such predator, Cupriavidus necator, was purported to degrade bacterial endospores. However, this was never proven by direct ...
Cupriavidus necator N-1 396802 Sus scrofa Did you look for something else? * Opioid Receptor, kappa 1 ELISA Kits ...
"Construction and use of a Cupriavidus necator H16 soluble hydrogenase promoter (PSH) fusion to gfp (green fluorescent protein)" ...
recombinant E. coli and in Cupriavidus necator. In order to develop an. ...
Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337) (Ralstonia eutropha). 351. ...
  • Cupriavidus necator JMP134 is a model for chloroaromatics biodegradation, capable of mineralizing 2,4-D, halobenzoates, chlorophenols and nitrophenols, among other aromatic compounds. (nih.gov)
  • To better characterize the lifestyle of C. necator, the genomes of two strains have been sequenced. (wikipedia.org)
  • Burkholderia xenovorans LB400, Cupriavidus necator H850, and Pseudomonas pseudoalcaligenes KF707 are bacterial strains able to mineralize biphenyl and to co-oxidize many of its halogenated derivatives (PCBs). (frontiersin.org)
  • reported a comprehensive reclassification of bacterial strains from the genera Cupriavidus and Ralstonia based on percentage of conserved proteins (POCP), average nucleotide identity (ANI), multilocus sequence analysis and 16S rRNA gene sequence. (frontiersin.org)
  • Over the course of our investigation, we noticed inconsistencies in the classification of several strains that were supposed to belong to the two closely-related genera Cupriavidus and Ralstonia. (mendeley.com)
  • As a result of whole-genome sequence analysis of 46 Cupriavidus strains and 104 Ralstonia strains, we propose that the taxonomic classification of 41 of the 150 strains should be changed. (mendeley.com)
  • Müller, R. H. Exploiting mixtures of H 2 , CO 2 , and O 2 for improved production of methacrylate precursor 2-hydroxyisobutyric acid by engineered Cupriavidus necator strains. (alfa.com)
  • In light of new genomic resources, the initial taxonomic assignment of strain PBA has also been previously questioned by Kim and Gan (2017) given its closer phylogenetic affiliation to the genus Cupriavidus than to the genus Ralstonia . (frontiersin.org)
  • In both phylogenomic trees, the Ralstonia and Cupriavidus clusters received maximal support and are sister taxa to the exclusion of strain PBA ( Figures 1A,B ). The updated phylogenomic placement of strain PBA in light of extensive taxon sampling precludes its genus assignment to the genus Ralstonia or Cupriavidus and suggests that it is a member of a hitherto undescribed genus within the family Burkholderiaceae . (frontiersin.org)
  • In this work, we investigated the native 3-HP metabolism in C. necator strain H16 with the aim of engineering a strain incapable of 3-HP utilisation, to be used as a chassis for the future introduction of biosynthetic routes towards its production. (biomedcentral.com)
  • Cupriavidus necator was applied as microbial production strain. (mdpi.com)
  • To validate the identification of NH9, phylogenetic analyses (16S rRNA sequence-based tree and multilocus sequence analysis) and whole-genome sequence analyses (average nucleotide identity, percentage of conserved proteins, and tetra-nucleotide analyses) were performed, confirming that NH9 is a C. necator strain. (mendeley.com)
  • Phylogenetic analyses based on 16S rRNA gene sequences showed that strain S23 T formed a phyletic lineage with Cupriavidus necator N-1 T within the genus Cupriavidus . (springer.com)
  • Strain S23 T is closely related to C. necator N-1 T (99.2%), Cupriavidus basilensis DSM 11853 T (98.8%), Cupriavidus alkaliphilus ASC-732 T (98.8%) and Cupriavidus numazuensis TE26 T (98.7%), based on 16S rRNA gene sequence similarities. (springer.com)
  • On the basis of phenotypic, chemotaxonomic and molecular properties, strain S23 T represents a novel species of the genus Cupriavidus , for which the name Cupriavidus lacunae sp. (springer.com)
  • Complete genome sequence of the type strain Cupriavidus necator N-1. (semanticscholar.org)
  • However, the hydrogenases of C. necator are different from typical [Ni-Fe] hydrogenases because they are tolerant to oxygen and are not inhibited by CO. While the four hydrogenases perform the same reaction in the cell, each hydrogenase is linked to a different cellular process. (wikipedia.org)
  • The differences between the regulatory hydrogenase, membrane-bound hydrogenase, soluble hydrogenase and actinobacterial hydrogenase in C. necator are described below. (wikipedia.org)
  • The membrane-bound hydrogenase (MBH) is linked to the respiratory chain through a specific cytochrome b-related protein in C. necator. (wikipedia.org)
  • Amongst a number of promising candidates for application in the oxidation of H 2 is a soluble [Ni-Fe] uptake hydrogenase (SH) produced by Cupriavidus necator H16. (peerj.com)
  • The bacterium Cupriavidus necator can store up to 85 percent of its dry weight as these polymers. (scitechdaily.com)
  • Looking at DNA-DNA hybridization and phenotype comparison with Cupriavidus necator, W. eutropha was found to be the same species as previously described C. necator. (wikipedia.org)
  • Because C. necator was named in 1987 far before the name change to R. eutropha and W. eutropha, the name C. necator was assigned to R. eutropha according to Rule 23a of the International Code of Nomenclature of Bacteria. (wikipedia.org)
  • da Silva K, Florentino LA, da Silva KB, de Brandt E, Vandamme P, de Souza Moreira FM (2012) Cupriavidus necator isolates are able to fix nitrogen in symbiosis with different legume species. (springer.com)
  • The findings on aromatic compounds biodegradation in C. necator reviewed here can easily be extrapolated to other environmentally relevant bacteria, whose genomes also possess a significant proportion of catabolic genes. (nih.gov)
  • The organism was initially identified as Ralstonia gilardii in 1999, renamed Wautersiella gilardii, and most recently moved into the genus Cupriavidus after 16S rRNA gene sequencing revealed it to be most closely related to Cupriavidus necator. (wikipedia.org)
  • When growing under autotrophic conditions, C. necator fixes carbon through the reductive pentose phosphate pathway. (wikipedia.org)
  • Replacing the Calvin cycle with the reductive glycine pathway in Cupriavidus necator. (mpg.de)
  • Cupriavidus gilardii is a Gram-negative, aerobic, motile, oxidase-positive bacterium from the genus Cupriavidus and the family Burkholderiaceae. (wikipedia.org)
  • Cupriavidus necator is a Gram-negative soil bacterium of the class Betaproteobacteria. (wikipedia.org)
  • Cupriavidus necator is a hydrogen-oxidizing bacterium ("knallgas" bacterium) capable of growing at the interface of anaerobic and aerobic environments. (wikipedia.org)
  • Both organic compounds and hydrogen can be used as a source of energy C. necator can perform aerobic or anaerobic respiration by denitrification of nitrate and/or nitrite to nitrogen gas. (wikipedia.org)
  • Cupriavidus necator can use hydrogen gas as a source of energy when growing under autotrophic conditions. (wikipedia.org)
  • One goal of our research is to develop and optimize a method, using fluorescent proteins, for the detection of maximum product yield of polyhydroxybutyrate (PHB, a bioplastic) in recombinant E. coli and in Cupriavidus necator. (igem.org)
  • 202 days of Mars polyhydroxybutyrate synthesis with Cupriavidus necator can lower the shipped mass to three-dimensional print a 120 m 3 six-person habitat by 85% and a few days of acetaminophen production with engineered Synechocystis sp. (royalsocietypublishing.org)
  • The results indicate that LW definitely acts as a 3HV precursor, but, at the same time, displays toxic effects on C. necator at concentrations exceeding 10 g/L. Based on these findings, PHA biosynthesis under controlled conditions was performed using a fed-batch feeding regime on a bioreactor scale. (mdpi.com)
  • One such predator, Cupriavidus necator, was purported to degrade bacterial endospores. (smcm.edu)
  • Poly-beta-hydroxybutyrate (PHB) can be formed in large amounts in Cupriavidus necator and is important for the industrial production of biodegradable plastics. (mdpi.com)
  • Evaluation of by-products from the biodiesel industry as fermentation feedstock for poly(3-hydroxybutyrate-co-3-hydroxyvalerate) production by Cupriavidus necator. (semanticscholar.org)
  • Microbial synthesis of poly((R)-3-hydroxybutyrate-co-3-hydroxypropionate) from unrelated carbon sources by engineered Cupriavidus necator. (semanticscholar.org)
  • Biotechnological Production of Poly(3-Hydroxybutyrate-co-4-Hydroxybutyrate-co-3-Hydroxyvalerate) Terpolymer by Cupriavidus sp. (vutbr.cz)
  • The periplasmic nitrate reductase (NapAB) from Cupriavidus necator is a heterodimeric protein that belongs to the dimethyl sulfoxide reductase family of mononuclear Mo-containing enzymes and catalyzes the reduction of nitrate to nitrite. (nih.gov)
  • Under heterotrophic growth conditions, the expression of [Ni-Fe] uptake hydrogenases in C. necator H16 is induced on poorly utilised carbon sources (e.g., glycerol). (peerj.com)
  • Then, in the 1970s, Imperial Chemical Industries (ICI, UK) started producing PHAs by using a mutant stain Cupriavidus necator , NCIB 11599 from various carbon sources such as 1,4-butanediol, 1,6-hexanediol, and butyrolactone. (hindawi.com)
  • It contains four different hydrogenases that have [Ni-Fe] active sites and all perform this reaction: H2 ⇌ {\displaystyle \rightleftharpoons } 2H+ + 2e− The hydrogenases of C. necator are like other typical [Ni-Fe] hydrogenases because they are made up of a large and a small subunit. (wikipedia.org)
  • A P SH promoter-gfp fusion was successfully constructed and inducible GFP expression driven by the P SH promoter under de-repressing conditions in heterotrophic growth media was demonstrated in the recombinant C. necator H16 cells. (peerj.com)
  • recombinant E. coli and in Cupriavidus necator. (igem.org)
  • In this study, the native 3-HP metabolism of Cupriavidus necator was investigated and manipulated as it represents a promising chassis for the production of 3-HP and other fatty acid derivatives from CO 2 and H 2 . (biomedcentral.com)
  • Waste rapeseed oil is a useful substrate for polyhydroxyalkanoates (PHA) production employing Cupriavidus necator H16. (semanticscholar.org)
  • Polyhydroxyalkanoates production by engineered Cupriavidus necator from waste material containing lactose. (semanticscholar.org)
  • Cupriavidus necator DSM 545 is a well-known polyhydroxyalkanoates (PHAs) producer, but unable to grow on lactose. (semanticscholar.org)
  • When testing C. necator for its tolerance towards 3-HP, it was noted that it could utilise the compound as the sole source of carbon and energy, a highly undesirable trait in the context of biological 3-HP production which required elimination. (biomedcentral.com)
  • In this investigation, laser tweezers Raman spectroscopy (LTRS) was used to characterize dynamic changes in PHB content-as well as in the contents of other common biomolecule-in C. necator during batch growth at both the population and single-cell levels. (mdpi.com)
  • Cupriavidus necator NH9, a 3-chlorobenzoate (3-CB)-degrading bacterium, was isolated from soil in Japan. (mendeley.com)
  • Among the six is the bio-polymer producer, Cupriavidus necator, which was smartly selected because of Ohio's large polymer industry. (polymerohio.org)
  • CC Cupriavidus necator megaplasmid pHG1, complete sequence. (univ-lyon1.fr)
  • In this study, the effects of Nippostrongylus brasiliensis infection (a murine model of Necator Americanus) on cognitive function were investigated. (readbyqxmd.com)
  • In addition, UV-Vis and EPR spectroscopy studies showed that the periplasmic nitrate reductase from C. necator might work at unexpectedly high redox potentials when compared to all periplasmic nitrate reductases studied to date. (nih.gov)