Cupriavidus necator: A gram-negative, facultatively chemoautotrophic bacterium, formerly called Wautersia eutropha, found in water and soil.Cupriavidus: A genus of gram-negative, aerobic, rod-shaped bacteria, in the family BURKHOLDERIACEAE, that are mobile by means of peritrichous FLAGELLA. The genus was formerly called Wautersia and species in this genus were formerly in the genus RALSTONIA.Necator americanus: A common parasite of humans in the moist tropics and subtropics. These organisms attach to villi in the small intestine and suck blood causing diarrhea, anorexia, and anemia.Chlorobenzoates: Benzoic acid or benzoic acid esters substituted with one or more chlorine atoms.Chlorophenols: Phenols substituted with one or more chlorine atoms in any position.Isethionic Acid: A colorless, syrupy, strongly acidic liquid that can form detergents with oleic acid.2,4-Dichlorophenoxyacetic Acid: An herbicide with irritant effects on the eye and the gastrointestinal system.Necator: A genus of intestinal parasite worms which includes one of the most important hookworms of man, NECATOR AMERICANUS. The only other known species, N. suillus, has been recovered from pigs.Burkholderiaceae: A family of gram negative, aerobic, non-sporeforming, rod-shaped bacteria.Necatoriasis: Infection of humans or animals with hookworms of the genus NECATOR. The resulting anemia from this condition is less severe than that from ANCYLOSTOMIASIS.Delftia acidovorans: A species of gram-negative rod-shaped bacteria found ubiquitously and formerly called Comamonas acidovorans and Pseudomonas acidovorans. It is the type species of the genus DELFTIA.Mimosa: A plant genus of the family FABACEAE that contains kukulkanin, a CHALCONE.Polyesters: Polymers of organic acids and alcohols, with ester linkages--usually polyethylene terephthalate; can be cured into hard plastic, films or tapes, or fibers which can be woven into fabrics, meshes or velours.Biodegradation, Environmental: Elimination of ENVIRONMENTAL POLLUTANTS; PESTICIDES and other waste using living organisms, usually involving intervention of environmental or sanitation engineers.Bacterial Proteins: Proteins found in any species of bacterium.Ancylostomiasis: Infection of humans or animals with hookworms of the genus ANCYLOSTOMA. Characteristics include anemia, dyspepsia, eosinophilia, and abdominal swelling.Ancylostoma: A genus of nematode intestinal parasites that consists of several species. A. duodenale is the common hookworm in humans. A. braziliense, A. ceylonicum, and A. caninum occur primarily in cats and dogs, but all have been known to occur in humans.Vitis: A plant genus in the family VITACEAE, order Rhamnales, subclass Rosidae. It is a woody vine cultivated worldwide. It is best known for grapes, the edible fruit and used to make WINE and raisins.FuraldehydeAscomycota: A phylum of fungi which have cross-walls or septa in the mycelium. The perfect state is characterized by the formation of a saclike cell (ascus) containing ascospores. Most pathogenic fungi with a known perfect state belong to this phylum.Ancylostomatoidea: A superfamily of nematode parasitic hookworms consisting of four genera: ANCYLOSTOMA; NECATOR; Bunostomum; and Uncinaria. ANCYLOSTOMA and NECATOR occur in humans and other mammals. Bunostomum is common in ruminants and Uncinaria in wolves, foxes, and dogs.Volcanic Eruptions: The ash, dust, gases, and lava released by volcanic explosion. The gases are volatile matter composed principally of about 90% water vapor, and carbon dioxide, sulfur dioxide, hydrogen, carbon monoxide, and nitrogen. The ash or dust is pyroclastic ejecta and lava is molten extrusive material consisting mainly of magnesium silicate. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Hookworm Infections: Infection of humans or animals with hookworms other than those caused by the genus Ancylostoma or Necator, for which the specific terms ANCYLOSTOMIASIS and NECATORIASIS are available.Burkholderia: A genus of gram-negative, aerobic, rod-shaped bacteria. Organisms in this genus had originally been classified as members of the PSEUDOMONAS genus but overwhelming biochemical and chemical findings indicated the need to separate them from other Pseudomonas species, and hence, this new genus was created.Selenic Acid: A strong dibasic acid with the molecular formula H2SeO4. Included under this heading is the acid form, and inorganic salts of dihydrogen selenium tetraoxide.Ubiquinone: A lipid-soluble benzoquinone which is involved in ELECTRON TRANSPORT in mitochondrial preparations. The compound occurs in the majority of aerobic organisms, from bacteria to higher plants and animals.Vitamin K 1: A family of phylloquinones that contains a ring of 2-methyl-1,4-naphthoquinone and an isoprenoid side chain. Members of this group of vitamin K 1 have only one double bond on the proximal isoprene unit. Rich sources of vitamin K 1 include green plants, algae, and photosynthetic bacteria. Vitamin K1 has antihemorrhagic and prothrombogenic activity.Electron Transport: The process by which ELECTRONS are transported from a reduced substrate to molecular OXYGEN. (From Bennington, Saunders Dictionary and Encyclopedia of Laboratory Medicine and Technology, 1984, p270)Vitamin K: A lipid cofactor that is required for normal blood clotting. Several forms of vitamin K have been identified: VITAMIN K 1 (phytomenadione) derived from plants, VITAMIN K 2 (menaquinone) from bacteria, and synthetic naphthoquinone provitamins, VITAMIN K 3 (menadione). Vitamin K 3 provitamins, after being alkylated in vivo, exhibit the antifibrinolytic activity of vitamin K. Green leafy vegetables, liver, cheese, butter, and egg yolk are good sources of vitamin K.Plastoquinone: Polyunsaturated side-chain quinone derivative which is an important link in the electron transport chain of green plants during the photosynthetic conversion of light energy by photophosphorylation into the potential energy of chemical bonds.Concentration Camps: Facilities in which WARFARE or political prisoners are confined.Californium: Californium. A man-made radioactive actinide with atomic symbol Cf, atomic number 98, and atomic weight 251. Its valence can be +2 or +3. Californium has medical use as a radiation source for radiotherapy.Biometric Identification: A method of differentiating individuals based on the analysis of qualitative or quantitative biological traits or patterns. This process which has applications in forensics and identity theft prevention includes DNA profiles or DNA fingerprints, hand fingerprints, automated facial recognition, iris scan, hand geometry, retinal scan, vascular patterns, automated voice pattern recognition, and ultrasound of fingers.Radio Frequency Identification Device: Machine readable patient or equipment identification device using radio frequency from 125 kHz to 5.8 Ghz.Doping in Sports: Illegitimate use of substances for a desired effect in competitive sports. It includes humans and animals.Troponin C: One of the three polypeptide chains that make up the TROPONIN complex of skeletal muscle. It is a calcium-binding protein.Troponin: One of the minor protein components of skeletal muscle. Its function is to serve as the calcium-binding component in the troponin-tropomyosin B-actin-myosin complex by conferring calcium sensitivity to the cross-linked actin and myosin filaments.Fatigue: The state of weariness following a period of exertion, mental or physical, characterized by a decreased capacity for work and reduced efficiency to respond to stimuli.Databases, Protein: Databases containing information about PROTEINS such as AMINO ACID SEQUENCE; PROTEIN CONFORMATION; and other properties.Sequence Analysis, Protein: A process that includes the determination of AMINO ACID SEQUENCE of a protein (or peptide, oligopeptide or peptide fragment) and the information analysis of the sequence.Systems Integration: The procedures involved in combining separately developed modules, components, or subsystems so that they work together as a complete system. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Internet: A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.Proteome: The protein complement of an organism coded for by its genome.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.Wood: A product of hard secondary xylem composed of CELLULOSE, hemicellulose, and LIGNANS, that is under the bark of trees and shrubs. It is used in construction and as a source of CHARCOAL and many other products.Industrial Microbiology: The study, utilization, and manipulation of those microorganisms capable of economically producing desirable substances or changes in substances, and the control of undesirable microorganisms.Polyhydroxyalkanoates: Fatty acid biopolymers that are biosynthesized by microbial polyhydroxyalkanoate synthase enzymes. They are being investigated for use as biodegradable polyesters.Microwaves: That portion of the electromagnetic spectrum from the UHF (ultrahigh frequency) radio waves and extending into the INFRARED RAYS frequencies.Refuse Disposal: The discarding or destroying of garbage, sewage, or other waste matter or its transformation into something useful or innocuous.Hydroxybutyrates: Salts and esters of hydroxybutyric acid.Fossil Fuels: Any combustible hydrocarbon deposit formed from the remains of prehistoric organisms. Examples are petroleum, coal, and natural gas.Drug Delivery Systems: Systems for the delivery of drugs to target sites of pharmacological actions. Technologies employed include those concerning drug preparation, route of administration, site targeting, metabolism, and toxicity.

Analysis of 4-phosphopantetheinylation of polyhydroxybutyrate synthase from Ralstonia eutropha: generation of beta-alanine auxotrophic Tn5 mutants and cloning of the panD gene region. (1/200)

The postulated posttranslational modification of the polyhydroxybutyrate (PHA) synthase from Ralstonia eutropha by 4-phosphopantetheine was investigated. Four beta-alanine auxotrophic Tn5-induced mutants of R. eutropha HF39 were isolated, and two insertions were mapped in an open reading frame with strong similarity to the panD gene from Escherichia coli, encoding L-aspartate-1-decarboxylase (EC 4.1.1.15), whereas two other insertions were mapped in an open reading frame (ORF) with strong similarity to the NAD(P)+ transhydrogenase (EC 1.6.1.1) alpha 1 subunit, encoded by the pntAA gene from Escherichia coli. The panD gene was cloned by complementation of the panD mutant of R. eutropha Q20. DNA sequencing of the panD gene region (3,312 bp) revealed an ORF of 365 bp, encoding a protein with 63 and 67% amino acid sequence similarity to PanD from E. coli and Bacillus subtilis, respectively. Subcloning of only this ORF into vectors pBBR1MCS-3 and pBluescript KS- led to complementation of the panD mutants of R. eutropha and E. coli SJ16, respectively. panD-encoded L-aspartate-1-decarboxylase was further confirmed by an enzymatic assay. Upstream of panD, an ORF with strong similarity to pntAA from E. coli, encoding NAD(P)+ transhydrogenase subunit alpha 1 was found; downstream of panD, two ORFs with strong similarity to pntAB and pntB, encoding subunits alpha 2 and beta of the NAD(P)+ transhydrogenase, respectively, were identified. Thus, a hitherto undetermined organization of pan and pnt genes was found in R. eutropha. Labeling experiments using one of the R. eutropha panD mutants and [2-14C]beta-alanine provided no evidence that R. eutropha PHA synthase is covalently modified by posttranslational attachment of 4-phosphopantetheine, nor did the E. coli panD mutant exhibit detectable labeling of functional PHA synthase from R. eutropha.  (+info)

3-Hydroxylaminophenol mutase from Ralstonia eutropha JMP134 catalyzes a Bamberger rearrangement. (2/200)

3-Hydroxylaminophenol mutase from Ralstonia eutropha JMP134 is involved in the degradative pathway of 3-nitrophenol, in which it catalyzes the conversion of 3-hydroxylaminophenol to aminohydroquinone. To show that the reaction was really catalyzed by a single enzyme without the release of intermediates, the corresponding protein was purified to apparent homogeneity from an extract of cells grown on 3-nitrophenol as the nitrogen source and succinate as the carbon and energy source. 3-Hydroxylaminophenol mutase appears to be a relatively hydrophobic but soluble and colorless protein consisting of a single 62-kDa polypeptide. The pI was determined to be at pH 4.5. In a database search, the NH2-terminal amino acid sequence of the undigested protein and of two internal sequences of 3-hydroxylaminophenol mutase were found to be most similar to those of glutamine synthetases from different species. Hydroxylaminobenzene, 4-hydroxylaminotoluene, and 2-chloro-5-hydroxylaminophenol, but not 4-hydroxylaminobenzoate, can also serve as substrates for the enzyme. The enzyme requires no oxygen or added cofactors for its reaction, which suggests an enzymatic mechanism analogous to the acid-catalyzed Bamberger rearrangement.  (+info)

Metabolic engineering of poly(3-hydroxyalkanoates): from DNA to plastic. (3/200)

Poly(3-hydroxyalkanoates) (PHAs) are a class of microbially produced polyesters that have potential applications as conventional plastics, specifically thermoplastic elastomers. A wealth of biological diversity in PHA formation exists, with at least 100 different PHA constituents and at least five different dedicated PHA biosynthetic pathways. This diversity, in combination with classical microbial physiology and modern molecular biology, has now opened up this area for genetic and metabolic engineering to develop optimal PHA-producing organisms. Commercial processes for PHA production were initially developed by W. R. Grace in the 1960s and later developed by Imperial Chemical Industries, Ltd., in the United Kingdom in the 1970s and 1980s. Since the early 1990s, Metabolix Inc. and Monsanto have been the driving forces behind the commercial exploitation of PHA polymers in the United States. The gram-negative bacterium Ralstonia eutropha, formerly known as Alcaligenes eutrophus, has generally been used as the production organism of choice, and intracellular accumulation of PHA of over 90% of the cell dry weight have been reported. The advent of molecular biological techniques and a developing environmental awareness initiated a renewed scientific interest in PHAs, and the biosynthetic machinery for PHA metabolism has been studied in great detail over the last two decades. Because the structure and monomeric composition of PHAs determine the applications for each type of polymer, a variety of polymers have been synthesized by cofeeding of various substrates or by metabolic engineering of the production organism. Classical microbiology and modern molecular bacterial physiology have been brought together to decipher the intricacies of PHA metabolism both for production purposes and for the unraveling of the natural role of PHAs. This review provides an overview of the different PHA biosynthetic systems and their genetic background, followed by a detailed summation of how this natural diversity is being used to develop commercially attractive, recombinant processes for the large-scale production of PHAs.  (+info)

CDC group IV c-2: a new Ralstonia species close to Ralstonia eutropha. (4/200)

CDC group IV c-2, an environmental gram-negative bacillus recently proposed for inclusion in the genus Ralstonia, has been isolated in several human infections. Biochemical characterization and 16S ribosomal DNA (rDNA) sequencing with phylogenetic analysis were used to characterize eight clinical isolates and four type strains. Other typing tools, such as pulsed-field gel electrophoresis (PFGE) and randomly amplified polymorphic DNA (RAPD) analysis, were also used. PFGE typing of clinical isolates was unsuccessful because the DNA was degraded, and RAPD analysis was poorly discriminatory. In contrast, the type strains were clearly distinguished with both PFGE and RAPD analysis. All of the 16S rDNA sequences were identical. Comparison of the 16S rDNA sequences to the GenBank sequences showed that they were consistent with CDC group IV c-2 belonging to the genus Ralstonia. The closest matches were obtained with Ralstonia eutropha. However, four differences in 32 biochemical tests separated R. eutropha from CDC group IV c-2, which suggests that CDC group IV c-2 is a new species of the genus Ralstonia.  (+info)

Chemoselective nitro group reduction and reductive dechlorination initiate degradation of 2-chloro-5-nitrophenol by Ralstonia eutropha JMP134. (5/200)

Ralstonia eutropha JMP134 utilizes 2-chloro-5-nitrophenol as a sole source of nitrogen, carbon, and energy. The initial steps for degradation of 2-chloro-5-nitrophenol are analogous to those of 3-nitrophenol degradation in R. eutropha JMP134. 2-Chloro-5-nitrophenol is initially reduced to 2-chloro-5-hydroxylaminophenol, which is subject to an enzymatic Bamberger rearrangement yielding 2-amino-5-chlorohydroquinone. The chlorine of 2-amino-5-chlorohydroquinone is removed by a reductive mechanism, and aminohydroquinone is formed. 2-Chloro-5-nitrophenol and 3-nitrophenol induce the expression of 3-nitrophenol nitroreductase, of 3-hydroxylaminophenol mutase, and of the dechlorinating activity. 3-Nitrophenol nitroreductase catalyzes chemoselective reduction of aromatic nitro groups to hydroxylamino groups in the presence of NADPH. 3-Nitrophenol nitroreductase is active with a variety of mono-, di-, and trinitroaromatic compounds, demonstrating a relaxed substrate specificity of the enzyme. Nitrosobenzene serves as a substrate for the enzyme and is converted faster than nitrobenzene.  (+info)

Earthworm egg capsules as vectors for the environmental introduction of biodegradative bacteria. (6/200)

Earthworm egg capsules (cocoons) may acquire bacteria from the environment in which they are produced. We found that Ralstonia eutropha (pJP4) can be recovered from Eisenia fetida cocoons formed in soil inoculated with this bacterium. Plasmid pJP4 contains the genes necessary for 2,4-dichlorophenoxyacetic acid (2,4-D) and 2, 4-dichlorophenol (2,4-DCP) degradation. In this study we determined that the presence of R. eutropha (pJP4) within the developing earthworm cocoon can influence the degradation and toxicity of 2,4-D and 2,4-DCP, respectively. The addition of cocoons containing R. eutropha (pJP4) at either low or high densities (10(2) or 10(5) CFU per cocoon, respectively) initiated degradation of 2,4-D in nonsterile soil microcosms. Loss of 2,4-D was observed within the first week of incubation, and respiking the soil with 2,4-D showed depletion within 24 h. Microbial analysis of the soil revealed the presence of approximately 10(4) CFU R. eutropha (pJP4) g-1 of soil. The toxicity of 2,4-DCP to developing earthworms was tested by using cocoons with or without R. eutropha (pJP4). Results showed that cocoons containing R. eutropha (pJP4) were able to tolerate higher levels of 2,4-DCP. Our results indicate that the biodegradation of 2, 4-DCP by R. eutropha (pJP4) within the cocoons may be the mechanism contributing to toxicity reduction. These results suggest that the microbiota may influence the survival of developing earthworms exposed to toxic chemicals. In addition, cocoons can be used as inoculants for the introduction into the environment of beneficial bacteria, such as strains with biodegradative capabilities.  (+info)

A novel Sinorhizobium meliloti operon encodes an alpha-glucosidase and a periplasmic-binding-protein-dependent transport system for alpha-glucosides. (7/200)

The most abundant carbon source transported into legume root nodules is photosynthetically produced sucrose, yet the importance of its metabolism by rhizobia in planta is not yet known. To identify genes involved in sucrose uptake and hydrolysis, we screened a Sinorhizobium meliloti genomic library and discovered a segment of S. meliloti DNA which allows Ralstonia eutropha to grow on the alpha-glucosides sucrose, maltose, and trehalose. Tn5 mutagenesis localized the required genes to a 6.8-kb region containing five open reading frames which were named agl, for alpha-glucoside utilization. Four of these (aglE, aglF, aglG, and aglK) appear to encode a periplasmic-binding-protein-dependent sugar transport system, and one (aglA) appears to encode an alpha-glucosidase with homology to family 13 of glycosyl hydrolases. Cosmid-borne agl genes permit uptake of radiolabeled sucrose into R. eutropha cells. Analysis of the properties of agl mutants suggests that S. meliloti possesses at least one additional alpha-glucosidase as well as a lower-affinity transport system for alpha-glucosides. It is possible that the Fix+ phenotype of agl mutants on alfalfa is due to these additional functions. Loci found by DNA sequencing to be adjacent to aglEFGAK include a probable regulatory gene (aglR), zwf and edd, which encode the first two enzymes of the Entner-Doudoroff pathway, pgl, which shows homology to a gene encoding a putative phosphogluconolactonase, and a novel Rhizobium-specific repeat element.  (+info)

Mutational analysis of the cbb operon (CO2 assimilation) promoter of Ralstonia eutropha. (8/200)

PL promoters direct the transcription of the duplicated cbb operons from the facultative chemoautotroph Ralstonia eutropha H16. The operons encode most enzymes of the Calvin-Benson-Bassham carbon reduction cycle required for CO2 assimilation. Their transcription depends on the activator protein CbbR. Structure-function relationships in the cloned chromosomal promoter region were analyzed by site-directed mutagenesis. PL was altered in its presumed hexameric -35 and/or -10 box or in the spacer region between the boxes to achieve a greater or lesser resemblance to the structure of the sigma70 consensus promoter of Escherichia coli. PL::lacZ transcriptional fusions of various promoter variants were assayed in transconjugant strains of R. eutropha as well as in corresponding cbbR deletion mutants. Mutations increasing the similarity of the -35 and/or -10 box to the consensus sequence stimulated PL activity to various extents, whereas mutations deviating from the consensus decreased the activity. The length of the spacer region also proved to be critical. The conversion of the boxes, either individually or simultaneously, into the consensus sequences resulted in a highly active PL. All improved PL mutants, however, retained the activation under inducing or derepressing growth conditions, although the full-consensus promoter was nearly constitutive. They were also activated in the cbbR mutants. The activity of the overlapping, divergently oriented cbbR promoter was less affected by the mutations. The half- and full-consensus PL mutants were comparably active in E. coli. Two major conclusions were drawn from the results: (i) the location and function of PL were verified, and (ii) indirect evidence was obtained for the involvement of another regulator(s), besides CbbR, in the transcriptional control of the R. eutropha cbb operons.  (+info)

Ralstonia eutropha strain E2 (previously Alcaligenes sp.) is a phenol-degrading bacterium expressing phenol-oxygenating activity with a low Ks (the apparent half-saturation constant in Haldane's equation) and an extremely high KSI (the apparent inhibition constant). To identify the molecular basis for these novel cellular kinetic properties, a 9.5 kb DNA fragment that allowed Pseudomonas aeruginosa PAO1c (Phl- Cat+) to grow on phenol as the sole carbon source was cloned from strain E2 into plasmid pRO1614. PAO1c harbouring this plasmid (designated pROE217) transformed phenol to catechol, indicating that this fragment contains gene(s) for phenol hydroxylase. The cloned genes consist of eight complete ORFs, designated poxRABCDEFG. The products are homologous to those of dmpRKLMNOPQ of Pseudomonas sp. CF600, sharing 30--65% identity: this suggests that the phenol hydroxylase is a multicomponent enzyme. The kinetic constants for phenol-oxygenating activity of PA01c(pROE217) were determined, and these
Ralstonia eutropha H16 is a facultatively autotrophic hydrogen-oxidizing bacterium capable of producing polyhydroxybutyrate (PHB)-based bioplastics. As PHBs physical properties may be improved by incorporation of medium-chain-length fatty acids (MCFAs), and MCFAs are valuable on their own as fuel and chemical intermediates, we engineered R. eutropha for MCFA production. Expression of UcFatB2, a medium-chain-length-specific acyl-ACP thioesterase, resulted in production of 14 mg/L laurate in wild-type R. eutropha. Total fatty acid production (22 mg/L) could be increased up to 2.5-fold by knocking out PHB synthesis, a major sink for acetyl-CoA, or by knocking out the acyl-CoA ligase fadD3, an entry point for fatty acids into β-oxidation. As ΔfadD3 mutants still consumed laurate, and because the R. eutropha genome is predicted to encode over 50 acyl-CoA ligases, we employed RNA-Seq to identify acyl-CoA ligases upregulated during growth on laurate. Knockouts of the three most highly upregulated acyl-CoA
EIIANtr is a member of a truncated phosphotransferase (PTS) system that serves regulatory functions and exists in many Proteobacteria in addition to the sugar transport PTS. In Escherichia coli, EIIANtr regulates K+ homeostasis through interaction with the K+ transporter TrkA and sensor kinase KdpD. In the β-Proteobacterium Ralstonia eutropha H16, EIIANtr influences formation of the industrially important bioplastic poly(3-hydroxybutyrate) (PHB). PHB accumulation is controlled by the stringent response and induced under conditions of nitrogen deprivation. Knockout of EIIANtr increases the PHB content. In contrast, absence of enzyme I or HPr, which deliver phosphoryl groups to EIIANtr, has the opposite effect. To clarify the role of EIIANtr in PHB formation, we screened for interacting proteins that co-purify with Strep-tagged EIIANtr from R. eutropha cells. This approach identified the bifunctional ppGpp synthase/hydrolase SpoT1, a key enzyme of the stringent response. Two-hybrid and far-Western
Sulfur is an essential element for life and the metabolism of organic sulfur compounds plays an important role in the global sulfur cycle. Sulfur occurs in various oxidation states ranging from +6 in sulfate to -2 in sulfide (H2S). Sulfate reduction can occur in both an energy consuming assimilatory pathway and an energy producing dissimilatory pathway. The assimilatory pathway, which is found in a wide range of organisms, produces reduced sulfur compounds for the biosynthesis of S-containing amino acids and does not lead to direct excretion of sulfide. In the dissimilatory pathway, which is restricted to obligatory anaerobic bacterial and archaeal lineages, sulfate (or sulfur) is the terminal electron acceptor of the respiratory chain producing large quantities of inorganic sulfide. Both pathways start from the activation of sulfate by reaction with ATP to form adenylyl sulfate (APS). In the assimilatory pathway [MD:M00176] APS is converted to 3-phosphoadenylyl sulfate (PAPS) and then reduced ...
Glycolysis is the process of converting glucose into pyruvate and generating small amounts of ATP (energy) and NADH (reducing power). It is a central pathway that produces important precursor metabolites: six-carbon compounds of glucose-6P and fructose-6P and three-carbon compounds of glycerone-P, glyceraldehyde-3P, glycerate-3P, phosphoenolpyruvate, and pyruvate [MD:M00001]. Acetyl-CoA, another important precursor metabolite, is produced by oxidative decarboxylation of pyruvate [MD:M00307]. When the enzyme genes of this pathway are examined in completely sequenced genomes, the reaction steps of three-carbon compounds from glycerone-P to pyruvate form a conserved core module [MD:M00002], which is found in almost all organisms and which sometimes contains operon structures in bacterial genomes. Gluconeogenesis is a synthesis pathway of glucose from noncarbohydrate precursors. It is essentially a reversal of glycolysis with minor variations of alternative paths [MD:M00003 ...
The chemoautotrophic bacterium Ralstonia eutropha can utilize H2/CO2 for growth under aerobic conditions. While this microbial host has great potential to be engineered to produce desired compounds (beyond polyhydroxybutyrate) directly from CO2, little work has been done to develop genetic part libraries to enable such endeavors. We report the development of a toolbox for the metabolic engineering of Ralstonia eutropha H16. We have constructed a set of broad-host-range plasmids bearing a variety of origins of replication, promoters, 5 mRNA stem-loop structures, and ribosomal binding sites. Specifically, we analyzed the origins of replication pCM62 (IncP), pBBR1, pKT (IncQ), and their variants. We tested the promoters PBAD, T7, Pxyls/PM, PlacUV5, and variants thereof for inducible expression. We also evaluated a T7 mRNA stem-loop structure sequence and compared a set of ribosomal binding site (RBS) sequences derived from Escherichia coli, R. eutropha, and a computational RBS design tool. Finally, we
Acetic acid, a potential growth inhibitor, commonly occurs in lignocellulosic hydrolysates. The growth of Cupriavidus necator DSM 545 and production of poly(3-hydroxybutyrate) (PHB) by this bacterium in a glucose-based medium supplemented with various initial concentrations of acetic acid are reported. The bacterium could use both glucose and acetic acid to grow and produce PHB, but acetic acid inhibited growth once its initial concentration exceeded 0.5 g/L. As acetic acid is an unavoidable contaminant in hydrolysates used as sugar sources in commercial fermentations, a mathematical model was developed to describe its impact on growth and the production of PHB ...
Liquefied wood (LW) prepared in a microwave process was applied as a novel; inexpensive precursor feedstock for incorporation of (R)-3-hydroxyvalerate (3HV) into polyhydroxyalkanoate (PHA) biopolyesters in order to improve the biopolyesters material quality; Cupriavidus necator was applied as microbial production strain. For proof of concept, pre-experiments were carried out on a shake flask scale using different mixtures of glucose and LW as carbon source. The results indicate that LW definitely acts as a 3HV precursor, but, at the same time, displays toxic effects on C. necator at concentrations exceeding 10 g/L. Based on these findings, PHA biosynthesis under controlled conditions was performed using a fed-batch feeding regime on a bioreactor scale. As major outcome, a poly(3HB-co-0.8%-3HV) copolyester was obtained displaying a desired high molar mass of Mw = 5.39 × 105 g/mol at low molar-mass dispersity (ĐM of 1.53), a degree of crystallinity (Xc) of 62.1%, and melting temperature Tm (176.3 °C)
JMP Training is pleased to announce a new live web class. JMP Software: Analysis of Attribute Data has been updated for JMP version 7 and has been
Gentaur molecular products has all kinds of products like :search , QED \ PHAP III \ 11084 for more molecular products just contact us
购买我们的PHAP1肽。Ab6240为封闭肽并经过Blocking实验验证。 Abcam提供免费的实验方案,操作技巧及专业的支持。中国80%以上现货。
Product comparison of LeEco Le 2 vs Lenovo Phab on Pricebaba. A complete comparison with photos, price, specifications and shopping research.
The unlocked Lenovo Phab 2 Pro serves as more of a showcase for Google Tango than a case for augmented reality, but the future looks promising, and the phone is solid in its own right.
The Tango-enabled Lenovo Phab 2 Pro, diminutive ZTE Axon 7 Mini and OG Moto Z are quite old, but theyre still compelling at these new all-time low prices.
This online statistics course is comprised of seven modules, totaling about 30 hours of self-paced learning, and includes videos, demonstrations and exercises.
This online statistics course is comprised of seven modules, totaling about 30 hours of self-paced learning, and includes videos, demonstrations and exercises.
Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRNA(Ala). Also edits incorrectly charged Ser-tRNA(Ala) and Gly-tRNA(Ala) via its editing domain.
A common active site of polyhydroxyalkanoate synthase from Bacillus cereus YB-4 is involved in polymerization and alcoholysis reactionsA common active site of polyhydroxyalkanoate synthase from Bacillus cereus YB-4 is involved in polymerization and alcoholysis reactions ...
Called Ralstonia eutropha H16, the bacterium uses electricity to fixate carbon dioxide into alcohols (which are merely carbon, oxygen, and hydrogen arranged in a different order). In theory the hydrogen atoms could be produced by solar panels, but for safety reasons the team instead created formic acid using electricity. The bacteria feasts on the formic acid to produce the combustible alcohol. ...
A team at University of California Los Angeles (UCLA) have genetically engineered a microorganism that converts carbon dioxide into isobutanol and 3-methyl-1-butanol, both of which could be used as a fuel source for cars, or other combustion engines. Called Ralstonia eutropha H16, the bacterium uses...
2PIM: Crystal structure of Phenylacetic acid degradation-related protein (YP_298971.1) from Ralstonia eutropha JMP134 at 2.20 A resolution
The gene encoding a 4-hydroxybutyryl-Co A transferase has been isolated from bacteria and integrated into the genome of bacteria also expressing a polyhydroxyalkanoate synthase, to yield an improved p
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
An amazing example of R being used sucessfully in combination (and not is isolation) with other enterprise software is the add-ins functionality of JMP and its R integration. See the following JMP add-ins which use R http://support.sas.com/demosdownloads/downarea_t4.jsp?productID=110454&jmpflag=Y JMP Add-in: Multidimensional Scaling using R This add-in creates a new menu command under the Add-Ins Menu in…
A resource for JMP software users. Start or join a conversation to solve a problem or share tips and tricks with other JMP users. Read blog posts,
JMP statistical discovery software from SAS is the tool of choice for scientists, engineers and other data explorers in almost every industry and government sector. WebAssigns JMP Statistics Question Bank presents real life examples using the JMP interactive applet to display the data. Students then use the applet to answer a series of questions. This question bank covers most introductory statistics topics and features simulations, solutions and question feedback ...
Mono- and Stereopictres of 5.0 Angstrom coordination sphere of Iron atom in PDB 1yfy: Crystal Structure of 3-Hydroxyanthranilate-3,4-Dioxygenase From Ralstonia Metallidurans Complexed With 3-Hydroxyanthranilic Acid
A single-nucleotide substitution in phasin gene leads to enhanced accumulation of polyhydroxyalkanoate (PHA) in Escherichia coli harboring Aeromonas caviae PHA biosynthetic operonA single-nucleotide substitution in phasin gene leads to enhanced accumulation of polyhydroxyalkanoate (PHA) in Escherichia coli harboring Aeromonas caviae PHA biosynthetic operon ...
Recently MALDI-TOF mass spectrum analysis has been considered an easy and discriminatory tool for identification of bacterial species (Lista et al., 2011). The results of MALDI-TOF mass spectrum analysis of the eight suspected isolates matched with that of the 16S rDNA sequence analysis. The four isolates DRDEBPS1001, DRDEBPS1002, DRDEBPS1003 and DRDEBPS1004 were confirmed as B. pseudomallei on the basis of score values 2.601, 2.099, 2.362 and 2.047. The other four isolates had been biochemically suspected but not supported by both the PCRs were also identified by MALDI-TOF spectrum analysis as Cupriavidus necator and Enterobacter cloacae with score value of 2.112, 2.122 and 2.341, 2.241 respectively, confirming the results of the 16S analysis.. The isolation of B. pseudomallei from soil is very complex as the presence of large numbers of closely related soil microflora interferes with its recovery although use of Ashdown broth and agar for the isolation of B. pseudomallei from soil samples ...
3-hydroxybutyric acid) (PHB) is the most commonly produced polyhydroxyalkanoate formed naturally inside many genera of bacteria and archaea when nutrients are limited and a carbon-source is available in excess. These water-insoluble biopolyester spherical beads in the size range of 20-800 nm can be recombinantly produced by insertion of the required PHB biosynthesis genes into alternative bacterial hosts and then culturing the organisms under suitable conditions. A gene fusion can also be made to enable production of PHB beads which display the selected proteins abundantly at the surface of the bead. Vaccines are needed which stimulate cell-mediated immunity and are effective at reducing intracellular infections such as tuberculosis, neosporosis and many viral infections. These diseases are responsible for a huge burden to human and animal health. Particulate vaccines target antigen presenting cells and cellular immune responses to protein antigens are enhanced when particulate vaccines are ...
Supplier of Metals, Alloys, Ceramics, Polymers, Compounds, Intermetallics & Composites for research & industrial markets. View our small quantity catalog.
putative poly(3-hydroxybutyrate) depolymerase [polyhydroxybutyrate depolymerase] ATGCAGCCGCCGCCGTTCCGGGGAATCCTCACCCCGCTGTTCCCCCTCTCCTCCTCGCCG CCGGTCGGGTCGTTGTCGCGTCCGGGACGGCGGGGGGTGCTCACCCGTCTCGTGGCCGTC GTGGCCCTCGTACTCGGAGCGGCCCTGCTCGGCCCGGCGCCGACGGCCCACGCCGCGGCG GGCCTGGCCAAGCCCGGTCTGACCAAGGCGGACCTGACCGAGGTCGCGGACTTCGGCACG AACCCGGGCCGGCTGAACATGTACGTCTACCGGCCCGCGTCCCTGCCCGCGGAGCCGGCG GTGGTGTTCGCCCTGCACGGTTGCACCCAGGACGCCCAGGGCTACGCCGACAACTCCGGC CTGCTCTCATTCGCGGACCGCTATGGCTTCCTGCTCGTGTTCGCCGAGACCACGTCGTCG AACAACGCGAACAGGTGCTTCAACTGGTTCCAGAGCAGCGACAACCGCAGGGGCCAGGGC GAAGCCGCGTCGATCCGGCAGATGGCCGCTCACACCGTCTCCGCCTACGGCGCGGACCCC CAGCGCACCTACATCACCGGGCTGTCCGCCGGCGGTGCCATGACGTCGGTGATGCTCGCC ACCTATCCGGACGTCTTCCAGGCCGGCGCGGTCGTCGCCGGCCTGCCCTTCGGCTGTGCC ACCGACGTCAGCAGCGCGTACCTGTGCATGAACCCCGGGACCGACCTGACCGCGGACCAG TGGGCGCGGCGGGTCCGTGACGGCTACCCCTCGTGGTCGGGCCCGTGGCCGCGCGTGGCC ATCTGGCACGGCGACAAGGACACCACCGTCGCGCCGCGCAACGCCGACGAGTTGCGCGAC CAGTGGACCGCTGTGCACGGCGTGTCCCAGACGCCGGACCGTACCTCGGTGATCGGCCCG ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Hyperthermophilic, sulfur-metabolizing organism. Cells are irregular spheres with a glycoprotein envelope and monopolar flagella. They grow between 60 and 95 degrees Celsius but their optimum is 83 degrees Celsius. They can be either organoheterotrophic using a variety of carbon and energy sources or they can also be lithoautotrophic using hydrogen, thiosulphate and carbon dioxide. (HAMAP: ARCFU ...
Cupriavidus sp. strain AMP6 is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from a root nodule of Mimosa asperata collected in Santa Ana National Wildlife Refuge, Texas, in 2005. Mimosa asperata is the only legume described so far to exclusively associates with Cupriavidus symbionts. Furthermore, strain AMP6 represents an early-diverging lineage within the symbiotic Cupriavidus group and has the capacity to develop an effective nitrogen-fixing symbiosis with three other species of Mimosa. Here, we describe the genome of Cupriavidus sp. strain AMP6 which enables comparative analyses of symbiotic trait evolution in this genus; the general features, together with sequence and annotation are further discussed. Finally, the 7,579,563 bp high-quality permanent draft genome is arranged in 260 scaffolds of 262 contigs, contains 7,033 protein-coding genes and 97 RNA-only encoding genes, and is part of the GEBA-RNB project proposal. ...
Polyhydroxybutyrate (PHB) is one of the polyhydroxyalkanoates (PHAs) which has biodegradable and biocompatible properties. They are adopted in the biomedical field, in, for example, medical implants and drug delivery carriers. This study seeks to promote the production of PHB by Vibrio sp. BM-1, isolated from a marine environment by improving constituents of medium and implementing an appropriate fermentation strategy. This study successfully developed a glycerol-yeast extract-tryptone (GYT) medium that can facilitate the growth of Vibrio sp. BM-1 and lead to the production of 1.4 g/L PHB at 20 h cultivation. This study also shows that 1.57 g/L PHB concentration and 16% PHB content were achieved, respectively, when Vibrio sp. BM-1 was cultivated with MS-GYT medium (mineral salts-supplemented GYT medium) for 12 h. Both cell dry weight (CDW) and residual CDW remained constant at around 8.2 g/L and 8.0 g/L after the 12 h of cultivation, until the end of the experiment. However, both 16% of PHB content and
Cupriavidus metallidurans ATCC ® 43123D-5™ Designation: Genomic DNA from Cupriavidus metallidurans strain CH34 TypeStrain=True Application:
We use cookies to enhance your experience on our website. By continuing to use our website, you are agreeing to our use of cookies. You can change your cookie settings at any time.Find out more ...
Shop Beta-ketothiolase ELISA Kit, Recombinant Protein and Beta-ketothiolase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
TEAM USU BACKGROUND Utah State University is proud to be involved in the 2008 iGEM competition for its first year. The 2008 USU iGEM team consists of graduate, undergraduate, and high school students with varying levels of experience in genetic and biological engineering under the supervision of faculty with backgrounds in Biological Engineering, Electrical Engineering, Biology, and Microbiology. Though many project topics were seriously discussed, the team chose to study a method of monitoring Polyhydroxybutyrate production in microorganisms by inserting a reporter in the PHB cassette. This project was selected because of its potential to make the PHB production process more efficient and cost effective by creating a simple system for determining the optimum time for PHB extraction. ...
PHA research has increased in an effort to understand its potential, as well as to counteract some of the issues preventing its widespread use. Because of its high cost, PHB has been used mostly for specialized medical applications, including bone fixation, drug delivery systems and degradable sutures (Knowles, 1993: Kose, 2004; Holmes, 1985: Chen, 2005), and less for commercial packaging. High expense is the primary factor preventing industrial scale PHB production and commercialization. A low estimate for the cost of PHB production is $3-5/kg PHB versus $1/kg petroleum-based plastics (Choi, 1997). Some of the factors that contribute to this cost difference are reactor operation, substrate costs, and the extraction and downstream processing procedures (Coats 2005). There are many techniques that have been researched, or are currently being researched, to eliminate some of these major costs. Production methods for PHB involve the use of recombinant microorganisms, crops of transgenic PHB ...
The JMP Learning Subscription provides unlimited access to all JMP e-Learning in a monthly or annual subscription. Learn how to:|br||ul||li|use JMP for data analysis and visualization, including bringing data in from various sources, manipulating data, and creating new variables, as well as creating and sharing JMP reports with other people|li|use statistical analysis to make decisions through the use of hypothesis testing, t tests, analysis of variance, regression analysis, and analysis of covariance|li|properly design and analyze an experiment through either classical methods or by using custom design in JMP. Use the designed experiment to identify important factors, predict responses, incorporate hard-to-change factors, evaluate and compare different designs, and optimize processes.|/ul||p|The curriculum includes the following courses:|br||ul||li||a href=http://support.sas.com/edu/schedules.html?ctry=ae&crs=JDEX|JMP Software: A Case Study Approach to Data Exploration|/a||li||a href=http://support
Large-scale production and purification of recombinant proteins by cell cultures represent a key-area in manufacturing field. The production process still has several drawbacks affecting cost/efficiency. In this work, three modular systems were designed to overcome some of these bottlenecks. A library of self-inducible promoters was built and characterized to start the peptide production at a desired culture density, without expensive inducer molecules. Two standard integrative vectors were realized to insert BioBrick parts in user-defined positions of E. coli or S. cerevisiae genome, to ensure genetic stability without using selection markers. Finally, two promising techniques were combined for an "in-cell" protein purification: PolyHydroxyAlkanoate (PHA) granules were used as a substrate for PHA-binding peptides (Phasins) fused to the target protein, thus replacing affinity resins/columns and tags, while a pH-based self-cleaving peptide (Intein) was used instead of a protease cleavage site. ...
Large-scale production and purification of recombinant proteins by cell cultures represent a key-area in manufacturing field. The production process still has several drawbacks affecting cost/efficiency. In this work, three modular systems were designed to overcome some of these bottlenecks. A library of self-inducible promoters was built and characterized to start the peptide production at a desired culture density, without expensive inducer molecules. Two standard integrative vectors were realized to insert BioBrick parts in user-defined positions of E. coli or S. cerevisiae genome, to ensure genetic stability without using selection markers. Finally, two promising techniques were combined for an "in-cell" protein purification: PolyHydroxyAlkanoate (PHA) granules were used as a substrate for PHA-binding peptides (Phasins) fused to the target protein, thus replacing affinity resins/columns and tags, while a pH-based self-cleaving peptide (Intein) was used instead of a protease cleavage site. ...
JMP Genomics software from SAS provides a suite of comprehensive tools for dynamic exploration and analysis of data from traditional microarray studies or summarized data from second-generation sequencing platforms. Its unique pedigree combines the JMP statistical discovery platform with industry-leading SAS® Analytics tailored for processing large genomics data sets. With release 4.1, JMP Genomics adds a 64-bit edition, new import and expression analysis features, enhanced genome visualization capabilities and more. This white paper describes the new and enhanced tools. ...
JMP Genomics software from SAS provides a suite of comprehensive tools for dynamic exploration and analysis of data from traditional microarray studies or summarized data from second-generation sequencing platforms. Its unique pedigree combines the JMP statistical discovery platform with industry-leading SAS® Analytics tailored for processing large genomics data sets. With release 4.1, JMP Genomics adds a 64-bit edition, new import and expression analysis features, enhanced genome visualization capabilities and more. This white paper describes the new and enhanced tools. ...
PHAP Polyclonal Antibody from Invitrogen for Western Blot, Immunofluorescence and Immunocytochemistry applications. This antibody reacts with Bovine, Human, Mouse, Rat samples. Supplied as 50 µg purified antibody in PBS with 0.02% sodium azide; pH 7.4.
JMP Marine Replacement Engine Cooling Raw Water / Seawater Pump #JPR-VP0130D. Replaces Volvo Penta 22905150, 3886848. D13 Series Engine Models D13B, D13C, D13C1-A MP, D13C2-A MP, D13C3-A MP, D13C4-A MP
BRISBANE, Calif., June 18, 2014 (GLOBE NEWSWIRE) -- Hyperion Therapeutics (Nasdaq:HPTX) today announced that the company is scheduled to present at the JMP Healthcare Conference on Tuesday, June 24, 2014, at 2:00 p.m. ET.
مقدمه: فیتاز، فیتیک‌اسید را هیدرولیز می‌کند و دسترسی زیستی فسفر و دیگر مواد معدنی مغذی را برای حیوانات تک‌معده‌ای افزایش می‌دهد.بنابراین، به‌شکل افزودنی غذایی مهم استفاده می‌شود. مواد و روش‏‏ها: هدف مطالعه حاضر، جداسازی باکتری‌‌های تولیدکننده فیتاز از مزرعه لوبیای شوشتر، جنوب‌غرب ایران، با استفاده از محیط غربال‌گری فیتاز (PSM) و بهینه‌سازی رشد و شرایط تولید آنزیم با بهترین جدایه است. نتایج: بهترین جدایه، سیتروباکتر فارمری سویه phas32 شناسایی شد. دمای 30 درجه سانتی‌گراد، اسیدیته 7، 25/0 درصد فیتیک‌اسید و 48 ساعت انکوباسیون، شرایط بهینه‌سازی‌شده برای
Platekompaniet - For å gi deg en bedre opplevelse av nettbutikken bruker Platekompaniet cookies. I innstillingene til din nettleser kan du selv velge å slette informasjonskapsler ...
View Notes - ia-32_instruction-set-ref_a-m from CPE 103 at Mississippi State. JMP--Jump 64-Bit Mode Valid N.S. Compat/ Leg Mode Valid Valid Opcode EB cb E9 cw Instruction JMP rel8 JMP rel16 E9 cd FF
This one-day-training covers the topics reliability- and survivaltime-analysis. Students will get an introduction to the basic concepts of probability calculation and
aang - koleksi berkas untuk download: Cannibal Feast [Goregrind], Pathology [Brutal], AGENT 0 [Brutal], Abated Mass of Flesh [Brutal], Kraanium [Slam]
A method for controlling and modifying biopolymer synthesis by manipulation of the genetics and enzymology of synthesis of polyhydroxybutyrate (PHB) and polyhydroxyalkanoate (PHA) polyesters at the molecular level in procaryotic and eukaryotic cells, especially plants. Examples demonstrate the isolation, characterization, and expression of the genes involved in the production of PHB and PHA polymers. Genes encoding the enzymes in the PHB and PHA synthetic pathway (beta-ketothiolase, acetoacetyl-CoA reductase and PHB polymerass or PHA polymerase) from Zoogloea ramigera strain I-16-M, Alcaligenes eutrophus, Nocardia salmonicolur, and P. olevorans were identified or isolated and expressed in a non-PHB producing organism, E. coli. Specific modifications to the polymers include variation in the chain length of the polymers and incorporation of different monomers into the polymers to produce co-polymers with different physical properties.
The physiology of the environmental bacterium Cupriavidus metallidurans CH34 (previously Ralstonia metallidurans) is being studied in comparison to the clinical model bacterium Escherichia coli in order to understand its behaviour and resistance under extreme conditions (e.g. space biology). In order to estimate physiological changes associated with pH stress, flow cytometry was employed to estimate the extent of damage on cell size, membrane integrity and potential and production of superoxides in the two bacterial strains. C. metallidurans and E. coli were submitted to a pH stress. C. metallidurans cells exhibited a different staining intensity than E. coli cells. For both bacterial strains, the physiological status was only slightly affected between pH 6 and 8 in comparison with pH 7 which represents the reference pH. Moderate physiological damage could be observed at pH 4 and 5 as well as at pH 9 in both strains. At pH 2, 10 and 12, membrane permeability and potential, esterase activity, ...
In the present study, nickel and iron (Ni/Fe) bimetallic nanoparticles (Ni-Fe NPs) were produced in the presence of activated carbon (AC) to prepare supported Ni/Fe bimetallic nanoparticles (Ni-Fe NPs/AC). The NPs were modified using cetylpyridinium chloride and used for the simultaneous adsorption and degradation of perchlorate. Synthesized Ni-Fe NPs/AC was characterized using FE-SEM, EDS, and XRD. The influential factors in the removal of perchlorate by Ni-Fe NPs/AC were optimized based on experimental design. According to the results, adsorption and degradation efficiencies were 96.98% and 78.81%, respectively, which could be achieved to the efficiency of nearly 100% by increasing the process time to 110 minutes. Reaction kinetics complied with the pseudo-first-order characteristics. Moreover, the rate constant of adsorption and degradation were estimated at 0.0848 and 0.0199 min-1 at 303 K, and the activation energy for adsorption and degradation was 42.39 and 12.47 kJ/mol, respectively. The
de Eugenio, L.I., García, P., Luengo, J.M., Sanz, J., San Román, J., García, J.L., and Prieto, M.A. (2007) Biochemical evidence that phaZ gene encodes a specific intracellular medium chain length polyhydroxyalkanoate depolymerase in Pseudomonas putida KT2442: characterization of a paradigmatic enzyme. J Biol Chem 282: 4951-4962 ...
That faint whirring sound you hear is every alchemist spinning in his grave. Scientists have discovered bacteria that eats toxic material and, well, po ...
We have used JMP extensively, and find it very useful. the academic price is quite reasonable. Unfortunately, I had to let my JMP expert go, due to a lack of funding... Marty On 8/2/06, Xiaowei JIANG ,xiaowei.jiang at msn.com, wrote: , , Dear all, , , Does anyone has the experience using JMP Genomics toolkit, if so, what do , you think of this environment specificly according to your experience? , , I am currently writing a case study report for this new platform. , , Thank you in advance. , , For more information please refer to , http://www.jmp.com/software/genomics/index.shtml , , , , Best regards, , Xiaowei JIANG , ---------------------------------------- , University Center for Statistics , Faculty of Science , Katholieke Universiteit Leuven,Belgium , ucs.kuleuven.be , ---------------------------------------- , MSc Statistics/Mathematics 2005-2006 , MSc Bioinformatics, BEng Computer Science , ---------------------------------------- , ...
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
NC Birth (n = 10,000).JMP - a datafile containing a random sample of n = 10,000 mothers and infants born in North Carolina in 2006.. NC Birth Data Description - this Word document contains variable descriptions and coding information for the NC Birth (n = 10000).JMP data file above.. OC-Age-MI.JMP - Oral contraceptive and myocardial infarction data.. Coffee-MI.JMP - Heavy coffee drinking and myocardial infarction data.. Chest Pain - Vessels.JMP - Chest pain and the number of diseased vessels.. ICU.JMP - ICU patient survival study. ...
The ACAT1 gene is associated with autosomal recessive beta-ketothiolase deficiency (aka mitochondrial acetoacetyl-CoA thiolase deficiency) (MedGen UID: 280689).
With the wide variety of food, chances are you'll want to give your dog something special, too. If you're contemplating what to feed your dog for the holiday, here is a guide to a great Canine Thanksgiving Feast.
This year, Bon Appétit will fete its fourth edition of Feast or Fashion, which will begin Thursday with the Hot 10 party at Gotham West Market.
Hematuria is the term for the presence of blood in the urine. Normally there is only a trace amount of blood in urine although there is a high quantity of the pigment deposits and other components present from [Read More ...] ...
rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:bibo="http://purl.org/ontology/bibo/" xmlns:dspace="http://digital-repositories.org/ontologies/dspace/0.1.0#" xmlns:foaf="http://xmlns.com/foaf/0.1/" xmlns:void="http://rdfs.org/ns/void#" xmlns:xsd="http://www.w3.org/2001/XMLSchema#" , ,rdf:Description rdf:about="https://kops.uni-konstanz.de/rdf/resource/123456789/8572", ,dcterms:isPartOf rdf:resource="https://kops.uni-konstanz.de/rdf/resource/123456789/28"/, ,dcterms:abstract xml:lang="deu",Ilyobacter delafieldii produced an extracellular poly-[3-hydroxybutyrate (PHB) depolymerase when grown on PHB; activity was not detected in cultures grown on 3-hydroxybutyrate, crotonate, pyruvate or lactate. PHB depolymerase activity was largely associated with the PHB granules (supplied as growth substrate), and only 16 % was detected free in the culture supernatant. Monomeric 3-hydroxybutyrate was ...
Transcription of the hupSL genes, which encode the uptake [NiFe]hydrogenase of Rhodobacter capsulatus, is specifically activated by H2. Three proteins are involved, namely the H2-sensor HupUV, the histidine kinase HupT and the transcriptional activator HupR. hupT and hupUV mutants have the same phenotype, i.e. an increased level of hupSL expression (assayed by phupS::lacZ fusion) in the absence of H2; they negatively control hupSL gene expression. HupT can autophosphorylate its conserved His217, and in vitro phosphotransfer to Asp54 of its cognate response regulator, HupR, was demonstrated. The non-phosphorylated form of HupR binds to an enhancer site (5′-TTG-N5-CAA) of phupS localized at −162/−152 nt and requires integration host factor to activate fully hupSL transcription. HupUV is an O2-insensitive [NiFe]hydrogenase, which interacts with HupT to regulate the phosphorylation state of HupT in response to H2 availability. The N-terminal domain of HupT, encompassing the PAS domain, is ...
A novel poly-3-hydroxybutyrate depolymerase was identified in Azotobacter vinelandii. This enzyme, now designated PhbZ1, is associated to the poly-3-hydroxybutyrate (PHB) granules and when expressed...
With an annual worldwide production exceeding 1,000,000 tons, steroid drugs are the second most marketed medical agents next to antibiotics [32]. The biotechnological steroid production is one of the best examples of the successful combination of microbial conversions and chemical reaction steps [1], since some specific modifications of the steroid skeleton cannot be performed by the latter. Examples of such reactions are stereo- and regioselective hydroxylations, dehydrogenations, and the steroid side-chain cleavage presented in this paper. Although there are many microorganisms of different taxa, which are able to convert cholesterol or phytosterols to androstenedione, androstadienedione or other C19-steroids, the efficient microbial conversion of these substrates to pregnenolone has not been described so far [33, 34]. The most abundant steroid in vertebrates, cholesterol, can be obtained in huge amounts by extraction of wool grease or bovine spinal cords [35].. In this study we developed a ...
In general as far as I know customers who bought Fancy Feast Chunky Chicken Feast (24/3-oz cans) or other products in the Internet also were interested in reviews, cheap & lowest prices in outlets and stores, shipping, gift ideas, city deals, sales, coupons online, new, holiday & daily deals, bargain, best buy products including special offers on Fancy Feast Chunky Chicken Feast (24/3-oz cans), best deals, discount coupons, top & hot deals, great offers, last minute deals and so on ...
the royal feast manufacturers and the royal feast suppliers Directory - Find the royal feast products,Choose Quality the royal feast manufacturers, suppliers, factory at ECBAY
This report updates information previously published regarding contamination of Vapotherm® respiratory gas administration devices (Vapotherm, Inc., Stevensville, Maryland) with Ralstonia spp. (1,2). The Food and Drug Administration (FDA) has issued an updated Preliminary Public Health Notification, advising health-care providers to use alternative devices until the source of the contamination has been identified.* CDC continues to receive information regarding Ralstonia spp. associated with Vapotherm use. Twenty-nine institutions in 16 states have reported recovery of Ralstonia spp. from Vapotherm devices and from approximately 40 pediatric patients. The majority of these cases appear to represent colonization, although one infection has been reported to CDC and other cases remain under investigation. In addition, the recommended disinfecting protocol has reportedly failed to eradicate Ralstonia spp. in three separate tests. Based on pulsed field gel electrophoresis analysis, isolates from ...
Ralstonia insidiosa ATCC ® 49129™ Designation: AmMS 155 TypeStrain=False Application: Quality control strain for MicroScan [Reg TM] products
Obeso C. G., Sousa M. P., Song W. L., Rodriguez-Perez M. A., Bhushan B., and Mano J. F., Modification of paper using polyhydroxybutyrate to obtain biomimetic superhydrophobic substrates, COLLOIDS AND SURFACES A-PHYSICOCHEMICAL AND ENGINEERING ASPECTS, vol. 416, pp. 51-55, doi:10.1016/j.colsurfa.2012.09.052, 2013. ...
http://i163.photobucket.com/albums/t289/controlledlabs/GoldFeast_HRweb.jpg What is Gold Feast ? When will Gold Feast be available in stores ? December, 2011 on most websites and about 6 weeks later in stores What flavor is Gold Feast ?
Gentaur molecular products has all kinds of products like :search , Zyagen \ PHAP Rabbit Polyclonal Antibody \ APO-3152 for more molecular products just contact us
Looking for TCI AMERICAS Ethyl (s)-4-Chloro-3-hydroxyButyrate,5g (29MA39)? Graingers got your back. Price:$196.00. Easy ordering & convenient delivery. Log-in or register for your pricing.
Create an InsideTracker-approved feast for your family. These recipes will ensure youve had your fill without making you wish you hadnt.
This course is for JMP users who work with data that have many variables. The course demonstrates various ways to examine high-dimensional data in fewer dimensions, as well as patterns that exist in the data. Methods for unsupervised learning are presented in which relationships between the observations, as well as relationships between the variables, are uncovered. The course also demonstrates various ways of performing supervised learning where the relationships among both the output variables and the input variables are considered. In the course, emphasis is on understanding the results of the analysis and presenting conclusions with graphs.
On Wednesday, June 21, 2017, Cardiovascular Systems (NASDAQ: CSII) Chief Financial Officer, Larry Betterley, will present at the JMP Securities Life
Find Phar Llc located at 280 S Beverly Dr Ste 505, Beverly Hills, California, 90212. Contact 3108589550. Ratings, reviews, hours, phone number and directions from ChamberofCommerce.com
Shop weekly with the endless delights of Borough Market and learn how to cook fresh seasonal produce from recipes for british food
As evening approached, I observed a number of Silver Eyes zipping around a Liquid Amber.. These birds would stop momentarily to collect food on the smaller branches.. On closer inspection I was able to determine that they were in fact collecting aphids. ...
Sex is like lot like pizza- no matter how bad it is its still pretty good. But the thing with sex is that everyone thinks they are the greatest lover, but sex is also like […]
Sex is like lot like pizza- no matter how bad it is its still pretty good. But the thing with sex is that everyone thinks they are the greatest lover, but sex is also like […]
Stratégiai játék, de kicsit másképp! A Feast For Odin a vikingek életének egy másik igen erős aspektusát mutatja be a játék. Az étkezést. A cél, hogy ...
Youre about to hit the gym - should you eat now or save it for a post-workout feast? Heres what you need to know about fuelling and refuelling your body.
Frolicsome flag directs hungry guests right to the chow line. Bold, bright and ever-so-right for your next outdoor feast! Pole not included. 100%
SIRIM consortium researchers developed the process technology in 2006 to produce polyhydroxyalkanoates (PHA) polyesters from palm oil wastes. (Image courtesy of SIRIM Berhad.)
Sigma-Aldrich offers Aldrich-460524, Ethyl (S)-(−)-4-chloro-3-hydroxybutyrate for your research needs. Find product specific information including CAS, MSDS, protocols and references.
See an archive of all feast of the seven fishes stories published on the New York Media network, which includes NYMag, The Cut, Vulture, and Grub Street.
THE FEAST of THE 7 FISH Is a Cherished Italian-American Christmas Tradition Brought to Life In Danile Bellino-Zwickes Book THE FEAST of THE 7 FISH; RECIPES And STORIES of The Great Italian Ritual "La VIGILIA" The Feast of Seven Fishes ... Available on AMAZON.com inPaperback & Kindle Editions. The Feast of 7 Fish ...
Its time to get ready for the final few weeks before Feast of Blades and Casey asks for your help at this critical final hurdle! See if you can help him out whether youre a Tournament veteran or not.
THE FEAST of THE 7 FISH Is a Cherished Italian-American Christmas Tradition Brought to Life In Danile Bellino-Zwickes Book THE FEAST of THE 7 FISH; RECIPES And STORIES of The Great Italian Ritual "La VIGILIA" The Feast of Seven Fishes ... Available on AMAZON.com inPaperback & Kindle Editions. The Feast of 7 Fish ...
... See more Stock market recommendations, Upgrades and Downgrades at GainersToday.com.
Chapter 9 Loglinear Variance Models Model the Variance and the Mean of the Response About Loglinear Variance Models The Loglinear Variance personality of the Fit Model platform enables you to … - Selection from JMP 11 Fitting Linear Models [Book]
13 MP Dual, f/2.0, laser & phase detection autofocus, Dual-LED flash, Geo-tagging, touch focus, face detection, HDR, panorama, Video, 2ndry 8 MP, f/2.2, 1.4 µm pixel size, ...
Can you name the Phar 401 Druglist Test your knowledge on this science quiz to see how you do and compare your score to others. Quiz by mpchiang
In the coming months, lots of us will be looking at all areas of our life to help protect our own bodies. The overall function of the immune system is to prevent or limit infection. The immune system is good at differentiating between normal healthy cells and unhealthy ones. Infectious microbes release signals that the immune system recognises causing a response to deal with the problem. Infection arises when the bugs get ahead of the immune system. When it comes to nutrition, there are some areas that you could focus on in a bid to better support your immune system.
How is 2,4-Dichlorophenoxyacetic Acid abbreviated? 24-D stands for 2,4-Dichlorophenoxyacetic Acid. 24-D is defined as 2,4-Dichlorophenoxyacetic Acid frequently.
Direct isolation of Ralstonia solanacearum can be obtained from plant ooze and exudates. The infected stems and/or petioles are cut using a sterile sharp knife or razor blade. If bacterial ooze does not actively appear, the plant material is squeezed between two fingers. A suspension of the ooze is prepared in sterile distilled water and then streaked onto either TZC or SPA plates. Pure cultures are usually easily isolated (4). R. solanacearum can also be isolated from water and soil using a modified Kelmans TZC medium (4). Isolates of R. solanacearum rapidly lose virulence when maintained on laboratory media; however, the organism can easily be maintained for years in sterile distilled water or on agar slants covered with sterile mineral oil and stored at room temperature (7 ...
This document explains the procedure for screening soils and aqueous matrices to determine whether 2,4-dichlorophenoxyacetic acid (2,4-D) [Chemical Abstracts Service (CAS) Registry 94-75-7] is likely to be present.. You may need Adobe Reader to view files on this page. See EPAs About PDF page to learn more. ...
... including Cupriavidus necator and Alcaligenes latus (PHB).. *mcl-PHA from hydroxy fatty acids with medium chain lengths ... Cuprividus necator). Specific types of PHAs include poly-3-hydroxybutyrate (PHB), polyhydroxyvalerate (PHV) and ...
PHB is produced by microorganisms (such as Cupriavidus necator, Methylobacterium rhodesianum or Bacillus megaterium) apparently ...
... system from Pseudomonas putida for orthogonal gene expression control in Escherichia coli and Cupriavidus necator". Scientific ...
These include 4-toluene sulfonate which may be transported by the TsaS of Cupriavidus necator (TC# 2.A.102.1.1), sulfolactate ... Weinitschke, S; Denger, K; Cook, AM; Smits, TH (September 2007). "The DUF81 protein TauE in Cupriavidus necator H16, a sulfite ... Weinitschke, S; Denger, K; Cook, AM; Smits, TH (September 2007). "The DUF81 protein TauE in Cupriavidus necator H16, a sulfite ... Cysteate-nitrogen assimilation by Cupriavidus necator H16 with excretion of 3-sulfolactate: a patchwork pathway". Archives of ...
"Sulfoacetate is degraded via a novel pathway involving sulfoacetyl-CoA and sulfoacetaldehyde in Cupriavidus necator H16". J. ...
"Production of poly-3-hydroxybutyrate by Cupriavidus necator fromcorn syrup: statisticalmodeling and optimization of biomass ...
... moved into the Cupriavidus genus after 16S rRNA gene sequencing revealed it to be most closely related to Cupriavidus necator. ... Cupriavidus gilardii is a Gram-negative, aerobic, motile, oxidase-positive bacterium from the genus Cupriavidus and the family ... "Cupriavidus necator gen. nov., sp. nov.: a nonobligate bacterial predator of bacteria in soil". Int J Syst Bacteriol. 37: 323- ... Cupriavidus gilardii may be resistant to multiple antibiotic agents; carbapenem-resistant C. gilardii has been found in stool ...
... is a Gram-negative soil bacterium of the Betaproteobacteria class. Cupriavidus necator has gone through a ... To better characterize the lifestyle of C. necator, the genomes of two strains have been sequenced. Cupriavidus necator can use ... necator. Because C. necator was named in 1987 far before the name change to R. eutropha and W. eutropha, the name C. necator ... Cupriavidus necator is a hydrogen-oxidizing bacterium ("knallgas" bacterium) capable of growing at the interface of anaerobic ...
To produce PHA, a culture of a micro-organism such as Cupriavidus necator is placed in a suitable medium and fed appropriate ... including Cupriavidus necator and Alcaligenes latus (PHB). Poly (HA MCL) from hydroxy fatty acids with medium chain lengths ...
Cupriavidus species, including C. metallidurans, are well characterised in the field of microbe-metal interactions, and are ... Both the species C. necator and C. metallidurans (when not distinguished as separate species) were originally classified in the ... Vandamme, Peter; Coenye, Tom (2004-11-01). "Taxonomy of the genus Cupriavidus: a tale of lost and found". International Journal ... metal transporting P1-type ATPases and a chemiosmotic antiporter efflux system similar to CzcCBA of Cupriavidus metallidurans. ...
It is also found in the NorA protein from Cupriavidus necator, this protein is a regulator of response to nitric oxide, which ...
"An analysis of the changes in soluble hydrogenase and global gene expression in Cupriavidus necator ( Ralstonia eutropha ) H16 ...
Hydrogen-oxidizing organisms, such as Cupriavidus necator (formerly Ralstonia eutropha), often inhabit oxic-anoxic interfaces ...
Cupriavidus necator NH9, a 3-chlorobenzoate (3-CB)-degrading bacterium, was isolated from soil in Japan. In this study, the ... Cupriavidus necator NH9, a 3-chlorobenzoate (3-CB)-degrading bacterium, was isolated from soil in Japan. In this study, the ... Complete genome sequence of 3-chlorobenzoate-degrading bacterium Cupriavidus necator NH9 and reclassification of the strains of ... of 3-chlorobenzoate-degrading bacterium Cupriavidus necator NH9 and reclassification of the strains of the genera cupriavidus ...
Cupriavidus necator N-1 chromosome 2, complete sequence. DNA ligase Lig. 9e-07. 56.2. ...
Cupriavidus necator N-1 plasmid BB2p, complete sequence. inner-membrane translocator. 2e-14. 80.1. ... Cupriavidus necator N-1 plasmid BB1p, complete sequence. ABC transporter permease. 7e-12. 72. ...
2010) and nitrophenol degradation in Cupriavidus necator Jmp134(Yin and Zhou 2010). Type II dioxygenases consist of two ... a Hydroquinone Dioxygenase Likely Involved in the meta-Nitrophenol Degradation by Cupriavidus necator JMP134. Current ...
Functions of Flavin Reductase and Quinone Reductase in 2,4,6-Trichlorophenol Degradation by Cupriavidus necator JMP134 Sara Mae ...
Cupriavidus necator H16 and its transformed mutant, C. necator PHB¯4 harboring the PHA synthase gene of Aeromonas caviae (PHB¯4 ... Biosynthesis of P(3HB-co-3HV-co-3HHp) terpolymer by Cupriavidus necator PHB4 transformant harboring the highly active PHA ... Aims: This study evaluates potentials of Cupriavidus necator PHB4 transformant harboring the highly active ... necator PHB¯4 was comparable, yielding a DCW of 22.3 g/L and P(3HB-co-3HHx) content of 85 wt%. Lipase activities for both ...
Wautersia eutropha use Cupriavidus necator Wave Wave Analyses, Pulse use Pulse Wave Analysis ...
Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337) (Ralstonia eutropha)Imported. Automatic assertion ... tr,Q0KDW9,Q0KDW9_CUPNH Hemolysin-coregulated protein OS=Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337) ... Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337) (Ralstonia eutropha) ... cellular organisms › Bacteria › Proteobacteria › Betaproteobacteria › Burkholderiales › Burkholderiaceae › Cupriavidus › ...
Wautersia use Cupriavidus Wautersia eutropha use Cupriavidus necator Wave WAVE Proteins use Wiskott-Aldrich Syndrome Protein ...
Acetates , Metabolism , Butyrates , Metabolism , Cupriavidus necator , Metabolism , Fermentation , Physiology , Lactates , ...
Cupriavidus necator (organism) {432717007 , SNOMED-CT } Cupriavidus oxalaticus (organism) {422535008 , SNOMED-CT } Cupriavidus ... Genus Cupriavidus (organism) {416121002 , SNOMED-CT } Parent/Child (Relationship Type) Cupriavidus basilensis (organism) { ... Cupriavidus gilardii (organism) {416329005 , SNOMED-CT } Cupriavidus metallidurans (organism) {423135006 , SNOMED-CT } ... Cupriavidus respiraculi (organism) {416495009 , SNOMED-CT } Cupriavidus taiwanensis (organism) {417659003 , SNOMED-CT } ...
Production of poly(3-hydroxybutyrate) by Cupriavidus Necator in hydrolyzed rice starch medium with soybean oil supplementation ...
disulfide bonds; NAD (coenzyme); metabolism; energy; proteins; monitoring; enzymes; Cupriavidus necator; acids; carbon; genes; ...
Cupriavidus necator/metabolismo , Expressão Gênica , Proteínas de Bactérias/genética , Chaperoninas/genética , Cupriavidus ... We previously reported a metabolic engineering strategy to develop an isopropanol producing strain of Cupriavidus necator ... Over expression of GroESL in Cupriavidus necator for heterotrophic and autotrophic isopropanol production. ... necator. Native groEL and groES genes from C. necator were over-expressed in a strain deleted for PHA synthesis. We ...
Wautersia use Cupriavidus Wautersia eutropha use Cupriavidus necator Wave WAVE Proteins use Wiskott-Aldrich Syndrome Protein ...
... of β-ketothiolase gene from Clostridium acetobutylicum and acetoacetyl-CoA reductase gene from Cupriavidus necator which led to ... Use of another thiolase gene, the second thiolase from C. necator (bktB), which theoretically should induce production of PHBV ... To counteract the effect of loss of accumulation stability, phasin gene (phaP1), originated from C. necator, was introduce ... necator were chosen to combine with PHA synthase gene (phaC) for creating the PHB-V producing strain. The PHA synthase ...
Vias Biossintéticas/genética , Cupriavidus necator/genética , Cupriavidus necator/metabolismo , Hemiterpenos/biossíntese , ...
Anis SNS, Iqbal NM, Kumar S, Al-Ashraf A. Increased recovery and improved purity of PHA from recombinant Cupriavidus necator. ...
... of thermo-separating aqueous two-phase system in extractive bioconversion of polyhydroxyalkanoates by Cupriavidus necator H16. ...
Cupriavidus metallidurans CH34. 18. Tfc11. 339326882. Tfc. NC_015726. Cupriavidus necator N-1. ...
Cupriavidus necator, Cupriavidus necator H16 / ATCC 23440 / NCIB 10442 / S-10-1 ...
Pharmacological interference with vacuolar-type H(+)-ATPase (V-ATPase), a proton-translocating enzyme involved in protein transport and pH regulation of cell organelles, is considered a potential strategy for cancer therapy. Macrophages are critically involved in tumor progression and may occur as pro-tumoral M2 phenotype, whereas classically-activated M1 can inhibit tumor development for example by releasing tumor-suppressing molecules, including tumor necrosis factor (TNF)alpha. Here, we show that targeting V-ATPase by selective inhibitors such as archazolid upregulates the expression and secretion of TNFalpha in lipopolysaccharide (LPS)- or LPS/interferon (INF)gamma-activated M1-like macrophages derived from human blood monocytes. In contrast, archazolid failed to elevate TNFalpha production from uncommitted (M0) or interleukin (IL)-4-treated M2-like macrophages. Secretion of other relevant cytokines (i.e., IL-1beta, IL-6, IL-10) or chemokines (i.e. IL-8 and monocyte chemotactic protein-1) ...
Siderophore-Mediated Iron Acquisition Enhances Resistance to Oxidative and Aromatic Compound Stress in Cupriavidus necator ... Here, we identified a novel siderophore-producing gene cluster in C. necator JMP134. This gene cluster produces a previously... ...
Purification and characterisation of alliinase produced by Cupriavidus necator and its application for generation of cytotoxic ...
Functions of flavin reductase and quinone reductase in 2,4,6-trichlorophenol degradation by Cupriavidus necator JMP134 ...
  • The periplasmic nitrate reductase (NapAB) from Cupriavidus necator is a heterodimeric protein that belongs to the dimethyl sulfoxide reductase family of mononuclear Mo-containing enzymes and catalyzes the reduction of nitrate to nitrite. (nih.gov)
  • These include 4-toluene sulfonate which may be transported by the TsaS of Cupriavidus necator (TC# 2.A.102.1.1), sulfolactate which may be exported by the TauE protein of Cupriavidus necator (TC# 2.A.102.2.1) and sulfoacetate which may be exported by the SafE1 protein of Neptuniibacter caesariensis (TC# 2.A.102.2.2). (wikipedia.org)
  • Amongst a number of promising candidates for application in the oxidation of H 2 is a soluble [Ni-Fe] uptake hydrogenase (SH) produced by Cupriavidus necator H16. (peerj.com)
  • The PhD project will be aimed at engineering Cuprividus necator to produce diols such as 1,4-butanediol and 1,3-propanediol from carbohydrate sources and then ultimately using carbon dioxide and hydrogen as sole carbon and energy source. (sbrc-nottingham.ac.uk)
  • The region where these genes are located was likely acquired horizontally and exhibits similarity to other Hydrogenovibrio species ( H. thermophilus MA2-6 and H. marinus MH-110 T ) and other hydrogen oxidizing Proteobacteria ( Cupriavidus necator H16 and Ghiorsea bivora TAG-1 T ). The genomes of XCL-2 and SP-41 show a strong conservation in gene order. (biomedcentral.com)
  • Then, in the 1970s, Imperial Chemical Industries (ICI, UK) started producing PHAs by using a mutant stain Cupriavidus necator , NCIB 11599 from various carbon sources such as 1,4-butanediol, 1,6-hexanediol, and butyrolactone. (hindawi.com)
  • da Silva K, Florentino LA, da Silva KB, de Brandt E, Vandamme P, de Souza Moreira FM (2012) Cupriavidus necator isolates are able to fix nitrogen in symbiosis with different legume species. (springer.com)
  • Staining and quantification of poly-3-hydroxybutyrate in Saccharomyces cerevisiae and Cupriavidus necator cell populations using automated flow cytometry. (umn.edu)
  • Anaerobic poly-3-d-hydroxybutyrate production from xylose in recombinant Saccharomyces cerevisiae using a NADH-dependent acetoacetyl-CoA reductase - Descarga este documento en PDF. (duhnnae.com)
  • One goal of our research is to develop and optimize a method, using fluorescent proteins, for the detection of maximum product yield of polyhydroxybutyrate (PHB, a bioplastic) in recombinant E. coli and in Cupriavidus necator . (igem.org)
  • A P SH promoter-gfp fusion was successfully constructed and inducible GFP expression driven by the P SH promoter under de-repressing conditions in heterotrophic growth media was demonstrated in the recombinant C. necator H16 cells. (peerj.com)
  • ResultsIn this study the acetoacetyl-CoA reductase gene from C. necator CnAAR, a NADPH-dependent enzyme, was replaced by the NADH-dependent AAR gene from Allochromatium vinosum AvAAR in recombinant xylose-utilizing S. cerevisiae and PHB production was compared. (duhnnae.com)
  • 2019). The genetic basis of 3-hydroxypropanoate metabolism in Cupriavidus necator H16. (uni-bielefeld.de)
  • One such predator, Cupriavidus necator, was purported to degrade bacterial endospores. (smcm.edu)
  • Amirul AA, Yahya ARM, Sudesh K, Azizan MNM, Majid MIA (2008) Biosynthesis of poly(3-hydroxybutyrate- co -4-hydroxybutyrate) copolymer by Cupriavidus sp. (springer.com)
  • Cupriavidus necator NH9, a 3-chlorobenzoate (3-CB)-degrading bacterium, was isolated from soil in Japan. (mendeley.com)
  • ConclusionsThis study reports a novel approach for boosting PHB accumulation in S. cerevisiae by replacement of the commonly used AAR from C. necator with the NADH-dependent alternative from A. vinosum. (duhnnae.com)
  • The results indicate that LW definitely acts as a 3HV precursor, but, at the same time, displays toxic effects on C. necator at concentrations exceeding 10 g/L. Based on these findings, PHA biosynthesis under controlled conditions was performed using a fed-batch feeding regime on a bioreactor scale. (mdpi.com)
  • Cells of Cupriavidus necator were grown on agar medium containing different concentrations of glucose (10-25 g/L) as a sole carbon source. (deepdyve.com)
  • Under heterotrophic growth conditions, the expression of [Ni-Fe] uptake hydrogenases in C. necator H16 is induced on poorly utilised carbon sources (e.g., glycerol). (peerj.com)
  • Trace amounts (100±5 μg) of dried C. necator cells were directly subjected to thermally assisted hydrolysis and methylation-gas chromatography (THM-GC) in the presence of tetramethylammonium hydroxide (TMAH). (deepdyve.com)
  • Here we report the first successful fluorescent reporter system to study P SH promoter activity in C. necator H16. (peerj.com)