AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and ProcessesTechnology, Industry, AgricultureInformation ScienceNamed GroupsHealth CareGeographicals
CoinfectionHIV InfectionsHepatitis CGB virus CFlaviviridae InfectionsHIVHepatitis BCD4 Lymphocyte CountHepacivirusAntiretroviral Therapy, Highly ActiveAIDS-Related Opportunistic InfectionsViral LoadHIV-1Hookworm InfectionsAntiviral AgentsHepatitis C, ChronicAnti-HIV AgentsRNA, ViralHepatitis, Viral, HumanDNA, ViralTuberculosisHTLV-II InfectionsEhrlichiosisGlossitis, Benign MigratoryInfluenzavirus BHelminthiasisPrevalenceInfluenzavirus ABabesia microtiSchistosomiasis mansoniPrimate DiseasesRibavirinVirus ReplicationSuperinfectionPolymerase Chain ReactionMansonellaHelicobacter felisBabesiosisLiver CirrhosisHTLV-I InfectionsSubstance Abuse, IntravenousSchistosoma mansoniHepatitis DDependovirusHepatitis B virusComorbidityHepatitis B, ChronicMansonelliasisDNA Virus InfectionsAnti-Retroviral AgentsHepatitis B Surface AntigensNematospiroides dubiusSimian foamy virusParvoviridae InfectionsHelminthsFlaviviridaeGenotypeAntitubercular AgentsHerpesvirus 6, HumanLactate dehydrogenase-elevating virusCohort StudiesHelminthiasis, AnimalMacaca nemestrinaInfectious Disease Incubation PeriodInterferon-alphaBacteriophage phi 6CD4-Positive T-LymphocytesLiver FailureHepatitis C AntibodiesMycobacterium tuberculosisBrazilHelper VirusesAdenoviruses, HumanRecombination, GeneticDisease ProgressionMolecular Sequence DataProtozoan InfectionsSimian immunodeficiency virusLyme DiseaseColobusRisk FactorsStrongyloidiasisStrongyloides stercoralisHIV SeropositivityTuberculosis, PulmonaryRoseolovirus InfectionsIxodesViral ProteinsAcquired Immunodeficiency SyndromeDrug Therapy, CombinationPneumonia, ViralMicrobial InteractionsLamivudineBartonellaPhylogenyErythroplasiaAnaplasma phagocytophilumStrongylida InfectionsHost-Pathogen InteractionsSimian T-lymphotropic virus 1Orthomyxoviridae InfectionsVirulenceSeroepidemiologic StudiesPlasmodiumRetrospective StudiesBocavirusBalamuthia mandrillarisSchistosomiasisHerpesviridae InfectionsCytomegalovirusUgandaCell LineAdenovirus Infections, HumanEhrlichiaMalariaCytomegalovirus InfectionsOrganophosphonatesPapillomavirus InfectionsPraziquantelTick-Borne DiseasesAnthelminticsPolyethylene GlycolsAdenoviridaeProspective StudiesSimian Acquired Immunodeficiency SyndromeBase SequenceAstroviridae InfectionsHepatitis D, ChronicViremiaUterine Cervical DiseasesInfluenza, HumanCircoviridae InfectionsViral InterferenceCote d'IvoireRetroviridae InfectionsTorque teno virusMycoplasma InfectionsHost-Parasite InteractionsInfectious Disease Transmission, VerticalVirus DiseasesTumor Virus InfectionsDefective VirusesMycobacterium bovisHerpesvirus 8, HumanParasitemiaIndinavirRotavirusGenes, ViralPneumonia, MycoplasmaSequence Analysis, DNACross-Sectional StudiesPandemicsInfluenza A virusBacterial InfectionsIncidenceCytokinesTreatment OutcomeLatent TuberculosisPregnancy Complications, InfectiousCircovirusInfluenza A Virus, H1N1 SubtypeGenome, ViralCD8-Positive T-LymphocytesGonorrheaGenetic FitnessMacaca mulattaLeukocytes, MononuclearSpodopteraDisease Models, AnimalGenetic VectorsGenetic VariationBiopsyDNA VirusesGhanaInterferonsIntestinal Diseases, ParasiticHerpesvirus 4, HumanInterferon-gammaProvirusesEpstein-Barr Virus InfectionsBlood DonorsPneumonia, BacterialHerpes GenitalisBenzoxazinesAntigens, ViralDrug-Induced Liver InjuryAdenineFatal OutcomeLiver DiseasesLiverMetapneumovirusCat DiseasesSouth AfricaHuman T-lymphotropic virus 2Schistosomiasis haematobiaHepatitis Delta VirusAlanine TransaminaseEnzyme-Linked Immunosorbent AssayLungCD4-CD8 RatioChlamydia Infections
Coinfection: Simultaneous infection of a host organism by two or more pathogens. In virology, coinfection commonly refers to simultaneous infection of a single cell by two or more different viruses.HIV Infections: Includes the spectrum of human immunodeficiency virus infections that range from asymptomatic seropositivity, thru AIDS-related complex (ARC), to acquired immunodeficiency syndrome (AIDS).Hepatitis C: INFLAMMATION of the LIVER in humans caused by HEPATITIS C VIRUS, a single-stranded RNA virus. Its incubation period is 30-90 days. Hepatitis C is transmitted primarily by contaminated blood parenterally, and is often associated with transfusion and intravenous drug abuse. However, in a significant number of cases, the source of hepatitis C infection is unknown.GB virus C: A species of virus (unassigned to a genus) in the family FLAVIVIRIDAE. It is genetically heterogeneous, of human origin, and transmitted by blood or blood products. Despite its alternate name (Hepatitis G virus), its pathogenicity remains controversial.Flaviviridae Infections: Infections with viruses of the family FLAVIVIRIDAE.HIV: Human immunodeficiency virus. A non-taxonomic and historical term referring to any of two species, specifically HIV-1 and/or HIV-2. Prior to 1986, this was called human T-lymphotropic virus type III/lymphadenopathy-associated virus (HTLV-III/LAV). From 1986-1990, it was an official species called HIV. Since 1991, HIV was no longer considered an official species name; the two species were designated HIV-1 and HIV-2.Hepatitis B: INFLAMMATION of the LIVER in humans caused by a member of the ORTHOHEPADNAVIRUS genus, HEPATITIS B VIRUS. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact.CD4 Lymphocyte Count: The number of CD4-POSITIVE T-LYMPHOCYTES per unit volume of BLOOD. Determination requires the use of a fluorescence-activated flow cytometer.Hepacivirus: A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.Antiretroviral Therapy, Highly Active: Drug regimens, for patients with HIV INFECTIONS, that aggressively suppress HIV replication. The regimens usually involve administration of three or more different drugs including a protease inhibitor.AIDS-Related Opportunistic Infections: Opportunistic infections found in patients who test positive for human immunodeficiency virus (HIV). The most common include PNEUMOCYSTIS PNEUMONIA, Kaposi's sarcoma, cryptosporidiosis, herpes simplex, toxoplasmosis, cryptococcosis, and infections with Mycobacterium avium complex, Microsporidium, and Cytomegalovirus.Viral Load: The quantity of measurable virus in a body fluid. Change in viral load, measured in plasma, is sometimes used as a SURROGATE MARKER in disease progression.HIV-1: The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.Hookworm Infections: Infection of humans or animals with hookworms other than those caused by the genus Ancylostoma or Necator, for which the specific terms ANCYLOSTOMIASIS and NECATORIASIS are available.Antiviral Agents: Agents used in the prophylaxis or therapy of VIRUS DISEASES. Some of the ways they may act include preventing viral replication by inhibiting viral DNA polymerase; binding to specific cell-surface receptors and inhibiting viral penetration or uncoating; inhibiting viral protein synthesis; or blocking late stages of virus assembly.Hepatitis C, Chronic: INFLAMMATION of the LIVER in humans that is caused by HEPATITIS C VIRUS lasting six months or more. Chronic hepatitis C can lead to LIVER CIRRHOSIS.Anti-HIV Agents: Agents used to treat AIDS and/or stop the spread of the HIV infection. These do not include drugs used to treat symptoms or opportunistic infections associated with AIDS.RNA, Viral: Ribonucleic acid that makes up the genetic material of viruses.Hepatitis, Viral, Human: INFLAMMATION of the LIVER in humans due to infection by VIRUSES. There are several significant types of human viral hepatitis with infection caused by enteric-transmission (HEPATITIS A; HEPATITIS E) or blood transfusion (HEPATITIS B; HEPATITIS C; and HEPATITIS D).DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.Tuberculosis: Any of the infectious diseases of man and other animals caused by species of MYCOBACTERIUM.HTLV-II InfectionsEhrlichiosis: A tick-borne disease characterized by FEVER; HEADACHE; myalgias; ANOREXIA; and occasionally RASH. It is caused by several bacterial species and can produce disease in DOGS; CATTLE; SHEEP; GOATS; HORSES; and humans. The primary species causing human disease are EHRLICHIA CHAFFEENSIS; ANAPLASMA PHAGOCYTOPHILUM; and Ehrlichia ewingii.Glossitis, Benign Migratory: An idiopathic disorder characterized by the loss of filiform papillae leaving reddened areas of circinate macules bound by a white band. The lesions heal, then others erupt.Influenzavirus B: A genus of the family ORTHOMYXOVIRUS causing HUMAN INFLUENZA and other diseases primarily in humans. In contrast to INFLUENZAVIRUS A, no distinct antigenic subtypes of hemagglutinin (HEMAGGLUTININS) and NEURAMINIDASE are recognized.Helminthiasis: Infestation with parasitic worms of the helminth class.Prevalence: The total number of cases of a given disease in a specified population at a designated time. It is differentiated from INCIDENCE, which refers to the number of new cases in the population at a given time.Influenzavirus A: A genus in the family ORTHOMYXOVIRIDAE causing influenza and other diseases in humans and animals. It contains many strains as well as antigenic subtypes of the integral membrane proteins hemagglutinin (HEMAGGLUTININS) and NEURAMINIDASE. The type species is INFLUENZA A VIRUS.Babesia microti: A species of protozoa infecting humans via the intermediate tick vector IXODES scapularis. The other hosts are the mouse PEROMYSCUS leucopus and meadow vole MICROTUS pennsylvanicus, which are fed on by the tick. Other primates can be experimentally infected with Babesia microti.Schistosomiasis mansoni: Schistosomiasis caused by Schistosoma mansoni. It is endemic in Africa, the Middle East, South America, and the Caribbean and affects mainly the bowel, spleen, and liver.Primate Diseases: Diseases of animals within the order PRIMATES. This term includes diseases of Haplorhini and Strepsirhini.Ribavirin: A nucleoside antimetabolite antiviral agent that blocks nucleic acid synthesis and is used against both RNA and DNA viruses.Virus Replication: The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.Superinfection: A frequent complication of drug therapy for microbial infection. It may result from opportunistic colonization following immunosuppression by the primary pathogen and can be influenced by the time interval between infections, microbial physiology, or host resistance. Experimental challenge and in vitro models are sometimes used in virulence and infectivity studies.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Mansonella: A genus of parasitic nematodes whose organisms are distributed in Central and South America. Characteristics include a smooth cuticle and an enlarged anterior end.Helicobacter felis: A species of HELICOBACTER that colonizes in the STOMACH of laboratory MICE; CATS; and DOGS. It is associated with lymphoid follicular hyperplasia and mild GASTRITIS in CATS.Babesiosis: A group of tick-borne diseases of mammals including ZOONOSES in humans. They are caused by protozoa of the genus BABESIA, which parasitize erythrocytes, producing hemolysis. In the U.S., the organism's natural host is mice and transmission is by the deer tick IXODES SCAPULARIS.Liver Cirrhosis: Liver disease in which the normal microcirculation, the gross vascular anatomy, and the hepatic architecture have been variably destroyed and altered with fibrous septa surrounding regenerated or regenerating parenchymal nodules.HTLV-I InfectionsSubstance Abuse, Intravenous: Abuse, overuse, or misuse of a substance by its injection into a vein.Schistosoma mansoni: A species of trematode blood flukes of the family Schistosomatidae. It is common in the Nile delta. The intermediate host is the planorbid snail. This parasite causes schistosomiasis mansoni and intestinal bilharziasis.Hepatitis D: INFLAMMATION of the LIVER in humans caused by HEPATITIS DELTA VIRUS, a defective RNA virus that can only infect HEPATITIS B patients. For its viral coating, hepatitis delta virus requires the HEPATITIS B SURFACE ANTIGENS produced by these patients. Hepatitis D can occur either concomitantly with (coinfection) or subsequent to (superinfection) hepatitis B infection. Similar to hepatitis B, it is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact.Dependovirus: A genus of the family PARVOVIRIDAE, subfamily PARVOVIRINAE, which are dependent on a coinfection with helper adenoviruses or herpesviruses for their efficient replication. The type species is Adeno-associated virus 2.Hepatitis B virus: The type species of the genus ORTHOHEPADNAVIRUS which causes human HEPATITIS B and is also apparently a causal agent in human HEPATOCELLULAR CARCINOMA. The Dane particle is an intact hepatitis virion, named after its discoverer. Non-infectious spherical and tubular particles are also seen in the serum.Comorbidity: The presence of co-existing or additional diseases with reference to an initial diagnosis or with reference to the index condition that is the subject of study. Comorbidity may affect the ability of affected individuals to function and also their survival; it may be used as a prognostic indicator for length of hospital stay, cost factors, and outcome or survival.Hepatitis B, Chronic: INFLAMMATION of the LIVER in humans caused by HEPATITIS B VIRUS lasting six months or more. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact.Mansonelliasis: Infection with nematodes of the genus MANSONELLA. Symptoms include pruritus, headache, and articular swelling.DNA Virus InfectionsAnti-Retroviral Agents: Agents used to treat RETROVIRIDAE INFECTIONS.Hepatitis B Surface Antigens: Those hepatitis B antigens found on the surface of the Dane particle and on the 20 nm spherical and tubular particles. Several subspecificities of the surface antigen are known. These were formerly called the Australia antigen.Nematospiroides dubius: A species of intestinal nematode parasites which occur most commonly in mice. Infection is by ingesting larvae. This particular species is used extensively in immunological research.Simian foamy virus: A species of SPUMAVIRUS causing non-pathogenic infections in chimpanzees and humans.Parvoviridae Infections: Virus infections caused by the PARVOVIRIDAE.Helminths: Commonly known as parasitic worms, this group includes the ACANTHOCEPHALA; NEMATODA; and PLATYHELMINTHS. Some authors consider certain species of LEECHES that can become temporarily parasitic as helminths.Flaviviridae: A family of RNA viruses, many of which cause disease in humans and domestic animals. There are three genera FLAVIVIRUS; PESTIVIRUS; and HEPACIVIRUS, as well as several unassigned species.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Antitubercular Agents: Drugs used in the treatment of tuberculosis. They are divided into two main classes: "first-line" agents, those with the greatest efficacy and acceptable degrees of toxicity used successfully in the great majority of cases; and "second-line" drugs used in drug-resistant cases or those in which some other patient-related condition has compromised the effectiveness of primary therapy.Herpesvirus 6, Human: The type species of ROSEOLOVIRUS isolated from patients with AIDS and other LYMPHOPROLIFERATIVE DISORDERS. It infects and replicates in fresh and established lines of hematopoietic cells and cells of neural origin. It also appears to alter NK cell activity. HHV-6; (HBLV) antibodies are elevated in patients with AIDS, Sjogren's syndrome, sarcoidosis, chronic fatigue syndrome, and certain malignancies. HHV-6 is the cause of EXANTHEMA SUBITUM and has been implicated in encephalitis.Lactate dehydrogenase-elevating virus: A species ARTERIVIRUS, occurring in a number of transplantable mouse tumors. Infected mice have permanently elevated serum levels of lactate dehydrogenase.Cohort Studies: Studies in which subsets of a defined population are identified. These groups may or may not be exposed to factors hypothesized to influence the probability of the occurrence of a particular disease or other outcome. Cohorts are defined populations which, as a whole, are followed in an attempt to determine distinguishing subgroup characteristics.Helminthiasis, Animal: Infestation of animals with parasitic worms of the helminth class. The infestation may be experimental or veterinary.Macaca nemestrina: A species of the genus MACACA which inhabits Malaya, Sumatra, and Borneo. It is one of the most arboreal species of Macaca. The tail is short and untwisted.Infectious Disease Incubation Period: The amount time between exposure to an infectious agent and becoming symptomatic.Interferon-alpha: One of the type I interferons produced by peripheral blood leukocytes or lymphoblastoid cells. In addition to antiviral activity, it activates NATURAL KILLER CELLS and B-LYMPHOCYTES, and down-regulates VASCULAR ENDOTHELIAL GROWTH FACTOR expression through PI-3 KINASE and MAPK KINASES signaling pathways.Bacteriophage phi 6: Virulent bacteriophage and sole member of the genus Cystovirus that infects Pseudomonas species. The virion has a segmented genome consisting of three pieces of doubled-stranded DNA and also a unique lipid-containing envelope.CD4-Positive T-Lymphocytes: A critical subpopulation of T-lymphocytes involved in the induction of most immunological functions. The HIV virus has selective tropism for the T4 cell which expresses the CD4 phenotypic marker, a receptor for HIV. In fact, the key element in the profound immunosuppression seen in HIV infection is the depletion of this subset of T-lymphocytes.Liver Failure: Severe inability of the LIVER to perform its normal metabolic functions, as evidenced by severe JAUNDICE and abnormal serum levels of AMMONIA; BILIRUBIN; ALKALINE PHOSPHATASE; ASPARTATE AMINOTRANSFERASE; LACTATE DEHYDROGENASES; and albumin/globulin ratio. (Blakiston's Gould Medical Dictionary, 4th ed)Hepatitis C Antibodies: Antibodies to the HEPATITIS C ANTIGENS including antibodies to envelope, core, and non-structural proteins.Mycobacterium tuberculosis: A species of gram-positive, aerobic bacteria that produces TUBERCULOSIS in humans, other primates, CATTLE; DOGS; and some other animals which have contact with humans. Growth tends to be in serpentine, cordlike masses in which the bacilli show a parallel orientation.BrazilHelper Viruses: Viruses which enable defective viruses to replicate or to form a protein coat by complementing the missing gene function of the defective (satellite) virus. Helper and satellite may be of the same or different genus.Adenoviruses, Human: Species of the genus MASTADENOVIRUS, causing a wide range of diseases in humans. Infections are mostly asymptomatic, but can be associated with diseases of the respiratory, ocular, and gastrointestinal systems. Serotypes (named with Arabic numbers) have been grouped into species designated Human adenovirus A-F.Recombination, Genetic: Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.Disease Progression: The worsening of a disease over time. This concept is most often used for chronic and incurable diseases where the stage of the disease is an important determinant of therapy and prognosis.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Protozoan Infections: Infections with unicellular organisms formerly members of the subkingdom Protozoa.Simian immunodeficiency virus: Species of the genus LENTIVIRUS, subgenus primate immunodeficiency viruses (IMMUNODEFICIENCY VIRUSES, PRIMATE), that induces acquired immunodeficiency syndrome in monkeys and apes (SAIDS). The genetic organization of SIV is virtually identical to HIV.Lyme Disease: An infectious disease caused by a spirochete, BORRELIA BURGDORFERI, which is transmitted chiefly by Ixodes dammini (see IXODES) and pacificus ticks in the United States and Ixodes ricinis (see IXODES) in Europe. It is a disease with early and late cutaneous manifestations plus involvement of the nervous system, heart, eye, and joints in variable combinations. The disease was formerly known as Lyme arthritis and first discovered at Old Lyme, Connecticut.Colobus: A genus of Old World monkeys, subfamily COLOBINAE, family CERCOPITHECIDAE, that inhabits the forests of Africa. It consists of eight species: C. angolensis (Angolan colobus), C. badius or C. rufomitratus (Red or Bay colobus), C. guereza (Guereza or Eastern black-and-white colobus), C. kirkii (Kirk's colobus), C. polykomos (King colobus or Western black-and-white colobus), C. satanas (Black colobus), and C. verus (Olive colobus). Some authors recognize Procolobus as a separate genus and then the olive colobus is recognized as the species P. verus.Risk Factors: An aspect of personal behavior or lifestyle, environmental exposure, or inborn or inherited characteristic, which, on the basis of epidemiologic evidence, is known to be associated with a health-related condition considered important to prevent.Strongyloidiasis: Infection with nematodes of the genus STRONGYLOIDES. The presence of larvae may produce pneumonitis and the presence of adult worms in the intestine could lead to moderate to severe diarrhea.Strongyloides stercoralis: A species of parasitic nematode widely distributed in tropical and subtropical countries. The females and their larvae inhabit the mucosa of the intestinal tract, where they cause ulceration and diarrhea.HIV Seropositivity: Development of neutralizing antibodies in individuals who have been exposed to the human immunodeficiency virus (HIV/HTLV-III/LAV).Tuberculosis, Pulmonary: MYCOBACTERIUM infections of the lung.Roseolovirus Infections: Infection with ROSEOLOVIRUS, the most common in humans being EXANTHEMA SUBITUM, a benign disease of infants and young children.Ixodes: The largest genus of TICKS in the family IXODIDAE, containing over 200 species. Many infest humans and other mammals and several are vectors of diseases such as LYME DISEASE, tick-borne encephalitis (ENCEPHALITIS, TICK-BORNE), and KYASANUR FOREST DISEASE.Viral Proteins: Proteins found in any species of virus.Acquired Immunodeficiency Syndrome: An acquired defect of cellular immunity associated with infection by the human immunodeficiency virus (HIV), a CD4-positive T-lymphocyte count under 200 cells/microliter or less than 14% of total lymphocytes, and increased susceptibility to opportunistic infections and malignant neoplasms. Clinical manifestations also include emaciation (wasting) and dementia. These elements reflect criteria for AIDS as defined by the CDC in 1993.Drug Therapy, Combination: Therapy with two or more separate preparations given for a combined effect.Pneumonia, Viral: Inflammation of the lung parenchyma that is caused by a viral infection.Microbial Interactions: The inter- and intra-relationships between various microorganisms. This can include both positive (like SYMBIOSIS) and negative (like ANTIBIOSIS) interactions. Examples include virus - bacteria and bacteria - bacteria.Lamivudine: A reverse transcriptase inhibitor and ZALCITABINE analog in which a sulfur atom replaces the 3' carbon of the pentose ring. It is used to treat HIV disease.Bartonella: A genus of gram-negative bacteria characteristically appearing in chains of several segmenting organisms. It occurs in man and arthropod vectors and is found only in the Andes region of South America. This genus is the etiologic agent of human bartonellosis. The genus Rochalimaea, once considered a separate genus, has recently been combined with the genus Bartonella as a result of high levels of relatedness in 16S rRNA sequence data and DNA hybridization data.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Erythroplasia: A condition of the mucous membrane characterized by erythematous papular lesions. (Dorland, 27th ed)Anaplasma phagocytophilum: A species of gram-negative bacteria in the genus ANAPLASMA, family ANAPLASMATACEAE, formerly called Ehrlichia phagocytophila or Ehrlichia equi. This organism is tick-borne (IXODES) and causes disease in horses and sheep. In humans, it causes human granulocytic EHRLICHIOSIS.Strongylida Infections: Infections with nematodes of the order STRONGYLIDA.Host-Pathogen Interactions: The interactions between a host and a pathogen, usually resulting in disease.Simian T-lymphotropic virus 1: A strain of PRIMATE T-LYMPHOTROPIC VIRUS 2, closely related to the human HTLV-1 virus. The clinical, hematological, and histopathological characteristics of the disease in STLV-infected monkeys are very similar to those of human adult T-cell leukemia. Subgroups include the African green monkey subtype (STLV-I-AGM), for which the nucleotide sequence is 95% homologous with that of HUMAN T-LYMPHOTROPIC VIRUS 1, and the Asian rhesus macaque subtype (STLV-I-MM), for which the nucleotide sequence is 90% homologous with that of HUMAN T-LYMPHOTROPIC VIRUS 1.Orthomyxoviridae Infections: Virus diseases caused by the ORTHOMYXOVIRIDAE.Virulence: The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.Seroepidemiologic Studies: EPIDEMIOLOGIC STUDIES based on the detection through serological testing of characteristic change in the serum level of specific ANTIBODIES. Latent subclinical infections and carrier states can thus be detected in addition to clinically overt cases.Plasmodium: A genus of protozoa that comprise the malaria parasites of mammals. Four species infect humans (although occasional infections with primate malarias may occur). These are PLASMODIUM FALCIPARUM; PLASMODIUM MALARIAE; PLASMODIUM OVALE, and PLASMODIUM VIVAX. Species causing infection in vertebrates other than man include: PLASMODIUM BERGHEI; PLASMODIUM CHABAUDI; P. vinckei, and PLASMODIUM YOELII in rodents; P. brasilianum, PLASMODIUM CYNOMOLGI; and PLASMODIUM KNOWLESI in monkeys; and PLASMODIUM GALLINACEUM in chickens.Retrospective Studies: Studies used to test etiologic hypotheses in which inferences about an exposure to putative causal factors are derived from data relating to characteristics of persons under study or to events or experiences in their past. The essential feature is that some of the persons under study have the disease or outcome of interest and their characteristics are compared with those of unaffected persons.Bocavirus: A genus in the subfamily PARVOVIRINAE comprising three species: Bovine parvovirus, Canine minute virus, and HUMAN BOCAVIRUS.Balamuthia mandrillaris: A species of free-living soil amoeba in the family Balamuthiidae, causing AMEBIASIS and a deadly form of ENCEPHALITIS in humans.Schistosomiasis: Infection with flukes (trematodes) of the genus SCHISTOSOMA. Three species produce the most frequent clinical diseases: SCHISTOSOMA HAEMATOBIUM (endemic in Africa and the Middle East), SCHISTOSOMA MANSONI (in Egypt, northern and southern Africa, some West Indies islands, northern 2/3 of South America), and SCHISTOSOMA JAPONICUM (in Japan, China, the Philippines, Celebes, Thailand, Laos). S. mansoni is often seen in Puerto Ricans living in the United States.Herpesviridae Infections: Virus diseases caused by the HERPESVIRIDAE.Cytomegalovirus: A genus of the family HERPESVIRIDAE, subfamily BETAHERPESVIRINAE, infecting the salivary glands, liver, spleen, lungs, eyes, and other organs, in which they produce characteristically enlarged cells with intranuclear inclusions. Infection with Cytomegalovirus is also seen as an opportunistic infection in AIDS.Uganda: A republic in eastern Africa, south of SUDAN and west of KENYA. Its capital is Kampala.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Adenovirus Infections, Human: Respiratory and conjunctival infections caused by 33 identified serotypes of human adenoviruses.Ehrlichia: Small, often pleomorphic, coccoid to ellipsoidal organisms occurring intracytoplasmically in circulating LYMPHOCYTES. They are the etiologic agents of tick-borne diseases of humans; DOGS; CATTLE; SHEEP; GOATS; and HORSES.Malaria: A protozoan disease caused in humans by four species of the PLASMODIUM genus: PLASMODIUM FALCIPARUM; PLASMODIUM VIVAX; PLASMODIUM OVALE; and PLASMODIUM MALARIAE; and transmitted by the bite of an infected female mosquito of the genus ANOPHELES. Malaria is endemic in parts of Asia, Africa, Central and South America, Oceania, and certain Caribbean islands. It is characterized by extreme exhaustion associated with paroxysms of high FEVER; SWEATING; shaking CHILLS; and ANEMIA. Malaria in ANIMALS is caused by other species of plasmodia.Cytomegalovirus Infections: Infection with CYTOMEGALOVIRUS, characterized by enlarged cells bearing intranuclear inclusions. Infection may be in almost any organ, but the salivary glands are the most common site in children, as are the lungs in adults.Organophosphonates: Carbon-containing phosphonic acid compounds. Included under this heading are compounds that have carbon bound to either OXYGEN atom or the PHOSPHOROUS atom of the (P=O)O2 structure.Papillomavirus Infections: Neoplasms of the skin and mucous membranes caused by papillomaviruses. They are usually benign but some have a high risk for malignant progression.Praziquantel: An anthelmintic used in most schistosome and many cestode infestations.Tick-Borne Diseases: Bacterial, viral, or parasitic diseases transmitted to humans and animals by the bite of infected ticks. The families Ixodidae and Argasidae contain many bloodsucking species that are important pests of man and domestic birds and mammals and probably exceed all other arthropods in the number and variety of disease agents they transmit. Many of the tick-borne diseases are zoonotic.Anthelmintics: Agents destructive to parasitic worms. They are used therapeutically in the treatment of HELMINTHIASIS in man and animal.Polyethylene Glycols: Polymers of ETHYLENE OXIDE and water, and their ethers. They vary in consistency from liquid to solid depending on the molecular weight indicated by a number following the name. They are used as SURFACTANTS, dispersing agents, solvents, ointment and suppository bases, vehicles, and tablet excipients. Some specific groups are NONOXYNOLS, OCTOXYNOLS, and POLOXAMERS.Adenoviridae: A family of non-enveloped viruses infecting mammals (MASTADENOVIRUS) and birds (AVIADENOVIRUS) or both (ATADENOVIRUS). Infections may be asymptomatic or result in a variety of diseases.Prospective Studies: Observation of a population for a sufficient number of persons over a sufficient number of years to generate incidence or mortality rates subsequent to the selection of the study group.Simian Acquired Immunodeficiency Syndrome: Acquired defect of cellular immunity that occurs naturally in macaques infected with SRV serotypes, experimentally in monkeys inoculated with SRV or MASON-PFIZER MONKEY VIRUS; (MPMV), or in monkeys infected with SIMIAN IMMUNODEFICIENCY VIRUS.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Astroviridae Infections: Infections with ASTROVIRUS, causing gastroenteritis in human infants, calves, lambs, and piglets.Hepatitis D, Chronic: INFLAMMATION of the LIVER in humans caused by HEPATITIS DELTA VIRUS in conjunction with HEPATITIS B VIRUS and lasting six months or more.Viremia: The presence of viruses in the blood.Uterine Cervical Diseases: Pathological processes of the UTERINE CERVIX.Influenza, Human: An acute viral infection in humans involving the respiratory tract. It is marked by inflammation of the NASAL MUCOSA; the PHARYNX; and conjunctiva, and by headache and severe, often generalized, myalgia.Circoviridae Infections: Virus diseases caused by the CIRCOVIRIDAE.Viral Interference: A phenomenon in which infection by a first virus results in resistance of cells or tissues to infection by a second, unrelated virus.Cote d'Ivoire: A republic in western Africa, south of MALI and BURKINA FASO, bordered by GHANA on the east. Its administrative capital is Abidjan and Yamoussoukro has been the official capital since 1983. The country was formerly called Ivory Coast.Retroviridae Infections: Virus diseases caused by the RETROVIRIDAE.Torque teno virus: A species of non-enveloped DNA virus in the genus ANELLOVIRUS, associated with BLOOD TRANSFUSIONS; and HEPATITIS. However, no etiological role has been found for TTV in hepatitis.Mycoplasma Infections: Infections with species of the genus MYCOPLASMA.Host-Parasite Interactions: The relationship between an invertebrate and another organism (the host), one of which lives at the expense of the other. Traditionally excluded from definition of parasites are pathogenic BACTERIA; FUNGI; VIRUSES; and PLANTS; though they may live parasitically.Infectious Disease Transmission, Vertical: The transmission of infectious disease or pathogens from one generation to another. It includes transmission in utero or intrapartum by exposure to blood and secretions, and postpartum exposure via breastfeeding.Virus Diseases: A general term for diseases produced by viruses.Tumor Virus Infections: Infections produced by oncogenic viruses. The infections caused by DNA viruses are less numerous but more diverse than those caused by the RNA oncogenic viruses.Defective Viruses: Viruses which lack a complete genome so that they cannot completely replicate or cannot form a protein coat. Some are host-dependent defectives, meaning they can replicate only in cell systems which provide the particular genetic function which they lack. Others, called SATELLITE VIRUSES, are able to replicate only when their genetic defect is complemented by a helper virus.Mycobacterium bovis: The bovine variety of the tubercle bacillus. It is called also Mycobacterium tuberculosis var. bovis.Herpesvirus 8, Human: A species in the genus RHADINOVIRUS, subfamily GAMMAHERPESVIRINAE, isolated from patients with AIDS-related and "classical" Kaposi sarcoma.Parasitemia: The presence of parasites (especially malarial parasites) in the blood. (Dorland, 27th ed)Indinavir: A potent and specific HIV protease inhibitor that appears to have good oral bioavailability.Rotavirus: A genus of REOVIRIDAE, causing acute gastroenteritis in BIRDS and MAMMALS, including humans. Transmission is horizontal and by environmental contamination. Seven species (Rotaviruses A thru G) are recognized.Genes, Viral: The functional hereditary units of VIRUSES.Pneumonia, Mycoplasma: Interstitial pneumonia caused by extensive infection of the lungs (LUNG) and BRONCHI, particularly the lower lobes of the lungs, by MYCOPLASMA PNEUMONIAE in humans. In SHEEP, it is caused by MYCOPLASMA OVIPNEUMONIAE. In CATTLE, it may be caused by MYCOPLASMA DISPAR.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Cross-Sectional Studies: Studies in which the presence or absence of disease or other health-related variables are determined in each member of the study population or in a representative sample at one particular time. This contrasts with LONGITUDINAL STUDIES which are followed over a period of time.Pandemics: Epidemics of infectious disease that have spread to many countries, often more than one continent, and usually affecting a large number of people.Influenza A virus: The type species of the genus INFLUENZAVIRUS A that causes influenza and other diseases in humans and animals. Antigenic variation occurs frequently between strains, allowing classification into subtypes and variants. Transmission is usually by aerosol (human and most non-aquatic hosts) or waterborne (ducks). Infected birds shed the virus in their saliva, nasal secretions, and feces.Bacterial Infections: Infections by bacteria, general or unspecified.Incidence: The number of new cases of a given disease during a given period in a specified population. It also is used for the rate at which new events occur in a defined population. It is differentiated from PREVALENCE, which refers to all cases, new or old, in the population at a given time.Cytokines: Non-antibody proteins secreted by inflammatory leukocytes and some non-leukocytic cells, that act as intercellular mediators. They differ from classical hormones in that they are produced by a number of tissue or cell types rather than by specialized glands. They generally act locally in a paracrine or autocrine rather than endocrine manner.Treatment Outcome: Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.Latent Tuberculosis: The dormant form of TUBERCULOSIS where the person shows no obvious symptoms and no sign of the causative agent (Mycobacterium tuberculosis) in the SPUTUM despite being positive for tuberculosis infection skin test.Pregnancy Complications, Infectious: The co-occurrence of pregnancy and an INFECTION. The infection may precede or follow FERTILIZATION.Circovirus: A genus of the family CIRCOVIRIDAE that infects SWINE; PSITTACINES; and non-psittacine BIRDS. Species include Beak and feather disease virus causing a fatal disease in psittacine birds, and Porcine circovirus causing postweaning multisystemic wasting syndrome in pigs (PORCINE POSTWEANING MULTISYSTEMIC WASTING SYNDROME).Influenza A Virus, H1N1 Subtype: A subtype of INFLUENZA A VIRUS with the surface proteins hemagglutinin 1 and neuraminidase 1. The H1N1 subtype was responsible for the Spanish flu pandemic of 1918.Genome, Viral: The complete genetic complement contained in a DNA or RNA molecule in a virus.CD8-Positive T-Lymphocytes: A critical subpopulation of regulatory T-lymphocytes involved in MHC Class I-restricted interactions. They include both cytotoxic T-lymphocytes (T-LYMPHOCYTES, CYTOTOXIC) and CD8+ suppressor T-lymphocytes.Gonorrhea: Acute infectious disease characterized by primary invasion of the urogenital tract. The etiologic agent, NEISSERIA GONORRHOEAE, was isolated by Neisser in 1879.Genetic Fitness: The capability of an organism to survive and reproduce. The phenotypic expression of the genotype in a particular environment determines how genetically fit an organism will be.Macaca mulatta: A species of the genus MACACA inhabiting India, China, and other parts of Asia. The species is used extensively in biomedical research and adapts very well to living with humans.Leukocytes, Mononuclear: Mature LYMPHOCYTES and MONOCYTES transported by the blood to the body's extravascular space. They are morphologically distinguishable from mature granulocytic leukocytes by their large, non-lobed nuclei and lack of coarse, heavily stained cytoplasmic granules.Spodoptera: A genus of owlet moths of the family Noctuidae. These insects are used in molecular biology studies during all stages of their life cycle.Disease Models, Animal: Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.Genetic Vectors: DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.Genetic Variation: Genotypic differences observed among individuals in a population.Biopsy: Removal and pathologic examination of specimens in the form of small pieces of tissue from the living body.DNA Viruses: Viruses whose nucleic acid is DNA.Ghana: A republic in western Africa, south of BURKINA FASO and west of TOGO. Its capital is Accra.Interferons: Proteins secreted by vertebrate cells in response to a wide variety of inducers. They confer resistance against many different viruses, inhibit proliferation of normal and malignant cells, impede multiplication of intracellular parasites, enhance macrophage and granulocyte phagocytosis, augment natural killer cell activity, and show several other immunomodulatory functions.Intestinal Diseases, Parasitic: Infections of the INTESTINES with PARASITES, commonly involving PARASITIC WORMS. Infections with roundworms (NEMATODE INFECTIONS) and tapeworms (CESTODE INFECTIONS) are also known as HELMINTHIASIS.Herpesvirus 4, Human: The type species of LYMPHOCRYPTOVIRUS, subfamily GAMMAHERPESVIRINAE, infecting B-cells in humans. It is thought to be the causative agent of INFECTIOUS MONONUCLEOSIS and is strongly associated with oral hairy leukoplakia (LEUKOPLAKIA, HAIRY;), BURKITT LYMPHOMA; and other malignancies.Interferon-gamma: The major interferon produced by mitogenically or antigenically stimulated LYMPHOCYTES. It is structurally different from TYPE I INTERFERON and its major activity is immunoregulation. It has been implicated in the expression of CLASS II HISTOCOMPATIBILITY ANTIGENS in cells that do not normally produce them, leading to AUTOIMMUNE DISEASES.Proviruses: Duplex DNA sequences in eukaryotic chromosomes, corresponding to the genome of a virus, that are transmitted from one cell generation to the next without causing lysis of the host. Proviruses are often associated with neoplastic cell transformation and are key features of retrovirus biology.Epstein-Barr Virus Infections: Infection with human herpesvirus 4 (HERPESVIRUS 4, HUMAN); which may facilitate the development of various lymphoproliferative disorders. These include BURKITT LYMPHOMA (African type), INFECTIOUS MONONUCLEOSIS, and oral hairy leukoplakia (LEUKOPLAKIA, HAIRY).Blood DonorsPneumonia, Bacterial: Inflammation of the lung parenchyma that is caused by bacterial infections.Herpes Genitalis: Infection of the genitals (GENITALIA) with HERPES SIMPLEX VIRUS in either the males or the females.Benzoxazines: OXAZINES with a fused BENZENE ring.Antigens, Viral: Substances elaborated by viruses that have antigenic activity.Drug-Induced Liver Injury: A spectrum of clinical liver diseases ranging from mild biochemical abnormalities to ACUTE LIVER FAILURE, caused by drugs, drug metabolites, and chemicals from the environment.Adenine: A purine base and a fundamental unit of ADENINE NUCLEOTIDES.Fatal Outcome: Death resulting from the presence of a disease in an individual, as shown by a single case report or a limited number of patients. This should be differentiated from DEATH, the physiological cessation of life and from MORTALITY, an epidemiological or statistical concept.Liver Diseases: Pathological processes of the LIVER.Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Metapneumovirus: A genus of the subfamily PNEUMOVIRINAE, containing two members: Turkey rhinotracheitis virus and a human Metapneumovirus. Virions lack HEMAGGLUTININ and NEURAMINIDASE.Cat Diseases: Diseases of the domestic cat (Felis catus or F. domesticus). This term does not include diseases of the so-called big cats such as CHEETAHS; LIONS; tigers, cougars, panthers, leopards, and other Felidae for which the heading CARNIVORA is used.South Africa: A republic in southern Africa, the southernmost part of Africa. It has three capitals: Pretoria (administrative), Cape Town (legislative), and Bloemfontein (judicial). Officially the Republic of South Africa since 1960, it was called the Union of South Africa 1910-1960.Human T-lymphotropic virus 2: A strain of PRIMATE T-LYMPHOTROPIC VIRUS 2 that can transform normal T-lymphocytes and can replicate in both T- and B-cell lines. The virus is related to but distinct from HTLV-1.Schistosomiasis haematobia: A human disease caused by the infection of parasitic worms SCHISTOSOMA HAEMATOBIUM. It is endemic in AFRICA and parts of the MIDDLE EAST. Tissue damages most often occur in the URINARY TRACT, specifically the URINARY BLADDER.Hepatitis Delta Virus: A defective virus, containing particles of RNA nucleoprotein in virion-like form, present in patients with acute hepatitis B and chronic hepatitis. It requires the presence of a hepadnavirus for full replication. This is the lone species in the genus Deltavirus.Alanine Transaminase: An enzyme that catalyzes the conversion of L-alanine and 2-oxoglutarate to pyruvate and L-glutamate. (From Enzyme Nomenclature, 1992) EC 2.6.1.2.Enzyme-Linked Immunosorbent Assay: An immunoassay utilizing an antibody labeled with an enzyme marker such as horseradish peroxidase. While either the enzyme or the antibody is bound to an immunosorbent substrate, they both retain their biologic activity; the change in enzyme activity as a result of the enzyme-antibody-antigen reaction is proportional to the concentration of the antigen and can be measured spectrophotometrically or with the naked eye. Many variations of the method have been developed.Lung: Either of the pair of organs occupying the cavity of the thorax that effect the aeration of the blood.CD4-CD8 Ratio: Ratio of T-LYMPHOCYTES that express the CD4 ANTIGEN to those that express the CD8 ANTIGEN. This value is commonly assessed in the diagnosis and staging of diseases affecting the IMMUNE SYSTEM including HIV INFECTIONS.Chlamydia Infections: Infections with bacteria of the genus CHLAMYDIA.

REACTIONS OF MONKEYS TO EXPERIMENTAL MIXED INFLUENZA AND STREPTOCOCCUS INFECTIONS : AN ANALYSIS OF THE RELATIVE ROLES OF HUMORAL AND CELLULAR IMMUNITY, WITH THE DESCRIPTION OF AN INTERCURRENT NEPHRITIC SYNDROME. (1/1033)

1. The vital importance of the cellular defense forces in the resistance of the monkey to combined streptococcus and influenza virus infections has been demonstrated. 2. Some of the conditions prejudicial to the maintenance of an optimum cellular reserve in the infected animal have been revealed; viz., undernutrition, physical cold, intratracheal route of infection. 3. The potential threat exerted by latent foci of streptococci, and the importance, in relation to the combined infection with virus, of cellular and humoral immunity, together or separately, have been demonstrated. The essential role of optimum nutrition (notably as concerns the vitamin B complex, and folic acid specifically) in the prevention of disastrous illness from these infectious agents, individually or in combination, would seem to have been proven. 4. Signs of glomerular nephritis appeared in a significant number of monkeys receiving Streptococcus hemolyticus and influenza virus in sequence, followed by reinoculation or spontaneous reappearance of the streptococci. 5. Reinoculation of Streptococcus hemolyticus, group C, resulted in a prompt "booster" increase in the opsonic index. Virus instillation was followed by just as sudden a depression in this index. 6. Reinoculation failed to evoke either the granulocytosis or the leucopenia in monkeys which are characteristic effects of the streptococcus and the virus respectively when these agents are introduced for the first time by way of the nasal mucous membrane. 7. Simultaneous intranasal inoculation of influenza virus, type A, and Streptococcus hemolyticus, group C, in nutritionally normal Macaca mulatta failed to produce obvious signs of disease. In most of the animals, however, a streptococcus-induced leucocytosis followed by a delayed virus-induced granulopenia developed. 8. Inoculation of influenza virus followed in 4 to 17 days by streptococci produced obvious signs of disease in five of eleven animals which had become leucopenic as result of the action of the virus, and fatal streptococcal septicemia in two monkeys. 9. The development of signs of infection in previously healthy monkeys exposed to virus followed by streptococci confirms both the clinical and laboratory experience of other observers, that virus infection may predispose to secondary bacterial invasion, and, that at times, under unfavorable circumstances, the infection may become overwhelming. Although the complete mechanism of resistance is as yet not wholly clear, the depressant or inhibitory effect of the virus on both its cellular and humoral elements has been established.  (+info)

The treatment of chronic hepatitis C virus infection in HIV co-infection. (2/1033)

Chronic HCV co-infection is present in up to one third of HIV-positive patients in Europe. In recent years, apart from the traditional transmission route of intravenous drug abuse, outbreaks of sexually transmitted acute HCV infections, mainly among HIV-positive men who have sex with men, have contributed to the overall disease burden. - Because the natural course of HCV infection is substantially accelerated in HIV-co-infection, end-stage liver disease has become the most frequent cause of non-AIDS related death in this population. Therefore every HIV/HCV co-infected patient should be evaluated for possible anti-HCV therapy with the goal of reaching a sustained virological response and thus cure of hepatitis C infection. The standard of care for the treatment of chronic HCV infection in HIV-infected remains a pegylated interferon in combination with weight-adapted ribavirin. - HAART should not be withheld from HCV co-infected patients due to concerns of drug related hepatotoxicity and in patients with reduced CD4-cell counts HAART should be started first. Under pegylated interferon and ribavirin combination therapy drug to drug interactions and cumulated toxicity between nucleoside analogues and anti-HCV therapy may be observed and concomitant didanosine use is contraindicated and zidovudine and stavudine should be avoided if possible. - The development of new drugs for the treatment of chronic hepatitis C represents a promising perspective also for HIV positive patients. However, these substances will probably reach clinical routine for HIV patients later than HCV monoinfected patients. Therefore at present waiting for new drugs is not an alternative to a modern pegylated interferon/ribavirin therapy.  (+info)

The impact of HIV/HCV co-infection on health care utilization and disability: results of the ACTG Longitudinal Linked Randomized Trials (ALLRT) Cohort. (3/1033)

 (+info)

Fungal peritonitis in peritoneal dialysis patients: successful prophylaxis with fluconazole, as demonstrated by prospective randomized control trial. (4/1033)

 (+info)

Short communication decreased incidence of dual infections in South african subtype C-infected women compared to a cohort ten years earlier. (5/1033)

 (+info)

HIV-malaria co-infection: effects of malaria on the prevalence of HIV in East sub-Saharan Africa. (6/1033)

 (+info)

Description of the parasite Wucheria bancrofti microfilariae identified in follicular fluid following transvaginal oocyte retrieval. (7/1033)

 (+info)

IL-22 production is regulated by IL-23 during Listeria monocytogenes infection but is not required for bacterial clearance or tissue protection. (8/1033)

 (+info)

Regulation of T cell recruitment and inflammation in the human immunodeficiency virus/hepatitis C virus coinfected liver |...Regulation of T cell recruitment and inflammation in the human immunodeficiency virus/hepatitis C virus coinfected liver |...
Background and Aim: Patients coinfected with both hepatitis C virus (HCV) and human immunodeficiency virus (HIV) have accelerated liver disease compared with HCV monoinfected patients. In chronic HCV infection, it is known that chemokines play a key role in T cell recruitment and in determining the extent of hepatic injury. Methods: In this study, we determined by quantitative real-time reverse transcriptase polymerase chain reaction and immunohistochemistry the intrahepatic phenotype of the cellular infiltrate and its associated chemokine profile and localization in a cohort of relatively immune competent coinfected HIV/HCV subjects. Results: Increased lobular expression of CD8+ cytotoxic T cells was found in the coinfected liver in conjunction with increased expression of the T cell chemoattractant, chemokine (C-C motif) ligand (CCL) 5, compared with the HCV mono-infected liver. Furthermore, the number of lobular-infiltrating CD8+ T cells was positively correlated with the expression of CCL5.
Pharmacokinetic Study of Raltegravir in Human Immunodeficiency Virus/Hepatitis C Virus (HIV/VHC) Coinfected Patients With...Pharmacokinetic Study of Raltegravir in Human Immunodeficiency Virus/Hepatitis C Virus (HIV/VHC) Coinfected Patients With...
Raltegravir is the first integrase inhibitor used in humans. It has been shown to be highly efficacious and well tolerated in phase III clinical trials in multidrug experienced human immunodeficiency virus(HIV)-infected patients, as well as initial therapy in untreated patients. Pharmacokinetic studies in healthy adult subjects indicate that the major mechanism of clearance of the drug is glucuronidation mediated by UGT1A1, with a minor contribution of renal excretion of unchanged parent compound. Unlike CYP-based metabolism, glucuronidation is generally found to be relatively unaffected by hepatic disease. A single dose pharmacokinetic study of raltegravir in patients with mild to moderate hepatic insufficiency (Steigbigel et al. 2008) found no clinically important effect on the drug pharmacokinetic profile, with no dosage adjustment being necessary. The liver safety and tolerability of boosted atazanavir (ATV/r) has been evaluated in human immunodeficiency virus and hepatitis C virus (HIV/HCV) ...
The prevalence and associated factors for delayed presentation for HIV care among tuberculosis/HIV co-infected patients in...The prevalence and associated factors for delayed presentation for HIV care among tuberculosis/HIV co-infected patients in...
A delay presentation for human immunodeficiency virus (HIV) patients care (that is late engagement to HIV care due to delayed HIV testing or delayed linkage for HIV care after the diagnosis of HIV positive) is a critical step in the series of HIV patient care continuum. In Ethiopia, delayed presentation (DP) for HIV care among vulnerable groups such as tuberculosis (Tb) /HIV co-infected patients has not been assessed. We aimed to assess the prevalence of and factors associated with DP (CD4 | 200 cells/μl at first visit) among Tb/HIV co-infected patients in southwest Ethiopia. A retrospective observational cohort study collated Tb/HIV data from Jimma University Teaching Hospital for the period of September 2010 and August 2012. The data analysis used logistic regression model at P value of ≤ 0.05 in the final model. The prevalence of DP among Tb/HIV co-infected patients was 59.9 %. Tb/HIV co-infected patients who had a house with at least two rooms were less likely (AOR, 0.5; 95 % CI: 0.3-1.0) to
Correlates of HIV and malaria co-infection in Southern India | Malaria Journal | Full TextCorrelates of HIV and malaria co-infection in Southern India | Malaria Journal | Full Text
Malaria and HIV co-infection adversely impact the outcome of both diseases and previous studies have mostly focused on falciparum malaria. Plasmodium vivax contributes to almost half of the malaria cases in India, but the disease burden of HIV and P. vivax co-infection is unclear. HIV-infected subjects (n=460) were randomly selected from the 4,611 individuals seen at a Voluntary Counseling and Testing Center in Chennai, India between Jan 2 to Dec 31 2008. Malaria testing was performed on stored plasma samples by nested PCR using both genus-specific and species-specific primers and immunochromatography-based rapid diagnostic test for detecting antibodies against Plasmodium falciparum and P. vivax. Recent malaria co-infection, defined by the presence of antibodies, was detected in 9.8% (45/460) participants. Plasmodium vivax accounted for majority of the infections (60%) followed by P. falciparum (27%) and mixed infections (13%). Individuals with HIV and malaria co-infection were more likely to be men (p
A Surveillance Program for the Detection of Hepatitis B Virus (HBV) Resistance to Tenofovir in HIV-HBV co-Infected Patients -...A Surveillance Program for the Detection of Hepatitis B Virus (HBV) Resistance to Tenofovir in HIV-HBV co-Infected Patients -...
Tenofovir disoproxil fumarate (TDF) is a nucleotide analogue that can inhibit both HIV and HBV DNA polymerases, and is active against wild-type HBV and HBV strains that contain lamivudine-associated polymerase gene mutations (Dore, Cooper et al. 2004). TDF was approved for use, in combination with other antiretrovirals, for HIV therapy in April 2002 in Australia. It is not currently approved for use in Australia for treatment of HBV mono-infection. TDF has only recently become available in Thailand where HIV/HBV co-infected individuals are predominantly infected with genotype B and C. In contrast, in Australia and Europe, the dominant HBV genotype in HIV/HBV co-infected individuals is A and D. As with all antiviral agents there is concern with long-term use and the development of resistance.. There has been a report of a signature mutation leading to TDF resistance at rtA194T (Sheldon et al., 2005). We recently conducted a retrospective study of HIV/HBV co infected individuals in Melbourne who ...
HIV/hepatitis C virus co-infection: basic, behavioral and cl... : AIDSHIV/hepatitis C virus co-infection: basic, behavioral and cl... : AIDS
The set of papers in this section examined challenges associated with treatment, providing treatment services, and prevention strategies for HIV/HCV co-infected patients. Kotoronis et al. provided an overview of the treatment advances for HCV mono-infection and HIV/HCV co-infection, and proposed a treatment algorithm of HCV in HIV co-infection. There has been a rapid evolution in the management of HCV in mono-infected patients. The most effective and generally available treatment for HCV is combination therapy that includes pegylated IFN-α and ribavirin. Although therapeutic advances have been made for HCV mono-infection, treatment intervention in HIV/HCV-co-infected patients has been limited. HIV caregivers and patients have been unwilling to try an additional medication regimen that is associated with many adverse events and drug interactions and in which treatment success is often limited, particularly for genotype 1, which makes up the majority of HCV in co-infected patients. For example, ...
CD4+ T-cell Count may not be a Useful Strategy to Monitor Antiretroviral Therapy Response in HTLV-1/HIV Co-infected Patients |...CD4+ T-cell Count may not be a Useful Strategy to Monitor Antiretroviral Therapy Response in HTLV-1/HIV Co-infected Patients |...
Title:CD4+ T-cell Count may not be a Useful Strategy to Monitor Antiretroviral Therapy Response in HTLV-1/HIV Co-infected Patients. VOLUME: 15 ISSUE: 3. Author(s):Alain Vandormael*, Filipe Rego, Siva Danaviah, Luiz Carlos Junior Alcantara, David R. Boulware and Tulio de Oliveira. Affiliation:Africa Health Research Institute (AHRI), University of KwaZulu-Natal, Durban, Instituto Gonçalo Moniz, Fundação Oswaldo Cruz, Salvador, Bahia, Africa Health Research Institute (AHRI), University of KwaZulu-Natal, Durban, Instituto Gonçalo Moniz, Fundação Oswaldo Cruz, Salvador, Bahia, Center for Infectious Disease and Microbiology Translational Research, University of Minnesota, Saint Paul, MN, Centre for the AIDS Programme of Research in South Africa (CAPRISA), University of KwaZulu-Natal, Durban. Keywords:HIV, HTLV-1, CD4+ count, co-infection, ART, treatment failure, South Africa.. Abstract:Background: HTLV-1/HIV co-infection is known to elevate the CD4+ T-cell counts of treatment-naïve persons. We ...
HIV/HCV Co-Infection Watch Enters its Fourth Year | The Miami News JournalHIV/HCV Co-Infection Watch Enters its Fourth Year | The Miami News Journal
Monthly publication offers a patient-centric informational portal serving three primary groups - patients, healthcare providers, and AIDS Service Organizations WASHINGTON, DC, January 10, 2018 /24-7PressRelease/ - The Community Access National Network, otherwise known as CANN, announced today that its groundbreaking HIVHCV Co-Infection Watch would continue in 2018, representing its fourth year in publication. The HIV/HCV Co-Infection Watch offers a patient-centric informational portal serving three primary groups - patients, healthcare providers, and AIDS Service Organizations.. According to the Centers for Disease Control & Prevention (CDC), approximately 25% of people living with HIV/AIDS are also co-infected with Hepatitis C (HCV). The CDC also estimates that between 50%-90% of people living with HIV/AIDS who inject drugs are co-infected with HCV. People living with HIV-infection face a higher risk of long-term liver failure as a result of co-infection with HCV. As such, treating co-infection ...
IFN-FREE THERAPY IS EFFECTIVE AND SAFE FOR HCV RECURRENCE IN LT HCV/HIV COINFECTION | CROI ConferenceIFN-FREE THERAPY IS EFFECTIVE AND SAFE FOR HCV RECURRENCE IN LT HCV/HIV COINFECTION | CROI Conference
Interferon (IFN)-based therapy against hepatitis C virus (HCV) recurrence after liver transplantation (LT) has poor effectiveness and tolerability both in HCV-mono-infected (≈30% of sustained virological response [SVR]) and HIV-HCV co-infected LT recipients (≈20% of SVR). Only small case series have reported on the use of direct antiviral agents (DAAs) in LT HCV/HIV co-infected recipients. The aim of this study is to report the effectiveness and safety of IFN-free regimens in a nationwide cohort of HIV HCV co-infected individuals having undergone LT.. A prospective, multicenter cohort study, including HCV/HIV co-infected LT patients who received IFN-free treatment for recurrent hepatitis C with two or more DAAs (patients receiving DAAs with IFN or Sofosbuvir (SOF) plus ribavirine (RBV) were excluded). For comparison, we included a matched cohort of HCV mono-infected patients who received similar treatment for recurrent HCV. Only patients reaching a follow-up of at least 12 weeks after the ...
Antiretroviral Therapy in HIV/HCV Co-Infection Italian Consensus WorkshopAntiretroviral Therapy in HIV/HCV Co-Infection Italian Consensus Workshop
About 50% of people living with the HIV infection in Italy are co-infected with HCV. In this group of patients, the primary cause of mortality is liver disease, which accounts for up to 14% of deaths. HIV/HCV co-infection also exposes patients to a higher risk of progression to AIDS, a faster evolution towards cirrhosis, more frequent drug toxicity, and lower tolerance for antiretroviral therapy. Moreover, HCV infection can play a part in increasing immune system depression; neurological, cognitive and renal damage; and bone fragility. Hence an optimal antiretroviral regimen needs to be chosen for co-administration with anti-HCV therapy and timed appropriately to improve the prognosis of co-infected HIV/HCV patients. Unfortunately, however, data on the safety and efficacy of antiretroviral drugs in these patients is scarce, as are studies of pharmacokinetics in patients with advanced liver impairment. Furthermore, restoring adequate immune constitution seems not to slow the progression of
Open label trial of adjuvant immunotherapy with Dzherelo, Svitanok and Lizorm, in MDR-TB, XDR-TB and TB/HIV co-infected...Open label trial of adjuvant immunotherapy with Dzherelo, Svitanok and Lizorm, in MDR-TB, XDR-TB and TB/HIV co-infected...
Open label trial of adjuvant immunotherapy with Dzherelo, Svitanok and Lizorm, in MDR-TB, XDR-TB and TB/HIV co-infected patients receiving anti-tuberculosis therapy under DOT. Міжнародна діяльність. Екомед
HIV-HCV RNA loads and liver failure in coinfected patients with coagulopathy | HaematologicaHIV-HCV RNA loads and liver failure in coinfected patients with coagulopathy | Haematologica
BACKGROUND AND OBJECTIVE: The aim of this study was to measure contemporaneously HCV-RNA load, HIV-RNA load and CD4+ lymphocyte count in HCV/HIV coinfected patients with coagulopathy and to examine the relationship between these parameters and the liver failure. DESIGN AND METHODS: A cross-sectional study was performed on 54 patients with severe coagulopathy: 39 HCV/HIV coinfected and 15 HCV+/HIV- comparable for age and HCV exposure time. HCV-RNA and HIV-RNA load, CD4+ lymphocyte count, biochemical and ultrasonographic parameters were evaluated at the time of entry to the study. RESULTS: Mean HCV-RNA load was significantly higher in coinfected patients (643,872 717,687 copies/mL) than in HCV+/HIV- (mean 161,573 276,896 copies/mL) (p = 0.01). The 39 HCV/HIV coinfected patients had a mean HIV-RNA load of 205,913 456,311 copies/mL (range 4,000-2,500,000) and a mean CD4+ lymphocyte count of 206.5171/microL (range 5-693). Five of the 39 (12.8%) coinfected patients had liver failure. In these five ...
Screening of differentially expressed gene in HIV/HCV co-infected patients | Retrovirology | Full TextScreening of differentially expressed gene in HIV/HCV co-infected patients | Retrovirology | Full Text
Eligibility Criteria including 20-40 year-old male, similar social-economic background, treatment naive, same transmission route methods (Sex or Injection drug), and CD4 count ,200 cells/mm3. All research objects signed on informed consent. The project proceeded after approval of the local REC.. Human blood samples were collected from 13 HIV/HCV coinfected patients, 8 mono infected patients, and 8 normal control. At first, CD4 and CD8 positive T cells were separated with magnetic activated cell sorting, then followed by RNA extraction. After reverse transcripted to cDNA with anchor primer and amplified with random primers, the products were run on PAGE electrophoresis followed by silver stain. The bands with different expression level were extracted from gel and cloned for sequencing. The expression changes were confirmed by SYBR Green real-time quantitative PCR. ...
IFN-FREE THERAPY IS EFFECTIVE AND SAFE FOR HCV RECURRENCE IN LT HCV/HIV CO-INFECTIONIFN-FREE THERAPY IS EFFECTIVE AND SAFE FOR HCV RECURRENCE IN LT HCV/HIV CO-INFECTION
Interferon (IFN)-based therapy against hepatitis C virus (HCV) recurrence after liver transplantation (LT) has poor effectiveness and tolerability both in HCV-mono-infected (≈30% of sustained virological response [SVR]) and HIV-HCV co-infected LT recipients (≈20% of SVR). Only small case series have reported on the use of direct antiviral agents (DAAs) in LT HCV/HIV co-infected recipients. The aim of this study is to report the effectiveness and safety of IFN-free regimens in a nationwide cohort of HIV HCV co-infected individuals having undergone LT ...
Immune activation and microbial translocation in liver disease progression in HIV/hepatitis co-infected patients : results from...Immune activation and microbial translocation in liver disease progression in HIV/hepatitis co-infected patients : results from...
BACKGROUND: We evaluated whether immune activation (IA) and microbial translocation (MT) might play a role in accelerating liver disease progression in HIV-HBV/HCV co-infected patients. METHODS: ART-naïve HIV/viral hepatitis co-infected patients from Icona with a CD4 cell count ,200/μl and with a known date of prior HIV neg/pos tests and ≥1 plasma sample stored were included in the study. Plasma MT (LPS, sCD14) and IA (IL-6,TNFα) were measured using ELISA while activated CD8 + CD38 + HLA-DR + were measured by flow cytometry, with one measurement being performed for all patients and two measurements for a smaller group of subjects. The association between these biomarkers and the time to i) a single ALT ,200 IU/l and ii) a Fib-4 ,1.45 was also investigated. A standard survival analysis with robust standard errors was used for all evaluations. Follow-up was censored at patients last clinical follow-up. RESULTS: We studied 127 HIV-infected hepatitis viruses co-infected patients (118 HCV, 9 ...
HIV/HCV Co-infection: HAART and CVD Pathophysiology - University of Miamis Research ProfilesHIV/HCV Co-infection: HAART and CVD Pathophysiology - University of Miami's Research Profiles
DESCRIPTION (provided by applicant): HAART medication has been implicated as a potential etiopathological source of the increased prevalence of cardiovascular disease (CVD) risk in HIV infected persons. Although recent reports indicate an increasing rate of Hepatitis C virus (HCV) coinfection in the HIV-infected, and HCV infection independently communicates increased cardiovascular risk, the literature has not adequately assessed the possible role of HCV coinfection in cardiovascular pathogenesis in HIV spectrum disease. Comorbid conditions known as dysmetabolic syndrome X are independently associated with both HIV and HCV infection; the syndrome includes alterations in fat deposition, cardiac structure and function, and vascular endothelial function, as well as dyslipidemia and insulin resistance. Two pathophysiological sources in HIV and HCV infected persons is increased pathogen burden and diminished infection surveillance, which result in an elevation of proinflammatory processes. These ...
diet w/hiv hcv co-infection - Forum on Hepatitis and HIV Coinfection - TheBody.comdiet w/hiv hcv co-infection - Forum on Hepatitis and HIV Coinfection - TheBody.com
I cannot advise about your diet question, because I am not a nutritionist. I would discuss that with someone with excellent expertise in this field. I am glad that you are feeling well, but your...
amfARs TREAT Asia Program Begins Hepatitis C Treatment Study in HIV Co-Infected Patients in Asia | Positively PositiveamfAR's TREAT Asia Program Begins Hepatitis C Treatment Study in HIV Co-Infected Patients in Asia | Positively Positive
PositivelyPositive.ca is designed to create awareness around the many HIV and AIDS issues and promotes messages of positive living with HIV
Image Gallery : Management of Hepatitis B and C in HIV Co-Infected Patients : JAIDS Journal of Acquired Immune Deficiency...Image Gallery : Management of Hepatitis B and C in HIV Co-Infected Patients : JAIDS Journal of Acquired Immune Deficiency...
Wolters Kluwer Health may email you for journal alerts and information, but is committed to maintaining your privacy and will not share your personal information without your express consent. For more information, please refer to our Privacy Policy ...
Leprosy Mailing List Blog: October 2016Leprosy Mailing List Blog: October 2016
Abstract We conducted a literature review based on current scientific articles and practice experiences to summarize information and guidance principles to make these following suggestions to health care practitioner: Before commencing BU treatment and before starting ART, all HIV/MU co-infected patients should be actively screened for tuberculosis. BU treatment should be commenced before commencing ART and provided for 8 weeks duration. And for the common sense, based on TB management experience HIV, TB and BU control programs should work together in a cooperative framework, mainly in tropical and subtropical regions where the prevalence of these 3 diseases seems high. As, HIV/BU co-infection is increasing in tropical regions, more study should be initiated to determine the cumulative effect of IRIS and paradoxical reactions in BU/HIV co-infected patients on ART and anti-mycobacterial agents, in order to set up recommendation as it was done in TB/HIV co-infection for proper management ...
HCV Research and News: 07/24/10HCV Research and News: 07/24/10
BACKGROUND/AIMS: Treatment of chronic HCV infection has become a priority in HIV+ patients, given the faster progression to end-stage liver disease. The primary endpoint of this study was to evaluate and compare antiviral efficacy of Peginterferon alpha 2a plus ribavirin in HIV-HCV co-infected and HCV mono-infected patients, and to examine whether 6 months of therapy would have the same efficacy in HIV patients with favourable genotypes 2 and 3 as in mono-infected patients, to minimise HCV-therapy-related toxicities. Secondary endpoints were to evaluate predictors of sustained virological response (SVR) and frequency of side-effects. METHODS: Patients with genotypes 1 and 4 were treated for 48 weeks with Pegasys 180 microg/week plus Copegus 1000-1200 mg/day according to body weight; patients with genotypes 2 and 3 for 24 weeks with Pegasys 180 microg/week plus Copegus 800 mg/day. RESULTS: 132 patients were enrolled in the study: 85 HCV mono-infected (38: genotypes 1 and 4; 47: genotypes 2 and ...
Most recent papers with the keyword carotid web | Read by QxMDMost recent papers with the keyword carotid web | Read by QxMD
The incidence of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) coinfection has been increasing with over 10 million people affected globally. The role biomarkers play as predictors of cardiovascular disease (CVD) risk among coinfected individuals is not well defined. We aimed to systematically review current evidence describing CVD biomarkers among individuals with HIV/HCV coinfection. We searched EMBASE, CINAHL, Google Scholar, PubMed, and Web of Science from inception to June 2017. MeSH terms and keywords were used to identify studies with information on HIV/HCV coinfection and CVD biomarkers (structural, functional, and serological) such as carotid intima-media thickness (CIMT), endothelial markers, C-reactive protein (CRP), homocysteine, and lipids ...
Abacavir/lamivudine could be driving liver damage in ART-treated patients with HIV/HCV co-infection | aidsmapAbacavir/lamivudine could be driving liver damage in ART-treated patients with HIV/HCV co-infection | aidsmap
Approximately two-thirds of patients received the Truvada backbone (PI = 67%; NNRTI = 69%).. The authors first analysis showed that PI therapy was associated with an 11% increase in APRI score over five years. This compared to a five-year increase of 7% with NNRTI therapy. The median APRI score was 32% higher among Truvada users when compared to patients treated with Kivexa.. Despite this, changes in APRI score appeared to be driven by use of the Kivexa backbone. The median five-year increase was 16% when combined with a PI and 11% when used with a NNRTI.. The investigators believe that the association between Kivexa and liver damage is biologically plausible. "ABC can reduce hepatocyte proliferation and increase intracellular lipids and lactate levels," they explain. "ABC is extensively metabolised by the liver.". In contrast, Truvada users did not experience a significant increase in APRI score during follow-up when used with either a PI (8% increase over five years) or NNRTI (3% increase ...
No Surprise - The Lead In Treating HCV/HIV Co-Infection Belongs To Incivek®No Surprise - The Lead In Treating HCV/HIV Co-Infection Belongs To Incivek®
First, a word of caution -- both legacy Schering-Ploughs Victrelis® (boceprevir), and Vertex Pharmas Incivek® (telaprevir) are still investigational drugs -- when we speak about treating HCV/HIV co-infected patients. That is, FDA has not approved either drug for use in such patients -- the companies drugs are only labeled to treat Hep C (or HCV),…
Impact of maternal HIV-HBV coinfection on pregnancy outcomes in an underdeveloped rural area of southwest China | Sexually...Impact of maternal HIV-HBV coinfection on pregnancy outcomes in an underdeveloped rural area of southwest China | Sexually...
Results A total of 13 198 pregnant women were included in our study, and among them, 99.1% were Yi people and 90.8% lived in rural area. The seroprevalences of HIV and HBV infections and HIV-HBV coinfection were 3.6% (95% CI: 3.2% to 3.9%), 3.2% (95% CI: 2.9% to 3.5%) and 0.2% (95% CI: 0.1% to 0.2%) among the pregnant women, respectively. Maternal HIV-HBV coinfection was a risk factor for low birth weight (adjusted OR (aOR)=5.52, 95% CI: 1.97 to 15.40). Compared with the HIV mono-infection group, the risk of low birth weight was significantly higher in the HIV-HBV coinfection group (aOR=3.62, 95% CI: 1.24 to 10.56). Maternal HIV infection was associated with an increased risk of low birth weight (aOR=1.90, 95% CI: 1.38 to 2.60) and preterm delivery (aOR=2.84, 95% CI: 1.81 to 4.47). Perinatal death was more common when mothers were infected with HBV (aOR=2.85, 95% CI: 1.54 to 5.26). ...
Safety and tolerability of etravirine in hepatitis B and/or C co-infected patients in DUET-1 and DUET-2: pooled 48-week resultsSafety and tolerability of etravirine in hepatitis B and/or C co-infected patients in DUET-1 and DUET-2: pooled 48-week results
events (AEs) and laboratory parameters were analysed. At baseline, HBV and/or HCV status was known for 1,130 HIV-1-infected patients. Of these, 140 patients (12.3%) were co-infected with HBV and/or HCV; the sample size was too small to compare HBV and HCV groups separately. Median treatment duration for this analysis was 52.3 vs 51.0 weeks in the ETR + BR and placebo + BR groups, respectively. In co-infected patients, grade 3 or 4 AEs, serious AEs and deaths were less frequent with ETR than with placebo. Grade 3 or 4 AST/ALT elevations were more frequent in co-infected patients receiving ETR, however the differences between the ETR and placebo groups was small. The incidence of grade 3 or 4 hepatic AEs was similar in both treatment groups ...
Most recent papers with the keyword hiv miRNA | Read by QxMDMost recent papers with the keyword hiv miRNA | Read by QxMD
Liver disease is one of the main contributors to the increased levels of morbidity and mortality seen in the HIV-1-infected, ART-treated population. Circulating miRNAs, particularly those located inside extracellular vesicles, are seen as promising biomarkers for a number of human disease conditions, including liver-related diseases. Here, we show that serum levels of miR-122 and miR-200a are greater in HIV/HCV co-infected individuals compared to HIV-1 mono-infected individuals. We also show that miR-122 and miR-200a are elevated in ART-treated, HIV-1-infected individuals prior to the development of fatal liver disease, suggesting that these miRNA may have some potential clinical utility as biomarkers ...
Ledipasvir and Sofosbuvir in HIV Coinfection - TheBodyPRO.comLedipasvir and Sofosbuvir in HIV Coinfection - TheBodyPRO.com
Researchers enrolled 50 HIV/HCV coinfected individuals with severe liver injury (cirrhosis) and assigned them to receive 12 weeks of ledipasvir + ...
Treatment for herpes in patients co-infected with herpes and HIV could delay HIV disease progression | EurekAlert! Science NewsTreatment for herpes in patients co-infected with herpes and HIV could delay HIV disease progression | EurekAlert! Science News
Most people who are infected with HIV-1 are dually infected with herpes simplex virus type 2 (HSV2). New research shows that aciclovir, used to treat HSV2, could delay HIV-1 disease progression in patients co-infected with both conditions. The findings are published in an article online first and in an upcoming edition of the Lancet.
Texas Biomed researchers pinpoint important mechanism behind TB/HIV co-infectionTexas Biomed researchers pinpoint important mechanism behind TB/HIV co-infection
Tuberculosis and HIV - two of the worlds deadliest infectious diseases - are far worse when they occur together. Now, Texas Biomedical Research Institute researchers have pinpointed an important mechanism at work in this troubling health problem.
C-type Lectin Receptor Pathways in the Pathogensis of TB/HIV Co-infection - UTMB Health Research Expert ProfilesC-type Lectin Receptor Pathways in the Pathogensis of TB/HIV Co-infection - UTMB Health Research Expert Profiles
Powered by Pure, Scopus & Elsevier Fingerprint Engine™ © 2020 Elsevier B.V "We use cookies to help provide and enhance our service and tailor content. By continuing you agree to the use of cookies. Log in to Pure. ...
Modelling the geographical distribution of co-infection risk from single-disease surveys - Schur - 2011 - Statistics in...Modelling the geographical distribution of co-infection risk from single-disease surveys - Schur - 2011 - Statistics in...
Background: The need to deliver interventions targeting multiple diseases in a cost-effective manner calls for integrated disease control efforts. Consequently, maps are required that show where the risk of co-infection is particularly high. Co-infection risk is preferably estimated via Bayesian geostatistical multinomial modelling, using data from surveys screening for multiple infections simultaneously. However, only few surveys have collected this type of data.. Methods: Bayesian geostatistical shared component models (allowing for covariates, disease-specific and shared spatial and non-spatial random effects) are proposed to model the geographical distribution and burden of co-infection risk from single-disease surveys. The ability of the models to capture co-infection risk is assessed on simulated data sets based on multinomial distributions assuming light- and heavy-dependent diseases, and a real data set of Schistosoma mansoni-hookworm co-infection in the region of Man, Côte dIvoire. ...
HCV: coinfection w/HIV and HBV - Forum on Hepatitis and HIV Coinfection - TheBody.comHCV: coinfection w/HIV and HBV - Forum on Hepatitis and HIV Coinfection - TheBody.com
Good question. About 30-40% of the approximately 1 million people with HIV have HCV. About 10% of the HIV poplulation has HBV. There is a small overlap of about 3-5% who have all three. These are at...
robust - Newsemiarobust - Newsemia
Related Articles Multinomial modelling of TB/HIV co-infection yields a robust predictive signature and generates hypotheses about the HIV+TB+ disease state. PLoS One. 2019;14(7):e0219322 Authors: Duffy ...
Viral and bacterial co-infections are pervasive in severe COVID-19 patientsViral and bacterial co-infections are pervasive in severe COVID-19 patients
A large group of researchers from China recently characterized microbial co-infections in the respiratory tract of hospitalized coronavirus disease (COVID-19) patients and demonstrated a high prevalence of both viral and bacterial co-infections - particularly in individuals presenting with severe disease.
Coinfection; Mixed InfectionCoinfection; Mixed Infection
... On-line free medical diagnosis assistant. Ranked list of possible diseases from either several symptoms or a full patient history. A similarity measure between symptoms and diseases is provided.
Inhibition of host TRAFs by virus | Herpes AdviceInhibition of host TRAFs by virus | Herpes Advice
The nonparametric Mann-Whitney U test was used to assess the difference in the geometric mean titers (GMTs) of anti-HHV8 IgG between the HHV8 mono-infection and co-infection groups. Triglyceride (TG) was measured with a Triglyceride kit (Wako, Tokyo, Japan) according to the manufacturers instructions. Differences were considered significant when p ≤ 0.05. Results from phylogenetic analyses suggest networks of HCV transmission among these men. Next we assessed dose-dependency of ODN 320, with concentrations ranging from 10 to 320 nM. Ind. Studies were rated as low, moderate or high risk of bias.. SDC2-specific monoclonal antibody (2965) was from R&D Systems. siRNA target sequences were: AAGGGTTCCTGCTTTCACAGA for CypA; AAGGTGGAGAGAGCACCAAGACA for CypB; GTGACATCACCACTGGAGATG for CypC; AACCTGCTAAATTGTGCGTTA for CypD; and AATTCTCCGAACGTGTCACGT for control. These seven helicase motifs essentially form the motor which converts the chemical energy derived from ATP hydrolysis into a mechanical force ...
西藏自治区2015年暗娼等7类艾滋病重点人群HIV、梅毒和HCV横断面调查 - 中华流行病学杂志西藏自治区2015年暗娼等7类艾滋病重点人群HIV、梅毒和HCV横断面调查 - 中华流行病学杂志
方法. 2015年6－12月对西藏自治区的拉萨市、昌都市、林芝市、日喀则市、山南市、阿里地区、那曲地区共7个市（地区）及25个县（区）的暗娼等7类艾滋病重点人群开展横断面调查。样本量分别为暗娼人群2 000人、MSM人群200人、注射吸毒者200人、男性流动人群1 200人、青年学生5 600人、医院就诊人群为2015年6－12月在综合医院就诊者、孕产妇为2015年6－12月在综合医院和妇幼保健机构首次接受孕期和围产期检查的门诊或住院孕产妇。收集人口学和行为学信息，进行HIV、梅毒和HCV血清学检测。计数资料采用率或构成比进行统计描述。 ...
From Individuals to Populations: Immunological and Epidemiological Significance of Co-infection in the Dynamics of HIV | Open...From Individuals to Populations: Immunological and Epidemiological Significance of Co-infection in the Dynamics of HIV | Open...
Immunological activation in response to an invading organism is essential in order to support an effective host response to an invading pathogen. Paradoxic..
Recombinant hepatitis c virus Hepatitis C Virus Genotype 6 NS3 protein (ab67974)Recombinant hepatitis c virus Hepatitis C Virus Genotype 6 NS3 protein (ab67974)
Buy our Recombinant hepatitis c virus Hepatitis C Virus Genotype 6 NS3 protein. Ab67974 is an active protein fragment produced in Escherichia coli and has been…
Recombinant Hepatitis C Virus Hepatitis C Virus NS4 protein (ab49026) ProtocolsRecombinant Hepatitis C Virus Hepatitis C Virus NS4 protein (ab49026) Protocols
There are no specific protocols for Recombinant Hepatitis C Virus Hepatitis C Virus NS4 protein (ab49026). Please download our general protocols booklet
Epidemiology and genomics of Mycobacterium tuberculosis in TB/HIV co-infection in VietnamEpidemiology and genomics of Mycobacterium tuberculosis in TB/HIV co-infection in Vietnam
TB and human HIV infection have mutually detrimental effects that complicate patient management and global TB control efforts. The overall aim was to improve our understanding of the TB epidemiology, drug resistance profile, and transmission dynamics among people living with HIV in Vietnam. The global epidemiology of TB, HIV and TB/HIV co-infection in low and high incidence countries with a specific focus on the Asia-Pacific region and relevant disease trends within Vietnam was described. Findings from a retrospective study with 200 M. tuberculosis isolates from TB/HIV co-infected patients in Ho Chi Minh city between 2009 and 2014, showed that TB/HIV co-infection in Vietnam was associated with high rates of drug resistant TB up to 42.0%. Beijing and Indo-Oceanic lineage strains were most common in those patients. M. tuberculosis transmission among people living with HIV appeared to be limited, with most transmission occurring within the community. There were high rates of transmitted drug ...
Early ribavirin pharmacokinetics, HCV RNA and alanine aminotransferase kinetics in HIV/HCV co-infected patients during...Early ribavirin pharmacokinetics, HCV RNA and alanine aminotransferase kinetics in HIV/HCV co-infected patients during...
Early ribavirin pharmacokinetics, HCV RNA and alanine aminotransferase kinetics in HIV/HCV co-infected patients during treatment with pegylated interferon and ribavirin, Academic Article ...
Incidence and predictors of LTFU among adults with TB/HIV co-infection in two governmental hospitals, Mekelle, Ethiopia, 2009...Incidence and predictors of LTFU among adults with TB/HIV co-infection in two governmental hospitals, Mekelle, Ethiopia, 2009...
Lost to follow-up (LTFU) negatively affects the treatment success of Anti-Retroviral Therapy (ART) and thus, increases Tuberculosis-Human Immunodeficiency Virus (TB/HIV) related morbidity, mortality and hospitalization. However, the incidence and predictors of loss to follow up (LTFU) among adults with TB/HIV co-infection have not yet well-investigated in Ethiopia. Therefore, this study was aimed at investigating the incidence and predictors of LTFU in the study setting in particular. A facility based retrospective cohort study was employed among 305 (114 anemic and 191 normal) TB/HIV co-infected adults in two governmental hospitals (Mekelle Hospital and Ayder Comprehensive Specialized Hospital), Mekelle, Ethiopia from 2009 to 2016 and data were collected using checklist. Besides to descriptive statistics, a cox regression analysis was applied to identify statistically significant predictors of LTFU at 5% level of significance. Eventually, the Adjusted Hazard Ratio (AHR) and 95% Confidence Interval (CI)
The role of social determinants on tuberculosis/HIV co-infection mortality in southwest Ethiopia: a retrospective cohort studyThe role of social determinants on tuberculosis/HIV co-infection mortality in southwest Ethiopia: a retrospective cohort study
BACKGROUND: The role played by social determinants of health including social, economic, environmental and cultural factors in influencing health outcomes for many health conditions has been widely described. However, the potential impact of these factors on morbidity and mortality of infectious diseases particularly tuberculosis (Tb)/HIV co-infection mortality is scantly addressed. We assessed the role that social determinants play in Tb/HIV co-infection mortality in southwest Ethiopia. METHODS: A retrospective cohort study collated Tb and HIV data from Jimma University Teaching Hospital, Southwest Ethiopia for the period of September 2010 and August 2012. Data analysis was conducted using STATA version 14 for mackintosh. Both descriptive and inferential statistics analyses were performed. Logistic regression was applied to identify factors associated with Tb/HIV co-infection mortality at P value of ≤0.05 in the final model. RESULTS: Fifty-five (20.2 %) patients died during the study period. ...
Early Mortality Risk of HIV/Hepatitis B Virus Coinfected Patients Initiating ART | CROI ConferenceEarly Mortality Risk of HIV/Hepatitis B Virus Coinfected Patients Initiating ART | CROI Conference
Hepatitis B virus (HBV) co-infection, common in HIV-infected patients in sub-Saharan Africa, is associated with impaired immunological recovery while on antiretroviral treatment (ART), and worse clinical outcomes, even in the context of effective ART. A clear association between HBV co-infection and early mortality has not been shown in African settings and the impact of tenofovir-containing ART on outcomes is unknown.. The prevalence of hepatitis B surface antigen (HBsAg) was determined in a cohort of patients enrolling in an ART programme in Kenya between 2003 and 2012. Clinical outcomes, immunological and virological responses to ART were compared between HIV mono-infected and HIV/HBV co-infected patients using Cox regression. The impact of tenofovir-containing ART,phased in over the observation period, on outcomes was determined in an analysis adjusting for confounders relating to time and indication.. 7,155 patients were enrolled in the cohort and followed for 12,408 person years. HBsAg was ...
Hepatitis C co-infection is associated with an increased risk of incident chronic kidney disease in HIV-infected patients...Hepatitis C co-infection is associated with an increased risk of incident chronic kidney disease in HIV-infected patients...
Combination antiretroviral therapy (cART) has reduced mortality from AIDS-related illnesses and chronic comorbidities have become prevalent among HIV-infected patients. We examined the association between hepatitis C virus (HCV) co-infection and chronic kidney disease (CKD) among patients initiating modern antiretroviral therapy. Data were obtained from the Canadian HIV Observational Cohort for individuals initiating cART from 2000 to 2012. Incident CKD was defined as two consecutive serum creatinine-based estimated glomerular filtration (eGFR) measurements |60 mL/min/1.73m2 obtained ≥3 months apart. CKD incidence rates after cART initiation were compared between HCV co-infected and HIV mono-infected patients. Hazard ratios (HRs) and 95% confidence intervals (CIs) were estimated using multivariable Cox regression. We included 2595 HIV-infected patients with eGFR |60 mL/min/1.73m2 at cART initiation, of which 19% were HCV co-infected. One hundred and fifty patients developed CKD during 10,903 person
Study Attributes Elevated Liver Enzymes in HIV/hepatitis to Coinfection Rather Than Antiretrovirals ( Many HIV/hepatitis...Study Attributes Elevated Liver Enzymes in HIV/hepatitis to Coinfection Rather Than Antiretrovirals ( Many HIV/hepatitis...
Health,Many HIV/hepatitis coinfected individuals on antiretroviral therapy (A...The study investigated whether coinfected individuals on antiretro...ICoNA is an Italian prospective observational study of HIV-infected ...LEE was defined as alanine aminotransferase (ALT) levels (5 x the b...HBV or HCV coinfection use of ART baseline ALT and demographics w...,Study,Attributes,Elevated,Liver,Enzymes,in,HIV/hepatitis,to,Coinfection,Rather,Than,Antiretrovirals,medicine,medical news today,latest medical news,medical newsletters,current medical news,latest medicine news
Direct-Acting Antivirals Have Lower SVR Rates for HCV/HIV Coinfection - Infectious Disease AdvisorDirect-Acting Antivirals Have Lower SVR Rates for HCV/HIV Coinfection - Infectious Disease Advisor
Researchers assessed safety, efficacy, and tolerability of direct-acting antivirals in patients with hepatitis C and HIV coinfection and compared the results with patients with HCV mono-infection.
Lyme co-infections - Symptoms, Treatments and Resources for Lyme co-infectionsLyme co-infections - Symptoms, Treatments and Resources for Lyme co-infections
Lyme co-infections - MedHelps Lyme co-infections Center for Information, Symptoms, Resources, Treatments and Tools for Lyme co-infections. Find Lyme co-infections information, treatments for Lyme co-infections and Lyme co-infections symptoms.
Engaging HIV-HCV co-infected patients in HCV treatment: the roles played by the prescribing physician and patients beliefs ...Engaging HIV-HCV co-infected patients in HCV treatment: the roles played by the prescribing physician and patients' beliefs ...
The present study conducted in a large cohort of HIV-HCV infected patients enrolled and followed up in France shows that barriers to HCV treatment do not solely depend on patient characteristics and physicians perceptions of their patients. It highlights that patient beliefs about HCV treatment can also significantly delay HCV treatment initiation. The results suggest that general practitioners working in hospitals play a major role in engaging patients in HCV care. As expected and in accordance with current guidelines for HCV treatment prescription, we found that having a liver biopsy and presenting with severe fibrosis remain major clinical determinants of HCV treatment initiation. It is worthwhile noting that the study started when non-invasive procedures had just become available and their sensitivity to detect advanced liver disease in co-infected was not completely known. It is likely that the association found with having had a liver biopsy reflects common hospital practices at the ...
P3.203 Mortality Rates in HIV-1/2 Dual- and Mono-Infected Individuals: A Systematic Review and Meta-Analysis | Sexually...P3.203 Mortality Rates in HIV-1/2 Dual- and Mono-Infected Individuals: A Systematic Review and Meta-Analysis | Sexually...
Results Of the 631 identified titles, 7 articles met the inclusion criteria. Of these, 6 articles were included in the meta-analysis of HIV-D versus HIV mono-infected and 7 were included in the analysis of HIV-1 versus HIV-2 mono-infected people. The overall MRR of HIV-D versus HIV-1 was 1.11 (95% CI 0.95-1.30). The overall MRR of HIV-D versus HIV-2 was 1.81 (95% CI 1.43-2.30) and the MRR of HIV-1 versus HIV-2 was 1.86 (95% CI 1.44-2.39). ...
Regional Actors Addressing Tuberculosis in Africa: Comparative Advantages, Challenges, and OpportunitiesRegional Actors Addressing Tuberculosis in Africa: Comparative Advantages, Challenges, and Opportunities
The African continent has seen pronounced movement toward regionalism in recent years. Regional bodies are actively contributing to the development of many sectors, including health. In a region with over a quarter of the worlds tuberculosis (TB) cases and the highest prevalence of cases relative to population, they have a particularly important role to play in supporting global TB initiatives. Due to its more recent resurgence and new status as the leading infectious killer in the world, combined with the fact that the African region bears the highest TB and TB/HIV co-infection rates in the world and continues to struggle with multi-drug resistant TB, a large number of African regional actors have scaled up their efforts to combat the disease.Understanding how these actors operate, as well as their comparative advantages and challenges, will ensure that governments, policymakers, donors, and implementers partner with them effectively to prevent new TB infections and end preventable deaths. ...
Hepatitis C Virus (HCV) and HIV/HCV Coinfection: A Critical Review of Research and Treatment Volume I: Clinical Science -...Hepatitis C Virus (HCV) and HIV/HCV Coinfection: A Critical Review of Research and Treatment Volume I: Clinical Science -...
Summary There are many unresolved questions regarding treatment of HIV in people coinfected with HIV and HCV. There are no United States treatment ...
Bacterial coinfection in influenza: a grand rounds review. - PubMed - NCBIBacterial coinfection in influenza: a grand rounds review. - PubMed - NCBI
JAMA. 2013 Jan 16;309(3):275-82. doi: 10.1001/jama.2012.194139. Case Reports; Clinical Conference; Research Support, N.I.H., Intramural
S43 Polyfunctional T cells reveal the spectrum of tuberculosis in HIV co-infection through the identification of immunological...S43 Polyfunctional T cells reveal the spectrum of tuberculosis in HIV co-infection through the identification of immunological...
Results The proportion of participants with a CD8+ PPD-specific IFN-γ (p=0.001) or TNF-α (p=0.006) response closely mirrored stage of TB disease, whereas the equivalent CD4 response was unaffected. The proportion of CD4+ and CD8+ PPD-specific cells increased with TB stage for IFN-γ and TNF-α, but did not increase in HIV/TB co-infection compared with TB (Abstract S43 figure 1). When individual cytokine subsets were examined, the percentage of CD4+ and CD8+ cells producing IFN-γ, TNF-α or dual responses was higher in all participants with TB compared with LTBI. CD4+IL-2+ cells were reduced by HIV co-infection, especially IFN-γ+/IL-2+ cells (p=0.008) and this was apparent as a proportion of total cytokine response (p=0.016). ...
PPT - Treating coinfection in Asia: Challenges and unmet needs PowerPoint Presentation - ID:2091254PPT - Treating coinfection in Asia: Challenges and unmet needs PowerPoint Presentation - ID:2091254
Treating coinfection in Asia: Challenges and unmet needs. Anchalee Avihingsanon, MD, PhD HIV-NAT, Thai Red Cross AIDS Research Centre, Thailand July2, 2013. HIV/HCV coinfection: Public Health Challenges in Asia . prevalence, HCV genotype distribution and disease progression Slideshow 2091254 by roger
HIV With HBV/HCV Co-infection Tied to Higher Chance of CancerHIV With HBV/HCV Co-infection Tied to Higher Chance of Cancer
In HIV patients on anti-retroviral therapy (ART), chronic hepatitis B or C co-infection is linked to a higher incidence of non-Hodgkin s lymphoma (NHL).
Hepatitis c dating free pdfHepatitis c dating free pdf
Re: HCV Clinical Criteria for the treatment of Hepatitis C. Date: To whom it may and is on label for HIV/HCV co-infection and liver transplant patients with HCV. . Treatment with Interferon (IFN) and Ribavirin (RBV)-Free Regimens with ...
List | SBIR.govList | SBIR.gov
DESCRIPTION (provided by applicant): The overall goal of this application is to develop and validate a potential biomarker based assay to determine if it can be used as a noninvasive test to detect the stage of hepatic fibrosis and to predict fibrosis progression in HIV/HCV co-infected patients. Significant fibrosis and cirrhosis are premalignant conditions that greatly increase the risk of the de .... ...
Hepatitis B And HIV Coinfection - Virology and Clinical ManagementHepatitis B And HIV Coinfection - Virology and Clinical Management
Hepatitis B and HIV coinfection presents unique diagnostic and treatment challenges due to overlapping therapeutic agents and drug resistance. , an article published by the Physicians Research Network, New York City.
HCV and HIV Coinfection - Hepatitis C - MedHelpHCV and HIV Coinfection - Hepatitis C - MedHelp
Just wondering if HCV And HIV coinfection can cause delayed seroconversion and what is the window period for HCV because i am getting mixed messages.Some say 7 days with a HCV RNA others say 3 to 6 MON...
Superbug: May 2009Superbug: May 2009
A: We′re very interested in that question. As you know, the seasonal influenza in children we′ve been tracking pediatric deaths, and we have seen MRSA among seasonal flu cases in children at a higher rate than we had expected. MRSA is a big problem in the United States right now in terms of the community associated resistant staff or its infections. So far as we′ve been looking at the patients with the H1N1 virus, we don′t have evidence of coinfection. Not everybody has been tested for bacterial infections. But among the ones that have been tested, we aren′t seeing an important role for bacterial coinfection, including MRSA. I think this is an important issue for us to continue to follow, whether bacterial co-infections or bacterial pneumonias following the illness are featured. It′s a feature we′re interested in but haven′t seen this turn up yet ...
Visceral leishmaniasis-HIV coinfection: Time for Concerted Action | Speaking of MedicineVisceral leishmaniasis-HIV coinfection: Time for Concerted Action | Speaking of Medicine
In 2013, PLOS Neglected Tropical Diseases decided to dedicate a special collection to VL-HIV co-infection. With Ed Zijlstra, Asrat Hailu, and myself as guest editors, they sent out a call for papers. Today the Visceral Leishmaniasis-HIV Collection is launched, containing the first batch of submitted papers. Previously published content from across the various PLOS journals are also included. The collection will be expanded over time with novel publications published by PLOS.. VL-HIV coinfection is an emerging global problem. It is on the rise in South-America and the Indian subcontinent, which harbours more than half of the global VL burden. In North-West Ethiopia, up to 40% of patients with VL were found to be co-infected with HIV, mainly among seasonal migrant workers.. Currently, prognosis of VL-HIV coinfection is poor. In the setting where we work in Ethiopia, case fatality rates of up to 25% have been documented. Many patients do not respond to therapy, and if they do, around half relapse ...
Johns Hopkins Medicine: Find a DoctorJohns Hopkins Medicine: Find a Doctor
Expertise, Disease and Conditions: Acute Viral Hepatitis, HBV/HIV Coinfection, HCV/HIV Coinfection, Hepatitis B (HBV), Hepatitis C (HCV), HIV/AIDS, Infectious ...
Johns Hopkins Medicine: Find a DoctorJohns Hopkins Medicine: Find a Doctor
Expertise, Disease and Conditions: Acute Viral Hepatitis, HBV/HIV Coinfection, HCV/HIV Coinfection, Hepatitis B (HBV), Hepatitis C (HCV), HIV/AIDS, Infectious ...
Clinical Management Of Hepatitis C In Patients With And Without HIV CoinfectionClinical Management Of Hepatitis C In Patients With And Without HIV Coinfection
In this lecture Andy Talal reviews recent advances in HCV monotherapy and implications for HIV-HCV coinfection. , an article published by the Physicians Research Network, New York City.
LSHTM Research OnlineLSHTM Research Online
Deps, P; Lucas, S; Porro, AM; Maeda, SM; Tomimori, J; Guidella, C; Reuter, T; Oliveira, NS; Madureira, BP; Souza, VA; +4 more... Loureiro, RM; Alves, BL; Bellone, A; Lockwood, DN; (2013) Clinical and histological features of leprosy and human immunodeficiency virus co-infection in Brazil. Clinical and experimental dermatology, 38 (5). pp. 470-7. ISSN 0307-6938 DOI: https://doi.org/10.1111/ced.12028 Full text not available from this repository ...
PPT - Management of HIV in tuberculosis co-infected patients PowerPoint Presentation - ID:686136PPT - Management of HIV in tuberculosis co-infected patients PowerPoint Presentation - ID:686136
Learning objectives. Identify the optimal timing of antiretroviral therapy in patients with HIV/TB coinfectionRecognize factors that influence the selection of optimal concurrent HAART regimens in HIV/TB co-infected patientsRecognize and manage complications associated with concurrent treatment of Slideshow 686136 by lynde
Progress Curing HCV among People Living with HIV in the US | HHS.govProgress Curing HCV among People Living with HIV in the US | HHS.gov
On World AIDS Day, HHSs Corinna Dan discusses progress in improving hepatitis C (HCV) screening, care, and treatment for people living with HIV/HCV coinfection.
Hepatic Steatosis Affects More HIV Patients without HCV CoinfectionHepatic Steatosis Affects More HIV Patients without HCV Coinfection
Researchers elucidate the prevalence of hepatic steatosis in patients infected with HIV, as well as in patients coinfected with HIV and HCV.
Coinfection | CTDCoinfection | CTD
Simultaneous infection of a host organism by two or more pathogens. In virology, coinfection commonly refers to simultaneous infection of a single cell by two or more different viruses ...
Co-Infection Clinic in Boston | Tufts Medical CenterCo-Infection Clinic in Boston | Tufts Medical Center
The Co-Infection Clinic at Tufts Medical Center provides coordinate care to manage the complexities of treating patients with HIV and Hepatitis C.
Os determinantes da mortalidade por Tuberculose e TB-HIV no Sul do Brasil: Da abordagem...Os determinantes da mortalidade por Tuberculose e TB-HIV no Sul do Brasil: Da abordagem...
O estudo teve como objetivo analisar os determinantes sociais da saúde associados à mortalidade por TB e verificar as mortes precoces ocorridas por TB e TB/HIV e seus fatores associados, por meio de duas...
coinfectionscoinfections
Everybody has their own opinions about what treatment protocol is best, or what they believe is the correct way to treat Lyme disease. This post is not about me pushing my beliefs onto you, but about outlining the different types and some of the most popular forms of treatments to help you better understand the […]. ...
Prepare yourselves again, the World TB Day 2012 is approaching!Prepare yourselves again, the World TB Day 2012 is approaching!
The World TB Day 2012 Campaign has started with the website created by the StopTBPartnership. This is a critical year, as only 3 years are left to the 2015 deadline and still lots of questions should be anwered. What about children? coinfection with HIV? what about new vaccines, treatments? MDR/XDR? And all this with the finantial crisis overwhelming us all,…
Systemic elevation of proinflammatory interleukin-18 in human immunodeficiency virus (HIV)/hepatitis C virus (HCV) coinfection...Systemic elevation of proinflammatory interleukin-18 in human immunodeficiency virus (HIV)/hepatitis C virus (HCV) coinfection...
TY - JOUR. T1 - Systemic elevation of proinflammatory interleukin-18 in human immunodeficiency virus (HIV)/hepatitis C virus (HCV) coinfection versus HIV or HCV monoinfection. AU - Terilli Veenhuis, Rebecca. AU - Astemborski, Jacquie. AU - Chattergoon, Michael Anand. AU - Greenwood, Paige. AU - Jarosinski, Marissa. AU - Moore, Richard D. AU - Mehta, Shruti Hemendra. AU - Cox, Andrea. PY - 2017. Y1 - 2017. N2 - Background. Human immunodeficiency virus (HIV)/hepatitis C virus (HCV) coinfection and elevated interleukin (IL)-18 levels are both associated with enhanced progression of hepatic inflammation and increased risk of diabetes, kidney disease, and cardiovascular disease. IL-18 is a proinflammatory cytokine made upon activation of the inflammasome, an innate sensing system. We assessed whether increased IL-18 could explain the increased incidence and progression of inflammatory conditions seen with HIV/HCV coinfection. Methods. Serum samples from 559 subjects with HIV monoinfection, HCV ...
Rapidly growing mycobacteria in TB/HIV co-infection: a report of two cases focusing on difficulties in diagnosis and management...Rapidly growing mycobacteria in TB/HIV co-infection: a report of two cases focusing on difficulties in diagnosis and management...
TY - JOUR. T1 - Rapidly growing mycobacteria in TB/HIV co-infection: a report of two cases focusing on difficulties in diagnosis and management.. AU - Bonura, Celestino. AU - Giammanco, Anna. AU - Cala, Cinzia. AU - Di Carlo, Paola. AU - Mammina, Caterina. AU - Fasciana, Teresa Maria Assunta. PY - 2012. Y1 - 2012. N2 - Recent reports indicate an increase in rates of infection and disease due to rapidly growing mycobacteria (RGM) in patients with pre-existing chronic lung disease. Studies have described difficulties in correctly identifying closely related species, even when proper methodologies are adopted, and several different gene targets have been proposed. We describe two cases of RGM infection in a 29-year-old HIV-1 positive Congolese man and a 19-year-old HIV-1 positive Liberian woman, respectively, both with bronchiectasis due to previous Mycobacterium tuberculosis (MTB) infection. Mycobacterium porcinum and Mycobacterium bolletii were identified in bronchoalveolar lavage fluid and ...
Association between IL7R polymorphisms and severe liver disease in HIV/HCV coinfected patients: a cross-sectional study |...Association between IL7R polymorphisms and severe liver disease in HIV/HCV coinfected patients: a cross-sectional study |...
Interleukin-7 (IL-7) is a critical factor for T cell development and for maintaining and restoring homeostasis of mature T cells. Polymorphisms at α-chain of the IL-7 receptor (IL7R or CD127) gene are related to evolution of HIV-infection, but there are no data concerning the evolution of hepatitis C virus (HCV) infection. The aim of this study was to analyze the association between IL7R polymorphisms and severe liver disease in HCV/HIV coinfected patients. We performed a cross-sectional study in 220 naïve patients who underwent a liver biopsy. IL7R polymorphisms (rs6897932, rs987106 and rs3194051) were genotyped using the GoldenGate® assay. The outcome variables were: (a) liver biopsy: advanced fibrosis (F ≥ 3), severe activity grade (A3); (b) non-invasive indexes: advanced fibrosis (APRI ≥1.5 and FIB-4 ≥3.25). Logistic regression analysis was used to investigate the association between IL7R polymorphisms and outcome variables. This test gives the differences between groups and the odds ratio
June 2016 - Blogging NeuroVirologyJune 2016 - Blogging NeuroVirology
Papers published in the June issue of the Journal of NeuroVirology focus on a variety of research topics, including: epigenetic aging in the brain during HIV infection; immune responses in ganglia during simian varicella virus infection; and effects of HIV/HCV co-infection on white matter. Continue reading JNV - June 2016. ...
CYTOKINE RESPONSE ASSOCIATED WITH HEPATITIS C VIRUS CLEARANCE IN HIV COINFECTED PATIENTS INITIATING PEG INTERFERON- BASED...CYTOKINE RESPONSE ASSOCIATED WITH HEPATITIS C VIRUS CLEARANCE IN HIV COINFECTED PATIENTS INITIATING PEG INTERFERON- BASED...
CYTOKINE RESPONSE ASSOCIATED WITH HEPATITIS C VIRUS CLEARANCE IN HIV COINFECTED PATIENTS INITIATING PEG INTERFERON- BASED THERAPY.
The influence of different helminth infection phenotypes on immune responses against HIV in co-infected adults in South Africa.The influence of different helminth infection phenotypes on immune responses against HIV in co-infected adults in South Africa.
Abstract Background The convergent distribution of the Human Immunodeficiency Virus (HIV) and helminth infections has led to the suggestion that infection with helminths exacerbates the HIV epidemic in developing countries. In South Africa, it is estimated that 57% of the population lives in poverty and carries the highest burden of both HIV and helmith infections, however, the disease interactions are under-researched. Methods We employed both coproscopy and Ascaris lumbricoides-specific serum IgE to increase diagnostic sensitivity and to distinguish between different helminth infection phenotypes and their effects on immune responses in HIV co-infected individuals. Coproscopy was done by formol ether and Kato Katz methods. HIV positive and negative adults were stratified according to the presence or absence of A. lumbricoides and/or Trichuris trichuria eggs with or without elevated Ascaris IgE. Lymphocyte subsets were phenotyped by flow cytometry. Viral loads, serum total IgE and eosinophils ...
Global TB data, according to the World Health Organisations 2016 Global Tuberculosis Report: | ConfidenteGlobal TB data, according to the World Health Organisation's 2016 Global Tuberculosis Report: | Confidente
Namibia is one of the top ten countries most affected by tuberculosis infection in the world. The WHO reported Namibia to have a case reporting rate of 489 per 100,000 population in 2015, with an esti-mated TB/HIV co-infection rate around 40 percent. Tuberculosis is a serious health threat, especially for people living with HIV. People living with HIV are more likely than others to become sick with TB. People infected with HIV, who also have either latent (dormant) TB infection or ac-tive TB disease, can be effectively treated.. ...
Cross-Cutting Budget Attribution(s) - Operational Plan ReportCross-Cutting Budget Attribution(s) - Operational Plan Report
Hiv/aids is the leading cause of maternal death and the maternal mortality rate in Zimbabwe nearly doubled between 1994 and 2007. Zimbabwe also has a very high tb/hiv co-infection rate (at 80%)
Boston Medical Center says five patients may have been exposed to Hepatitis B virus - Hepatitis C BlogBoston Medical Center says five patients may have been exposed to Hepatitis B virus - Hepatitis C Blog
DAA Treatment in Donor HCV-positive to Recipient HCV-negative Heart Transplant This is a proof of concept, single center study for the donation of HCV-positive hearts to HCV negative recipient patients, with preemptive, interventional treatment with 12 weeks of commercially available … Continue reading → The post DAA Treatment in Donor HCV-positive to Recipient HCV-negative Heart ...
Extracellular Signal-Regulated Kinase - Drug Resistance to EGFR Inhibitors in Lung CancerExtracellular Signal-Regulated Kinase - Drug Resistance to EGFR Inhibitors in Lung Cancer
Background Ahead of routine screening process of blood items many sufferers with haemophilia were infected with hepatitis C computer virus (HCV) Zaurategrast and have subsequently gone on to develop end-stage liver disease (ESLD). and 4 (22%) experienced hepatocellular carcinoma. Median intra-operative blood loss was 4.2 l (range 0.8-12) and all received coagulation factor support peri-operatively. Coagulation was unsupported by 72 h post-operatively in all recipients. Two sufferers developed problems as a complete consequence of post-operative bleeding. At a median follow-up of 90 a few months 8 sufferers have passed away including 4 from the 5 sufferers which were HIV positive. The median success of sufferers with and without HIV co-infection was 26 and 118 a few months respectively. Bottom line LT in sufferers with haemophilia treatments the coagulation disorder and in the Zaurategrast lack of HIV/HCV co-infection is certainly connected with long-term individual success. = 5) ahead of 1997 or ...
DSC000101 | Partners in Animal HealthDSC000101 | Partners in Animal Health
Concurrent infections, such as colibacillosis, are frequent in chronic Mycoplasma infections. This image shows severe perihepatitis and pericarditis. The highest morbidity and mortality in Mycolplasma infections is usually associated with the presence of concurrent infections and environmental stress, which exacerbate the underlying disease ...
British Library EThOS: The immune response in Influenza A-S. pneumoniae coinfectionBritish Library EThOS: The immune response in Influenza A-S. pneumoniae coinfection
Streptococcus pneumoniae coinfection is a major cause of influenza-associated mortality. In this thesis the underlying disease mechanisms and the role of the immune response are investigated in a mouse model. Coinfection with otherwise mild influenza and S. pneumoniae strains is shown to synergistically cause mortality and severe disease. Loss of bacterial but not viral control, and subsequent outgrowth, is identified as the main driver of mortality. Influenza-mediated immune impairment and lung damage have been proposed as mechanisms of coinfection. Here the aspects of the immune response profiled are not impaired; in contrast, coinfection induces a strong proinflammatory cytokine response and an influx of functional neutrophils. Depletion of neutrophils or TNF-α blockade exacerbates disease and bacterial outgrowth, showing these aspects of the immune response are protective. In addition to profiling the downstream response to bacterial outgrowth, the upstream causes of bacterial colonization ...
May | 2018 | Ras signalMay | 2018 | Ras signal
51 Limketkai BN, Mehta SH, Sutcliffe CG et al. Relationship of liver disease stage and antiviral therapy with liver-related events and death in adults coinfected with HIV/HCV. JAMA 2012; 308: 370-378. 52 Jain MK, Seremba E, Bhore R et al. Change in fibrosis score as a predictor of mortality among HIV-infected patients. with viral hepatitis. AIDS Patient Care STDS 2012; 26: 73-80. 53 Cozzi Lepri A, Prosperi M, LoCaputo S et al. Fib4 is an independent predictor Selleckchem AZD5363 of serious liver disease among HIV-infected patients with or without HBV/HCV co-infection in the Icona foundation study. Infection 2010; 38: 73-74. 54 Vu TM, Sutcliff C, Mehta S et al. Baseline liver stiffness measured by transient elastography is independently associated with risk of end-stage liver disease and death among HIV/HCV co-infected adults. J Hepatol 2011; 54(Suppl 1): S470. 55 Martinez SM, Crespo G, Navasa M, Forns X. Noninvasive assessment of liver fibrosis. Hepatology 2011; 53: 325-335.. 56 Lin ZH, Xin YN, ...
Andrejs Ivanovs | RSUAndrejs Ivanovs | RSU
Raksti​​. Analysis of the spatiotemporal development of hematopoietic stem and progenitor cells in the early human embryo / J.Easterbrook, S.Rybtsov, A.Ivanovs ...[et al.] // Stem Cell Reports. - Vol.12, No.5 (2019, May), p.1056-1068. - Web of Science un/vai Scopus. - DOI: 10.1016/j.stemcr.2019.03.003. Cone beam computed tomography evaluation of maxillary sinus before and after sinus floor elevation / L.Neimane, L.Zamure, V.Klimecs, A.Grišuļonoks, A.Skaģers, A.Ivanovs // Proceedings of the Latvian Academy of Sciences. Sect.B. - Vol.73, No.4 (2019, Aug.), p.387-392. - Web of Science un/vai Scopus. - DOI: 10.2478/prolas-2019-0060. Difference in markers of microbial translocation and cell apoptosis in HIV monoinfected and HIV/HCV coinfected patients / M.Madelane, A.Krumina, R.Simanis, G.Skenders, A.Ivanovs, G.Sture, L.Viksna // Proceedings of the Latvian Academy of Sciences. Sect.B. - Vol.73, No.4 (2019, Aug.), p.304-311. - Web of Science un/vai Scopus. - DOI: 10.2478/prolas-2019-0048. Risk ...
TB/HIV Coinfection and Other Medical Co-Morbidity in Older Adults (50 - 64 Years) in Botswana: Evidence from 2013 Botswana AIDS...TB/HIV Coinfection and Other Medical Co-Morbidity in Older Adults (50 - 64 Years) in Botswana: Evidence from 2013 Botswana AIDS...
Background: Many older adults (50 - 64 years) in Botswana with HIV do not know they are infected with TB. Some with TB disease are unaware of their HIV status, yet HIV/TB coinfection is high. The study aims to determine the prevalence of TB among older adults with HIV, their HIV/AIDS knowledge and vulnerability to hypertension, diabetes and asthma using the 2013 BAIS IV data. Material and Methods: The BAIS IV study, from which the data for this article is derived, used a stratified two-stage probability sampling design. The first stage was the selection of 297 Enumeration Areas (EAs) as Primary Sampling Units and second stage was selection of households (5,415) in the EAs. The study targeted all usual members of the selected households aged 6 weeks and above for the Biomarker or testing for HIV and those aged 10 - 64 years old for the behavioral questionnaire. Results: The study shows that the older adults (50 - 64 years) with TB have a low level of education and HIV prevalence is very high (44% for age
HCV Research and News: The regulatory process in Japan for SimeprevirHCV Research and News: The regulatory process in Japan for Simeprevir
This site contains copyrighted material the use of which has not always been specifically authorized by the copyright owner. It is being made available in an effort to advance the understanding of Hepatitis C, New hepatitis c drugs, Related clinical trials and ongoing research, HIV/HCV coinfection, HIV/AIDS, Other factors of liver disease, and so on. It is believed that this constitutes a fair use of any such copyrighted material as provided for in section 107 of the US Copyright Law. In accordance with Title 17 U.S.C. Section 107, the material on this site is distributed without profit to those who have expressed a prior interest in receiving the included information for research and educational purposes. If you wish to use copyrighted material from this site for purposes of your own that go beyond fair use, you must obtain permission from the copyright owner ...
HCV Research and News: 11/28/10HCV Research and News: 11/28/10
This site contains copyrighted material the use of which has not always been specifically authorized by the copyright owner. It is being made available in an effort to advance the understanding of Hepatitis C, New hepatitis c drugs, Related clinical trials and ongoing research, HIV/HCV coinfection, HIV/AIDS, Other factors of liver disease, and so on. It is believed that this constitutes a fair use of any such copyrighted material as provided for in section 107 of the US Copyright Law. In accordance with Title 17 U.S.C. Section 107, the material on this site is distributed without profit to those who have expressed a prior interest in receiving the included information for research and educational purposes. If you wish to use copyrighted material from this site for purposes of your own that go beyond fair use, you must obtain permission from the copyright owner ...
HCV Research and News: 06/16/10HCV Research and News: 06/16/10
This site contains copyrighted material the use of which has not always been specifically authorized by the copyright owner. It is being made available in an effort to advance the understanding of Hepatitis C, New hepatitis c drugs, Related clinical trials and ongoing research, HIV/HCV coinfection, HIV/AIDS, Other factors of liver disease, and so on. It is believed that this constitutes a fair use of any such copyrighted material as provided for in section 107 of the US Copyright Law. In accordance with Title 17 U.S.C. Section 107, the material on this site is distributed without profit to those who have expressed a prior interest in receiving the included information for research and educational purposes. If you wish to use copyrighted material from this site for purposes of your own that go beyond fair use, you must obtain permission from the copyright owner ...
HCV Research and News: 06/16/10HCV Research and News: 06/16/10
This site contains copyrighted material the use of which has not always been specifically authorized by the copyright owner. It is being made available in an effort to advance the understanding of Hepatitis C, New hepatitis c drugs, Related clinical trials and ongoing research, HIV/HCV coinfection, HIV/AIDS, Other factors of liver disease, and so on. It is believed that this constitutes a fair use of any such copyrighted material as provided for in section 107 of the US Copyright Law. In accordance with Title 17 U.S.C. Section 107, the material on this site is distributed without profit to those who have expressed a prior interest in receiving the included information for research and educational purposes. If you wish to use copyrighted material from this site for purposes of your own that go beyond fair use, you must obtain permission from the copyright owner ...
Retreatment of Persons in Whom Prior Therapy Failed | HCV GuidanceRetreatment of Persons in Whom Prior Therapy Failed | HCV Guidance
This section provides guidance on the retreatment of persons with chronic HCV infection in whom prior therapy failed. The level of the evidence available to inform the best regimen for each patient and the strength of the recommendation vary, and are rated accordingly (see Methods Table 2). In addition, specific recommendations are given when treatment differs for a particular group (eg, those infected with different viral genotypes). Recommended regimens are those that are favored for most patients in that group, based on optimal efficacy, favorable tolerability and toxicity profiles, complexity, and treatment duration. Alternative regimens are those that are effective but, relative to recommended regimens, have potential disadvantages, limitations for use in certain patient populations, or less supporting data. In certain situations, an alternative regimen may be optimal for a specific patient. Specific considerations for pediatric patients and persons with HIV/HCV coinfection, decompensated ...
AIDS Work » immune defense systemAIDS Work » immune defense system
Human Immunodeficiency Virus (HIV) is the virus that causes AIDS. Two types of HIV are currently known: HIV-1 and HIV-2. World wide, the predominant virus is HIV-1. Although cases of HIV-2 have been reported in several parts of virus are transmitted by sexual contact, through blood, and from mother-to-child during pregnancy, delivery, or breast feeding. They both appear to cause clinically indistinguishable AIDS. However HIV-2 is less easily transmitted and the period between initial infection and illness is longer than in HIV-1 cases. Cases of concurrent infections with the two viruses have been described in West Africa.. HIV belongs to the family of retroviruses. Like all retroviruses HIV contains RNA in its core and to live and replicate it needs a host cell. HIV preferentially infects a specific subset of white blood cells (CD4) that are fundamental in the immune defense system of the human body. Once the contact is made between the virus and the human cell, the virus transfers its RNA into ...
AIDS Work » blood cellsAIDS Work » blood cells
Human Immunodeficiency Virus (HIV) is the virus that causes AIDS. Two types of HIV are currently known: HIV-1 and HIV-2. World wide, the predominant virus is HIV-1. Although cases of HIV-2 have been reported in several parts of virus are transmitted by sexual contact, through blood, and from mother-to-child during pregnancy, delivery, or breast feeding. They both appear to cause clinically indistinguishable AIDS. However HIV-2 is less easily transmitted and the period between initial infection and illness is longer than in HIV-1 cases. Cases of concurrent infections with the two viruses have been described in West Africa.. HIV belongs to the family of retroviruses. Like all retroviruses HIV contains RNA in its core and to live and replicate it needs a host cell. HIV preferentially infects a specific subset of white blood cells (CD4) that are fundamental in the immune defense system of the human body. Once the contact is made between the virus and the human cell, the virus transfers its RNA into ...
Infectious Coryza | Poultry Health CentreInfectious Coryza | Poultry Health Centre
The disease has a short incubation period, 1 - 3 days, and will spread rapidly through a flock of susceptible birds in 7 to 10 days. In uncomplicated infections the course of the disease is about 3 weeks. However, concurrent infection with ART, IBV, ILT, mycoplasmas and virulent E.coliwould be expected to increase the severity of the disease. The initial signs will include watery discharges (seromucoid) from the nostril and eyes with swelling of the face with a marked morbidity in the flock but low mortality. Conjunctivitis, closed eyes, open mouthed breathing, lethargy and drops in feed and water consumption. This can result in egg production drops, failure to grow and in the presence of secondary infections severe mortality.. ...
HIV and HCV Coinfection - HIV PositiveHIV and HCV Coinfection - HIV Positive
HIV can worsen hepatitis C. Not only does HIV increase the risk of liver damage, but it can also speed up the onset of liver damage following infection.
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and ProcessesTechnology, Industry, AgricultureInformation ScienceNamed GroupsHealth CareGeographicals
CoinfectionHIV InfectionsHepatitis CGB virus CFlaviviridae InfectionsHIVHepatitis BCD4 Lymphocyte CountHepacivirusAntiretroviral Therapy, Highly ActiveAIDS-Related Opportunistic InfectionsViral LoadHIV-1Hookworm InfectionsAntiviral AgentsHepatitis C, ChronicAnti-HIV AgentsRNA, ViralHepatitis, Viral, HumanDNA, ViralTuberculosisHTLV-II InfectionsEhrlichiosisGlossitis, Benign MigratoryInfluenzavirus BHelminthiasisPrevalenceInfluenzavirus ABabesia microtiSchistosomiasis mansoniPrimate DiseasesRibavirinVirus ReplicationSuperinfectionPolymerase Chain ReactionMansonellaHelicobacter felisBabesiosisLiver CirrhosisHTLV-I InfectionsSubstance Abuse, IntravenousSchistosoma mansoniHepatitis DDependovirusHepatitis B virusComorbidityHepatitis B, ChronicMansonelliasisDNA Virus InfectionsAnti-Retroviral AgentsHepatitis B Surface AntigensNematospiroides dubiusSimian foamy virusParvoviridae InfectionsHelminthsFlaviviridaeGenotypeAntitubercular AgentsHerpesvirus 6, HumanLactate dehydrogenase-elevating virusCohort StudiesHelminthiasis, AnimalMacaca nemestrinaInfectious Disease Incubation PeriodInterferon-alphaBacteriophage phi 6CD4-Positive T-LymphocytesLiver FailureHepatitis C AntibodiesMycobacterium tuberculosisBrazilHelper VirusesAdenoviruses, HumanRecombination, GeneticDisease ProgressionMolecular Sequence DataProtozoan InfectionsSimian immunodeficiency virusLyme DiseaseColobusRisk FactorsStrongyloidiasisStrongyloides stercoralisHIV SeropositivityTuberculosis, PulmonaryRoseolovirus InfectionsIxodesViral ProteinsAcquired Immunodeficiency SyndromeDrug Therapy, CombinationPneumonia, ViralMicrobial InteractionsLamivudineBartonellaPhylogenyErythroplasiaAnaplasma phagocytophilumStrongylida InfectionsHost-Pathogen InteractionsSimian T-lymphotropic virus 1Orthomyxoviridae InfectionsVirulenceSeroepidemiologic StudiesPlasmodiumRetrospective StudiesBocavirusBalamuthia mandrillarisSchistosomiasisHerpesviridae InfectionsCytomegalovirusUgandaCell LineAdenovirus Infections, HumanEhrlichiaMalariaCytomegalovirus InfectionsOrganophosphonatesPapillomavirus InfectionsPraziquantelTick-Borne DiseasesAnthelminticsPolyethylene GlycolsAdenoviridaeProspective StudiesSimian Acquired Immunodeficiency SyndromeBase SequenceAstroviridae InfectionsHepatitis D, ChronicViremiaUterine Cervical DiseasesInfluenza, HumanCircoviridae InfectionsViral InterferenceCote d'IvoireRetroviridae InfectionsTorque teno virusMycoplasma InfectionsHost-Parasite InteractionsInfectious Disease Transmission, VerticalVirus DiseasesTumor Virus InfectionsDefective VirusesMycobacterium bovisHerpesvirus 8, HumanParasitemiaIndinavirRotavirusGenes, ViralPneumonia, MycoplasmaSequence Analysis, DNACross-Sectional StudiesPandemicsInfluenza A virusBacterial InfectionsIncidenceCytokinesTreatment OutcomeLatent TuberculosisPregnancy Complications, InfectiousCircovirusInfluenza A Virus, H1N1 SubtypeGenome, ViralCD8-Positive T-LymphocytesGonorrheaGenetic FitnessMacaca mulattaLeukocytes, MononuclearSpodopteraDisease Models, AnimalGenetic VectorsGenetic VariationBiopsyDNA VirusesGhanaInterferonsIntestinal Diseases, ParasiticHerpesvirus 4, HumanInterferon-gammaProvirusesEpstein-Barr Virus InfectionsBlood DonorsPneumonia, BacterialHerpes GenitalisBenzoxazinesAntigens, ViralDrug-Induced Liver InjuryAdenineFatal OutcomeLiver DiseasesLiverMetapneumovirusCat DiseasesSouth AfricaHuman T-lymphotropic virus 2Schistosomiasis haematobiaHepatitis Delta VirusAlanine TransaminaseEnzyme-Linked Immunosorbent AssayLungCD4-CD8 RatioChlamydia Infections
Neglected tropical diseasesNeglected tropical diseases
Coinfection[edit]. Coinfection is a major concern with neglected tropical diseases, making NTDs more damaging than their ... For this reason, coinfection carries a higher risk of mortality. NTDs may also play a role in infection with other diseases, ... NTD co-infection can also make HIV/AIDS and tuberculosis more deadly.[3] ... "Diagnosing Neglected Tropical Diseases in HIV Coinfection". Human Parasitic Diseases. 2015 (7): 11. doi:10.4137/HPD.S19569 ...
HIV/AIDS in EswatiniHIV/AIDS in Eswatini
TB-HIV co-infection. References[edit]. *^ "Swaziland 2016 Country factsheet". UNAIDS. Retrieved 14 January 2018.. .mw-parser- ... More than one-third of Swazi women between the ages of 15 and 49 are living with HIV;[22] this is accompanied by high HIV-TB co-infection ... HIV and tuberculosis (TB) co-infection[edit]. Eswatini not only has the highest adult HIV prevalence globally, it also has the ... second highest rate of HIV-tuberculosis (TB) co-infection in the world.[43] Accompanying this statistic, TB-related mortality ...
Hookworm infectionHookworm infection
Malaria co-infectionEdit. Co-infection with hookworm and Plasmodium falciparum is common in Africa.[52] Although exact numbers ... Knowles SC (August 2011). "The effect of helminth co-infection on malaria in mice". Int. J. Parasitol. 41 (10): 1041-51. doi: ... Additionally, both malaria and helminth infection can cause anemia, but the effect of co-infection and possible enhancement of ... While original hypotheses stated that co-infection with multiple parasites would impair the host's immune response to a single ...
SyphilisSyphilis
... increases the risk of HIV transmission by two to five times, and coinfection is common (30-60% in some urban centers ... Karp, G; Schlaeffer, F; Jotkowitz, A; Riesenberg, K (January 2009). "Syphilis and HIV co-infection". European Journal of ...
MicroparasiteMicroparasite
In growing populations the equivalent expression is: (1.3)R0∼B/(A−M) At the same time, co-infection impaired top-down control ... Graham, Andrea L. (2008-01-15). "Ecological rules governing helminth-microparasite coinfection". Proceedings of the National ...
MycovirusMycovirus
May, R. M.; Nowak, M. A. (1995). "Coinfection and the evolution of parasite virulence" (PDF). Proceedings of the Royal Society ...
SyndemicSyndemic
A coinfection may open up multiple syndemic pathways. Lethal synergism between influenza virus and pneumococcus, causes excess ... Merrill Singer,Development, coinfection, and the syndemics of pregnancy in Sub-Saharan Africa. Infectious Diseases of Poverty ... One disease may enhance the virulence of another, as for example, herpes simplex virus co-infection exacerbates HIV infection ... 2011) HIV-1/Mycobacterium tuberculosis Coinfection Immunology: How Does HIV-1 Exacerbate Tuberculosis? Infection and Immunity. ...
Leishmania donovaniLeishmania donovani
Okwor, I; Uzonna, JE (May 2013). "The immunology of Leishmania/HIV co-infection". Immunologic Research. 56 (1): 163-71. doi: ... Olivier, M; Badaró, R; Medrano, FJ; Moreno, J (2003). "The pathogenesis of Leishmania/HIV co-infection: cellular and ...
Triatoma virusTriatoma virus
A cross infection and co-infection study". Journal of Invertebrate Pathology. doi:10.1016/j.jip.2017.09.014. ...
SuperinfectionSuperinfection
Coinfection Reassortment Antibiotic resistance HIV superinfection "Superinfection". Merriam-Webster Inc. Retrieved 14 March ...
Elbasvir/grazoprevirElbasvir/grazoprevir
C-WORTHY Coinfection studied patients with HCV and HIV. Treatments of monoinfected patients and coinfected patients resulted in ... Additional Phase 2 trials were examined under the names: C-SWIFT, C-WORTHY, and C-WORTHY Coinfection. The first trial studied ... with or without ribavirin in patients with hepatitis C virus genotype 1 mono-infection and HIV/hepatitis C virus co-infection ( ... better SRV12 for the patients with coinfection and treated with ribrivin, too, at 97%. Phase 3 study results of the drug were ...
Tomato bushy stunt virusTomato bushy stunt virus
... instead they require coinfection with an intact "helper" virus. TBSV infections often produce significant numbers of DIs from ...
HIV/AIDS in TaiwanHIV/AIDS in Taiwan
Epidemiology of viral hepatitis and HIV co-infection. J Hepatol 2006; 44: S6-S9. Law WP, Dore GJ, Duncombe CJ, et al. Risk of ... The long-term impact of hepatitis coinfections on HIV and on morbidity and mortality from liver disease requires monitoring. By ... Because of their high background prevalence, HBV and HCV coinfections with HIV are particularly important in Asian countries in ...
Abu HummusAbu Hummus
Applied Mathematical & Computational Sciences (2008). Evaluation of Rotavirus Models with Coinfection and Vaccination. ...
XVIII International AIDS Conference, 2010XVIII International AIDS Conference, 2010
"AIDS 2010: Halving HIV/TB Co-infection Deaths; Financial Transaction Tax Discussed, And More". globalhealth.kff.org. 2011. ...
Schistosoma mansoniSchistosoma mansoni
Co-infection is known to cause earlier liver deterioration and more severe illness. Adult and larval worms migrate through the ... This is an important diagnostic tool because co-infection with S. haematobium (having a terminal-spined eggs) is common, and ... Gasim, Gasim I; Bella, Abdelhaleem; Adam, Ishag (2015). "Schistosomiasis, hepatitis B and hepatitis C co-infection". Virology ...
Lyme diseaseLyme disease
Coinfections complicate Lyme symptoms, especially diagnosis and treatment. It is possible for a tick to carry and transmit one ... Swanson SJ, Neitzel D, Reed KD, Belongia EA (October 2006). "Coinfections acquired from ixodes ticks". Clin. Microbiol. Rev. 19 ... with high risks of coinfection in roe deer. Nevertheless, in the 2000s, in roe deer in Europe " two species of Rickettsia and ... coinfections), including ehrlichiosis, babesiosis, and immune suppression[citation needed] in the patient. It is believed that ...
Borrelia burgdorferiBorrelia burgdorferi
More studies and research must be done to determine the synergistic effect of co-infection and its effect on the human body. So ... ISBN 0-321-73360-6. Swanson, Stephen J.; Neitzel, David; Reed, Kurt D.; Belongia, Edward A. (2006-10-01). "Coinfections ...
OncovirusOncovirus
Hu J, Ludgate L (2007). "HIV-HBV and HIV-HCV coinfection and liver cancer development". Cancer Treatment and Research. Cancer ...
DientamoebiasisDientamoebiasis
Numerous studies reported high rates of coinfection with helminthes. However, recent study has failed to show any association ...
Antigenic shiftAntigenic shift
1918 flu pandemic Coinfection Superinfection Viral Shift Narayan, O; Griffin, DE; Chase, J (1977). "Antigenic shift of visna ...
SwazilandSwaziland
"HIV-TB in Swaziland: A Deadly Co-Infection Epidemic". USA: Doctors Without Borders/Médecins Sans Frontières. 28 October 2009. ... "Swaziland: An MSF Doctors Explains HIV-TB Co-Infection". USA: Doctors Without Borders/Médecins Sans Frontières. 28 October 2009 ...
Lemierres syndromeLemierre's syndrome
... there may exist a co-infection by another bacterium. For these reasons is often advised not to use monotherapy in treating ...
BronchiolitisBronchiolitis
"Procalcitonin to Predict Bacterial Coinfection in Infants With Acute Bronchiolitis". Pediatric Emergency Care. 30 (1): 11-15. ... have suggested that elevated procalcitonin levels may assist clinicians in determining the presence of bacterial coinfection, ...
Hookworm infectionHookworm infection
Knowles SC (August 2011). "The effect of helminth co-infection on malaria in mice". Int. J. Parasitol. 41 (10): 1041-51. doi: ... Hartgers FC, Yazdanbakhsh M (October 2006). "Co-infection of helminths and malaria: modulation of the immune responses to ... "Epidemiology of Plasmodium-Helminth co-infection in Africa: Populations at risk, potential impact on anemia and prospects for ...
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and ProcessesTechnology, Industry, AgricultureInformation ScienceNamed GroupsHealth CareGeographicals
CoinfectionHIV InfectionsHepatitis CGB virus CFlaviviridae InfectionsHIVHepatitis BCD4 Lymphocyte CountHepacivirusAntiretroviral Therapy, Highly ActiveAIDS-Related Opportunistic InfectionsViral LoadHIV-1Hookworm InfectionsAntiviral AgentsHepatitis C, ChronicAnti-HIV AgentsRNA, ViralHepatitis, Viral, HumanDNA, ViralTuberculosisHTLV-II InfectionsEhrlichiosisGlossitis, Benign MigratoryInfluenzavirus BHelminthiasisPrevalenceInfluenzavirus ABabesia microtiSchistosomiasis mansoniPrimate DiseasesRibavirinVirus ReplicationSuperinfectionPolymerase Chain ReactionMansonellaHelicobacter felisBabesiosisLiver CirrhosisHTLV-I InfectionsSubstance Abuse, IntravenousSchistosoma mansoniHepatitis DDependovirusHepatitis B virusComorbidityHepatitis B, ChronicMansonelliasisDNA Virus InfectionsAnti-Retroviral AgentsHepatitis B Surface AntigensNematospiroides dubiusSimian foamy virusParvoviridae InfectionsHelminthsFlaviviridaeGenotypeAntitubercular AgentsHerpesvirus 6, HumanLactate dehydrogenase-elevating virusCohort StudiesHelminthiasis, AnimalMacaca nemestrinaInfectious Disease Incubation PeriodInterferon-alphaBacteriophage phi 6CD4-Positive T-LymphocytesLiver FailureHepatitis C AntibodiesMycobacterium tuberculosisBrazilHelper VirusesAdenoviruses, HumanRecombination, GeneticDisease ProgressionMolecular Sequence DataProtozoan InfectionsSimian immunodeficiency virusLyme DiseaseColobusRisk FactorsStrongyloidiasisStrongyloides stercoralisHIV SeropositivityTuberculosis, PulmonaryRoseolovirus InfectionsIxodesViral ProteinsAcquired Immunodeficiency SyndromeDrug Therapy, CombinationPneumonia, ViralMicrobial InteractionsLamivudineBartonellaPhylogenyErythroplasiaAnaplasma phagocytophilumStrongylida InfectionsHost-Pathogen InteractionsSimian T-lymphotropic virus 1Orthomyxoviridae InfectionsVirulenceSeroepidemiologic StudiesPlasmodiumRetrospective StudiesBocavirusBalamuthia mandrillarisSchistosomiasisHerpesviridae InfectionsCytomegalovirusUgandaCell LineAdenovirus Infections, HumanEhrlichiaMalariaCytomegalovirus InfectionsOrganophosphonatesPapillomavirus InfectionsPraziquantelTick-Borne DiseasesAnthelminticsPolyethylene GlycolsAdenoviridaeProspective StudiesSimian Acquired Immunodeficiency SyndromeBase SequenceAstroviridae InfectionsHepatitis D, ChronicViremiaUterine Cervical DiseasesInfluenza, HumanCircoviridae InfectionsViral InterferenceCote d'IvoireRetroviridae InfectionsTorque teno virusMycoplasma InfectionsHost-Parasite InteractionsInfectious Disease Transmission, VerticalVirus DiseasesTumor Virus InfectionsDefective VirusesMycobacterium bovisHerpesvirus 8, HumanParasitemiaIndinavirRotavirusGenes, ViralPneumonia, MycoplasmaSequence Analysis, DNACross-Sectional StudiesPandemicsInfluenza A virusBacterial InfectionsIncidenceCytokinesTreatment OutcomeLatent TuberculosisPregnancy Complications, InfectiousCircovirusInfluenza A Virus, H1N1 SubtypeGenome, ViralCD8-Positive T-LymphocytesGonorrheaGenetic FitnessMacaca mulattaLeukocytes, MononuclearSpodopteraDisease Models, AnimalGenetic VectorsGenetic VariationBiopsyDNA VirusesGhanaInterferonsIntestinal Diseases, ParasiticHerpesvirus 4, HumanInterferon-gammaProvirusesEpstein-Barr Virus InfectionsBlood DonorsPneumonia, BacterialHerpes GenitalisBenzoxazinesAntigens, ViralDrug-Induced Liver InjuryAdenineFatal OutcomeLiver DiseasesLiverMetapneumovirusCat DiseasesSouth AfricaHuman T-lymphotropic virus 2Schistosomiasis haematobiaHepatitis Delta VirusAlanine TransaminaseEnzyme-Linked Immunosorbent AssayLungCD4-CD8 RatioChlamydia Infections
TB & HIV Coinfection | Basic TB Facts | TB | CDCTB & HIV Coinfection | Basic TB Facts | TB | CDC
People infected with HIV who also have either latent TB infection or TB disease can be effectively treated. The first step is to ensure that people living with HIV are tested for TB infection. If found to have TB infection, further tests are needed to rule out TB disease. The next step is to start treatment for latent TB infection or TB disease based on test results.. Treatment. Untreated latent TB infection can quickly progress to TB disease in people living with HIV since the immune system is already weakened. And without treatment, TB disease can progress from sickness to death.. Fortunately, there are a number of treatment options for people living with HIV who also have either latent TB infection or TB disease.. Learn about Treatment.. ...
cdc.gov
Anaplasma Co-infections | Anaplasmosis | CDCAnaplasma Co-infections | Anaplasmosis | CDC
Risk of coinfection. *Anaplasma coinfection with non-rickettsial pathogens has been reported in ,10% of patients. ... The presence of a rash might indicate that the patient has a coinfection with Lyme disease, or another tickborne disease. ...
cdc.gov
TB and HIV Coinfection - Video | Basic TB Facts | TB | CDCTB and HIV Coinfection - Video | Basic TB Facts | TB | CDC
A video discussing the impact of TB on HIV infected persons and the importance of detecting and curing TB. Provided by the Centers for Disease Control and Prevention (CDC).
cdc.gov
HIV and Hepatitis C Co-infection: Guideline and CommentaryHIV and Hepatitis C Co-infection: Guideline and Commentary
The high rate of HIV/HCV co-infection and the similar routes of transmission of both viruses underscore the importance of ... HIV and Hepatitis C Co-infection: Guideline and Commentary - Medscape - Jan 05, 2011. ...
medscape.com
HIV and Hepatitis C Co-infection: Guideline and CommentaryHIV and Hepatitis C Co-infection: Guideline and Commentary
Influence of Hepatitis C Virus Co-Infection and Hepatitis C Virus Treatment on Risk of Chronic Kidney Disease in HIV-Positive ... HIV and Hepatitis C Co-infection: Guideline and Commentary - Medscape - Jan 05, 2011. ...
medscape.com
HCV and HIV Coinfection - Hepatitis C - MedHelpHCV and HIV Coinfection - Hepatitis C - MedHelp
Just wondering if HCV And HIV coinfection can cause delayed seroconversion and what is the window period for HCV because i am ... HCV and HIV Coinfection. Just wondering if HCV And HIV coinfection can cause delayed seroconversion and what is the window ... Just wondering if HCV And HIV coinfection can cause delayed seroconversion and what is the window period for HCV because i am ... Such tests are done at baseline, 6 weeks, 12 weeks, and 6 months, and longer in specific circumstances, such as co-infection ...
medhelp.org
Mathematical Analysis of Malaria-Schistosomiasis Coinfection ModelMathematical Analysis of Malaria-Schistosomiasis Coinfection Model
... E. A. Bakare1 and C. R. Nwozo2 ... E. A. Bakare and C. R. Nwozo, "Mathematical Analysis of Malaria-Schistosomiasis Coinfection Model," Epidemiology Research ...
hindawi.com
Coinfection - WikipediaCoinfection - Wikipedia
Anaplasmosis Bacteriophage coinfection GB virus C HIV-HCV coinfection HIV-TB coinfection (enhances TB transmission and ... Coinfection with helminths affects around 800 million people worldwide. Coinfection is of particular human health importance ... Other common examples of coinfections are AIDS, which involves coinfection of end-stage HIV with opportunistic parasites and ... D Hookworm-malaria coinfection Mansonella perstans Trichuriasis Chikungunya and Dengue coinfection Dengue and HIV coinfection ( ...
en.wikipedia.org
Bacterial coinfection in influenza: a grand rounds review. - PubMed - NCBIBacterial coinfection in influenza: a grand rounds review. - PubMed - NCBI
Bacterial coinfection complicated nearly all influenza deaths in the 1918 influenza pandemic and up to 34% of 2009 pandemic ... Bacterial coinfection in influenza: a grand rounds review.. Chertow DS1, Memoli MJ. ... Complex viral, bacterial, and host factors contribute to the pathogenesis of coinfection. Reductions in morbidity and mortality ... infection admitted to 35 intensive care units in the United States reveal that bacterial coinfection commonly occurs within the ...
ncbi.nlm.nih.gov
Iron and coinfectionsIron and coinfections
Fry labs said I was clear of all coinfections (had the whole enchilada of tests they offer, and all came up negative). I dont ... I know iron does not encourage Lyme, but what about coinfections? Does anyone know if iron feeds Bartonella, Babesia or ...
healingwell.com
HCV Coinfection & Neurologic ImpairmentHCV Coinfection & Neurologic Impairment
Some studies have found rates of neurocognitive dysfunction in HIV/HCV coinfection not to be significantly worse than rates in ... cause cerebral changes on magnetic resonance spectroscopy of the brain.3-5 The combined effect of both HIV and HCV coinfection ... HCV-monoinfected individuals.6,7 Other studies observe a trend for patients with HIV/HCV coinfection to perform worse ...
natap.org
HIV/tuberculosis co-infection: Tunneling towards better diagnosis | EurekAlert! Science NewsHIV/tuberculosis co-infection: Tunneling towards better diagnosis | EurekAlert! Science News
HIV/tuberculosis co-infection: Tunneling towards better diagnosis. CNRS. Journal. Cell Reports. Funder. CNRS, Inserm. Keywords ...
eurekalert.org
HCV - Forum on Hepatitis and HIV Coinfection - TheBody.comHCV - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A HCV. Sep 16, 2012 My MPX test came back positive and ...
thebody.com
serocovert - Forum on Hepatitis and HIV Coinfection - TheBody.comserocovert - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A serocovert. Sep 12, 2010 hi what is seroconvertion stage means ...
thebody.com
Bodybuilding - Forum on Hepatitis and HIV Coinfection - TheBody.comBodybuilding - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A Bodybuilding. Oct 9, 2006 I am 18 months post tx. Also I am ...
thebody.com
hepatitis - Forum on Hepatitis and HIV Coinfection - TheBody.comhepatitis - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A hepatitis. Sep 29, 2004 My cousin came to stay with me and my ...
thebody.com
HBV - Forum on Hepatitis and HIV Coinfection - TheBody.comHBV - Forum on Hepatitis and HIV Coinfection - TheBody.com
There are some data that suggest that even without the whole series of shots, there may be some protection. I would still finish the entire...
thebody.com
Positive? - Forum on Hepatitis and HIV Coinfection - TheBody.comPositive? - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A Positive?. Sep 9, 2007 I was tested for all sorts of STDs and ...
thebody.com
Naringin - Forum on Hepatitis and HIV Coinfection - TheBody.comNaringin - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A Naringin. Mar 7, 2008 What is the latest on the grapefruit ...
thebody.com
A Time Scales Approach to Coinfection by Opportunistic DiseasesA Time Scales Approach to Coinfection by Opportunistic Diseases
... Marcos Marvá,1 Ezio Venturino,2 and Rafael Bravo de la Parra1 ... E. C. Griffiths, A. B. P. Pedersen, A. Fenton, and O. L. Petchey, "The nature and consequences of coinfection in humans," ...
hindawi.com
hepc - Forum on Hepatitis and HIV Coinfection - TheBody.comhepc - Forum on Hepatitis and HIV Coinfection - TheBody.com
This antibody test just tells you about past exposure. To tell about activity of the infection, you need a viral load test (hepatitis C...
thebody.com
HCV ? - Forum on Hepatitis and HIV Coinfection - TheBody.comHCV ? - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A HCV ?. Jul 18, 2005 hello im 30 years old. between years 99 ...
thebody.com
helppppp - Forum on Hepatitis and HIV Coinfection - TheBody.comhelppppp - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A helppppp. May 2, 2005 hey... i just had my dental cleaning... ...
thebody.com
hepc - Forum on Hepatitis and HIV Coinfection - TheBody.comhepc - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A hepc. Jan 24, 2008 what is genotype 1a?my sister has hepc 1a. ...
thebody.com
viremia - Forum on Hepatitis and HIV Coinfection - TheBody.comviremia - Forum on Hepatitis and HIV Coinfection - TheBody.com
Ask the Experts > Forum on Hepatitis and HIV Coinfection > Q & A viremia. Feb 3, 2003 If there is a simultaneous co-infection ... with more than one pathogen (HIV and HepC for instance), what causes lower viremia levels during acute co-infection? Is it the ...
thebody.com
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and ProcessesTechnology, Industry, AgricultureInformation ScienceNamed GroupsHealth CareGeographicals
CoinfectionHIV InfectionsHepatitis CGB virus CFlaviviridae InfectionsHIVHepatitis BCD4 Lymphocyte CountHepacivirusAntiretroviral Therapy, Highly ActiveAIDS-Related Opportunistic InfectionsViral LoadHIV-1Hookworm InfectionsAntiviral AgentsHepatitis C, ChronicAnti-HIV AgentsRNA, ViralHepatitis, Viral, HumanDNA, ViralTuberculosisHTLV-II InfectionsEhrlichiosisGlossitis, Benign MigratoryInfluenzavirus BHelminthiasisPrevalenceInfluenzavirus ABabesia microtiSchistosomiasis mansoniPrimate DiseasesRibavirinVirus ReplicationSuperinfectionPolymerase Chain ReactionMansonellaHelicobacter felisBabesiosisLiver CirrhosisHTLV-I InfectionsSubstance Abuse, IntravenousSchistosoma mansoniHepatitis DDependovirusHepatitis B virusComorbidityHepatitis B, ChronicMansonelliasisDNA Virus InfectionsAnti-Retroviral AgentsHepatitis B Surface AntigensNematospiroides dubiusSimian foamy virusParvoviridae InfectionsHelminthsFlaviviridaeGenotypeAntitubercular AgentsHerpesvirus 6, HumanLactate dehydrogenase-elevating virusCohort StudiesHelminthiasis, AnimalMacaca nemestrinaInfectious Disease Incubation PeriodInterferon-alphaBacteriophage phi 6CD4-Positive T-LymphocytesLiver FailureHepatitis C AntibodiesMycobacterium tuberculosisBrazilHelper VirusesAdenoviruses, HumanRecombination, GeneticDisease ProgressionMolecular Sequence DataProtozoan InfectionsSimian immunodeficiency virusLyme DiseaseColobusRisk FactorsStrongyloidiasisStrongyloides stercoralisHIV SeropositivityTuberculosis, PulmonaryRoseolovirus InfectionsIxodesViral ProteinsAcquired Immunodeficiency SyndromeDrug Therapy, CombinationPneumonia, ViralMicrobial InteractionsLamivudineBartonellaPhylogenyErythroplasiaAnaplasma phagocytophilumStrongylida InfectionsHost-Pathogen InteractionsSimian T-lymphotropic virus 1Orthomyxoviridae InfectionsVirulenceSeroepidemiologic StudiesPlasmodiumRetrospective StudiesBocavirusBalamuthia mandrillarisSchistosomiasisHerpesviridae InfectionsCytomegalovirusUgandaCell LineAdenovirus Infections, HumanEhrlichiaMalariaCytomegalovirus InfectionsOrganophosphonatesPapillomavirus InfectionsPraziquantelTick-Borne DiseasesAnthelminticsPolyethylene GlycolsAdenoviridaeProspective StudiesSimian Acquired Immunodeficiency SyndromeBase SequenceAstroviridae InfectionsHepatitis D, ChronicViremiaUterine Cervical DiseasesInfluenza, HumanCircoviridae InfectionsViral InterferenceCote d'IvoireRetroviridae InfectionsTorque teno virusMycoplasma InfectionsHost-Parasite InteractionsInfectious Disease Transmission, VerticalVirus DiseasesTumor Virus InfectionsDefective VirusesMycobacterium bovisHerpesvirus 8, HumanParasitemiaIndinavirRotavirusGenes, ViralPneumonia, MycoplasmaSequence Analysis, DNACross-Sectional StudiesPandemicsInfluenza A virusBacterial InfectionsIncidenceCytokinesTreatment OutcomeLatent TuberculosisPregnancy Complications, InfectiousCircovirusInfluenza A Virus, H1N1 SubtypeGenome, ViralCD8-Positive T-LymphocytesGonorrheaGenetic FitnessMacaca mulattaLeukocytes, MononuclearSpodopteraDisease Models, AnimalGenetic VectorsGenetic VariationBiopsyDNA VirusesGhanaInterferonsIntestinal Diseases, ParasiticHerpesvirus 4, HumanInterferon-gammaProvirusesEpstein-Barr Virus InfectionsBlood DonorsPneumonia, BacterialHerpes GenitalisBenzoxazinesAntigens, ViralDrug-Induced Liver InjuryAdenineFatal OutcomeLiver DiseasesLiverMetapneumovirusCat DiseasesSouth AfricaHuman T-lymphotropic virus 2Schistosomiasis haematobiaHepatitis Delta VirusAlanine TransaminaseEnzyme-Linked Immunosorbent AssayLungCD4-CD8 RatioChlamydia Infections
Antiretroviral therapyBacteriophageHepatitis C virTenofovirLymeVirusesLiverPreventionStudyHighStudiesHostRiskEffectPeopleCareTests
Antiretroviral therapy2
Bacteriophage1
Hepatitis C vir1
Tenofovir1
  • Antepartum ART in pregnant women with HIV/HBV coinfection should include tenofovir disoproxil fumarate (TDF) plus lamivudine or emtricitabine (AI) . (nih.gov)
Lyme3
Viruses2
  • During phage coinfection, it pertains to viruses which produce more protein products than they use (cooperators) and viruses which use more protein products than they produce (defectors). (wikipedia.org)
  • Coinfection with viruses (usually, coxsackievirus B3 and cytomegalovirus) seems to have an important effect as the GISCA autopsy records show that 83% of patients with myocarditis and 50% with dilated cardiomyopathy were coinfected with viruses. (wikipedia.org)
Liver4
  • Pregnant women with HIV/HBV coinfection receiving antiretroviral (ARV) drugs should be counseled about signs and symptoms of liver toxicity, and liver transaminases should be assessed 1 month following initiation of ARV drugs and at least every 3 months thereafter during pregnancy (BIII) . (nih.gov)
  • However, chronic liver disease due to coinfection with hepatitis B (HBV) or C (HCV) virus has emerged as the second leading cause of mortality among HIV-infected persons. (clinicaltrials.gov)
  • The HBRN will not address the critical issue of HBV liver disease progression in HIV-infected persons because patients with HIV coinfection will be excluded. (clinicaltrials.gov)
  • Collectively, this study will fulfill many of the key priorities outlined in the NIH Action Plan for Liver Disease for HBV-HIV coinfection. (clinicaltrials.gov)
Prevention2
  • Improvement in the surveillance of HCV and HIV is imperative to help define the epidemiology of coinfection and inform appropriate policies for testing, prevention, care and treatment to those in need. (bristol.ac.uk)
  • It included counseling, treatment, the prevention of mother-to-child transmission and managing HIV/TB coinfection. (wikipedia.org)
Study2
  • However, very little was known about the extent of HIV/HCV coinfection prior to this study, which was the first global study of its kind. (bristol.ac.uk)
  • The study shows the greatest burden of HIV/HCV coinfection in Eastern Europe and central Asia, where there are an estimated 607,700 cases (27 per cent of all cases), particularly among PWID. (bristol.ac.uk)
High4
  • This is especially the case in countries with growing populations of PWID and also in sub-Saharan Africa where the burden of coinfection is large due to high burden of HIV. (bristol.ac.uk)
  • The researchers included studies with estimates of HCV coinfection in the main HIV population, as well as sub-groups of PWID, men who have sex with men, heterosexually exposed and pregnant women, other high-risk groups and the general population. (bristol.ac.uk)
  • Numerous studies reported high rates of coinfection with helminthes. (wikipedia.org)
  • Chlamydia co-testing and testing for other STI's is recommended due to high rates of coinfection. (wikipedia.org)
Studies1
  • Some studies have found rates of neurocognitive dysfunction in HIV/HCV coinfection not to be significantly worse than rates in HCV-monoinfected individuals.6,7 Other studies observe a trend for patients with HIV/HCV coinfection to perform worse neurocognitively than patients infected solely with HIV. (natap.org)
Host1
  • During the coinfection of a host cell, a critical ratio will eventually be reached in which more viral factors are being used to produce the non-infectious DIPs than infectious particles. (wikipedia.org)
Risk1
  • The search focused on published medical literature, and excluded samples drawn from populations with other comorbidities, or undergoing interventions that put them at increased risk of coinfection. (bristol.ac.uk)
Effect1
People3
  • Coinfection with helminths affects around 800 million people worldwide. (wikipedia.org)
  • To address the challenge of TB among people with HIV, the government of Kenya, with support from partners like CDC, has made changes to public health programs and policies that have helped the country exceed its goals of identifying and treating people with TB/HIV coinfection. (cdc.gov)
  • While this presents a considerable challenge, the policy and program changes that Kenya has implemented and the addition of new tools like isoniazid preventive therapy will go a long way in addressing TB/HIV coinfection and helping people living with HIV remain healthy and live longer. (cdc.gov)
Care1
  • HIV/HBV coinfection does not necessitate cesarean delivery, if not otherwise indicated (see Intrapartum Care ) (AIII) . (nih.gov)
Tests1