A set of three nucleotides in a protein coding sequence that specifies individual amino acids or a termination signal (CODON, TERMINATOR). Most codons are universal, but some organisms do not produce the transfer RNAs (RNA, TRANSFER) complementary to all codons. These codons are referred to as unassigned codons (CODONS, NONSENSE).
A codon that directs initiation of protein translation (TRANSLATION, GENETIC) by stimulating the binding of initiator tRNA (RNA, TRANSFER, MET). In prokaryotes, the codons AUG or GUG can act as initiators while in eukaryotes, AUG is the only initiator codon.
Any codon that signals the termination of genetic translation (TRANSLATION, GENETIC). PEPTIDE TERMINATION FACTORS bind to the stop codon and trigger the hydrolysis of the aminoacyl bond connecting the completed polypeptide to the tRNA. Terminator codons do not specify amino acids.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
A transfer RNA which is specific for carrying methionine to sites on the ribosomes. During initiation of protein synthesis, tRNA(f)Met in prokaryotic cells and tRNA(i)Met in eukaryotic cells binds to the start codon (CODON, INITIATOR).
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
An amino acid-specifying codon that has been converted to a stop codon (CODON, TERMINATOR) by mutation. Its occurance is abnormal causing premature termination of protein translation and results in production of truncated and non-functional proteins. A nonsense mutation is one that converts an amino acid-specific codon to a stop codon.
A process of GENETIC TRANSLATION whereby the formation of a peptide chain is started. It includes assembly of the RIBOSOME components, the MESSENGER RNA coding for the polypeptide to be made, INITIATOR TRNA, and PEPTIDE INITIATION FACTORS; and placement of the first amino acid in the peptide chain. The details and components of this process are unique for prokaryotic protein biosynthesis and eukaryotic protein biosynthesis.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
The small RNA molecules, 73-80 nucleotides long, that function during translation (TRANSLATION, GENETIC) to align AMINO ACIDS at the RIBOSOMES in a sequence determined by the mRNA (RNA, MESSENGER). There are about 30 different transfer RNAs. Each recognizes a specific CODON set on the mRNA through its own ANTICODON and as aminoacyl tRNAs (RNA, TRANSFER, AMINO ACYL), each carries a specific amino acid to the ribosome to add to the elongating peptide chains.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
The sequential set of three nucleotides in TRANSFER RNA that interacts with its complement in MESSENGER RNA, the CODON, during translation in the ribosome.
A subtype of caspases that contain long pro-domain regions that regulate the activation of the enzyme. The pro-domain regions contain protein-protein interaction motifs that can interact with specific signaling adaptor proteins such as DEATH DOMAIN RECEPTORS; DED SIGNALING ADAPTOR PROTEINS; and CARD SIGNALING ADAPTOR PROTEINS. Once activated, the initiator caspases can activate other caspases such as the EFFECTOR CASPASES.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
A unique DNA sequence of a replicon at which DNA REPLICATION is initiated and proceeds bidirectionally or unidirectionally. It contains the sites where the first separation of the complementary strands occurs, a primer RNA is synthesized, and the switch from primer RNA to DNA synthesis takes place. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Multicomponent ribonucleoprotein structures found in the CYTOPLASM of all cells, and in MITOCHONDRIA, and PLASTIDS. They function in PROTEIN BIOSYNTHESIS via GENETIC TRANSLATION.
The meaning ascribed to the BASE SEQUENCE with respect to how it is translated into AMINO ACID SEQUENCE. The start, stop, and order of amino acids of a protein is specified by consecutive triplets of nucleotides called codons (CODON).
The process by which a DNA molecule is duplicated.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
A conserved A-T rich sequence which is contained in promoters for RNA polymerase II. The segment is seven base pairs long and the nucleotides most commonly found are TATAAAA.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
Intermediates in protein biosynthesis. The compounds are formed from amino acids, ATP and transfer RNA, a reaction catalyzed by aminoacyl tRNA synthetase. They are key compounds in the genetic translation process.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
Enzymes that catalyze the transfer of hydroxymethyl or formyl groups. EC 2.1.2.
Proteins found in any species of bacterium.
The largest of the three prokaryotic initiation factors with a molecular size of approximately 80 kD. It functions in the transcription initiation process by promoting the binding of formylmethionine-tRNA to the P-site of the 30S ribosome and by preventing the incorrect binding of elongator tRNA to the translation initiation site.
Protein factors uniquely required during the initiation phase of protein synthesis in GENETIC TRANSLATION.
Proteins that catalyze the unwinding of duplex DNA during replication by binding cooperatively to single-stranded regions of DNA or to short regions of duplex DNA that are undergoing transient opening. In addition DNA helicases are DNA-dependent ATPases that harness the free energy of ATP hydrolysis to translocate DNA strands.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
The functional hereditary units of BACTERIA.
A prokaryotic initiation factor that plays a role in recycling of ribosomal subunits for a new round of translational initiation. It binds to 16S RIBOSOMAL RNA and stimulates the dissociation of vacant 70S ribosomes. It may also be involved in the preferential binding of initiator tRNA to the 30S initiation complex.
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.
An enzyme that activates methionine with its specific transfer RNA. EC 6.1.1.10.
A eukaryotic initiation factor that binds to 40S ribosomal subunits. Although initially considered a "non-essential" factor for eukaryotic transcription initiation, eukaryotic initiation factor-1 is now thought to play an important role in localizing RIBOSOMES at the initiation codon of MRNA.
A process of GENETIC TRANSLATION whereby the terminal amino acid is added to a lengthening polypeptide. This termination process is signaled from the MESSENGER RNA, by one of three termination codons (CODON, TERMINATOR) that immediately follows the last amino acid-specifying CODON.
Proteins found in any species of virus.
A sulfur-containing essential L-amino acid that is important in many body functions.
A family of intracellular CYSTEINE ENDOPEPTIDASES that play a role in regulating INFLAMMATION and APOPTOSIS. They specifically cleave peptides at a CYSTEINE amino acid that follows an ASPARTIC ACID residue. Caspases are activated by proteolytic cleavage of a precursor form to yield large and small subunits that form the enzyme. Since the cleavage site within precursors matches the specificity of caspases, sequential activation of precursors by activated caspases can occur.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
Biochemical identification of mutational changes in a nucleotide sequence.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
A long pro-domain caspase that contains a caspase recruitment domain in its pro-domain region. Activation of this enzyme can occur via the interaction of its caspase recruitment domain with CARD SIGNALING ADAPTOR PROTEINS. Caspase 2 plays a role in APOPTOSIS by cleaving and activating effector pro-caspases. Several isoforms of this protein exist due to multiple alternative splicing of its MESSENGER RNA.
Effective in the initiation of protein synthesis. The initiating methionine residue enters the ribosome as N-formylmethionyl tRNA. This process occurs in Escherichia coli and other bacteria as well as in the mitochondria of eucaryotic cells.
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
A group of transfer RNAs which are specific for carrying each one of the 20 amino acids to the ribosome in preparation for protein synthesis.
A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
A peroxide derivative that has been used topically for BURNS and as a dermatologic agent in the treatment of ACNE and POISON IVY DERMATITIS. It is used also as a bleach in the food industry.
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
A process of GENETIC TRANSLATION, when an amino acid is transferred from its cognate TRANSFER RNA to the lengthening chain of PEPTIDES.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.
A long pro-domain caspase that contains a caspase recruitment domain in its pro-domain region. Caspase 9 is activated during cell stress by mitochondria-derived proapoptotic factors and by CARD SIGNALING ADAPTOR PROTEINS such as APOPTOTIC PROTEASE-ACTIVATING FACTOR 1. It activates APOPTOSIS by cleaving and activating EFFECTOR CASPASES.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Constituent composed of protein and phospholipid that is widely distributed in many tissues. It serves as a cofactor with factor VIIa to activate factor X in the extrinsic pathway of blood coagulation.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
Established cell cultures that have the potential to propagate indefinitely.
Family of retrovirus-associated DNA sequences (ras) originally isolated from Harvey (H-ras, Ha-ras, rasH) and Kirsten (K-ras, Ki-ras, rasK) murine sarcoma viruses. Ras genes are widely conserved among animal species and sequences corresponding to both H-ras and K-ras genes have been detected in human, avian, murine, and non-vertebrate genomes. The closely related N-ras gene has been detected in human neuroblastoma and sarcoma cell lines. All genes of the family have a similar exon-intron structure and each encodes a p21 protein.
A long pro-domain caspase that contains a death effector domain in its pro-domain region. Caspase 8 plays a role in APOPTOSIS by cleaving and activating EFFECTOR CASPASES. Activation of this enzyme can occur via the interaction of its N-terminal death effector domain with DEATH DOMAIN RECEPTOR SIGNALING ADAPTOR PROTEINS.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Eukaryotic initiation factor of protein synthesis. In higher eukaryotes the factor consists of three subunits: alpha, beta, and gamma. As initiation proceeds, eIF-2 forms a ternary complex with Met-tRNAi and GTP.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
Mutation process that restores the wild-type PHENOTYPE in an organism possessing a mutationally altered GENOTYPE. The second "suppressor" mutation may be on a different gene, on the same gene but located at a distance from the site of the primary mutation, or in extrachromosomal genes (EXTRACHROMOSOMAL INHERITANCE).
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.
A long pro-domain caspase that contains a death effector domain in its pro-domain region. Activation of this enzyme can occur via the interaction of its N-terminal death effector domain with DEATH DOMAIN RECEPTOR SIGNALING ADAPTOR PROTEINS. Caspase 10 plays a role in APOPTOSIS by cleaving and activating EFFECTOR CASPASES. Several isoforms of this protein exist due to multiple alternative splicing of its MESSENGER RNA.
The functional hereditary units of VIRUSES.
Proteins that are involved in the peptide chain termination reaction (PEPTIDE CHAIN TERMINATION, TRANSLATIONAL) on RIBOSOMES. They include codon-specific class-I release factors, which recognize stop signals (TERMINATOR CODON) in the MESSENGER RNA; and codon-nonspecific class-II release factors.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Deletion of sequences of nucleic acids from the genetic material of an individual.
The combination of two or more different factors in the production of cancer.
The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.
The major sequence-specific DNA-binding component involved in the activation of transcription of RNA POLYMERASE II. It was originally described as a complex of TATA-BOX BINDING PROTEIN and TATA-BINDING PROTEIN ASSOCIATED FACTORS. It is now know that TATA BOX BINDING PROTEIN-LIKE PROTEINS may take the place of TATA-box binding protein in the complex.
The rate dynamics in chemical or physical systems.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
The origin recognition complex is a multi-subunit DNA-binding protein that initiates DNA REPLICATION in eukaryotes.
A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
Proteins obtained from ESCHERICHIA COLI.
A subclass of enzymes that aminoacylate AMINO ACID-SPECIFIC TRANSFER RNA with their corresponding AMINO ACIDS.
An enzyme that activates alanine with its specific transfer RNA. EC 6.1.1.7.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
Nucleic acid sequences involved in regulating the expression of genes.
Any DNA sequence capable of independent replication or a molecule that possesses a REPLICATION ORIGIN and which is therefore potentially capable of being replicated in a suitable cell. (Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
The three possible sequences of CODONS by which GENETIC TRANSLATION may occur from one nucleotide sequence. A segment of mRNA 5'AUCCGA3' could be translated as 5'AUC.. or 5'UCC.. or 5'CCG.., depending on the location of the START CODON.
Substances that increase the risk of NEOPLASMS in humans or animals. Both genotoxic chemicals, which affect DNA directly, and nongenotoxic chemicals, which induce neoplasms by other mechanism, are included.
The relationships of groups of organisms as reflected by their genetic makeup.
Proteins prepared by recombinant DNA technology.
Endogenous and exogenous compounds and that either inhibit CASPASES or prevent their activation.
A circumscribed benign epithelial tumor projecting from the surrounding surface; more precisely, a benign epithelial neoplasm consisting of villous or arborescent outgrowths of fibrovascular stroma covered by neoplastic cells. (Stedman, 25th ed)
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.
The first nucleotide of a transcribed DNA sequence where RNA polymerase (DNA-DIRECTED RNA POLYMERASE) begins synthesizing the RNA transcript.
The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Immature ERYTHROCYTES. In humans, these are ERYTHROID CELLS that have just undergone extrusion of their CELL NUCLEUS. They still contain some organelles that gradually decrease in number as the cells mature. RIBOSOMES are last to disappear. Certain staining techniques cause components of the ribosomes to precipitate into characteristic "reticulum" (not the same as the ENDOPLASMIC RETICULUM), hence the name reticulocytes.
Differential and non-random reproduction of different genotypes, operating to alter the gene frequencies within a population.
A method for determining the sequence specificity of DNA-binding proteins. DNA footprinting utilizes a DNA damaging agent (either a chemical reagent or a nuclease) which cleaves DNA at every base pair. DNA cleavage is inhibited where the ligand binds to DNA. (from Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.
Enzymes that catalyze the endonucleolytic cleavage of single-stranded regions of DNA or RNA molecules while leaving the double-stranded regions intact. They are particularly useful in the laboratory for producing "blunt-ended" DNA molecules from DNA with single-stranded ends and for sensitive GENETIC TECHNIQUES such as NUCLEASE PROTECTION ASSAYS that involve the detection of single-stranded DNA and RNA.
Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.
Any method used for determining the location of and relative distances between genes on a chromosome.
Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
A death domain receptor signaling adaptor protein that plays a role in signaling the activation of INITIATOR CASPASES such as CASPASE 2. It contains a death domain that is specific for RIP SERINE-THEONINE KINASES and a caspase-binding domain that binds to and activates CASPASES such as CASPASE 2.
Basic peptide antibiotic from Bacillus brevis. It exhibits broad-spectrum antibacterial activity and inhibits bacterial DNA synthesis.
Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.
A fractionated cell extract that maintains a biological function. A subcellular fraction isolated by ultracentrifugation or other separation techniques must first be isolated so that a process can be studied free from all of the complex side reactions that occur in a cell. The cell-free system is therefore widely used in cell biology. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p166)
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
Multimeric protein complexes formed in the CYTOSOL that play a role in the activation of APOPTOSIS. They can occur when MITOCHONDRIA become damaged due to cell stress and release CYTOCHROME C. Cytosolic cytochrome C associates with APOPTOTIC PROTEASE-ACTIVATING FACTOR 1 to form the apoptosomal protein complex. The apoptosome signals apoptosis by binding to and activating specific INITIATOR CASPASES such as CASPASE 9.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
An enzyme catalyzing the endonucleolytic cleavage of RNA at the 3'-position of a guanylate residue. EC 3.1.27.3.
A multisubunit eukaryotic initiation factor that contains at least 8 distinct polypeptides. It plays a role in recycling of ribosomal subunits to the site of transcription initiation by promoting the dissociation of non-translating ribosomal subunits. It also is involved in promoting the binding of a ternary complex of EUKARYOTIC INITIATION FACTOR-2; GTP; and INITIATOR TRNA to the 40S ribosomal subunit.
Cells of the higher organisms, containing a true nucleus bounded by a nuclear membrane.
Chemical reaction in which monomeric components are combined to form POLYMERS (e.g., POLYMETHYLMETHACRYLATE).
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.
Guanosine 5'-(tetrahydrogen triphosphate). A guanine nucleotide containing three phosphate groups esterified to the sugar moiety.
The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.
Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
Chemical compound used to initiate polymerization of dental resins by the use of DENTAL CURING LIGHTS. It absorbs UV light and undergoes decomposition into free radicals that initiate polymerization process of the resins in the mix. Each photoinitiator has optimum emission spectrum and intensity for proper curing of dental materials.
The methyl ester of methacrylic acid. It polymerizes easily to form POLYMETHYL METHACRYLATE. It is used as a bone cement.
The methyl esters of methacrylic acid that polymerize easily and are used as tissue cements, dental materials, and absorbent for biological substances.
Proteins found in ribosomes. They are believed to have a catalytic function in reconstituting biologically active ribosomal subunits.
A species of DELTAPAPILLOMAVIRUS infecting cattle.
The functional hereditary units of FUNGI.
Enzymes that catalyze the S-adenosyl-L-methionine-dependent methylation of ribonucleotide bases within a transfer RNA molecule. EC 2.1.1.
7,12-Dimethylbenzanthracene. Polycyclic aromatic hydrocarbon found in tobacco smoke that is a potent carcinogen.
The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)
Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)
Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.
The conversion of uncharged TRANSFER RNA to AMINO ACYL TRNA.
Variation in a population's DNA sequence that is detected by determining alterations in the conformation of denatured DNA fragments. Denatured DNA fragments are allowed to renature under conditions that prevent the formation of double-stranded DNA and allow secondary structure to form in single stranded fragments. These fragments are then run through polyacrylamide gels to detect variations in the secondary structure that is manifested as an alteration in migration through the gels.
A directed change in translational READING FRAMES that allows the production of a single protein from two or more OVERLAPPING GENES. The process is programmed by the nucleotide sequence of the MRNA and is sometimes also affected by the secondary or tertiary mRNA structure. It has been described mainly in VIRUSES (especially RETROVIRUSES); RETROTRANSPOSONS; and bacterial insertion elements but also in some cellular genes.
Polymerized methyl methacrylate monomers which are used as sheets, moulding, extrusion powders, surface coating resins, emulsion polymers, fibers, inks, and films (From International Labor Organization, 1983). This material is also used in tooth implants, bone cements, and hard corneal contact lenses.
The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
The process by which two molecules of the same chemical composition form a condensation product or polymer.
A transfer RNA which is specific for carrying glutamine to sites on the ribosomes in preparation for protein synthesis.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Deoxyribonucleic acid that makes up the genetic material of viruses.
Pairing of purine and pyrimidine bases by HYDROGEN BONDING in double-stranded DNA or RNA.
The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.
Permanganic acid (HMnO4), potassium salt. A highly oxidative, water-soluble compound with purple crystals, and a sweet taste. (From McGraw-Hill Dictionary of Scientific and Technical Information, 4th ed)
Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.
Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.
Acrylic acids or acrylates which are substituted in the C-2 position with a methyl group.
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Tumor suppressor genes located on the short arm of human chromosome 17 and coding for the phosphoprotein p53.
A genus in the family NANOVIRIDAE containing multiple circular single-stranded DNA molecules. The type species is Subterranean clover stunt virus.
A single chain of deoxyribonucleotides that occurs in some bacteria and viruses. It usually exists as a covalently closed circle.
Promoter-specific RNA polymerase II transcription factor that binds to the GC box, one of the upstream promoter elements, in mammalian cells. The binding of Sp1 is necessary for the initiation of transcription in the promoters of a variety of cellular and viral GENES.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.
Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
Genotypic differences observed among individuals in a population.
A transfer RNA which is specific for carrying serine to sites on the ribosomes in preparation for protein synthesis.
A group of enzymes that catalyzes the hydrolysis of terminal, non-reducing beta-D-galactose residues in beta-galactosides. Deficiency of beta-Galactosidase A1 may cause GANGLIOSIDOSIS, GM1.
Cells lacking a nuclear membrane so that the nuclear material is either scattered in the cytoplasm or collected in a nucleoid region.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
A transfer RNA which is specific for carrying arginine to sites on the ribosomes in preparation for protein synthesis.
Tumors or cancer of the SKIN.
Genes that have a suppressor allele or suppressor mutation (SUPPRESSION, GENETIC) which cancels the effect of a previous mutation, enabling the wild-type phenotype to be maintained or partially restored. For example, amber suppressors cancel the effect of an AMBER NONSENSE MUTATION.
Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.
Inorganic or organic compounds derived from phosphine (PH3) by the replacement of H atoms. (From Grant & Hackh's Chemical Dictionary, 5th ed)
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
A short pro-domain caspase that plays an effector role in APOPTOSIS. It is activated by INITIATOR CASPASES such as CASPASE 7; CASPASE 8; and CASPASE 10. Isoforms of this protein exist due to multiple alternative splicing of its MESSENGER RNA.
A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.
A protein found in bacteria and eukaryotic mitochondria which delivers aminoacyl-tRNA's to the A site of the ribosome. The aminoacyl-tRNA is first bound to a complex of elongation factor Tu containing a molecule of bound GTP. The resulting complex is then bound to the 70S initiation complex. Simultaneously the GTP is hydrolyzed and a Tu-GDP complex is released from the 70S ribosome. The Tu-GTP complex is regenerated from the Tu-GDP complex by the Ts elongation factor and GTP.
An enzyme that catalyzes the acetylation of chloramphenicol to yield chloramphenicol 3-acetate. Since chloramphenicol 3-acetate does not bind to bacterial ribosomes and is not an inhibitor of peptidyltransferase, the enzyme is responsible for the naturally occurring chloramphenicol resistance in bacteria. The enzyme, for which variants are known, is found in both gram-negative and gram-positive bacteria. EC 2.3.1.28.
Aminopeptidases that remove METHIONINE from the amino-terminus of a peptide chain, such as the initiator METHIONINE found on nascent peptide chains.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.
A family of DNA helicases that participate in DNA REPLICATION. They assemble into hexameric rings with a central channel and unwind DNA processively in the 5' to 3' direction. DnaB helicases are considered the primary replicative helicases for most prokaryotic organisms.

Machine learning approaches for the prediction of signal peptides and other protein sorting signals. (1/852)

Prediction of protein sorting signals from the sequence of amino acids has great importance in the field of proteomics today. Recently, the growth of protein databases, combined with machine learning approaches, such as neural networks and hidden Markov models, have made it possible to achieve a level of reliability where practical use in, for example automatic database annotation is feasible. In this review, we concentrate on the present status and future perspectives of SignalP, our neural network-based method for prediction of the most well-known sorting signal: the secretory signal peptide. We discuss the problems associated with the use of SignalP on genomic sequences, showing that signal peptide prediction will improve further if integrated with predictions of start codons and transmembrane helices. As a step towards this goal, a hidden Markov model version of SignalP has been developed, making it possible to discriminate between cleaved signal peptides and uncleaved signal anchors. Furthermore, we show how SignalP can be used to characterize putative signal peptides from an archaeon, Methanococcus jannaschii. Finally, we briefly review a few methods for predicting other protein sorting signals and discuss the future of protein sorting prediction in general.  (+info)

Exon shuffling by L1 retrotransposition. (2/852)

Long interspersed nuclear elements (LINE-1s or L1s) are the most abundant retrotransposons in the human genome, and they serve as major sources of reverse transcriptase activity. Engineered L1s retrotranspose at high frequency in cultured human cells. Here it is shown that L1s insert into transcribed genes and retrotranspose sequences derived from their 3' flanks to new genomic locations. Thus, retrotransposition-competent L1s provide a vehicle to mobilize non-L1 sequences, such as exons or promoters, into existing genes and may represent a general mechanism for the evolution of new genes.  (+info)

The chloroplast infA gene with a functional UUG initiation codon. (3/852)

All chloroplast genes reported so far possess ATG start codons and sometimes GTGs as an exception. Sequence alignments suggested that the chloroplast infA gene encoding initiation factor 1 in the green alga Chlorella vulgaris has TTG as a putative initiation codon. This gene was shown to be transcribed by RT-PCR analysis. The infA mRNA was translated accurately from the UUG codon in a tobacco chloroplast in vitro translation system. Mutation of the UUG codon to AUG increased translation efficiency approximately 300-fold. These results indicate that the UUG is functional for accurate translation initiation of Chlorella infA mRNA but it is an inefficient initiation codon.  (+info)

Involvement of the aphthovirus RNA region located between the two functional AUGs in start codon selection. (4/852)

Initiation of translation in picornavirus RNAs occurs internally, mediated by an element termed internal ribosome entry site (IRES). In the aphthovirus RNA, the IRES element directs translation initiation at two in-frame AUGs separated by 84 nucleotides. We have found that bicistronic constructs that contained the IRES element followed by the fragment including the aphthovirus start codons in front of the second gene mimicked the translation initiation pattern of viral RNA observed in infected cells. In those constructs, the frequency of initiation at the first AUG was increased by a sequence context that resembled the favorable consensus for cap-dependent translation, although initiation at the second site was always preferred. In addition, we have found that initiation at the second start codon was not diminished under conditions in which the first initiation codon was blocked by antisense oligonucleotide interference. Interestingly, mutations that positioned the second AUG out-of-frame with the first AUG did not interfere with the frequency of initiation at the second one. On the contrary, IRES-dependent translation initiation in bicistronic constructs lacking the sequences present between functional AUGs in the viral RNA was sensitive to the presence of out-of-frame initiator codons and hairpins in the spacer region. This remarkable difference in start codon recognition was due to the nucleotide composition of the RNA that separated the IRES from the initiator codon. Thus our results indicate that the region located in the aphthovirus RNA between functional AUGs is involved in start codon recognition, strongly favoring selection of the second start AUG as the main initiator codon.  (+info)

Analysis of elements involved in pseudoknot-dependent expression and regulation of the repA gene of an IncL/M plasmid. (5/852)

Replication of the IncL/M plasmid pMU604 is controlled by a small antisense RNA molecule (RNAI), which, by inhibiting the formation of an RNA pseudoknot, regulates translation of the replication initiator protein, RepA. Efficient translation of the repA mRNA was shown to require the translation and correct termination of the leader peptide, RepB, and the formation of the pseudoknot. Although the pseudoknot was essential for the expression of repA, its presence was shown to interfere with the translation of repB. The requirement for pseudoknot formation could in large part be obviated by improving the ribosome binding region of repA, either by replacing the GUG start codon by AUG or by increasing the spacing between the start codon and the Shine-Dalgarno sequence (SD). The spacing between the distal pseudoknot sequence and the repA SD was shown to be suboptimal for maximal expression of repA.  (+info)

Multiple murine double minute gene 2 (MDM2) proteins are induced by ultraviolet light. (6/852)

The mdm2 (murine double minute 2) oncogene encodes several proteins, the largest of which (p90) binds to and inactivates the p53 tumor suppressor protein. Multiple MDM2 proteins have been detected in tumors and in cell lines expressing high levels of mdm2 mRNAs. Here we show that one of these proteins (p76) is expressed, along with p90, in wild-type and p53-null mouse embryo fibroblasts, indicating that it may have an important physiological role in normal cells. Expression of this protein is induced, as is that of p90, by UV light in a p53-dependent manner. The p76 protein is synthesized via translational initiation at AUG codon 50 and thus lacks the N terminus of p90 and does not bind p53. In cells, p90 and p76 can be synthesized from mdm2 mRNAs transcribed from both the P1 (constitutive) and P2 (p53-responsive) promoters. Site-directed mutagenesis reveals that these RNAs give rise to p76 via internal initiation of translation. In addition, mdm2 mRNAs lacking exon 3 give rise to p76 exclusively, and such mRNAs are induced by p53 in response to UV light. These data indicate that p76 may be an important product of the mdm2 gene and a downstream effector of p53.  (+info)

Postsynaptic alpha-neurotoxin gene of the spitting cobra, Naja naja sputatrix: structure, organization, and phylogenetic analysis. (7/852)

The venom of the spitting cobra, Naja naja sputatrix contains highly potent alpha-neurotoxins (NTXs) in addition to phospholipase A2 (PLA2) and cardiotoxin (CTX). In this study, we report the complete characterization of three genes that are responsible for the synthesis of three isoforms of alpha-NTX in the venom of a single spitting cobra. DNA amplification by long-distance polymerase chain reaction (LD-PCR) and genome walking have provided information on the gene structure including their promoter and 5' and 3' UTRs. Each NTX isoform is approximately 4 kb in size and contains three exons and two introns. The sequence homology among these isoforms was found to be 99%. Two possible transcription sites were identified by primer extension analysis and they corresponded to the adenine (A) nucleotide at positions +1 and -45. The promoter also contains two TATA boxes and a CCAAT box. Putative binding sites for transcriptional factors AP-2 and GATA are also present. The high percentage of similarity observed among the NTX gene isoforms of N. n. sputatrix as well as with the alpha-NTX and kappa-NTX genes from other land snakes suggests that the NTX gene has probably evolved from a common ancestral gene.  (+info)

The cis acting sequences responsible for the differential decay of the unstable MFA2 and stable PGK1 transcripts in yeast include the context of the translational start codon. (8/852)

A general pathway of mRNA turnover has been described for yeast in which the 3' poly(A) tail is first deadenylated to an oligo(A) length, leading to decapping and subsequent 5'-3' exonucleolytic decay. The unstable MFA2 mRNA and the stable PGK1 mRNAs both decay through this pathway, albeit at different rates of deadenylation and decapping. To determine the regions of the mRNAs that are responsible for these differences, we examined the decay of chimeric mRNAs derived from the 5' untranslated, coding, and 3' untranslated regions of these two mRNAs. These experiments have led to the identification of the features of these mRNAs that lead to their different stabilities. The MFA2 mRNA is unstable solely because its 3' UTR promotes the rates of deadenylation and decapping; all other features of this mRNA are neutral with respect to mRNA decay rates. The PGK1 mRNA is stable because the sequence context of the PGK1 translation start codon and the coding region function together to stabilize the transcript, whereas the PGK13' UTR is neutral with respect to decay. Importantly, changes in the PGK1 start codon context that destabilized the transcript also reduced its translational efficiency. This observation suggests that the nature of the translation initiation complex modulates the rates of mRNA decapping and decay.  (+info)

An AUG in an optimal nucleotide context is the preferred translation initiation site in eukaryotic cells. Interactions among translation initiation factors, including eIF1 and eIF5, govern start codon selection. Experiments described here showed that high intracellular eIF5 levels reduced the stringency of start codon selection in human cells. In contrast, high intracellular eIF1 levels increased stringency. High levels of eIF5 induced translation of inhibitory upstream open reading frames (uORFs) in eIF5 mRNA that initiate with AUG codons in conserved poor contexts. This resulted in reduced translation from the downstream eIF5 start codon, indicating that eIF5 autoregulates its own synthesis. As with eIF1, which is also autoregulated through translation initiation, features contributing to eIF5 autoregulation show deep evolutionary conservation. The results obtained provide the basis for a model in which auto- and cross-regulation of eIF5 and eIF1 translation establish a regulatory feedback ...
Medicina di varicosity che sta a uomini; Il massager per gambe da varicosity. merlicam. on at Aug 30, · Video embedded 10/10(22). Medicina di varicosity che sta a uomini; Il massager per gambe da varicosity. merlicam. on at Aug 30, · Video embedded 10/10(22). Medicina di varicosity che sta a uomini; Il massager per gambe da varicosity. merlicam. on at Aug 30, · Video embedded 10/10(22). Medicina di varicosity che sta a uomini; Il massager per gambe da varicosity. merlicam. on at Aug 30, · Video embedded 10/10(22). Medicina di varicosity che sta a uomini; Il massager per gambe da varicosity. merlicam. on at Aug 30, · Video embedded 10/10(22). ...
The PLRV gene coding for the pr17 protein was modified by the addition of a 5 terminal extension by fusion to the multiple cloning site (polylinker) of the vector pBluescript. By targeted mutagenesis, the first two AUG translation start codons of the pr17 gene were changed into ACG codons and an AUG codon was inserted into the polylinker sequence ...
SYSTEM AND METHOD FOR VIRTUAL PARTITION MONITORING | PROCESS TESTING APPARATUS, PROCESS TESTING PROGRAM, AND PROCESS TESTING METHOD | Automated Code Lockdown To Reduce Attack Surface For Software | SYSTEM AND METHOD FOR HYPERVISOR-BASED SECURITY | FILE INTEGRITY PRESERVATION |
METHOD FOR CONSTRUCTING CYLINDRICAL TANK | MULTIFUNCTIONAL ENCLOSURE | AUTONOMOUS BEAM ASSEMBLY SYSTEM FOR STEEL STRUCTURE | ARCHITECTURAL BUILDING BLOCK | FILTRATION APPARATUS FOR USE WITH DRAINAGE STRUCTURES AND METHOD FOR INSTALLING THE SAME |
This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, which in human have been shown to have different subcellular localization. [provided by RefSeq, Jul 2008 ...
c-myc_Antibody- by Western blot 1:2,000 dilution will yield a strong band in WB.There is evidence to show that alternative translation initiations from an upstream
Scene missing! A video that used to be embedded in this post has disappeared. If you know of a copy of this video that is still accessible, please mail me so that I can update the link ...
Usage of presumed 5′UTR or downstream in-frame AUG codons, next to non-AUG codons as translation start codons contributes to the diversity of a proteome as protein isoforms harboring different N-terminal extensions or truncations can serve different functions. Recent ribosome profiling data revealed a highly underestimated occurrence of database nonannotated, and thus alternative translation initiation sites (aTIS), at the mRNA level. N-terminomics data in addition showed that in higher eukaryotes around 20% of all identified protein N termini point to such aTIS, to incorrect assignments of the translation start codon, translation initiation at near-cognate start codons, or to alternative splicing. We here report on more than 1700 unique alternative protein N termini identified at the proteome level in human and murine cellular proteomes. Customized databases, created using the translation initiation mapping obtained from ribosome profiling data, additionally demonstrate the use of initiator ...
In prokaryotes, several mRNA sequences surrounding the initiation codon have been found to influence the translation process; these include the downstream region and its codon context, the Shine-Dalgarno sequence and the S1 ribosomal protein-binding site. In this thesis, the purpose has been to study the role of the downstream region and Shine-Dalgarno-like sequences on early translation elongation and gene expression in Escherichia coli.. The downstream region (DR) after the initiation codon (around five to seven codons), has an important role in the initiation of translation. We find that most of the codons which give very low gene expression at +2 (considering AUG as +1), reach 5 to 10 fold higher expression when those codons are positioned posteriori to +2, with the exception of the NGG codons. The NGG codons abort the translation process if located within the first five codons of the DR, due to peptidyl-tRNA drop-off. However, when the NGG codons are situated further down from the DR, the ...
From UniProtKB/Swiss-Prot: Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S preinitiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. Required for nonsense-mediated mRNA decay (NMD); may act in conjunction with UPF2 to divert mRNAs from translation to the NMD pathway. May interact with MCM7 and EPAS1 and regulate the proteasome-mediated degradation of these proteins.
This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It plays an essential role in the normal development of the urogenital system, and the orthologous human gene is mutated in a small subset of patients with Wilm's tumors. Alternative splicing has been noted for this gene, however, the full-length nature of these variants is not known. The mRNA for this gene has been shown to initiate translation from non-AUG (CUG) and AUG translation start sites, resulting in different isoforms. [provided by RefSeq, Apr 2013 ...
Prodigal: prokaryotic gene recognition and translation initiation site identification. Background: The quality of automated gene prediction in microbial organisms has improved steadily over the past decade, but there is still room for improvement. Increasing the number of correct identifications, both of genes and of the translation initiation sites for each gene, and reducing the overall number of false positives, are all desirable goals. Results: With our years of experience in manually curating genomes for the Joint Genome Institute, we developed a new gene prediction algorithm called Prodigal (PROkaryotic DYnamic programming Gene-finding ALgorithm). With Prodigal, we focused specifically on the three goals of improved gene structure prediction, improved translation initiation site recognition, and reduced false positives. We compared the results of Prodigal to existing gene-finding methods to demonstrate that it met each of these objectives. Conclusion: We built a fast, lightweight, open source gene
A typical fully processed mRNA includes one reference-protein coding ORF (RefORF) or coding sequence. This overly simplistic view is however challenged by recent evidence of translation of alternative ORFs (AltORFs). AltORFs are defined as ORFs occurring either in untranslated regions, or overlapping the RefORF in the non-canonical +2 and +3 reading frames. The use of alternative translation initiation is well-described for viruses and provide small viral genomes with an increased coding capacity, but has been overlooked in eukaryotes. To address this issue, we generated a database of predicted AltORFs in the human transcriptome. We identified 83,886 AltORFs with a minimum size of 40 codons. This threshold was established to increase the chances of detecting the predicted alternative proteins by proteomic techniques, including tryptic digestion and mass spectrometry, and SDS-PAGE. For the majority of mRNAs (87.58 %) we found at least one predicted AltORF and, on average, 3.88 predicted AltORFs ...
Looking for 20 Aug? Find out information about 20 Aug. African World Festival Aug 20, 2011; Aug 20, 2016; Aug 20, 2017; Aug 20, 2022; Aug 20, 2023 Asanha Bucha Day Aug 20, 2013 Baths of Caracalla Aug 20, 2011;... Explanation of 20 Aug
Independent pathways for detecting fault condition in electric motor | Methods and systems for transient voltage protection | Electrical drive system and energy storage apparatus therefor | Method to control a switched reluctance motor | Methods of controlling a machine using a torque command limit derived from a current limit and systems thereof |
Three dimensional printer and method for adjusting working coordinate of platform thereof | Method for applying reinforcing seam tape | Apparatus for the manufacture of a plastics filling material and a method of using the apparatus | Motor chain saw with supply pump | Transversal cutting equipment for sheets separable from overlapped continuous forms |
(= start codon) The codon 5 AUG in mRNA, at which polypeptide synthesis is started. It is recognized by formylmethionyl tRNA in bacteria and by methionyl tRNA in eukaryotes
(KudoZ) English to Portuguese translation of environmental initiators : desencadeadores ambientais [Diabetes - Medical: Pharmaceuticals (Medical)].
Survey: - KAPALA [details]. Deployment Type: - Catch Station: 990801. Operation No.: 4150. When: 23-Aug-1999 21:00 to 23-Aug-1999 22:30 UTC Where: 36° 13.0 S 150° 24.0 E ...
Everlasting Blort - a compendium of the webs weird underbelly, updated daily with links to the strange, absurd, bizarre, humorous, surreal and satiric.
TY - JOUR. T1 - Translational control of Scamper expression via a cell-specific internal ribosome entry site. AU - de Pietri Tonelli, Davide. AU - Mihailovich, Marija. AU - Schnurbus, Raphaela. AU - Pesole, Graziano. AU - Grohovaz, Fabio. AU - Zacchetti, Daniele. PY - 2003/5/15. Y1 - 2003/5/15. N2 - The mRNA of Scamper, a putative intracellular calcium channel activated by sphingosylphosphocholine, contains a long 5′ transcript leader with several upstream AUGs. In this work we have investigated the role this sequence plays in the translational control of Scamper expression. The cytosolic transcription machinery of a T7 RNA polymerase recombinant vaccinia virus was used to avoid artifacts arising from cryptic promoters or mRNA processing. Based on transient transfection experiments of dicistronic and bi-monocistronic plasmids expressing reporter genes, we present evidence that the 5′ transcript leader of Scamper contains a functional internal ribosome entry site (IRES). Our data indicate ...
Our understanding of translation underpins our capacity to engineer living systems. The canonical start codon (AUG) and a few near-cognates (GUG, UUG) are considered as the start codons for translation initiation in Escherichia coli. Translation is typically not thought to initiate from the 61 remaining codons. Here, we quantified translation initiation of green fluorescent protein and nanoluciferase in E. coli from all 64 triplet codons and across a range of DNA copy number. We detected initiation of protein synthesis above measurement background for 47 codons. Translation from non-canonical start codons ranged from 0.007 to 3% relative to translation from AUG. Translation from 17 non-AUG codons exceeded the highest reported rates of non-cognate codon recognition. Translation initiation from non-canonical start codons may contribute to the synthesis of peptides in both natural and synthetic biological systems. ...
Whatever happens with Floyd, I cant help but think this could have been handled better. No one at the Chatenay-Malabry lab should be discussing the results of the A test, and it does cycling no good for information to be leaked in dribs and drabs like this.. I suppose well know the truth soon, but whether the B sample exonerates Landis or shows that he did have synthetic testosterone in his system, Ill always have doubts. Posted by: Jason at Aug 1, 2006 1:14:42 AM. As discussed in the I need testosterone comments, what other lab governing body leaks details and isnt that suspect?. Posted by: DL Byron at Aug 1, 2006 9:08:56 AM. Is Red Bull a permitted drink for cyclists? Does Floyd partake? I imagine the rumors about it containing testosterone are silly urban legend, but one cant help but wonder.. Posted by: Julie at Aug 1, 2006 9:52:53 AM. The leaks are a little irritating, no doubt, but the bottom line is this: it aint looking good for Landis. We cant cut him any slack because we like ...
Conference: Proposed for presentation at the Rio Grande Symposium on Advanced Material held October 2, 2015 in Albuquerque, NM ...
Codons are three-letter codes that make up the genetic code. Both RNA and DNA have triplets known as codons. Each codon codes one of 20 amino acids that the body uses to synthesize amino acids....
MRNA codons are molecules that act as a template for protein synthesis when a cell passes on its genetic code. Each mRNA codon...
Amino acids and codons: arithmetical patterns in assignment of amino acids to codons. Variants of a 5-dimensional chain applied from a suggested model in theoretical physics.
u aau a uua c ----- aa uau 5 guua cagg auu aacaauu cua gac uaug a ,,,, ,,,, ,,, ,,,,,,, ,,, ,,, ,,,, a 3 caau gucc uaa uuguuaa gau cug auac u a --- g uac a ccuua -a uug ...
Read In Touch - Aug. 31, 2007 from todays daily devotional. Be encouraged and grow your faith with daily and weekly devotionals.
Time to say goodbye - In January 2012, I decided it was time to plan ahead. I knew which way I wanted my life to go and had a pretty good idea of the time frame. I made a decisi... ...
gagucacuggaagcaguuca ---- g a gug 5 ggg cugcagcau caga gcugu c ,,, ,,,,,,,,, ,,,, ,,,,, 3 ccc gacgucgua gucu cgaca u ggagucccgucgucgacacgguuccuccauca uacg g a gug ...
In this article we will go through important interview questions around JQuery, JSON and Angular.js.; Author: |b|Shivprasad koirala|/b|; Updated: 11 Aug 2014; Section: ASP.NET; Chapter: Web Development; Updated: 11 Aug 2014
The hepatitis B virus X gene encodes a transcription activator which stimulates the synthesis of RNAs from a variety of class II and III promoter elements. In this report, we present a mutational analysis which genetically demonstrates that the X gene actually encodes two, and possibly three, related polypeptides from a single mRNA using alternate translation initiation from any of three in-frame AUG codons. Genetic analysis shows that translation initiates at the 5 proximal AUG of X mRNA and produces a full-length 17-kDa X protein but in addition also likely initiates at either of two conserved, in-frame AUG codons, producing two amino-terminally truncated X proteins presumably of 8 and 6.6 kDa. Expression of mRNAs capable of encoding only one of each X protein all individually transactivate class III (RNA polymerase III)-transcribed promoters. However, class II (RNA polymerase II)-transcribed promoters displayed various requirements for the different X proteins. Expression of two X proteins, ...
Mitochondria are essential organelles of eukaryotic cells and are responsible for their energy metabolism. The citric acid cycle, a chain of redox reactions in the mitochondrial matrix, is a central metabolic hub. The energy of these redox reactions is preserved in reducing equivalents, which are fed into the electron transport chain of the inner mitochondrial membrane. This process ultimately produces ATP.. Mitochondrial ribosomes are responsible for the synthesis of the hydrophobic core components of the respiratory chain complexes. Using the bakers yeast Saccharomyces cerevisiae as a eukaryotic model organism, the composition of the polypeptide tunnel exit of mitochondrial ribosomes was defined. We identified novel mitochondria-specific ribosomal proteins and generated insights into how they contribute to the specialization of mitochondrial ribosomes.. In a second approach, Kgd4 was identified as a novel structural component of the a-ketoglutarate dehydrogenase complex (KGDH), which is part ...
Well in terms of my own career it was the first time you discover something is always probably-in some ways the most memorable and certainly the work that Mario Cappechi and I did in discovering the initiation mechanism for polypeptides was quite extraordinary. I had done part of the experiment by learning how to label the formal methionine transfer in a way that it sort of could be studied. And Mario had a protein synthetic system working. So the idea was to see if in fact this formal methionine would actually be incorporated into protein, and indeed it was. And so I can remember standing beside Mario as he was taking the radioactive tape off the machine and it was immediately clear that formal methionine had been incorporated in the polypeptides and by its nature that meant that it had to be going in at the amino-terminus. That it had to be the initiator of polypeptide synthesis. So it was a very exciting time trying to quickly round off that story and get it ready for publication. It helped a ...
AUGS has recognized the need to develop performance measures for FPMRS to help shape what is standard of care in our ever-growing subspecialty. The AUGS Quality Outcomes Committee has made performance measure development its priority.
2. A Universal Trend of Reduced mRNA Stability near the Translation-Initiation Site in Prokaryotes and Eukaryotes [LINK]. 3. Translation efficiency is determined by both codon bias and folding energy [LINK]. Optional Listen to Yoshimi Battles The Pink Robots as you read the papers.... ...
Initiator polymers having an initiator group and a ligand group are provided. The initiator polymers are capable of specifically binding to a receptor on a surface. Using a macromer system, the initiator polymers are useful for the formation of a polymeric matrix on the surface of a material. In particular, initiator polymers are provided that have specificity to pancreatic β cells and can be used to encapsulate cells for transplantation and the treatment of diabetes.
I would like to create custom templates of header and footer for each language using WP Multilang plugin or any alternative translation plugin.
Clipping found in The Ogden Standard in Ogden, Utah on Fri, Aug 1, 1913. Kaysville Pioneer Honored by Many_ Standard 01Aug1913 weeks pit) hed excellent ball and won his initial virion of the season, holding the visitors to four hits. The only run scored by Chicago resulted resulted from an error by Hartzell in the fifth Innin
Tuesday, Aug. 11 12:37 p.m. - Quann Lane, Chester Gap, unresponsive person, company 9 1:45 p.m. - Schoolhouse Road, Washington, difficulty breathing, companies 1 and 7 5:00 p.m. - Bear Wallow Road, Huntly, injury, companies 1 and 4 Wednesday, Aug. 12 6:00 a.m. - Rolling road, Sperryville, general illness, company 7...
On Wed, Aug 28, 2019 at 2:40 PM Josef Bacik ,josef toxicpanda com, wrote: , , On Wed, Aug 28, 2019 at 02:35:39PM -0400, Laura Abbott wrote: , , On 8/28/19 1:58 PM, Josef Bacik wrote: , , , On Tue, Aug 27, 2019 at 07:53:20AM -0400, Laura Abbott wrote: , , , , On 8/26/19 11:39 PM, Neal Gompa wrote: , , , , , On Mon, Aug 26, 2019 at 11:16 AM Laura Abbott ,labbott redhat com, wrote: , , , , , , , , , , , , On 8/23/19 9:00 PM, Chris Murphy wrote: , , , , , , , On Fri, Aug 23, 2019 at 1:17 PM Adam Williamson , , , , , , , ,adamwill fedoraproject org, wrote: , , , , , , , , , , , , , , , So, there was recently a Thing where btrfs installs were broken, and , , , , , , , , this got accepted as a release blocker: , , , , , , , , , , , , , , , , https://bugzilla.redhat.com/show_bug.cgi?id=1733388 , , , , , , , , , , , , , , Summary: This bug was introduced and discovered in linux-next, it , , , , , , , started to affect Fedora 5.3.0-rc0 kernels in openqa tests, patch , , , , , , , appeared during rc1, and ...
State Fair exhibits. 4-H exhibits that are eligible to advance to the state fair must be brought to the Extension Service office by 8:30 a.m. Aug. 17. Exhibits will be transported to the State Fair for entry that morning. Items will be returned to the Extension office Aug. 31. Exhibits and ribbons can be picked up after 3 p.m. State Fair Shows. The Kentucky State Fair 4-H Rabbit Show will be Aug. 21; the 4-H and FFA youth Beef shows will be Aug. 27.. ...
2016 SSC CGL Tier 1 28 Aug Shift - 3 Question Paper with Answer Key. Full question paper and answer key, free to view or download.
The orientation session, which is a prerequisite for the course, will be held from 9 a.m. to noon on Aug. 4-8 at 1025 Main St. in Great Bend. Those interested can call ahead or arrive on the first day of orientation ...
The latest numbers of confirmed COVID-19 cases in Canada as of 7:36 p.m. on Aug. 12, 2020:There are 120,844 confirmed cases in Canada._ Quebec: 60,813 confirmed (including 5,709 deaths, 53,270 . . .
Health,... ... ... ...SHELTON Conn. Aug. 24 /- iMedX Inc. a leading healthca...,iMedX,Announces,Acquisition,of,Worldtech,Inc.,medicine,medical news today,latest medical news,medical newsletters,current medical news,latest medicine news
Expanded employee recruiting efforts and optimized daily staffing practices will be in focus at a McKnights webcast starting at 1 p.m. Eastern Time on Aug. 2
World titleholders Gervonta Davis and Nathan Cleverly will defend their belts on the undercard of the Floyd Mayweather-Conor McGregor fight on Aug. 26.
the bag is constructed from rugged geometric polygonal shapes that harness the tension of the elastic fabrics, which is gained by attaching the rugged parts to the while they are stretched on a frame.
Ive been with my guy for a year and a half, and lately we have been able to open up about things we want to try. Well, more so things I want to try..
EURUSD - Rejects off Key Level The Euro rejected off a key level and 3 month high to end last week, forming a 2 bar reversal. It should be noted the 2 Bar
3-methylmorphine for sale - Sal 1 - Topics (Page 86) - MedsChat - The Peoples Medicine.... We provides discount BoilX relieves painful Boils fast and naturally.
EURUSD - Uptrend Intact But... After reaching a high of 1.3342 last week, the Euro sold off for 24hrs straight, bottoming around 1.3200/3190. From here it
... a new initiator codon in vertebrate mitochondrial genome". Nucleic Acids Research. 16 (13): 6233. doi:10.1093/nar/16.13.6233. ... GUG may possibly function as an initiator in Drosophila. AUU is not used as an initiator in Mytilus "An exceptional mechanism ... Sengupta S, Yang X, Higgs PG (June 2007). "The mechanisms of codon reassignments in mitochondrial genetic codes". Journal of ... The codon AGG is absent in Drosophila. AUA, AUU AUC: Apis GUG: Polyplacophora UUG: Ascaris, Caenorhabditis. Nematoda: Ascaris, ...
Kozak, M. (November 1990). "Downstream secondary structure facilitates recognition of initiator codons by eukaryotic ribosomes ... scanning where the start codon is skipped, whereas a strong Kozak context leads to start codon recognition by the 48S PIC and ... inspecting each successive triplet for a functional start codon. Translation initiation is most successful at an AUG codon ... Cigan, A M; Pabich, E K; Donahue, T F (July 1988). "Mutational analysis of the HIS4 translational initiator region in ...
It also allows for rapid codon-anticodon pairing for the initiator tRNA to bind quickly to. IF3 is required by the small ... Bacterial initiation factor 2 binds to an initiator tRNA and controls the entry of that tRNA into the ribosome. IF2, bound to ...
The amber initiator tRNA inserts methionine and glutamine at UAG codons preceded by a strong Shine-Dalgarno sequence. An ... Highly expressed genes seem to be enriched in codons that are exclusively using codons that will be decoded by these modified ... Once the A/A and P/P tRNAs have moved to the P/P and E/E sites, the mRNA has also moved over by one codon and the A/T site is ... The mRNA encodes a protein as a series of contiguous codons, each of which is recognized by a particular tRNA. One end of the ...
Start codons can also be suppressed with suppressor initiator tRNAs, such as the amber stop codon suppressor tRNAfMet2(CUA). ... In addition, many genes do not have only one termination codon, and cells commonly use ochre codons as the termination signal, ... Nonsense suppressors can be generally divided into two classes: a) a mutated tRNA which can bind with a termination codon on ... Genes with different or multiple stop codons will be unaffected. SUP35, a nonsense suppressor identified by Wickner in 1994, is ...
Moreover, it binds 40S in such a manner that AUG initiator codon is positioned in the ribosomal P-site, thus no ribosomal ... Initiator tRNA is delivered either by eIF2 or, in stress conditions when eIF2 is inactivated, by eIF2A, eIF2D, or possibly ... UTR to reach to start codon. In contrast, translation of hepatitis C virus (HCV) mRNA is initiated by a different mechanism ...
In all, there are 64 codons, 61 of each code for one of the 20 amino acids, while the remaining codons specify chain ... The binding of a charged initiator tRNA into the P site of the ribosome 3. The proper alignment of the ribosome with mRNA's ... The last stage of translation occurs when a stop codon enters the A site. Then, the following steps occur: 1. The recognition ... Biology portal Technology portal Lipids Phospholipid bilayer Nucleotides DNA DNA replication Proteinogenic amino acid Codon ...
Initiation involves recognition of the start codon (AUG) by initiator tRNA in the P-site, elongation involves passage of many ... The A-site binds to incoming aminoacyl-tRNA which has the anti-codon for the corresponding codon in the mRNA presented in the A ... When a stop codon is reached, the peptidyl-tRNA bond of the tRNA located in the P-site is cleaved releasing the newly ... Translation moves the tRNA from the A-site through the P- and E-sites, with the exception of the initiator tRNA, which binds ...
Industrial melanism Infectious transfer Informed consent Inherit Inherited Initiation codon Initiation Initiation Initiator ... bank Cloned DNA Cloning Cloning vector Coccus Code Code dictionary Coding strand Codominance Codon Codon usage bias aka Codon ... Ochre codon Okazaki fragment Oligo Oligogenic Oligonucleotide Oncogene Oncogenes Oncovirus Oocyte Oogenesis Oogonia Opal codon ... Non-disjunction Non-histone protein Non-linear tetrad Non-Mendelian ratio Non-parental Non-recombinant Nonsense codon Nonsense ...
... codon MeSH D13.444.735.544.355.225 - codon, initiator MeSH D13.444.735.544.355.250 - codon, terminator MeSH D13.444.735.544. ... 355.250.235 - codon, nonsense MeSH D13.444.735.544.500 - rna caps MeSH D13.444.735.544.500.710 - rna cap analogs MeSH D13.444. ...
... and an initiator. Exons are the part of the transcript that will eventually be transported to the cytoplasm for translation. ... region downstream from the stop codon is separated into two parts: 3' UTR is never translated, but serves to add mRNA stability ...
The principal functions these proteins perform include ribosome RNA/mRNA recognition, delivery of the initiator Met-tRNAiMet, ... these TIFs help correct the identification of the initiation codon, while its function is unknown in bacteria. Just between ...
Instead, kasugamycin mimics the codon nucleotides at the P and E sites by binding within the path of the mRNA, thus perturbing ... Kasugamycin inhibition is thought to occur by direct competition with initiator transfer RNA. Recent experiments suggest that ... the mRNA-tRNA codon-anticodon interaction. Low level resistance to kasugamycin is acquired by mutations in the 16S rRNA ...
... in-frame and downstream of the initiator AUG codon, to give rise to nuclear forms of this hormone.[8] ...
Alteration of the ATG start codon of the A protein of bacteriophage phi X174 into an ATT codon yields a viable phage indicating ... an initiator of DNA replication. Nature 288(5791) 561-566 van Mansfeld AD, van Teeffelen HA, Baas PD, Jansz HS (1987) Two ...
Once bound to the 5' cap of mRNA, this 48S complex then searches for the (usually) AUG start codon and translation begins. In ... Eukaryotic initiation factor complex 2 (eIF2) forms a ternary complex with GTP and the initiator Met-tRNA - this process is ...
Since the start codon of the genetic code codes for the amino acid methionine, most protein sequences start with a methionine ( ... Modifications include the removal of initiator methionine (iMet) by aminopeptidases, attachment of small chemical groups such ...
... it acts more like a near-cognate codon interaction instead of the cognate codon interaction. This can be seen in the delay in ... such as separating the initiator tRNAMet from elongator tRNAMet.. Moreover, they increase overall tRNA stability. Some studies ... All eukaryotic stop codons contain one uridine (UAA, UGA and UGA); conversion of this uridine to pseudouridine results in ... Secondly, this mark is enriched in specific regions of the transcriptome; it is mostly found close to stop codons, in 3'-UTRs ...
Wuitschick JD, Karrer KM (1999). "Analysis of genomic G + C content, codon usage, initiator codon context and translation ...
Once the 16S rRNA recognizes the mRNA start codon, a special transfer RNA, f-Met-tRNA, binds and protein translation begins. ... "The ribosome-bound initiation factor 2 recruits initiator tRNA to the 30S initiation complex". EMBO Reports. 11 (4): 312-316. ... a complementary binding site about 8 base pairs upstream from the start codon. This ensures the ribosome starts translation at ... guides the initiating start codon (5′)-AUG-(3′) of mRNA into position by recognizing the Shine-Dalgarno sequence, ...
"Thermodynamic characterization of ppGpp binding to EF-G or IF2 and of initiator tRNA binding to free IF2 in the presence of GDP ... and pentaphosphate requires the presence of a codon-specific, uncharged transfer ribonucleic acid in the acceptor site of ...
... between the first and second nucleotide of a codon (phase 1 introns), or between the second and third nucleotide of a codon ( ... replication initiator (Rep) and a DNA helicase (Hel) domain. The Rep domain is involved in the catalytic reactions for ... Introns can interrupt the reading frame of a gene by inserting a sequence between two consecutive codons (phase 0 introns), ...
This suggests that these prion domains are, in fact, portable and are the sole initiator of prionogenesis. This supports the ... leading to more frequent stop codon read-through and the development of novel phenotypes. With over 20 prion-like domains ...
By analyzing the effects of single base substitutions around the ATG initiator codon in a cloned preproinsulin gene, I have ... Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes.. Kozak M ... A purine in position -3 (i.e., 3 nucleotides upstream from the ATG codon) has a dominant effect; when a pyrimidine replaces the ... The mechanism by which nucleotides flanking the ATG codon might exert their effect is discussed. ...
... a new initiator codon in vertebrate mitochondrial genome". Nucleic Acids Research. 16 (13): 6233. doi:10.1093/nar/16.13.6233. ... GUG may possibly function as an initiator in Drosophila. AUU is not used as an initiator in Mytilus "An exceptional mechanism ... Sengupta S, Yang X, Higgs PG (June 2007). "The mechanisms of codon reassignments in mitochondrial genetic codes". Journal of ... The codon AGG is absent in Drosophila. AUA, AUU AUC: Apis GUG: Polyplacophora UUG: Ascaris, Caenorhabditis. Nematoda: Ascaris, ...
Kozak, M. (November 1990). "Downstream secondary structure facilitates recognition of initiator codons by eukaryotic ribosomes ... scanning where the start codon is skipped, whereas a strong Kozak context leads to start codon recognition by the 48S PIC and ... inspecting each successive triplet for a functional start codon. Translation initiation is most successful at an AUG codon ... Cigan, A M; Pabich, E K; Donahue, T F (July 1988). "Mutational analysis of the HIS4 translational initiator region in ...
similar to suppressor of initiator codon mutations, related sequence 1 Symbol and Name status set to provisional. 70820. ... Gene: LOC366309 (similar to suppressor of initiator codon mutations, related sequence 1) Rattus norvegicus. {{ watchLinkText }} ...
We next tested whether the non-AUG initiator codons identified above can also act as initiator codons in GRS1. To this end, the ... it was interesting to point out that the non-AUG initiator codons of ALA1 and GRS1 and the cryptic initiator codon of ALA1 ... a less-efficient non-AUG initiator codon in the context of ALA1, was one of the strongest non-AUG initiator codons in the ... Codon PositionInitiator CodonFusion ConstructSequence ContextAlternative Translation Initiation. Background. Aminoacyl-tRNA ...
Codon, Initiator / genetics * Computational Biology* * Conserved Sequence * DNA, Complementary / genetics* * Databases, Genetic ...
Incomplete terminal codon variant. Inframe deletion. Inframe insertion. Initiator codon variant. Intergenic variant. Intron ...
We analyzed G + C content, codon usage, initiator codon context and stop codon sites in the extremely A + T rich genome of this ... Regions immediately preceding Tetrahymena translation initiator codons were generally A-rich. For the 60 stop codons examined, ... the 75 available T. thermophila protein coding sequences favored codons ending in T and, where possible, avoided those with G ... Highly expressed genes were relatively G + C-rich and exhibited an extremely biased pattern of codon usage while ...
... which is three codons upstream of a second start site (ATG). The SCP genotype can be determined with the restriction enzyme ... The vitamin D receptor (VDR) gene contains a start codon polymorphism (SCP) which is three codons upstream of a second start ... Codon, Initiator * Receptors, Calcitriol * DNA Grant support * DK-02459/DK/NIDDK NIH HHS/United States ... The vitamin D receptor gene start codon polymorphism: a functional analysis of FokI variants J Bone Miner Res. 1998 Nov;13(11): ...
The presumed initiator methionine and stop codon are boxed. (B) Comparison of the basic helix-loop-helix domain among human, ...
initiator_codon_variant. A codon variant that changes at least one base of the first codon of a transcript. ... initiator_codon_variant, incomplete_terminal_codon_variant, stop_lost, stop_retained_variant, stop_gained, NMD_transcript_ ... incomplete_terminal_codon_variant. A sequence variant where at least one base of the final codon of an incompletely annotated ... A sequence variant whereby at least one base of a codon is changed, resulting in a premature stop codon, leading to a shortened ...
0 (Codon, Initiator); 0 (Genetic Markers). [Em] M s de entrada:. 1705. ... Optimizing Sample Size to Assess the Genetic Diversity in Common Vetch (Vicia sativa L.) Populations Using Start Codon Targeted ... using Start Codon Targeted (SCoT) markers. Two cultivated varieties and two wild accessions were evaluated using five SCoT ...
Codon usage pattern. Most protein-coding genes employed the standard initiator codon AUG; however, six unusual start codons ... the codon usage patterns were determined for 71 distinct protein-coding genes in Sect. Marmorata chloroplast genomes. Codons of ... Wright F. The effective number of codons used in a gene. Gene. 1990;87(1):23-9.PubMedGoogle Scholar ... Codon usage and substitution rate calculation. RSCU, GC3s, and ENc for 71 protein-coding genes were calculated using CodonW ...
The AUG codon basepairs with the initiator tRNA delivered by eIF2. eIF4GI binding is stimulated by eIF4A and modulated by PTB, ... eIF2 delivers the initiator methionyl tRNA as a ternary complex, comprised of eIF2•GTP•met-tRNAimet. The 40S ribosomal subunit ... The HCV pseudoknot (shaded in grey) positions the initiation codon (green box) in the mRNA binding cleft of the 40S subunit [] ... then scans to locate the AUG codon where the 60S joins, some factors are ejected including eIF2, and the 80S ribosome enters ...
initiator_codon_variant, missense_variant. rs104886035. pathogenic, not provided, Smith-Lemli-Opitz syndrome, Smith-Lemli-Opitz ...
initiator_codon_variant, missense_variant. rs148622862. pathogenic, Diamond-Blackfan anemia 10. 56,042,170(+). G/A. splice_ ...
CTG leucine codon is translated as initiator methionine.Curated. Experimental Info. Feature key. Position(s). Description ...
Reconstruction of the first eight codons is accomplished by ligation to oliognucleotides: EcoRI Initiator BsmI. ... This deletes all of the sequences 3′ to the translation terminator codon of the BMP-4 cDNA, juxtaposing this terminator codon ... The protein is preceded by a 5′ untranslated region of 342 bp with stop codons in all frames. The 13 bp region preceding this 5 ... Because the genetic code is degenerate (more than one codon can code for the same amino acid), the number of oligo-nucleotides ...
Unusual initiator. The initiator methionine is coded by a non-canonical CTG leucine codon.Curated ... Unusual initiator. The initiator methionine is coded by a non-canonical CTG leucine codon.Curated ...
This gene terminates two nucleotides before the initiator codon of the coat protein gene. Potential signal sequences ... Overlapping the terminal five codons of this readthrough reading frame is a second reading frame coding for a protein of Mr ...
The figure is a schematic diagram of the pAUU-CAT reporter gene construct in which the CAT gene has its ATG initiator codon ... and is based on the ability of IF3 to discriminate against translation initiation at the atypical start codon of the reporter ... 15 the first codon of the reporter gene is an atypical start codon. To make a test strain, the native ATG start codon of a ... The figure is a schematic diagram of the pAUU-CAT reporter gene construct in which the CAT gene has its ATG initiator codon ...
The only differences are in available initiator codons. NCBI Genetic Codes home page: (Last update of the Genetic Codes: April ... codon is_ter_codon Title : is_ter_codon Usage : $obj-,is_ter_codon(GAA) Function: returns true (1) for all codons that can be ... codon unambiguous_codons Title : unambiguous_codons Usage : @codons = $self-,unambiguous_codons(ACN) Returns : array of ... Example : $myCodonTable-,is_ter_codon(ATG) Returns : boolean Args : codon is_unknown_codon Title : is_unknown_codon Usage : $ ...
10/01/2011 - "The insertion of the transposon, which occurred 16 bp upstream from the start codon of an ORF encoding a soluble ...
An in-frame termination codon TAG locates 54 nucleotides upstream of the initiator ATG. The human ICAM-5 gene is composed of 11 ... for a strong initiator element [8]. This initiator sequence has been proposed to function as an alternate TFIID-binding site in ... Analysis of the promoter region of the mouse ICAM-5 gene revealed a consensus strong initiator element for TATA-fewer genes, ... This indicates that nucleotides 92-95 bp upstream from the start codon are potential transcription initiation site of the mouse ...
The A-site in translation is the entrance for tRNA to be tested for codon/anti-codon match with mRNA. ... 5 UTR is the region of a mRNA that is directly upstream of the initiation codon. 3 UTR is the region that directly follows ... The ability of one tRNA with a specific anticodon to complementary base pair with more than one codon. Matching the 1st and 2nd ... Once the small subunit reaches start codon, eIFs dissociate to all the large subunit to assemble with tRNAiMet in which site? ...
The initiator tRNA can then bind to the complex at the P site paired with AUG codon.. 30S initiation complex. The 50S subunits ... Initiators tRNA 4. Codon-anticodon interaction* In the cleft of the ribosome, an anti-parallel formation of three base pairs ... AUG (GUG) start codons in prokaryotes and eukaryotes. *Initiator tRNAs differ from the one that inserts internal Met residues. ... with stop codon and cause release of completed polypeptide chain.. RF1 and RF2 recognizes the stop codon with the help of RF3. ...
When stop codon in the mRNA reaches the A site what happens? ... What is the initiator tRNA carrying to pair with codon AUG? ... What is the start codon that the small ribosomal subunit stops at? ...
During each round of translation initiation, eIF2•GTP brings initiator methionyl-transfer RNA (methionyl-tRNA) to the ribosome ... to recognize the start codon. eIF2B is therefore referred to as a guanine nucleotide exchange factor (GEF). Most, but not all, ...
16 codons). If the fourth potential initiator methionine codon were used, a 691-amino-acid protein lacking the first 37 amino ... 1994). The predicted initiator methionine codon of the SL2-spliced Y71G12B.9 cDNAs lies just downstream of the trans-splice ... The open reading frames defined by the first three potential initiator methionine codons of the SL1-spliced cDNA are all short ... The open reading frame beginning with this initiator methionine encodes a 728-amino-acid protein (Figure 2 ). The SL1 trans- ...
However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG ... However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG ... Mentions: Of the 9 possible codons that differ from AUG in a single position, 5 are used to initiate the extensions of the 17 ... Mentions: Of the 9 possible codons that differ from AUG in a single position, 5 are used to initiate the extensions of the 17 ...
  • AUU is not used as an initiator in Mytilus "An exceptional mechanism must operate for initiation of translation of the cytochrome oxidase subunit I mRNA in both D. melanogaster and D. yakuba, since its only plausible initiation codon, AUA, is out of frame with the rest of the gene. (wikipedia.org)
  • The small ribosomal subunit and various eukaryotic initiation factors are recruited to the mRNA 5′ TL and to form the 48S PIC complex, which scans 5′ to 3′ along the mRNA transcript, inspecting each successive triplet for a functional start codon. (wikipedia.org)
  • If the first AUG codon is mutated, then initiation can begin at the next available AUG from the 5' end of mRNA. (beds.ac.uk)
  • The A-site in translation is the entrance for tRNA to be tested for codon/anti-codon match with mRNA. (brainscape.com)
  • In the cleft of the ribosome, an anti-parallel formation of three base pairs occurs between the codon on the mRNA and the anticodon on the tRNA. (powershow.com)
  • 20. The last codon in a mRNA molecule that specifies the end of a protein molecule is known as a ____________codon. (majortests.com)
  • the anticodon base-pairs with a complementary codon on mRNA and (abbreviated tRNA and formerly referred to as sRNA , for soluble RNA [1] ) is an adaptor molecule composed of RNA , typically 76 to 90 nucleotides in length, [2] that serves as the physical link between the mRNA and the amino acid sequence of proteins. (wikipedia.org)
  • tRNA does this by carrying an amino acid to the protein synthetic machinery of a cell ( ribosome ) as directed by a 3-nucleotide sequence ( codon ) in a messenger RNA (mRNA). (wikipedia.org)
  • [3] The mRNA encodes a protein as a series of contiguous codons, each of which is recognized by a particular tRNA. (wikipedia.org)
  • The anticodon forms three complementary base pairs with a codon in mRNA during protein biosynthesis. (wikipedia.org)
  • 1-In Nirenberg's experiment (building a protein from mRNA made only of U-U-U-U-U ...), how was the protein actually built if it didn't start with AUG (the starting Codon). (physicsforums.com)
  • The nucleotide sequence in mRNA is recognized in triplets, called codons. (news-medical.net)
  • The ribosome moves along the single strand mRNA, and when a complimentary codon sequence belonging to amino acid bearing tRNA bonds with the mRNA, the amino acid is added to the chain. (news-medical.net)
  • The mRNA possesses a stop codon, a sequence of three nucleotides that indicates that translation is complete. (news-medical.net)
  • Upon reaching the stop codon, the ribosome ceases translation and releases the mRNA and newly generated polypeptide. (news-medical.net)
  • Strands of mRNA are made up of codons, each of which signifies a particular amino acid to be added to the polypeptide in a certain order. (news-medical.net)
  • mRNA must interact with ribosomal RNA (rRNA), the central component of ribosomal machinery that recognizes the start and stop codons of mRNA, and tRNA, which provides the amino acid once bound with a complimentary mRNA codon. (news-medical.net)
  • Each tRNA is read as a ribonucleotide triplet called an anticodon that is complementary to an mRNA codon. (news-medical.net)
  • The initiator tRNA which is equipped with the anticodon (UAC) also binds to the start codon (AUG) of the mRNA. (news-medical.net)
  • If the anticodon of the new tRNA matches the mRNA codon, base pairing occurs and the two amino acids are linked by the ribosome through a peptide bond. (news-medical.net)
  • As the ribosome moves along the mRNA, it encounters one of the three stop codons for which there is no corresponding tRNA. (news-medical.net)
  • Translation initiation is a complex process in which the initiator tRNA and the 40S and 60S ribosomal subunits are recruited to the 5′ end of a mRNA molecule and assembled by eukaryotic translation initiation factors into an 80S ribosome at the start codon of the mRNA (Fig. 1) . (aacrjournals.org)
  • The 43S initiation complex (40S/eIF2/Met-tRNA/GTP complex) scans the mRNA in a 5′→3′ direction until it encounters an AUG start codon. (aacrjournals.org)
  • Codon and amino acid content are associated with mRNA stability in mammalian cells 2020-02-13 00:00:00 a1111111111 a1111111111 Messenger RNA (mRNA) degradation plays a critical role in regulating transcript levels in the a1111111111 cell and is a major control point for modulating gene expression. (deepdyve.com)
  • Herein we characterize the contribution of coding sequence towards TJ, Hanson G, Coller J (2020) Codon and amino mRNA decay in human and Chinese Hamster Ovary cells. (deepdyve.com)
  • In agreement with previous stud- acid content are associated with mRNA stability in ies, we observed that synonymous codon usage impacts mRNA stability in mammalian cells. (deepdyve.com)
  • The impact of codon and amino acid identity Editor: Yoon Ki Kim, Korea University, REPUBLIC on mRNA decay appears to be associated with underlying tRNA and intracellular amino acid OF KOREA concentrations. (deepdyve.com)
  • Accordingly, genes of similar physiological function appear to coordinate Received: December 5, 2019 their mRNA stabilities in part through codon and amino acid content. (deepdyve.com)
  • i) The termination codon of a uORF can be recognised as premature and nonsense‐mediated mRNA decay ( NMD ) is triggered through a mechanism involving the UPF1 protein and ribonucleases. (els.net)
  • p97 mRNA has no initiator AUG and translation starts exclusively at a GUG codon. (embl-heidelberg.de)
  • During initiation , the ribosome is assembled at the initiation codon in the mRNA with a methionyl initiator tRNA bound in the peptidyl (P) site. (hindawi.com)
  • The translational regulator protein regA is encoded by the T4 bacteriophage and binds to a region of messenger RNA (mRNA) that includes the initiator codon. (rcsb.org)
  • During the elongation phase, amino acids are added to the nascent peptide chain in accordance with codon sequences in the mRNA. (asnjournals.org)
  • Translation of mRNA, the process by which codon sequences in mRNA are used to synthesize a polypeptide chain, has received scant attention. (asnjournals.org)
  • instead, Ksg mimics codon nucleotides at the P and E sites by binding within the path of the mRNA. (sigmaaldrich.com)
  • Coupled with biochemical experiments, our results suggest that Ksg indirectly inhibits P-site tRNA binding through perturbation of the mRNA-tRNA codon-anticodon interaction during 30S canonical initiation. (sigmaaldrich.com)
  • Each three mRNA nucleotides are called a codon and their three complementary tRNA nucleotides are called its anti-codon . (academickids.com)
  • Initiation of translation involves the small ribosomal subunit binding to the 'start' codon on the mRNA, which indicates where the mRNA starts coding for the protein. (academickids.com)
  • Once loaded onto the mRNA, the 43S PIC is thought to scan the mRNA in search of an AUG start codon. (nih.gov)
  • Previous studies in Saccharomyces cerevisiae showed that ALA1 (encoding alanyl-tRNA synthetase) and GRS1 (encoding glycyl-tRNA synthetase) respectively use ACG and TTG as their alternative translation initiator codons. (beds.ac.uk)
  • However, two Saccharomyces cerevisiae genes, HTS1 (the gene encoding histidyl-tRNA synthetase) [ 6 ] and VAS1 (the gene encoding valyl-tRNA synthetase (ValRS)) [ 7 ], specify both the mitochondrial and cytosolic forms through alternative translation initiation from two in-frame AUG codons. (beds.ac.uk)
  • The AUG codon basepairs with the initiator tRNA delivered by eIF2. (nih.gov)
  • Only the initiator methionyl-tRNA is modified by transformylase to give N-formylmethionyl-tRNAfmet. (powershow.com)
  • The initiator tRNA can then bind to the complex at the P site paired with AUG codon. (powershow.com)
  • Because the genetic code contains multiple codons that specify the same amino acid, there are several tRNA molecules bearing different anticodons which carry the same amino acid. (wikipedia.org)
  • tRNA carry a particular amino acid, which is added to the growing polypeptide chain if complimentary codons bond. (news-medical.net)
  • Following initiation, a new tRNA-amino acid complex enters the codon next to the AUG codon. (news-medical.net)
  • If the anticodon does not match the codon, base pairing cannot happen and the tRNA is rejected. (news-medical.net)
  • Then, the ribosome moves one codon forward making space for a new tRNA-amino acid complex to enter. (news-medical.net)
  • This start codon is then base-paired to the anticodon of initiator tRNA, forming the 48S initiation complex. (aacrjournals.org)
  • The initiator tRNA charged with Met forms part of the ribosomal complex. (academickids.com)
  • It begins when an initiator methionyl tRNA (Met-tRNAi) is loaded onto the small (40S) ribosomal subunit. (nih.gov)
  • In addition, the initiator tRNA moves from a position that is not fully engaged in the ribosomal P site [termed P (OUT) ] to one that is [P (IN) ], and the PIC as a whole converts from an open conformation that is conducive to scanning to a closed one that is not. (nih.gov)
  • Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. (nih.gov)
  • By analyzing the effects of single base substitutions around the ATG initiator codon in a cloned preproinsulin gene, I have identified ACCATGG as the optimal sequence for initiation by eukaryotic ribosomes. (nih.gov)
  • Unexpectedly, these non-AUG initiator codons exhibited different preferences toward various sequence contexts. (beds.ac.uk)
  • This finding indicates that a sequence context that is favorable for a given non-ATG initiator codon might not be as favorable for another. (beds.ac.uk)
  • Ribosomes pause at the end of the 2A coding sequence, over the glycine and proline codons, and the nascent chain up to and including this glycine is released. (asm.org)
  • Also, the uORF nucleotide sequence can have a role on its translation efficiency, for instance by encoding rare codons that cause the ribosome to stall. (els.net)
  • A genomic reference sequence is preferred because it overcomes difficult cases, including multiple transcription initiation sites (promoters), alternative splicing, the use of different poly-A addition signals, multiple translation initiation sites (ATG-codons) and the occurence of length variations. (cf.ac.uk)
  • The 5′UTR is succeeded by the coding sequence of bases, which in triplets form codons that carry the genetic message for individual amino acids. (asnjournals.org)
  • At its 3′ end, the coding sequence contains a termination codon, which signals ending of peptide chain synthesis. (asnjournals.org)
  • Terminator proteins present at the stop codon bind to the ribosome and trigger the release of the newly synthesized polypeptide chain. (news-medical.net)
  • This procedure repeats until the ribosome encounters one of three possible stop codons, where translation is terminated. (academickids.com)
  • There is also evidence for alternative translation initiation from non-AUG (CUG and GUG) start sites, in-frame and downstream of the initiator AUG codon, to give rise to nuclear forms of this hormone. (wikipedia.org)
  • Single base substitutions around an upstream, out-of-frame ATG codon affect the efficiency with which it acts as a barrier to initiating at the downstream start site for preproinsulin. (nih.gov)
  • directionally scanning along the 5′ TL to select the first "best" start codon to begin protein synthesis. (wikipedia.org)
  • See A) Weak or absent Kozak context surrounding the AUG leads to "leaky" scanning where the start codon is skipped, whereas a strong Kozak context leads to start codon recognition by the 48S PIC and binding of Met-tRNAi in the "closed" state. (wikipedia.org)
  • Conversely, downstream stem-loops may increase the probability of translation initiation at start codons with a weak Kozak context, possibly by blocking scanning. (wikipedia.org)
  • The vitamin D receptor (VDR) gene contains a start codon polymorphism (SCP) which is three codons upstream of a second start site (ATG). (nih.gov)
  • Optimizing Sample Size to Assess the Genetic Diversity in Common Vetch (Vicia sativa L.) Populations Using Start Codon Targeted (SCoT) Markers. (bireme.br)
  • Here, we investigate the optimal number of individuals that may represent the genetic diversity of a single population, using Start Codon Targeted (SCoT) markers. (bireme.br)
  • The assay uses a reporter gene system in whole cells, and is based on the ability of IF3 to discriminate against translation initiation at the atypical start codon of the reporter gene. (google.es)
  • Initiator tRNAs are special tRNAs recognizing the AUG (GUG) start codons in prokaryotes and eukaryotes. (powershow.com)
  • Numbering is relative to the first nucleotide of the start codon. (nih.gov)
  • (15) identified two polymorphisms at the 5′ noncoding region (A23G, at position −4 from the ATG start codon) and codon 228 (G709A, in exon 6) in the XPA gene. (aacrjournals.org)
  • Anyway, the point is that the protein was made although the RNA did not start with AUG (the starting codon). (physicsforums.com)
  • Translation is generally linear from the initiating start to the terminating stop codon of an open reading frame (ORF). (asm.org)
  • Heterologous expression of the trp(G.D) and trpC genes in E.coli and N-terminal sequencing of their polypeptide products showed that their translation is initiated at the rate start codons TTG and ATC, respectively. (uni-regensburg.de)
  • Furthermore, our experiments demonstrate that two isoforms of Oskar protein are produced by alternative start codon usage. (biologists.org)
  • This codon is most commonly an AUG, but alternative start codons are common in prokaryotes . (academickids.com)
  • 1994 ) Positions +5 and +6 can be major determinants of the efficiency of non-AUG initiation codons for protein synthesis. (biologists.org)
  • the 75 available T. thermophila protein coding sequences favored codons ending in T and, where possible, avoided those with G in the third position. (marquette.edu)
  • Regions immediately preceding Tetrahymena translation initiator codons were generally A-rich. (marquette.edu)
  • Codon tables are also called translation tables or genetic codes since that is what they represent. (ubuntu.com)
  • In eukaryotes, it is generally assumed that translation initiation occurs at the AUG codon closest to the messenger RNA 5' cap. (nih.gov)
  • Recoding events include programmed ribosomal frameshift and stop codon readthrough, used extensively by viruses but also during translation of a number of cellular mRNAs to generate certain proteins or protein variants. (asm.org)
  • Here we review the basic principles of translational control, the alterations en countered in cancer, and selected therapies targeting translation initiation to elucidate potential new therapeutic avenues. (aacrjournals.org)
  • For a uORF to function as a translational regulatory element, its initiation codon must be recognised, at least at certain times, by the scanning 40S ribosomal subunit and associated translation initiation factors. (els.net)
  • 1994 ) The immediate downstream codon strongly influences the efficiency of utilization of eukaryotic translation initiation codons. (biologists.org)
  • Kozak, At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. (xenbase.org)
  • We hypothesized that alternative translation initiation from four AUG codons corresponding to amino acid positions 1, 5, 16, and 33 could produce the observed RGS2 expression profile. (aspetjournals.org)
  • Recent studies suggest that initiation occurs surprisingly often in eukaryotes at Near Cognate Codons (NCCs), which differ from AUG by one nucleotide. (wikipedia.org)
  • In many eukaryotic messenger ribonucleic acids (mRNAs) one or more short upstream open reading frames (uORFs) precede the initiation codon of the main coding region. (els.net)
  • To explore if any other non-ATG triplets can act as initiator codons in yeast, ALA1 was used as a reporter for screening. (beds.ac.uk)
  • We show herein that except for AAG and AGG, all triplets that differ from ATG by a single nucleotide were able to serve as initiator codons in ALA1 . (beds.ac.uk)
  • Upstream open reading frames (uORFs) are cis ‐acting RNA elements involved in translational regulation, which precede the initiation codon of the main coding region. (els.net)
  • Highly expressed genes were relatively G + C-rich and exhibited an extremely biased pattern of codon usage while developmentally regulated genes were more A + T-rich and showed less codon usage bias. (marquette.edu)
  • Additionally, almost all the plastid protein coding genes were found to prefer ending with A/U. Mutation bias and selection pressure predominately shaped the codon bias of most genes. (springer.com)
  • Mutation and natural selection were the main forces to drive the codon bias pattern of most plastid protein coding genes. (springer.com)
  • The +1 A is the first base of the AUG initiator codon (shaded) responsible for binding of fMet-tRNAfMet. (thermofisher.com)
  • Overlapping the terminal five codons of this readthrough reading frame is a second reading frame coding for a protein of Mr 29,987. (pnas.org)
  • We propose that the nascent 2A peptide interacts with ribosomes to drive a highly unusual and specific "termination" reaction, despite the presence of a proline codon in the A site. (asm.org)
  • Initiator tRNAs differ from the one that inserts internal Met residues. (powershow.com)
  • Of the 9 possible codons that differ from AUG in a single position, 5 are used to initiate the extensions of the 17 known cases that passed our qualitative analysis for conservation of the extension. (nih.gov)
  • Activity of prokaryotic RBSs can be influenced by the length and nucleotide composition of the spacer separating the RBS and the initiator AUG. (thermofisher.com)
  • Further, high-level expression of a 2A peptide-containing protein inhibits the growth of cells compromised for release factor activity and leads to errors in stop codon recognition. (asm.org)
  • In yeast and other model organisms, codon identity is a powerful determinant of transcript stability, contributing broadly to impact half-lives. (deepdyve.com)
  • This order correlates with the efficiency of initiation for each non-AUG codon, with CUG the most efficient of them all (16). (nih.gov)
  • We analyzed G + C content, codon usage, initiator codon context and stop codon sites in the extremely A + T rich genome of this ciliate. (marquette.edu)
  • In particular, GTG was one of the most efficient non-ATG initiator codons, while ATA was essentially inactive in the context of GRS1 . (beds.ac.uk)
  • In addition to the identity of the initiation codon, the initiation context of the 17 previously known examples that passed the screening process and the 42 newly identified candidates were examined (Figure 6). (nih.gov)
  • The figure is a schematic diagram of the pAUU-CAT reporter gene construct in which the CAT gene has its ATG initiator codon replaced with ATT. (google.es)
  • Several arthropods translate the codon AGG as lysine instead of serine (as in the Pterobranchia Mitochondrial Code) or arginine (as in the standard genetic code). (wikipedia.org)
  • When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). (proteopedia.org)
  • The distribution of the putative initiation codons of the 42 new candidates in humans is not radically different (notwithstanding the potential for observer bias in locating the precise initiation codon in a small number of cases). (nih.gov)
  • For the 60 stop codons examined, the frequency of G in the end + 1 site was much higher than expected whereas C never occupied this position. (marquette.edu)
  • What are the stop codons? (brainscape.com)
  • We need to find a new vector with a bacterial ribosyme binding site, initiator, and a stop codon. (igem.org)