A group of genetically identical cells all descended from a single common ancestral cell by mitosis in eukaryotes or by binary fission in prokaryotes. Clone cells also include populations of recombinant DNA molecules all carrying the same inserted sequence. (From King & Stansfield, Dictionary of Genetics, 4th ed)
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Established cell cultures that have the potential to propagate indefinitely.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.
A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Any method used for determining the location of and relative distances between genes on a chromosome.
A form of GENE LIBRARY containing the complete DNA sequences present in the genome of a given organism. It contrasts with a cDNA library which contains only sequences utilized in protein coding (lacking introns).
The relationships of groups of organisms as reflected by their genetic makeup.
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
Plasmids containing at least one cos (cohesive-end site) of PHAGE LAMBDA. They are used as cloning vehicles.
Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Gel electrophoresis in which the direction of the electric field is changed periodically. This technique is similar to other electrophoretic methods normally used to separate double-stranded DNA molecules ranging in size up to tens of thousands of base-pairs. However, by alternating the electric field direction one is able to separate DNA molecules up to several million base-pairs in length.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.
The functional hereditary units of BACTERIA.
Sites on an antigen that interact with specific antibodies.
Any cell, other than a ZYGOTE, that contains elements (such as NUCLEI and CYTOPLASM) from two or more different cells, usually produced by artificial CELL FUSION.
Genotypic differences observed among individuals in a population.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
Proteins prepared by recombinant DNA technology.
Antibodies produced by a single clone of cells.
A technique for identifying individuals of a species that is based on the uniqueness of their DNA sequence. Uniqueness is determined by identifying which combination of allelic variations occur in the individual at a statistically relevant number of different loci. In forensic studies, RESTRICTION FRAGMENT LENGTH POLYMORPHISM of multiple, highly polymorphic VNTR LOCI or MICROSATELLITE REPEAT loci are analyzed. The number of loci used for the profile depends on the ALLELE FREQUENCY in the population.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Immunized T-lymphocytes which can directly destroy appropriate target cells. These cytotoxic lymphocytes may be generated in vitro in mixed lymphocyte cultures (MLC), in vivo during a graft-versus-host (GVH) reaction, or after immunization with an allograft, tumor cell or virally transformed or chemically modified target cell. The lytic phenomenon is sometimes referred to as cell-mediated lympholysis (CML). These CD8-positive cells are distinct from NATURAL KILLER CELLS and NATURAL KILLER T-CELLS. There are two effector phenotypes: TC1 and TC2.
DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Morphologic alteration of small B LYMPHOCYTES or T LYMPHOCYTES in culture into large blast-like cells able to synthesize DNA and RNA and to divide mitotically. It is induced by INTERLEUKINS; MITOGENS such as PHYTOHEMAGGLUTININS, and by specific ANTIGENS. It may also occur in vivo as in GRAFT REJECTION.
Short tracts of DNA sequence that are used as landmarks in GENOME mapping. In most instances, 200 to 500 base pairs of sequence define a Sequence Tagged Site (STS) that is operationally unique in the human genome (i.e., can be specifically detected by the polymerase chain reaction in the presence of all other genomic sequences). The overwhelming advantage of STSs over mapping landmarks defined in other ways is that the means of testing for the presence of a particular STS can be completely described as information in a database.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Deoxyribonucleic acid that makes up the genetic material of viruses.
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
Overlapping of cloned or sequenced DNA to construct a continuous region of a gene, chromosome or genome.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.
Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
Chromosomes in which fragments of exogenous DNA ranging in length up to several hundred kilobase pairs have been cloned into yeast through ligation to vector sequences. These artificial chromosomes are used extensively in molecular biology for the construction of comprehensive genomic libraries of higher organisms.
The sum of the weight of all the atoms in a molecule.
Procedures for identifying types and strains of bacteria. The most frequently employed typing systems are BACTERIOPHAGE TYPING and SEROTYPING as well as bacteriocin typing and biotyping.
A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
Partial cDNA (DNA, COMPLEMENTARY) sequences that are unique to the cDNAs from which they were derived.
A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.
The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.
The functional hereditary units of VIRUSES.
Molecules on the surface of T-lymphocytes that recognize and combine with antigens. The receptors are non-covalently associated with a complex of several polypeptides collectively called CD3 antigens (ANTIGENS, CD3). Recognition of foreign antigen and the major histocompatibility complex is accomplished by a single heterodimeric antigen-receptor structure, composed of either alpha-beta (RECEPTORS, ANTIGEN, T-CELL, ALPHA-BETA) or gamma-delta (RECEPTORS, ANTIGEN, T-CELL, GAMMA-DELTA) chains.
The application of molecular biology to the answering of epidemiological questions. The examination of patterns of changes in DNA to implicate particular carcinogens and the use of molecular markers to predict which individuals are at highest risk for a disease are common examples.
A collection of cloned peptides, or chemically synthesized peptides, frequently consisting of all possible combinations of amino acids making up an n-amino acid peptide.
Proteins found in any species of bacterium.
Antigens on surfaces of cells, including infectious or foreign cells or viruses. They are usually protein-containing groups on cell membranes or walls and may be isolated.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
T-cell receptors composed of CD3-associated alpha and beta polypeptide chains and expressed primarily in CD4+ or CD8+ T-cells. Unlike immunoglobulins, the alpha-beta T-cell receptors recognize antigens only when presented in association with major histocompatibility (MHC) molecules.
A type of IN SITU HYBRIDIZATION in which target sequences are stained with fluorescent dye so their location and size can be determined using fluorescence microscopy. This staining is sufficiently distinct that the hybridization signal can be seen both in metaphase spreads and in interphase nuclei.
Lymphoid cells concerned with humoral immunity. They are short-lived cells resembling bursa-derived lymphocytes of birds in their production of immunoglobulin upon appropriate stimulation.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.

Classification of human colorectal adenocarcinoma cell lines. (1/9318)

Eleven human colorectal adenocarcinoma cell lines established in this laboratory were classified into three groups based on morphological features (light and electron microscopy), modal chromosome number, and ability to synthesize carcinoembryonic antigen (CEA). Group 1 cell lines contained both dedifferentiated and differentiating cells growing in tight clusters or islands of epithelium-like cells; their modal chromosome number was about 47, and they synthesized small to moderate amounts of CEA. Group 2 cell lines were more dedifferentiated, were hyperdiploid, and synthesized small amounts of CEA. Group 3 cell lines were morphologically similar to those of Group 1 by light microscopy. They differed ultrastructurally by containing microvesicular bodies; the modal chromosome number varied from hyperdiploid to hypertriploid or they had bimodal populations of hypodiploid and hypertriploid cells, and they synthesized relatively large amounts of CEA. No correlation could be found between Broder's grade or Duke's classification of the original tumor and modal chromosome number or ability to synthesize CEA. These findings support Nowell's hypothesis that the stem line is different for each solid tumor, which makes it difficult to relate chromosomal changes to the initiation of the neoplastic state.  (+info)

Cloning of a novel gene specifically expressed in clonal mouse chondroprogenitor-like EC cells, ATDC5. (2/9318)

We cloned a full-length cDNA encoding a novel mouse protein, A-C2, by differential display method using mouse embryonic fibroblast C3H10T1/2 cells and mouse chondroprogenitor-like EC cells, ATDC5. The deduced amino acid sequence of A-C2 consisted of 106 amino acids with no significant homology to the sequences previously reported. Northern blot analysis showed two major bands of 2.1 and 1.8 kb sizes. Expression of A-C2 mRNA was exclusive to ATDC5 cells at their undifferentiated stage. None of ATDC5 cells at their differentiated stage and adult mice tissues examined expressed A-C2 gene.  (+info)

Crystal structures of two H-2Db/glycopeptide complexes suggest a molecular basis for CTL cross-reactivity. (3/9318)

Two synthetic O-GlcNAc-bearing peptides that elicit H-2Db-restricted glycopeptide-specific cytotoxic T cells (CTL) have been shown to display nonreciprocal patterns of cross-reactivity. Here, we present the crystal structures of the H-2Db glycopeptide complexes to 2.85 A resolution or better. In both cases, the glycan is solvent exposed and available for direct recognition by the T cell receptor (TCR). We have modeled the complex formed between the MHC-glycopeptide complexes and their respective TCRs, showing that a single saccharide residue can be accommodated in the standard TCR-MHC geometry. The models also reveal a possible molecular basis for the observed cross-reactivity patterns of the CTL clones, which appear to be influenced by the length of the CDR3 loop and the nature of the immunizing ligand.  (+info)

Analysis of V(H)-D-J(H) gene transcripts in B cells infiltrating the salivary glands and lymph node tissues of patients with Sjogren's syndrome. (4/9318)

OBJECTIVE: In patients with Sjogren's syndrome (SS), B lymphocytes have been found to infiltrate salivary glands, resulting in sialadenitis and keratoconjunctivitis. The disease is frequently associated with benign and neoplastic lymphoproliferation. The present study was undertaken to investigate whether clonal B cell expansion takes place in lymphocytic infiltrations of salivary glands under (auto- [?]) antigen stimulation, by analyzing in more detail the variable part (V(H)-D-J(H)) of the immunoglobulin heavy chain genes expressed in these B cells. METHODS: Biopsies of the labial salivary glands and lymph nodes were performed on 2 female patients with SS. The Ig gene rearrangements in these tissues were amplified by reverse transcriptase-polymerase chain reaction using specific primers. RESULTS: A total of 94 V(H)-D-J(H) transcripts were cloned and sequenced. Our data suggest a polyclonal origin of the B cell infiltrates. In 92 of the transcripts, V(H) genes were modified by somatic mutation. Further analysis showed counterselection for replacement mutations within the framework regions, suggesting that those B cells were stimulated and selected for functional expression of a surface Ig. In labial salivary glands from both patients, clonally related B cells became evident. Members of 1 particular clone were found in both the lip and lymph node material. CONCLUSION: These data provide evidence, on the nucleotide sequence level, that an antigen-triggered clonal B cell expansion takes place in the salivary glands of patients with SS who do not have histologic evidence of developing lymphoma. It may be speculated that those B cell clones expand during disease progression, resulting in lymphomagenesis.  (+info)

Isolation and characterization of two mouse L cell lines resistant to the toxic lectin ricin. (5/9318)

Two variant mouse L cell lines (termed CL 3 and CL 6) have been selected for resistant to ricin, a galactose-binding lectin with potent cytotoxic activity. The resistant lines exhibit a 50 to 70% decrease in ricin binding and a 300- to 500-fold increase in resistance to the toxic effects of ricin. Crude membrane preparations of CL 3 cells have increased sialic acid content (200% of control), while the galactose, mannose, and hexosamine content is within normal limits. Both the glycoproteins and glycolipids of CL 3 cells have increased sialic acid, with the GM3:lactosylceramide ratios for parent L and CL 3 cells being 0.29 and 1.5, respectively. In contrast, the membranes of CL 6 cells have a decrease in sialic acid, galactose, and hexosamine content with mannose being normal. Both cell lines have specific alterations in glycosyltransferase activities which can account for the observed membrane sugar changes. CL 3 cells have increased CMP-sialic acid:glycoprotein sialyltransferase and GM3 synthetase activities, while CL 6 cells have decrease UDP-GlcNAc:glycoproteinN-acetylglucosaminyltransferase and DPU-galactose:glycoprotein galactosyltransferase activities. The increased sialic acid content of CL 3 cells serves to mask ricin binding sites, since neuraminidase treatment of this cell line restores ricin binding to essentially normal levels. However, the fact that neuraminidase-treated CL 3 cells are still 45-fold resistant to ricin indicates that either a special class of productive ricin binding sites is not being exposed or that the cell line has a second mechanism for ricin resistance.  (+info)

Enhanced tumor growth and invasiveness in vivo by a carboxyl-terminal fragment of alpha1-proteinase inhibitor generated by matrix metalloproteinases: a possible modulatory role in natural killer cytotoxicity. (6/9318)

Matrix metalloproteinases (MMPs) are believed to contribute to the complex process of cancer progression. They also exhibit an alpha1-proteinase inhibitor (alphaPI)-degrading activity generating a carboxyl-terminal fragment of approximately 5 kd (alphaPI-C). This study reports that overexpression of alphaPI-C in S2-020, a cloned subline derived from the human pancreas adenocarcinoma cell line SUIT-2, potentiates the growth capability of the cells in nude mice. After stable transfection of a vector containing a chimeric cDNA encoding a signal peptide sequence of tissue inhibitor of metalloproteinase-1 followed by cDNA for alphaPI-C into S2-020 cells, three clones that stably secrete alphaPI-C were obtained. The ectopic expression of alphaPI-C did not alter in vitro cellular growth. However, subcutaneous injection of the alphaPI-C-secreting clones resulted in tumors that were 1.5 to 3-fold larger than those of control clones with an increased tendency to invasiveness and lymph node metastasis. These effects could be a result of modulation of natural killer (NK) cell-mediated control of tumor growth in nude mice, as the growth advantage of alphaPI-C-secreting clones was not observed in NK-depleted mice, and alphaPI-C-secreting clones showed decreased NK sensitivity in vitro. In addition, production of alphaPI and generation of the cleaved form of alphaPI by MMP were observed in various human tumor cell lines and in a highly metastatic subline of SUIT-2 in vitro. These results provide experimental evidence that the alphaPI-degrading activity of MMPs may play a role in tumor progression not only via the inactivation of alphaPI but also via the generation of alphaPI-C.  (+info)

Organ-selective homing defines engraftment kinetics of murine hematopoietic stem cells and is compromised by Ex vivo expansion. (7/9318)

Hematopoietic reconstitution of ablated recipients requires that intravenously (IV) transplanted stem and progenitor cells "home" to organs that support their proliferation and differentiation. To examine the possible relationship between homing properties and subsequent engraftment potential, murine bone marrow (BM) cells were labeled with fluorescent PKH26 dye and injected into lethally irradiated hosts. PKH26(+) cells homing to marrow or spleen were then isolated by fluorescence-activated cell sorting and assayed for in vitro colony-forming cells (CFCs). Progenitors accumulated rapidly in the spleen, but declined to only 6% of input numbers after 24 hours. Although egress from this organ was accompanied by a simultaneous accumulation of CFCs in the BM (plateauing at 6% to 8% of input after 3 hours), spleen cells remained enriched in donor CFCs compared with marrow during this time. To determine whether this differential homing of clonogenic cells to the marrow and spleen influenced their contribution to short-term or long-term hematopoiesis in vivo, PKH26(+) cells were sorted from each organ 3 hours after transplantation and injected into lethally irradiated Ly-5 congenic mice. Cells that had homed initially to the spleen regenerated circulating leukocytes (20% of normal counts) approximately 2 weeks faster than cells that had homed to the marrow, or PKH26-labeled cells that had not been selected by a prior homing step. Both primary (17 weeks) and secondary (10 weeks) recipients of "spleen-homed" cells also contained approximately 50% higher numbers of CFCs per femur than recipients of "BM-homed" cells. To examine whether progenitor homing was altered upon ex vivo expansion, highly enriched Sca-1(+)c-kit+Lin- cells were cultured for 9 days in serum-free medium containing interleukin (IL)-6, IL-11, granulocyte colony-stimulating factor, stem cell factor, flk-2/flt3 ligand, and thrombopoietin. Expanded cells were then stained with PKH26 and assayed as above. Strikingly, CFCs generated in vitro exhibited a 10-fold reduction in homing capacity compared with fresh progenitors. These studies demonstrate that clonogenic cells with differential homing properties contribute variably to early and late hematopoiesis in vivo. The dramatic decline in the homing capacity of progenitors generated in vitro underscores critical qualitative changes that may compromise their biologic function and potential clinical utility, despite their efficient numerical expansion.  (+info)

Phenotypic and functional characterization of CD8(+) T cell clones specific for a mouse cytomegalovirus epitope. (8/9318)

A series of CD8(+) T cell clones, specific for the IE1 epitope YPHFMPTNL, of the immediate-early protein 1 of the murine cytomegalovirus (MCMV) were generated in order to determine their protective activity against this infection and correlate their phenotypic markers with antiviral activity. We found that the adoptive transfer of three of these anti-MCMV CD8(+) T cell clones into irradiated naive mice resulted in protection against challenge, while another CD8(+) T cell clone, of the same specificity, failed to confer protection. The clones that conferred protection against lethal challenge reduced greatly viral replication in the lung and other organs of the mice. Using one of the protective anti-MCMV CD8(+) T cell clones we found that in order to be fully protective the cells had to be transferred to recipient mice no later than 1 day after MCMV challenge. The adoptive transfer of these CD8(+) T cell clones also protected CD4(+) T-cell-depleted mice. Phenotypic characterization of the anti-MCMV clones revealed that the nonprotective clone expressed very low levels of CD8 molecules and produced only small amounts of TNF-alpha upon antigenic stimulation. Most importantly, our current study demonstrates that this MHC class I-restricted IE1 epitope of MCMV is efficiently presented to CD8(+) T cell clones in vivo and further strengthens the possibility of the potential use of CD8(+) T cell clones as immunotherapeutic tools against cytomegalovirus-induced disease.  (+info)

Clonal heterogeneity detected by karyotyping is a biomarker associated with adverse prognosis in acute myeloid leukemia (AML). Constitutive activation of the phosphatidylinositol-3-kinase-Akt-mechanistic target of rapamycin (PI3K-Akt-mTOR) pathway is present in AML cells, and this pathway integrates signaling from several upstream receptors/mediators. We suggest that this pathway reflects biologically important clonal heterogeneity. We investigated constitutive PI3K-Akt-mTOR pathway activation in primary human AML cells derived from 114 patients, together with 18 pathway mediators. The cohort included patients with normal karyotype or single karyotype abnormalities and with an expected heterogeneity of molecular genetic abnormalities. Clonal heterogeneity reflected as pathway mediator heterogeneity was detected for 49 patients. Global gene expression profiles of AML cell populations with and without clonal heterogeneity differed with regard to expression of ectopic olfactory receptors (a subset ...
PRIMARY OBJECTIVES:. I. To assess the safety and toxicity of cellular adoptive immunotherapy in melanoma patients using autologous CD4+ and CD8+ antigen-specific T cell clones.. II. To evaluate the antitumor effects of CD4+ and CD8+ antigen-specific T cells in patients with metastatic melanoma.. III. To determine the duration of in vivo persistence of adoptively transferred CD8+ antigen-specific T cell clones in the presence or absence of transferred CD4+ T cells.. SECONDARY OBJECTIVES:. I. To assess the in vivo antitumor efficacy of the infused autologous antigen-specific CD4+ T cells.. OUTLINE: This is a phase I study followed by a phase II study.. Beginning 48 hours before T-cell infusion, patients receive cyclophosphamide IV. Patients then receive antigen-specific CD8+ T cells IV alone or with CD4+ T helper clones over 1-2 hours on day 0. Patients also receive aldesleukin subcutaneously twice daily on days 0-13. Treatment repeats every 28 days for up to 3 courses in the absence of disease ...
Fingerprint Dive into the research topics of Antibodies to CD44 Trigger Effector Functions of Human T Cell Clones. Together they form a unique fingerprint. ...
Principal Investigator:YAMAMOTO Kazuhiko, Project Period (FY):1995 - 1997, Research Category:Grant-in-Aid for Scientific Research (A), Section:展開研究, Research Field:内科学一般
An experimental model of two interacting clones of T cells is described, which may be used for defining and exploring the T-cell immunoregulatory network. Mx9/9 is a CD4 clone bearing an antigen receptor recognized by the Mx9 anti-V beta 8 monoclonal antibody (MoAb). Anti-V beta 8 MoAbs activate and induce cell proliferation of this clone. Autologous clones were raised against Mx9/9 cells using the peripheral blood mononuclear (PBM) cells of the Mx9/9 clone donor (PBMjm). Some of these cloned anti-clone cells proliferated after stimulation with irradiated Mx9/9 cells, but not after stimulation with other autologous cloned T cells or heterologous PBM, suggesting that these clones recognize the T cell receptor (TCR) of the Mx9/9 cells. The proliferation of the Mx9/9 stimulated cloned anticlone cells was blocked by anti-class II MoAbs, indicating that the autoreactive clones recognize their target antigen in conjunction with HLA Class II products. The ability of clone Mx9/9 to proliferate after stimulation
Animals were immunized with the cloned cytotoxic T lymphocyte lines V4 and 243/2.5. Spleen cells were fused with Sp2/0-Ag14 myeloma cells.
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed as is with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed as is with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
If the clone is an EST clone, it can be ordered from ATCC or the evil Invitrogen empire, which also has other clones as well and a clone search engine. RIKEN clones must be ordered from Japan from the link HomeBrew listed or sometimes you can order from the German RZPD website. Google it to find the web address. Ive ordered from all except the Japanese place. And I highly recommend buying clones from ATCC before Invitrogen. Ive had clones from Invitrogen end up being the wrong clone many times. But thats a risk you take ordering clones from anyone ...
A new, high-throughput in vivo MHC-I peptide minigene library platform shows that the naive immune system cannot eliminate cells presenting immunogenic antigens found at low frequencies within a growing tumor.
In this report, we describe the molecular and functional characterization of T-cell clones identified in peripheral blood from patients with relapsed myeloma responding to DLI. These clones were initially identified through analysis of TCR Vβ repertoire (spectratyping), a technique that provides a comprehensive characterization of the circulating T-cell compartment (21 , 24 , 25) . Serial analysis of T-cell repertoire in patient samples has also been used to detect the emergence of oligoclonal and clonal T cells at different times in vivo (18 , 26 , 27) . By combining analysis of TCR repertoire with clinical events, we observed the expansion of individual T-cell clones in peripheral blood that were temporally associated with the initiation of either a GVM or GVHD response (17) . However, despite the association of these T-cell clones with specific clinical responses, the functional specificity of these T cells was not established. Further studies were therefore undertaken to quantify the ...
Clouse KA, Powell D, Washington I, Poli G, Strebel K, Farrar W, Barstad P, Kovacs J, Fauci AS, Folks TM (1989). „Monokine regulation of human immunodeficiency virus-1 expression in a chronically infected human T cell clone. J Immunol. 142 (2): 431-8. PMID 2463307 ...
Agriyas Online Food Ordering Script is a well compiled Just Eat clone script to create a food ordering platform.With its advanced features and functionalities it strongly comes across as a swiggy and Foodpanda clone script also.
I have 3 questions if someone could help me with those please. 1. Could 2 different bands (size wise) be detected for the same protein using poly colonal and monoclonal antibodies? 2. If the samples are run on electrophoresis for too long, can the size of the protein show difference comparing to the previous (shorter) runs? 3. In siRNA , I have knock down my gene of interest at the mRNA level (70-80% according to quantitative PCR x2 experiments), but western blot of the same colony cell protein lysates show no or less ( only 30% ) decrement. Any explanation please? Thanks Laleh ...
CD4, PerCP-Cyanine5.5, clone: OKT4 (OKT-4), eBioscience™ 25 Tests; PerCP-Cyanine5.5 CD4, PerCP-Cyanine5.5, clone: OKT4 (OKT-4), eBioscience™ Primary...
As Orphan Black begins its fifth and final season, heres a reminder of the many clones that have appeared on the BBC America show.
CD223 (LAG-3), eFluor 450, clone: eBioC9B7W (C9B7W), eBioscience™ 100μg; eFluor 450 CD223 (LAG-3), eFluor 450, clone: eBioC9B7W (C9B7W), eBioscience™...
Monoclonal expansion of B cells and plasma cells, producing antibodies against self molecules, can be found not only in different autoimmune diseases, such as peripheral neuropathy (PN), but also in malignancies, such as Waldenstr?ms macroglobulinaemia and B-type of chronic lymphocytic leukaemia (B-CLL), as well as in precancerous conditions including monoclonal gammopathy of undetermined significance (MGUS). time. PIK3CD The anti-P0 antibodies were of IgM- type. The antibodies belonged to the VH3gene family with presence of somatic mutations. The IgM reacted with P0 and myelin-associated glycoprotein (MAG), and showed no evidence for polyreactivity, in contrast to other IgM CD5+clones included in the study as controls. The expanded clones expressed CD80 and HLA-DR, which is compatible with properties of antigen-presenting cells. The immunomagnetic selection technique was successfully used for isolation SM-406 of antimyelin protein P0-specific clones. The cell lines may provide useful tools in ...
The role of clonal complexity has gradually been accepted in infection by Mycobacterium tuberculosis (MTB), although analyses of this issue are limited. We performed an in-depth study of a case of recurrent MTB infection by integrating genotyping, whole genome sequencing, analysis of gene expression and infectivity in in vitro and in vivo models. Four different clonal variants were identified from independent intrapatient evolutionary branches. One of the single-nucleotide polymorphisms in the variants mapped in mce3R, which encodes a repressor of an operon involved in virulence, and affected expression of the operon. Competitive in vivo and in vitro co-infection assays revealed higher infective efficiency for one of the clonal variants. A new clonal variant, which had not been observed in the clinical isolates, emerged in the infection assays and showed higher fitness than its parental strain. The analysis of other patients involved in the same transmission cluster revealed new clonal variants acquired
De heer, D H. and Edgington, T S., Clonal heterogeneity of the anti-erythrocyte autoantibody responses of nzb mice. (1974). Subject Strain Bibliography 1974. 168 ...
Based on our knowledge of the cell division pattern of the early developing mandibular region (see above) we were able to look at its morphogenesis at a very high level of resolution. By means of single cell labeling with the fluorescent dye DiI we were able to reconstruct and analyze the clonal composition of the mandibular region from the beginning of ectodermal proliferation up to the differentiation of the mouthparts. The cell labeling reveals that the paragnaths have their origin in the area I and area II which comprises columns 1 to 3 of region E(0). The mandibles originate from cells of the areas II and III (columns 2 to 4). Areas I and II contribute also to the sternal region and the mandibular ganglia whereas area III forms parts of the tergites as well. In more posterior segments, columns 1 and 2 mainly contribute to the formation of segmental ganglia and probably sternites, and columns 3 to 5 mainly give rise to limbs [36, 46]. Hence, when compared with clonal composition of the ...
Townsend, A R. and Skehel, J J., Influenza a specific cytotoxic t-cell clones that do not recognize viral glycoproteins. (1982). Subject Strain Bibliography 1982. 1222 ...
The diversity of the human TCR repertoire in aging has been studied by examining the profiles of complementarity-determining region 3 (CDR3) sizes expressed by the BV families. The TCRBV CDR3 profile, which shows size heterogeneity in young adult humans, is significantly restricted in aged humans. Clonal T cell expansions were identified using a PCR-based approach, in one or more BV families from all 14 healthy persons over the age of 65 that we studied. CD4+ T cell expansions were identified in 8 of 11 donors and CD8+ T cell expansions in 7 of 10 donors. These clonal expansions were stable during a 2-year period. Interestingly, more than half of the aged persons had clonal expansions within the BV3, -14, -16, and -23 families. Although there was no homology among the eight CDR3 sequences identified in clonal T cells from 8 aged persons, selective pressure on the expanded T cell clones was suggested by the fact that the BV families used by the T cell clones were not proportional to the number of ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Cancer progression in humans is difficult to infer because we do not routinely sample patients at multiple stages of their disease. However, heterogeneous breast tumors provide a unique opportunity to study human tumor progression because they still contain evidence of early and intermediate subpopulations in the form of the phylogenetic relationships. We developed a method we call Sector-Ploidy-Profiling to study the clonal composition of breast tumors. SPP involves macro-dissecting tumors, flow-sorting genomic subpopulations by DNA content, and profiling genomes using comparative genomic hybridization. Breast carcinomas display two classes of genomic structural variation: (1) monogenomic and (2) polygenomic. Monogenomic tumors appear to contain a single major clonal subpopulation with a highly stable chromosome structure. Polygenomic tumors contain multiple clonal tumor subpopulations, which may occupy the same sectors, or separate anatomic locations. In polygenomic tumors, we show that ...
The property of 109 CD4+ T cell clones (TCC) to induce IgE synthesis in vitro in human B cells was compared with their ability to produce IL-2, IL-4, and IFN-gamma in their supernatants (SUP) after 24-h stimulation with PHA. A significant positive correlation was found between the property of TCC to induce or enhance spontaneous IgE synthesis and their ability to release IL-4. In contrast, there was an inverse relationship between the IgE helper activity of TCC and their ability to release IFN-gamma, whereas no statistical correlation between the property to induce IgE synthesis and to produce IL-2 was observed. The ability of PHA-SUP from 71 CD4+ TCC to induce IgE synthesis in B cells was also investigated. Twenty-nine SUP (all derived from TCC active on IgE synthesis) induced production of substantial amounts of IgE in target B cells. There was a correlation between the amount of IgE synthesized by B cells in response to these SUP and their IL-4 content. An even higher correlation was found ...
A human CD4 clone (Mx9/9) using the V beta 8 receptor was used as antigen to generate autologous clones (termed anti-Mx9/9 clones) which proliferate in response to this clone, but not other autologous clones. This was used as an experimental model to explore the specific interactions between autologous T cells. Anti-HLA-DR monoclonal antibodies inhibited the response of the anti-Mx9/9 clones, suggesting that these clones recognize their target antigen in association with HLA-DR. Because of the specificity of the anti-Mx9/9 clones for the initiating clone (Mx9/9), but not any other autologous V beta 8- or V beta 8+ CD4 clones, the target antigen seems to be part of the T cell receptor, but not V beta 8 itself. However, the anti-Mx9/9 clones responded also to the autologous EBV line, and thus the target antigen is not known. The regulatory activity of the anti-Mx9/9 clones was assayed by coculture with their target clone. A variety of responses were seen, both inhibitory and stimulatory, which varied
Actin (muscle specific)Clone: HHF35Species reactivity: Human, rabbit, rat.Host: MouseDescription: Actin is a major component of the cytoskeleton. This antibody recognizes actin of skeletal, cardiac, and smooth muscle cells. It is not reactive with other mesenchymal cells except for myoepithelium. Anti-Muscle-Specific Actin recognizes alpha and gamma isotypes of all muscle groups. Non-muscle cells such as vascular endothelial cells and connective tissues are non-reactive. Also, neoplastic cells of non-muscle-derived tissue such as carcinomas, melanomas, and lymphomas are negative. This antibody is useful in the identification of rhabdoid cellular elements.
I am presently looking at cytokine mediated differential gene expression in T cells. Ideally I would like to use human T cell clones derived from subjects with rheumatoid arthritis. I dont have much experience in T cell cloning and I am led to believe that it is very time consuming and not always successful. Any help along this line would be most appreciated, particularly a contact address/number for someone who may have developed such clones already. I can be contacted directly at dh5 at holyrood.ed.ac.uk Thanx in advance, Dave Hunter ...
Cytotoxic T lymphocytes recognize short peptides presented in association with MHC class I (MHCI) molecules on the surface of target cells. The Ag specificity of T lymphocytes is conferred by the TCR, but invariable regions of the peptide-MHCI (pMHCI) molecule also interact with the cell surface glycoprotein CD8. The distinct binding sites for CD8 and the TCR allow pMHCI to be bound simultaneously by both molecules. Even before it was established that the TCR recognized pMHCI, it was shown that CTL exhibit clonal heterogeneity in their ability to activate in the presence of anti-CD8 Abs. These Ab-based studies have since been interpreted in the context of the interaction between pMHCI and CD8 and have recently been extended to show that anti-CD8 Ab can affect the cell surface binding of multimerized pMHCI Ags. In this study, we examine the role of CD8 further using point-mutated pMHCI Ag and show that anti-CD8 Abs can either enhance or inhibit the activation of CTL and the stable cell surface binding of
Open-access immunosequencing data | Weber, Jeffrey | Cancer Immunology Research | Adaptive Biotechnologies | To understand prognostic factors for outcome between differentially sequenced nivolumab and ipilimumab in a randomized phase II trial, we measured T-cell infiltration and PD-L1 by immunohistochemistry, T-cell repertoire metrics, and mutational load within the tumor. We used next-generation sequencing (NGS) and assessed the association of those parameters with response and overall survival. Immunosequencing of the T-cell receptor -chain locus (TCR) from DNA of 91 pretreatment tumor samples and an additional 22 pairs of matched pre- and post treatment samples from patients who received nivolumab followed by ipilimumab (nivo/ipi), or the reverse (ipi/nivo), was performed to measure T cell clonality and fraction. Mutational and neoantigen load were also assessed by NGS in 82 of the 91 patients. Tumors were stained using immunohistochemistry for PD-L1+ and CD8+ T cells. Pretreatment tumor TCR
IL-17 producing γδ T cells (γδT17) promote numerous autoimmune diseases such as psoriasis and arthritis, as well as, cancers of the colon, lung and breasts. Yet γδT17 peripheral regulation has yet to be thoroughly explored. In mice deficient in IL-17 signaling, we observed expansion of γδT17 in all major tissues. However, γδT17 expansion was not uniformly distributed systemically and was most prominent in oral draining cervical lymph nodes (LNs) with monoclonal expansion of Vγ6 γδT17. In vitro proliferation assays of these cervical LNs showed endogenous proliferation by γδT17 dependent on cell-to-cell contact with CD103+ DCs. CD86+ and CD80+ activated CD103+ DCs are increased in the oral draining LNs suggesting that perhaps microbiota-activated CD103+ DC expand γδT17. 16s rRNA FISH hybridization shows increase in 16s rRNA in oral draining LNs. Treatment of mice deficient in IL-17 signaling with α-LTBR-Ig (to remove LNs) or oral broad-spectrum antibiotics abrogates γδT17 expansion.
Milli-Mark Anti-CD38-FITC Antibody, clone AT13/5 is an antibody against CD38 for use in FC. Find MSDS or SDS, a COA, data sheets and more information.
The organization seeks to identify new anti-cancer drugs that contain the cancer, develop natural immunity to the cells, and reduce the emergence of tumor cell clones.. Parents and families around the globe, including over 200 children in Arizona every year, are desperately searching for help, answers and treatment when their child is diagnosed with cancer and the Steele Childrens Research Center strives to provide them with the most current and effective cures that will keep their families whole.. Since its founding, the Phoenix Womens Board of the Steele Childrens Research Center, known as PANDA (People Acting Now Discover Answers), has raised more than $5.25 million to improve treatments and cures for devastating childhood diseases as well as to fund and recruit internationally recognized pediatric physicians and scientists to Arizona, providing local families with the most cutting-edge medical care.. Last year, they opened an office in the Arcadia neighborhood of Phoenix, located at 4455 ...
Purified helper-inducer (T4+) and suppressor-cytotoxic (T8+) lymphocytes from eight patients with acquired immunodeficiency syndrome (AIDS) and eight healthy heterosexual donors were examined by limiting dilution analysis for their ability to be clonally expanded. It was demonstrated that viable T4+ and T8+ lymphocytes from patients with AIDS had markedly reduced proportions of clonable cells compared to the healthy donors (T4 = 1:255 vs. 1:34, P = 0.06; T8 = 1:355 vs. 1:55, P = 0.01). However, the cloned T cells that were obtained from the patients with AIDS demonstrated normal proliferation in response to phytohemagglutinin and alloantigen, and normal ability to help or suppress pokeweed mitogen-driven IgG synthesis. These results strongly suggest that, in addition to a quantitative diminution of T4+ lymphocytes in AIDS, there is an intrinsic functional defect in the surviving T4+ and T8+ lymphocytes, which is reflected by a severe decrease in their potential for clonal expansion. ...
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
I disagreed wih the the production of human clones. One reason was that I could not think of a practical reason to make more people. Dont we have enough already? One might say that we can, in a way, bring people back from the dead. I know thats probably not a good way to put it, but Im hoping that you get the jist of what Im saying. I dont think people would accept clones the way they accept real people; its just not the same thing. I dont think many people would like to buy a clone. I know I wouldnt. So really, I think making clones is a waste of time. Theres no real purpose for it, and its a waste of money (we brought up the topic of space travel at this point...). Making clones for a war, like Star Wars, also seemed pretty bizzare. If one were to create a million clones to go to war, Im not sure they would obey. Their purpose is to die, or to kill. As blan as the clones would be, their sense of moral would be intact Im sure. You cant order a living thing to die in these ...
Although there is multiple evidence for the functional heterogeneity and polyclonality of TRAb (1 - 3) both statements are questioned by some investigators (4, 5). Furthermore there is growing...
Clonal competition in cancer describes the process in which the progeny of a cell clone supersedes or succumbs to other competing clones due to differences in their functional characteristics, mostly based on subsequently acquired mutations. Even though the patterns of those mutations are well explored in many tumors, the dynamical process of clonal selection is underexposed. We studied the dynamics of clonal competition in a BcrAbl-induced leukemia using a γ-retroviral vector library encoding the oncogene in conjunction with genetic barcodes. To this end, we studied the growth dynamics of transduced cells on the clonal level both in vitro and in vivo in transplanted mice. While we detected moderate changes in clonal abundancies in vitro, we observed monoclonal leukemias in 6/30 mice after transplantation, which intriguingly were caused by only two different BcrAbl clones. To analyze the success of these clones, we applied a mathematical model of hematopoietic tissue maintenance, which indicated that a
A phase 0, exploratory study of the pharmacodynamics of a single intratumoral dose of IMCgp100, a monoclonal T cell receptor anti-CD3 scFv fusion protei
CD36 Mouse anti-Human, Clone: eBioNL07 (NL07), eBioscience™ 100 μg; Unconjugated CD36 Mouse anti-Human, Clone: eBioNL07 (NL07), eBioscience™ Primary...
PRIMARY OBJECTIVES:. I. To determine the safety and feasibility of infusing gene-modified, human immunodeficiency virus (HIV)-protected hematopoietic stem cells (HSC) after high-dose chemotherapy for treatment of acquired immunodeficiency syndrome (AIDS)-related lymphoma.. II. To determine the dose of carmustine (BCNU) in combination with O^6-benzylguanine (O6BG) that results in selection in vivo of gene-modified HIV-resistant cells.. III. To estimate the effect of HIV infection on the presence of HIV-resistant blood cells as measured by genetic marking for vector sequences before and after antiviral treatment interruption.. SECONDARY OBJECTIVES:. I. Evaluate the molecular and clonal composition of gene-modified cells after hematopoietic cell transplant (HCT).. II. Evaluate the molecular and clonal composition of gene-modified cells after O6BG/BCNU.. III. Determine the correlation of the level of O6-methylguanine- methyltransferase (MGMT) (P140K) marking with toxicity and response.. IV. ...
Brief report: a single neoplastic clone in sequential biopsy specimens from a patient with primary gastric-mucosa-associated lymphoid-tissue lymphoma and Sjögrens syndrome. New England Journal of Medicine New England Journal of Medicine 0028-4793 10.1056/NEJM199307153290305
During this time, a hot line with a reference lab will be established to answer technical questions.. A meeting six months later will concentrate on evaluating the results from each laboratory, the consistency of the results and potential for applying within trials. At this meeting an approach to external quality control will be established. At year one a further meeting will evaluate the results, the functioning of the EQUAS and value of each of the probe sets. At this point we will initiate a program to develop and optimize the probes. At year one we will start to map and recruit laboratories to the assay network. By 18 months we will have a fully established network into which we can introduce the necessary technology. ...
The liver is the major site of clearance and degradation of foreign antigens from the portal circulation. Despite the presence of hepatic accessory cells, antibody responses to orally administered antigens are uncommon. To ascertain if hepatic accessory cells are incapable of stimulating specific subsets of T lymphocytes, freshly isolated hepatic nonparenchymal and splenic cells were cultured with a panel of antigen-specific, H-2-restricted Th1 and Th2 HTL clones. Whereas spleen cells stimulated the proliferation of both Th1 and Th2 clones, hepatic nonparenchymal cells (NPC) stimulated the proliferation of only Th1 and not Th2 clones. Adding rIL-1, rIL-6, and rIL-7, alone or in combination, to the cultures did not result in proliferation of the Th2 clones. Despite the absence of Th2 proliferation, NPC were able to stimulate the secretion of IL-3 and IL-4 by Th2 clones in the presence of antigen. Moreover, adding hepatic NPC did not inhibit spleen cells from stimulating Th2 clones in the presence ...
TY - JOUR. T1 - Evidence for common clonal origin of multifocal lung cancers. AU - Wang, Xiaoyan. AU - Wang, Mingsheng. AU - MacLennan, Gregory T.. AU - Abdul-Karim, Fadi W.. AU - Eble, John N.. AU - Jones, Timothy D.. AU - Olobatuyi, Felix. AU - Eisenberg, Rosana. AU - Cummings, Oscar W.. AU - Zhang, Shaobo. AU - Lopez-Beltran, Antonio. AU - Montironi, Rodolfo. AU - Zheng, Suqin. AU - Lin, Haiqun. AU - Davidson, Darrell D.. AU - Cheng, Liang. PY - 2009/4/1. Y1 - 2009/4/1. N2 - Background Lung cancer is the most common cause of cancer death in the United States. Multiple anatomically separate but histologically similar lung tumors are often found in the same patient. The clonal origin of multiple lung tumors is uncertain. Methods We analyzed 70 lung tumors from 30 patients (23 females and seven males) who underwent surgical resection for lung epithelial tumors, of whom 26 had non-small cell carcinomas and four had carcinoid/atypical carcinoid tumors. All patients had multiple tumors (two to ...
Understanding the kinetics and molecular events underlying trafficking of HSCs is important both in basic hematology research and for implementation and interpretation of experimental and clinical BM transplantation protocols. Here, we studied posttransplantation skeletal distribution of hundreds of HSC clones to address the extent of migration in steady-state conditions and upon G-CSF-induced mobilization. Genetic barcoding of highly purified hematopoietic cells was used to quantitatively analyze HSC clone sizes in different bones and contributions of these clones to blood.. Our findings demonstrate that at very extended time intervals (at least 11 mo) after transplantation, the distribution of both old and young HSC clones across multiple skeletal sites is highly skewed. This is in line with data showing relatively slow rates of HSC equilibration in parabiotic mice (Abkowitz et al., 2003). However, our findings are in contrast with a study that suggested that 1-5% of HSC pool circulates daily ...
To evaluate the impact of immunodominance on CD8 T-cell properties, we compared the functional properties of dominant and subdominant populations in the response to lymphocytic choriomeningitis virus (LCMV). To improve functional discrimination, in addition to the usual tests of phenotype and function, we used a sensitive technique that allows the screening of all CD8 effector genes simultaneously in single cells. Surprisingly, these methods failed to reveal a major impact of clonal dominance in CD8 properties throughout the response. Aiming to increase clonal dominance, we examined high-frequency transferred P14 T-cell receptor transgenic (TCR Tg) cells. Under these conditions LCMV is cleared faster, and accordingly we found an accelerated response. However, when Tg and endogenous cells were studied in the same mice, where they should be subjected to the same antigen load, they showed overlapping properties, and the presence of P14 cells did not modify endogenous responses to other LCMV epitopes or a
In contrast to the ease of cloning and characterizing, at the molecular level, helper and cytotoxic T cells, suppressor T cells remain an enigma, and their existence as discrete entities is being increasingly challenged. Here we review evidence that CD4+ regulatory clones, capable of expressing both helper and suppressor functions, may account for much of the suppressor function. It is suggested that a single T cell clone, depending on the signals it receives from its environment, may release either helper or suppressor cytokines. Studying such clones under defined conditions (providing suppressor signals), may preclude detection of their helper capacity. Since some therapeutic approaches in various human diseases are based on the manipulation of helper and suppressor functions, the question whether committed suppressor cells exist has important practical implications in medicine.
Andreas Wack was born in Frankfurt, studied biology in Konstanz and got his first degree based upon a thesis on the clonal composition of T cell populations in the elderly. He performed his PhD work at the Medical Research Council National Institute for Medical Research (now part of the Francis Crick Institute) under the supervision of Dimitris Kioussis on thymocyte lineage decisions and went on to do a postdoc and work as a staff scientist in the research institute of Novartis Vaccines, formely Chiron, in Siena, Italy.. The focus of his work there was the modulation of T and NK cell function by the hepatitis C virus, human dendritic cell subsets and their crosstalk, the mechanism of action of mucosal and parenteral vaccine adjuvants, and next generation influenza vaccines.. His current research interests at the Crick include the understanding of pathogenesis and protection in influenza infection and influenza-bacterial coinfection. He is also interested in the anti-influenza response of airway ...
Figure 1. Stem cell dynamics in tumour initiation illustrated by quantifying the clonal benefit of KrasG12D (from Vermeulen et al., Science 2013; 342: 995). (A) Intestinal stem cells are equipotent and continuously replace each other in a stochastic fashion. (B) Confocal images of SI crypt bottoms of AhCreER/tdTom-/fl mice (WT) and AhCreER/tdTom-/fl/Kras-G12Dfl (KrasG12D) at the indicated time points after clone induction. Clone sizes are indicated as fractions (in eighths) of the crypt circumference. Blue, nuclear stain (DAPI); red, tdTom expression; scale bars represent 30mm. (C and D) The distribution of clone sizes and the corresponding distribution changes caused by the activation of Kras can be captured using stochastic models. The models describe the competition between the stem cells and summarise the fitness of the mutant stem cell via PR, the probability that the mutant will replace its neighbour. A value of PR = 0.5 means that the mutant stem cell is as fit as the WT cells and a value ...
HLA-DR3- and HLA-DRw52-associated functional polymorphism was investigated with selected tetanus toxoid (TT)-specific T cell clones. We have shown earlier that HLA-DR antigens are encoded by two distinct loci, DR beta I and DR beta III. The alloantigenic determinant(s) defined by the serological HLA-DR3 specificity map to the former, while the supratypic HLA-DRw52 determinants map to DR beta III. Furthermore, we have recently recognized by DNA sequencing three alleles of HLA-DRw52 at locus DR beta III, referred to as 52 a, b, and c. Our objective was to correlate the pattern of T cell restriction with the gene products of individual DR beta chain loci and with the three newly described alleles of locus DR beta III. Among the selected T cell clones, 5 reacted exclusively when TT was presented by HLA-DR3+ APCs (TT-DR3-APC). In contrast, two T cell clones were stimulated by TT-DRw52-APC. More specifically, these two T cell clones (Clones 10 and 16) were stimulated by different subsets of ...
The vast majority of proviruses that persist on ART are defective. Of the minority that are intact (~2%), the fractions that are latent or transcriptionally active are not known. To address this question, we determined the fraction of proviruses that express HIV RNA in vivo in cell populations carrying either intact or defective proviruses.. PBMC were obtained from Patient #1 in Maldarelli, et al. (Science, 2014). This donor had multiple clones of cells that contain intact or defective proviruses. Proviral expression was determined by single-genome pro-pol sequencing (SGS) of HIV DNA and RNA from multiple aliquots of PBMC diluted to an endpoint such that each aliquot contained one to a few HIV RNA expressing cells. Intact proviruses were identified using viral outgrowth assays (VOA). The levels and fractions of cells expressing HIV RNA were determined for probable clones (identified by identical sequence matches) carrying intact and defective proviruses.. A total of 77 million PBMC were ...
Tumor cell clones isolated from a rat 13762NF mammary adenocarcinoma and its spontaneous metastases were heterogeneous in their survival responses to continuous 42° heating. Clones MTLn3 and MTF7 had similar initial survival responses; they were significantly less sensitive than clone MTC. Following the first decrease in survival, different magnitudes of induced thermal resistance were observed. When ratios of the first and resistant slopes of survival curves were compared (the thermotolerance ratio), the order of induced thermal resistance was MTLn3 , MTF7 , MTC.. These clones were compared for the rates of synthesis of heat stress proteins (HSP). The same four major HSP at Mr 112,000, 90,000, 70,000, and 22,000 were induced or enhanced in all 3 clones. The rates of synthesis of these HSP were analyzed through a unique system of computer-assisted video densitometry and digitization. When all 4 HSP were analyzed as a group, the rates were significantly different (p , 0.017), and the rank order ...
The outcome of patients with MM has improved substantially during the last decades as a result of drug development and progress in the understanding of disease biology.11,12 However, even in the era of novel agents some patients with high-risk cytogenetic abnormalities or early relapse after first-line treatment have a dismal outcome.13,14 Clonal heterogeneity and evolution are contributors to disease progression and ultimately refractoriness in MM.6 So far, there are only limited data available that proved clonal evolution in patients relapsing after ASCT for newly diagnosed disease. With our current analysis of 128 patients with FISH data at primary diagnosis and relapse after ASCT we demonstrate that high-risk cytogenetic abnormalities occur more frequently at relapse. This observation was especially due to de novo gains of chromosome 1q and new deletions of chromosome 17p. No changes were observed between primary diagnosis and relapse for defined IGH translocations, including t(4;14).. A ...
https://doi.org/10.18632/oncotarget.25743 Kentaro Tanaka, Toyoshi Yanagihara, Yuki Ikematsu, Hiroyuki Inoue, Keiichi Ota, Eiji Kashiwagi, Kunihiro Suzuki, Naoki Hamada, Ario Takeuchi, Katsunori...
Re: [PATCH 1/6] selftests/clone3: convert test modes into an enum 2019-09-10 12:03 ` [PATCH 1/6] selftests/clone3: convert test modes into an enum Eugene Syromiatnikov @ 2019-09-16 16:28 ` shuah 0 siblings, 0 replies; 13+ messages in thread From: shuah @ 2019-09-16 16:28 UTC (permalink / raw) To: Eugene Syromiatnikov, linux-kernel, Christian Brauner, linux-kselftest Cc: Adrian Reber, shuah On 9/10/19 6:03 AM, Eugene Syromiatnikov wrote: , * tools/testing/selftests/clone3/clone3.c (CLONE3_ARGS_NO_TEST, , CLONE3_ARGS_ALL_0, CLONE3_ARGS_ALL_1): Change into an enum. , (call_clone3): Change test_mode parameter type to enum test_mode; , use switch statement for actions that dependent on test_mode selection. , (test_clone3): Change test_mode parameter type to enum test_mode. , You dont need the file name in the commit log. Please describe what you are fixing/doing in the commit. Describing the actual code changes doesnt help. Including why these changes are needed as opposed the actual changes will ...
Get Cell Cloning Cylinders at Spectrum Chemical. SpectrumChemical.com carries a full line of fine chemicals, lab appliances and lab supplies. Spectrum Chemical has a complete line of laboratory supplies, equipment and safety items.
Over the past two years, a team led by biologist Teruhiko Wakayama at the University of Hawaii has produced six generations of cloned mice clones of clones of clones of clones of clones of clones. The researchers paid particular attention to the animals telomeres, the caps at the tips of their chromosomes. These genetic caps are associated with aging. They grow shorter over time and are thought to contribute to cell death as they wear away. In conventional reproduction, telomeres are restored during the formation of sperm and egg cells, but cloning bypasses that process. We might therefore expect telomeres to become shorter and shorter in successive generations of clones, says Tony Perry of Rockefeller University, one of Wakayamas collaborators. Bafflingly, they seem to get longer ...
Effective neutralization of different strains of HIV virus is shown by neutralizing antibodies against HIV-1 envelope glycoproteins. It has been demonstrated that gp41 is involved in virus mediated membrane fusion which results in HIV-entry into target cells. Recombinant single chain antibodies (scFvs) with high specificity and high affinity properties have been identified as useful agents in anti-viral targeted therapy. In this study we selected specific scFvs against a conserved neutralizing epitope of gp41. Four rounds of panning were performed to select the specific clones. The reactivity of the selected scFvs against the corresponding epitope was tested in ELISA. Results demonstrated that the specific clones were selected with the frequencies of 65% and 30%. The ELISA evaluation demonstrated significant higher OD of scFvs in reaction with the corresponding epitope than the negative control. Specific scFvs against conserved neutralizing epitope of gp41 of HIV has the potential to be ...
Nov 13, 2007, 22:49. Todo lo que Tú Querías Saber Sobre los Robotoides y Clones. Por Candace. 2007-11-10. Hola a todos, puesto que recientemente Patrick Bellringer ha estado haciendo énfasis en los clones, es tiempo de aclarar más completamente los misterios. Primero usemos dos términos diferentes: clones y Robotoides. Un clon ç en esta discusión significará los clones que ustedes ven en el gobierno, tales como el residente y no-electro clon que funciona en la Casa Blanca, y todos sus cómplices clones. La mayoría de estos clones son hechos en cuestión de algunas semanas, de células tomadas del cuerpo original, ya sean que se trate de humanos reales o robotoides. ¿Así que entonces que es un robotoides? No es exactamente un clon, como se describe arriba. Aproximadamente en el año 2500 A.C.a los propietarios del planeta les preocupaba que aquellos sobrevivientes del último viaje a través del Cinturón de Fotones, del gran diluvio y de otras calamidades se volviera nuevamente por ...
Based in Abingdon (UK) and Philadelphia (USA) were a privately owned biotechnology company developing innovative biological therapeutics for the treatment of a range of serious diseases. Our world-leading T cell receptor technology exploits the power of the bodys own immune system to find and kill diseased cells. Weve established a robust technology platform which combines monoclonal T cell receptor (mTCR) targeting technology with an effector technology, anti-CD3 scFv, that catalyses the killing of the targeted diseased cells by the hosts own non-specific cytotoxic T cells. And were developing a portfolio of products from the platform, called ImmTACs, for the treatment of cancer, chronic infectious disease and diabetes.. ...
Mouse monoclonal antibody raised against full length recombinant human MB. Recombinant protein corresponding to full length of human MB. (MAB12457) - Products - Abnova
Mouse monoclonal antibody raised against partial recombinant PNPLA2 . Recombinant protein corresponding to amino acids 30-504 of human PNPLA2 . (MAB3210) - Products - Abnova
Scientists are testing immune checkpoint proteins, CD8 T cell clonal expansion, mutational load, and PSA levels as predictive biomarkers.
Reagents. shRNA lentiviral constructs targeting ITPKB, NOX4, NOX1, IPMK, and TRC Human Kinase shRNA Gene Family Library were purchased from GE Healthcare Dharmacon. sgRNA lentiviral constructs to target ITPKB were obtained from Genecopoeia. The shRNA sense strand sequences were ACAGCTATGGAAATTGACAAA (ITPKB shRNA clone 1), GCCTTCAGAGAGTTCACTAAA (ITPKB shRNA clone 2), CCCTCAACTTCTCAGTGAATT (NOX4 shRNA clone 1), CAGAGTTTACCCAGCACAAAT (NOX4 shRNA clone 2), CCGCACACTGAGAAAGCAATT (NOX1 shRNA clone 1), CCAAGGTTGTTATGCACCCAT (NOX1 shRNA clone 2), GCCCTGTATAATGGATGTAAA (IPMK shRNA clone 1), and GCAAGTTCATTACTCTTTGTT (IPMK shRNA clone 2). ITPKB sgRNA sequences were AGCCGAGTCGCTGTCCCCCG (ITPKB sgRNA clone 1) and CGGGGGCGTCTCGCTGCCAC (ITPKB sgRNA clone 2). Primers for ITPKB shRNA-resistant silent mutant and ITPKB kinase-dead D897N mutant were obtained from Integrated DNA Technologies. Bt2-Ins (1345) P4/PM was obtained from SiChem. GKT137831, Z-VAD-fmk, cyclosporin A, and necrostatin-1 were from Selleckchem. ...
For some time, scientists have been able to craft precise genetic copies of many creatures. Whether they are animals, or single cells, they are similarly refereed to as clones. For various technical and perceived ethical reasons, the procedures involved have been difficult to replicate for humans. A new paper published in the journal Cell shares the work of a group of researchers in Oregon who have grown a human clone - at least up to a couple hundred cells.. ...
Remember also that gene expression in behavior is not mathematically precise. In other words, you could have responded many different ways to different environments (within definite biologically determined boundaries). The clone would not be you; he or she might unpredictably behave differently from you. Lets say both you and therefore (presumably) your clone have a rebellious streak under certain circumstances, and have an orderly streak under others. You were reared, lets say, in a permissive environment, and your coping response was to call on your orderly streak, leading you to blossom into the upright example you doubtless are at present. But supposing you were to raise your clone in a (even only infinitesimally) more restrictive, less permissive environment. (Such as an enviroment in which your every move, feeling, and thought were anxiously monitored and commented upon by a weirdo parent.) In that case, the clones prevalent coping response may be to call upon his/your rebellious ...
An inbred strain can produce several hundred different anti-group A carbohydrate (GAC) antibodies, as analyzed by isoelectric focusing. However, each individual mouse produces the bulk of its anti-GAC antibody as only one or two different spectrotypes, which appear to be randomly chosen. By using adoptive transfer techniques, we have observed that clonal commitment occurs very early in immunization, sometimes even before immunization, and thus does not result from competition among B cells for antigen ...
At the peak of an immune response, hundreds of thousands of identical T cells are scampering about, searching out the pathogen and doing their own special T cell things to try to get rid of it. We know that these hundreds of thousands of cells werent there at the onset of infection; the whole T cell schtick involves rapid expansion of very, very rare cells. Only a very few T cells are able to recognize any particular antigen; but within a few days, the progeny of those rare cells are now common, and all retain their ability to recognize the same antigen. 1. In the past few years, weve learned a little more, quantitatively, just how dramatic this expansion phase is. Delicate work has established that there are maybe 20 to 1000 potentially-reactive T cells in a mouse, before infection (see my discussion here and here). Those few cells are the precursors of the huge numbers of T cells a week or so after infection.. If you think about it, its pretty remarkable that these few T cells, hidden ...
CD66b, PE, clone: G10F5, eBioscience™ 100 Tests; PE CD66b, PE, clone: G10F5, eBioscience™ Primary Antibodies CD51 to CD100
CD284 (TLR4), PE, clone: HTA125, eBioscience™ 25 Tests; PE CD284 (TLR4), PE, clone: HTA125, eBioscience™ Primary Antibodies CD251 to CD400
... "conservation cloning"?". Cloning and Stem Cells. 11 (3): 341-346. doi:10.1089/clo.2009.0026. PMID 19594389. Profile at The ... Celia provided suitable tissue samples for cloning. However, attempts to clone her highlighted a major problem: even if it were ... only certain extinct animals are candidates for cloning because of the need for a suitable proxy surrogate to carry the clone ... The first cloning attempts failed. Of the 285 embryos reconstructed, 54 were transferred to 12 ibex and ibex-goat hybrids, but ...
They may also be created by somatic cell nuclear transfer (SCNT) into an egg cell of another species, creating a cloned embryo ... 1] Fulka Jr, J.; Loi, P.; Ptak, G.; Fulka, H.; John, J. (2009). "Hope for the mammoth?". Cloning and Stem Cells. 11 (1): 1-4. ... The remaining inner cell mass can be injected into a blastocele of the recipient species to acquire its trophoblastic cells. It ... In this experiment, nuclei from cells taken from abdominal muscles of giant pandas were transferred to egg cells of rabbits and ...
Cyranoski, David (2007-11-14). "Cloned monkey stem cells produced". Nature News. doi:10.1038/news.2007.245. White-house, David ... Semos - a nine-year-old male rhesus macaque at the Oregon National Primate Research Center who supplied the skin cells from ... Tetra - a rhesus macaque at the Oregon National Primate Research Center who was the first cloned primate, created through ... 14 January 2000). "Scientists 'clone' monkey". BBC News. "Stranger Than Fiction: Jack the Signalman". www.knoxvilledailysun.com ...
Evan Snyder clones the first neural stem cells from the human central nervous system of a fetus in 1998, offering the ... "Nerve Cell Clones Repair Brain Damage". The Harvard University Gazette. Archived from the original on 3 October 1999. Retrieved ... a young patient with sickle cell disease, to try Hydroxyurea, a drug used to treat blood cancer, to treat her sickle cell ... even in the absence of conventional T-helper cells. In addition, NKT cells respond to a different class of antigens that are ...
"Cardiac tissue engineering and regeneration using cell-based therapy". Stem Cells and Cloning: Advances and Applications. 8: 81 ... First, cells from the patient in which the scaffold will be implanted in are harvested. These cells are expanded and seeded ... Once cells begin to populate the cell, the scaffold is designed to gradually degrade, leaving behind a constructed heart valve ... Cell line as well as cell type such as fibroblasts can largely impact tissue responses towards implanted foreign devices by ...
It has been actively used in cell-free cloning, which is the enzymatic method of amplifying DNA in vitro without cell culturing ... Hutchison, C. A.; Smith, HO; Pfannkoch, C; Venter, JC (2005). "Cell-free cloning using φ29 DNA polymerase". Proceedings of the ... The ability to sequence individual cells is also useful in combating human disease. Genomes from single human embryonic cells ... "Sequencing genomes from single cells by polymerase cloning". Nature Biotechnology. 24 (6): 680-6. doi:10.1038/nbt1214. PMID ...
24 January 2018). "Cloning of Macaque Monkeys by Somatic Cell Nuclear Transfer". Cell. 172 (4): 881-887.e7. doi:10.1016/j.cell. ... In January 2018, scientists in China reported in the journal Cell the first creation of two crab-eating macaque clones, named ... "Scientists Successfully Clone Monkeys; Are Humans Up Next?". The New York Times. Associated Press. 24 January 2018. Retrieved ... Normile, Dennis (24 January 2018). "These monkey twins are the first primate clones made by the method that developed Dolly". ...
24 January 2018). "Cloning of Macaque Monkeys by Somatic Cell Nuclear Transfer". Cell. 172 (4): 881-887.e7. doi:10.1016/j.cell. ... a process where the cells in the embryo are split at the eight-cell stage to create four identical two cell embryos. This was ... scientists in China reported in the journal Cell the creation of two crab-eating macaque monkey clones, named Zhong Zhong and ... A further four monkeys, cloned using this same technique were due to be born in May 2000. The team at the Oregon National ...
The cloning process involved the selection of individual cells or clusters expressing neuron-like characteristics. The SH-SY5Y ... The cells typically grow in tissue culture in two distinct ways. Some grow into clumps of cells which float in the media, while ... The cells are always grown at 37 degrees Celsius with 95% air and 5% carbon dioxide. It is advised to cultivate the cells in ... However, the cell line is appreciated to be N-type (neuronal), given its morphology and the ability to differentiate the cells ...
Campbell, K. H. S.; McWhir, J.; Ritchie, W. A.; Wilmut, I. (1996). "Sheep cloned by nuclear transfer from a cultured cell line ... the first mammal to be successfully cloned from an adult cell, at the Institute. A year later, two other sheep named Polly and ... Firn, D. (1999). "Roslin Institute upset by human cloning suggestions". Nature Medicine. 5 (3): 253. doi:10.1038/6449. PMID ... which was key in laying the groundwork for the institute's work on cloning in the 1990s. In 1986, the Poultry Research Centre ...
Human cloning Nuclear transfer Germline gene therapy Budnick, Nick (June 2, 2013). "Oregon Stem-cell Groundbreaker Stirs ... Mitalipov and his team published a study in Cell that describes a new process for creating human stem cells from skin cells. ... He discovered a new way of creating human stem cells from skin cells. Mitalipov was born in 1961 in Almaty, Kazakhstan, then ... After the fall of the Soviet Union in 1991 funding for stem cell research was scarce, so Mitalipov applied for and won a ...
Francis Crick states the "central dogma of molecular biology". John Gurdon clones a frog using somatic-cell nuclear transfer ... Williams, R. (2008). "Sir John Gurdon: Godfather of cloning". The Journal of Cell Biology. 181 (2): 178-179. doi:10.1083/jcb. ... The Reversal of Cell Differentiation". Annual Review of Cell and Developmental Biology. 22: 1-22. doi:10.1146/annurev.cellbio. ... Kain, K. (2009). "The birth of cloning: An interview with John Gurdon". Disease Models and Mechanisms. 2 (1-2): 9-10. doi: ...
... or express the insert in the target cell. All vectors may be used for cloning and are therefore cloning vectors, but there are ... Cloning site: This may be a multiple cloning site or other features that allow for the insertion of foreign DNA into the vector ... Some cloning vectors need not have a promoter for the cloned insert but it is an essential component of expression vectors so ... Cells containing vector with an insert may be identified using blue/white selection by growing cells in media containing an ...
Doherty, Peter C (8 January 2008). "Burnet, chick embryos, viruses, clones and quantitative biology". Immunology and Cell ...
Items are grouped into three categories: reproductive cloning, stem cell, and therapeutic cloning. PopGen consists of a ... The Consortium's mission is to map the genetic regulatory nodes and networks that control the activity of embryonic stem cells ... Some of the topics covered include: Property rights in data and biological samples Eugenics Stem cell regulation by country ... The selective review of literature in stem cell research covers peer-reviewed articles, book chapters, and monographs published ...
Human x mouse somatic cell hybrid clone secreting immunoglobulins of both parental types. Nature. 1973 Aug 17;244(5416):444-7. ... The hybrid cells continued secretion of mouse immunoglobulin and initiate synthesis and secretion of human immunoglobulin." The ... In 1973 he described, with Edward Cohen, a method of producing antibodies involving human-mouse hybrid cells, or hybridomas. ... They fused "mouse myeloma cells secreting immunoglobulin of known specificity and human peripheral blood lymphocytes not ...
U45 was originally cloned from HeLa cells and expression verified by northern blotting. It is related to the snoRNA (MBII-401) ... This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis ... Cell. 85 (7): 1077-88. doi:10.1016/S0092-8674(00)81308-2. PMID 8674114. S2CID 10418885. Hüttenhofer A, Kiefmann M, Meier-Ewert ...
... was born to her twin mother who her cloning cells originated from. Texas A&M University was also undertaking a horse- ... OCLC 228117551.CS1 maint: others (link) World's first cloned horse is born New Scientist. Referenced March 6, 2011. Cloning ... The ethics of cloning on horses still needs to be fully explored but there are concerns of genetic variability. Cloning also ... is the first cloned horse and the first to be born from and carried by its cloning mother. Her birth was announced publicly on ...
"Generation of transgenic rabbits by the novel technique of chimeric somatic cell cloning." Biology of Reproduction 74 (2006): ... Biophysical Techniques as Applied to Cell Biology (in Polish). Warsaw, 1977 Edition. Print. Darzynkiewicz, Z., V.K. Dokov, and ... He was founder and chairman of the board for Piengen Biomedical Corporation, which developed novel cloning technology and ... He collaborated in important discoveries related to immunology, viral oncogenes, genetic engineering, and cloning and has ...
This snoRNA was originally cloned from HeLa cells and expression verified by northern blotting. It is predicted to guide 2'O- ... This type of modifying RNA is usually located in the nucleolus of the eukaryotic cell which is a major site of snRNA biogenesis ... Cell. 85 (7): 1077-88. doi:10.1016/S0092-8674(00)81308-2. PMID 8674114. S2CID 10418885. Lestrade L, Weber MJ (January 2006). " ...
"Cloning of two human liver bilirubin UDP-glucuronosyltransferase cDNAs with expression in COS-1 cells". The Journal of ... "Cloning and substrate specificity of a human phenol UDP-glucuronosyltransferase expressed in COS-7 cells". Proceedings of the ...
Type Ap spermatogonia repeatedly divide mitotically to produce identical cell clones linked by cytoplasmic bridges. The ... The stem cells involved are called spermatogonia and are a specific type of stem cell known as gametogonia. Three functionally ... These cells do not directly participate in producing sperm, instead serving to maintain the supply of stem cells for ... When repeated division ceases, the cells differentiate into type B spermatogonia. This stage is referred to as the ...
... : Gene Expression, Cloning and Beyond Harvard Molecular and Cell Biology Lab Website (Columbia). ... and cloned the human beta-globin gene cluster. In 1981 Maniatis returned to Harvard where he applied molecular cloning methods ... wrote Molecular Cloning: A Laboratory Manual, which made the newly emerging gene cloning technology accessible to a wide range ... His laboratory currently studies the role of single cell diversity in brain wiring, and the molecular and cellular mechanisms ...
Following phenotypic selection, genomic DNA is extracted from the selected clones, alongside a control cell population. In the ... March 2019). "Single-Cell Heterogeneity Analysis and CRISPR Screen Identify Key β-Cell-Specific Disease Genes". Cell Reports. ... The two cell lines are cultivated, and any under-represented or dead cells are analysed to identify potential synthetic lethal ... For this, a wild-type cell line and a tumour cell line containing the resistance-causing mutation are transduced with a CRISPR ...
The legs are made from artificial muscle tissue cloned from embryonic stem cells of ungulate embryos. With these legs, the ...
Li X, Tedder TF (May 1999). "CHST1 and CHST2 sulfotransferases expressed by human vascular endothelial cells: cDNA cloning, ... molecular cloning, chromosomal mapping, and expression in various organs and tumor cells". J. Biochem. 124 (3): 670-8. doi: ... 1998). "Molecular cloning and characterization of an N-acetylglucosamine-6-O-sulfotransferase". J. Biol. Chem. 273 (35): 22577- ... 2001). "Molecular cloning, expression, and chromosomal mapping of human chondroitin 4-sulfotransferase, whose expression ...
... who also offers animal cloning services. The cloning process used by both ViaGen and their competitor is somatic cell nuclear ... ViaGen Pets offers cloning as well as DNA preservation services, sometimes called tissue or cell banking. ViaGen's subsidiary, ... ViaGen Pets began by offering cloning to the livestock and equine industry in 2003, and later included cloning of cats and dogs ... "If You Love Animals, Don't Clone Your Pet". Forbes. Retrieved June 6, 2020. Staff, WTOC. "Viagen Pets take animal cloning from ...
He also produced the first dendritic cell-specific monoclonal antibody and cloned the first dendritic cell receptor. ... As a Ph.D. student, Nussenzweig was the first to show that dendritic cells present foreign antigens to initiate T cell immunity ... while work on innate immunity focuses on dendritic cells. The laboratory has isolated and cloned human antibodies to HIV-1 and ... Cell. 158 (5): 989-999. doi:10.1016/j.cell.2014.07.043. PMC 4163911. PMID 25131989. Scheid, Johannes F.; et al. (28 July 2016 ...
It comes from a clone of Dryvax which is purified and produced using modern cell culture technology. Emergent BioSolutions ... Second-generation vaccines are cell-cultured and include ACAM2000 and CCSV. Both Dryvax and ACA2000 come from the New York City ...
Striebich CC, Falta MT, Wang Y, Bill J, Kotzin BL (October 1998). "Selective accumulation of related CD4+ T cell clones in the ... Mahoney JA, Ntolosi B, DaSilva RP, Gordon S, McKnight AJ (March 2001). "Cloning and characterization of CPVL, a novel serine ... "Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ ... hematopoietic stem/progenitor cells". Genome Research. 10 (10): 1546-60. doi:10.1101/gr.140200. PMC 310934. PMID 11042152. ...
... the activation and growth of B cell clones able to secrete antibodies of higher affinity for the antigen. ... Plasma cells, also called plasma B cells, plasmocytes, plasmacytes, or effector B cells, are white blood cells that secrete ... In humans, CD27 is a good marker for plasma cells, naive B cells are CD27-, memory B-cells are CD27+ and plasma cells are ... Germinal center B cells may differentiate into memory B cells or plasma cells. Most of these B cells will become plasmablasts ( ...
Sertoli cell proliferation. • توصيل الإشارة. • peptide hormone processing. • positive regulation of gene expression. • cell- ... "DNA Cloning Using In Vitro Site-Specific Recombination". Genome Res. 10 (11): 1788-95. PMC 310948. . PMID 11076863. doi ... positive regulation of cell migration. • positive regulation of transcription from RNA polymerase II promoter. • حمل أنثوي. • ... 1989). "Expression of biologically active human follitropin in Chinese hamster ovary cells". J. Biol. Chem. 264 (9): 4769-75. ...
"Blood Cells Mol. Dis. 39 (3): 336-9. doi:10.1016/j.bcmd.2007.06.009. PMC 2387274. PMID 17698380.. ... "Cloning and characterization of MN1, a gene from chromosome 22q11, which is disrupted by a balanced translocation in a ... Cell. Proteomics. 7 (3): 499-508. doi:10.1074/mcp.M700325-MCP200. PMID 18029348.. ... 2009). "Meningioma 1 gene is differentially expressed in CD34 positive cells from bone marrow of patients with myelodysplastic ...
cell junction. • plasma membrane. • GABA-ergic synapse. • integral component of postsynaptic specialization membrane. • ... Yang W, Drewe JA, Lan NC (1996). "Cloning and characterization of the human GABAA receptor alpha 4 subunit: identification of a ...
... has been known to stimulate cell growth in normal and cancer cell line cultures,[37] and it was shown that ... and functional expression of cDNA clones". Biochemistry. 30 (44): 10640-6. doi:10.1021/bi00108a006. PMID 1657150.. ... on cells (including cancer cells) bestowing upon them mobility.[40] and metastasis.[41] It has been suggested that cancer ... stem cells, white blood cells) in many tissues and organs. SP amplifies or excites most cellular processes.[15][16] ...
"The Plant Cell. 3 (11): 1187-1193. doi:10.2307/3869226. JSTOR 3869226. PMC 160085 . PMID 1821764.. ... Tomatoes have been used as a model in map-based cloning, where transgenic plants must be created to prove that a gene has been ... "Plant Cell Reports. 12: 644-647. doi:10.1007/bf00232816.. CS1 maint: Multiple names: authors list (link) ... "Fruit Cell Wall Proteins Help Fungus Turn Tomatoes From Ripe To Rotten". Science Daily. Jan 31, 2008. Retrieved 29 August 2010. ...
regulation of metanephric nephron tubule epithelial cell differentiation. • cell differentiation. • mesonephric tubule ... "Chromosomal localization of seven PAX genes and cloning of a novel family member, PAX-9". Nature Genetics. 3 (4): 292-8. doi: ... positive regulation of metanephric DCT cell differentiation. • negative regulation of mesenchymal cell apoptotic process ... pancreatic islet cells and lymphoid cells.[8] PAX8 and other transcription factors play a role in binding to DNA and regulating ...
2000). „Melatonin receptor mRNA expression in human granulosa cells". Mol. Cell. Endocrinol. 156 (1-2): 107-10. PMID 10612428. ... 1996). „Cloning of a melatonin-related receptor from human pituitary". FEBS Lett. 386 (2-3): 219-24. PMID 8647286. doi:10.1016/ ... Cell. Endocrinol. 192 (1-2): 147-56. PMID 12088876. doi:10.1016/S0303-7207(02)00029-1.. CS1 одржавање: Експлицитна употреба et ... Sugden D, Davidson K, Hough KA, Teh MT (2004). „Melatonin, melatonin receptors and melanophores: a moving story". Pigment Cell ...
cell-cell adhesion. • positive regulation of nucleic acid-templated transcription. • heart development. • actin cytoskeleton ... Wang H، Harrison-Shostak DC، Lemasters JJ، Herman B (1996). "Cloning of a rat cDNA encoding a novel LIM domain protein with ... cadherin binding involved in cell-cell adhesion. • actin binding. • muscle alpha-actinin binding. ... Pitx2 pathway mediating cell-type-specific proliferation during development.". Cell. 111 (5): 673-85. PMID 12464179. doi: ...
cell nucleus. • cytosol. Biological process. • regulation of transcription, DNA-templated. • cell-cell signaling. • negative ... "Complete amino acid sequence of the human progesterone receptor deduced from cloned cDNA". Biochemical and Biophysical Research ... epithelial cell maturation. • mammary gland development. • paracrine signaling. • lung alveolus development. • regulation of ... epithelial cell proliferation both in response to estrogen alone and in the presence of progesterone and estrogen. These ...
Back in the sewers the X-Men soon realize that killing Sinister was a mistake as the Boom Boom clone demons screech and ... Meanwhile, as Domino (who was placed in a fiery prison cell) works her charm on a familiar looking kid to exploit an ... Madelyne then used the dragon Nightcrawler to kill all the clones. Darkchylde soon arrives and massacres most of the heroes and ... Bob: Blue skinned, can create miniature duplicates from his blood cells.. *Russell: Possesses super speed. Often seen wearing a ...
In some species of squamates, a population of females is able to produce a unisexual diploid clone of the mother. This form of ... Cell. 25 (4): 326-328. doi:10.1016/j.devcel.2013.05.011. PMID 23725759.. ...
Bahori was a writer who predicted cell phones and the possible cloning of humans.[1] ...
It is represented by a lattice of points which repeats a basic pattern, called a unit cell, in three dimensions. The lattice ... Hanksite, Na22K(SO4)9(CO3)2Cl, one of the few minerals that is considered a carbonate and a sulfate ... can be characterized by its symmetries and by the dimensions of the unit cell. These dimensions are represented by three Miller ...
of Cell and Dev. Biol. 13: 425-456. *↑ Colman R. D. ja Filbin T. M. (2006). Cell adhesion molecules, lk 111-121. George J. ... Pimenta, A. F., Fischer, I., Levitt, P. (1996). cDNA cloning and structural analysis of the human limbic-system-associated ... Cell Biol. 10: 1959-1968. *↑ Goodman,C. S., Bastiani, M. J., Doe, C. Q., Lac, S., Helfand,S. L., Kuwada, J. Y., Thomas, J. B. ( ... J. Cell Sci. 117: 3961-3973. *↑ 11,0 11,1 Pimenta, A. F. ja Levitt, P. (2004). Characterization of the genomic structure of the ...
"Cloning of Large Segments of Exogenous DNA into Yeast by Means of Artificial Chromosome Vectors" (PDF). Science 236 (4803). ... "Methods for High-Content, High-Throughput Image-Based Cell Screening" (PDF). Proceedings of the Workshop on Microscopic Image ...
1999). "Phosphorylation of adducin by Rho-kinase plays a crucial role in cell motility". J. Cell Biol. 145 (2): 347-61. doi: ... 1993). "Cloning and mapping of the alpha-adducin gene close to D4S95 and assessment of its relationship to Huntington disease ... Mangeat PH (1989). "Interaction of biological membranes with the cytoskeletal framework of living cells". Biol. Cell. 64 (3): ... 1994). "Cloning of the alpha-adducin gene from the Huntington's disease candidate region of chromosome 4 by exon amplification ...
January - The first animal from an extinct species to be recreated by cloning, a Pyrenean Ibex, is born alive, but dies seven ... 23 July - Two teams of Chinese researchers create live mice from induced pluripotent stem (iPS) cells. 3 September - Saturn's ... Gray, Richard; Dobson, Roger (January 31, 2009). "Extinct ibex is resurrected by cloning". The Daily Telegraph. Retrieved 2011- ... President of the International Society for Molecular and Cell Biology and Biotechnology Protocols and Researches (ISMCBBPR). ( ...
Esophageal squamous cell cancer. Over-expression. 47%. Immunohistochemistry. [24]. Renal cell carcinoma. Under-expression. 100% ... Shinohara A, Ogawa H, Matsuda Y, Ushio N, Ikeo K, Ogawa T (Jul 1993). "Cloning of human, mouse and fission yeast recombination ... "Association of BRCA1 with Rad51 in mitotic and meiotic cells". Cell. 88 (2): 265-75. doi:10.1016/s0092-8674(00)81847-4. PMID ... Non-small-cell lung cancer. Over-expression. 29%. Immunohistochemistry. [22]. Soft tissue sarcoma. Over-expression. 95%. ...
... and uncapped mRNA were all discovered by studying poliovirus infected cells, and a poliovirus clone was the first infectious ... These acids form a pore in the cell membrane through which RNA is injected [2]. Once inside the cell, the RNA un-coats and the ... The whole of replication occurs within the host cell cytoplasm and infection can even happen in cells that do not contain a ... MP and VPg interact to provide specificity for the transport of viral RNA from cell to cell. To fulfill energy requirements, MP ...
Positional cloning of the mouse obese gene and its human homologue.. Nature (Research Support). 1994-12-01, 372 (6505): 425-32 ... Cell (Review). 2004, 116 (2): 337-50. PMID 14744442. doi:10.1016/S0092-8674(03)01081-X.. ...
"Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure.". Proc. Natl. ... 1997). "CD2 induced apoptosis of peripheral T cells.". Transplant. Proc. 29 (5): 2377-8. PMID 9270771. doi:10.1016/S0041-1345( ... Peterson A, Seed B (1987). "Monoclonal antibody and ligand binding sites of the T cell erythrocyte receptor (CD2).". Nature 329 ... Yang J, Ye Y, Carroll A, Yang W, Lee H (2001). "Structural biology of the cell adhesion protein CD2: alternatively folded ...
Gerald Karp (19 October 2009). Cell and Molecular Biology: Concepts and Experiments. John Wiley and Sons. pp. 14-. ISBN 978-0- ... Carmichael WW, Gorham PR (1978). "Anatoxins from clones of Anabaena flos-aquae isolated from lakes of western Canada". Mitt. ... Toxic effects from anatoxin-a progress very rapidly because it acts directly on the nerve cells (neurons) as a neurotoxin. The ... It acts on the voltage-gated sodium channels of nerve cells, preventing normal cellular function and leading to paralysis. The ...
cell junction. • dendrite. • sarcolemma. • cell projection. • perikaryon. • synapse. • postsynaptic membrane. Biological ... "Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium ... membrane depolarization during atrial cardiac muscle cell action potential. • cardiac muscle cell action potential involved in ... "Cell and Tissue Research. 357 (2): 463-76. doi:10.1007/s00441-014-1936-3. PMID 24996399.. ...
Further information: Cell wall § Archaeal cell walls. Most archaea (but not Thermoplasma and Ferroplasma) possess a cell wall.[ ... molecular biology by allowing the polymerase chain reaction to be used in research as a simple and rapid technique for cloning ... Cell division is controlled in a cell cycle; after the cell's chromosome is replicated and the two daughter chromosomes ... In euryarchaea the cell division protein FtsZ, which forms a contracting ring around the cell, and the components of the septum ...
positive regulation of cell migration. • Оперантное обусловливание. • GO:0042311 вазодилатация. • regulation of dopamine ... Zhou QY, Grandy DK, Thambi L, Kushner JA, Van Tol HH, Cone R, Pribnow D, Salon J, Bunzow JR, Civelli O (1990). "Cloning and ... Dearry A, Gingrich JA, Falardeau P, Fremeau RT Jr, Bates MD, Caron MG (1990). "Molecular cloning and expression of the gene for ...
A new gene located on chromosome 2 was named timeless (tim) and was successfully cloned and sequenced. They found strong ... Cell. 94 (1): 83-95. doi:10.1016/s0092-8674(00)81224-6. PMID 9674430. Retrieved April 8, 2015.. ... which led to his future work in cloning the period gene.[6] ...
Messier TL, Pittman DD, Long GL, et al. (1991). „Cloning and expression in COS-1 cells of a full-length cDNA encoding human ... Jagadeeswaran P, Reddy SV, Rao KJ, et al. (1990). „Cloning and characterization of the 5' end (exon 1) of the gene encoding ... Morgenstern KA, Sprecher C, Holth L, et al. (1994). „Complementary DNA cloning and kinetic characterization of a novel ...
DNA from a rhabdomyosarcoma cell line and a fibrosarcoma cell line transformed a NIH/3T3 mouse fibroblast cell line. After ... GTPase activity of different mutant forms of p21, one cloned from a patient with myeloblastic leukaemia and one derived from in ... cells. Downregulation of RhoA in the HBE cell lines using siRNAs showed a lack of apical junction formation in contrast with ... made seminal contributions to our understanding of cell signalling in animal cells, in particular the role of Rho and Ras small ...
1998). "Molecular cloning and characterization of a human protein kinase that specifically activates c-Jun N-terminal kinase". ... The knockout studies in mice suggested the roles of this kinase in mediating survival signal in T cell development, as well as ... Cell. Biol. UNITED STATES. 20 (7): 2334-42. doi:10.1128/MCB.20.7.2334-2342.2000. ISSN 0270-7306. PMC 85399 . PMID 10713157. Ito ... Cell. Biol. UNITED STATES. 19 (11): 7539-48. doi:10.1128/mcb.19.11.7539. ISSN 0270-7306. PMC 84763 . PMID 10523642. Matsuura, ...
... cells of the Mx9/9 clone donor (PBMjm). Some of these cloned anti-clone cells proliferated after stimulation with irradiated ... Anti-V beta 8 MoAbs activate and induce cell proliferation of this clone. Autologous clones were raised against Mx9/9 cells ... The ability of clone Mx9/9 to proliferate after stimulation with anti-V beta 8 MoAb was inhibited when clone 121 cells were ... Mx9/9 cells, but not after stimulation with other autologous cloned T cells or heterologous PBM, suggesting that these clones ...
Antibodies to CD44 Trigger Effector Functions of Human T Cell Clones. Ricciarda Galandrini, Nicola Albi, Gino Tripodi, Daniela ... Fingerprint Dive into the research topics of Antibodies to CD44 Trigger Effector Functions of Human T Cell Clones. Together ...
... have effectively been able to use somatic cell nuclear transfer to create cloned human embryos and harvest stem cells. ... What are stem cells and why are they important? Stem cells are a type of cell that we all produce. They are nonspecific cells ... the first mammal ever to be cloned. The finding was published in the journal Cell.. Stem cells derived by somatic cell nuclear ... Adult tissue, i.e. adult stem cells.. Dolly the sheep, cloned in 1996, was the first mammal to be cloned using the SCNT ...
Photo credit: Wikipedia) A paper in this weeks Cell describes how a team in Oregon finally achieved what many scientists have ... from the H9 cell line (NIH code: WA09). Viewed at 10X with Carl Zeiss Axiovert scope. ( ... the first cloned sheep. For now, banning human reproductive cloning-not cloning for stem cell research, as many nations have ... A colony of embryonic stem cells, from the H9 cell line (NIH code: WA09). Viewed at 10X with Carl... [+] Zeiss Axiovert scope ...
Human embryonic stem cells created from adult tissue for first time, The Guardian reports, while the Daily Mails front page ... leads with the somewhat fanciful warning that new research raises the spectre of cloned babies… ... When these stem cells were tested, researchers found that the cells were able to develop into other types of cells in a manner ... The embryonic stem cells were able to develop into several different types of cells, including heart cells. They were also ...
The ability to easily reprogram any cell to an embryonic state will inevitably bring out maverick human cloners. We shouldnt ... Stem cell breakthrough could reopen clone wars. The ability to easily reprogram any cell to an embryonic state will inevitably ... stem cells - and are trying to do the same with human cells (see "Stem cell power unleashed after 30 minute dip in acid"). ... Totipotent cells are the most versatile of all stem cells; a single one can develop into an embryo with a placenta, and hence ...
... cloned human embryos capable of producing embryonic stem cells. We had to find the perfect combination, Mitalipov says. As it ... Scientists Clone Human Embryos To Make Stem Cells 92 Posted by samzenpus on Wednesday May 15, 2013 @06:08PM. from the me-an-the ... harvesting stem cells from a clone doesnt result in the destruction of the cell donor, you seem to be ignoring the social, ... Youre wrong! Cloned embryos dont have souls, God only gives souls to embryos that from from an egg and a sperm cell! ...
The new institute, the World Stem Cell Foundation, is being announced tonight in Seoul, according to an article in this weeks ... The Korean researchers who pioneered the cloning of human cells say they will set up a worldwide foundation to help create ... Cloning of diseased cells is now seen as one of the most promising applications of embryonic stem cell research. ... scientists in this country have held back from trying to clone human cells. Dr. Hwang says he will perform the cloning service ...
... primary cell cultures potentially contain more than one type of cell. Interpretation of data arising from studies using these ... Freshney RI (1987). Cloning and selection of specific cell types. In: Culture of Animal Cells: A Manual of Basic Technique, pp ... many scientists have resorted to cloning of cells in order to insure the purity of cell cultures. Three major strategies have ... cloning ring technique, and robotic cell transfer. Successful cloning is dependent on optimization of attachment substrata, ...
... cloning cell phone esn, find name using phone number india, reverse mobile phone number search uk free, reverse phone lookup ... Comments to Cloning cell phone esn. *. sex_simvol - 08.11.2015 at 18:13:43. More SIM, the only thing there are crimes or ... Cloning cell phone esn,reverse phone lookup,reverse phone lookup india - Plans On 2016. admin , Category: 800 Phone Number , ... Reverse phone lookup uk T mobile phone number to pay my bill New mexico court records Louise arnold Free cell phone tracker ...
... can be used to produce a supply of unspecialized stem cells that can be induced to grow into various types of body cells. ... The cloning procedure works by combining a patients body cell with an unfertilized egg cell from a donor. ... In the laboratory, scientists have cloned stem cells from human skin and egg cells. This is significant because the process ... Stem cells are primitive, unspecialized cells. A 5-day-old human embryo, called a blastocyst, contains an inner cell mass ...
But the discovery raises ethical concerns because it brings researchers closer to cloning humans. ... The achievement is a long-sought step toward harnessing the potential power of such cells to treat diseases. ... They even showed that the stem cells could be turned into other types of cells, including heart cells that in a laboratory dish ... Scientists Clone Human Embryos To Make Stem Cells : Shots - Health News The achievement is a long-sought step toward harnessing ...
Cloned tumor-fighting immune cells cured one of 11 patients with metastatic melanoma in a dramatic demonstration of the power ... Melanoma Patient Tumor Free in T-Cell Clone Study. Immune Therapy for Late-Stage Melanoma: No More Cancer in 1 of 11 Patients ... Successful treatment depended on isolating and cloning just the right kind of cancer-fighting immune cell. This happened in ... late-stage melanoma is cancer free 3.5 years after experimental treatment with clones of his own immune cells. ...
Human embryonic stem cells made using adult cells could enable medical advances such as replacement organs. ... Human somatic cell nuclear transfer using adult cells. Cell Stem Cell. Vol. 14, June 5, 2014, p.1. Doi: 10.1016/j.stem.2014.03. ... Human cloning to produce stem cells works even with cells from middle-aged or elderly people, scientists report in the June 5 ... Last year, scientists described a cloning technique for reprogramming human cells to make stem cells. That technique, known as ...
John Gurdon and Shinya Yamanaka have won this years Nobel prize in Physiology or Medicine for showing that cells can be ... Dolly was created by rewinding an udder cell into an embryonic state, then fusing its DNA with an egg cell that had been ... Furthermore, researchers showed last year that mice that received iPS cells displayed an immune response even though the cells ... They rewrote biology textbooks by showing that mature cells could be reprogrammed into embryonic cells that could then turn ...
This brought about pluripotent cells - cells that can transform into any sort of human cell. ... Researchers from South Korea have formulated a system for cloning adult stem cells that doesnt include the obliteration of ... Its a procedure called helpful cloning and it includes the processing of embryonic cells that are hereditarily ... The researchers, whose study now shows up in Cell, concentrated skin cells from two grown-up guys, matured 35 and 75. The DNA ...
Defective cloned embryos could be a source of stem cells, a preliminary study suggests1. Cells from failed cloned frog embryos ... Although stem cells taken from adults look increasingly promising, some believe that stem cells from embryos are still more ... If the same technique works for human cells it could help scientists hoping to use stem cells, which can grow into any tissue ... Frog study suggests scientists should hold onto defective clones.. Xenopus embryos: valuable even when they fail. © Sally Moody ...
... previous cloning efforts had failed to clone animals from the nuclei of any mature "post-mitotic" cells such as neurons - that ... According to Axel, the cloning achievement eliminates one potential mechanism and narrows the possible ways in which a cell ... Cell growth and cell differentiation as well as the release and efficacy of hormones such as insulin depend on the presence of ... These processes might interfere with the cell s ability to become totipotent, a property of certain stem cells that permits ...
In turn, the new stem cell has the potential to transform into any type of cell in the body. ... Scientists report theyve used a cloning technique to reprogram an ordinary human skin cell to become an embryonic stem cell. ... into several different cell types, including nerve cells, liver cells and heart cells," Mitalipov said in the news release. " ... "While the method might be considered a technique for cloning stem cells, commonly called therapeutic cloning, the same method ...
"However, despite cloning success in animals, the derivation of stem cells from cloned human embryos has proven elusive. Only ... the team reports in the journal Cell Stem Cell. Cells from these embryos closely match the men and could, in theory, be used to ... "Therapeutic cloning has long been envisioned as a means for generating patient-specific stem cells that could be used to treat ... NBC News] Researchers say they have made powerful stem cells from both young and old adults using cloning techniques, and also ...
... Mr. D.N.C. Hunter dhunter at hgmp.mrc.ac.uk Tue Sep 9 09:24:57 EST 1997 *Previous ... I dont have much experience in T cell cloning and I am led to believe that it is very time consuming and not always successful ... Ideally I would like to use human T cell clones derived from subjects with rheumatoid arthritis. ... I am presently looking at cytokine mediated differential gene expression in T cells. ...
Comparison of a T Cell Clone and of T Cells from a TCR Transgenic Mouse: TCR Transgenic T Cells Specific for Self-Antigen Are ... We have produced a panel of islet-specific T-cell clones from nonobese diabetic (NOD) mice. These clones proliferate and make ... Pancreatic islet-specific T-cell clones from nonobese diabetic mice. K Haskins, M Portas, B Bergman, K Lafferty, and B Bradley ... Most of the clones respond to islet-cell antigen from different mouse strains but only in the presence of antigen-presenting ...
A breakthrough in stem cell research has been achieved with scientists using cloning techniques to turn human skin cells into ... Stem cell breakthrough A breakthrough in stem cell research has been achieved with scientists using cloning techniques to turn ... into several different cell types, including nerve cells, liver cells and heart cells," says Mitalipov. ... The work, published today in Cell, uses somatic cell nuclear transfer (SCNT) - the process used to clone Dolly the Sheep. ...
Fraudulent cloned cells were likely the first example of a human egg turned directly into stem cells ... Korean Cloned Human Cells Were Product of "Virgin Birth". Fraudulent cloned cells were likely the first example of a human egg ... Korean Cloned Human Cells Were Product of "Virgin Birth"Fraudulent cloned cells were likely the first example of a human egg ... The same goes for cloned cells. But in contrast, pairs of matching chromosomes in parthenogenetic cells tend to match one ...
... Can a cell from an animal(a fish or a mammal) be duplicated?Cloned? How is this ... Subject: Can a specific cell from an animal be cloned? Date: Sun Jan 12 22:58:57 1997. Posted by: Don Deverell. Grade level: ... Re:Can a specific cell from an animal be cloned? Current Queue , Current Queue for Genetics , Genetics archives Try the links ...
Ronald Munson spoke about the future of and advances in cloning, stem cell research, and other human biotechnologies. ... They discussed the company Advanced Cell Technology which had been trying to clone a human embryo. Munson and many scientists ... The promise of stem cells is almost limitless, Munson contended-- such as curing Alzheimers, growing new brain cells for ones ... In other words, cloning human blood, body parts and organs, is the arena researchers should be delving into. ...
"It s important to note," says Blelloch, "that the stem cells from the cloned melanoma were incorporated into most, if not all, ... First, they removed the nucleus from a melanoma cell and injected it into a de-nucleated egg cell (a process known as nuclear ... The team demonstrated this by successfully cloning mice from an advanced melanoma cell. ... Researchers have known for decades that cancer begins when certain key genes in an otherwise healthy cell mutate, and tumor ...
... who were able to produce clones from granulocytes (a type ... Milestone: Fully Differentiated Cells Yield Clones. October 4th ... Yet, even for cloning of an embryo to the blastocyst stage, from which embryonic stem cells can be generated, adult stem cells ... Many have attributed clonings limited success to a theory that clones must be derived from adult stem cells, which reside in a ... 49 percent developed to the blastocyst stage and 18 cloned pups were born…. Since Dolly, animal cloning using adult cells has ...
The news that scientists have successfully cloned a human embryo seems almost certain to rekindle a political fight that has ... Cloning, Stem Cells Long Mired In Legislative Gridlock. Cloning, Stem Cells Long Mired In Legislative Gridlock. Listen · 3:55 3 ... Cloning, Stem Cells Long Mired In Legislative Gridlock : Shots - Health News The news that scientists have successfully cloned ... Cloning, Stem Cells Long Mired In Legislative Gridlock. Listen · 3:55 3:55. ...
Demonstrated in mice but not in humans, it begins with stem cells derived from a cloned embryo. But if cloned embryos cant ... But they dont agree about what that means for stem cells derived from cloned embryos. Therapeutic cloning is a promising ... Scientists agree that cloned animals are biologically flawed. ... Cloned stem cells prove identical to fertilized stem cells ... produce normal organisms, how can they produce normal stem cells? ... Cloned stem cells prove identical to fertilized stem cells. ...
Cloned pigs produced by nuclear transfer from adult somatic cells.. Polejaeva IA1, Chen SH, Vaught TD, Page RL, Mullins J, Ball ... we investigate some of these factors and report the successful production of cloned piglets from a cultured adult somatic cell ... 1), successful development has been obtained in sheep, cattle, mice and goats using a variety of somatic cell types as nuclear ... Since the first report of live mammals produced by nuclear transfer from a cultured differentiated cell population in 1995 (ref ...
... cloning approach with another technology that reprograms blood or skin cells directly into substitutes for embryonic stem cells ... In 2004, a South Korean scientist claimed to have gotten stem cells from cloned human embryos, but that turned out to be a ... Scientists have tried to get stem cells from cloned human embryos for about a decade, but theyve failed. Generally, thats ... Stem cells can turn into any cell of the body, so scientists are interested in using them to create tissue for treating disease ...
  • Mx9/9 is a CD4 clone bearing an antigen receptor recognized by the Mx9 anti-V beta 8 monoclonal antibody (MoAb). (ox.ac.uk)
  • Some of these cloned anti-clone cells proliferated after stimulation with irradiated Mx9/9 cells, but not after stimulation with other autologous cloned T cells or heterologous PBM, suggesting that these clones recognize the T cell receptor (TCR) of the Mx9/9 cells. (ox.ac.uk)
  • The proliferation of the Mx9/9 stimulated cloned anticlone cells was blocked by anti-class II MoAbs, indicating that the autoreactive clones recognize their target antigen in conjunction with HLA Class II products. (ox.ac.uk)
  • Autologous clones were raised against Mx9/9 cells using the peripheral blood mononuclear (PBM) cells of the Mx9/9 clone donor (PBMjm). (ox.ac.uk)
  • Such cells cannot therefore be designated as 'suppressor cells', although they expressed suppressor potential at certain stages. (ox.ac.uk)
  • Anti-V beta 8 MoAbs activate and induce cell proliferation of this clone. (ox.ac.uk)
  • However, clone 121 lost its suppressor function after 4 months in culture and instead gained the ability to enhance the proliferation of Mx9/9 cells in the presence of anti-V beta 8 MoAb. (ox.ac.uk)
  • Through human cloning, American scientists have effectively produced early embryos and used them as a source of stem cells with a procedure similar to the one that produced "Dolly the sheep", the first mammal ever to be cloned. (medicalnewstoday.com)
  • A paper in this week's Cell describes how a team in Oregon finally achieved what many scientists have expected--and many others have dreaded: they derived embryonic stem cells from human embryos that they created in the lab themselves. (forbes.com)
  • Shoukhrat Mitalipov and his team at Oregon Health and Science University were able to generate the embryos through somatic cell nuclear transfer (SCNT), otherwise known as cloning . (forbes.com)
  • Further evidence of their robustness was confirmed when Mitalipov's team was able to differentiate the embryonic stem cells from the cloned embryos into contracting heart cells. (forbes.com)
  • These stem cells do not require the use of human embryos for their derivation, and they can be generated from any cell in the adult body. (forbes.com)
  • If patient-specific stem cells made from SCNT embryos turn out to be healthier and more robust than the 'standard' iPSCs, there could be a significant demand for SCNT-derived stem cells. (forbes.com)
  • When these stem cells were tested, researchers found that the cells were able to develop into other types of cells in a manner similar to that seen in stem cells derived directly from embryos. (www.nhs.uk)
  • Scientists say they have, for the first time, cloned human embryos capable of producing embryonic stem cells . (slashdot.org)
  • I'm sure it isn't done every day of the week due to the ethical concerns, but I couldn't see how cloning embryos would present any difficulty at all. (slashdot.org)
  • There is still an issue with yield - almost all of the embryos cloned will die soon after. (slashdot.org)
  • Scientists report Wednesday that they have successfully cloned human embryos from a person's skin cells. (npr.org)
  • Shoukhrat Mitalipov, of Oregon Health & Science University, first cloned monkey embryos before trying his method on human eggs. (npr.org)
  • Researchers had already shown that they could do this using pluripotent cells from human embryos, called human embryonic stem cells . (newscientist.com)
  • But because human embryos had to be destroyed to obtain the cells, the technique was widely opposed by anti-abortion groups, especially in the US. (newscientist.com)
  • Defective cloned embryos could be a source of stem cells, a preliminary study suggests 1 . (innovations-report.de)
  • Cells from failed cloned frog embryos grafted into normal host embryos grow into muscle, skin and backbone, J. B. Gurdon, of the Wellcome/Cancer Research UK Institute in Cambridge, and colleagues have found. (innovations-report.de)
  • Although stem cells taken from adults look increasingly promising, some believe that stem cells from embryos are still more adaptable. (innovations-report.de)
  • But there are huge ethical, legal and technical obstacles to therapeutic cloning - the creation of early-stage human embryos specifically to collect stem cells. (innovations-report.de)
  • Hundreds of eggs are wasted to produce each embryo, and only a handful of embryos survive to grow beyond a few thousand cells. (innovations-report.de)
  • The frog finding hints that "it should be possible to use human embryos which are destined to die as a source of cells for research in order to make human cells grow and differentiate," Gurdon says. (innovations-report.de)
  • Byrne, A. J., Smonsson, S. S. & Gurdon, J. B. From intestine to muscle: Nuclear reprogramming through defective cloned embryos. (innovations-report.de)
  • Axel emphasized that their experiments had no application to the newly announced achievement by South Korean scientists in cloning human embryos. (innovations-report.com)
  • One key point in the new research: Creation of the new, functioning embryonic stem cell did not involve the use of fertilized embryos, the focus of heated debate over the past decade. (medicinenet.com)
  • They used a bit of skin from each man, took the DNA from the skin cells and inserted it into the egg cell of a female donor, and grew very early embryos called blastocysts, the team reports in the journal Cell Stem Cell. (bioethics.net)
  • Cells from these embryos closely match the men and could, in theory, be used to make near-identical tissue, blood or organ transplants for the men. (bioethics.net)
  • However, despite cloning success in animals, the derivation of stem cells from cloned human embryos has proven elusive. (bioethics.net)
  • Without regulations in place, such embryos could also be used for human reproductive cloning, although this would be unsafe and grossly unethical," Lanza told NBC News. (bioethics.net)
  • We also saw that the embryos that developed the furthest were from the same egg donors, suggesting that genetic variation between egg donors plays an important role in the developmental potential of cloned embryos. (bioethics.net)
  • But he says it is an important step in research because it does not require the use of embryos in creating the type of stem cell capable of transforming into any other type of cell in the body. (abc.net.au)
  • Researchers say they have confirmed suspicions that embryonic stem cells claimed to be extracted from the first cloned human embryo by discredited South Korean scientist Woo Suk Hwang actually owe their existence to parthenogenesis, a process in which egg cells give rise to embryos without being fertilized by sperm. (scientificamerican.com)
  • But they don't agree about what that means for stem cells derived from cloned embryos, the basis for therapeutic cloning. (eurekalert.org)
  • But if cloned embryos can't produce normal organisms, how can they produce normal stem cells? (eurekalert.org)
  • Scientists have finally recovered stem cells from cloned human embryos, a longstanding goal that could lead to new treatments for such illnesses as Parkinson's disease and diabetes. (seattletimes.com)
  • That idea was met with some ethical objections because harvesting the stem cells involved destroying human embryos. (seattletimes.com)
  • Scientists have tried to get stem cells from cloned human embryos for about a decade, but they've failed. (seattletimes.com)
  • Generally, that's because the embryos stopped developing before producing the cells. (seattletimes.com)
  • In 2004, a South Korean scientist claimed to have gotten stem cells from cloned human embryos, but that turned out to be a fraud. (seattletimes.com)
  • In Wednesday's edition of the journal Cell, however, scientists in Oregon report harvesting stem cells from six embryos created from donated eggs. (seattletimes.com)
  • Two embryos had been given DNA from skin cells of a child with a genetic disorder, and the others had DNA from fetal skin cells. (seattletimes.com)
  • Mitalipov also said that based on monkey work, he believes human embryos made with the technique could not develop into cloned babies, and he has no interest in trying to do that. (seattletimes.com)
  • Marcy Darnovsky, executive director of the Center for Genetics and Society in Berkeley, Calif., said she was glad that Mitalipov doubted the embryos could be used to clone babies. (seattletimes.com)
  • It's relatively easy to clone embryos from the adult stem cells of simpler animals like sheep, but humans have proved challenging. (engadget.com)
  • Researchers in Oregon claimed they have succeeded in producing cloned human embryos and obtained their embryonic stem cells. (lifenews.com)
  • The Oregon Health & Science University scientists published today a paper in the online journal Cell reporting on the use of cloning techniques to produce human embryos, 21 of whom they were able to sustain to the point in development at which stem cells were present, after which the human embryos were killed and the stem cells harvested. (lifenews.com)
  • These researchers created many human embryos, male and female, and allowed them to grow for up to seven days, for the sole purpose of killing them and harvesting their stem cells," said NRLC Legislative Director Douglas Johnson. (lifenews.com)
  • We will certainly continue to oppose attempts in Congress to provide federal funds to create human embryos for the purpose of harvesting their cells - which is a step towards human embryo farms. (lifenews.com)
  • He said this way of making embryos will also be taken up by people who want to produce cloned children as "copies" of other people. (lifenews.com)
  • Therapeutic cloning involves the replication of human embryos to harvest stem cells for medical uses. (thenakedscientists.com)
  • In 2001, Great Britain became the first country in the world to legalize the creation of human embryos -- not to create living human clones, but to create embryos whose stem cells can be taken for experimental use. (thenakedscientists.com)
  • Scientists have had some success treating Parkinson's in animals using stem cells from aborted animal fetuses, Lindvall says, but those stem cells aren't as effective as the ones harvested from very early embryos of just a few days old. (thenakedscientists.com)
  • The researchers showed that the resulting embryos could develop to a stage where they could produce healthy stem cells containing the genes from the skin cells. (kuer.org)
  • The researchers got a surprising result: About 35 percent of the fully mature cells produced embryos, whereas only 11 percent of the intermediate and 8 percent of the stem cells did. (thefreelibrary.com)
  • In that procedure, researchers make cloned embryos and then harvest stem cells from them for growing specific tissues. (thefreelibrary.com)
  • VATICAN CITY, April 23, 2013 ( LifeSiteNews.com ) - One of the top researchers in the field of stem cells has said that iPS (induced pluripotent) stem cells, the "embryo-like" cells hailed by many as the answer to the ethical problems presented by embryonic stem cells, are "probably" actually already embryos and have already, with the right conditions and treatment in the lab, developed into "complete animals" in experiments. (lifesitenews.com)
  • The revelation that some iPS cells are indistinguishable from single-cell embryos is likely to dismantle arguments supporting the cells as "ethical. (lifesitenews.com)
  • At the time of their discovery in 2007, iPS cells were hailed by both the research community and many in the pro-life world as a solution to the problem of obtaining pluripotent cells - those capable of producing all the tissue types of the body - without destroying human embryos. (lifesitenews.com)
  • Since their discovery, however, some ethicists have warned of various problems with iPS cells, including the fact that cells derived from embryos have been used in the process of creating the iPS cells. (lifesitenews.com)
  • Some also warned that iPS cells could give rise to complete organisms and are, in fact, indistinguishable from embryonic cells that can be induced to begin replication as whole embryos. (lifesitenews.com)
  • According to his own papers, Yamanaka said that some of the cells obtained through his process are "pluripotent," while some are "totipotent," which means they can spontaneously become embryos and start to develop into a mature organism. (lifesitenews.com)
  • So according to that assay some of the iPS cells are already embryos. (lifesitenews.com)
  • All of the cloned embryos showed severe placental hypertrophy and defective differentiation of placental tissues. (bioone.org)
  • The news that South Korean researchers have become the first to produce human embryos and stem cells through cloning has revived a complex debate about whether such research should be permitted in the United States. (nytimes.com)
  • In reproductive cloning, which has been performed with animals but not people, the embryos are implanted in the womb and develop into a fetus. (nytimes.com)
  • In therapeutic cloning, the embryos are never implanted, but are grown for a few days in the laboratory so that the stem cells can be extracted. (nytimes.com)
  • We know that the recipe for creating cloned embryos could in theory be used by somebody for reproductive purposes,'' Dr. Silver said. (nytimes.com)
  • Therapeutic cloning with adult stem cells nevertheless creates and destroys embryos. (genethique.org)
  • In this particular study, "77 embryos had to be created and destroyed to obtain 2 cell lines" . (genethique.org)
  • The researchers, at Oregon Health and Science University, took skin cells from a baby with a genetic disease and fused them with donated human eggs to create human embryos that were genetically identical to the 8-month-old. (nytimes.com)
  • They then extracted stem cells from those embryos. (nytimes.com)
  • Nonetheless, the fact that the scientists were able to get cloned human embryos to survive long enough for stem cell extraction is likely to be seen as a step on the way to human reproductive cloning. (nytimes.com)
  • Human embryonic cells are now mainly derived from embryos created by fertilization in fertility clinics. (nytimes.com)
  • Still, the demand for therapeutic cloning may be less now than it was a decade ago because scientists can now use adult skin cells to create a stem cell very similar to embryonic cells, but without the need for embryos. (nytimes.com)
  • The induced cells also sidestep the ethical issues of embryonic stem cells, which are often created by destroying embryos. (nytimes.com)
  • The monkeys were created using different donor blastocysts (early-stage embryos), so they were not clones of one another-each monkey was a clone of the original blastocyst that had developed from a fertilized egg. (libraryindex.com)
  • Even though therapeutic cloning entails gathering stem cells from an embryo only a few days old, that practice has been banned in many places too, as it seems either difficult to distinguish from reproductive cloning and/or raises ethical questions itself, given the use of embryos. (giantfreakinrobot.com)
  • One of the scientists behind the recent advancement is from a Massachusetts company called Advanced Cell Technology, which is the organization that started the 2001 stem cell firestorm when it became the first to clone embryos for research purposes. (giantfreakinrobot.com)
  • Previous reports have described the generation of bovine ES-like cells ( 4 ) and mouse ES cells from the ICMs of cloned blastocysts ( 5 - 7 ) and the development of cloned human embryos to the 8- to 10-cell stage ( 8 , 9 ). (sciencemag.org)
  • In preimplantation embryos, Nanog is restricted to founder cells from which ES cells can be derived. (nih.gov)
  • Surprisingly, the researchers found that not only could clones be created from fully differentiated cells, but that the differentiated cells were actually the easiest to clone-about 35 percent of the fully differentiated cells developed into early stage embryos known as blastocysts, while only four percent of stem cells did. (seedmagazine.com)
  • Clones made from the two types of stem cells never developed into full embryos. (seedmagazine.com)
  • The researchers found that following SCNT, injection of H3K9me3 demethylase Kdm4d mRNA and treatment with histone deacetylase inhibitor trichostatin A at one-cell stage correlated with improvement in blastocyst development and the rate of pregnancy of transplanted SCNT embryos in surrogate monkeys. (doctorslounge.com)
  • Also, murine embryos of Ryukyu mouse (Mus caroli) will survive to term inside the uterus of a house mouse (Mus musculus) only if enveloped in Mus musculus trophoblast cells. (wikipedia.org)
  • The experiment supports the argument that although cloning leads to mostly defective animals it could be used for therapeutic cloning," agrees Rudolf Jaenisch, who works on cloning at the Massachusetts Institute of Technology in Cambridge. (innovations-report.de)
  • While the method might be considered a technique for cloning stem cells, commonly called therapeutic cloning, the same method would not likely be successful in producing human clones otherwise known as reproductive cloning," OHSU said in a university press release. (medicinenet.com)
  • Therapeutic cloning has long been envisioned as a means for generating patient-specific stem cells that could be used to treat a range of age-related diseases," said Dr. Robert Lanza, chief scientific officer for Advanced Cell Technology. (bioethics.net)
  • The paper is of academic interest but unlikely to have any bearing on the therapeutic use of stem cells," he says. (abc.net.au)
  • While some reports hailed the work as a first step in cloning humans, the researchers were quick to dampen such suggestions, saying their focus was on "therapeutic' uses. (abc.net.au)
  • He believes that we should be funding cloning projects but only for therapeutic reasons, not reproductive. (coasttocoastam.com)
  • Also known as somatic cell nuclear transfer, therapeutic cloning is a promising approach to create individually customized cellular therapies for treating certain disorders. (eurekalert.org)
  • But transplants run the risk of rejection, so more than a decade ago, researchers proposed a way around that: Create tissue from stem cells that bear the patient's own DNA, obtained with a process called therapeutic cloning. (seattletimes.com)
  • But therapeutic cloning has different implications. (newstimes.com)
  • That's why therapeutic cloning is so important," Yang said. (newstimes.com)
  • This therapeutic cloning. (newstimes.com)
  • There is an important report out in New Scientist about therapeutic cloning and the relative vigor of different stem cell types. (futurepundit.com)
  • Six states also ban therapeutic cloning. (chron.com)
  • Many scientists who urge a ban on reproductive cloning urge that the ban not be extended to therapeutic cloning and the harvesting of stem cells to cure disease. (thenakedscientists.com)
  • I am convinced that therapeutic cloning offers health opportunities that you could not attain in any other way," says Ian Wilmut, adding that it shouldn't be banned along with reproductive cloning (NewScientist.com, November 7, 2003). (thenakedscientists.com)
  • Responding to fears that if therapeutic cloning is allowed, some renegade researcher may decide to implant a cloned embryo, rather than destroy it, Wilmut says, "We can't stop this valuable research from going forward for fear of a few bad apples out there. (thenakedscientists.com)
  • Therapeutic cloning, or somatic-cell nuclear transfer (SCNT), begins with the same process used to create Dolly, the famous cloned sheep, in 1996. (omicsonline.org)
  • Yang and his colleagues report in Nature Genetics, as published online Oct. 1, that the finding could eventually streamline therapeutic cloning. (thefreelibrary.com)
  • Animals can also be cloned to produce proteins for human therapeutic use such as human antibodies, allowing for large-scale production of human vaccines. (bio.org)
  • A challenging point in this piece is the bit about therapeutic cloning. (lehigh.edu)
  • They split on therapeutic or research cloning for stem cells. (nytimes.com)
  • Ethicists note that some Christian churches and most Jewish groups back therapeutic cloning. (nytimes.com)
  • PNCI Global News_Dec 22, 2015] US: Bill Authorizing Adult Stem Cell Treatments The US Congress has passed the Stem Cell Therapeutic and Research Reauthorization Act (HR 2820), reauthorizing programs that utilize adult stem cells and cord blood stem cells to treat a range of diseases in adults and children. (physiciansforlife.org)
  • These results have generated enthusiastic comments and have rekindled the debate on therapeutic cloning. (genethique.org)
  • Therapeutic cloning known as somatic cell nucleus transfer (SCNT), involves producing embryo stem cells that are genetically identical to the donor in an attempt to treat a disease. (genethique.org)
  • Therapeutic cloning using adult stem cells to obtain embryo stem cells involves creating an embryo by cloning. (genethique.org)
  • The United States prohibits the use of federal funds for therapeutic and reproductive cloning. (genethique.org)
  • Cardinal Sean O'Malley of Boston said human cloning was immoral, even if used for therapeutic purposes, because it "treats human being as products, manufactured to order to suit other people's wishes. (nytimes.com)
  • The Oregon researchers, who published a paper on their work in the journal Cell, say their goal is what has been called therapeutic cloning: making embryonic stem cells that are genetically identical to a particular patient. (nytimes.com)
  • A drawback of therapeutic cloning is that there might never be enough human eggs available to treat all patients, should the therapy ever work. (nytimes.com)
  • In leukemia stem cells, however, overexpression of ADAR1 enhances the missplicing of RNA, which leads to greater self-renewal and therapeutic resistance of malignant stem cells. (labspaces.net)
  • This concept, known as "therapeutic cloning," refers to the transfer of the nucleus of a somatic cell into an enucleated donor oocyte ( 3 ). (sciencemag.org)
  • Such cloning allows the production of genetically uniform monkeys as animal models for basic research in primate biology and for studying human disease mechanisms and therapeutic treatments. (doctorslounge.com)
  • IT DIDN'T take long after Dolly the sheep was cloned in 1996 for maverick scientists to start talking about cloning humans. (newscientist.com)
  • This is the first time that scientists have been able to use SCNT to create human embryonic stem cells (hESCs). (medicalnewstoday.com)
  • On the other hand, if the work of scientists like Sheng Ding is any indication, we may soon see better cell reprogramming via small molecules, and not retroviruses. (forbes.com)
  • I have this vision of the scientists keeping the cell cultures separate by placing them into separate waffle holes. (slashdot.org)
  • Because of political and ethical debates that have left the future of stem cell research uncertain in the United States, scientists in this country have held back from trying to clone human cells. (nytimes.com)
  • While a number of procedures have been used to enrich the cell population of interest, many scientists have resorted to cloning of cells in order to insure the purity of cell cultures. (springer.com)
  • In the laboratory, scientists have cloned stem cells from human skin and egg cells. (livescience.com)
  • The scientists also used cloning techniques, which raise concerns that the research could lead to the cloning of people. (npr.org)
  • Ever since human embryonic stem cells were discovered, scientists have had high hopes for them because the cells can morph into any kind of cell in the body. (npr.org)
  • So for years, scientists have been trying to use cloning techniques to make embryonic stem cells that are essentially a genetic match for patients. (npr.org)
  • If the same technique works for human cells it could help scientists hoping to use stem cells, which can grow into any tissue type, to treat diseases such as Alzheimer s, Parkinson s and heart disease. (innovations-report.de)
  • The scientists credit the idea for the experiments to Woody Allen whose classic comedy Sleeper depicted scientists who try to clone a dead dictator from his nose. (innovations-report.com)
  • A central question, said the scientists, was whether mature cells had undergone certain irreversible genetic processes, such as gene rearrangements, that would prevent them from reprogramming their nuclei to allow totipotent development. (innovations-report.com)
  • WEDNESDAY, May 15 (HealthDay News) -- Scientists report they've used a cloning technique to reprogram an ordinary human skin cell to become an embryonic stem cell. (medicinenet.com)
  • Besides marking a breakthrough in stem cell technology, which has the potential to one day cure a myriad of illnesses, the achievement has some concerned that scientists are moving a step closer to human cloning. (medicinenet.com)
  • When human embryonic stem cells were first discovered in 1998, scientists immediately dreamed of using cloning technology to help people grow their own organ and tissue transplants, and to use them to study disease. (bioethics.net)
  • Stem cell breakthrough A breakthrough in stem cell research has been achieved with scientists using cloning techniques to turn human skin cells into embryonic stem cells. (abc.net.au)
  • While scientists have previously been able to make embryonic stem cells using this approach in monkeys and mice, until now they have not been able to this with human cells. (abc.net.au)
  • Munson and many scientists doubt they will be able to do it, but he absolutely thinks that eventually human cloning will happen. (coasttocoastam.com)
  • But only recently have scientists begun to understand the "epigenetic" components of cancer-that is, how other molecules in a cell affect genes without actually altering the sequence of DNA. (innovations-report.com)
  • The news that scientists have successfully cloned a human embryo seems almost certain to rekindle a political fight that has raged, on and off, since the creation of Dolly the sheep. (npr.org)
  • Scientists generally agree that all cloned animals are biologically flawed. (eurekalert.org)
  • Analyzing the complete gene-expression profiles of both cloned and fertilization-derived stem cells in mice, scientists at Whitehead Institute for Biomedical Research now have concluded that the two are, in fact, indistinguishable. (eurekalert.org)
  • This is one reason why scientists generally believe that attempting to clone a human being is morally reprehensible. (eurekalert.org)
  • Although these animals generated entirely from cloned stem cells appear to be fine, many scientists don't accept this result as definitive. (eurekalert.org)
  • Stem cells can turn into any cell of the body, so scientists are interested in using them to create tissue for treating disease. (seattletimes.com)
  • Scientists have cloned more than a dozen kinds of mammals, starting with Dolly the sheep. (seattletimes.com)
  • Now, Daley said, scientists must compare the embryo-cloning approach with another technology that reprograms blood or skin cells directly into substitutes for embryonic stem cells. (seattletimes.com)
  • Daley said he believed scientists will prefer using the reprogramming approach unless it can be proven "beyond a shadow of a doubt" that embryo cloning produces better cells for treating patients. (seattletimes.com)
  • The process just took a gigantic step forward, though, as scientists have finally used an adult human's stem cells to clone a pre-embryonic blastocyst . (engadget.com)
  • It is the first time scientists have been able to grow stable stem cell lines from a large mammal. (newstimes.com)
  • In recent years, scientists have become excited by the potential of these cells. (newstimes.com)
  • Scientists as well as regular civilians know that stem cell research is extremely sketchy. (brightkite.com)
  • Many scientists are trying to coax adult stem cells into becoming various differentiated cell types and some successes are even being reported . (futurepundit.com)
  • As scientists find ways to coax adult stem cells into becoming various assorted differentiated cell types will they find that the adult stem cells will be too old and tired to become enough of each needed cell type to be useful? (futurepundit.com)
  • Scientists at the Oregon Health & Science University announced they have produced embryonic stem cells from an embryo they made by cloning a human . (chron.com)
  • The Johns Hopkins Berman Institute of Bioethics in the United States helped set up the Hinxton Group , a collaboration of British and American scientists determining the ethical and moral structures of stem cell research. (hubpages.com)
  • The mainstream media - under the influence of spin from "the scientists" - has been playing a game of hide-the-ball about the recent first human cloning success. (cbc-network.org)
  • Instead of implanting the resulting embryo into a female host, as would be done in reproductive cloning, scientists destroy the embryo so that researchers can extract the stem cells. (thenakedscientists.com)
  • Scientists say the use of stem cells to grow new cells has the potential to treat or cure dozens of degenerative diseases, from heart disease to Parkinson's to kidney failure. (thenakedscientists.com)
  • Jerry was one of the greatest scientists and cloning pioneers of our time," Dr. Robert Lanza, chief science officer at Advanced Cell Technology of Worcester, a biotech company which has pursued creating stem cells through cloning, told The Hartford Courant. (fisheaters.com)
  • That approach raises the possibility that scientists could try to clone a human being. (kuer.org)
  • in fact, using such cells for this purpose may be more efficient than using stem cells, scientists report. (thefreelibrary.com)
  • Since Dolly the cloned sheep was born in 1996, some scientists have speculated that the donor cells used to create her and other cloned animals were rare adult stem cells--immature cells that have the potential to create a multitude of other cell types. (thefreelibrary.com)
  • Many, if not most, scientists support cloning to make embryonic stem cells. (nytimes.com)
  • At the same time, scientists are nearly unanimous in denouncing so-called reproductive cloning, to create babies. (nytimes.com)
  • Last week, in the Stem Cell journal, a team of American scientists (California) published the results of their research enabling them to clone adult human stem cells to create embryo stem cells. (genethique.org)
  • Scientists have finally succeeded in using cloning to create human embryonic stem cells, a step toward developing replacement tissue to treat diseases but one that might also hasten the day when it will be possible to create cloned babies. (nytimes.com)
  • Scientists have been trying for more than 10 years to create human embryonic stem cells using the cloning method. (nytimes.com)
  • Eighteen years ago, scientists in Scotland took the nuclear DNA from the cell of an adult sheep and put it into another sheep's egg cell that had been emptied of its own nucleus. (wunc.org)
  • So ideally scientists would like to be able to extract DNA from the cells of older people - not just cells from infants - to create therapies for adult diseases. (wunc.org)
  • In the 18 years since researchers cloned a sheep, scientists have found another way to produce cloned human cell lines. (wunc.org)
  • In principle, scientists could produce a series of cell lines that would allow a close match for the majority of would-be cell recipients - just as transplant surgeons currently seek a close match for organ donors. (wunc.org)
  • In SCNT scientists transfer genetic material from the nucleus of a donor adult cell to an enucleated egg (an egg from which the nucleus has been removed). (libraryindex.com)
  • In 1952 scientists transferred a cell from a frog embryo into an unfertilized egg, which then developed into a tadpole. (libraryindex.com)
  • Ever since, scientists have been cloning animals. (libraryindex.com)
  • We're not quite on the path to an Orphan Black scenario just yet, but scientists just got one step closer - they have cloned adult human skin cells. (giantfreakinrobot.com)
  • This time, scientists took skin cells from adult humans, ages 35 and 75, and created an exact genetic match. (giantfreakinrobot.com)
  • The process was performed on infant cells last year , but it was important for scientists to be able to replicate that technique with adult cells, especially if they want to use this breakthrough to treat diseases that strike only or mostly adults, such as Alzheimer's or heart disease. (giantfreakinrobot.com)
  • The technique, which was described in the journal Cell Stem Cell, started with a healthy, unfertilized human egg into which scientists implanted DNA from the donors' skin cells and removed the original DNA . (giantfreakinrobot.com)
  • The somatic cell nuclear transfer technique used in this case was researched and performed in California, but was funded in part by the Ministry of Science of South Korea, a country whose scientists have worked on human embryo cloning for quite some time. (giantfreakinrobot.com)
  • Scientists create a way to isolate mRNA from a single living cell within a tissue. (the-scientist.com)
  • Now, with reports arriving almost daily about proposals to clone humans, and with similar reports surfacing with disturbing frequency about scientists' planned use of human-derived stem cells, I believe that an in-depth analysis of these two subjects is both timely and warranted. (apologeticspress.org)
  • The news was that a mammal had been cloned from an adult cell-something that even scientists like James Watson and Francis Crick (who were awarded the 1962 Nobel Prize in Physiology or Medicine for their elucidation of the molecular structure of DNA) had gone on record as stating was very likely impossible. (apologeticspress.org)
  • Shortly after the details of the procedure used to produce Dolly were published, scientists began to report one success story after another using the same procedure (or ones similar to it) to clone additional mammals from adult cells, including mice (Wakayama, et al. (apologeticspress.org)
  • Then surely the next question becomes obvious: If scientists have successfully cloned sheep, mice, cattle, goats, monkeys, and pigs (all of which are mammals), can they then clone humans-who likewise are mammals? (apologeticspress.org)
  • You will hear from Museum scientists, medical researchers at the frontiers of the field, and a panel of bioethics experts who will address the ethical implications of stem cell research and therapy. (coursera.org)
  • This week, New York University's Dr. Esteban Mazzoni will discuss how scientists can coax stem cells to differentiate into particular cell types. (coursera.org)
  • In 1996, Scottish scientists made Dolly, the famous cloned sheep, by removing the nucleus from an adult sheep's udder cell and placing it into an unfertilized egg. (seedmagazine.com)
  • But scientists don't know much about what kind of udder cell helped to create Dolly. (seedmagazine.com)
  • Most scientists assumed that the udder cell that led to Dolly-as well as the cells used to clone over a dozen mammalian species since-were these rare adult stem cells. (seedmagazine.com)
  • Many scientists believe that the further a cell is from the embryonic stem cell stage, the harder it is to make a successful clone using that cell's genetic material. (mit.edu)
  • But a team of researchers led by Rudolf Jaenisch and Andrew Chess, scientists at Whitehead and professors in the Department of Biology, and by Richard Axel of Columbia University showed that even a cell as highly specialized as an olfactory neuron can produce successful clones. (mit.edu)
  • a single one can develop into an embryo with a placenta, and hence give rise to a fully formed animal - in other words, a clone. (newscientist.com)
  • These are then fused with human cells - in this case skin cells - and the fused cell begins behaving in a similar way to an embryo by producing human stem cells. (www.nhs.uk)
  • The Slashdot headline neglected to mention that they synthesised an embryo from adult human skin cells - so it's 100% genetically compatible with the donor. (slashdot.org)
  • I was wondering how cloning an embryo would be news. (slashdot.org)
  • Actually the nice thing about this is that if you had some genetic disease(like cystic fibrosis) you could take the genetic material out of one of your skin cells, correct it, and then use that with this process to make an embryo. (slashdot.org)
  • A 5-day-old human embryo, called a blastocyst, contains an inner cell mass composed of about 12 embryonic stem cells. (livescience.com)
  • Then in 2006, Yamanaka showed that by inserting just four "rejuvenation" genes into skin cells, he could rewind their genetic code, turning them back into embryo-like cells that he called induced pluripotent stem (iPS) cells . (newscientist.com)
  • Both breakthroughs destroyed the long-held dogma that once cells had matured into specific tissue types, such as skin, brain or muscle, they could never regress back to the state from which they originated in an embryo. (newscientist.com)
  • And using the cloning technique is controversial, because it involves creating, then destroying, a human embryo. (bioethics.net)
  • They discussed the company Advanced Cell Technology which had been trying to clone a human embryo. (coasttocoastam.com)
  • Yet, even for cloning of an embryo to the blastocyst stage, from which embryonic stem cells can be generated, adult stem cells have yielded disappointing results, with success rates in the range of 1 to 5 percent. (medgadget.com)
  • Somatic cell nuclear transfer (SCNT), the scientific term for cloning, involves creating an embryo by using a nucleus that's been removed from a somatic cell - any cell other than a reproductive cell - and transferring it into an unfertilized egg that has had its chromosomes removed. (medgadget.com)
  • Because the resulting new embryo contains the entire genome of the donor somatic cell it is an identical copy. (medgadget.com)
  • Surprisingly, the granulocytes were the most efficient donor cells for nuclear transfer among the different lineage cells, with 35 to 39 percent becoming a blastocyst, an early embryo consisting of about 100 to 150 cells, compared to 11 percent for the progenitor cells and only 4 percent for the stem cells. (medgadget.com)
  • Demonstrated in mice but not in humans, it begins with stem cells derived from a cloned embryo. (eurekalert.org)
  • This paper demonstrates clearly that it doesn't matter if a stem cell has been derived from a cloned embryo or from a fertilized embryo," says Whitehead Member Rudolf Jaenisch, senior author on the paper that will appear in the online the week of January 16 in the Proceedings of the National Academy of Sciences. (eurekalert.org)
  • The egg develops into a blastocyst, an early stage embryo consisting of no more than 100 or so cells. (eurekalert.org)
  • If DNA from a patient is put into a human egg, which is then grown into an early embryo, the stem cells from that embryo would provide a virtual genetic match. (seattletimes.com)
  • The Rev. Tad Pacholczyk, director of education for National Catholic Bioethics Center, an independent think tank in Philadelphia, reiterated his opposition to embryo cloning, calling the approach unethical. (seattletimes.com)
  • After the stimulation of the cell starts, the clone embryo is placed in a uterus. (brightkite.com)
  • To make the stem cells, they had to let the embryo reach the balstocyst stage before destroying it to extract the stem cells and grow them in the lab. (chron.com)
  • Cloning, by the way, is the act of creating an embryo through asexual means such as somatic cell nuclear transfer (which I explain in the article). (cbc-network.org)
  • He told me that his is one of the very few efforts in the world that has successfully cloned a human embryo. (thenakedscientists.com)
  • But Yang died before achieving one of his dreams: the cloning of a human embryo for potentially lifesaving stem cells. (fisheaters.com)
  • Asked what the difference is between an iPS cell that has been reverted back to its pluripotent state and an embryo in its earliest, single-cell stage, Gurdon replied, "Probably none. (lifesitenews.com)
  • Irving described the process of "regulation," a natural part of the embryo's genetic systems, which automatically reacts to changes in an embryonic cell to correct genetic damage and reassert the direction of development to produce a whole embryo with the normal complement of 46 chromosomes. (lifesitenews.com)
  • This process can also revert the DNA in a separated totipotent cell to what it needs to function as an embryo rather than just a "cell. (lifesitenews.com)
  • It may not be well known or understood in the public," Irving said, "but in the scientific research community, it is well known that sometimes a pluripotent iPS cell could, through this process of regulation, spontaneously revert to being totipotent, which can then become an embryo. (lifesitenews.com)
  • Some of these were allowed to develop to the blastocyst stage, while others were enucleated and the nucleus was transferred to an enucleated fertilized 1-cell embryo. (bioone.org)
  • For the first time, adult stem cells have been cloned to obtain embryo stem cells. (genethique.org)
  • In 2013, the Oregon team succeeded in creating embryo stem cells from skin cells using DNA taken from an 18-month old infant. (genethique.org)
  • The 77 oocytes generated 2 lines of embryo stem cells. (genethique.org)
  • The embryo-creation technique is essentially the same as that used to create Dolly the sheep and the many cloned animals that have followed. (nytimes.com)
  • This mouse egg (top) is being injected with genetic material from an adult cell to ultimately create an embryo - and, eventually, embryonic stem cells. (wunc.org)
  • They look like the cells in a human embryo - in fact, they're called embryonic stem cells. (wunc.org)
  • Once the cloned embryo reaches a suitable stage, it is transferred to the uterus of a surrogate (female host), where it continues to grow and develop until birth. (libraryindex.com)
  • The experimental research combined two types of stem cells and created a viable embryo - which the team say would provide an unlimited stock for medical research. (express.co.uk)
  • ES cells would be isolated from the inner cell mass (ICM) of the cloned preimplantation embryo. (sciencemag.org)
  • And these little balls are nothing but an embryo that is a two-cell stage. (coursera.org)
  • This process reprogrammed the DNA of the udder cell, turning the egg into an embryo, rather than another udder cell. (seedmagazine.com)
  • Dolly the sheep, cloned in 1996, was the first mammal to be cloned using the SCNT technique. (medicalnewstoday.com)
  • Everyone remembers Dolly, no-one really notices the hundreds of other sheep clones that didn't survive. (slashdot.org)
  • This was the prelude to the creation of Dolly the sheep , the first mammal produced from a single mature cell. (newscientist.com)
  • Dolly was created by rewinding an udder cell into an embryonic state, then fusing its DNA with an egg cell that had been stripped of its nucleus. (newscientist.com)
  • While Dolly the Sheep was cloned in 1996, and other species have been cloned since, researchers have been unable to clone a primate such as a monkey, chimpanzee or human. (medicinenet.com)
  • The work, published today in Cell , uses somatic cell nuclear transfer (SCNT) - the process used to clone Dolly the Sheep. (abc.net.au)
  • Moreover, they say results of their studies provide compelling evidence that Dolly the sheep and other mammals cloned by somatic cell nuclear transfer were most likely derived from fully differentiated cells, not adult stem cells, as most have argued in the nine years since Dolly was first created. (medgadget.com)
  • Since Dolly, animal cloning using adult cells has been accomplished in more than a dozen mammalian species, but the process is highly inefficient. (medgadget.com)
  • With such odds, it's hard to believe that Dolly and other cloned animals could have possibly been derived from adult stem cells. (medgadget.com)
  • INCOSC comprises the Roslin Institute (University of Edinburgh, Scotland) which originally cloned Dolly, the sheep, the Chinese Academy of Sciences, Peking University, Sichuan University, the Scottish Centre for Regenerative Medicine, and two anonymous contributors. (hubpages.com)
  • Wilmut is the scientist who cloned Dolly, the sheep, in 1996 and is now a leading commentator on the subject of cloning. (thenakedscientists.com)
  • The world's first cloned animal was Dolly the sheep, created in 1996 in Scotland. (fisheaters.com)
  • Moreover, Mitalipov used the same method that researchers used previously to clone Dolly the sheep . (kuer.org)
  • Dolly, the first mammal to be genetically cloned from adult cells, poses for the camera in 1997 at the Roslin Institute in Edinburgh, Scotland. (wunc.org)
  • The resulting egg was implanted in the womb of a third sheep, and the result was Dolly, the first clone of a mammal. (wunc.org)
  • In 1997 cloning became headline news when, following more than 250 failed attempts, Ian Wilmut (1944-) and his colleagues at the Roslin Institute in Edinburgh, Scotland, successfully cloned a sheep, which they named Dolly. (libraryindex.com)
  • Dolly was the first mammal cloned from the cell of an adult animal, and since then researchers have used cells from adult animals and various modifications of nuclear transfer technology to clone a range of animals including sheep, goats, cows, mice, pigs, cats, rabbits, and the gaur named Noah. (libraryindex.com)
  • To create Dolly, the Roslin Institute researchers transplanted a nucleus from a mammary gland cell of a Finn Dorsett sheep into the enucleated egg of a Scottish blackface ewe and used electricity to stimulate cell division. (libraryindex.com)
  • Born several months later, Dolly was a true clone-genetically identical to the Finn Dorsett mammary cells and not to the blackface ewe, which served as her surrogate mother. (libraryindex.com)
  • In fact, when Dolly was cloned, the event touched off widespread fears that the technology would soon be used to create cloned humans. (libraryindex.com)
  • An important distinction between the process that created Dolly and the one that produced the monkeys was that unspecialized embryonic cells were used to create the monkeys, whereas a specialized adult cell was used to create Dolly. (libraryindex.com)
  • The process was a lot like the one used to create Dolly the sheep back in 1997, when they inserted into a female sheep an egg that had been implanted with cells that had two copies of the same DNA. (giantfreakinrobot.com)
  • Cloning continues to fascinate the science world, particularly after Dolly the Sheep made headlines across the globe in 1996. (express.co.uk)
  • It turns out that the successful cloning of Dolly was only the tip of the proverbial iceberg. (apologeticspress.org)
  • While employing "stressed" body cells (e.g., mammary gland cells from an adult, such as those used to clone Dolly the sheep) has no ethical overtones (when used in non-human cloning procedures), the use of certain human stem cells does. (apologeticspress.org)
  • As for the mystery surrounding Dolly, Ian Wilmut, the embryologist who supervised the sheep cloning project, said the new findings don't indicate whether the original udder cell was a stem cell or an already differentiated cell. (seedmagazine.com)
  • The researchers do not use the word "totipotent" and have no stated intention of cloning a human. (newscientist.com)
  • However, because iPS can sometimes cause unexpected mutations in the cells, researchers have been seeking alternative methods. (medicalnewstoday.com)
  • It should be noted that no babies were born as a result of this research, and the researchers had no intention of producing a live cloned human being. (www.nhs.uk)
  • Researchers have been looking into ways of using a patient's own cells to create embryonic stem cells, as this would ensure that the genetic material in any cells used therapeutically would match the patient's DNA. (www.nhs.uk)
  • The researchers report that previous attempts to produce embryonic stem cells using this technique have failed, as the cells stopped dividing before they reached an advanced enough stage. (www.nhs.uk)
  • During their experiments, researchers identified two reasons for this inability to sufficiently grow the cells and developed techniques to overcome these limiting factors. (www.nhs.uk)
  • This study will no doubt be very exciting for researchers working with stem cells, but we're still a long way from the findings of this study being translated into new treatments for conditions such as Parkinson's disease or heart disease . (www.nhs.uk)
  • The researchers used a technique called somatic cell nuclear transfer (SCNT) to transfer genetic material from adult human skin cells into a human egg cell in order to produce embryonic stem cells. (www.nhs.uk)
  • Researchers then optimised methods to prompt the egg cell to start and continue to divide using electricity and chemical compounds, including caffeine. (www.nhs.uk)
  • The Korean researchers who pioneered the cloning of human cells say they will set up a worldwide foundation to help create embryonic stem cells for medical research. (nytimes.com)
  • Stem cells' value to researchers is that they can be induced into becoming specific tissue or organ cells. (livescience.com)
  • But the discovery raises ethical concerns because it brings researchers closer to cloning humans. (npr.org)
  • Furthermore, researchers showed last year that mice that received iPS cells displayed an immune response even though the cells were made from their own tissue. (newscientist.com)
  • Researchers from South Korea have formulated a system for cloning adult stem cells that doesn't include the obliteration of human developing lives. (topnews.us)
  • The researchers, whose study now shows up in Cell, concentrated skin cells from two grown-up guys, matured 35 and 75. (topnews.us)
  • A year ago, researchers basically did the same thing, however the cells were determined from human fetal and baby DNA (which have a tendency to be more flexible). (topnews.us)
  • Researchers have successfully cloned a mouse using mature olfactory neurons as the genetic donor. (innovations-report.com)
  • According to the researchers, previous cloning efforts had failed to clone animals from the nuclei of any mature "post-mitotic" cells such as neurons - that is, those that had ceased dividing to produce new cells. (innovations-report.com)
  • The researchers chose olfactory neurons as the source of genetic material because previous research had suggested that these cells might undergo gene rearrangements during development. (innovations-report.com)
  • Using standard cloning techniques, the researchers in Jaenisch s laboratory then isolated individual neurons, removed nuclei from the tagged cells and introduced the nuclei into mouse eggs from which the nuclei had been removed. (innovations-report.com)
  • The new research was published online May 15 in the journal Cell , and was led by Shoukhrat Mitalipov, a senior scientist at the Oregon National Primate Research Center, in partnership with researchers at Oregon Health & Science University (OHSU). (medicinenet.com)
  • The researchers downplayed the notion that this research might somehow lead to human cloning. (medicinenet.com)
  • NBC News ] Researchers say they have made powerful stem cells from both young and old adults using cloning techniques, and also found clues about why it is so difficult to do this with human beings. (bioethics.net)
  • In other words, cloning human blood, body parts and organs, is the arena researchers should be delving into. (coasttocoastam.com)
  • Researchers have known for decades that cancer begins when certain key genes in an otherwise healthy cell mutate, and tumor growth depends on continuing, multiple mutations. (innovations-report.com)
  • This is the first demonstration that an animal can be derived directly from a fully differentiated cell, report lead researchers Xiangzhong (Jerry) Yang, Ph.D., of the University of Connecticut, and Tao Cheng, M.D., of the University of Pittsburgh, in the journal Nature Genetics. (medgadget.com)
  • In their studies, the researchers compared the efficiency for cloning mice using a fully differentiated blood cell called a granulocyte with its ancestor cells at different stages: hematopoietic stem cells, which are found in bone marrow and give rise to all red and white blood cells, and progenitor cells. (medgadget.com)
  • President Bush put that policy into force but severely limited the cell lines available to researchers. (npr.org)
  • Researchers have tried to test the integrity of these surviving stem cells by transplanting them into fertilized blastocysts and then observing the overall health of the resulting animal. (eurekalert.org)
  • Researchers and ethicists in the United States say they see no reason to fear the move would encourage the use of the technology to make cloned babies - something that most of the international biomedical community has agreed not to pursue. (abovetopsecret.com)
  • Cloning has been successfully demonstrated under GSM , but the process is not easy and currently remains in the realm of serious hobbyists and researchers. (tech-faq.com)
  • The process was mostly similar to that for other species: researchers removed the DNA from the nucleus of an unfertilized egg and inserted a skin cell into that egg. (engadget.com)
  • There is hope that if researchers learn how to manipulate them, stem cells can be used to heal damaged organs and to cure chronic neurological diseases like Parkinson 's disease. (newstimes.com)
  • It could mean that researchers could take a few skin cells from a human and create a line of embryonic stem cells that carry that person's DNA. (newstimes.com)
  • What the UConn team has not been able to do at this point is to use enzymes to break up the bovine stem cells colonies into new colonies - something researchers have done with monkey and mouse stem cell colonies. (newstimes.com)
  • As proof, researchers report they created two mouse pups from a type of blood cell that itself is incapable of dividing to produce a second generation of its own kind. (eurekalert.org)
  • Stem cell research is really picking up these days, as it gives researchers a chance to develop totally new cells out of limited resources. (topnews.ae)
  • This embryonic cell development is the result of an effort in which researchers from three different organizations, the New York Stem Cell Foundation, the University of California at San Diego, and Columbia University in the US took part. (topnews.ae)
  • Then researchers put that material in the donated egg cell. (topnews.ae)
  • Researchers at Oregon Health and Science University have successfully used cloning to create human embryonic stem cells by taking skin cells and fusing them with donated human eggs. (nytimes.com)
  • The researchers must still show they can produce stem cells starting with skin cells from adults. (nytimes.com)
  • An international team, headed by researchers at the University of California, San Diego School of Medicine, has identified a key enzyme in the reprogramming process that promotes malignant stem cell cloning and the growth of chronic myeloid leukemia (CML), a cancer of the blood and marrow that experts say is increasing in prevalence. (labspaces.net)
  • The researchers believe the wonder creation could see mice being cloned in three years time, and humans two decades later. (express.co.uk)
  • Only top-performing clones are released for use by researchers. (sigmaaldrich.com)
  • Researchers discover a tool to trigger an uncommon strategy cancer cells can use to lengthen their telomeres. (the-scientist.com)
  • Researchers show that cancer stem cells can exist in two distinct and interconvertible states. (the-scientist.com)
  • In late 1999, the IVF procedure was carried out, and in early October of 2000, as Time reported, researchers working at the Fairview University Hospital in Minneapolis, Minnesota, successfully transferred the stem cells from the newborn's (his name is Adam) umbilical cord to Molly. (apologeticspress.org)
  • Stem cells might not be the easiest way to clone animals: That's what researchers at the University of Connecticut are saying after they recently cloned mice from fully differentiated blood cells. (seedmagazine.com)
  • Now, researchers at MIT and the Whitehead Institute for Biomedical Research have cloned mice using olfactory neurons--cells far removed from the embryonic state. (mit.edu)
  • For the study, published Feb. 15 in the online edition of the journal Nature, researchers successfully cloned mice from nuclei taken from olfactory cells, something that until now was thought impossible. (mit.edu)
  • Many researchers have long assumed that nervous system cells distinguish themselves from each other the same way immune system cells do--that is, by removing all pieces of genetic information that the cell doesn't need for its particular function. (mit.edu)
  • Adult tissue , i.e. adult stem cells. (medicalnewstoday.com)
  • In addition, generating iPSCs from adult skin cells, for example, can take between four and six months on average. (forbes.com)
  • This was a laboratory study that aimed to produce embryonic stem cells from adult skin cells. (www.nhs.uk)
  • Adult human bodies contain relatively few stem cells, mostly concentrated in the bone marrow. (livescience.com)
  • It s important to note," says Blelloch, "that the stem cells from the cloned melanoma were incorporated into most, if not all, tissues of adult mice, showing that they can develop into normal, healthy cells," such as those for skin pigmentation, immunity, and connective tissue. (innovations-report.com)
  • Many have attributed cloning's limited success to a theory that clones must be derived from adult stem cells, which reside in a specific area of each tissue and remain quiescent until they are activated by the presence of disease or tissue injury. (medgadget.com)
  • Yet, if this were true, Drs. Yang and Cheng point out, the results of their studies would have found the adult stem cells to be more efficient than the other, more differentiated cells. (medgadget.com)
  • Cloned pigs produced by nuclear transfer from adult somatic cells. (nih.gov)
  • Here we investigate some of these factors and report the successful production of cloned piglets from a cultured adult somatic cell population using a new nuclear transfer procedure. (nih.gov)
  • The cloned cells seemed to have an amazing ability to take over from adult ones, replacing up to 50 per cent of the cows' blood stem cells after just one infusion, even in the cow whose immune system was untouched. (futurepundit.com)
  • Then they injected those blood stem cells back into the adult cows that had been cloned. (futurepundit.com)
  • While this article doesn't convey the details of these experiments with sufficient clarity the article does seem to be claiming that the cloned stem cells were in some sense younger than the more adult stem cells. (futurepundit.com)
  • However, the cells in the adult stem cell reservoirs in the body age along the rest of the body. (futurepundit.com)
  • Yet the adult stem cells of old people are also going to be old and therefore less vigorous than those of younger adults. (futurepundit.com)
  • Youthful adult stem cells are not just useful for treating illnesses. (futurepundit.com)
  • If the adult stem cell reservoirs could be replenished with youthful cells then we could become at least partially youthful again. (futurepundit.com)
  • Just as embryonic stem cells (whether created by classical fertilization or by cloning) can be converted into fully differentiated cells it ought to be possible to find ways to coax them into becoming each of the specialized adult stem cell types. (futurepundit.com)
  • This is desireable because adult stem cells are creating differentiated cells throughout our bodies every day. (futurepundit.com)
  • However, coaxing embryonic stem cells to become adult stem cell types may not turn out to be any easier than coaxing a given adult stem cell type into becoming other different adult stem cell types. (futurepundit.com)
  • We need to understand in far more detail what makes each adult stem cell type be that type and not some other adult stem cell type or the embryonic stem cell type. (futurepundit.com)
  • But to stop differentiation at an intermediate step (ie at the adult stem cell step) is harder. (futurepundit.com)
  • As I was heading into Parliament House this morning, I heard some coverage on ABC radio mentioning a briefing that was being held today with a leading researcher into adult stem cells. (andrewbartlett.com)
  • PITTSBURGH, Oct. 1 - New research dismisses the notion that adult stem cells are necessary for successful animal cloning, proving instead that cells that have completely evolved to a specific type not only can be used for cloning purposes, but they may be a better and more efficient starting point. (eurekalert.org)
  • Our results clearly demonstrate that there is no apparent advantage in using either adult stem cells or progenitor cells over fully differentiated cells as nuclear donors. (eurekalert.org)
  • To the contrary, we found that cloned pups can be produced from adult, fully differentiated somatic cells, a conclusion that goes against popular opinion and current hypotheses," says Dr. Yang, animal science professor, director of the University of Connecticut's Center for Regenerative Biology and co-corresponding author of the study. (eurekalert.org)
  • In a surprise statement in his keynote address at the conference co-sponsored by the Vatican, Dr. John Gurdon, a pioneer in nuclear transfer cloning techniques, said that with iPS cells created from adult skin cells, "You can actually get a totally normal, reproducing, adult animal from a skin cell without the use of an egg. (lifesitenews.com)
  • Passage ensures the adult stem cell programs will be funded through 2020, and the C.W. Bill Young Cell Transplantation Program and National Cord Blood Inventory will be funded for another five years. (physiciansforlife.org)
  • It remains one of the best kept secrets in America that umbilical cord blood stem cells and adult stem cells in general are curing people of a myriad of terrible conditions and diseases in adults as well as children. (physiciansforlife.org)
  • So-called adult stem cells, taken from blood, fat or other parts of the body, are another possible option. (nytimes.com)
  • It also means that finally getting the sheep technology to work with cells from adult humans may not turn out to be a turning point for this technology, after all. (wunc.org)
  • The February 27, 1997 issue of Nature reported it in a mundanely titled article, "Viable Offspring Derived from Fetal and Adult Mammalian Cells. (apologeticspress.org)
  • An adult mammal had been cloned! (apologeticspress.org)
  • Like most tissues, sheep udder tissue contains a huge number of mature, differentiated cells, along with a handful of adult stem cells. (seedmagazine.com)
  • Yang's research will change the direction of future cloning work, Scadden said, and presents an appealing alternative to using adult stem cells, which are rare and poorly understood. (seedmagazine.com)
  • Twenty-two pregnancies were confirmed in 42 surrogates for SCNT using adult monkey cumulus cells, yielding two babies that were short-lived. (doctorslounge.com)
  • The patient's skin cell is inserted into the outer membrane of the egg cell and chemically induced to begin developing into a blastocyst. (livescience.com)
  • In the blastocyst, embryonic cells divide, producing a mass of stem cells. (livescience.com)
  • After the egg cell developed into a blastocyst, Hochedlinger and Blelloch harvested embryonic stem cells which they then incorporated into a group of healthy mouse blastocysts. (innovations-report.com)
  • Of the 1,828 nuclear transfers we performed with stem cells, very few could develop to the blastocyst stage and not one clone was produced. (medgadget.com)
  • The scientist can then either remove the stem cells from this blastocyst, or place it into a uterus where it has the potential to develop into a fetus. (eurekalert.org)
  • But this entire process is almost never perfect, and nearly all cells in a cloned blastocyst retain some memory of their original source. (eurekalert.org)
  • Studies have demonstrated that a small number of stem cells in the blastocyst appear to be spared this faulty reprogramming. (eurekalert.org)
  • When stem cells from a cloned blastocyst are removed and placed into a dish, most die. (eurekalert.org)
  • The egg 'reprograms' the DNA in the donor cell to an embryonic state and divides until it has reached the early, blastocyst stage. (omicsonline.org)
  • In this study, we report the derivation of a pluripotent embryonic stem (ES) cell line (SCNT-hES-1) from a cloned human blastocyst. (sciencemag.org)
  • Such envelopment can be created by first isolating the inner cell mass of blastocysts of the species to be reproduced by immunosurgery, wherein the blastocyst is exposed to antibodies toward that species. (wikipedia.org)
  • Stem cells derived by somatic cell nuclear transfer (SCNT) have the potential to transform into any cell type, such as bone or brain tissue cells. (medicalnewstoday.com)
  • 2007). Therefore, human oocytes were maintained in 1.25 mM caffeine during spindle removal and somatic cell fusion. (forbes.com)
  • As expected, they wrote, somatic cell nuclei introduced into cytoplasts under these conditions developed into normal blastocysts. (forbes.com)
  • These headlines are based on newly published research into the use of a technique known as somatic cell nuclear transfer (SCNT) as part of embryonic stem cell research. (www.nhs.uk)
  • Somatic Cell Nuclear transfer. (slashdot.org)
  • This joint Nobel Prize traces and celebrates the wonderful scientific journey from John Gurdon's pioneering early work to the sensational discovery of somatic cell reprogramming by Shinya Yamanaka," said Anthony Hollander , head of cellular and molecular medicine at the University of Bristol, UK. (newscientist.com)
  • The research involved a version of what's known as somatic cell nuclear transfer, where the cell's nucleus -- which contains all a person's genetic information -- is transferred into an egg cell that has had all of its DNA removed. (medicinenet.com)
  • The new finding brings a measure of closure to a story that first rocked the science world in February 2004, when Hwang and colleagues at Seoul National University announced they had cloned a female donor's cell by transferring its nucleus into one of her egg cells stripped of its nucleus in a procedure known as somatic cell nuclear transfer (SCNT), and harvested embryonic stem cells from the resulting fusion. (scientificamerican.com)
  • Great news from investigators at the University of Connecticut and the University of Pittsburgh, who were able to produce clones from granulocytes (a type of blood cell that does not itself divide) and to show that differentiated cells are more efficient than stem cells for somatic cell nuclear transfer. (medgadget.com)
  • Since the first report of live mammals produced by nuclear transfer from a cultured differentiated cell population in 1995 (ref. 1), successful development has been obtained in sheep, cattle, mice and goats using a variety of somatic cell types as nuclear donors. (nih.gov)
  • This type of cloning uses a process called somatic cell transfer. (brightkite.com)
  • Most clones are created through a process called "somatic cell nuclear transfer. (thenakedscientists.com)
  • In his lecture, Gurdon said, "You know from nuclear transfer that you can take the body [somatic] cell and it will be completely perfect. (lifesitenews.com)
  • The reproductive cloning technology used to create animals is called somatic cell nuclear transfer (SCNT). (libraryindex.com)
  • Somatic cell nuclear transfer (SCNT) technology has recently been used to generate animals with a common genetic composition. (sciencemag.org)
  • The isolation of pluripotent human embryonic stem (ES) cells ( 1 ) and breakthroughs in somatic cell nuclear transfer (SCNT) in mammals ( 2 ) have raised the possibility of performing human SCNT to generate potentially unlimited sources of undifferentiated cells for use in research, with potential applications in tissue repair and transplantation medicine. (sciencemag.org)
  • In theory, the oocyte's cytoplasm would reprogram the transferred nucleus by silencing all the somatic cell genes and activating the embryonic ones. (sciencemag.org)
  • Somatic cell therapy refers to efforts to correct the functioning of a defective gene in an individual's body cells or to replace it and thus cure the disease that it causes. (apologeticspress.org)
  • Cloning cynomolgus monkeys ( Macaca fascicularis ) is feasible by somatic cell nuclear transfer using fetal fibroblasts, according to a study published online Jan. 24 in Cell . (doctorslounge.com)
  • SCNT involves removing the nucleus of a donor cell and transferring it to an egg cell that has had its nucleus removed. (medicalnewstoday.com)
  • And Dieter Egli, a regenerative medicine specialist at the New York Stem Cell Foundation, successfully produced human SCNT lines, but only when the egg's nucleus was left in the cell. (forbes.com)
  • SCNT involved taking the nucleus (the part of a cell containing most of the genetic information) from a person's skin cells, inserting its cells into a donor's unfertilised egg cell that had its nucleus removed. (www.nhs.uk)
  • The skin cell nucleus was then fused with the donor egg cell. (www.nhs.uk)
  • In 1962, Gurdon showed that frog eggs grew into healthy tadpoles even though he had removed the original nucleus and replaced it with the nucleus from a gut cell taken from a mature frog. (newscientist.com)
  • Once the new nucleus is in place, the unfertilized egg cell proceeds to develop and produce stem cells, according to an OHSU news release. (medicinenet.com)
  • First, they removed the nucleus from a melanoma cell and injected it into a de-nucleated egg cell (a process known as nuclear transfer). (innovations-report.com)
  • To create a clone, a scientist removes the nucleus from a donor cell, then places it into an egg from which the nucleus has been removed. (eurekalert.org)
  • The original donated nucleus may have come from, say, a skin cell. (eurekalert.org)
  • Cell transferring is the process of taking genetic material out of the nucleus of a donor's cell to an egg cell. (brightkite.com)
  • Essentially, a scientist uses a tiny needle to pull DNA material from the nucleus of a donor cell and transfer it into a hollow egg. (thenakedscientists.com)
  • The method involves transplanting the nucleus of the cell, which contains an individual's DNA, to an egg cell that has had its genetic material removed. (salem-news.com)
  • A donor cell from a body tissue such as skin is fused with an unfertilized egg from which the nucleus has been removed. (omicsonline.org)
  • a cell other than the egg or sperm) of an existing or previously existing person and inserting it into an oocyte (the egg) from which the nucleus has been removed. (bio.org)
  • Genetic analysis in both cases confirmed that the nuclear DNA of the offspring originated from the nucleus donor cell, and mitochondria DNA of the offspring originated from the oocyte donor monkey. (doctorslounge.com)
  • And in this week's issue of the journal Cell , Mitalipov's team reports they finally did it in humans. (npr.org)
  • Wardemann H, Nussenzweig MC (2007) B-cell self-tolerance in humans. (springer.com)
  • The breakthrough doesn't quite live up to the sci-fi vision of cloning humans outright, however. (engadget.com)
  • These cells thus might prove important now, as humans begin to understand how stem cells work and how they might be used to cure injury and disease. (newstimes.com)
  • if they tried to clone humans they would end up creating hundreds of mutated "Human beings" for every attempt to make once single person. (brightkite.com)
  • Who is Cloning Humans? (hubpages.com)
  • Depending on who you talk to, cloning of humans is now more an ethical than technical dilemma. (hubpages.com)
  • The procedure, developed by Shoukhrat Mitalipov, Ph.D. at OHSU's Oregon National Primate Research Center, accelerated efforts to generate stem cell therapies for humans. (salem-news.com)
  • A scientific group, the International Society for Stem Cell Research of Northbrook, Ill., called yesterday for ''a complete ban on using stem cell technology to clone humans,'' but strongly supported cloning experiments to derive stem cells. (nytimes.com)
  • The images are of a newborn mouse cloned from an olfactory sensory neuron that had been marked with a genetic change so that it would be green under fluorescent light. (innovations-report.com)
  • If the central nervous system acted in the same way, a mouse cloned from an olfactory cell should have a very limited sense of smell. (mit.edu)
  • Cloning of diseased cells is now seen as one of the most promising applications of embryonic stem cell research. (nytimes.com)
  • After President Obama overturned Bush-era policy restricting federal funding of embryonic stem cell research in 2009, Nebraska Right to Life led a protest of the research outside the University of Nebraska regents' meeting. (npr.org)
  • But both the issues of cloning - for research and reproduction - and embryonic stem cell research have been mired in the abortion controversy from the start. (npr.org)
  • Meanwhile, over the years Congress debated several bills to expand federal funding of embryonic stem cell research, under specific ethical guidelines, as well as legislation to ban cloning intended to make a baby. (npr.org)
  • Their work prompted restrictions on embryonic stem cell research, which were retracted eight years later under the Obama administration. (giantfreakinrobot.com)
  • SCNT involves taking donated egg cells from women and removing their genetic material. (www.nhs.uk)
  • The resulting stem cells could then possibly be used to repair damaged tissue, or even treat genetic conditions. (www.nhs.uk)
  • Next, they removed most of the DNA from each egg and replaced the genetic material with DNA from other peoples' skin cells. (npr.org)
  • Because the cloned animals are normal, our experiment also shows that [some] brain functions do not involve genetic alterations of the neuron s genome," said Jaenisch. (innovations-report.com)
  • This entry was posted in Health Care and tagged Beginning of Life Matters and Reproductive Technologies , biotechnology , Genetic Testing and Privacy Issues , genomics , Stem Cells and Cloning , syndicated , World News - Home , World News - News . (bioethics.net)
  • This process involves placing the genetic material from a body cell, such as a skin cell, and transferring it into an unfertilised donor egg that has had its genetic material removed. (abc.net.au)
  • He says since the reprogrammed cells use genetic material from the patient, there is no concern about transplant rejection. (abc.net.au)
  • We may now be able to take a person's skin cells, use them to make embryonic stem cells, repair genetic problems, and then turn the embryonic stem cells into new nerve cells, for example, that repair the person's brain. (abc.net.au)
  • A series of genetic markers sprinkled throughout the cells' chromosomes show the same pattern found in parthenogenetic mice as opposed to cloned mice, according to a report published online today in the journal Cell Stem Cell . (scientificamerican.com)
  • A cloned cell should be identical to its donor, but the probe found that of 48 common genetic variations, or markers, present in the 2004 cells, eight did not match their apparent donor. (scientificamerican.com)
  • To settle the case, they analyzed the genetic sequence of the cell line at 500,000 locations across the genome. (scientificamerican.com)
  • But in contrast, pairs of matching chromosomes in parthenogenetic cells tend to match one another in the middle and differ near the ends because of a genetic mixing process called recombination. (scientificamerican.com)
  • There are already 60 countries in the world that have laws on their books banning human reproductive cloning, and this prohibition is also in a number of international agreements" says Marcy Darnovsky, executive director of the Center for Genetics and Society , which is devoted to the responsible use of new genetic and reproductive technologies. (npr.org)
  • Unlike the organ transplants of today, there would be no worries about rejection - the cells and organs would carry the patients' genetic code. (newstimes.com)
  • They would need some genetic marker that would let them tell the cloned cells apart from the native cells of the cow. (futurepundit.com)
  • It simply means creating genetic copies of individual cells. (bio.org)
  • Because of this role, it was hoped that DP cells grown in the laboratory (i.e., grown in culture) could form the basis of a treatment for genetic hair loss. (bernsteinmedical.com)
  • The research that got funded by the University of California, the New York Stem Cell Foundation and by the Russell Berrie Foundation used a mature cell, from which they took out genetic material. (topnews.ae)
  • It was noticed that the egg would only survive if its genetic material remains intact, and if it remains then it would lead to multiplication of cells, which would have three copies of each chromosome, which is not found in human cells. (topnews.ae)
  • But it has to be kept in mind that these cells are not normal, irrespective of the fact that it has been taken from human genetic material. (topnews.ae)
  • They repeated the process - this time starting with the genetic material extracted from the skin cells of a much older man. (wunc.org)
  • Scottish embryologist Ian Wilmut and his colleagues had taken a mammary gland cell from a six-year-old Scottish Finn Dorset ewe and, via a process known as "nuclear transfer," succeeded in placing the genetic material from that cell into a hollowed-out egg cell from a Scottish Blackface sheep. (apologeticspress.org)
  • The genetic material from these cells will be removed and replaced with genetic material from another cell. (sciencephoto.com)
  • This study demonstrated that cloning of non-human primates is feasible by SCNT using fetal somatic cells, which could be efficiently modified by genetic editing and screening in vitro," the authors write. (doctorslounge.com)
  • These findings shift the spotlight away from the type of cell used to produce a clone to the more fundamental question of how the egg cell reactivates the donated genetic material," Jaenisch said. (mit.edu)
  • The cells scramble this unnecessary genetic information in such a way that it can't be restored. (mit.edu)
  • However, there remain ethical concerns over the implications of using SCNT to develop stem cells. (www.nhs.uk)
  • SCNT has been used to clone animals before, and is thought to have potential applications in the study and treatment of human diseases. (www.nhs.uk)
  • Importantly he says more research needs to be done to determine the long-term stability and safety of these SCNT embryonic stem cell lines. (abc.net.au)
  • Organisms or animals generated using SCNT are not perfect or identical clones of the donor organism or "parent" animal. (libraryindex.com)
  • The SCNT-hES-1 cells displayed typical ES cell morphology and cell surface markers and were capable of differentiating into embryoid bodies in vitro and of forming teratomas in vivo containing cell derivatives from all three embryonic germ layers in severe combined immunodeficient mice. (sciencemag.org)
  • After continuous proliferation for more than 70 passages, SCNT-hES-1 cells maintained normal karyotypes and were genetically identical to the somatic nuclear donor cells. (sciencemag.org)
  • Although we cannot completely exclude the possibility that the cells had a parthenogenetic origin, imprinting analyses support a SCNT origin of the derived human ES cells. (sciencemag.org)
  • Zhen Liu, from the Chinese Academy of Sciences Institute of Neuroscience in Shanghai, and colleagues examined the feasibility of cloning cynomolgus monkeys by SCNT to generate genetically uniform non-human primates for establishing animal models for research. (doctorslounge.com)
  • Dr. Hwang says he will perform the cloning service for any scientist who wishes to establish a research culture of cells from patients suffering from particular diseases. (nytimes.com)
  • This is a huge scientific advance," said Dr. George Daley , a Harvard stem cell scientist who wasn't involved in the work. (npr.org)
  • There was once a team of scientist in Korea that has created dozens of human embryonic stem cell. (brightkite.com)
  • Now New Scientist has uncovered a patent application that claims cloned stem cells have a big advantage over other stem cells. (futurepundit.com)
  • HARTFORD, Conn. (AP) - Xiangzhong "Jerry" Yang, a stem cell scientist who successfully cloned the first farm animal in the United States, has died after a long battle with cancer. (fisheaters.com)
  • In 2012 Dr. Gurdon and Japanese scientist Shinya Yamanaka were jointly awarded the Nobel Prize in medicine for their work surrounding the development of iPS cells. (lifesitenews.com)
  • That's an exciting prospect, but as so often with stem cells, ethical concerns are lurking. (newscientist.com)
  • Is human cloning ethical? (medicalnewstoday.com)
  • Cloning and Stem Cells ' presented the ethical issues around cloning champion racehorses and the future of stem-cell therapies. (bionews.org.uk)
  • Dolly's birth set off a huge outpouring of ethical concern - along with hope that the same techniques, applied to human cells, could be used to treat myriad diseases. (wunc.org)
  • The cloning procedure works by combining a patient's body cell with an unfertilized egg cell from a donor. (livescience.com)
  • Possibly they used mitochondrial DNA for that purpose by using a different cow as the egg donor for the cloning. (futurepundit.com)
  • The reconstructed egg containing the DNA from a donor cell is treated with chemicals or electric current in order to stimulate cell division. (libraryindex.com)
  • As for the possibility of human reproductive cloning? (forbes.com)
  • While nuclear transfer breakthroughs often lead to a public discussion about the ethics of human cloning, this is not our focus, nor do we believe our findings might be used by others to advance the possibility of human reproductive cloning. (medicinenet.com)
  • This particular procedure is a technological process that involves "copying" a human's nuclear DNA, this type of cloning is known as reproductive cloning. (brightkite.com)
  • 1004 words - 5 pages The matter of human reproductive cloning is a complex topic, in which there are many issues that must be addressed before any actions take place. (brightkite.com)
  • Any decision based on reproductive cloning will not be clear-cut, and instead will host a multitude of ideas. (brightkite.com)
  • In this paper, I will determine, through philosophical thinking, if human reproductive cloning is morally appropriate. (brightkite.com)
  • Reproductive cloning hasn't been advanced by this new paper," Rudolf Jaenisch of the Massachusetts Institute of Technology told Reuters . (chron.com)
  • California banned reproductive cloning in 1997. (chron.com)
  • BIO has opposed human reproductive cloning - using cloning technology to create a human being. (bio.org)
  • We're all against reproductive cloning, but what if science could clone a defective kidney? (lehigh.edu)
  • Religious groups also oppose reproductive cloning. (nytimes.com)
  • Reproductive cloning would be unethical, the president of the group, Dr. Leonard I. Zon, a professor of pediatrics at Harvard, said, because too many cloned animals have been unhealthy with problems like arthritis and obesity. (nytimes.com)
  • A rival bill to ban just reproductive cloning was also introduced. (nytimes.com)
  • Organismal or reproductive cloning is a technology used to produce a genetically identical organism-an animal that has the same nuclear DNA as an existing, or even an extinct, animal. (libraryindex.com)
  • Satellite cells isolated from sheep skeletal muscle are not homogeneous. (springer.com)
  • It seems it is much harder to clone a human being than it is to clone a sheep, a frog or a mouse. (bioethics.net)
  • That zygote-which then contained the full complement of 54 chromosomes (as if it had been fertilized by a sperm cell)-was placed into the uterus of a second Scottish Blackface sheep that served as a surrogate mother. (apologeticspress.org)
  • Goat fetuses have likewise been successfully grown in sheep wombs by enveloping the goat inner cell mass in sheep trophoblast. (wikipedia.org)
  • A 1997 CNN/USA Today/Gallup Poll found that 87% of Americans polled believed human cloning would be a bad development for humanity, and 88% believed it would be morally wrong. (libraryindex.com)
  • In February 1997 Don Wolf (1939-) and his colleagues at the Oregon Regional Primate Center in Beaverton successfully cloned two rhesus monkeys using laboratory techniques that had previously produced frogs, cows, and mice. (libraryindex.com)
  • For example, in May and June 1997, I authored a series on "Cloning-Scientific and Biblical Ramifications. (apologeticspress.org)
  • The blastocysts were missing a few cell types needed to produce a child, and the blastocysts created so far won't implant in a womb. (engadget.com)
  • These cells are genetically identical to the patient's own cells (that is, they are cloned). (livescience.com)
  • That's because the new stem cell is genetically identical to cells from the person from whom it was derived. (medicinenet.com)
  • The point is we have a new way to ensure new cells being generated for treatment would be genetically identical to the person being treated, since they originated from that person in the first place. (abc.net.au)
  • The cells can then be turned into any different kind of cell, and used to produce new tissues that would be genetically identical to the person whose genome was inserted into the egg. (chron.com)
  • CEO, Xu Xiaochun, educated at Canadian and American universities, plans to produce cloned beef using genetically identical super-cattle to cater to the hugely successful Chinese middle class who enjoy the taste of Kobe beef. (hubpages.com)
  • Our intent is to use this technology to generate stem cells to treat serious and life-threatening diseases, not to create a child," says Robert Lanza of Advanced Cell Technology (ACT) in an article in "Scientific American" (January 2002). (thenakedscientists.com)
  • The work is being carried out at the Bio Sidus biotechnology company, in Argentina, which successfully cloned a cow in 2002. (sciencephoto.com)
  • In the past, creating identical cells in this manner has been a major challenge. (medicalnewstoday.com)
  • With cloning, all meat will be identical. (hubpages.com)
  • Phillip had Melvin cloned about two years ago, and he now has two identical dogs - Ken Gordon, named after his uncle, and Henry Fontenot, named after his friend - with the same traits and characteristics as Melvin. (hubpages.com)
  • Under new regulations, these clones must be destroyed after 14 days, and it is illegal to create live babies by cloning. (thenakedscientists.com)
  • Mitapilov and his team took donated egg cells and swapped their nuclei for the nuclei of cells from fetal tissue. (forbes.com)
  • Tissue Cell 20: 899-908. (springer.com)
  • Skin cells, for example, could be taken from a patient, rewound to an embryonic state, then turned into whatever tissue was needed. (newscientist.com)
  • That suggests there is something in these cells that makes them different from native tissue, and therefore potentially harmful. (newscientist.com)
  • Stem cells can differentiate into cells for all of the tissue types that the body needs, such as nerves, muscle and bone. (medicinenet.com)
  • Much more likely is that these animals were derived from fully differentiated tissue cells," Dr. Yang argues. (medgadget.com)
  • For a viable fetus to develop, the egg needs to reprogram the genome of the skin cell, shutting off genes specific for skin tissue and turning on genes needed for embryonic development, genes that are normally dormant in tissue-specific cells. (eurekalert.org)
  • In other words, the egg needs to erase all tissue-specific memories from the skin cell and revert it into a genomic blank slate. (eurekalert.org)
  • Dr. George Daley, a stem cell expert at Children's Hospital Boston who didn't participate in the work, called the new results "one landmark step in a very long journey" toward creating DNA-matched transplant tissue. (seattletimes.com)
  • He noted his technique, unlike the cell-reprogramming approach, would supply tissue with new mitochondrial genes that could replace defective ones. (seattletimes.com)
  • From there, the team only needed growth chemicals to develop the stem cells into specific cell types, such as heart tissue. (engadget.com)
  • These cells have the ability to grow into all the different types of tissue and organs in the body: skin, hair, bones, brain tissue, internal organs. (newstimes.com)
  • they have the potential to form any cell or tissue in the human body. (thenakedscientists.com)
  • Think of an embryonic stem cell as a kind of master cell, an early-stage cell that retains the ability to form almost any kind of cell or tissue type in the human body. (thenakedscientists.com)
  • Thus far, these human replacement cells appear to function normally in vitro, raising the possibility for their application in the treatment of devastating chronic diseases affecting these tissue types. (bio.org)
  • Those cells are prized for research because of their potential to become almost any type of tissue, perhaps one day to be used to treat illnesses or injuries. (nytimes.com)
  • Next the article notes that vaccines for hepatitis A, German measles, chickenpox and rabies were developed using cell lines grown from tissue from elective abortions. (physiciansforlife.org)
  • That raises the hope that one day the cells will be turned into replacement tissue or even replacement organs to treat a host of diseases. (nytimes.com)
  • After being cultured in a lab, the stem cells can do their magic - they can turn into pretty much any type of cell or tissue, all of which would match the donors' DNA exactly. (giantfreakinrobot.com)
  • It is not the birth of a cloned baby. (cbc-network.org)
  • The same technique, tried in monkeys for years, never resulted in the birth of a cloned monkey, they said. (nytimes.com)
  • Kits include electrocompetent cells or no cells. (bio-medicine.org)
  • We also offer many other different strains and formats of chemically competent cells and electrocompetent cells to help meet your specific transformation needs. (thermofisher.com)
  • HLA II DG+DR+DP Monoclonal Antibody, Purified, Unconjugated, Clone: IQU9 This antibody is specific for the monomorphic determinant of the HLA Class II beta chains of the human MHC (28 kDa). (bio-medicine.org)
  • Clone 2A12 is a ZooMAb rabbit recombinant monoclonal antibody that detects Transcriptional regulator ATRX. (sigmaaldrich.com)
  • Granulocytes are well characterized white blood cells unique for their segmented nuclei and the numerous granules in the cells' cytoplasm. (medgadget.com)
  • It removed the nuclei from unfertilized eggs and replaced them with DNA from a cell taken elsewhere from the animal - in this case, the skin -and induced the eggs to begin dividing. (newstimes.com)
  • Yang's team isolated the cells' nuclei and injected them into mouse eggs whose own nuclei had been removed. (thefreelibrary.com)
  • The nuclei of the skin cells taken from the 2 men were transferred to 77 oocytes of four female donors following removal of the oocyte nuclei. (genethique.org)
  • They] show that we have to have an open mind about the developmental potential of nuclei from different types of cell. (seedmagazine.com)
  • For now, Jaenisch's lab is continuing to investigate ways to produce healthier animal clones by studying how genomes of donated nuclei are reactivated. (mit.edu)
  • The turkey myogenic satellite cell: Optimization of in vitro proliferation and differentiation. (springer.com)
  • In vitro characteristics of myogenic satellite cells derived from the pectoralis major and biceps femoris muscles of the chicken. (springer.com)
  • This protocol offers a detailed description of the method starting from the flow-cytometric isolation of single human B cells to the reverse transcription-polymerase chain reaction (RT-PCR)-based amplification of the expressed immunoglobulin (Ig) transcripts ( IGH , IGK , and IGL) and their subsequent cloning into expression vectors for the in vitro production of recombinant monoclonal antibodies. (springer.com)
  • The center created one of its embryonic stem cell lines through in-vitro fertilization, letting sperm impregnate an egg in a petri dish. (newstimes.com)
  • So, using presently available in vitro fertilization techniques, they set out intentionally to create a "genetically matched" brother or sister for Molly-with the specific goal of using the newborn's stem cells (derived from the umbilical-cord blood shortly after birth) to treat Molly's condition. (apologeticspress.org)
  • However, the technological advances described in the new study are such that "it's a matter of time before they produce a cloned monkey," Jose Cibelli, a cloning expert at Michigan State University who wasn't involved in the study, told the Wall Street Journal . (medicinenet.com)
  • Attempts over many years to create monkey clones have failed, the university noted, and human cells are even more fragile and less amenable to cloning. (medicinenet.com)
  • The team pointed out years of research on monkey cells using the same technique have not successfully produced any monkey clones. (abc.net.au)
  • Dr. Mitalipov and his colleagues created monkey stem cells through cloning in 2007 and since then have been trying to tweak the technique to work with human cells. (nytimes.com)
  • These clones proliferate and make interleukin 2 in an antigen-specific manner in response to NOD antigen-presenting cells and islet cells. (pnas.org)
  • Cytotoxic antibodies to cloned rat islet cells in serum of patients with diabetes mellitus. (jci.org)
  • We have found complement-dependent cytotoxic antibodies in the serum of 8 of 24 patients with insulin-dependent diabetes mellitus using a 51Cr cytotoxicity assay with monolayers of cloned rat islet cells (clones RINm 5F and RINm 14B). (jci.org)
  • The first mammals were also cloned from embryonic cells in the 1980s. (libraryindex.com)
  • The purpose of the procedure is not to clone human beings but to establish cell cultures that can serve as models of human disease. (nytimes.com)
  • Satellite clinics will be set up in San Francisco and in England, and three technicians trained in Dr. Hwang's procedure will visit to perform the cloning. (nytimes.com)
  • ACT is one of the very few private companies in the United States that kept working on stem cell research after the U.S. government dried up federal funds for the procedure. (thenakedscientists.com)
  • Many also hailed the procedure because it avoided the need for embryonic stem cells. (salem-news.com)
  • A blast of power was utilized to fuse grown cells with eggs whose own DNA had been evacuated. (topnews.us)
  • Then they cloned them by putting their nucleuses into unfertilized eggs (from the same or different cows? (futurepundit.com)
  • Boyalife's South Korean partner, Sooam, has set up in China in order to avoid Korea's bioethics laws which ban the use of human eggs in stem cell research. (hubpages.com)
  • One such question could be that why a woman needs to pay for donating her eggs for cloning purpose. (topnews.ae)
  • Dr. Mitalipov said the technique was efficient enough that one donation - which can include multiple eggs - would probably be enough to generate a stem cell line, even accounting for failures. (nytimes.com)
  • Writing in the journal Cell Stem Cell , they say they started with nuclear DNA extracted from the skin cells of a middle-age man and injected it into human eggs donated by four women. (wunc.org)
  • Light micrograph of eggs (female reproductive cells) from a cow (Bos taurus) being used in cloning. (sciencephoto.com)
  • Yamanaka's breakthrough in 2006 raised the prospect of growing tissues from a person's own cells. (newscientist.com)
  • PORTLAND, Ore.) - Oregon Health & Science University's unique method of transforming a person's own skin cells into stem cells has officially been patented. (salem-news.com)
  • For instance, because we transform a person's own cells, there are no issues of rejection when the stem cells are transplanted back into a patient. (salem-news.com)
  • This brought about pluripotent cells - cells that can transform into any sort of human cell. (topnews.us)
  • The result of stem cell cloning is absolutely inhumane due to the production of the mutated creatures. (brightkite.com)
  • The claim went up in smoke in January of 2006 after a probe by the university concluded that Hwang had fabricated the evidence, which followed a similarly damning assessment of a landmark paper from the previous year in which the group falsely reported creating 11 cell lines genetically matched to their donors. (scientificamerican.com)
  • however, no live offspring were obtained in studies using somatic cells such as diploid or mitotic fetal fibroblasts as nuclear donors. (nih.gov)
  • 0.05) than in peripheral blood mononudear cells of nonallergic donors. (tudelft.nl)
  • Acquired mutations in the mDNA contribute to differences between clones and their donors and are believed to influence the aging process. (libraryindex.com)
  • While the debate rages in the United States, the United Kingdom has issued a license to Newcastle University, to allow them to use cloning to produce human stem cells. (abovetopsecret.com)
  • PHILADELPHIA - (KRT) - In a move that could accelerate stem-cell research, the British government yesterday granted Newcastle University that country's first license to use cloning to create human stem cells. (abovetopsecret.com)
  • Gretchen Vogel, "Korean team speeds up creation of cloned human stem cells. (brightkite.com)
  • Three major strategies have been used to produce clones, namely, the dilution technique, cloning ring technique, and robotic cell transfer. (springer.com)
  • Cloning can be used to produce a supply of unspecialized stem cells that can be induced to grow into various types of body cells. (livescience.com)
  • Only the granulocytes were able to produce two live cloned pups, although both died within a few hours of birth. (medgadget.com)
  • The state also created the Center for Regenerative Biology at UConn, headed by Yang, who in the 1990s was the first researcher to produce a cloned bull, as well as the first cow cloned from farm animals. (newstimes.com)
  • They could then manipulate the cells to produce cells to repair a specific organ. (newstimes.com)
  • The research " will lead inexorably to cloning to produce a live born child, " said bioethicist O. Carter Snead, of the University of Notre Dame, told Reuters . (chron.com)
  • To examine how a cell's maturity affects its usefulness for cloning, Xiangzhong (Jerry) Yang of the University of Connecticut in Storrs and his colleagues worked with three types of blood cells from a mouse: stem cells that produce all types of blood cells, more-mature cells that can make only a few blood cell types, and fully mature white blood cells called granulocytes that can no longer divide. (thefreelibrary.com)
  • The Conference of Catholic Bishops, for instance, said Wednesday that the research "will be taken up by those who want to produce cloned children as 'copies' of other people. (nytimes.com)
  • Furthermore, the effects of drugs on cells produce both chemical and morphological changes, the latter could affect the spectra of cells incubated with drugs. (rsc.org)
  • As such, they have the ability to divide for indefinite periods in a laboratory culture to produce more stem cells, or to give rise, under specified conditions, to a veritable plethora of other cells. (apologeticspress.org)
  • The cloned cows are intended to be used to produce human growth hormone (hGH) in their milk. (sciencephoto.com)
  • Embryonic stem cells are unique in that they are able to develop (or differentiate) into other types of cells. (www.nhs.uk)
  • The stem cells can be induced to differentiate into different types of cells as needed (heart, nerve, muscle, etc. (livescience.com)
  • Because stem cells have the ability to self-renew and differentiate into any specialized cell type, they have been heralded for their promise for treating a variety of diseases and conditions. (medgadget.com)
  • The ewe lived for six years after being the first mammal cloned by professors at the University of Edinburgh by Keith Campbell and Ian Wilmut. (express.co.uk)