Clone Cells: A group of genetically identical cells all descended from a single common ancestral cell by mitosis in eukaryotes or by binary fission in prokaryotes. Clone cells also include populations of recombinant DNA molecules all carrying the same inserted sequence. (From King & Stansfield, Dictionary of Genetics, 4th ed)Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Chromosomes, Artificial, Bacterial: DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Genomic Library: A form of GENE LIBRARY containing the complete DNA sequences present in the genome of a given organism. It contrasts with a cDNA library which contains only sequences utilized in protein coding (lacking introns).Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Blotting, Northern: Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.DNA Restriction Enzymes: Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Cosmids: Plasmids containing at least one cos (cohesive-end site) of PHAGE LAMBDA. They are used as cloning vehicles.DNA, Recombinant: Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Electrophoresis, Gel, Pulsed-Field: Gel electrophoresis in which the direction of the electric field is changed periodically. This technique is similar to other electrophoretic methods normally used to separate double-stranded DNA molecules ranging in size up to tens of thousands of base-pairs. However, by alternating the electric field direction one is able to separate DNA molecules up to several million base-pairs in length.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.T-Lymphocytes: Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.Genes, Bacterial: The functional hereditary units of BACTERIA.Epitopes: Sites on an antigen that interact with specific antibodies.Hybrid Cells: Any cell, other than a ZYGOTE, that contains elements (such as NUCLEI and CYTOPLASM) from two or more different cells, usually produced by artificial CELL FUSION.Genetic Variation: Genotypic differences observed among individuals in a population.Open Reading Frames: A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).Tumor Cells, Cultured: Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Antibodies, Monoclonal: Antibodies produced by a single clone of cells.DNA Fingerprinting: A technique for identifying individuals of a species that is based on the uniqueness of their DNA sequence. Uniqueness is determined by identifying which combination of allelic variations occur in the individual at a statistically relevant number of different loci. In forensic studies, RESTRICTION FRAGMENT LENGTH POLYMORPHISM of multiple, highly polymorphic VNTR LOCI or MICROSATELLITE REPEAT loci are analyzed. The number of loci used for the profile depends on the ALLELE FREQUENCY in the population.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).Cell Division: The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.T-Lymphocytes, Cytotoxic: Immunized T-lymphocytes which can directly destroy appropriate target cells. These cytotoxic lymphocytes may be generated in vitro in mixed lymphocyte cultures (MLC), in vivo during a graft-versus-host (GVH) reaction, or after immunization with an allograft, tumor cell or virally transformed or chemically modified target cell. The lytic phenomenon is sometimes referred to as cell-mediated lympholysis (CML). These CD8-positive cells are distinct from NATURAL KILLER CELLS and NATURAL KILLER T-CELLS. There are two effector phenotypes: TC1 and TC2.Genetic Vectors: DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Lymphocyte Activation: Morphologic alteration of small B LYMPHOCYTES or T LYMPHOCYTES in culture into large blast-like cells able to synthesize DNA and RNA and to divide mitotically. It is induced by INTERLEUKINS; MITOGENS such as PHYTOHEMAGGLUTININS, and by specific ANTIGENS. It may also occur in vivo as in GRAFT REJECTION.Sequence Tagged Sites: Short tracts of DNA sequence that are used as landmarks in GENOME mapping. In most instances, 200 to 500 base pairs of sequence define a Sequence Tagged Site (STS) that is operationally unique in the human genome (i.e., can be specifically detected by the polymerase chain reaction in the presence of all other genomic sequences). The overwhelming advantage of STSs over mapping landmarks defined in other ways is that the means of testing for the presence of a particular STS can be completely described as information in a database.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.DNA Probes: Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.Contig Mapping: Overlapping of cloned or sequenced DNA to construct a continuous region of a gene, chromosome or genome.Multigene Family: A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)Oligonucleotide Probes: Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.Polymorphism, Restriction Fragment Length: Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Chromosomes, Artificial, Yeast: Chromosomes in which fragments of exogenous DNA ranging in length up to several hundred kilobase pairs have been cloned into yeast through ligation to vector sequences. These artificial chromosomes are used extensively in molecular biology for the construction of comprehensive genomic libraries of higher organisms.Molecular Weight: The sum of the weight of all the atoms in a molecule.Bacterial Typing Techniques: Procedures for identifying types and strains of bacteria. The most frequently employed typing systems are BACTERIOPHAGE TYPING and SEROTYPING as well as bacteriocin typing and biotyping.Poly A: A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.Expressed Sequence Tags: Partial cDNA (DNA, COMPLEMENTARY) sequences that are unique to the cDNAs from which they were derived.Cricetinae: A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.Virus Replication: The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.Genes, Viral: The functional hereditary units of VIRUSES.Receptors, Antigen, T-Cell: Molecules on the surface of T-lymphocytes that recognize and combine with antigens. The receptors are non-covalently associated with a complex of several polypeptides collectively called CD3 antigens (ANTIGENS, CD3). Recognition of foreign antigen and the major histocompatibility complex is accomplished by a single heterodimeric antigen-receptor structure, composed of either alpha-beta (RECEPTORS, ANTIGEN, T-CELL, ALPHA-BETA) or gamma-delta (RECEPTORS, ANTIGEN, T-CELL, GAMMA-DELTA) chains.Molecular Epidemiology: The application of molecular biology to the answering of epidemiological questions. The examination of patterns of changes in DNA to implicate particular carcinogens and the use of molecular markers to predict which individuals are at highest risk for a disease are common examples.Mice, Inbred BALB CPeptide Library: A collection of cloned peptides, or chemically synthesized peptides, frequently consisting of all possible combinations of amino acids making up an n-amino acid peptide.Bacterial Proteins: Proteins found in any species of bacterium.Antigens, Surface: Antigens on surfaces of cells, including infectious or foreign cells or viruses. They are usually protein-containing groups on cell membranes or walls and may be isolated.Protein Biosynthesis: The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.RNA, Ribosomal, 16S: Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.Receptors, Antigen, T-Cell, alpha-beta: T-cell receptors composed of CD3-associated alpha and beta polypeptide chains and expressed primarily in CD4+ or CD8+ T-cells. Unlike immunoglobulins, the alpha-beta T-cell receptors recognize antigens only when presented in association with major histocompatibility (MHC) molecules.In Situ Hybridization, Fluorescence: A type of IN SITU HYBRIDIZATION in which target sequences are stained with fluorescent dye so their location and size can be determined using fluorescence microscopy. This staining is sufficiently distinct that the hybridization signal can be seen both in metaphase spreads and in interphase nuclei.B-Lymphocytes: Lymphoid cells concerned with humoral immunity. They are short-lived cells resembling bursa-derived lymphocytes of birds in their production of immunoglobulin upon appropriate stimulation.Cell Differentiation: Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.

Classification of human colorectal adenocarcinoma cell lines. (1/9318)

Eleven human colorectal adenocarcinoma cell lines established in this laboratory were classified into three groups based on morphological features (light and electron microscopy), modal chromosome number, and ability to synthesize carcinoembryonic antigen (CEA). Group 1 cell lines contained both dedifferentiated and differentiating cells growing in tight clusters or islands of epithelium-like cells; their modal chromosome number was about 47, and they synthesized small to moderate amounts of CEA. Group 2 cell lines were more dedifferentiated, were hyperdiploid, and synthesized small amounts of CEA. Group 3 cell lines were morphologically similar to those of Group 1 by light microscopy. They differed ultrastructurally by containing microvesicular bodies; the modal chromosome number varied from hyperdiploid to hypertriploid or they had bimodal populations of hypodiploid and hypertriploid cells, and they synthesized relatively large amounts of CEA. No correlation could be found between Broder's grade or Duke's classification of the original tumor and modal chromosome number or ability to synthesize CEA. These findings support Nowell's hypothesis that the stem line is different for each solid tumor, which makes it difficult to relate chromosomal changes to the initiation of the neoplastic state.  (+info)

Cloning of a novel gene specifically expressed in clonal mouse chondroprogenitor-like EC cells, ATDC5. (2/9318)

We cloned a full-length cDNA encoding a novel mouse protein, A-C2, by differential display method using mouse embryonic fibroblast C3H10T1/2 cells and mouse chondroprogenitor-like EC cells, ATDC5. The deduced amino acid sequence of A-C2 consisted of 106 amino acids with no significant homology to the sequences previously reported. Northern blot analysis showed two major bands of 2.1 and 1.8 kb sizes. Expression of A-C2 mRNA was exclusive to ATDC5 cells at their undifferentiated stage. None of ATDC5 cells at their differentiated stage and adult mice tissues examined expressed A-C2 gene.  (+info)

Crystal structures of two H-2Db/glycopeptide complexes suggest a molecular basis for CTL cross-reactivity. (3/9318)

Two synthetic O-GlcNAc-bearing peptides that elicit H-2Db-restricted glycopeptide-specific cytotoxic T cells (CTL) have been shown to display nonreciprocal patterns of cross-reactivity. Here, we present the crystal structures of the H-2Db glycopeptide complexes to 2.85 A resolution or better. In both cases, the glycan is solvent exposed and available for direct recognition by the T cell receptor (TCR). We have modeled the complex formed between the MHC-glycopeptide complexes and their respective TCRs, showing that a single saccharide residue can be accommodated in the standard TCR-MHC geometry. The models also reveal a possible molecular basis for the observed cross-reactivity patterns of the CTL clones, which appear to be influenced by the length of the CDR3 loop and the nature of the immunizing ligand.  (+info)

Analysis of V(H)-D-J(H) gene transcripts in B cells infiltrating the salivary glands and lymph node tissues of patients with Sjogren's syndrome. (4/9318)

OBJECTIVE: In patients with Sjogren's syndrome (SS), B lymphocytes have been found to infiltrate salivary glands, resulting in sialadenitis and keratoconjunctivitis. The disease is frequently associated with benign and neoplastic lymphoproliferation. The present study was undertaken to investigate whether clonal B cell expansion takes place in lymphocytic infiltrations of salivary glands under (auto- [?]) antigen stimulation, by analyzing in more detail the variable part (V(H)-D-J(H)) of the immunoglobulin heavy chain genes expressed in these B cells. METHODS: Biopsies of the labial salivary glands and lymph nodes were performed on 2 female patients with SS. The Ig gene rearrangements in these tissues were amplified by reverse transcriptase-polymerase chain reaction using specific primers. RESULTS: A total of 94 V(H)-D-J(H) transcripts were cloned and sequenced. Our data suggest a polyclonal origin of the B cell infiltrates. In 92 of the transcripts, V(H) genes were modified by somatic mutation. Further analysis showed counterselection for replacement mutations within the framework regions, suggesting that those B cells were stimulated and selected for functional expression of a surface Ig. In labial salivary glands from both patients, clonally related B cells became evident. Members of 1 particular clone were found in both the lip and lymph node material. CONCLUSION: These data provide evidence, on the nucleotide sequence level, that an antigen-triggered clonal B cell expansion takes place in the salivary glands of patients with SS who do not have histologic evidence of developing lymphoma. It may be speculated that those B cell clones expand during disease progression, resulting in lymphomagenesis.  (+info)

Isolation and characterization of two mouse L cell lines resistant to the toxic lectin ricin. (5/9318)

Two variant mouse L cell lines (termed CL 3 and CL 6) have been selected for resistant to ricin, a galactose-binding lectin with potent cytotoxic activity. The resistant lines exhibit a 50 to 70% decrease in ricin binding and a 300- to 500-fold increase in resistance to the toxic effects of ricin. Crude membrane preparations of CL 3 cells have increased sialic acid content (200% of control), while the galactose, mannose, and hexosamine content is within normal limits. Both the glycoproteins and glycolipids of CL 3 cells have increased sialic acid, with the GM3:lactosylceramide ratios for parent L and CL 3 cells being 0.29 and 1.5, respectively. In contrast, the membranes of CL 6 cells have a decrease in sialic acid, galactose, and hexosamine content with mannose being normal. Both cell lines have specific alterations in glycosyltransferase activities which can account for the observed membrane sugar changes. CL 3 cells have increased CMP-sialic acid:glycoprotein sialyltransferase and GM3 synthetase activities, while CL 6 cells have decrease UDP-GlcNAc:glycoproteinN-acetylglucosaminyltransferase and DPU-galactose:glycoprotein galactosyltransferase activities. The increased sialic acid content of CL 3 cells serves to mask ricin binding sites, since neuraminidase treatment of this cell line restores ricin binding to essentially normal levels. However, the fact that neuraminidase-treated CL 3 cells are still 45-fold resistant to ricin indicates that either a special class of productive ricin binding sites is not being exposed or that the cell line has a second mechanism for ricin resistance.  (+info)

Enhanced tumor growth and invasiveness in vivo by a carboxyl-terminal fragment of alpha1-proteinase inhibitor generated by matrix metalloproteinases: a possible modulatory role in natural killer cytotoxicity. (6/9318)

Matrix metalloproteinases (MMPs) are believed to contribute to the complex process of cancer progression. They also exhibit an alpha1-proteinase inhibitor (alphaPI)-degrading activity generating a carboxyl-terminal fragment of approximately 5 kd (alphaPI-C). This study reports that overexpression of alphaPI-C in S2-020, a cloned subline derived from the human pancreas adenocarcinoma cell line SUIT-2, potentiates the growth capability of the cells in nude mice. After stable transfection of a vector containing a chimeric cDNA encoding a signal peptide sequence of tissue inhibitor of metalloproteinase-1 followed by cDNA for alphaPI-C into S2-020 cells, three clones that stably secrete alphaPI-C were obtained. The ectopic expression of alphaPI-C did not alter in vitro cellular growth. However, subcutaneous injection of the alphaPI-C-secreting clones resulted in tumors that were 1.5 to 3-fold larger than those of control clones with an increased tendency to invasiveness and lymph node metastasis. These effects could be a result of modulation of natural killer (NK) cell-mediated control of tumor growth in nude mice, as the growth advantage of alphaPI-C-secreting clones was not observed in NK-depleted mice, and alphaPI-C-secreting clones showed decreased NK sensitivity in vitro. In addition, production of alphaPI and generation of the cleaved form of alphaPI by MMP were observed in various human tumor cell lines and in a highly metastatic subline of SUIT-2 in vitro. These results provide experimental evidence that the alphaPI-degrading activity of MMPs may play a role in tumor progression not only via the inactivation of alphaPI but also via the generation of alphaPI-C.  (+info)

Organ-selective homing defines engraftment kinetics of murine hematopoietic stem cells and is compromised by Ex vivo expansion. (7/9318)

Hematopoietic reconstitution of ablated recipients requires that intravenously (IV) transplanted stem and progenitor cells "home" to organs that support their proliferation and differentiation. To examine the possible relationship between homing properties and subsequent engraftment potential, murine bone marrow (BM) cells were labeled with fluorescent PKH26 dye and injected into lethally irradiated hosts. PKH26(+) cells homing to marrow or spleen were then isolated by fluorescence-activated cell sorting and assayed for in vitro colony-forming cells (CFCs). Progenitors accumulated rapidly in the spleen, but declined to only 6% of input numbers after 24 hours. Although egress from this organ was accompanied by a simultaneous accumulation of CFCs in the BM (plateauing at 6% to 8% of input after 3 hours), spleen cells remained enriched in donor CFCs compared with marrow during this time. To determine whether this differential homing of clonogenic cells to the marrow and spleen influenced their contribution to short-term or long-term hematopoiesis in vivo, PKH26(+) cells were sorted from each organ 3 hours after transplantation and injected into lethally irradiated Ly-5 congenic mice. Cells that had homed initially to the spleen regenerated circulating leukocytes (20% of normal counts) approximately 2 weeks faster than cells that had homed to the marrow, or PKH26-labeled cells that had not been selected by a prior homing step. Both primary (17 weeks) and secondary (10 weeks) recipients of "spleen-homed" cells also contained approximately 50% higher numbers of CFCs per femur than recipients of "BM-homed" cells. To examine whether progenitor homing was altered upon ex vivo expansion, highly enriched Sca-1(+)c-kit+Lin- cells were cultured for 9 days in serum-free medium containing interleukin (IL)-6, IL-11, granulocyte colony-stimulating factor, stem cell factor, flk-2/flt3 ligand, and thrombopoietin. Expanded cells were then stained with PKH26 and assayed as above. Strikingly, CFCs generated in vitro exhibited a 10-fold reduction in homing capacity compared with fresh progenitors. These studies demonstrate that clonogenic cells with differential homing properties contribute variably to early and late hematopoiesis in vivo. The dramatic decline in the homing capacity of progenitors generated in vitro underscores critical qualitative changes that may compromise their biologic function and potential clinical utility, despite their efficient numerical expansion.  (+info)

Phenotypic and functional characterization of CD8(+) T cell clones specific for a mouse cytomegalovirus epitope. (8/9318)

A series of CD8(+) T cell clones, specific for the IE1 epitope YPHFMPTNL, of the immediate-early protein 1 of the murine cytomegalovirus (MCMV) were generated in order to determine their protective activity against this infection and correlate their phenotypic markers with antiviral activity. We found that the adoptive transfer of three of these anti-MCMV CD8(+) T cell clones into irradiated naive mice resulted in protection against challenge, while another CD8(+) T cell clone, of the same specificity, failed to confer protection. The clones that conferred protection against lethal challenge reduced greatly viral replication in the lung and other organs of the mice. Using one of the protective anti-MCMV CD8(+) T cell clones we found that in order to be fully protective the cells had to be transferred to recipient mice no later than 1 day after MCMV challenge. The adoptive transfer of these CD8(+) T cell clones also protected CD4(+) T-cell-depleted mice. Phenotypic characterization of the anti-MCMV clones revealed that the nonprotective clone expressed very low levels of CD8 molecules and produced only small amounts of TNF-alpha upon antigenic stimulation. Most importantly, our current study demonstrates that this MHC class I-restricted IE1 epitope of MCMV is efficiently presented to CD8(+) T cell clones in vivo and further strengthens the possibility of the potential use of CD8(+) T cell clones as immunotherapeutic tools against cytomegalovirus-induced disease.  (+info)

*Clone (cell biology)

Clone (B-cell biology) Cloning List of animals that have been cloned Polyclonal antibodies Polyclonal response "Clone ... so they are technically a single clone of cells. However, during course of cell division, one of the cells can get mutated ... bone marrow cells. Most other cells cannot divide indefinitely as after a few cycles of cell division the cells stop expressing ... A clone is a group of identical cells that share a common ancestry, meaning they are derived from the same cell. Clonality ...

*Clone (B-cell biology)

Clone (cell biology) Nossal, G. J. V. & Lederberg, J. (1958). "Antibody production by single cells". Nature. 181: 1419-1420. ... The expansion of a particular clone of immune B cells is usually interpreted by clinicians as evidence of unrestricted cell ... This differentiation and activation of the B cell occurs most rapidly after exposure to antigen by antigen-presenting cells in ... The process of immunological B-cell maturation involves transformation from an undifferentiated B cell to one that secretes ...

*Human cloning

... therapeutic cloning and reproductive cloning. Therapeutic cloning would involve cloning cells from a human for use in medicine ... 24 January 2018). "Cloning of Macaque Monkeys by Somatic Cell Nuclear Transfer". Cell (journal). doi:10.1016/j.cell.2018.01.020 ... Trounson A, DeWitt ND (2013). "Pluripotent stem cells from cloned human embryos: success at long last". Cell Stem Cell. 12 (6 ... "Human somatic cell nuclear transfer using adult cells". Cell Stem Cell. 14 (6): 777-80. doi:10.1016/j.stem.2014.03.015. PMID ...

*Xenbase

This process (transfer of nuclei from cloned cells) is referred to as serial transplantation. To provide examples of how ... a liver cell nucleus remains a liver cell nucleus and cannot return to an undifferentiated state). Specifically, John Gurdon's ... Genome browser BLAST Expression Search and Clone Search (search by gene symbol, gene name, or Affymetrix id) Gene nomenclature ... Importance: Gurdon's experiments challenged the dogma of the time which suggested that the nucleus of a differentiated cell is ...

*Katherine Sanford

Additionally, cloning allowed the development of new vaccines and advanced the study of stem cells. Later in her career Sanford ... Virginia Evans and a group of tissue-culture workers she became the first to successfully clone a mammalian cell in vitro. This ... In the 1940s she became the first person to successfully clone a mammalian cell in vitro, which allowed for more efficient ... The cell cultures were exposed to fluorescent light that damaged the DNA of the cells. Following this, they were treated with ...

*TAL1

J. Cell Cloning. 10 (5): 269-76. doi:10.1002/stem.5530100504. PMID 1453013. Aplan PD, Lombardi DP, Reaman GH, Sather HN, ... T-cell acute lymphocytic leukemia protein 1 is a protein that in humans is encoded by the TAL1 gene. The protein encoded by ... Cell. Biol. 10 (12): 6426-35. PMC 362919 . PMID 2247063. Chen Q, Cheng JT, Tasi LH, Schneider N, Buchanan G, Carroll A, Crist W ... Cell. Biol. 20 (6): 2248-59. doi:10.1128/mcb.20.6.2248-2259.2000. PMC 110841 . PMID 10688671. Lécuyer E, Herblot S, Saint-Denis ...

*Kevin Andrews (politician)

"Stem cell cloning ban overturned". News.com.au. 6 December 2006. Retrieved 31 August 2007. [dead link] "Andrews sets out ... In taking a stance against stem cell research in 2002, he stated that it was the "first time" that "human beings can be treated ... "Politicians prepare to vote on stem cell issue". Australian Broadcasting Corporation. 15 August 2002. Retrieved 31 August 2007 ... euthanasia or embryonic stem cell experimentation. Andrews has described his role with LDI as an "honorary patronage". In 2007 ...

*Gábor Vajta

"Somatic Cell Cloning without Micromanipulators". Cloning. 3 (2): 89-95. doi:10.1089/15204550152475590. PMID 11900643. Vajta, G ... "Birth of a cloned calf derived from a vitrified hand-made cloned embryo". Reproduction, Fertility and Development. 15 (7): 361 ... OPS is also regarded as the most appropriate carrier tool for vitrification of human embryonic stem cells (hESCs). Vajta, G. B ... All work is done by hand, with simple handheld tools (blade and micropipette).The first cloned animals in Africa and ...

*C. Garrison Fathman

Clones of alloreactive T cells. Nature 272:617-8. Kimoto, Masao, and Fathman, C. Garrison. (1981) Antigen-reactive T cell ... His research centers on a molecular and cellular understanding of CD4 T cell responsiveness in mice and man. President of the ... 1996) Monoclonal T cells identified in early NOD islet infiltrates. Immunity 4:189-194. Anandasabapathy, Niroshana, Ford, ... 2004) Two isoforms of otubain 1 regulate T cell anergy via GRAIL. Nat Immunol 5:45-54. Kodama, Keiichi, Butte, Atul J., Creusot ...

*Boston Children's Hospital

Evan Snyder clones the first neural stem cells from the human central nervous system of a fetus,, offering the possibility of ... "Nerve Cell Clones Repair Brain Damage". The Harvard University Gazette. Archived from the original on 3 October 1999. Retrieved ... even in the absence of conventional T-helper cells. Moreover, NKT cells respond to a different class of antigens than are ... To date, cell lines have been distributed to over 65 laboratories worldwide.[citation needed] In 2010, a drug that boosts ...

*Prototype pattern

When a cell splits, two cells of identical genotype result. In other words, the cell clones itself. The Prototype design ... method clone() is output: a WordOccurrences object containing the same data. Call clone() on the super class. On the returned ... The mitotic division of a cell - resulting in two identical cells - is an example of a prototype that plays an active role in ... You can see here, we have used Clone method to clone the prototype when required. // Prototype pattern public abstract class ...

*Glucocorticoid

... s cause B cells to express smaller amounts of IL-2 and of IL-2 receptors. This diminishes both B cell clone ... The effect is more prominent in immature T cells still inside in the thymus, but peripheral T cells are also affected. The ... including both B cells and T cells. The major mechanism for this immunosuppression through inhibition of nuclear factor kappa- ... including both B cells and T cells), monocytes, macrophages, and the anatomical barrier function of the skin. This suppression ...

*Immunosuppressive drug

This diminishes both B cell clone expansion and antibody synthesis. Glucocorticoids influence all types of inflammatory events ... In this way, it prevents the cell from transitioning from the G0 into G1 phase of the cell cycle. Tacrolimus is more potent ... This lowers the number of available T-cells, perhaps by sensitizing them for the uptake by the epithelial reticular cells. The ... They affect the proliferation of both T cells and B cells. Due to their highest effectiveness, purine analogs are most ...

*Tong Dizhou

Some of the clone cells grew into an embryo and developed into juvenile goldfish, the first artificially cloned fish in the ... Cellular cloning refers to producing genetically identical organisms by transferring the nucleus of a donor cell into a host ... The researchers found that some of the resultant clone cells in the juvenile fish had traits previously found just in Rhodeus ... Tong demonstrated that in hairy sea squirts, during the third division of cells in an embryo, cells divide unequally. Tong ...

*Hwang Woo-suk

Hwang claimed he and his team had extracted stem cells from cloned human embryos. However, further examination of the cells' ... Hwang maintained that two of his 11 forged stem cell lines had been maliciously switched for cells from regular, not cloned, ... 100,000 each to have their dogs cloned. Hwang's intention to develop better technique for cloning was focused on stem cells ... each new cell has the potential to either remain a stem cell or become another type of cell with a more specialized function. ...

*HEK 293 cells

... obtaining just one clone of cells that were cultured for several months. After presumably adapting to tissue culture, cells ... 293 cells, or less precisely as HEK cells, are a specific cell line originally derived from human embryonic kidney cells grown ... As a consequence, HEK 293 cells should not be used as an in vitro model of typical kidney cells. HEK 293 cells have a complex ... HEK 293 Transfection and Selection Data @ Cell-culture Database A HEK293 Cell Database 293 Cells (CRL-1573) in the ATCC ...

*Ann Kiessling

Cook, G. (2001, Jul 13). WORCESTER FIRM AIMS TO CLONE HUMAN CELLS. Boston Globe. Krasner, J. (2003, Apr 09). KEEPING ACT ... 2001, Jul 13). Scientists pursue controversial goal: Cloning for tissue --- resulting cells might cure life-threatening ... Ann Kiessling Devotes Full Time to Bedford Stem Cell Research Foundation". Bedford Stem Cell Research Foundation. Retrieved 23 ... "About the director". Bedford Stem Cell Research Foundation. Retrieved 8 November 2012. "Bedford Stem Cell Research Foundation ...

*Interleukin 3

... identification by expression cloning of a novel hematopoietic growth factor related to murine IL-3". Cell. 47 (1): 3-10. doi: ... He found a T cell derived factor that induced the synthesis of 20alpha-hydroxysteroid dehydrogenase in hematopoietic cells and ... In addition, IL-3 stimulates proliferation of all cells in the myeloid lineage (granulocytes, monocytes, and dendritic cells), ... Interleukin 3 stimulates the differentiation of multipotent hematopoietic stem cells into myeloid progenitor cells or, with the ...

*Monoclonal B-cell lymphocytosis

February 2009). "B-Cell Clones as Early Markers for Chronic Lymphocytic Leukemia". N Engl J Med. 360 (7): 659-667. doi:10.1056/ ... Molecular techniques can detect monoclonal B cell levels as low as 3-5 B cells/microliter (comparable to the amount of stem ... "monoclonal B-cell lymphocytosis" was proposed by a consensus committee in 2005 to indicate a monoclonal B cell population in a ... Monoclonal B-cell lymphocytosis (MBL) is a condition that resembles chronic lymphocytic leukemia (CLL), but does not meet the ...

*Nuclear transfer

24 January 2018). "Cloning of Macaque Monkeys by Somatic Cell Nuclear Transfer". Cell (journal). doi:10.1016/j.cell.2018.01.020 ... If the cloned cells are placed in the uterus of a female mammal, a cloned organism develops to term in rare instances. This is ... "Human Embryonic Stem Cells Derived by Somatic Cell Nuclear Transfer". Cell. 153 (6): 1228-38. doi:10.1016/j.cell.2013.05.006. ... The cell contains genetic information identical to the donated somatic cell. After stimulating this cell to begin dividing, in ...

*Dead No More: The Clone Conspiracy

When Spider-Man activates the Webware to stabilize the human and clone cells all across the world, the various Miles Warren ... Julia Carpenter arrives and fends Electro off as she tells Prowler that Spider-Man's stabilized the human and clone cells. When ... In a side-story, Gwen is supposedly resurrected by Jackal and his clones. The Jackal claims that this one is not a clone, but ... Anna Maria reveals she knows how to stop the decaying process on the clones and Jackal offers her the "Proto Clone" body in ...

*Needless

But Arclight's right eye and heart rejected the cloned cells and he was deemed a failure and left for dead at a landfill. ... It was revealed that he is a clone of the strongest Needless, 'The Second Christ'. His only flaw is his attraction to cute, ... Eventually it was discovered that he was the head of the Simeon initiative to clone the Second and presided over the creation ... Eventually, Arclight is revealed to be a clone of the real Adam Arclight and is destroyed once he served his purpose. Riru ...

*Robert J. Desnick

K Amniotic fluid cells are more efficiently reprogrammed to pluripotency than adult cells. Cloning Stem Cells [Epub] Dec. 17, ... PMID 20677926 doi:10.1089/cell.2009.0077 Khanna, R, Soska, R, Lun, Y, Feng, J, Frascella, M, Young, B, Brignol, N, Pellegrino, ... He is currently Professor of Pediatrics, Oncological Sciences, Obstetrics, Gynecology and Reproductive Science, Gene and Cell ... ". "USPTO: Cloning and expression of biologically active alpha-galactosidase A as a fusion protein". "USPTO: Cloning and ...

*Nickel allergy

... clone) themselves. With enough exposures to nickel, the amassing clones of T-cells reach "threshold" and the skin develops a ... The antigenic epitope is collected by dermal dendritic cells and Langerhans cells, the antigen-presenting cells (APC) of the ... when skin contact to nickel results in antigen presentation to the T cells, and T cell duplication (cloning) occurs. The metal ... 2003). "Components of the ligand for a Ni++ reactive human T cell clone". J Exp Med. 197: 567-574. doi:10.1084/jem.20021762. ...

*Clonogenic assay

The word "clonogenic" refers to the fact that these cells are clones of one another. The experiment involves three major steps ... human tumor cells are a typical choice. The cells either come from prepared "cell lines," which have been well-studied and ... The cells are put in petri dishes or in plates which contain several circular "wells." Particular numbers of cells are plated ... For Cell-killing Particle assays, the surviving fraction of cells is used to approximate the Poisson Distribution of virus ...

*Phage display

Multiple cloning sites are sometimes used to ensure that the fragments are inserted in all three possible reading frames so ... The use of a helper phage can be eliminated by using 'bacterial packaging cell line' technology. Elution can be done combining ... Then the expression of single chain Fv's (scFv), and single chain T cell receptors (scTCR) were expressed both with and without ... Endemann H, Model P (July 1995). "Location of filamentous phage minor coat proteins in phage and in infected cells". J. Mol. ...
PRIMARY OBJECTIVES:. I. To assess the safety and toxicity of cellular adoptive immunotherapy in melanoma patients using autologous CD4+ and CD8+ antigen-specific T cell clones.. II. To evaluate the antitumor effects of CD4+ and CD8+ antigen-specific T cells in patients with metastatic melanoma.. III. To determine the duration of in vivo persistence of adoptively transferred CD8+ antigen-specific T cell clones in the presence or absence of transferred CD4+ T cells.. SECONDARY OBJECTIVES:. I. To assess the in vivo antitumor efficacy of the infused autologous antigen-specific CD4+ T cells.. OUTLINE: This is a phase I study followed by a phase II study.. Beginning 48 hours before T-cell infusion, patients receive cyclophosphamide IV. Patients then receive antigen-specific CD8+ T cells IV alone or with CD4+ T helper clones over 1-2 hours on day 0. Patients also receive aldesleukin subcutaneously twice daily on days 0-13. Treatment repeats every 28 days for up to 3 courses in the absence of disease ...
Principal Investigator:YAMAMOTO Kazuhiko, Project Period (FY):1995 - 1997, Research Category:Grant-in-Aid for Scientific Research (A), Section:展開研究, Research Field:内科学一般
An experimental model of two interacting clones of T cells is described, which may be used for defining and exploring the T-cell immunoregulatory network. Mx9/9 is a CD4 clone bearing an antigen receptor recognized by the Mx9 anti-V beta 8 monoclonal antibody (MoAb). Anti-V beta 8 MoAbs activate and induce cell proliferation of this clone. Autologous clones were raised against Mx9/9 cells using the peripheral blood mononuclear (PBM) cells of the Mx9/9 clone donor (PBMjm). Some of these cloned anti-clone cells proliferated after stimulation with irradiated Mx9/9 cells, but not after stimulation with other autologous cloned T cells or heterologous PBM, suggesting that these clones recognize the T cell receptor (TCR) of the Mx9/9 cells. The proliferation of the Mx9/9 stimulated cloned anticlone cells was blocked by anti-class II MoAbs, indicating that the autoreactive clones recognize their target antigen in conjunction with HLA Class II products. The ability of clone Mx9/9 to proliferate after stimulation
Animals were immunized with the cloned cytotoxic T lymphocyte lines V4 and 243/2.5. Spleen cells were fused with Sp2/0-Ag14 myeloma cells.
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed "as is" with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed "as is" with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
If the clone is an EST clone, it can be ordered from ATCC or the evil Invitrogen empire, which also has other clones as well and a clone search engine. RIKEN clones must be ordered from Japan from the link HomeBrew listed or sometimes you can order from the German RZPD website. Google it to find the web address. Ive ordered from all except the Japanese place. And I highly recommend buying clones from ATCC before Invitrogen. Ive had clones from Invitrogen end up being the wrong clone many times. But thats a risk you take ordering clones from anyone ...
In this report, we describe the molecular and functional characterization of T-cell clones identified in peripheral blood from patients with relapsed myeloma responding to DLI. These clones were initially identified through analysis of TCR Vβ repertoire (spectratyping), a technique that provides a comprehensive characterization of the circulating T-cell compartment (21 , 24 , 25) . Serial analysis of T-cell repertoire in patient samples has also been used to detect the emergence of oligoclonal and clonal T cells at different times in vivo (18 , 26 , 27) . By combining analysis of TCR repertoire with clinical events, we observed the expansion of individual T-cell clones in peripheral blood that were temporally associated with the initiation of either a GVM or GVHD response (17) . However, despite the association of these T-cell clones with specific clinical responses, the functional specificity of these T cells was not established. Further studies were therefore undertaken to quantify the ...
Clouse KA, Powell D, Washington I, Poli G, Strebel K, Farrar W, Barstad P, Kovacs J, Fauci AS, Folks TM (1989). „Monokine regulation of human immunodeficiency virus-1 expression in a chronically infected human T cell clone". J Immunol. 142 (2): 431-8. PMID 2463307 ...
Agriyas Online Food Ordering Script is a well compiled Just Eat clone script to create a food ordering platform.With its advanced features and functionalities it strongly comes across as a swiggy and Foodpanda clone script also.
I have 3 questions if someone could help me with those please. 1. Could 2 different bands (size wise) be detected for the same protein using poly colonal and monoclonal antibodies? 2. If the samples are run on electrophoresis for too long, can the size of the protein show difference comparing to the previous (shorter) runs? 3. In siRNA , I have knock down my gene of interest at the mRNA level (70-80% according to quantitative PCR x2 experiments), but western blot of the same colony cell protein lysates show no or less ( only 30% ) decrement. Any explanation please? Thanks Laleh ...
As Orphan Black begins its fifth and final season, heres a reminder of the many clones that have appeared on the BBC America show.
GenEZ™ ORF cDNA clones makes it easy to order customized expression-ready ORF clones from the worlds largest commercial ORF clone database.
We are happy to introduce Theonlinemom Clone Script. Coded with high professional acumen to provide corporate networking solutions. Use this super-efficient script to fastrack launching of your own website. High in demand, this W3 compliant, search friendly, mobile responsive and easily editable product is indeed a users delight!
This lab is studying the function & pharmacology of heterologously expressed nAChRs in cloned cells & native nAChRs in neurons isolated from brain tissue.
Using a genome-scale approach to study transcription levels in a human CD8+ T-cell clone, a recent study has suggested that the repertoire of molecules on the surface of T cells …
Possibly a intersectClone or somesuch would be useful and could be faster, taking advantage of the fact that the text must be the same. Also, d.clone could be made faster by the asumption that once a cell is a clone of something, it will never change: the root clone stays. Tuomas ...
prior to its discontinuation, i had a lot of success with superdrol. i did two cycles, one bulking and one cutting. i followed all the advice given in
I ve asked this question before and i know there is not exact answer so I am hoping for a little speculation from the experts. If just harvested some
pF1KB6168 4922 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCCATGAGTGCTGCA GTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCCGGGGTCCCCGGA GTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATCCCGGAGGTCCTA GTGGACCCACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGCAAGGGCGGCTTT GCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAGGTGTTCGCGGGCAAGATTGTG CCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATGGAAATATCCATT CACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTCGAGGACAACGAC TTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAGCTGCACAAGAGG AGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATTGTGCTTGGCTGC CAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTG AATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGAC GGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGC AAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTG TTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAG AAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAG ...
pF1KB0922 4148 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCCATGGCCCGGCCG CAGAGGACTCCGGCGCGCAGTCCCGATAGCATCGTCGAGGTGAAGAGCAAATTTGACGCC GAGTTCCGACGCTTCGCGCTGCCTCGCGCTTCGGTGAGCGGCTTCCAGGAGTTCTCGCGG TTGCTGCGGGCGGTGCACCAGATCCCGGGCCTGGACGTGCTACTTGGCTATACGGATGCT CATGGCGACCTGCTGCCCCTCACCAACGACGACAGCCTGCACCGGGCCCTGGCCAGCGGG CCCCCGCCACTGCGCCTACTGGTGCAGAAGCGGGAAGCTGACTCCAGCGGCCTGGCTTTT GCCTCCAACTCTCTGCAGCGGCGCAAGAAAGGGCTCTTGCTGCGGCCAGTGGCACCCCTG CGCACCCGGCCACCCTTGCTAATCAGCCTGCCCCAAGATTTCCGCCAGGTTTCCTCAGTC ATAGACGTGGACCTACTGCCTGAGACCCACCGACGGGTGCGGCTGCACAAGCATGGTTCA GACCGCCCCCTGGGCTTCTACATCCGAGATGGCATGAGCGTGCGTGTGGCTCCCCAGGGC CTGGAGCGGGTTCCAGGAATCTTCATCTCCCGCCTGGTACGTGGGGGTCTGGCTGAGAGT ACAGGGCTGCTGGCGGTCAGTGATGAGATCCTCGAGGTCAATGGCATTGAAGTAGCCGGG AAGACCTTGGACCAAGTGACGGACATGATGGTTGCCAACAGCCATAACCTCATTGTCACT GTCAAGCCCGCCAACCAGCGCAATAACGTGGTGCGAGGGGCATCTGGGCGTTTGACAGGT CCTCCCTCTGCAGGGCCTGGGCCTGCTGAGCCTGATAGTGACGATGACAGCAGTGACCTG ...
https://kdvr.com/news/california-family-spends-50000-to-clone-dog-that-saved-their-lives/ I know a lot of PSers have e-rings that exceed 50K, so my...
Monoclonal expansion of B cells and plasma cells, producing antibodies against self molecules, can be found not only in different autoimmune diseases, such as peripheral neuropathy (PN), but also in malignancies, such as Waldenstr?ms macroglobulinaemia and B-type of chronic lymphocytic leukaemia (B-CLL), as well as in precancerous conditions including monoclonal gammopathy of undetermined significance (MGUS). time. PIK3CD The anti-P0 antibodies were of IgM- type. The antibodies belonged to the VH3gene family with presence of somatic mutations. The IgM reacted with P0 and myelin-associated glycoprotein (MAG), and showed no evidence for polyreactivity, in contrast to other IgM CD5+clones included in the study as controls. The expanded clones expressed CD80 and HLA-DR, which is compatible with properties of antigen-presenting cells. The immunomagnetic selection technique was successfully used for isolation SM-406 of antimyelin protein P0-specific clones. The cell lines may provide useful tools in ...
The role of clonal complexity has gradually been accepted in infection by Mycobacterium tuberculosis (MTB), although analyses of this issue are limited. We performed an in-depth study of a case of recurrent MTB infection by integrating genotyping, whole genome sequencing, analysis of gene expression and infectivity in in vitro and in vivo models. Four different clonal variants were identified from independent intrapatient evolutionary branches. One of the single-nucleotide polymorphisms in the variants mapped in mce3R, which encodes a repressor of an operon involved in virulence, and affected expression of the operon. Competitive in vivo and in vitro co-infection assays revealed higher infective efficiency for one of the clonal variants. A new clonal variant, which had not been observed in the clinical isolates, emerged in the infection assays and showed higher fitness than its parental strain. The analysis of other patients involved in the same transmission cluster revealed new clonal variants acquired
De heer, D H. and Edgington, T S., "Clonal heterogeneity of the anti-erythrocyte autoantibody responses of nzb mice." (1974). Subject Strain Bibliography 1974. 168 ...
Based on our knowledge of the cell division pattern of the early developing mandibular region (see above) we were able to look at its morphogenesis at a very high level of resolution. By means of single cell labeling with the fluorescent dye DiI we were able to reconstruct and analyze the clonal composition of the mandibular region from the beginning of ectodermal proliferation up to the differentiation of the mouthparts. The cell labeling reveals that the paragnaths have their origin in the area I and area II which comprises columns 1 to 3 of region E(0). The mandibles originate from cells of the areas II and III (columns 2 to 4). Areas I and II contribute also to the sternal region and the mandibular ganglia whereas area III forms parts of the tergites as well. In more posterior segments, columns 1 and 2 mainly contribute to the formation of segmental ganglia and probably sternites, and columns 3 to 5 mainly give rise to limbs [36, 46]. Hence, when compared with clonal composition of the ...
Townsend, A R. and Skehel, J J., "Influenza a specific cytotoxic t-cell clones that do not recognize viral glycoproteins." (1982). Subject Strain Bibliography 1982. 1222 ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Cancer progression in humans is difficult to infer because we do not routinely sample patients at multiple stages of their disease. However, heterogeneous breast tumors provide a unique opportunity to study human tumor progression because they still contain evidence of early and intermediate subpopulations in the form of the phylogenetic relationships. We developed a method we call Sector-Ploidy-Profiling to study the clonal composition of breast tumors. SPP involves macro-dissecting tumors, flow-sorting genomic subpopulations by DNA content, and profiling genomes using comparative genomic hybridization. Breast carcinomas display two classes of genomic structural variation: (1) monogenomic and (2) polygenomic. Monogenomic tumors appear to contain a single major clonal subpopulation with a highly stable chromosome structure. Polygenomic tumors contain multiple clonal tumor subpopulations, which may occupy the same sectors, or separate anatomic locations. In polygenomic tumors, we show that ...
Deleting CD98hc in T cells blocks their ability to cause autoimmune diabetes, and CD98-null T cells exhibit defective clonal expansion but intact effector function. Therefore, we asked whether the clonal expansion defect explained the protection from T1D observed with the loss of T cell CD98hc. First we examined the ability of OT-1, dLck-Cre+, Slc3a2fl/fl T cells to home and to proliferate in the pancreatic lymph nodes of RIPmOVA recipient mice. CD98hc-null OT-1 CFSE-labeled T cells homed efficiently, as evidenced by similar numbers of purified naive OT-1, dLck-Cre+, Slc3a2fl/fl or control OT-1, Slc3a2fl/fl T cells in pancreatic draining lymph nodes 2 d after transfer (Figs. 1C, bar graph, 7A, graph). However, control OT-1, Slc3a2fl/fl T cells were beginning to divide at 2 d after transfer, whereas the CD98-null cells were not (Fig. 7A), despite becoming activated in pancreatic lymph nodes. The results of this clonal expansion defect were apparent 4 d after transfer when the abundance of CD98+ ...
I am presently looking at cytokine mediated differential gene expression in T cells. Ideally I would like to use human T cell clones derived from subjects with rheumatoid arthritis. I dont have much experience in T cell cloning and I am led to believe that it is very time consuming and not always successful. Any help along this line would be most appreciated, particularly a contact address/number for someone who may have developed such clones already. I can be contacted directly at dh5 at holyrood.ed.ac.uk Thanx in advance, Dave Hunter ...
IL-17 producing γδ T cells (γδT17) promote numerous autoimmune diseases such as psoriasis and arthritis, as well as, cancers of the colon, lung and breasts. Yet γδT17 peripheral regulation has yet to be thoroughly explored. In mice deficient in IL-17 signaling, we observed expansion of γδT17 in all major tissues. However, γδT17 expansion was not uniformly distributed systemically and was most prominent in oral draining cervical lymph nodes (LNs) with monoclonal expansion of Vγ6 γδT17. In vitro proliferation assays of these cervical LNs showed endogenous proliferation by γδT17 dependent on cell-to-cell contact with CD103+ DCs. CD86+ and CD80+ activated CD103+ DCs are increased in the oral draining LNs suggesting that perhaps microbiota-activated CD103+ DC expand γδT17. 16s rRNA FISH hybridization shows increase in 16s rRNA in oral draining LNs. Treatment of mice deficient in IL-17 signaling with α-LTBR-Ig (to remove LNs) or oral broad-spectrum antibiotics abrogates γδT17 expansion.
Milli-Mark Anti-CD38-FITC Antibody, clone AT13/5 is an antibody against CD38 for use in FC. Find MSDS or SDS, a COA, data sheets and more information.
The organization seeks to identify new anti-cancer drugs that contain the cancer, develop natural immunity to the cells, and reduce the emergence of tumor cell clones.. Parents and families around the globe, including over 200 children in Arizona every year, are desperately searching for help, answers and treatment when their child is diagnosed with cancer and the Steele Childrens Research Center strives to provide them with the most current and effective cures that will keep their families whole.. Since its founding, the Phoenix Womens Board of the Steele Childrens Research Center, known as PANDA (People Acting Now Discover Answers), has raised more than $5.25 million to improve treatments and cures for devastating childhood diseases as well as to fund and recruit internationally recognized pediatric physicians and scientists to Arizona, providing local families with the most cutting-edge medical care.. Last year, they opened an office in the Arcadia neighborhood of Phoenix, located at 4455 ...
Purified helper-inducer (T4+) and suppressor-cytotoxic (T8+) lymphocytes from eight patients with acquired immunodeficiency syndrome (AIDS) and eight healthy heterosexual donors were examined by limiting dilution analysis for their ability to be clonally expanded. It was demonstrated that viable T4+ and T8+ lymphocytes from patients with AIDS had markedly reduced proportions of clonable cells compared to the healthy donors (T4 = 1:255 vs. 1:34, P = 0.06; T8 = 1:355 vs. 1:55, P = 0.01). However, the cloned T cells that were obtained from the patients with AIDS demonstrated normal proliferation in response to phytohemagglutinin and alloantigen, and normal ability to help or suppress pokeweed mitogen-driven IgG synthesis. These results strongly suggest that, in addition to a quantitative diminution of T4+ lymphocytes in AIDS, there is an intrinsic functional defect in the surviving T4+ and T8+ lymphocytes, which is reflected by a severe decrease in their potential for clonal expansion. ...
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
I disagreed wih the the production of human clones. One reason was that I could not think of a practical reason to make more people. Dont we have enough already? One might say that we can, in a way, bring people back from the dead. I know thats probably not a good way to put it, but Im hoping that you get the jist of what Im saying. I dont think people would accept clones the way they accept real people; its just not the same thing. I dont think many people would like to buy a clone. I know I wouldnt. So really, I think making clones is a waste of time. Theres no real purpose for it, and its a waste of money (we brought up the topic of space travel at this point...). Making clones for a war, like Star Wars, also seemed pretty bizzare. If one were to create a million clones to go to war, Im not sure they would obey. Their purpose is to die, or to kill. As blan as the clones would be, their sense of moral would be intact Im sure. You cant order a living thing to die in these ...
Although there is multiple evidence for the functional heterogeneity and polyclonality of TRAb (1 - 3) both statements are questioned by some investigators (4, 5). Furthermore there is growing...
A phase 0, exploratory study of the pharmacodynamics of a single intratumoral dose of IMCgp100, a monoclonal T cell receptor anti-CD3 scFv fusion protei
On 3/16/17, Charles Leifer ,[email protected], wrote: , Hi, Im attempting to clone the source tree using the instructions from the , website (http://www.sqlite.org/getthecode.html#clone), but Im getting an , error when Artifacts received hits 58416: , , $ fossil clone http://www.sqlite.org/cgi/src sqlite. ...
MagickWand *mw_rgba = NewMagickWand(); MagickReadImage(mw_rgba, "E:\\temp\\1.png"); MagickWand *mw_red = CloneMagickWand(mw_rgba); MagickWand *mw_green = CloneMagickWand(mw_rgba); MagickWand *mw_blue = CloneMagickWand(mw_rgba); MagickWand *mw_alpha = CloneMagickWand(mw_rgba); // -channel RGBA -separate ? MagickSeparateImageChannel(mw_red, RedChannel); MagickSeparateImageChannel(mw_green, GreenChannel); MagickSeparateImageChannel(mw_blue, BlueChannel); MagickSeparateImageChannel(mw_alpha, AlphaChannel); // ( +clone -remap pattern:gray50 ) MagickWand *mw_clone = CloneMagickWand(mw_alpha); // +clone ? MagickRemapImage(mw_clone, mw_rgba, FloydSteinbergDitherMethod); // -remap ? MagickThresholdImage(mw_clone, QuantumRange * 50.0 / 100); // pattern:gray50 ? // +swap -combine ? MagickSetImageAlphaChannel(mw_clone, ActivateAlphaChannel); //MagickSetImageAlphaChannel(mw_alpha, ActivateAlphaChannel); MagickCompositeImage(mw_red, mw_green, CopyGreenCompositeOp, 0, 0); MagickCompositeImage(mw_red, mw_blue, ...
magick -respect-parenthesis \ \( 6214291349a70-af1a-431a-8186-0ced1d8e8c4d.png -fuzz 50% -fill "rgb(225,225,225)" -opaque black -quality 20 \) \ \( -clone 0 -background "rgb(53,63,124)" -shadow 50x1+2+1 \) \ \( -clone 0 -background black -shadow 30x1-2-1 \) \ \( -clone 0 -clone 1 -clone 2 -reverse -background none -layers merge -quality 20 +repage +write output_text.png \) \ null ...
Gentaur molecular products has all kinds of products like :search , Accu \ Mouse TCR D011.10, Clone KJ1_26, Mab anti_, FITC \ ACL7214F for more molecular products just contact us
Gentaur molecular products has all kinds of products like :search , Accu \ CD117, c_kit, Clone 2B8, Rat Mab anti_Mouse, PE_Cy5 \ ACL8932TC for more molecular products just contact us
News surrounding the first primate clones is mostly positive and focused on the furthering of future research, but itll also perpetuate animal abuse.
Next-day shipping cDNA ORF clones derived from LOC100287387 uncharacterized LOC100287387 available at GenScript, starting from $99.00.
Molecular Cloning, also known as Maniatis, has served as the foundation of technical expertise in labs worldwide for 30 years. No other manual has been so popular, or so influential.
Clone dating show - Is the number one destination for online dating with more relationships than any other dating or personals site. If you are a middle-aged man looking to have a good time dating woman half your age, this advertisement is for you. Rich woman looking for older woman & younger man. Im laid back and get along with everyone. Looking for an old soul like myself. Im a woman. My interests include staying up late and taking naps.
Hi-Tech Pharmaceuticals has released HydroxyElite, which is basically an OxyELITE Pro replacement / clone that INCLUDES 1,3 Dimethylamylamine (DMAA)!
Expression ClonesSSGCID clones are available to order free of charge (except for shipping) from SSGCIDs clone repository. The clones represent un-induced expression constructs which have been verified by sequencing from vector primers.
Although cloning and expression of T-cell Receptors (TcRs) has been performed for almost two decades, these procedures are still challenging. For example, the use of T-cell clones that have undergone limited expansion as ...
PRIMARY OBJECTIVES:. I. To determine the safety and feasibility of infusing gene-modified, human immunodeficiency virus (HIV)-protected hematopoietic stem cells (HSC) after high-dose chemotherapy for treatment of acquired immunodeficiency syndrome (AIDS)-related lymphoma.. II. To determine the dose of carmustine (BCNU) in combination with O^6-benzylguanine (O6BG) that results in selection in vivo of gene-modified HIV-resistant cells.. III. To estimate the effect of HIV infection on the presence of HIV-resistant blood cells as measured by genetic marking for vector sequences before and after antiviral treatment interruption.. SECONDARY OBJECTIVES:. I. Evaluate the molecular and clonal composition of gene-modified cells after hematopoietic cell transplant (HCT).. II. Evaluate the molecular and clonal composition of gene-modified cells after O6BG/BCNU.. III. Determine the correlation of the level of O6-methylguanine- methyltransferase (MGMT) (P140K) marking with toxicity and response.. IV. ...
A panel of antigen-specific mouse helper T cell clones was characterized according to patterns of lymphokine activity production, and two types of T cell were distinguished. Type 1 T helper cells (TH1) produced IL 2, interferon-gamma, GM-CSF, and IL 3 in response to antigen + presenting cells or to Con A, whereas type 2 helper T cells (TH2) produced IL 3, BSF1, and two other activities unique to the TH2 subset, a mast cell growth factor distinct from IL 3 and a T cell growth factor distinct from IL 2. Clones representing each type of T cell were characterized, and the pattern of lymphokine activities was consistent within each set. The secreted proteins induced by Con A were analyzed by biosynthetic labeling and SDS gel electrophoresis, and significant differences were seen between the two groups of T cell line. Both types of T cell grew in response to alternating cycles of antigen stimulation, followed by growth in IL 2-containing medium. Examples of both types of T cell were also specific for ...
Brief report: a single neoplastic clone in sequential biopsy specimens from a patient with primary gastric-mucosa-associated lymphoid-tissue lymphoma and Sjögrens syndrome. New England Journal of Medicine New England Journal of Medicine 0028-4793 10.1056/NEJM199307153290305
During this time, a hot line with a reference lab will be established to answer technical questions.. A meeting six months later will concentrate on evaluating the results from each laboratory, the consistency of the results and potential for applying within trials. At this meeting an approach to external quality control will be established. At year one a further meeting will evaluate the results, the functioning of the EQUAS and value of each of the probe sets. At this point we will initiate a program to develop and optimize the probes. At year one we will start to map and recruit laboratories to the assay network. By 18 months we will have a fully established network into which we can introduce the necessary technology. ...
The liver is the major site of clearance and degradation of foreign antigens from the portal circulation. Despite the presence of hepatic accessory cells, antibody responses to orally administered antigens are uncommon. To ascertain if hepatic accessory cells are incapable of stimulating specific subsets of T lymphocytes, freshly isolated hepatic nonparenchymal and splenic cells were cultured with a panel of antigen-specific, H-2-restricted Th1 and Th2 HTL clones. Whereas spleen cells stimulated the proliferation of both Th1 and Th2 clones, hepatic nonparenchymal cells (NPC) stimulated the proliferation of only Th1 and not Th2 clones. Adding rIL-1, rIL-6, and rIL-7, alone or in combination, to the cultures did not result in proliferation of the Th2 clones. Despite the absence of Th2 proliferation, NPC were able to stimulate the secretion of IL-3 and IL-4 by Th2 clones in the presence of antigen. Moreover, adding hepatic NPC did not inhibit spleen cells from stimulating Th2 clones in the presence ...
Understanding the kinetics and molecular events underlying trafficking of HSCs is important both in basic hematology research and for implementation and interpretation of experimental and clinical BM transplantation protocols. Here, we studied posttransplantation skeletal distribution of hundreds of HSC clones to address the extent of migration in steady-state conditions and upon G-CSF-induced mobilization. Genetic barcoding of highly purified hematopoietic cells was used to quantitatively analyze HSC clone sizes in different bones and contributions of these clones to blood.. Our findings demonstrate that at very extended time intervals (at least 11 mo) after transplantation, the distribution of both old and young HSC clones across multiple skeletal sites is highly skewed. This is in line with data showing relatively slow rates of HSC equilibration in parabiotic mice (Abkowitz et al., 2003). However, our findings are in contrast with a study that suggested that 1-5% of HSC pool circulates daily ...
To evaluate the impact of immunodominance on CD8 T-cell properties, we compared the functional properties of dominant and subdominant populations in the response to lymphocytic choriomeningitis virus (LCMV). To improve functional discrimination, in addition to the usual tests of phenotype and function, we used a sensitive technique that allows the screening of all CD8 effector genes simultaneously in single cells. Surprisingly, these methods failed to reveal a major impact of clonal dominance in CD8 properties throughout the response. Aiming to increase clonal dominance, we examined high-frequency transferred P14 T-cell receptor transgenic (TCR Tg) cells. Under these conditions LCMV is cleared faster, and accordingly we found an accelerated response. However, when Tg and endogenous cells were studied in the same mice, where they should be subjected to the same antigen load, they showed overlapping properties, and the presence of P14 cells did not modify endogenous responses to other LCMV epitopes or a
In contrast to the ease of cloning and characterizing, at the molecular level, helper and cytotoxic T cells, suppressor T cells remain an enigma, and their existence as discrete entities is being increasingly challenged. Here we review evidence that CD4+ regulatory clones, capable of expressing both helper and suppressor functions, may account for much of the suppressor function. It is suggested that a single T cell clone, depending on the signals it receives from its environment, may release either helper or suppressor cytokines. Studying such clones under defined conditions (providing suppressor signals), may preclude detection of their helper capacity. Since some therapeutic approaches in various human diseases are based on the manipulation of helper and suppressor functions, the question whether committed suppressor cells exist has important practical implications in medicine.
Figure 1. Stem cell dynamics in tumour initiation illustrated by quantifying the clonal benefit of KrasG12D (from Vermeulen et al., Science 2013; 342: 995). (A) Intestinal stem cells are equipotent and continuously replace each other in a stochastic fashion. (B) Confocal images of SI crypt bottoms of AhCreER/tdTom-/fl mice (WT) and AhCreER/tdTom-/fl/Kras-G12Dfl (KrasG12D) at the indicated time points after clone induction. Clone sizes are indicated as fractions (in eighths) of the crypt circumference. Blue, nuclear stain (DAPI); red, tdTom expression; scale bars represent 30mm. (C and D) The distribution of clone sizes and the corresponding distribution changes caused by the activation of Kras can be captured using stochastic models. The models describe the competition between the stem cells and summarise the fitness of the mutant stem cell via PR, the probability that the mutant will replace its neighbour. A value of PR = 0.5 means that the mutant stem cell is as fit as the WT cells and a value ...
HLA-DR3- and HLA-DRw52-associated functional polymorphism was investigated with selected tetanus toxoid (TT)-specific T cell clones. We have shown earlier that HLA-DR antigens are encoded by two distinct loci, DR beta I and DR beta III. The alloantigenic determinant(s) defined by the serological HLA-DR3 specificity map to the former, while the supratypic HLA-DRw52 determinants map to DR beta III. Furthermore, we have recently recognized by DNA sequencing three alleles of HLA-DRw52 at locus DR beta III, referred to as 52 a, b, and c. Our objective was to correlate the pattern of T cell restriction with the gene products of individual DR beta chain loci and with the three newly described alleles of locus DR beta III. Among the selected T cell clones, 5 reacted exclusively when TT was presented by HLA-DR3+ APCs (TT-DR3-APC). In contrast, two T cell clones were stimulated by TT-DRw52-APC. More specifically, these two T cell clones (Clones 10 and 16) were stimulated by different subsets of ...
The vast majority of proviruses that persist on ART are defective. Of the minority that are intact (~2%), the fractions that are latent or transcriptionally active are not known. To address this question, we determined the fraction of proviruses that express HIV RNA in vivo in cell populations carrying either intact or defective proviruses.. PBMC were obtained from Patient #1 in Maldarelli, et al. (Science, 2014). This donor had multiple clones of cells that contain intact or defective proviruses. Proviral expression was determined by single-genome pro-pol sequencing (SGS) of HIV DNA and RNA from multiple aliquots of PBMC diluted to an endpoint such that each aliquot contained one to a few HIV RNA expressing cells. Intact proviruses were identified using viral outgrowth assays (VOA). The levels and fractions of cells expressing HIV RNA were determined for probable clones (identified by identical sequence matches) carrying intact and defective proviruses.. A total of 77 million PBMC were ...
Tumor cell clones isolated from a rat 13762NF mammary adenocarcinoma and its spontaneous metastases were heterogeneous in their survival responses to continuous 42° heating. Clones MTLn3 and MTF7 had similar initial survival responses; they were significantly less sensitive than clone MTC. Following the first decrease in survival, different magnitudes of induced thermal resistance were observed. When ratios of the first and resistant slopes of survival curves were compared (the thermotolerance ratio), the order of induced thermal resistance was MTLn3 , MTF7 , MTC.. These clones were compared for the rates of synthesis of heat stress proteins (HSP). The same four major HSP at Mr 112,000, 90,000, 70,000, and 22,000 were induced or enhanced in all 3 clones. The rates of synthesis of these HSP were analyzed through a unique system of computer-assisted video densitometry and digitization. When all 4 HSP were analyzed as a group, the rates were significantly different (p , 0.017), and the rank order ...
The outcome of patients with MM has improved substantially during the last decades as a result of drug development and progress in the understanding of disease biology.11,12 However, even in the era of novel agents some patients with high-risk cytogenetic abnormalities or early relapse after first-line treatment have a dismal outcome.13,14 Clonal heterogeneity and evolution are contributors to disease progression and ultimately refractoriness in MM.6 So far, there are only limited data available that proved clonal evolution in patients relapsing after ASCT for newly diagnosed disease. With our current analysis of 128 patients with FISH data at primary diagnosis and relapse after ASCT we demonstrate that high-risk cytogenetic abnormalities occur more frequently at relapse. This observation was especially due to de novo gains of chromosome 1q and new deletions of chromosome 17p. No changes were observed between primary diagnosis and relapse for defined IGH translocations, including t(4;14).. A ...
Re: [PATCH 1/6] selftests/clone3: convert test modes into an enum 2019-09-10 12:03 ` [PATCH 1/6] selftests/clone3: convert test modes into an enum Eugene Syromiatnikov @ 2019-09-16 16:28 ` shuah 0 siblings, 0 replies; 13+ messages in thread From: shuah @ 2019-09-16 16:28 UTC (permalink / raw) To: Eugene Syromiatnikov, linux-kernel, Christian Brauner, linux-kselftest Cc: Adrian Reber, shuah On 9/10/19 6:03 AM, Eugene Syromiatnikov wrote: , * tools/testing/selftests/clone3/clone3.c (CLONE3_ARGS_NO_TEST, , CLONE3_ARGS_ALL_0, CLONE3_ARGS_ALL_1): Change into an enum. , (call_clone3): Change test_mode parameter type to enum test_mode; , use switch statement for actions that dependent on test_mode selection. , (test_clone3): Change test_mode parameter type to enum test_mode. , You dont need the file name in the commit log. Please describe what you are fixing/doing in the commit. Describing the actual code changes doesnt help. Including why these changes are needed as opposed the actual changes will ...
Get Cell Cloning Cylinders at Spectrum Chemical. SpectrumChemical.com carries a full line of fine chemicals, lab appliances and lab supplies. Spectrum Chemical has a complete line of laboratory supplies, equipment and safety items.
Over the past two years, a team led by biologist Teruhiko Wakayama at the University of Hawaii has produced six generations of cloned mice clones of clones of clones of clones of clones of clones. The researchers paid particular attention to the animals telomeres, the caps at the tips of their chromosomes. These genetic caps are associated with aging. They grow shorter over time and are thought to contribute to cell death as they wear away. In conventional reproduction, telomeres are restored during the formation of sperm and egg cells, but cloning bypasses that process. "We might therefore expect telomeres to become shorter and shorter in successive generations of clones," says Tony Perry of Rockefeller University, one of Wakayamas collaborators. "Bafflingly, they seem to get longer ...
Effective neutralization of different strains of HIV virus is shown by neutralizing antibodies against HIV-1 envelope glycoproteins. It has been demonstrated that gp41 is involved in virus mediated membrane fusion which results in HIV-entry into target cells. Recombinant single chain antibodies (scFvs) with high specificity and high affinity properties have been identified as useful agents in anti-viral targeted therapy. In this study we selected specific scFvs against a conserved neutralizing epitope of gp41. Four rounds of panning were performed to select the specific clones. The reactivity of the selected scFvs against the corresponding epitope was tested in ELISA. Results demonstrated that the specific clones were selected with the frequencies of 65% and 30%. The ELISA evaluation demonstrated significant higher OD of scFvs in reaction with the corresponding epitope than the negative control. Specific scFvs against conserved neutralizing epitope of gp41 of HIV has the potential to be ...
Nov 13, 2007, 22:49. Todo lo que Tú Querías Saber Sobre los Robotoides y Clones. Por Candace. 2007-11-10. Hola a todos, puesto que recientemente Patrick Bellringer ha estado haciendo énfasis en los clones, es tiempo de aclarar más completamente los misterios. Primero usemos dos términos diferentes: clones y Robotoides. Un clon ç en esta discusión significará los clones que ustedes ven en el gobierno, tales como el residente y no-electro clon que funciona en la Casa Blanca, y todos sus cómplices clones. La mayoría de estos clones son hechos en cuestión de algunas semanas, de células tomadas del cuerpo original, ya sean que se trate de humanos reales o robotoides. ¿Así que entonces que es un robotoides? No es exactamente un clon, como se describe arriba. Aproximadamente en el año 2500 A.C.a los propietarios del planeta les preocupaba que aquellos sobrevivientes del último viaje a través del Cinturón de Fotones, del gran diluvio y de otras calamidades se volviera nuevamente por ...
Based in Abingdon (UK) and Philadelphia (USA) were a privately owned biotechnology company developing innovative biological therapeutics for the treatment of a range of serious diseases. Our world-leading T cell receptor technology exploits the power of the bodys own immune system to find and kill diseased cells. Weve established a robust technology platform which combines monoclonal T cell receptor (mTCR) targeting technology with an effector technology, anti-CD3 scFv, that catalyses the killing of the targeted diseased cells by the hosts own non-specific cytotoxic T cells. And were developing a portfolio of products from the platform, called ImmTACs, for the treatment of cancer, chronic infectious disease and diabetes.. ...
Mouse monoclonal antibody raised against full length recombinant human MB. Recombinant protein corresponding to full length of human MB. (MAB12457) - Products - Abnova
Mouse monoclonal antibody raised against partial recombinant PNPLA2 . Recombinant protein corresponding to amino acids 30-504 of human PNPLA2 . (MAB3210) - Products - Abnova
Reagents. shRNA lentiviral constructs targeting ITPKB, NOX4, NOX1, IPMK, and TRC Human Kinase shRNA Gene Family Library were purchased from GE Healthcare Dharmacon. sgRNA lentiviral constructs to target ITPKB were obtained from Genecopoeia. The shRNA sense strand sequences were ACAGCTATGGAAATTGACAAA (ITPKB shRNA clone 1), GCCTTCAGAGAGTTCACTAAA (ITPKB shRNA clone 2), CCCTCAACTTCTCAGTGAATT (NOX4 shRNA clone 1), CAGAGTTTACCCAGCACAAAT (NOX4 shRNA clone 2), CCGCACACTGAGAAAGCAATT (NOX1 shRNA clone 1), CCAAGGTTGTTATGCACCCAT (NOX1 shRNA clone 2), GCCCTGTATAATGGATGTAAA (IPMK shRNA clone 1), and GCAAGTTCATTACTCTTTGTT (IPMK shRNA clone 2). ITPKB sgRNA sequences were AGCCGAGTCGCTGTCCCCCG (ITPKB sgRNA clone 1) and CGGGGGCGTCTCGCTGCCAC (ITPKB sgRNA clone 2). Primers for ITPKB shRNA-resistant silent mutant and ITPKB kinase-dead D897N mutant were obtained from Integrated DNA Technologies. Bt2-Ins (1345) P4/PM was obtained from SiChem. GKT137831, Z-VAD-fmk, cyclosporin A, and necrostatin-1 were from Selleckchem. ...
For some time, scientists have been able to craft precise genetic copies of many creatures. Whether they are animals, or single cells, they are similarly refereed to as clones. For various technical and perceived ethical reasons, the procedures involved have been difficult to replicate for humans. A new paper published in the journal Cell shares the work of a group of researchers in Oregon who have grown a human clone - at least up to a couple hundred cells.. ...
At the peak of an immune response, hundreds of thousands of identical T cells are scampering about, searching out the pathogen and doing their own special T cell things to try to get rid of it. We know that these hundreds of thousands of cells werent there at the onset of infection; the whole T cell schtick involves rapid expansion of very, very rare cells. Only a very few T cells are able to recognize any particular antigen; but within a few days, the progeny of those rare cells are now common, and all retain their ability to recognize the same antigen. 1. In the past few years, weve learned a little more, quantitatively, just how dramatic this expansion phase is. Delicate work has established that there are maybe 20 to 1000 potentially-reactive T cells in a mouse, before infection (see my discussion here and here). Those few cells are the precursors of the huge numbers of T cells a week or so after infection.. If you think about it, its pretty remarkable that these few T cells, hidden ...
北京大学定量生物学中心学术报告 题目: Modeling clonal populations in hematopoiesis and T cell dynamics报告人: Tom ChouProfessor, Depts. of Computational Medicine and Mathematics, UCLAwww.math.ucla.edu/~tcho
TRI-EDRE is pleased to announce the avaibility of Clone X 2.0.2 (*) This is a free update for owners of Clone X 2.x. Clone X 2 Clone X is a disk copy utility for Mac OS X. Clone X features the copy of an entire disk to another disk, or to a set of CDs or DVDs. Copies are fully functional. Clone X provides restoration features as well, and bootable CD creation. Clone X offers a set of tools to efficiently do your copies, including: - the copy of entire disk with all their caracteristics, applications, users and their documents and settings - the copy of disks, without the Users data (for example to create a master that can be used to install the same System and applications on different machines). - the restoration of your disk, to put it back into a previous state and contents (as it was during the copy). - the creation of OS X bootable CD including your applications - the creation of disk with a minimal System (for a small or emergency disk, for test, etc.). - disks comparison. Clone ...
I suspect that over time, cloning will become more and more economically viable, and you may see people jump on the clone bandwagon to get their next competition horses, however I think theyll find out quickly that there is more than genetic material to insuring a good performance career. I will not be surprised in my lifetime (not the near future, but down the road) to see clones available for sale from top competition horses, much the way that ET foals are available now. Headley Britannia has a few foals on the ground and she just retired this year ...
Myc-DDK-tagged ORF clone of Homo sapiens MLF1 interacting protein (MLF1IP) as transfection-ready DNA - 10 µg - OriGene - cdna clones
The structured clone algorithm is an algorithm defined by the HTML5 specification for copying complex JavaScript objects. It is used internally when transferring data to and from Workers via postMessage() or when storing objects with IndexedDB. It builds up a clone by recursing through the input object while maintaining a map of previously visited references in order to avoid infinitely traversing cycles.
To clone a sitemap page or a group of pages, follow these steps: Hover your mouse the sitemap cell you wish to clone. Click the arrow...
To request individual clones from the collection, view the list and click "add to cart" (far right-hand side of the table) to add individual clones to your cart. ...
To request individual clones from the collection, view the list and click "add to cart" (far right-hand side of the table) to add individual clones to your cart. ...
Resumo: Introdu o: endometriose uma doen a benigna, capaz de progredir extensamente e gerar clones at picos. Considerada precursora dos carcinomas de c lulas claras (CCOC) e endometri ide (EOC) de ov rio, atualmente chamados carcinomas de ov rio associados endometriose (EAOC). Objetivos: comparar o perfil epidemiol gico, a associa o com endometriose e a express o de marcadores imuno-histoqu micos para ARID1A, VEGF, PD-L1 e PARP-1 em mulheres com CCOC e EOC, e sua correla o com a sobrevida livre de progress o (SLP) e sobrevida global (SG). M todos: estudo de coorte reconstitu da, com 50 casos inclu dos de CCOC e EOC tratados no CAISM-UNICAMP entre 1995 at 2016, acompanhados at 02/2017. Microarranjos de tecido com amostras de CCOC, EOC e endometriose foram corados com anticorpos monoclonais contra ARID1A, e para os biomarcadores proteicos VEGF, PD-L1, PARP-1 atrav s de imuno-histoqu mica. A express o de ARID1A foi classificada (0 a 100) conforme a porcentagem de c lulas n o coradas. A express o de ...
The new ClonePix™2 system from Genetix Ltd. utilizes fluorescence and white light imaging and advanced image analysis capabilities to automatically screen more clones in less time, select cells with optimal expression levels and pick colonies with accuracy and confidence.
MED29 - (untagged)-Human mRNA, cDNA DKFZp434H247 (from clone DKFZp434H247) available for purchase from OriGene - Your Gene Company.
Great news from investigators at the University of Connecticut and the University of Pittsburgh, who were able to produce clones from granulocytes (a type
Explore the Star Wars: The Clone Wars episode Hostage Crisis with an episode guide featuring galleries, behind the scenes videos, and character bios.
A 67-year-old Caucasian male presented with a chief complaint of shortness of breath and fatigue. Initial laboratory evaluation revealed hyperleukocytosis with WBC count of 76,000/mcL and 83% blasts. He immediately received leukapheresis for respiratory symptoms. Bone marrow biopsy and peripheral blood flow cytometry confirmed a diagnosis of acute myeloid leukemia (AML) with normal cytogenetics. Fluorescence in-situ hybridization (FISH) study of the bone marrow was negative for t(8;21), t(15;17), inv(16) and abnormalities of Mixed Lineage Leukemia. Mutation analysis by PCR (Quest Diagnostics, AML Prognostic Panel) showed mutations in nucleophosmin (NPM1) gene and internal tandem duplication in the FMS-like Tyrosine Kinase 3 gene (FLT3-ITD) but wild-type for CCAAT/enhancer binding protein α gene (CEBPA).. The patient received induction chemotherapy with cytarabine and idarubicin (7 3). Day-14 bone marrow biopsy showed a hypocellular marrow with no morphologic evidence of residual AML. ...
The selection of T cell clones with mutations in the hypoxanthine guanine phosphoribosyltransferase (hprt) gene has been used to isolate T cells reactive to myelin basic protein (MBP) in patients with multiple sclerosis (MS). These T cell clones are activated in vivo, and are not found in healthy individuals. The third complementarity determining regions (CDR3) of the T cell receptor (TCR) alpha and beta chains are the putative contact sites for peptide fragments of MBP bound in the groove of the HLA molecule. The TCR V gene usage and CDR3s of these MBP-reactive hprt- T cell clones are homologous to TCRs from other T cells relevant to MS, including T cells causing experimental allergic encephalomyelitis (EAE) and T cells found in brain lesions and in the cerebrospinal fluid (CSF) of MS patients. In vivo activated MBP-reactive T cells in MS patients may be critical in the pathogenesis of MS ...
HIV-epitope-specific T cell responses are critical components of the natural immune response to HIV infection, but these cells often become dysfunctional in chronic infection. Structural diversity within the epitope-specific T cell receptor (TCR) repertoire is likely beneficial in the suppression of viral epitope variants. However, the relationship between the structural and clonotypic composition of the HIV-specific TCR repertoire, clonotypic surface and functional phenotype, and avidity for and exposure to antigen is poorly defined. Dominant and sub-dominant epitope-specific T cell clonotypes were identified and the TCR repertoire was assessed over time. Surface expression of PD-1, CD38, CD127, CD45RO, and CCR7 was measured and used to define exhaustion and memory profiles on epitope-specific T cell populations during chronic infection and after initiation of antiretroviral therapy. Dominant clonotypes in chronic infection express a surface phenotype consistent with exhaustion which is ...
Reliable PCR-based methods for the determination of B cell clonality in both fresh and formalin-fixed paraffin-embedded tissue are now routinely available.35-37 Most importantly, the availability of optimised PCR primers and protocols for the analysis of IGH, IGK and IGL gene rearrangement, developed by the European BIOMED-2 Concerted Action Program, now permits the sensitive, specific, practical and standardised detection of B cell clonality by any pathology laboratory. Approximately 80% of formalin-fixed paraffin-embedded tissue samples yield DNA suitable for BIOMED-2 analysis.. The utility of PCR in the diagnosis of MALT lymphoma has been examined most thoroughly in gastric biopsies. Using current techniques, monoclonal B cell populations are detected in approximately 80-90% of overt gastric MALT lymphomas.38,39 Similarly, the detection of unequivocal B cell monoclonality in a gastric biopsy showing morphological features suspicious for, but not diagnostic of, MALT lymphoma (ie, Wotherspoon ...
5,000 CLL-type lymphocytes per mm³). If the diagnosis of CLL is based on the B cell count rather than the total lymphocyte count (which includes both B and T cells), many patients formerly diagnosed with Rai Stage 0 CLL would instead be classified as having MBL. Molecular techniques can detect monoclonal B cell levels as low as 3-5 B cells/microliter (comparable to the amount of stem cells in peripheral blood). The term "monoclonal B-cell lymphocytosis" was proposed by a consensus committee in 2005 to indicate a monoclonal B cell population in a person with fewer than 5,000 B lymphocytes per microliter (or 5.0 x 109 B lymphocytes/L), no enlarged lymph nodes or enlarged liver and/or spleen or other indications of a lymphoproliferative disorder. MBL has been found in less than 1% of asymptomatic adults under age 40, and in around 5% of adults older than 60. Exact numbers depend on the population studied and the sensitivity of the diagnostic technique. Like CLL, it appears to be more common in ...
This volume reviews the fundamental understanding of this potentially life-threatening disease and the advances in treatment that have been achieved with the use of the monoclonal antibody eculizumab. Although the PIGA gene has been known for many years, the mechanism of clonal dominance in paroxysmal nocturnal hemoglobinuria is still largely unknown. This book, Paroxysmal Nocturnal Hemoglobinuria, discusses the direction of continuing research in this area, as well as the potential for the development of management guidelines. It serves as a valuable source of information for both basic scientists and physicians, especially immunologists targeting GPI-anchored proteins and complements, and hematologists specializing in bone marrow failure. ...
Five immortal cell lines derived from a Li-Fraumeni syndrome patient (MDAH 087) with a germline mutant p53 allele were characterized with respect to telomere length and genomic instability. The remaining wild-type p53 allele is lost in the cell lines. Telomerase activity was undetectable in all immortal cell lines. Five subclones of each cell line and five re-subclones of each of the subclones also showed undetectable telomerase activity. All five immortal cell lines exhibited variability in the mean length of terminal restriction fragments (TRFs). Subclones of each cell line, and re-subclones of the subclones also showed TRF variability, indicating that the variability is owing to clonal heterogeneity. Chromosome aberrations were observed at high frequencies in these cell lines including the subclones and re-subclones, and the principal types of aberrations were breaks, double minute chromosomes and dicentric chromosomes. In addition, minisatellite instability detected by DNA fingerprints was ...

clone cells Protocols and Video...'clone cells' Protocols and Video...

... clone cells include Use of Interferon-γ Enzyme-linked Immunospot Assay to Characterize Novel T-cell Epitopes of Human ... Clone Cells: A group of genetically identical cells all descended from a single common ancestral cell by mitosis in eukaryotes ... Clone cells also include populations of recombinant DNA molecules all carrying the same inserted sequence. (From King & ... Use of Interferon-γ Enzyme-linked Immunospot Assay to Characterize Novel T-cell Epitopes of Human Papillomavirus. Xuelian Wang1 ...
more infohttps://www.jove.com/keyword/clone+cells

Cloning cell phone esn, reverse phone lookup appCloning cell phone esn, reverse phone lookup app

... cloning cell phone esn, find name using phone number india, reverse mobile phone number search uk free, reverse phone lookup ... Comments to Cloning cell phone esn. *. sex_simvol - 08.11.2015 at 18:13:43. More SIM, the only thing there are crimes or ... Cloning cell phone esn,reverse phone lookup,reverse phone lookup india - Plans On 2016. admin , Category: 800 Phone Number , ... Reverse phone lookup uk T mobile phone number to pay my bill New mexico court records Louise arnold Free cell phone tracker ...
more infohttp://s3.amazonaws.com/checkphno/cloning-cell-phone-esn.html

Clone cell phone number phone Jobs, Employment | FreelancerClone cell phone number phone Jobs, Employment | Freelancer

Search for jobs related to Clone cell phone number phone or hire on the worlds largest freelancing marketplace with 15m+ jobs ... Other jobs related to clone cell phone number phone. clone phone number , tell network cell phone number , cell phone number ... cell phone number grabber , cell phone number verifacation , cell phone number verification , clone cell phone number , phone ... view indian cell phone number , upload via cell phone number , cell phone number reverse lookup ukraine , blackberry app clone ...
more infohttps://www.freelancer.com/job-search/clone-cell-phone-number-phone/490/

Korean Researchers to Help Others Clone Cells for Study - The New York TimesKorean Researchers to Help Others Clone Cells for Study - The New York Times

The new institute, the World Stem Cell Foundation, is being announced tonight in Seoul, according to an article in this weeks ... The Korean researchers who pioneered the cloning of human cells say they will set up a worldwide foundation to help create ... Cloning of diseased cells is now seen as one of the most promising applications of embryonic stem cell research. ... scientists in this country have held back from trying to clone human cells. Dr. Hwang says he will perform the cloning service ...
more infohttps://www.nytimes.com/2005/10/19/us/health/korean-researchers-to-help-others-clone-cells-for-study.html

TNO Repository search for: subject:Clone CellsTNO Repository search for: subject:'Clone Cells'

Cancer graft · Clonogenesis · Tumor cell · Animal · Biological Assay · Cell Line · Cell Survival · Clone Cells · Dose-Response ... Animal · Cell Division · Cell Survival · Clone Cells · Colony-Forming Units Assay · Epitopes · H-2 Antigens · Hematopoietic ... T-cell clones · Food allergen · Immunoglobulin e · Interleukin 4 · Interleukin 5 · Adolescent · Case report · Cell clone · ... Cell Differentiation · Cell Survival · Clone Cells · Comparative Study · Disease Models, Animal · Dose-Response Relationship, ...
more infohttps://repository.tudelft.nl/search/tno/?q=subject:%22Clone%20Cells%22

jira] [Created] (HBASE-15721) Optimization in cloning cells into MSLABjira] [Created] (HBASE-15721) Optimization in cloning cells into MSLAB

... cell.getValueLength()); pos = appendKeyTo(cell, output, pos); pos = CellUtil.copyValueTo(cell, output, pos); if ((cell. ... Before cells added to memstore CSLM, there is a clone of cell after copying it to MSLAB chunk area. This is done not in an ... final Cell cell, final byte[] output, final int offset) { int pos = offset; pos = Bytes.putInt(output, pos, keyLength(cell)); ... Anoop Sam John created HBASE-15721: -------------------------------------- Summary: Optimization in cloning cells into MSLAB ...
more infohttp://mail-archives.apache.org/mod_mbox/hbase-dev/201604.mbox/%[email protected]%3E

Cloned Cells essaysCloned Cells essays

Clones Of Cells Inside An Organism 1,003 words Cloning What is a Clone A clone is a group of genetically identical cells. For ... Clones Of Millions Of Cells 446 words Cloning Cloning is the production of duplicate copies of genetic material, cells, or ... Definition of Cloning History of Cloning The Embryo Cloning Process The Human Cloning Process Pros of Cloning Cons of Cloning ... Clone Of Cells 448 words Cloning is a big issue now. Many arguments are going on about cloning humans being immoral. But what ...
more infohttps://essaypride.com/topic/cloned-cells/

Culture of Cloned Cells from the Mouse Preputial Gland Tumor ESR 586 | Cancer ResearchCulture of Cloned Cells from the Mouse Preputial Gland Tumor ESR 586 | Cancer Research

Culture of Cloned Cells from the Mouse Preputial Gland Tumor ESR 586. Toby G. Rossman, Lawrence Prutkin and Victor R. Wheatley ... The cells are grown in a modified CMRL-1415 medium supplemented with 10% fetal calf serum. Clones tend to fall into two classes ... Cells from the mouse preputial gland tumor ESR 586 have been cultured and cloned. Trypsin-ethylenediaminetetraacetate was used ... Preliminary studies on the control of differentiation in Class 1 clones suggest that a minimum cell density is required before ...
more infohttp://cancerres.aacrjournals.org/content/37/2/557

Human embryo stem cells cloning breakthrough - NHSHuman embryo stem cells cloning breakthrough - NHS

Human embryonic stem cells created from adult tissue for first time, The Guardian reports, while the Daily Mails front page ... leads with the somewhat fanciful warning that new research raises the spectre of cloned babies… ... When these stem cells were tested, researchers found that the cells were able to develop into other types of cells in a manner ... The embryonic stem cells were able to develop into several different types of cells, including heart cells. They were also ...
more infohttps://www.nhs.uk/news/genetics-and-stem-cells/human-embryo-stem-cells-cloning-breakthrough/

Melanoma Patient Tumor Free in T-Cell Clone StudyMelanoma Patient Tumor Free in T-Cell Clone Study

Cloned tumor-fighting immune cells cured one of 11 patients with metastatic melanoma in a dramatic demonstration of the power ... Melanoma Patient Tumor Free in T-Cell Clone Study. Immune Therapy for Late-Stage Melanoma: No More Cancer in 1 of 11 Patients ... Successful treatment depended on isolating and cloning just the right kind of cancer-fighting immune cell. This happened in ... late-stage melanoma is cancer free 3.5 years after experimental treatment with clones of his own immune cells. ...
more infohttps://www.webmd.com/melanoma-skin-cancer/news/20120305/melanoma-patient-tumor-free-in-t-cell-clone-study

Wanted - T cell clones, rheumatoid arthritisWanted - T cell clones, rheumatoid arthritis

... Mr. D.N.C. Hunter dhunter at hgmp.mrc.ac.uk Tue Sep 9 09:24:57 EST 1997 *Previous ... I dont have much experience in T cell cloning and I am led to believe that it is very time consuming and not always successful ... Ideally I would like to use human T cell clones derived from subjects with rheumatoid arthritis. ... I am presently looking at cytokine mediated differential gene expression in T cells. ...
more infohttp://www.bio.net/bionet/mm/immuno/1997-September/010957.html

Clones cell - Heroes WikiClones' cell - Heroes Wiki

... cell on her way to Juliens cell. Notes. * In Root and Branch, Part 2, Noahs cell is shown to be directly opposite the clones ... Clones cell • Colobanth Station • Computer control room • Erics cell • Ithaca college • Juliens cell • The Louvre • Micahs ... Several of Julien Dumonts rogue clones are held in this level 5 Company holding cell.. ... After Bianca, Devin, Donna, and Thompson, Jr. apprehend their targets, the targets are put in a level 5 Company holding cell. ...
more infohttp://heroeswiki.com/Duplicates%27_cell

Skin cells cloned into embryonic cells  › News in Science (ABC Science)Skin cells cloned into embryonic cells › News in Science (ABC Science)

A breakthrough in stem cell research has been achieved with scientists using cloning techniques to turn human skin cells into ... Stem cell breakthrough A breakthrough in stem cell research has been achieved with scientists using cloning techniques to turn ... into several different cell types, including nerve cells, liver cells and heart cells," says Mitalipov. ... The work, published today in Cell, uses somatic cell nuclear transfer (SCNT) - the process used to clone Dolly the Sheep. ...
more infohttp://www.abc.net.au/science/articles/2013/05/16/3759974.htm

Human embryo stem cells cloning breakthrough  | NHS Choices | Nursing TimesHuman embryo stem cells cloning breakthrough | NHS Choices | Nursing Times

When these stem cells were tested, researchers found that the cells were able to develop into other types of cells in a manner ... The embryonic stem cells were able to develop into several different types of cells, including heart cells. They were also ... These are then fused with human cells - in this case skin cells - and the fused cell begins behaving in a similar way to an ... This was a laboratory study that aimed to produce embryonic stem cells from adult skin cells. Embryonic stem cells are unique ...
more infohttps://www.nursingtimes.net/home/behind-the-headlines/human-embryo-stem-cells-cloning-breakthrough/5058821.article

Reproductive Human Stem Cell Cloning  	 Essay - 1353 Words - BrightKiteReproductive Human Stem Cell Cloning Essay - 1353 Words - BrightKite

The argument on whether human cloning/stem cell research should be deemed acceptable still e... ... Read this full essay on Reproductive Human Stem Cell Cloning . ... Stem cell cloning and stem cell cloning research should be ... Against Stem Cell Cloning Essay. 1858 words - 7 pages not be destroyed. Stem cell cloning of any types of cell has no definite ... this type of cloning is known as reproductive cloning. This type of cloning uses a process called somatic cell transfer. Cell ...
more infohttps://brightkite.com/essay-on/reproductive-human-stem-cell-cloning

Developmental fate of a distinct class of chick myoblasts after transplantation of cloned cells into quail embryos | DevelopmentDevelopmental fate of a distinct class of chick myoblasts after transplantation of cloned cells into quail embryos | Development

After four days of growth, cells of the transplant-containing quail legs were grown as clones. Chick clones were located by ... Developmental fate of a distinct class of chick myoblasts after transplantation of cloned cells into quail embryos ... Developmental fate of a distinct class of chick myoblasts after transplantation of cloned cells into quail embryos ... Developmental fate of a distinct class of chick myoblasts after transplantation of cloned cells into quail embryos ...
more infohttp://dev.biologists.org/content/58/1/119

CiNii 論文 - 
 		
 		
 			
 		 	
 		 		
 		 			Role of Pseudomonas aeruginosa Culture Filtrates in the Association, Invasion, and...CiNii 論文 - Role of Pseudomonas aeruginosa Culture Filtrates in the Association, Invasion, and...

... and Cytotoxicity Against Cloned Cells from Murine Corneal Epithelium and KB Cells * * ISHINO Gou ... The effects of short-term contact lens wear on adherence of Pseudomonas aeruginosa to human corneal cells HARDING AS ... Relationship between cytotoxicity and corneal epithelial cell invasion by clinical isolates of Pseudomonas aeruginosa FLEISZIG ... Transformation of Mouse Peritoneal Macrophages and Bone Marrow Cells by Simian Virus 40 Takayama Hisao ...
more infohttps://ci.nii.ac.jp/naid/10013263688

First Embryonic Stem Cells Cloned From A Mans Skin | WUNCFirst Embryonic Stem Cells Cloned From A Man's Skin | WUNC

... scientists in Scotland took the nuclear DNA from the cell of an adult sheep and put it into another sheeps egg cell that had ... And with a bit of coaxing, these cells could be turned into nerve cells, pancreas cells, liver cells, heart cells, just about ... But he says this does mean we could be getting closer to being able to go beyond cloned cell lines to cloning an entire human ... HARRIS: And used the DNA from those cells in this cloning process. They injected it into 77 human egg cells and managed to ...
more infohttp://wunc.org/post/first-embryonic-stem-cells-cloned-mans-skin

Pancreatic islet-specific T-cell clones from nonobese diabetic mice | PNASPancreatic islet-specific T-cell clones from nonobese diabetic mice | PNAS

Comparison of a T Cell Clone and of T Cells from a TCR Transgenic Mouse: TCR Transgenic T Cells Specific for Self-Antigen Are ... We have produced a panel of islet-specific T-cell clones from nonobese diabetic (NOD) mice. These clones proliferate and make ... Pancreatic islet-specific T-cell clones from nonobese diabetic mice. K Haskins, M Portas, B Bergman, K Lafferty, and B Bradley ... Most of the clones respond to islet-cell antigen from different mouse strains but only in the presence of antigen-presenting ...
more infohttps://www.pnas.org/content/86/20/8000?ijkey=793d9d204ef1c2384b2d2d3436756f057092c9cf&keytype2=tf_ipsecsha

Patent Issued for OHSU Stem Cell Cloning - Salem-News.ComPatent Issued for OHSU Stem Cell Cloning - Salem-News.Com

Science Universitys unique method of transforming a persons own skin cells into stem cells has officially been patented. The ... This cell then develops into stem cells, which are undifferentiated cells that can transform into various other cell types - ... Patent Issued for OHSU Stem Cell Cloning. Salem-News.com "In addition to improving the health of all Oregonians, part of OHSUs ... The method involves transplanting the nucleus of the cell, which contains an individuals DNA, to an egg cell that has had its ...
more infohttp://www.salem-news.com/articles/november012011/stem-cell.php

Stem Cells Cloned from Patient with Diabetes - MPRStem Cells Cloned from Patient with Diabetes - MPR

In this cloning process, known as nuclear transfer, a donated ovum with all DNA removed had the womans adult cells inserted ... Patients with diabetes may one day benefit from stem cell therapy, as research published in the journal Nature describes the ... This could lead to diabetic patients being able to produce their own cells that make insulin to replace their non-functioning ... "clone" cells .... READ FULL ARTICLE From Time ... Thats a question that stem cell researchers - and policy ...
more infohttp://www.empr.com/medical-news/stem-cells-cloned-from-patient-with-diabetes/article/344475/

Cloning - Reproductive Cloning - Cloned, Clone, Cell, and Dolly
	Cloning - Reproductive Cloning - Cloned, Clone, Cell, and Dolly

Cloning - Therapeutic Cloning [next] [back] Cloning - Cloning Genes Citing this material. Please include a link to this page if ... In May 2004 the first bull was cloned from a previously cloned bull in a process known as "serial somatic cell cloning" or " ... Library Index » Science Encyclopedia » Cloning - Cloning Genes, Reproductive Cloning, Therapeutic Cloning, Opinions Shape ... Dolly was the first mammal cloned from the cell of an adult animal, and since then researchers have used cells from adult ...
more infohttps://www.libraryindex.com/pages/2263/Cloning-REPRODUCTIVE-CLONING.html

Clone (cell biology) - WikipediaClone (cell biology) - Wikipedia

Clone (B-cell biology) Cloning List of animals that have been cloned Polyclonal antibodies Polyclonal response "Clone ... so they are technically a single clone of cells. However, during course of cell division, one of the cells can get mutated ... bone marrow cells. Most other cells cannot divide indefinitely as after a few cycles of cell division the cells stop expressing ... A clone is a group of identical cells that share a common ancestry, meaning they are derived from the same cell. Clonality ...
more infohttps://en.wikipedia.org/wiki/Clone_(cell_biology)

Enzyme accelerates malignant stem cell cloning in chronic myeloid leukemiaEnzyme accelerates malignant stem cell cloning in chronic myeloid leukemia

... has identified a key enzyme in the reprogramming process that promotes malignant stem cell cloning and the growth of chronic ... Enzyme accelerates malignant stem cell cloning in chronic myeloid leukemia. Wednesday, January 2, 2013. This shows chronic ... Genetic switch makes fat cells burn energy rather than store it. We now know how to turn fat cells into ones that burn calories ... has identified a key enzyme in the reprogramming process that promotes malignant stem cell cloning and the growth of chronic ...
more infohttp://www.labspaces.net/126086/Enzyme_accelerates_malignant_stem_cell_cloning_in_chronic_myeloid_leukemia

Stem cells & cloning - Andrew BartlettStem cells & cloning - Andrew Bartlett

Cloning Bill passes Senate - just. 7 November, 2006. / 81 Comments Despite a general expectation that the stem cell legislation ... Category: Stem cells & cloning. Pell and Parliamentary Privilege. 9 June, 2007. / 16 Comments ... Stem Cell fest gathers pace. 9 October, 2006. / 68 Comments This fortnight is the final sitting period before the stem cell ... Stem Cell Inquiry reports. 30 October, 2006. / 35 Comments The report of the Senate Committee examining the stem cell ...
more infohttp://andrewbartlett.com/category/the-senate/stem-cells/
  • Cloning of Animals On Sunday, February 23, 1997, Scottish researchers broke one of nature's greatest laws by cloning a lamb from a single cell of an adult ewe. (essaypride.com)
  • Dolly, the first mammal to be genetically cloned from adult cells, poses for the camera in 1997 at the Roslin Institute in Edinburgh, Scotland. (wunc.org)
  • In 1997 cloning became headline news when, following more than 250 failed attempts, Ian Wilmut (1944-) and his colleagues at the Roslin Institute in Edinburgh, Scotland, successfully cloned a sheep, which they named Dolly. (libraryindex.com)
  • A 1997 CNN/USA Today/Gallup Poll found that 87% of Americans polled believed human cloning would be a bad development for humanity, and 88% believed it would be morally wrong. (libraryindex.com)
  • In February 1997 Don Wolf (1939-) and his colleagues at the Oregon Regional Primate Center in Beaverton successfully cloned two rhesus monkeys using laboratory techniques that had previously produced frogs, cows, and mice. (libraryindex.com)
  • Expressed during embryogenesis to help blood cell development, ADAR1 subsequently turns off and is triggered by viral infections where it protects normal hematopoietic stem cells from attack. (labspaces.net)
  • 0.05) than in peripheral blood mononudear cells of nonallergic donors. (tudelft.nl)
  • In principle, scientists could produce a series of cell lines that would allow a close match for the majority of would-be cell recipients - just as transplant surgeons currently seek a close match for organ donors. (wunc.org)
  • There are ethical concerns surrounding nuclear transfer, particularly regarding recruitment and compensation for egg donors needed for stem cell research. (empr.com)
  • Acquired mutations in the mDNA contribute to differences between clones and their donors and are believed to influence the aging process. (libraryindex.com)
  • The claim went up in smoke in January of 2006 after a probe by the university concluded that Hwang had fabricated the evidence, which followed a similarly damning assessment of a landmark paper from the previous year in which the group falsely reported creating 11 cell lines genetically matched to their donors. (scientificamerican.com)
  • Finally it happens this small idea of science fiction becomes real with the first clone, Dolly the sheep, but now people are thinking that this might not be such a good idea. (essaypride.com)
  • Cloning has been all over the papers and the news lately, mostly caused by the death of possibly the world's most famous animal behind Lassie, Ian Wilmut's cloned sheep, Dolly. (essaypride.com)
  • The resulting egg was implanted in the womb of a third sheep, and the result was Dolly, the first clone of a mammal. (wunc.org)
  • Born several months later, Dolly was a true clone-genetically identical to the Finn Dorsett mammary cells and not to the blackface ewe, which served as her surrogate mother. (libraryindex.com)
  • An important distinction between the process that created Dolly and the one that produced the monkeys was that unspecialized embryonic cells were used to create the monkeys, whereas a specialized adult cell was used to create Dolly. (libraryindex.com)
  • These findings indicate that IP represents in its final stage in the aging C57BL mice an intrinsic cellular defect within the affected B cell clone, which is, however, different from that found in B cell malignancies. (tudelft.nl)
  • Spleen cells of BALB/c mice, immunized with fragments Y of normal human fibrinogen, were fused with P3 x 63 Ag 8653 myeloma cells. (tudelft.nl)
  • We have produced a panel of islet-specific T-cell clones from nonobese diabetic (NOD) mice. (pnas.org)
  • A series of genetic markers sprinkled throughout the cells' chromosomes show the same pattern found in parthenogenetic mice as opposed to cloned mice, according to a report published online today in the journal Cell Stem Cell . (scientificamerican.com)
  • Objective: In this study we therefore characterized peanut-specific T cells, cloned from a patient with severe peanut allergy. (tudelft.nl)
  • Methods: Peripheral blood mononudear cells from patients with peanut allergy and nonallergic individuals were stimulated with crude peanut extract (CPE) to compare the proliferative responses and to select a suitable patient for the cloning of CPE-specific T cells. (tudelft.nl)
  • The CPE-specific T-lymphocyte clones generated from the selected patient were all CD4+/CD8- T helper cells with a TH2 cytokine profile, secreting high amounts of IL-4 and IL-5, but little or no interferon-γ. (tudelft.nl)
  • The technique could potentially be used to take skin cells from a patient to create "personalised" stem cells. (www.nhs.uk)
  • Each of these treatments captures a patient's own tumor-fighting cells, grows them to high numbers in the lab, and infuses them back into the patient. (webmd.com)
  • He says since the reprogrammed cells use genetic material from the patient, there is no concern about transplant rejection. (abc.net.au)
  • Physicians could also extract DNA from the person who is going to receive the cellular transplant - creating a patient-specific treatment - though that would end up being far more expensive than drawing from a library of ready-made cells. (wunc.org)
  • For instance, because we transform a person's own cells, there are no issues of rejection when the stem cells are transplanted back into a patient. (salem-news.com)
  • These clones proliferate and make interleukin 2 in an antigen-specific manner in response to NOD antigen-presenting cells and islet cells. (pnas.org)
  • Most of the clones respond to islet-cell antigen from different mouse strains but only in the presence of antigen-presenting cells bearing the class II major histocompatibility complex of the NOD mouse. (pnas.org)
  • This differentiation and activation of the B cell occurs most rapidly after exposure to antigen by antigen-presenting cells in the reticuloendothelial system, and under modulation by T cells, and is closely intertwined with affinity maturation. (wikipedia.org)
  • In 1880, a man named Walter Sutton made one of the most important discoveries towards cloning- he proved that chromosomes hold genetic information. (essaypride.com)
  • But in contrast, pairs of matching chromosomes in parthenogenetic cells tend to match one another in the middle and differ near the ends because of a genetic mixing process called recombination. (scientificamerican.com)
  • In their paper, Daley and colleagues report that the SNPs in the Korean cell line do indeed match toward the center of the chromosomes, similar to five parthenogenetic mouse cell lines that the team created for comparison. (scientificamerican.com)
  • The team pointed out years of research on monkey cells using the same technique have not successfully produced any monkey clones. (abc.net.au)
  • The result follows on the heels of an announcement last month by another California stem cell company, International Stem Cell Corporation (ISC) in Oceanside, that it had successfully achieved human parthenogenesis for the first time. (scientificamerican.com)
  • Whereas, the cells of clones dealt with here are specialized cells of a multicellular organism (usually vertebrates), and reside at quite distant places. (wikipedia.org)
  • The possibility that people might be cloned from the cells of a single adult human being had long been a subject primarily of fantasy and science fiction but became very definite at the end of the 20th century. (essaypride.com)
  • This was a laboratory study that aimed to produce embryonic stem cells from adult skin cells. (www.nhs.uk)
  • As I was heading into Parliament House this morning, I heard some coverage on ABC radio mentioning a briefing that was being held today with a leading researcher into adult stem cells. (andrewbartlett.com)
  • Dr. Arnold Kriegstein, director of the stem cell institute at the University of California, San Francisco, said he had been approached to be the San Francisco partner of the Korean foundation but had held back, in part because he wished to develop the university's own expertise. (nytimes.com)
  • Lanza's colleagues, including Young Gie Chung at the CHA Stem Cell Institute in Seoul, Korea (with labs in Los Angeles as well), now report success. (wunc.org)
  • Later, during a chance discussion with European colleagues, stem cell researcher George Daley of Children's Hospital Boston and the Harvard Stem Cell Institute learned that they had received samples of the cell line before the work was retracted. (scientificamerican.com)
  • When a chromosome from a sperm cell joins with that of an egg, these single nucleotide polymorphisms (SNPs or "snips") tend not to match each other. (scientificamerican.com)
  • This could lead to diabetic patients being able to produce their own cells that make insulin to replace their non-functioning cells. (empr.com)
  • The newly formed cell divided and was placed in the uterus of a blackface ewe to gestate. (libraryindex.com)
  • Introduction The idea of cloning has been around for a while, but the thought of it becoming a reality is surprisingly new. (essaypride.com)
  • A new study by Gerald de Haan, Leonid Bystrykh, and colleagues suggests that the skeletal distribution of transplanted hematopoietic stem cell (HSC) clones is surprisingly nonuniform. (rupress.org)
  • Their motive is it to obtain the power of speeding up the cloning process by hoping to improve their productivity. (brightkite.com)
  • The process has been difficult to do with human cells. (wunc.org)
  • What we show for the first time is that you can actually take skin cells, from a middle-aged 35-year-old male, but also from an elderly, 75-year-old male" and use the DNA from those cells in this cloning process, Lanza says. (wunc.org)
  • This process became the prototype for cloning. (libraryindex.com)
  • Despite the emergence of new therapies, such as tyrosine kinase inhibitors, CML and other leukemias remain problematic because some cancer stem cells avoid destruction and eventually regenerate themselves, a stem cell process known as self-renewal that can result in a return and spread (metastasis) of the disease. (labspaces.net)
  • The reconstructed egg containing the DNA from a donor cell is treated with chemicals or electric current in order to stimulate cell division. (libraryindex.com)
  • Each of those two cells is able to divide indefinitely, "so from a small vial of those cells we could grow up as many cells as we would ever want," Lanza says. (wunc.org)
  • Most other cells cannot divide indefinitely as after a few cycles of cell division the cells stop expressing an enzyme telomerase. (wikipedia.org)
  • A technique appropriate to investigation of the developmental fates of distinct embryonic cell types is described and the fate of a particular type of chick myoblast (CMR-I) examined. (biologists.org)
  • While there is much work to be done in developing safe and effective stem cell treatments, we believe this is a significant step forward in developing the cells that could be used in regenerative medicine," Mitalipov says. (abc.net.au)
  • I think this is an extremely important-and solid-paper," says stem cell researcher Robert Lanza, vice president of research and scientific development at Applied Cell Technology, a regenerative medicine company headquartered in Alameda, Calif., who did not take part in the study. (scientificamerican.com)
  • And the other technique, which produces " induced pluripotent stem cells ," skips the step that requires a human egg cell, so some people find it less fraught, ethically. (wunc.org)