A group of genetically identical cells all descended from a single common ancestral cell by mitosis in eukaryotes or by binary fission in prokaryotes. Clone cells also include populations of recombinant DNA molecules all carrying the same inserted sequence. (From King & Stansfield, Dictionary of Genetics, 4th ed)
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Established cell cultures that have the potential to propagate indefinitely.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.
A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Any method used for determining the location of and relative distances between genes on a chromosome.
A form of GENE LIBRARY containing the complete DNA sequences present in the genome of a given organism. It contrasts with a cDNA library which contains only sequences utilized in protein coding (lacking introns).
The relationships of groups of organisms as reflected by their genetic makeup.
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
Plasmids containing at least one cos (cohesive-end site) of PHAGE LAMBDA. They are used as cloning vehicles.
Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Gel electrophoresis in which the direction of the electric field is changed periodically. This technique is similar to other electrophoretic methods normally used to separate double-stranded DNA molecules ranging in size up to tens of thousands of base-pairs. However, by alternating the electric field direction one is able to separate DNA molecules up to several million base-pairs in length.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.
The functional hereditary units of BACTERIA.
Sites on an antigen that interact with specific antibodies.
Any cell, other than a ZYGOTE, that contains elements (such as NUCLEI and CYTOPLASM) from two or more different cells, usually produced by artificial CELL FUSION.
Genotypic differences observed among individuals in a population.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
Proteins prepared by recombinant DNA technology.
Antibodies produced by a single clone of cells.
A technique for identifying individuals of a species that is based on the uniqueness of their DNA sequence. Uniqueness is determined by identifying which combination of allelic variations occur in the individual at a statistically relevant number of different loci. In forensic studies, RESTRICTION FRAGMENT LENGTH POLYMORPHISM of multiple, highly polymorphic VNTR LOCI or MICROSATELLITE REPEAT loci are analyzed. The number of loci used for the profile depends on the ALLELE FREQUENCY in the population.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Immunized T-lymphocytes which can directly destroy appropriate target cells. These cytotoxic lymphocytes may be generated in vitro in mixed lymphocyte cultures (MLC), in vivo during a graft-versus-host (GVH) reaction, or after immunization with an allograft, tumor cell or virally transformed or chemically modified target cell. The lytic phenomenon is sometimes referred to as cell-mediated lympholysis (CML). These CD8-positive cells are distinct from NATURAL KILLER CELLS and NATURAL KILLER T-CELLS. There are two effector phenotypes: TC1 and TC2.
DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Morphologic alteration of small B LYMPHOCYTES or T LYMPHOCYTES in culture into large blast-like cells able to synthesize DNA and RNA and to divide mitotically. It is induced by INTERLEUKINS; MITOGENS such as PHYTOHEMAGGLUTININS, and by specific ANTIGENS. It may also occur in vivo as in GRAFT REJECTION.
Short tracts of DNA sequence that are used as landmarks in GENOME mapping. In most instances, 200 to 500 base pairs of sequence define a Sequence Tagged Site (STS) that is operationally unique in the human genome (i.e., can be specifically detected by the polymerase chain reaction in the presence of all other genomic sequences). The overwhelming advantage of STSs over mapping landmarks defined in other ways is that the means of testing for the presence of a particular STS can be completely described as information in a database.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Deoxyribonucleic acid that makes up the genetic material of viruses.
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
Overlapping of cloned or sequenced DNA to construct a continuous region of a gene, chromosome or genome.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.
Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
Chromosomes in which fragments of exogenous DNA ranging in length up to several hundred kilobase pairs have been cloned into yeast through ligation to vector sequences. These artificial chromosomes are used extensively in molecular biology for the construction of comprehensive genomic libraries of higher organisms.
The sum of the weight of all the atoms in a molecule.
Procedures for identifying types and strains of bacteria. The most frequently employed typing systems are BACTERIOPHAGE TYPING and SEROTYPING as well as bacteriocin typing and biotyping.
A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
Partial cDNA (DNA, COMPLEMENTARY) sequences that are unique to the cDNAs from which they were derived.
A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.
The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.
The functional hereditary units of VIRUSES.
Molecules on the surface of T-lymphocytes that recognize and combine with antigens. The receptors are non-covalently associated with a complex of several polypeptides collectively called CD3 antigens (ANTIGENS, CD3). Recognition of foreign antigen and the major histocompatibility complex is accomplished by a single heterodimeric antigen-receptor structure, composed of either alpha-beta (RECEPTORS, ANTIGEN, T-CELL, ALPHA-BETA) or gamma-delta (RECEPTORS, ANTIGEN, T-CELL, GAMMA-DELTA) chains.
The application of molecular biology to the answering of epidemiological questions. The examination of patterns of changes in DNA to implicate particular carcinogens and the use of molecular markers to predict which individuals are at highest risk for a disease are common examples.
A collection of cloned peptides, or chemically synthesized peptides, frequently consisting of all possible combinations of amino acids making up an n-amino acid peptide.
Proteins found in any species of bacterium.
Antigens on surfaces of cells, including infectious or foreign cells or viruses. They are usually protein-containing groups on cell membranes or walls and may be isolated.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
T-cell receptors composed of CD3-associated alpha and beta polypeptide chains and expressed primarily in CD4+ or CD8+ T-cells. Unlike immunoglobulins, the alpha-beta T-cell receptors recognize antigens only when presented in association with major histocompatibility (MHC) molecules.
A type of IN SITU HYBRIDIZATION in which target sequences are stained with fluorescent dye so their location and size can be determined using fluorescence microscopy. This staining is sufficiently distinct that the hybridization signal can be seen both in metaphase spreads and in interphase nuclei.
Lymphoid cells concerned with humoral immunity. They are short-lived cells resembling bursa-derived lymphocytes of birds in their production of immunoglobulin upon appropriate stimulation.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.

Classification of human colorectal adenocarcinoma cell lines. (1/9318)

Eleven human colorectal adenocarcinoma cell lines established in this laboratory were classified into three groups based on morphological features (light and electron microscopy), modal chromosome number, and ability to synthesize carcinoembryonic antigen (CEA). Group 1 cell lines contained both dedifferentiated and differentiating cells growing in tight clusters or islands of epithelium-like cells; their modal chromosome number was about 47, and they synthesized small to moderate amounts of CEA. Group 2 cell lines were more dedifferentiated, were hyperdiploid, and synthesized small amounts of CEA. Group 3 cell lines were morphologically similar to those of Group 1 by light microscopy. They differed ultrastructurally by containing microvesicular bodies; the modal chromosome number varied from hyperdiploid to hypertriploid or they had bimodal populations of hypodiploid and hypertriploid cells, and they synthesized relatively large amounts of CEA. No correlation could be found between Broder's grade or Duke's classification of the original tumor and modal chromosome number or ability to synthesize CEA. These findings support Nowell's hypothesis that the stem line is different for each solid tumor, which makes it difficult to relate chromosomal changes to the initiation of the neoplastic state.  (+info)

Cloning of a novel gene specifically expressed in clonal mouse chondroprogenitor-like EC cells, ATDC5. (2/9318)

We cloned a full-length cDNA encoding a novel mouse protein, A-C2, by differential display method using mouse embryonic fibroblast C3H10T1/2 cells and mouse chondroprogenitor-like EC cells, ATDC5. The deduced amino acid sequence of A-C2 consisted of 106 amino acids with no significant homology to the sequences previously reported. Northern blot analysis showed two major bands of 2.1 and 1.8 kb sizes. Expression of A-C2 mRNA was exclusive to ATDC5 cells at their undifferentiated stage. None of ATDC5 cells at their differentiated stage and adult mice tissues examined expressed A-C2 gene.  (+info)

Crystal structures of two H-2Db/glycopeptide complexes suggest a molecular basis for CTL cross-reactivity. (3/9318)

Two synthetic O-GlcNAc-bearing peptides that elicit H-2Db-restricted glycopeptide-specific cytotoxic T cells (CTL) have been shown to display nonreciprocal patterns of cross-reactivity. Here, we present the crystal structures of the H-2Db glycopeptide complexes to 2.85 A resolution or better. In both cases, the glycan is solvent exposed and available for direct recognition by the T cell receptor (TCR). We have modeled the complex formed between the MHC-glycopeptide complexes and their respective TCRs, showing that a single saccharide residue can be accommodated in the standard TCR-MHC geometry. The models also reveal a possible molecular basis for the observed cross-reactivity patterns of the CTL clones, which appear to be influenced by the length of the CDR3 loop and the nature of the immunizing ligand.  (+info)

Analysis of V(H)-D-J(H) gene transcripts in B cells infiltrating the salivary glands and lymph node tissues of patients with Sjogren's syndrome. (4/9318)

OBJECTIVE: In patients with Sjogren's syndrome (SS), B lymphocytes have been found to infiltrate salivary glands, resulting in sialadenitis and keratoconjunctivitis. The disease is frequently associated with benign and neoplastic lymphoproliferation. The present study was undertaken to investigate whether clonal B cell expansion takes place in lymphocytic infiltrations of salivary glands under (auto- [?]) antigen stimulation, by analyzing in more detail the variable part (V(H)-D-J(H)) of the immunoglobulin heavy chain genes expressed in these B cells. METHODS: Biopsies of the labial salivary glands and lymph nodes were performed on 2 female patients with SS. The Ig gene rearrangements in these tissues were amplified by reverse transcriptase-polymerase chain reaction using specific primers. RESULTS: A total of 94 V(H)-D-J(H) transcripts were cloned and sequenced. Our data suggest a polyclonal origin of the B cell infiltrates. In 92 of the transcripts, V(H) genes were modified by somatic mutation. Further analysis showed counterselection for replacement mutations within the framework regions, suggesting that those B cells were stimulated and selected for functional expression of a surface Ig. In labial salivary glands from both patients, clonally related B cells became evident. Members of 1 particular clone were found in both the lip and lymph node material. CONCLUSION: These data provide evidence, on the nucleotide sequence level, that an antigen-triggered clonal B cell expansion takes place in the salivary glands of patients with SS who do not have histologic evidence of developing lymphoma. It may be speculated that those B cell clones expand during disease progression, resulting in lymphomagenesis.  (+info)

Isolation and characterization of two mouse L cell lines resistant to the toxic lectin ricin. (5/9318)

Two variant mouse L cell lines (termed CL 3 and CL 6) have been selected for resistant to ricin, a galactose-binding lectin with potent cytotoxic activity. The resistant lines exhibit a 50 to 70% decrease in ricin binding and a 300- to 500-fold increase in resistance to the toxic effects of ricin. Crude membrane preparations of CL 3 cells have increased sialic acid content (200% of control), while the galactose, mannose, and hexosamine content is within normal limits. Both the glycoproteins and glycolipids of CL 3 cells have increased sialic acid, with the GM3:lactosylceramide ratios for parent L and CL 3 cells being 0.29 and 1.5, respectively. In contrast, the membranes of CL 6 cells have a decrease in sialic acid, galactose, and hexosamine content with mannose being normal. Both cell lines have specific alterations in glycosyltransferase activities which can account for the observed membrane sugar changes. CL 3 cells have increased CMP-sialic acid:glycoprotein sialyltransferase and GM3 synthetase activities, while CL 6 cells have decrease UDP-GlcNAc:glycoproteinN-acetylglucosaminyltransferase and DPU-galactose:glycoprotein galactosyltransferase activities. The increased sialic acid content of CL 3 cells serves to mask ricin binding sites, since neuraminidase treatment of this cell line restores ricin binding to essentially normal levels. However, the fact that neuraminidase-treated CL 3 cells are still 45-fold resistant to ricin indicates that either a special class of productive ricin binding sites is not being exposed or that the cell line has a second mechanism for ricin resistance.  (+info)

Enhanced tumor growth and invasiveness in vivo by a carboxyl-terminal fragment of alpha1-proteinase inhibitor generated by matrix metalloproteinases: a possible modulatory role in natural killer cytotoxicity. (6/9318)

Matrix metalloproteinases (MMPs) are believed to contribute to the complex process of cancer progression. They also exhibit an alpha1-proteinase inhibitor (alphaPI)-degrading activity generating a carboxyl-terminal fragment of approximately 5 kd (alphaPI-C). This study reports that overexpression of alphaPI-C in S2-020, a cloned subline derived from the human pancreas adenocarcinoma cell line SUIT-2, potentiates the growth capability of the cells in nude mice. After stable transfection of a vector containing a chimeric cDNA encoding a signal peptide sequence of tissue inhibitor of metalloproteinase-1 followed by cDNA for alphaPI-C into S2-020 cells, three clones that stably secrete alphaPI-C were obtained. The ectopic expression of alphaPI-C did not alter in vitro cellular growth. However, subcutaneous injection of the alphaPI-C-secreting clones resulted in tumors that were 1.5 to 3-fold larger than those of control clones with an increased tendency to invasiveness and lymph node metastasis. These effects could be a result of modulation of natural killer (NK) cell-mediated control of tumor growth in nude mice, as the growth advantage of alphaPI-C-secreting clones was not observed in NK-depleted mice, and alphaPI-C-secreting clones showed decreased NK sensitivity in vitro. In addition, production of alphaPI and generation of the cleaved form of alphaPI by MMP were observed in various human tumor cell lines and in a highly metastatic subline of SUIT-2 in vitro. These results provide experimental evidence that the alphaPI-degrading activity of MMPs may play a role in tumor progression not only via the inactivation of alphaPI but also via the generation of alphaPI-C.  (+info)

Organ-selective homing defines engraftment kinetics of murine hematopoietic stem cells and is compromised by Ex vivo expansion. (7/9318)

Hematopoietic reconstitution of ablated recipients requires that intravenously (IV) transplanted stem and progenitor cells "home" to organs that support their proliferation and differentiation. To examine the possible relationship between homing properties and subsequent engraftment potential, murine bone marrow (BM) cells were labeled with fluorescent PKH26 dye and injected into lethally irradiated hosts. PKH26(+) cells homing to marrow or spleen were then isolated by fluorescence-activated cell sorting and assayed for in vitro colony-forming cells (CFCs). Progenitors accumulated rapidly in the spleen, but declined to only 6% of input numbers after 24 hours. Although egress from this organ was accompanied by a simultaneous accumulation of CFCs in the BM (plateauing at 6% to 8% of input after 3 hours), spleen cells remained enriched in donor CFCs compared with marrow during this time. To determine whether this differential homing of clonogenic cells to the marrow and spleen influenced their contribution to short-term or long-term hematopoiesis in vivo, PKH26(+) cells were sorted from each organ 3 hours after transplantation and injected into lethally irradiated Ly-5 congenic mice. Cells that had homed initially to the spleen regenerated circulating leukocytes (20% of normal counts) approximately 2 weeks faster than cells that had homed to the marrow, or PKH26-labeled cells that had not been selected by a prior homing step. Both primary (17 weeks) and secondary (10 weeks) recipients of "spleen-homed" cells also contained approximately 50% higher numbers of CFCs per femur than recipients of "BM-homed" cells. To examine whether progenitor homing was altered upon ex vivo expansion, highly enriched Sca-1(+)c-kit+Lin- cells were cultured for 9 days in serum-free medium containing interleukin (IL)-6, IL-11, granulocyte colony-stimulating factor, stem cell factor, flk-2/flt3 ligand, and thrombopoietin. Expanded cells were then stained with PKH26 and assayed as above. Strikingly, CFCs generated in vitro exhibited a 10-fold reduction in homing capacity compared with fresh progenitors. These studies demonstrate that clonogenic cells with differential homing properties contribute variably to early and late hematopoiesis in vivo. The dramatic decline in the homing capacity of progenitors generated in vitro underscores critical qualitative changes that may compromise their biologic function and potential clinical utility, despite their efficient numerical expansion.  (+info)

Phenotypic and functional characterization of CD8(+) T cell clones specific for a mouse cytomegalovirus epitope. (8/9318)

A series of CD8(+) T cell clones, specific for the IE1 epitope YPHFMPTNL, of the immediate-early protein 1 of the murine cytomegalovirus (MCMV) were generated in order to determine their protective activity against this infection and correlate their phenotypic markers with antiviral activity. We found that the adoptive transfer of three of these anti-MCMV CD8(+) T cell clones into irradiated naive mice resulted in protection against challenge, while another CD8(+) T cell clone, of the same specificity, failed to confer protection. The clones that conferred protection against lethal challenge reduced greatly viral replication in the lung and other organs of the mice. Using one of the protective anti-MCMV CD8(+) T cell clones we found that in order to be fully protective the cells had to be transferred to recipient mice no later than 1 day after MCMV challenge. The adoptive transfer of these CD8(+) T cell clones also protected CD4(+) T-cell-depleted mice. Phenotypic characterization of the anti-MCMV clones revealed that the nonprotective clone expressed very low levels of CD8 molecules and produced only small amounts of TNF-alpha upon antigenic stimulation. Most importantly, our current study demonstrates that this MHC class I-restricted IE1 epitope of MCMV is efficiently presented to CD8(+) T cell clones in vivo and further strengthens the possibility of the potential use of CD8(+) T cell clones as immunotherapeutic tools against cytomegalovirus-induced disease.  (+info)

Clonal heterogeneity detected by karyotyping is a biomarker associated with adverse prognosis in acute myeloid leukemia (AML). Constitutive activation of the phosphatidylinositol-3-kinase-Akt-mechanistic target of rapamycin (PI3K-Akt-mTOR) pathway is present in AML cells, and this pathway integrates signaling from several upstream receptors/mediators. We suggest that this pathway reflects biologically important clonal heterogeneity. We investigated constitutive PI3K-Akt-mTOR pathway activation in primary human AML cells derived from 114 patients, together with 18 pathway mediators. The cohort included patients with normal karyotype or single karyotype abnormalities and with an expected heterogeneity of molecular genetic abnormalities. Clonal heterogeneity reflected as pathway mediator heterogeneity was detected for 49 patients. Global gene expression profiles of AML cell populations with and without clonal heterogeneity differed with regard to expression of ectopic olfactory receptors (a subset ...
Advances in the fields of cancer initiating cells and high-throughput in vivo shRNA screens have highlighted a need to observe the growth of tumor cells in cancer models at the clonal level. While in vivo cancer cell growth heterogeneity in xenografts has been described, it has yet to be measured. Here, we tested an approach to quantify the clonal growth heterogeneity of cancer cells in subcutaneous xenograft mouse models. Using a high-throughput sequencing method, we followed the fate in vitro and in vivo of ten thousand HCT-116 cells individually tagged with a unique barcode delivered by lentiviral transduction. While growth in vitro was less homogeneous than anticipated, we still find that 95% of the final cells derived from 80% of the original cells. In xenografts, however, 95% of the retrieved barcoded cells originated from only 6% of the initially injected cells, an effect we term clonal dominance. We observed this clonal dominance in two additional xenograft models (MDA-MB-468 and ...
PRIMARY OBJECTIVES:. I. To assess the safety and toxicity of cellular adoptive immunotherapy in melanoma patients using autologous CD4+ and CD8+ antigen-specific T cell clones.. II. To evaluate the antitumor effects of CD4+ and CD8+ antigen-specific T cells in patients with metastatic melanoma.. III. To determine the duration of in vivo persistence of adoptively transferred CD8+ antigen-specific T cell clones in the presence or absence of transferred CD4+ T cells.. SECONDARY OBJECTIVES:. I. To assess the in vivo antitumor efficacy of the infused autologous antigen-specific CD4+ T cells.. OUTLINE: This is a phase I study followed by a phase II study.. Beginning 48 hours before T-cell infusion, patients receive cyclophosphamide IV. Patients then receive antigen-specific CD8+ T cells IV alone or with CD4+ T helper clones over 1-2 hours on day 0. Patients also receive aldesleukin subcutaneously twice daily on days 0-13. Treatment repeats every 28 days for up to 3 courses in the absence of disease ...
Fingerprint Dive into the research topics of Antibodies to CD44 Trigger Effector Functions of Human T Cell Clones. Together they form a unique fingerprint. ...
Principal Investigator:YAMAMOTO Kazuhiko, Project Period (FY):1995 - 1997, Research Category:Grant-in-Aid for Scientific Research (A), Section:展開研究, Research Field:内科学一般
An experimental model of two interacting clones of T cells is described, which may be used for defining and exploring the T-cell immunoregulatory network. Mx9/9 is a CD4 clone bearing an antigen receptor recognized by the Mx9 anti-V beta 8 monoclonal antibody (MoAb). Anti-V beta 8 MoAbs activate and induce cell proliferation of this clone. Autologous clones were raised against Mx9/9 cells using the peripheral blood mononuclear (PBM) cells of the Mx9/9 clone donor (PBMjm). Some of these cloned anti-clone cells proliferated after stimulation with irradiated Mx9/9 cells, but not after stimulation with other autologous cloned T cells or heterologous PBM, suggesting that these clones recognize the T cell receptor (TCR) of the Mx9/9 cells. The proliferation of the Mx9/9 stimulated cloned anticlone cells was blocked by anti-class II MoAbs, indicating that the autoreactive clones recognize their target antigen in conjunction with HLA Class II products. The ability of clone Mx9/9 to proliferate after stimulation
We record that individual T cells persistently contaminated with primate foamy pathogen type 1 (PFV-1) display an elevated capacity to bind individual immunodeficiency pathogen type 1 (HIV-1), leading to improved cell permissiveness to HIV-1 infection and improved cell-to-cell pathogen transmission. replication could be modulated by the current presence of either homologous faulty viral genomes or infections of specific classes with the capacity of interfering with particular levels of the pathogen routine in dually contaminated organisms. It really is set up that coinfection with various other retroviruses (individual T-cell leukemia pathogen types 1 and 2) (31), individual herpesviruses (individual herpesvirus type 6 [HHV-6], HHV-7, and HHV-8) (4, 7, 9, 12, 32), or non-pathogenic flavivirus GB pathogen (30) influences development of individual immunodeficiency pathogen type 1 (HIV-1) disease. Foamy infections (FVs) are innocuous complicated retroviruses that create lifelong persistent ...
Animals were immunized with the cloned cytotoxic T lymphocyte lines V4 and 243/2.5. Spleen cells were fused with Sp2/0-Ag14 myeloma cells.
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed as is with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed as is with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
Monoclonal expansion of B cells and plasma cells, producing antibodies against self molecules, can be found not only in different autoimmune diseases, such as peripheral neuropathy (PN), but also in malignancies, such as Waldenstr?ms macroglobulinaemia and B-type of chronic lymphocytic leukaemia (B-CLL), as well as in precancerous conditions including monoclonal gammopathy of undetermined significance (MGUS). time. PIK3CD The anti-P0 antibodies were of IgM- type. The antibodies belonged to the VH3gene family with presence of somatic mutations. The IgM reacted with P0 and myelin-associated glycoprotein (MAG), and showed no evidence for polyreactivity, in contrast to other IgM CD5+clones included in the study as controls. The expanded clones expressed CD80 and HLA-DR, which is compatible with properties of antigen-presenting cells. The immunomagnetic selection technique was successfully used for isolation SM-406 of antimyelin protein P0-specific clones. The cell lines may provide useful tools in ...
The role of clonal complexity has gradually been accepted in infection by Mycobacterium tuberculosis (MTB), although analyses of this issue are limited. We performed an in-depth study of a case of recurrent MTB infection by integrating genotyping, whole genome sequencing, analysis of gene expression and infectivity in in vitro and in vivo models. Four different clonal variants were identified from independent intrapatient evolutionary branches. One of the single-nucleotide polymorphisms in the variants mapped in mce3R, which encodes a repressor of an operon involved in virulence, and affected expression of the operon. Competitive in vivo and in vitro co-infection assays revealed higher infective efficiency for one of the clonal variants. A new clonal variant, which had not been observed in the clinical isolates, emerged in the infection assays and showed higher fitness than its parental strain. The analysis of other patients involved in the same transmission cluster revealed new clonal variants acquired
De heer, D H. and Edgington, T S., Clonal heterogeneity of the anti-erythrocyte autoantibody responses of nzb mice. (1974). Subject Strain Bibliography 1974. 168 ...
Cytotoxic T-cell clones were raised in CBA mice that recognised both A/X31 and A/JAP/305/1957 influenza virus. Here, we describe one CTL clone that recognises target cells infected with a recombinant vaccinia virus expressing influenza PB1.
Based on our knowledge of the cell division pattern of the early developing mandibular region (see above) we were able to look at its morphogenesis at a very high level of resolution. By means of single cell labeling with the fluorescent dye DiI we were able to reconstruct and analyze the clonal composition of the mandibular region from the beginning of ectodermal proliferation up to the differentiation of the mouthparts. The cell labeling reveals that the paragnaths have their origin in the area I and area II which comprises columns 1 to 3 of region E(0). The mandibles originate from cells of the areas II and III (columns 2 to 4). Areas I and II contribute also to the sternal region and the mandibular ganglia whereas area III forms parts of the tergites as well. In more posterior segments, columns 1 and 2 mainly contribute to the formation of segmental ganglia and probably sternites, and columns 3 to 5 mainly give rise to limbs [36, 46]. Hence, when compared with clonal composition of the ...
Townsend, A R. and Skehel, J J., Influenza a specific cytotoxic t-cell clones that do not recognize viral glycoproteins. (1982). Subject Strain Bibliography 1982. 1222 ...
Interleukin-1 has a key role in the initial activation of T cells. However, its role, once T cells are fully activated, is not known. Human T-cell clones, driven with antigen and antigen-presenting cells once a week, and twice weekly with interleukin-2, are the most activated T cells known. We thus tested whether IL-1 was necessary for the activation of T-cell clones, using mouse L cells (incapable of producing human IL-1) transfected with human HLA-DP genes. No requirement for exogenous IL-1 was detected for induction of proliferation. In contrast to the lack of a requirement for IL-1 in T-cell activation, T-cell tolerance, the state of antigen-specific antigen-induced unresponsiveness, was partly blocked by IL-1 indicating that these cells can still respond to IL-1 in the appropriate circumstances. Blockage of tolerance induction by IL-1 may be one of the mechanisms underlying the maintenance of the autoimmune process.
The diversity of the human TCR repertoire in aging has been studied by examining the profiles of complementarity-determining region 3 (CDR3) sizes expressed by the BV families. The TCRBV CDR3 profile, which shows size heterogeneity in young adult humans, is significantly restricted in aged humans. Clonal T cell expansions were identified using a PCR-based approach, in one or more BV families from all 14 healthy persons over the age of 65 that we studied. CD4+ T cell expansions were identified in 8 of 11 donors and CD8+ T cell expansions in 7 of 10 donors. These clonal expansions were stable during a 2-year period. Interestingly, more than half of the aged persons had clonal expansions within the BV3, -14, -16, and -23 families. Although there was no homology among the eight CDR3 sequences identified in clonal T cells from 8 aged persons, selective pressure on the expanded T cell clones was suggested by the fact that the BV families used by the T cell clones were not proportional to the number of ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Cancer progression in humans is difficult to infer because we do not routinely sample patients at multiple stages of their disease. However, heterogeneous breast tumors provide a unique opportunity to study human tumor progression because they still contain evidence of early and intermediate subpopulations in the form of the phylogenetic relationships. We developed a method we call Sector-Ploidy-Profiling to study the clonal composition of breast tumors. SPP involves macro-dissecting tumors, flow-sorting genomic subpopulations by DNA content, and profiling genomes using comparative genomic hybridization. Breast carcinomas display two classes of genomic structural variation: (1) monogenomic and (2) polygenomic. Monogenomic tumors appear to contain a single major clonal subpopulation with a highly stable chromosome structure. Polygenomic tumors contain multiple clonal tumor subpopulations, which may occupy the same sectors, or separate anatomic locations. In polygenomic tumors, we show that ...
The property of 109 CD4+ T cell clones (TCC) to induce IgE synthesis in vitro in human B cells was compared with their ability to produce IL-2, IL-4, and IFN-gamma in their supernatants (SUP) after 24-h stimulation with PHA. A significant positive correlation was found between the property of TCC to induce or enhance spontaneous IgE synthesis and their ability to release IL-4. In contrast, there was an inverse relationship between the IgE helper activity of TCC and their ability to release IFN-gamma, whereas no statistical correlation between the property to induce IgE synthesis and to produce IL-2 was observed. The ability of PHA-SUP from 71 CD4+ TCC to induce IgE synthesis in B cells was also investigated. Twenty-nine SUP (all derived from TCC active on IgE synthesis) induced production of substantial amounts of IgE in target B cells. There was a correlation between the amount of IgE synthesized by B cells in response to these SUP and their IL-4 content. An even higher correlation was found ...
A human CD4 clone (Mx9/9) using the V beta 8 receptor was used as antigen to generate autologous clones (termed anti-Mx9/9 clones) which proliferate in response to this clone, but not other autologous clones. This was used as an experimental model to explore the specific interactions between autologous T cells. Anti-HLA-DR monoclonal antibodies inhibited the response of the anti-Mx9/9 clones, suggesting that these clones recognize their target antigen in association with HLA-DR. Because of the specificity of the anti-Mx9/9 clones for the initiating clone (Mx9/9), but not any other autologous V beta 8- or V beta 8+ CD4 clones, the target antigen seems to be part of the T cell receptor, but not V beta 8 itself. However, the anti-Mx9/9 clones responded also to the autologous EBV line, and thus the target antigen is not known. The regulatory activity of the anti-Mx9/9 clones was assayed by coculture with their target clone. A variety of responses were seen, both inhibitory and stimulatory, which varied
ID:1,Note:Day(s) Test Set up: Last updated on 16/01/17.,Date:2017-01-16T03:55:00.000Z,Deleted:false,IsNew:false},{ID:2,Note:​,font face=\Times New Roman\,\n,font face=\Calibri\,Day(s) Test Set-Up has been last updated on 05/02/21.,/font,,/font,,font face=\Times New Roman\,\n\n,/font,,Date:2021-02-05T07:00:00.000Z,Deleted:false,IsNew:true ...
Actin (muscle specific)Clone: HHF35Species reactivity: Human, rabbit, rat.Host: MouseDescription: Actin is a major component of the cytoskeleton. This antibody recognizes actin of skeletal, cardiac, and smooth muscle cells. It is not reactive with other mesenchymal cells except for myoepithelium. Anti-Muscle-Specific Actin recognizes alpha and gamma isotypes of all muscle groups. Non-muscle cells such as vascular endothelial cells and connective tissues are non-reactive. Also, neoplastic cells of non-muscle-derived tissue such as carcinomas, melanomas, and lymphomas are negative. This antibody is useful in the identification of rhabdoid cellular elements.
I am presently looking at cytokine mediated differential gene expression in T cells. Ideally I would like to use human T cell clones derived from subjects with rheumatoid arthritis. I dont have much experience in T cell cloning and I am led to believe that it is very time consuming and not always successful. Any help along this line would be most appreciated, particularly a contact address/number for someone who may have developed such clones already. I can be contacted directly at dh5 at holyrood.ed.ac.uk Thanx in advance, Dave Hunter ...
Cytotoxic T lymphocytes recognize short peptides presented in association with MHC class I (MHCI) molecules on the surface of target cells. The Ag specificity of T lymphocytes is conferred by the TCR, but invariable regions of the peptide-MHCI (pMHCI) molecule also interact with the cell surface glycoprotein CD8. The distinct binding sites for CD8 and the TCR allow pMHCI to be bound simultaneously by both molecules. Even before it was established that the TCR recognized pMHCI, it was shown that CTL exhibit clonal heterogeneity in their ability to activate in the presence of anti-CD8 Abs. These Ab-based studies have since been interpreted in the context of the interaction between pMHCI and CD8 and have recently been extended to show that anti-CD8 Ab can affect the cell surface binding of multimerized pMHCI Ags. In this study, we examine the role of CD8 further using point-mutated pMHCI Ag and show that anti-CD8 Abs can either enhance or inhibit the activation of CTL and the stable cell surface binding of
Open-access immunosequencing data | Weber, Jeffrey | Cancer Immunology Research | Adaptive Biotechnologies | To understand prognostic factors for outcome between differentially sequenced nivolumab and ipilimumab in a randomized phase II trial, we measured T-cell infiltration and PD-L1 by immunohistochemistry, T-cell repertoire metrics, and mutational load within the tumor. We used next-generation sequencing (NGS) and assessed the association of those parameters with response and overall survival. Immunosequencing of the T-cell receptor -chain locus (TCR) from DNA of 91 pretreatment tumor samples and an additional 22 pairs of matched pre- and post treatment samples from patients who received nivolumab followed by ipilimumab (nivo/ipi), or the reverse (ipi/nivo), was performed to measure T cell clonality and fraction. Mutational and neoantigen load were also assessed by NGS in 82 of the 91 patients. Tumors were stained using immunohistochemistry for PD-L1+ and CD8+ T cells. Pretreatment tumor TCR
IL-17 producing γδ T cells (γδT17) promote numerous autoimmune diseases such as psoriasis and arthritis, as well as, cancers of the colon, lung and breasts. Yet γδT17 peripheral regulation has yet to be thoroughly explored. In mice deficient in IL-17 signaling, we observed expansion of γδT17 in all major tissues. However, γδT17 expansion was not uniformly distributed systemically and was most prominent in oral draining cervical lymph nodes (LNs) with monoclonal expansion of Vγ6 γδT17. In vitro proliferation assays of these cervical LNs showed endogenous proliferation by γδT17 dependent on cell-to-cell contact with CD103+ DCs. CD86+ and CD80+ activated CD103+ DCs are increased in the oral draining LNs suggesting that perhaps microbiota-activated CD103+ DC expand γδT17. 16s rRNA FISH hybridization shows increase in 16s rRNA in oral draining LNs. Treatment of mice deficient in IL-17 signaling with α-LTBR-Ig (to remove LNs) or oral broad-spectrum antibiotics abrogates γδT17 expansion.
Milli-Mark Anti-CD38-FITC Antibody, clone AT13/5 is an antibody against CD38 for use in FC. Find MSDS or SDS, a COA, data sheets and more information.
The organization seeks to identify new anti-cancer drugs that contain the cancer, develop natural immunity to the cells, and reduce the emergence of tumor cell clones.. Parents and families around the globe, including over 200 children in Arizona every year, are desperately searching for help, answers and treatment when their child is diagnosed with cancer and the Steele Childrens Research Center strives to provide them with the most current and effective cures that will keep their families whole.. Since its founding, the Phoenix Womens Board of the Steele Childrens Research Center, known as PANDA (People Acting Now Discover Answers), has raised more than $5.25 million to improve treatments and cures for devastating childhood diseases as well as to fund and recruit internationally recognized pediatric physicians and scientists to Arizona, providing local families with the most cutting-edge medical care.. Last year, they opened an office in the Arcadia neighborhood of Phoenix, located at 4455 ...
Supplementary MaterialsSupplementary Materials: Supplementary Figure 1: T cell colonies under treatment of parental and gastrospheres conditioned media in ratios of 1 1?:?1, 1?:?5, and 1?:?10 in MLR. anti-CD3/CD28 beads. The proliferation was evaluated using CFSE staining; the percentages of CD4+CD25+FoxP3+ Treg and CD4+IL-17+ Th17 cells and IFN-and death induction in target cells. All these changes were related to the upregulation of IL-6, IL-10, and IL-22 in gastrospheres compared to parental cells. Conclusion Our study showed that the condition media of gastrospheres can potentially induce Th17 with increasing in their cytotoxic effect. Based on our knowledge, the present study is the first study that emphasizes the role of gastrospheres in the induction of antitumor Th17 cells. However, it should be confirmed with complementary studies tridimensional (3D) culture model of gastric CSCs with stemness properties [3]. In general, CSCs employ several mechanisms to evade the immune system such as ...
Purified helper-inducer (T4+) and suppressor-cytotoxic (T8+) lymphocytes from eight patients with acquired immunodeficiency syndrome (AIDS) and eight healthy heterosexual donors were examined by limiting dilution analysis for their ability to be clonally expanded. It was demonstrated that viable T4+ and T8+ lymphocytes from patients with AIDS had markedly reduced proportions of clonable cells compared to the healthy donors (T4 = 1:255 vs. 1:34, P = 0.06; T8 = 1:355 vs. 1:55, P = 0.01). However, the cloned T cells that were obtained from the patients with AIDS demonstrated normal proliferation in response to phytohemagglutinin and alloantigen, and normal ability to help or suppress pokeweed mitogen-driven IgG synthesis. These results strongly suggest that, in addition to a quantitative diminution of T4+ lymphocytes in AIDS, there is an intrinsic functional defect in the surviving T4+ and T8+ lymphocytes, which is reflected by a severe decrease in their potential for clonal expansion. ...
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
I disagreed wih the the production of human clones. One reason was that I could not think of a practical reason to make more people. Dont we have enough already? One might say that we can, in a way, bring people back from the dead. I know thats probably not a good way to put it, but Im hoping that you get the jist of what Im saying. I dont think people would accept clones the way they accept real people; its just not the same thing. I dont think many people would like to buy a clone. I know I wouldnt. So really, I think making clones is a waste of time. Theres no real purpose for it, and its a waste of money (we brought up the topic of space travel at this point...). Making clones for a war, like Star Wars, also seemed pretty bizzare. If one were to create a million clones to go to war, Im not sure they would obey. Their purpose is to die, or to kill. As blan as the clones would be, their sense of moral would be intact Im sure. You cant order a living thing to die in these ...
Although there is multiple evidence for the functional heterogeneity and polyclonality of TRAb (1 - 3) both statements are questioned by some investigators (4, 5). Furthermore there is growing...
Clonal competition in cancer describes the process in which the progeny of a cell clone supersedes or succumbs to other competing clones due to differences in their functional characteristics, mostly based on subsequently acquired mutations. Even though the patterns of those mutations are well explored in many tumors, the dynamical process of clonal selection is underexposed. We studied the dynamics of clonal competition in a BcrAbl-induced leukemia using a γ-retroviral vector library encoding the oncogene in conjunction with genetic barcodes. To this end, we studied the growth dynamics of transduced cells on the clonal level both in vitro and in vivo in transplanted mice. While we detected moderate changes in clonal abundancies in vitro, we observed monoclonal leukemias in 6/30 mice after transplantation, which intriguingly were caused by only two different BcrAbl clones. To analyze the success of these clones, we applied a mathematical model of hematopoietic tissue maintenance, which indicated that a
A phase 0, exploratory study of the pharmacodynamics of a single intratumoral dose of IMCgp100, a monoclonal T cell receptor anti-CD3 scFv fusion protei
HELIOS, APC-eFluor 780, clone: 22F6, eBioscience™ 100 Tests; APC-eFluor 780 HELIOS, APC-eFluor 780, clone: 22F6, eBioscience™ Primary Antibodies He to Hf
CD39 Mouse anti-Human, PE, Clone: eBioA1 (A1), eBioscience™ 100 tests; PE CD39 Mouse anti-Human, PE, Clone: eBioA1 (A1), eBioscience™ Primary Antibodies...
CD36 Mouse anti-Human, Clone: eBioNL07 (NL07), eBioscience™ 100 μg; Unconjugated CD36 Mouse anti-Human, Clone: eBioNL07 (NL07), eBioscience™ Primary...
PRIMARY OBJECTIVES:. I. To determine the safety and feasibility of infusing gene-modified, human immunodeficiency virus (HIV)-protected hematopoietic stem cells (HSC) after high-dose chemotherapy for treatment of acquired immunodeficiency syndrome (AIDS)-related lymphoma.. II. To determine the dose of carmustine (BCNU) in combination with O^6-benzylguanine (O6BG) that results in selection in vivo of gene-modified HIV-resistant cells.. III. To estimate the effect of HIV infection on the presence of HIV-resistant blood cells as measured by genetic marking for vector sequences before and after antiviral treatment interruption.. SECONDARY OBJECTIVES:. I. Evaluate the molecular and clonal composition of gene-modified cells after hematopoietic cell transplant (HCT).. II. Evaluate the molecular and clonal composition of gene-modified cells after O6BG/BCNU.. III. Determine the correlation of the level of O6-methylguanine- methyltransferase (MGMT) (P140K) marking with toxicity and response.. IV. ...
Brief report: a single neoplastic clone in sequential biopsy specimens from a patient with primary gastric-mucosa-associated lymphoid-tissue lymphoma and Sjögrens syndrome. New England Journal of Medicine New England Journal of Medicine 0028-4793 10.1056/NEJM199307153290305
During this time, a hot line with a reference lab will be established to answer technical questions.. A meeting six months later will concentrate on evaluating the results from each laboratory, the consistency of the results and potential for applying within trials. At this meeting an approach to external quality control will be established. At year one a further meeting will evaluate the results, the functioning of the EQUAS and value of each of the probe sets. At this point we will initiate a program to develop and optimize the probes. At year one we will start to map and recruit laboratories to the assay network. By 18 months we will have a fully established network into which we can introduce the necessary technology. ...
The liver is the major site of clearance and degradation of foreign antigens from the portal circulation. Despite the presence of hepatic accessory cells, antibody responses to orally administered antigens are uncommon. To ascertain if hepatic accessory cells are incapable of stimulating specific subsets of T lymphocytes, freshly isolated hepatic nonparenchymal and splenic cells were cultured with a panel of antigen-specific, H-2-restricted Th1 and Th2 HTL clones. Whereas spleen cells stimulated the proliferation of both Th1 and Th2 clones, hepatic nonparenchymal cells (NPC) stimulated the proliferation of only Th1 and not Th2 clones. Adding rIL-1, rIL-6, and rIL-7, alone or in combination, to the cultures did not result in proliferation of the Th2 clones. Despite the absence of Th2 proliferation, NPC were able to stimulate the secretion of IL-3 and IL-4 by Th2 clones in the presence of antigen. Moreover, adding hepatic NPC did not inhibit spleen cells from stimulating Th2 clones in the presence ...
TY - JOUR. T1 - Evidence for common clonal origin of multifocal lung cancers. AU - Wang, Xiaoyan. AU - Wang, Mingsheng. AU - MacLennan, Gregory T.. AU - Abdul-Karim, Fadi W.. AU - Eble, John N.. AU - Jones, Timothy D.. AU - Olobatuyi, Felix. AU - Eisenberg, Rosana. AU - Cummings, Oscar W.. AU - Zhang, Shaobo. AU - Lopez-Beltran, Antonio. AU - Montironi, Rodolfo. AU - Zheng, Suqin. AU - Lin, Haiqun. AU - Davidson, Darrell D.. AU - Cheng, Liang. PY - 2009/4/1. Y1 - 2009/4/1. N2 - Background Lung cancer is the most common cause of cancer death in the United States. Multiple anatomically separate but histologically similar lung tumors are often found in the same patient. The clonal origin of multiple lung tumors is uncertain. Methods We analyzed 70 lung tumors from 30 patients (23 females and seven males) who underwent surgical resection for lung epithelial tumors, of whom 26 had non-small cell carcinomas and four had carcinoid/atypical carcinoid tumors. All patients had multiple tumors (two to ...
Understanding the kinetics and molecular events underlying trafficking of HSCs is important both in basic hematology research and for implementation and interpretation of experimental and clinical BM transplantation protocols. Here, we studied posttransplantation skeletal distribution of hundreds of HSC clones to address the extent of migration in steady-state conditions and upon G-CSF-induced mobilization. Genetic barcoding of highly purified hematopoietic cells was used to quantitatively analyze HSC clone sizes in different bones and contributions of these clones to blood.. Our findings demonstrate that at very extended time intervals (at least 11 mo) after transplantation, the distribution of both old and young HSC clones across multiple skeletal sites is highly skewed. This is in line with data showing relatively slow rates of HSC equilibration in parabiotic mice (Abkowitz et al., 2003). However, our findings are in contrast with a study that suggested that 1-5% of HSC pool circulates daily ...
To evaluate the impact of immunodominance on CD8 T-cell properties, we compared the functional properties of dominant and subdominant populations in the response to lymphocytic choriomeningitis virus (LCMV). To improve functional discrimination, in addition to the usual tests of phenotype and function, we used a sensitive technique that allows the screening of all CD8 effector genes simultaneously in single cells. Surprisingly, these methods failed to reveal a major impact of clonal dominance in CD8 properties throughout the response. Aiming to increase clonal dominance, we examined high-frequency transferred P14 T-cell receptor transgenic (TCR Tg) cells. Under these conditions LCMV is cleared faster, and accordingly we found an accelerated response. However, when Tg and endogenous cells were studied in the same mice, where they should be subjected to the same antigen load, they showed overlapping properties, and the presence of P14 cells did not modify endogenous responses to other LCMV epitopes or a
In contrast to the ease of cloning and characterizing, at the molecular level, helper and cytotoxic T cells, suppressor T cells remain an enigma, and their existence as discrete entities is being increasingly challenged. Here we review evidence that CD4+ regulatory clones, capable of expressing both helper and suppressor functions, may account for much of the suppressor function. It is suggested that a single T cell clone, depending on the signals it receives from its environment, may release either helper or suppressor cytokines. Studying such clones under defined conditions (providing suppressor signals), may preclude detection of their helper capacity. Since some therapeutic approaches in various human diseases are based on the manipulation of helper and suppressor functions, the question whether committed suppressor cells exist has important practical implications in medicine.
Andreas Wack was born in Frankfurt, studied biology in Konstanz and got his first degree based upon a thesis on the clonal composition of T cell populations in the elderly. He performed his PhD work at the Medical Research Council National Institute for Medical Research (now part of the Francis Crick Institute) under the supervision of Dimitris Kioussis on thymocyte lineage decisions and went on to do a postdoc and work as a staff scientist in the research institute of Novartis Vaccines, formely Chiron, in Siena, Italy.. The focus of his work there was the modulation of T and NK cell function by the hepatitis C virus, human dendritic cell subsets and their crosstalk, the mechanism of action of mucosal and parenteral vaccine adjuvants, and next generation influenza vaccines.. His current research interests at the Crick include the understanding of pathogenesis and protection in influenza infection and influenza-bacterial coinfection. He is also interested in the anti-influenza response of airway ...
Figure 1. Stem cell dynamics in tumour initiation illustrated by quantifying the clonal benefit of KrasG12D (from Vermeulen et al., Science 2013; 342: 995). (A) Intestinal stem cells are equipotent and continuously replace each other in a stochastic fashion. (B) Confocal images of SI crypt bottoms of AhCreER/tdTom-/fl mice (WT) and AhCreER/tdTom-/fl/Kras-G12Dfl (KrasG12D) at the indicated time points after clone induction. Clone sizes are indicated as fractions (in eighths) of the crypt circumference. Blue, nuclear stain (DAPI); red, tdTom expression; scale bars represent 30mm. (C and D) The distribution of clone sizes and the corresponding distribution changes caused by the activation of Kras can be captured using stochastic models. The models describe the competition between the stem cells and summarise the fitness of the mutant stem cell via PR, the probability that the mutant will replace its neighbour. A value of PR = 0.5 means that the mutant stem cell is as fit as the WT cells and a value ...
HLA-DR3- and HLA-DRw52-associated functional polymorphism was investigated with selected tetanus toxoid (TT)-specific T cell clones. We have shown earlier that HLA-DR antigens are encoded by two distinct loci, DR beta I and DR beta III. The alloantigenic determinant(s) defined by the serological HLA-DR3 specificity map to the former, while the supratypic HLA-DRw52 determinants map to DR beta III. Furthermore, we have recently recognized by DNA sequencing three alleles of HLA-DRw52 at locus DR beta III, referred to as 52 a, b, and c. Our objective was to correlate the pattern of T cell restriction with the gene products of individual DR beta chain loci and with the three newly described alleles of locus DR beta III. Among the selected T cell clones, 5 reacted exclusively when TT was presented by HLA-DR3+ APCs (TT-DR3-APC). In contrast, two T cell clones were stimulated by TT-DRw52-APC. More specifically, these two T cell clones (Clones 10 and 16) were stimulated by different subsets of ...
The vast majority of proviruses that persist on ART are defective. Of the minority that are intact (~2%), the fractions that are latent or transcriptionally active are not known. To address this question, we determined the fraction of proviruses that express HIV RNA in vivo in cell populations carrying either intact or defective proviruses.. PBMC were obtained from Patient #1 in Maldarelli, et al. (Science, 2014). This donor had multiple clones of cells that contain intact or defective proviruses. Proviral expression was determined by single-genome pro-pol sequencing (SGS) of HIV DNA and RNA from multiple aliquots of PBMC diluted to an endpoint such that each aliquot contained one to a few HIV RNA expressing cells. Intact proviruses were identified using viral outgrowth assays (VOA). The levels and fractions of cells expressing HIV RNA were determined for probable clones (identified by identical sequence matches) carrying intact and defective proviruses.. A total of 77 million PBMC were ...
Tumor cell clones isolated from a rat 13762NF mammary adenocarcinoma and its spontaneous metastases were heterogeneous in their survival responses to continuous 42° heating. Clones MTLn3 and MTF7 had similar initial survival responses; they were significantly less sensitive than clone MTC. Following the first decrease in survival, different magnitudes of induced thermal resistance were observed. When ratios of the first and resistant slopes of survival curves were compared (the thermotolerance ratio), the order of induced thermal resistance was MTLn3 , MTF7 , MTC.. These clones were compared for the rates of synthesis of heat stress proteins (HSP). The same four major HSP at Mr 112,000, 90,000, 70,000, and 22,000 were induced or enhanced in all 3 clones. The rates of synthesis of these HSP were analyzed through a unique system of computer-assisted video densitometry and digitization. When all 4 HSP were analyzed as a group, the rates were significantly different (p , 0.017), and the rank order ...
The outcome of patients with MM has improved substantially during the last decades as a result of drug development and progress in the understanding of disease biology.11,12 However, even in the era of novel agents some patients with high-risk cytogenetic abnormalities or early relapse after first-line treatment have a dismal outcome.13,14 Clonal heterogeneity and evolution are contributors to disease progression and ultimately refractoriness in MM.6 So far, there are only limited data available that proved clonal evolution in patients relapsing after ASCT for newly diagnosed disease. With our current analysis of 128 patients with FISH data at primary diagnosis and relapse after ASCT we demonstrate that high-risk cytogenetic abnormalities occur more frequently at relapse. This observation was especially due to de novo gains of chromosome 1q and new deletions of chromosome 17p. No changes were observed between primary diagnosis and relapse for defined IGH translocations, including t(4;14).. A ...
https://doi.org/10.18632/oncotarget.25743 Kentaro Tanaka, Toyoshi Yanagihara, Yuki Ikematsu, Hiroyuki Inoue, Keiichi Ota, Eiji Kashiwagi, Kunihiro Suzuki, Naoki Hamada, Ario Takeuchi, Katsunori...
TY - JOUR. T1 - Isolation of myoblastic, fibro-adipogenic, and fibroblastic clonal cell lines from a common precursor and study of their requirements for growth and differentiation. AU - Darmon, Michel. AU - Serrero, Ginette. AU - Rizzino, Angie. AU - Sato, Gordon. N1 - Funding Information: We thank Dr H. Jakob for the gift of the T984 cell line and for the stimulatingd iscussionswhich led to this study and also Drs H. E&en, J.-F. Nicolas, M. H. But and F. Jacob for stimulatingd iscussions. We thank Dr R. Bloch for his assistancei n performing experimentsw ith rhodamine-labeleda BT and Drs J. Orly, D. McClure, and D. Barnes for their valuable help during this work. We thank Dr D. Weinstein for helu in oreoarine delioidated and delioooroteinized sera and-D; S. Cohenfor the gift of high molecular weight EGF. These experimentsw ere conductedd ur-ingthe tenure of an ACS-Eleanor Roosevelt lnter- national Cancer Fellowship awarded by the Intema-tional Union Against Cancer to M. D. USPHS-CA 19731a nd ...
Re: [PATCH 1/6] selftests/clone3: convert test modes into an enum 2019-09-10 12:03 ` [PATCH 1/6] selftests/clone3: convert test modes into an enum Eugene Syromiatnikov @ 2019-09-16 16:28 ` shuah 0 siblings, 0 replies; 13+ messages in thread From: shuah @ 2019-09-16 16:28 UTC (permalink / raw) To: Eugene Syromiatnikov, linux-kernel, Christian Brauner, linux-kselftest Cc: Adrian Reber, shuah On 9/10/19 6:03 AM, Eugene Syromiatnikov wrote: , * tools/testing/selftests/clone3/clone3.c (CLONE3_ARGS_NO_TEST, , CLONE3_ARGS_ALL_0, CLONE3_ARGS_ALL_1): Change into an enum. , (call_clone3): Change test_mode parameter type to enum test_mode; , use switch statement for actions that dependent on test_mode selection. , (test_clone3): Change test_mode parameter type to enum test_mode. , You dont need the file name in the commit log. Please describe what you are fixing/doing in the commit. Describing the actual code changes doesnt help. Including why these changes are needed as opposed the actual changes will ...
All normal somatic cells are thought to acquire mutations, but understanding of the rates, patterns, causes and consequences of somatic mutations in normal cells is limited. The uterine endometrium adopts multiple physiological states over a lifetime and is lined by a gland-forming epithelium1,2. Here, using whole-genome sequencing, we show that normal human endometrial glands are clonal cell populations with total mutation burdens that increase at about 29 base substitutions per year and that are many-fold lower than those of endometrial cancers. Normal endometrial glands frequently carry driver mutations in cancer genes, the burden of which increases with age and decreases with parity. Cell clones with drivers often originate during the first decades of life and subsequently progressively colonize the epithelial lining of the endometrium. Our results show that mutational landscapes differ markedly between normal tissues-perhaps shaped by differences in their structure and physiology-and indicate
Get Cell Cloning Cylinders at Spectrum Chemical. SpectrumChemical.com carries a full line of fine chemicals, lab appliances and lab supplies. Spectrum Chemical has a complete line of laboratory supplies, equipment and safety items.
Over the past two years, a team led by biologist Teruhiko Wakayama at the University of Hawaii has produced six generations of cloned mice clones of clones of clones of clones of clones of clones. The researchers paid particular attention to the animals telomeres, the caps at the tips of their chromosomes. These genetic caps are associated with aging. They grow shorter over time and are thought to contribute to cell death as they wear away. In conventional reproduction, telomeres are restored during the formation of sperm and egg cells, but cloning bypasses that process. We might therefore expect telomeres to become shorter and shorter in successive generations of clones, says Tony Perry of Rockefeller University, one of Wakayamas collaborators. Bafflingly, they seem to get longer ...
Effective neutralization of different strains of HIV virus is shown by neutralizing antibodies against HIV-1 envelope glycoproteins. It has been demonstrated that gp41 is involved in virus mediated membrane fusion which results in HIV-entry into target cells. Recombinant single chain antibodies (scFvs) with high specificity and high affinity properties have been identified as useful agents in anti-viral targeted therapy. In this study we selected specific scFvs against a conserved neutralizing epitope of gp41. Four rounds of panning were performed to select the specific clones. The reactivity of the selected scFvs against the corresponding epitope was tested in ELISA. Results demonstrated that the specific clones were selected with the frequencies of 65% and 30%. The ELISA evaluation demonstrated significant higher OD of scFvs in reaction with the corresponding epitope than the negative control. Specific scFvs against conserved neutralizing epitope of gp41 of HIV has the potential to be ...
Nov 13, 2007, 22:49. Todo lo que Tú Querías Saber Sobre los Robotoides y Clones. Por Candace. 2007-11-10. Hola a todos, puesto que recientemente Patrick Bellringer ha estado haciendo énfasis en los clones, es tiempo de aclarar más completamente los misterios. Primero usemos dos términos diferentes: clones y Robotoides. Un clon ç en esta discusión significará los clones que ustedes ven en el gobierno, tales como el residente y no-electro clon que funciona en la Casa Blanca, y todos sus cómplices clones. La mayoría de estos clones son hechos en cuestión de algunas semanas, de células tomadas del cuerpo original, ya sean que se trate de humanos reales o robotoides. ¿Así que entonces que es un robotoides? No es exactamente un clon, como se describe arriba. Aproximadamente en el año 2500 A.C.a los propietarios del planeta les preocupaba que aquellos sobrevivientes del último viaje a través del Cinturón de Fotones, del gran diluvio y de otras calamidades se volviera nuevamente por ...
Get a chat clone script from Grow Wider that is a highly reliable and secure messaging app. Contact for Whatsapp clone, wechat clone and telegram clone script with android and ios app.
Based in Abingdon (UK) and Philadelphia (USA) were a privately owned biotechnology company developing innovative biological therapeutics for the treatment of a range of serious diseases. Our world-leading T cell receptor technology exploits the power of the bodys own immune system to find and kill diseased cells. Weve established a robust technology platform which combines monoclonal T cell receptor (mTCR) targeting technology with an effector technology, anti-CD3 scFv, that catalyses the killing of the targeted diseased cells by the hosts own non-specific cytotoxic T cells. And were developing a portfolio of products from the platform, called ImmTACs, for the treatment of cancer, chronic infectious disease and diabetes.. ...
Mouse monoclonal antibody raised against full length recombinant human MB. Recombinant protein corresponding to full length of human MB. (MAB12457) - Products - Abnova
Mouse monoclonal antibody raised against partial recombinant PNPLA2 . Recombinant protein corresponding to amino acids 30-504 of human PNPLA2 . (MAB3210) - Products - Abnova
Scientists are testing immune checkpoint proteins, CD8 T cell clonal expansion, mutational load, and PSA levels as predictive biomarkers.
Reagents. shRNA lentiviral constructs targeting ITPKB, NOX4, NOX1, IPMK, and TRC Human Kinase shRNA Gene Family Library were purchased from GE Healthcare Dharmacon. sgRNA lentiviral constructs to target ITPKB were obtained from Genecopoeia. The shRNA sense strand sequences were ACAGCTATGGAAATTGACAAA (ITPKB shRNA clone 1), GCCTTCAGAGAGTTCACTAAA (ITPKB shRNA clone 2), CCCTCAACTTCTCAGTGAATT (NOX4 shRNA clone 1), CAGAGTTTACCCAGCACAAAT (NOX4 shRNA clone 2), CCGCACACTGAGAAAGCAATT (NOX1 shRNA clone 1), CCAAGGTTGTTATGCACCCAT (NOX1 shRNA clone 2), GCCCTGTATAATGGATGTAAA (IPMK shRNA clone 1), and GCAAGTTCATTACTCTTTGTT (IPMK shRNA clone 2). ITPKB sgRNA sequences were AGCCGAGTCGCTGTCCCCCG (ITPKB sgRNA clone 1) and CGGGGGCGTCTCGCTGCCAC (ITPKB sgRNA clone 2). Primers for ITPKB shRNA-resistant silent mutant and ITPKB kinase-dead D897N mutant were obtained from Integrated DNA Technologies. Bt2-Ins (1345) P4/PM was obtained from SiChem. GKT137831, Z-VAD-fmk, cyclosporin A, and necrostatin-1 were from Selleckchem. ...
For some time, scientists have been able to craft precise genetic copies of many creatures. Whether they are animals, or single cells, they are similarly refereed to as clones. For various technical and perceived ethical reasons, the procedures involved have been difficult to replicate for humans. A new paper published in the journal Cell shares the work of a group of researchers in Oregon who have grown a human clone - at least up to a couple hundred cells.. ...
Remember also that gene expression in behavior is not mathematically precise. In other words, you could have responded many different ways to different environments (within definite biologically determined boundaries). The clone would not be you; he or she might unpredictably behave differently from you. Lets say both you and therefore (presumably) your clone have a rebellious streak under certain circumstances, and have an orderly streak under others. You were reared, lets say, in a permissive environment, and your coping response was to call on your orderly streak, leading you to blossom into the upright example you doubtless are at present. But supposing you were to raise your clone in a (even only infinitesimally) more restrictive, less permissive environment. (Such as an enviroment in which your every move, feeling, and thought were anxiously monitored and commented upon by a weirdo parent.) In that case, the clones prevalent coping response may be to call upon his/your rebellious ...
An inbred strain can produce several hundred different anti-group A carbohydrate (GAC) antibodies, as analyzed by isoelectric focusing. However, each individual mouse produces the bulk of its anti-GAC antibody as only one or two different spectrotypes, which appear to be randomly chosen. By using adoptive transfer techniques, we have observed that clonal commitment occurs very early in immunization, sometimes even before immunization, and thus does not result from competition among B cells for antigen ...
Some members have expressed a desire to have CryptoOperation objects be clone-able, so that the same operation may be re-used for multiple data streams, without affecting the state of the original object ...
T cells engineered to express the α and β chains of antigen-specific T cell receptors (TCRs) have shown promise as a cancer immunotherapy treatment; however, durable responses have been limited by poor persistence of gene-modified T cells. Additionally, severe toxicities, including patient deaths, have occurred upon infusion of large numbers of TCR-modified T cells. To enhance T cell persistence while providing a safeguard against life-threatening toxicity, we developed a dual-switch αβ TCR platform that uses a rapamycin (Rap)-induced caspase-9 (iRC9) together with a rimiducid (Rim)-controlled activation switch, inducible MyD88/CD40 (iMC).. The αβ TCR sequence derived from an HLA-A2-restricted, PRAME-specific T cell clone was synthesized and placed in-frame with iMC, comprising signaling domains from MyD88 and CD40 fused to tandem Rim-binding mutant FKBP12v36 domains to generate the iMC-PRAME TCR. Caspase-9 was fused to FRB and wild-type FKBP12 domains and cloned in-frame with a selectable ...
At the peak of an immune response, hundreds of thousands of identical T cells are scampering about, searching out the pathogen and doing their own special T cell things to try to get rid of it. We know that these hundreds of thousands of cells werent there at the onset of infection; the whole T cell schtick involves rapid expansion of very, very rare cells. Only a very few T cells are able to recognize any particular antigen; but within a few days, the progeny of those rare cells are now common, and all retain their ability to recognize the same antigen. 1. In the past few years, weve learned a little more, quantitatively, just how dramatic this expansion phase is. Delicate work has established that there are maybe 20 to 1000 potentially-reactive T cells in a mouse, before infection (see my discussion here and here). Those few cells are the precursors of the huge numbers of T cells a week or so after infection.. If you think about it, its pretty remarkable that these few T cells, hidden ...
CD66b, PE, clone: G10F5, eBioscience™ 100 Tests; PE CD66b, PE, clone: G10F5, eBioscience™ Primary Antibodies CD51 to CD100
CD284 (TLR4), PE, clone: HTA125, eBioscience™ 25 Tests; PE CD284 (TLR4), PE, clone: HTA125, eBioscience™ Primary Antibodies CD251 to CD400
Clone (cell biology) Nossal, G. J. V. & Lederberg, J. (1958). "Antibody production by single cells". Nature. 181: 1419-1420. ... The expansion of a particular clone of immune B cells is usually interpreted by clinicians as evidence of unrestricted cell ... This differentiation and activation of the B cell occurs most rapidly after exposure to antigen by antigen-presenting cells in ... The process of immunological B-cell maturation involves transformation from an undifferentiated B cell to one that secretes ...
... so they are technically a single clone of cells. However, during course of cell division, one of the cells can get mutated ... bone marrow cells. Most other cells cannot divide indefinitely as after a few cycles of cell division the cells stop expressing ... A clone is a group of identical cells that share a common ancestry, meaning they are derived from the same cell. Clonality ... This concept of clone assumes importance as all the cells that form a clone share common ancestry, which has a very significant ...
However, the cloning was done from early embryonic cells, while the sheep Dolly in 1996 was cloned from an adult cell. Megan ... 24 January 2018). "Cloning of Macaque Monkeys by Somatic Cell Nuclear Transfer". Cell. 172 (4): 881-887.e7. doi:10.1016/j.cell. ... Peru cloned a Jersey cattle by handmade cloning method using cells of an ear of a cow. The first Peruvian clone was called " ... The cloned animals are included in the list when citing scientific sources. A Javan banteng calf was cloned from frozen cells ...
"A modified method for cloning adherent mammalian cells". "Cloning by Limiting Dilution".[permanent dead link] "Cloning by ... Dilution cloning or cloning by limiting dilution describes a procedure to obtain a monoclonal cell population starting from a ... Applications for the procedure include cloning of parasites, T cells, transgenic cells, and macrophages. Freshney, R. Ian (2010 ... A suspension of the parent cells is made. Appropriate dilutions are then made, depending on cell number in the starting ...
Gor, Mosam (2016-05-20). "What is Cell Phone Cloning - Everything You Need to Know". MovZio. Retrieved 2019-04-05. "S.493 - ... as the target telephone is now a clone of the telephone from which the original ESN and MIN data were obtained. GSM cloning ... Phone cloning is the copying of identity from one cellular device to another. Analogue mobile telephones were notorious for ... Phone cloning is outlawed in the United States by the Wireless Telephone Protection Act of 1998, which prohibits "knowingly ...
24 January 2018). "Cloning of Macaque Monkeys by Somatic Cell Nuclear Transfer". Cell. 172 (4): 881-887.e7. doi:10.1016/j.cell. ... Trounson A, DeWitt ND (2013). "Pluripotent stem cells from cloned human embryos: success at long last". Cell Stem Cell. 12 (6 ... Two commonly discussed types of human cloning are therapeutic cloning and reproductive cloning. Therapeutic cloning would ... "Human somatic cell nuclear transfer using adult cells". Cell Stem Cell. 14 (6): 777-80. doi:10.1016/j.stem.2014.03.015. PMID ...
... a cell means to derive a population of cells from a single cell. In the case of unicellular organisms such as bacteria ... 24 January 2018). "Cloning of Macaque Monkeys by Somatic Cell Nuclear Transfer". Cell. 172 (4): 881-887.e7. doi:10.1016/j.cell. ... However, in the case of cell cultures from multi-cellular organisms, cell cloning is an arduous task as these cells will not ... Two commonly discussed types of theoretical human cloning are therapeutic cloning and reproductive cloning. Therapeutic cloning ...
"Cloning, Stem Cells, and the Current National Debate: Incorporating Ethics into a Large Introductory Biology Course." Cell ... While most Christians do not support reproductive cloning, therapeutic cloning is a branch of cloning which has garnered ... Stem cell law Stem cell controversy Weasel, Lisa H., and Eric Jensen. "Language and Values in the Human Cloning Debate: A Web- ... "Cloning, like all science, must be used responsibly. Cloning humans is not desirable. But cloning sheep has its uses." On the ...
Kolb, A.F. (2002). "Genome Engineering Using Site-Specific Recombinases". Cloning & Stem Cells. 4 (1): 65-80. doi:10.1089/ ... Cell. 58 (4): 779-90. doi:10.1016/0092-8674(89)90111-6. PMID 2548736. S2CID 46508016. Stark, W.M.; Boocock, M.R. (1994). "The ... Cell. 82 (2): 193-207. doi:10.1016/0092-8674(95)90307-0. PMID 7628011. S2CID 15849525. Li, W.; Kamtekar, S; Xiong, Y; Sarkis, ... Cell. 25 (3): 721-8. doi:10.1016/0092-8674(81)90179-3. PMID 6269756. S2CID 28410571. Reed, R.R.; Moser, C.D. (1984). "Resolvase ...
"Amniotic Fluid Cells Are More Efficiently Reprogrammed to Pluripotency Than Adult Cells". Cloning Stem Cells. 12 (2): 117-25. ... doi:10.1089/cell.2009.0077. PMC 2998987. PMID 20677926. Copperman, KB; Schertz, JC; Witkin, G; Sandler, B; Brodman, M; ...
Alice Park (17 April 2014). "Researchers Clone Cells From Two Adult Men". TIME. Retrieved 17 April 2014. "Leukaemia: Cardiff ... fat cells into brown, or "good," fat cells. Two compounds have already been shown to achieve this in human cells. 10 December ... "Stem cells created from a drop of blood: DIY finger-prick technique opens door for extensive stem cell banking". Science Daily ... "Stap cells: research paper on stem cell breakthrough was partly falsified". The Guardian. 1 April 2014. Retrieved 1 April 2014 ...
"Conservation Cloning"?". Cloning and Stem Cells. 11 (3): 341-346. doi:10.1089/clo.2009.0026. ISSN 1536-2302. PMID 19594389. ... "First Extinct-Animal Clone Created". news.nationalgeographic.com. Retrieved 2017-06-29. Piña-Aguilar, Raul E.; Lopez-Saucedo, ...
... "conservation cloning"?". Cloning and Stem Cells. 11 (3): 341-346. doi:10.1089/clo.2009.0026. PMID 19594389. Profile at The ... Celia provided suitable tissue samples for cloning. However, attempts to clone her highlighted a major problem: even if it were ... only certain extinct animals are candidates for cloning because of the need for a suitable proxy surrogate to carry the clone ... The first cloning attempts failed. Of the 285 embryos reconstructed, 54 were transferred to 12 ibex and ibex-goat hybrids, but ...
Cloning and Stem Cells. 11 (3): 427-435. doi:10.1089/clo.2009.0024. PMID 19751112. Gamer LW, Wolfman NM, Celeste AJ, Hattersley ... GDF11 fed mice saw 45.7% reduction in senescent liver cells and a 21.7% reduction in senescent kidney cells. GDF11 induces ... GDF11 induces tumor suppressive properties in human hepatocellular carcinoma-derived cells, Huh7 and Hep3B cell lines, ... and controls the competence of progenitor cells to regulate numbers of retinal ganglionic cells developing in the retina. Other ...
J. Cell Cloning. 10 (5): 269-76. doi:10.1002/stem.5530100504. PMID 1453013. Aplan PD, Lombardi DP, Reaman GH, Sather HN, ... T-cell acute lymphocytic leukemia protein 1 (i.e. TAL1 but also termed stem cell leukemia/T-cell acute leukemia 1 [i.e. SCL/ ... Cell. Biol. 10 (12): 6426-35. doi:10.1128/mcb.10.12.6426. PMC 362919. PMID 2247063. Chen Q, Cheng JT, Tasi LH, Schneider N, ... Cell. Biol. 13 (2): 801-8. doi:10.1128/mcb.13.2.801. PMC 358963. PMID 8423803. TAL1+protein,+human at the US National Library ...
Cloning and Stem Cells. 6 (4): 375-385. doi:10.1089/clo.2004.6.375. ISSN 1536-2302. PMID 15671666. Martins Da Silva, Sarah ... Da Silva's research investigates the functionality of sperm cells, particularly the sperm-specific calcium channel CatSper, and ... and investigated egg cell maturation and the development of the ovaries. Her advisor was Richard Anderson. In 2008 she ... activin A promotes germ cell survival and proliferation before primordial follicle formation". Developmental Biology. 266 (2): ...
Trounson's areas of interest include cloning, stem cells, biotechnology, cloning for agricultural industry, gene storage and in ... "Cloning and Stem Cells". Archived from the original on 28 September 2007. "ISSCR Officers". International Society for Stem Cell ... when in fact the cells were germ cells from a fetal rat. In 2003 he was appointed a Personal Chair as Professor of Stem Cell ... March 2007). "Cloning and Stem Cells". ISSN 1536-2302. {{cite journal}}: Cite journal requires ,journal= (help) Clohesy, ...
Ihle JN, Askew D (1989). "Origins and properties of hematopoietic growth factor-dependent cell lines". Int J Cell Cloning. 9 (1 ... TF-1 cells are immortal cell line derived from the human Erythroleukemia used in biomedical research. This cells are ... Other cell lines in LL-100 panel Kitamura T, Tange T, Terasawa T, Chiba S, Kuwaki T, Miyagawa K, Piao YF, Miyazono K, Urabe A, ... Information on TF-1 in the ATCC catalog Cellosaurus entry for TF-1 (Human cell lines). ...
In cloning, the nucleus of a diploid cell from a donor organism is inserted into an enucleated egg cell and the cell is then ... Mature egg cells are produced by mitotic divisions, and these cells directly develop into embryos. In flowering plants, cells ... Cloning and Stem Cells. 10 (1): 11-24. doi:10.1089/clo.2007.0063. PMID 18092905. Williams, Chris. "Stem cell fraudster made ' ... "Patient-Specific Stem Cell Lines Derived from Human Parthenogenetic Blastocysts". Cloning and Stem Cells. 9 (3): 432-449. doi: ...
"Human Embryonic Stem Cell-Derived Cells Rescue Visual Function in Dystrophic RCS Rats - Cloning Stem Cells". Cloning and Stem ... 2014). "Human somatic cell nuclear transfer using adult cells". Cell Stem Cell. Cell Press. 14 (6): 777-780. doi:10.1016/j.stem ... "Cell Stem Cell - Generation of Human Induced Pluripotent Stem Cells by Direct Delivery of Reprogramming Proteins". Cell Stem ... 28 April 2000). "Extension of Cell Life-Span and Telomere Length in Animals Cloned from Senescent Somatic Cells" (PDF). Science ...
They may also be created by somatic cell nuclear transfer (SCNT) into an egg cell of another species, creating a cloned embryo ... 1] Fulka Jr, J.; Loi, P.; Ptak, G.; Fulka, H.; John, J. (2009). "Hope for the mammoth?". Cloning and Stem Cells. 11 (1): 1-4. ... The remaining inner cell mass can be injected into a blastocele of the recipient species to acquire its trophoblastic cells. It ... In this experiment, nuclei from cells taken from abdominal muscles of giant pandas were transferred to egg cells of rabbits and ...
Maienschein, Jane (2009-06-30). Whose View of Life? Embryos, Cloning, and Stem Cells. p. 120. ISBN 9780674040434. Friese, ... Webber coined the word "clone" in 1903 and was the first to use it to describe a colony of organisms derived asexually from a ... Enacting Conservation and Biomedicine: Cloning Animals of Endangered Species. p. 58. ISBN 9780549132806. "The Citrus Industry ...
"Stem cell cloning ban overturned". News.com.au. 6 December 2006. Retrieved 31 August 2007.[dead link] "Andrews sets out ... In taking a stance against stem cell research in 2002, he stated that it was the "first time" that "human beings can be treated ... cite news}}: Check ,url= value (help)[dead link] "Politicians prepare to vote on stem cell issue". Australian Broadcasting ... as a commodity". He also took a stance against stem cell research during a debate in 2006, which resulted in the overturning of ...
Cloning, and Stem Cells". Maienschein and Manfred Laubichler collaborated to co-write: "From Embryology to Evo-Devo: A History ... Maienschein researched the history and philosophy of developmental biology as well as issues surrounding stem cell research and ... In 2009, Maienschein presented, with Tedx Talks on "Stem Cells, Regenerative Medicine and Us". In November 2010, Maienschein ...
Cyranoski, David (2007-11-14). "Cloned monkey stem cells produced". Nature News. doi:10.1038/news.2007.245. White-house, David ... Semos - a nine-year-old male rhesus macaque at the Oregon National Primate Research Center who supplied the skin cells from ... Tetra - a rhesus macaque at the Oregon National Primate Research Center who was the first cloned primate, created through ... 14 January 2000). "Scientists 'clone' monkey". BBC News. "Stranger Than Fiction: Jack the Signalman". www.knoxvilledailysun.com ...
"Somatic Cell Cloning without Micromanipulators". Cloning. 3 (2): 89-95. doi:10.1089/15204550152475590. PMID 11900643. Vajta, G ... "Birth of a cloned calf derived from a vitrified hand-made cloned embryo". Reproduction, Fertility and Development. 15 (7): 361 ... OPS is also regarded as the most appropriate carrier tool for vitrification of human embryonic stem cells (hESCs). Vajta, G. B ... All work is done by hand, with simple handheld tools (blade and micropipette). The first cloned animals in Africa and ...
Lindström, Sara; Larsson, Rolf; Svahn, Helene Andersson (2008-03-01). "Towards high-throughput single cell/clone cultivation ... cell culture and detection of antimicrobial activity. The enormous growth in studies of whole live cells has led to an entirely ... "High-density microwell chip for culture and analysis of stem cells". PLOS ONE. 4 (9): e6997. Bibcode:2009PLoSO...4.6997L. doi: ... modified using an oxygen plasma discharge to make their surfaces more hydrophilic so that it becomes easier for adherent cells ...
Clones of alloreactive T cells. Nature 272:617-8. Kimoto, Masao, and Fathman, C. Garrison. (1981) Antigen-reactive T cell ... His research centers on a molecular and cellular understanding of CD4 T cell responsiveness in mice and man. President of the ... 1996) Monoclonal T cells identified in early NOD islet infiltrates. Immunity 4:189-194. Anandasabapathy, Niroshana, Ford, ... 2004) Two isoforms of otubain 1 regulate T cell anergy via GRAIL. Nat Immunol 5:45-54. Kodama, Keiichi, Butte, Atul J., Creusot ...
"Green light for stem cell clones". The Guardian. Archived from the original on 12 December 2013. Retrieved 22 August 2013. ... Newcastle University was the first in the UK and the second in Europe to receive a licence to perform research on stem cells ... Newcastle University is now a leading institution in the development of stem cell technology being the first in the United ... Dr Karim Nayernia was the first to isolate spermatagonial stem cells at this University. Many new healthcare developments have ...
Genetics, Stem Cell Research, and Cloning. Kregel, 2004. Kilner, John F., co-authored. Biotechnology and the Human Good. ... Stem Cell Research, and Cloning. Reviewed and discussed in Bevington, Linda K., Ray G. Bohlin, Gary P. Stewart, John F. Kilner ... and C. Christopher Hook (2004). Genetics, Stem Cell Research, and Cloning. Grand Rapids, Michigan: Kregel. He has also written ... Kilner, John F., and C. Ben Mitchell (2003). Does God Need Our Help? Cloning, Assisted Suicide, & Other Challenges in Bioethics ...
Cell. 122 (6): 957-68. doi:10.1016/j.cell.2005.08.029. hdl:11858/00-001M-0000-0010-8592-0. PMID 16169070. S2CID 8235923. ... Suchi M, Mizuno H, Kawai Y, Tsuboi T, Sumi S, Okajima K, Hodgson ME, Ogawa H, Wada Y (Mar 1997). "Molecular cloning of the ... Suchi M, Harada N, Tsuboi T, Asai K, Okajima K, Wada Y, Takagi Y (1990). "Molecular cloning of human UMP synthase". Purine and ... Suttle DP, Bugg BY, Winkler JK, Kanalas JJ (Mar 1988). "Molecular cloning and nucleotide sequence for the complete coding ...
"CAR T Cells: Engineering Patients' Immune Cells to Treat Their Cancers". National Cancer Institute. 2013-12-06. Retrieved 9 ... Multiple cloning sites are sometimes used to ensure that the fragments are inserted in all three possible reading frames so ... The phage gene and insert DNA hybrid is then inserted (a process known as "transduction") into E. coli bacterial cells such as ... This displayed the different peptides on the outer surfaces of the collection of viral clones, where the screening step of the ...
Al.. Human Cloning and Moral Status. The Florida State University, 2003. McClendon J. F. The distribution of iodine with ... life processes of cell membranes, the importance of pH control, the role of iodine in human health, and specifically its ...
The cloning and sequencing of the Norwalk virus genome showed that these viruses have a genomic organization consistent with ... FUT2 fucosyltransferase transfers a fucose sugar to the end of the ABO(H) precursor in gastrointestinal cells and saliva glands ... Entry into the host cell is achieved by attachment to host receptors, which mediates endocytosis. Positive-stranded RNA virus ...
In embryonic cells, Nfix has been shown to regulate intermediate progenitor cell (IPC) generation by promoting the ... Apt D, Liu Y, Bernard HU (1994). "Cloning and functional analysis of spliced isoforms of human nuclear factor I-X: interference ... Intermediate progenitor cells can divide to produce neuroblasts. Neurons produced by Nfix null IPC's do not mature, usually die ... Cell. Biol. 20 (22): 8499-8512. doi:10.1128/MCB.20.22.8499-8512.2000. PMC 102156. PMID 11046146. Imagawa M, Sakaue R, Tanabe A ...
Cell Growth Differ. 5 (12): 1347-55. PMID 7696183. Lee J, Wang Z, Luoh SM, Wood WI, Scadden DT (January 1994). "Cloning of FRK ... Lyn and Fgr are highly expressed in malignant prostate cells compared to normal prostate cells. When the primary prostate cells ... HSP90 inhibitor NVP-BEP800 has been described to affect stability of Src tyrosine kinase and growth of T-cell and B-cell acute ... Src, Fyn and Yes are expressed ubiquitously in all cell types while the others are generally found in hematopoietic cells. c- ...
... and c-Src are activated in human aortic smooth muscle cells by pressure stress". Mol. Cell. Biochem. 262 (1-2): 71-8. doi: ... The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro". DNA Res. 6 (3): 197-205. doi: ... 2006). "JSAP1/JIP3 cooperates with focal adhesion kinase to regulate c-Jun N-terminal kinase and cell migration". J. Biol. Chem ... 2001). "Characterization of long cDNA clones from human adult spleen". DNA Res. 7 (6): 357-66. doi:10.1093/dnares/7.6.357. PMID ...
Cram DS, Barnett LD, Joseph JL, Harrison LC (July 1991). "Cloning and partial nucleotide sequence of human glutamic acid ... enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell ...
Cell. 127 (3): 635-48. doi:10.1016/j.cell.2006.09.026. PMID 17081983. S2CID 7827573. v t e (Articles with short description, ... The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro". DNA Res. 5 (5): 277-86. doi: ... "Large-scale characterization of HeLa cell nuclear phosphoproteins". Proc. Natl. Acad. Sci. U.S.A. 101 (33): 12130-5. Bibcode: ...
Apoptosis is a cell self-destruct process that removes toxic and/or useless cells during mammalian development and other life ... Mukae N, Enari M, Sakahira H, Fukuda Y, Inazawa J, Toh H, Nagata S (August 1998). "Molecular cloning and characterization of ... The cell diversity is originated by cell differentiation, which has been attributed to the activation of specific transcription ... Despite this gene being present in every cell, this protein is only expressed in different tissues and cell variety such as ...
... and causes cell death in cultured cells". J. Biol. Chem. 275 (4): 2647-53. doi:10.1074/jbc.275.4.2647. PMID 10644725. Li PF, Li ... Irie Y, Yamagata K, Gan Y, Miyamoto K, Do E, Kuo CH, Taira E, Miki N (2000). "Molecular cloning and characterization of Amida, ... "Calcium binding of ARC mediates regulation of caspase 8 and cell death". Mol. Cell. Biol. 24 (22): 9763-70. doi:10.1128/MCB. ... Cell. 15 (6): 901-12. doi:10.1016/j.molcel.2004.08.020. PMID 15383280. Jo DG, Jun JI, Chang JW, Hong YM, Song S, Cho DH, Shim ...
The FCP's intent was both to indicate their opposition to cloning technology, and to suggest that the major parties were ... embryonic stem cell research, in vitro fertilization, pornography, and contraception. The party's first election was the 1987 ... The party achieved limited media attention by conducting a demonstration at Queen's Park featuring three "cloned sheep" to ...
... and cell death. Daxx interacts with the TGF-β type II receptor by binding of C-terminal domain of the protein. When the cell is ... Kiriakidou M, Driscoll DA, Lopez-Guisa JM, Strauss JF (1997). "Cloning and expression of primate Daxx cDNAs and mapping of the ... Another important cell death-property of Daxx is the association with PML-NB. It was shown that Daxx associates with Pml only ... This partnership is found mainly in the S-phase of the cell cycle. No expression of Daxx leads to malfunction of S phase and ...
Hirschhorn R, Huie ML, Kasper JS (Oct 2002). "Computer assisted cloning of human neutral alpha-glucosidase C (GANC): a new ... expressed in Chinese hamster ovary cells". The Journal of Biological Chemistry. 265 (18): 10373-82. doi:10.1016/S0021-9258(18) ... "Temporal expression of HIV-1 envelope proteins in baculovirus-infected insect cells: implications for glycosylation and CD4 ... Cytogenetics and Cell Genetics. 27 (2-3): 168-75. doi:10.1159/000131478. PMID 6995030. ...
1999). "[Cloning and expression analyses of down-regulated cDNA C6-2A in human esophageal cancer]". Zhonghua Yi Xue Yi Chuan ... Cell. 15 (1): 91-8. doi:10.1091/mbc.E03-06-0427. PMC 307530. PMID 14565974. Strausberg RL, Feingold EA, Grouse LH, et al. (2003 ...
"Molecular cloning and structural analysis of a gene from Zea mays (L.) coding for a putative receptor for the plant hormone ... Plant Cell. 4 (2): 193-201. doi:10.1105/tpc.4.2.193. PMC 160120. PMID 1321684. This article incorporates text from the public ... known to be responsible for preventing secretion of proteins from the lumen of the ER in eukaryotic cells. Woo EJ, Marshall J, ...
The forced over expression of CMTM5-v1 in Huh7 human hepatic cells also inhibited the ability of these cells to grow in a mouse ... by in silico cloning and experimental validation". Genomics. 81 (6): 609-17. doi:10.1016/s0888-7543(03)00095-8. PMID 12782130. ... Cai B, Xiao Y, Li Y, Zheng S (August 2017). "CMTM5 inhibits renal cancer cell growth through inducing cell-cycle arrest and ... the forced overexpression of CMTM5-v1 in cultured DU145 cells (a human prostate cancer cell line) reduces, while the forced ...
V. The coding sequences of 40 new genes (KIAA0161-KIAA0200) deduced by analysis of cDNA clones from human cell line KG-1". DNA ... Cell. 14 (2): 625-41. doi:10.1091/mbc.E02-09-0552. PMC 149997. PMID 12589059. Wasiak S, Denisov AY, Han Z, et al. (2004). " ... Cell. 13 (11): 4060-73. doi:10.1091/mbc.E02-03-0171. PMC 133614. PMID 12429846. Pimm J, McQuillin A, Thirumalai S, Lawrence J, ... Cell. 13 (11): 4060-73. doi:10.1091/mbc.E02-03-0171. PMC 133614. PMID 12429846. Strausberg RL, Feingold EA, Grouse LH, et al. ( ...
... cell-cell adhesion and neurite outgrowth using atomic force microscopy-based single-cell force spectroscopy". Nano Letters. 13 ... Qian X, Barsyte-Lovejoy D, Wang L, Chewpoy B, Gautam N, Al Chawaf A, Lovejoy DA (June 2004). "Cloning and characterization of ... Ten-m3 mRNA is prominently co-expressed with Ten-m2 and Ten-m4 in the Purkinje's cell zone of the cerebellum. Ten-m3 protein is ... They are also expressed in some non-neuronal tissues that regulate pattern formation and sites of cell migration. Some Ten-m3 ...
BMC Cell Biology. 10: 54. doi:10.1186/1471-2121-10-54. PMC 2717050. PMID 19607714. Satake W, Nakabayashi Y, Mizuta I, Hirota Y ... "Circular rapid amplification of cDNA ends for high-throughput extension cloning of partial genes". Genomics. 84 (1): 205-10. ... "Identification of genes associated with non-small-cell lung cancer promotion and progression". Lung Cancer. 67 (2): 151-9. doi: ...
"Cloning of novel immunoglobulin superfamily receptors expressed on human myeloid and lymphoid cells: structural evidence for ... and dendritic cells involved in antigen processing". The Journal of Experimental Medicine. 185 (10): 1743-51. doi:10.1084/jem. ... an inhibitory receptor expressed on effector and memory CD8 T cells) with their HLA ligands, thus modulating immune reactions ... "A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells ...
The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro". DNA Research. 6 (1): 63-70. ... Cell adhesion proteins). ...
doi:10.1016/j.cell.2016.12.039. PMC 5329766. PMID 28187287. Cooper GM (2000). "The Molecular Composition of Cells". The Cell: A ... Lees ND, Skaggs B, Kirsch DR, Bard M (March 1995). "Cloning of the late genes in the ergosterol biosynthetic pathway of ... Proteins are also important in cell signaling, immune responses, cell adhesion, active transport across membranes, and the cell ... Binding of the hormone to insulin receptors on cells then activates a cascade of protein kinases that cause the cells to take ...
... mRNA is readily detectable in several commonly used laboratory cell lines (HEK293A, HeLa, A431) and several cancer cell ... Hartley JL, Temple GF, Brasch MA (2001). "DNA Cloning Using In Vitro Site-Specific Recombination". Genome Res. 10 (11): 1788-95 ... Curr Opin Cell Biol. 22 (2): 150-6. doi:10.1016/j.ceb.2009.11.013. PMID 20036114. * Polson HE, de Lartigue J, Rigden DJ, ... which is a lysosomal degradation pathway required for maintaining cell health, surviving periods of nutrient deprivation and ...
If time is the responsible factor, it may be possible to delay cell division in clones, giving time for proper reprogramming to ... Imprinting may cause problems in cloning, with clones having DNA that is not methylated in the correct positions. It is ... Cell. 176 (5): 952-965. doi:10.1016/j.cell.2019.01.043. PMID 30794780. Wood AJ, Oakey RJ (November 2006). "Genomic imprinting ... of the parents and are maintained through mitotic cell divisions in the somatic cells of an organism. Appropriate imprinting of ...
Yabe T, McSherry C, Bach FH, Houchins JP (October 1990). "A cDNA clone expressed in natural killer and T cells that likely ... Its expression is restricted to cytotoxic immune cells such as cytotoxic T cells, NK cells, NKT cells and γδ T cells. Orthologs ... such as NK cells, cytotoxic T cells, helper T cells, and in higher concentrations, immature dendritic cells. The 9 kDa form ... Granulysin is expressed in killer cells, such as cytotoxic T cells and Natural Killer (NK) cells, which hold the cytotoxic ...
Tsurumi C, DeMartino GN, Slaughter CA, Shimbara N, Tanaka K (May 1995). "cDNA cloning of p40, a regulatory subunit of the human ... UPS proteolysis plays a major role in responses of cancer cells to stimulatory signals that are critical for the development of ... Goff SP (Aug 2003). "Death by deamination: a novel host restriction system for HIV-1". Cell. 114 (3): 281-3. doi:10.1016/S0092- ... Kleiger G, Mayor T (Jun 2014). "Perilous journey: a tour of the ubiquitin-proteasome system". Trends in Cell Biology. 24 (6): ...
Cell. 17 (4): 525-35. doi:10.1016/j.molcel.2005.02.003. PMID 15721256. Soung YH, Lee JW, Park WS, et al. (2006). "BH3 domain ... 2001). "Characterization of long cDNA clones from human adult spleen". DNA Res. 7 (6): 357-66. doi:10.1093/dnares/7.6.357. PMID ... Cell. 17 (3): 393-403. doi:10.1016/j.molcel.2004.12.030. PMID 15694340. Kuwana T, Bouchier-Hayes L, Chipuk JE, et al. (2005). " ... Bmf and Bcl-G in laryngeal squamous cell carcinomas". Tumori. 93 (2): 195-7. doi:10.1177/030089160709300214. PMID 17557568. ...
In cell biology, ways in which fragmentation is useful for a cell: DNA cloning and apoptosis. DNA cloning is important in ... The key to cloning a DNA fragment is to link it to a vector DNA molecule that can replicate within a host cell. After a single ... DNA cloning can be performed spontaneously by the cell for reproductive purposes. This is a form of asexual reproduction where ... 1. Red blood cell fragmentation A fragmented red blood cell is known as a schistocyte and is generally the result of an ...
2002). "An NAD(P)H oxidase regulates growth and transcription in melanoma cells". Am. J. Physiol., Cell Physiol. 282 (6): C1212 ... 2001). "Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5". Gene. 269 (1-2): 131-40. doi:10.1016/ ... "Nox4-dependent ROS modulation by amino endoperoxides to induce apoptosis in cancer cells". Cell Death Dis. 4 (3): e552. doi: ... Cell. Biol. 24 (5): 1844-54. doi:10.1128/MCB.24.5.1844-1854.2004. PMC 350558. PMID 14966267. Chamulitrat W, Stremmel W, ...
Cloning of human cells is a technology that holds the potential to cure many diseases and provide a source of exactly matched ... One cloning technology that has been developed for mammalian and human cells is somatic cell nuclear transfer (SCNT). SCNT is a ... They derived several human embryonic stem cell lines from these cloned embryos whose DNA was an exact match to the adult cell ... This was the first successful reprogramming of human somatic cells into embryonic stem cells using a cloning technique, SCNT. ...
Cloning of malaria parasites / by D. Walliker  Walliker, D; World Health Organization (‎World Health OrganizationWorld Health ... Cloning of mefloquine resistant Plasmodium falciparum from Thailand / by H. Kyle Webster ... [‎et al.]‎  ...
"One potential advantage of cloning is to produce identical cells, genetically identical cells," he said. With cloned cells, the ... Cloning cure? "Theres no relationship between cloning cows or cloning sheep or cloning pigs for therapeutic uses and the ... Cloning often raises fears, but researchers say theres a big difference between cloning brain cells and cloning humans. ... Researchers at the University of Colorado transplanted cloned bovine brain cells into the brains of rats. The cloned cells were ...
Why is embryonic stem cell research wrong? How has adult stem cell research helped medicine?. *Stem cell/human cloning debate ... New monkey clone? Would it be possible to clone a dinosaur? What about cloning other extinct animals?. *Commentary on The Lost ... Cloning, Stem Cells, and Reproductive Technology Questions and Answers. Key articles. *Cloning: Right or Wrong? ... Stem cells and Genesis What is cloning? Is it biblically right or wrong, and how is Genesis creation relevant?. * Legalized ...
Smokers with T cell-driven pathogenesis may benefit from targeted therapy ... Abundant T Cell Clones in Smokers Tied to Crohns Recurrence. - Smokers with T cell-driven pathogenesis may benefit from ... While expanded clones were found predominantly in the CD8 T cell compartment, a few were of CD4 lineage. Since most patients ... Moreover, these expanded T cell clones persist over time and may drive disease progression, the authors explained. ...
Australia Official: Keep Human Cloning, Embryonic Stem Cell Research Regs. Bioethics , Steven Ertelt , Mar 20, 2006 , 9:00AM , ... In June 2004, Australias National Stem Cell Centre announced it would make new human embryonic stem cell lines freely ... human cloning and embryonic stem cell research. Fresh from a defeat on the dangerous abortion drug RU 486, Abbott says he wont ... The stem cell lines are being derived from a Melbourne in-vitro fertilization clinic. ...
... using cells from a fetus rather than cells of an adult animal. The calf was produced by PPL Therapeutics Inc. of Blacksburg, a ... AP) - The company that cloned Dolly the sheep announced Monday that it has cloned a calf, ... Jefferson was cloned from cells taken from a 55-day-old calf fetus. Advanced Cell Technology and ABS also used fetal cells, and ... PPL said the cloned calf and the cloned sheep were produced by a process called somatic cell nuclear transfer. Somatic cells ...
When cloning animals, you need a non-reproductive cell (called a somatic cell) that contains all of the individuals DNA. ... Animal cloning from freeze-dried cells? Amazing achievement by scientists. Echo Richards July 7, 2022 3 min read ... As the authors of new research on this issue demonstrate, in the long run, even many years of cell storage and cloning can play ... It is possible to clone animals from freeze-dried cells, although its effectiveness has so far been low. ...
The first collaboration from long-time label mainstays Hodge and Simo Cell is true to the styles the artists have individually ... Hodge & Simo Cell. Drums From The West EP. Hodge & Simo Cell - Drums From The West EP (12inch) ... 2022 clone.nl site by joep-i.nl. subscribe to our newsletter. Terms and Conditions ... The first collaboration from long-time label mainstays Hodge and Simo Cell is true to the styles the artists have individually ...
Koreans Say they Cloned Embryos from Stem Cells (WaPo). Scientists in South Korea reported making nearly a dozen cloned human ... Koreans Say they Cloned Embryos from Stem Cells. James Joyner · Friday, May 20, 2005 · No comments ... The single previous claim that stem cells had been derived from a cloned human embryo, reported last year by the same team at ... If therapeutic cloning can indeed be achieved with the same efficiency as such a widely accepted medical procedure, it would ...
... is derived from the hybridoma NZ-1.2 produced by the fusion of mouse myeloma cells and splenocytes from CD rat immunized with ... is an integral membrane mucoprotein present on the surface of podocytes in kidney glomeruli and the parietal cells of the ...
But his genetic fingerprint says otherwise.Meet Snuppy, the worlds first cloned dog. Scientists duplicated this Afghan ... are split over whether to ban just human cloning or cloning of all kinds, including the production of stem cells.Embryonic stem ... Korean stem cell pioneer succeeds in cloning a dog, reigniting ethics furor. News News , Aug 3, 2005. ... the cloning team also condemned the reproductive cloning of humans as "unsafe and inefficient." Human reproductive cloning ...
I will be presenting the basics of stem cell research and cloning. There are two reasons for that. First, I am not a scientist ... Stem Cell Research and Cloning 101: A Primer is hosted by Rev. Dr. James I. Lamb. He says, ... Download the "Stem Cell Research and Cloning 101: A Primer" Discussion Guide ...
A team of researchers at the University of Yamanashi in Japan has cloned mice from… ... After the preservation, the cells were rehydrated and cell nuclei extracted from them were transplanted into ordinary egg cells ... A team of researchers at the University of Yamanashi in Japan has cloned mice from freeze-dried mouse cells preserved for up to ... Preserving animal egg cells requires liquid nitrogen, which comes with challenges in terms of costs and preservation during a ...
Cloning hybridomas and CHO cells can be done faster and more efficiently using semi-solid cloning, compared to traditional ... Why Use Semi-Solid Medium for Cloning Hybridomas and CHO Cells Cloning hybridomas and CHO cells can be done faster and more ... Cloning hybridomas and CHO cells can be done faster and more efficiently using semi-solid cloning. During semi-solid cloning, ... Semi-Solid Cloning of CHO Cells Using ClonaCell™-CHO Medium Publish Date: July 17, 2013 ...
Three mules that were born in 2003 were cloned from fetal cells. If it turns out that the mules remain healthy and live normal ... was cloned from an adult cell. She had a number of health problems and died at a relatively young age. ... Dolly, the sheep, was cloned from an adult cell. She had a number of health problems and died at a relatively young age. Three ... mules that were born in 2003 were cloned from fetal cells. If it turns out that the mules remain healthy and live normal lives ...
... the first Przewalskis horse to ever be cloned, can bring badly needed genetic diversity to his species ... Kurt, a 2-month-old colt, is the worlds first Przewalskis horse clone. He was cloned using cells that have been stored at the ... He was cloned from skin cells taken from a stallion in 1980 and safeguarded at the Frozen Zoo, San Diego Zoo Globals vast ... San Diego Zoo scientists revive cells from 40-year deep freeze to clone endangered horse ...
The GlyS kit can screen specifically the sialylation levels of secreted proteins in crude cell culture samples and does not ... High-Throughput Sialylation Screening on an Octet Label-Free Instrument: Expediting Clone Selection in Cell Line Development. ... Thermo Fisher cutting jobs at NY cell culture media plant. *. Sponsored Content. Grow Your CDMO With the Addition of Gloveless ... Using this method, 96 crude cell culture samples can be screened for sialylation in 60 minutes or less. Here we used the GlyS ...
Thus, p18 appears to be the sole specific partner of p45 NF-E2 in erythroid cells. Cloning of human p45 NF-E2 should permit ... Thus, p18 appears to be the sole specific partner of p45 NF-E2 in erythroid cells. Cloning of human p45 NF-E2 should permit ... Thus, p18 appears to be the sole specific partner of p45 NF-E2 in erythroid cells. Cloning of human p45 NF-E2 should permit ... Thus, p18 appears to be the sole specific partner of p45 NF-E2 in erythroid cells. Cloning of human p45 NF-E2 should permit ...
Culture of Canine Hematopoietic Progenitor Cells in Methylcellulose Medium: A Reproducible Cloning Assay Cells in ... a. rhStem Cell Factor(50ng/ml), rh GM-CSF(10ng/ml), rh IL-3(10ng/ml), rh IL-6(20ng/ml), rh G-CSF(20ng/ml), rh EPO(3 units/ml). ... Human citoquines- Stem Cell Factor, CSF-GM, CSF-G, IL-3, IL-6, and EPO- get a stimulant growth effect in the in vitro canine ... The reading with inverse microscope, evaluated the existence of colonies (more than 50 cells), clusters (between 10 and 50 ...
No Comments on How To Clone A Cell Phone For Free rank How To Clone A Cell Phone For Free. Cocospy is a cell phone cloning app ... After the backup process, restore it on the clone phone.. To Clone A Cell Phone Number Using Sim Cloning Tool, Follow The Steps ... In this way, you can learn how to clone a phone remotely. To clone a cell phone number using sim cloning tool, follow the steps ... How To Clone A Phone Without Sim Card.. Phone cloning is copying the data and identity of one cell phone to another. How to ...
Transient transfection of 293T cells and of 293T-long terminal repeat-green fluorescent protein cells with the STLV-3 clone ... Example: +cell +stem * Tip 3. You can use + and - symbols to force inclusion or exclusion of specific words.. Example: +cell - ... Construction and characterization of a full-length infectious simian T-cell lymphotropic virus type 3 molecular clone. ... This STLV-3 molecular clone was then transfected into 293T cells. Reverse transcriptase PCR experiments followed by sequence ...
Establishment of a GAT-specific suppressor T cell clone from GAT-tolerant responders which afferently regulates DTH responses. ... Establishment of a GAT-specific suppressor T cell clone from GAT-tolerant responders which afferently regulates DTH responses. ... Establishment of a GAT-specific suppressor T cell clone from GAT-tolerant responders which afferently regulates DTH responses. ... Establishment of a GAT-specific suppressor T cell clone from GAT-tolerant responders which afferently regulates DTH responses. ...
Help promote the Pro-Life Action Calls which are put out by Pro-Life organizations nationwide. .(JavaScript must be enabled to view this email address). to email us and we will send you the Action Code & sign you up as a member of Pro-Life Unity. Your site will be listed on the Members page. ...
Right here, we current a large-scale retrospective research of blood and cerebrospinal fluid (CSF) immune cell profiles of ...
Examination of T cell clones derived from patients receiving DLT relapse following bone marrow transplantation. Blood, 86 (10 ... Examination of T cell clones derived from patients receiving DLT relapse following bone marrow transplantation ...
Cloning genes in mammalian cell-lines - Walker, John M., Rapley, Ralph, Murray, Edward J. ...
Pistoia, V., Facchetti, P., Ghiotto, F., Cesbron-Delauw, M. F., & Prigione, I. (1996). Characterization of human T cell clones ... Characterization of human T cell clones specific for Toxoplasma gondii. V. Pistoia, P. Facchetti, F. Ghiotto, M. F. Cesbron- ... Pistoia, V, Facchetti, P, Ghiotto, F, Cesbron-Delauw, MF & Prigione, I 1996, Characterization of human T cell clones specific ... Characterization of human T cell clones specific for Toxoplasma gondii. In: Current Topics in Microbiology and Immunology. 1996 ...
These are CD4+ and CD8+ T cells, yet ATL is regularly CD4+. Accordingly, untransformed HTLV-1+CD4+ but not CD8+ T cells cloned ... Vernin, C., Pinatel, C., Nazaret, N. et al. Cloned HTLV-1+CD4+, but not CD8+, T-cells display an oncogenic miRNome. ... Cloned HTLV-1+CD4+, but not CD8+, T-cells display an oncogenic miRNome. *Céline Vernin1, ... Cloned HTLV-1+CD4+, but not CD8+, T-cells display an oncogenic miRNome ...
T cell response to myoglobin : a comparison of T cell clones in high‐responder and low‐responder mice. In: European Journal of ... T cell response to myoglobin : a comparison of T cell clones in high‐responder and low‐responder mice. / Gorai, Itsuo; Aihara, ... Gorai I, Aihara M, Bixler GS, Zouhair Atassi M, Walden P, Klein J. T cell response to myoglobin: a comparison of T cell clones ... title = "T cell response to myoglobin: a comparison of T cell clones in high‐responder and low‐responder mice", ...
  • This has led to a lot of interest in SCNT, which is best known as the method used to pioneer whole animal cloning technology, such as Dolly the sheep. (news-medical.net)
  • How was Dolly the sheep cloned? (creation.com)
  • BLACKSBURG, Va. (AP) - The company that cloned Dolly the sheep announced Monday that it has cloned a calf, using cells from a fetus rather than cells of an adult animal. (mndaily.com)
  • Dolly, the sheep PPL cloned in Scotland last year, was created from a cell taken from the udder of a 6-year-old ewe. (mndaily.com)
  • Despite the success with Dolly, cloning is very difficult and has a high failure rate. (mndaily.com)
  • Like Dolly, Snuppy was created using a method called somatic cell nuclear transfer.Scientists took a skin cell from the ear of a 3-year-old male Afghan hound and extracted genetic material from the nucleus. (vaildaily.com)
  • Dolly, the sheep, was cloned from an adult cell. (pearson.com)
  • It's the same method that was famously used to clone Dolly the sheep in 1996, and has since been used to clone cattle, cats, deer and horses, among other species. (pacificsandiego.com)
  • The most famous clone was a Scottish sheep named Dolly. (medlineplus.gov)
  • That is how the first cloned sheep, named "Dolly", was created [3]. (who.int)
  • Dolly is arguably the most famous sheep in the world, having been the first mammal to be cloned from an adult cell. (soci.org)
  • In 1996 when Ian Wilmut, a British biologist, cloned a sheep named Dolly, the reaction was dramatically different. (infobasepublishing.com)
  • Beginning chapters discuss cloning within the context of a natural process that many animals use as a survival strategy, followed by the historical development of the nuclear transfer procedure, the cloning of Dolly the sheep, the medical applications of cloning technology, plant clones, and much more. (infobasepublishing.com)
  • It seemed like the prophecies of doom had come true back in 2003, when reports circulated that Dolly, the famous (and first) ewe cloned in 1996, suffered from what might be considered premature aging, in the form of osteoarthritis (OA). (blogspot.com)
  • Its tissue-specific component, p45 NF-E2, was cloned by use of a low-stringency library screen with murine p45 NF-E2 cDNA (N. C. Andrews, H. Erdjument-Bromage, M. B. Davidson, P. Tempst, and S. H. Orkin, Nature [London] 362:722-728,1993). (monash.edu)
  • Sequencing of overlapping clones obtained by a modified rapid amplification of cDNA ends procedure generated a complete cDNA sequence that exhibited no significant homology to sequences in GenBank, indicating that KPL2 is a novel gene. (uab.edu)
  • Cloning and characterization of a cDNA for a new mouse T cell growth factor (P40). (rupress.org)
  • Here, we report the cloning and expression of a cDNA for this new growth factor. (rupress.org)
  • Tony Burgess had the idea that maybe one of my T-cell clones - which was a very high producer of some CSFs - would be a good source of cDNA (complementary DNA) to clone CSFs. (edu.au)
  • Burgess was right, and Kelso's T-cell clone yielded material for the first GM-CSF cDNA , a milestone in the 35-year investigation overseen by Metcalf. (edu.au)
  • The peptide-Ia specificities of these clones were determined by testing the response to 1) a panel of peptide analogs of R1-11, 2) splenic APC from mice expressing MHC molecules from serologically distinct haplotypes, and 3) L cell transfectants expressing mutant/recombinant A beta cDNA containing combinations of polymorphic nucleotide sequences from the k and u alleles. (ox.ac.uk)
  • Variability for known alleles at 75 RFLP loci and 194 polymorphic fragments revealed by 69 anonymous cDNA probes and a clone of alliinase were scored to yield genetically characterized and uncharacterized data sets, respectively. (umn.edu)
  • RNA was reverse-transcribed to obtain the cDNA and then proceeded with PCR using specific primers for the Notch signaling pathway molecules (Notch1, Jagged-1, Jagged-2 and, Hes1) as well as stem cell marker (Nanog). (bvsalud.org)
  • Over the years, understanding the biology and pathogenesis of HTLV-1 and HTLV-2 has been widely improved by the creation of molecular clones. (pasteur.fr)
  • We have therefore decided to construct an STLV-3 molecular clone. (pasteur.fr)
  • This STLV-3 molecular clone was then transfected into 293T cells. (pasteur.fr)
  • All together, our data demonstrate that the STLV-3 molecular clone is functional and infectious. (pasteur.fr)
  • Molecular Cloning and Chromosomal Localization of the Human T-Cell Rec" by Allan M. Weissman, Damon Hou et al. (nova.edu)
  • The molecular mechanisms whereby CD8(+) T cells become "exhausted" in the tumor microenvironment remain unclear. (bioxcell.com)
  • The molecular sequence of this clone aligns with the gene accession number as a point of reference only. (origene.com)
  • 1990. Cell replication and unscheduled DNA synthesis (UDS) activity of low molecular weight chlorinated paraffins in the rat liver in vivo. (cdc.gov)
  • and (i i) to develop (epi)genomic powerful molecular and/or cell biology and close col aboration to create synergies methodologies, profiling strategies, and functional genomics tools, recent progress and better exploit and further expand bioinformatics tools and resources that in understanding of the cancer (epi) unique research tools and expertise. (who.int)
  • Crohn's disease (CD) patients with higher proportions of clonal T cell expansions in the ileal mucosa are likely to smoke, have T cell-driven pathogenesis, and postoperative recurrence, a small French study found. (medpagetoday.com)
  • Compared with non-smokers, active smokers at time of surgery had a significantly higher proportion of clonal expansions, particularly of CD8 T cells (25.9% vs 17.9%, P =0.02), and this group may represent a subset of patients at risk for poor outcomes, according to Matthieu Allez, MD, PhD, of Hôpital Saint-Louis in Paris, writing in Gut . (medpagetoday.com)
  • Clonal T cell expansions have also been implicated in postoperative endoscopic recurrence, and smoking is associated with specific T cell changes, including reduced repertoire diversity and an increased proportion of clonal expansions. (medpagetoday.com)
  • HTLV-1 persistence in vivo relies on the persistent clonal expansion of its host cells. (biomedcentral.com)
  • To characterize the cell types and circuit diagram within these clonal units, we performed single-cell RNA-sequencing and multi-cell patch clamp recordings of neurons derived from Nestin -positive progenitors. (biorxiv.org)
  • The risk of genotoxicity of retroviral vector-delivered gene therapy targeting hematopoietic stem cells (HSCs) has been highlighted by the development of clonal dominance and malignancies in human and animal gene therapy trials. (omicsdi.org)
  • Acute lymphocytic leukemia (ALL) is a malignant clonal disorder of the bone marrow lymphopoietic precursor cells. (medscape.com)
  • Using T cell receptor profiling paired with in vivo clonal analysis of T cell differentiation, we identified Tconv cell clones that are recurrently enriched in non-lymphoid organs following ablation of Foxp3+ regulatory T (Treg) cells . (bvsalud.org)
  • A subset of these clones was highly proliferative in the lymphoid organs at steady state and exhibited overt reactivity to self - ligands displayed by dendritic cells , yet were not purged by clonal deletion . (bvsalud.org)
  • Of the four patients in the Vienna cohort who subsequently developed aggressive B-cell lymphoma during treatment with ruxolitinib, three displayed a clonal IgR in the bone marrow, which occurred as early as 47 to 70 months before a lymphoma was diagnosed (no information was available for the fourth patient). (medscape.com)
  • A clonal aggressive B-cell malignancy subsequently developed. (medscape.com)
  • What we found was that the bovine fetal dopamine cells were just as good as bovine embryo cells from an animal that was not cloned," said Dr. Curt Freed of the University of Colorado. (cnn.com)
  • Advanced Cell Technology and ABS also used fetal cells, and scientists said no other company has succeeded in cloning a mammal from an adult cell. (mndaily.com)
  • Three mules that were born in 2003 were cloned from fetal cells. (pearson.com)
  • At present, various types of stem cells like human embryonic stem (hES) cells, induced pluripotent stem (iPS) cells, fetal stem cells, adult tissue-specific stem cells (HSCs, MSCs, etc.), very small embryonic-like stem cells (VSELs) and related technologies like therapeutic cloning are subject to extensive research. (who.int)
  • Origination - pluripotent stem cells (fetal liver & bone marrow of animal host) Pluripotent- not yet committed to differentiate. (kupdf.net)
  • to harvesting and cloning fetal cells, saying NO! (thewhiterose.uk)
  • 3) I AM OPPOSED to any laboratory use of aborted fetal cells, clones thereof, fetal cell cultures and fetal cell-lines, whether this use be in the course of research, experiment, development, production or testing. (thewhiterose.uk)
  • Are these vaccines made with African Green Monkey kidney cells and aborted human fetal cells really used in the United States? (newstarget.com)
  • This page from the FDA lists all the vaccines which are "licensed for use in the United States," and it includes the vaccines containing African Green Monkey kidney cells and the WI-38 aborted human fetal cells. (newstarget.com)
  • When cloning animals, you need a non-reproductive cell (called a somatic cell) that contains all of the individual's DNA. (moviesonline.ca)
  • Although cloning is not easy, it allows you to get all of the animal's genetic material, not just half, that is contained in the reproductive cells. (moviesonline.ca)
  • However, the paper also points out that in dogs as in most species, cloning for reproductive purposes is unsafe. (vaildaily.com)
  • The cloned puppy was the lone success from more than 100 dogs implanted with more than 1,000 cloned embryos.In a news conference in Seoul, the cloning team also condemned the reproductive cloning of humans as "unsafe and inefficient. (vaildaily.com)
  • Human reproductive cloning already is banned in South Korea. (vaildaily.com)
  • I contend that if my principles are applied, then there is no objective, non-discriminatory, non-safety reason against human reproductive and non-reproductive cloning, and that it should be permitted, provided it can be demonstrated as a safe technology. (ethicalrights.com)
  • 2. Over the years, the international community has tried without success to build a consensus on an international convention against the reproductive cloning of human beings. (who.int)
  • 3. Creating awareness among ministries of health in the African Region will provide them with critical and relevant information on the reproductive cloning of human beings and its implications to the health status of the general population. (who.int)
  • 7. The WHO Regional Committee for Africa is invited to review this document for information and guidance concerning reproductive cloning of human beings. (who.int)
  • 3. Media reports on nuclear transfer are usually about one form, reproductive nuclear transfer, also known as reproductive cloning of human beings . (who.int)
  • 5. In 2001, France and Germany requested the United Nations General Assembly to develop international conventions on human reproductive cloning, therapeutic cloning and research on stem cells. (who.int)
  • Cloning technology, however, is perceived as having the potential for reproductive cloning, which raises serious ethical and moral concerns. (who.int)
  • This is reproductive cloning, and can in theory be applied to any species of mammals, including humans. (who.int)
  • In humans, a major roadblock in achieving successful SCNT leading to embryonic stem cells has been the fact that human SCNT embryos fail to progress beyond the eight-cell stage. (news-medical.net)
  • They derived several human embryonic stem cell lines from these cloned embryos whose DNA was an exact match to the adult cell that donated the DNA. (news-medical.net)
  • PPL believes cloning will be a more efficient and useful way to produce genetically modified livestock than micro-injecting embryos. (mndaily.com)
  • Scientists in South Korea reported making nearly a dozen cloned human embryos that are genetic twins of patients with various medical problems and have isolated from those embryos batches of stem cells with the potential to replace failing tissues in those patients. (outsidethebeltway.com)
  • If therapeutic cloning can indeed be achieved with the same efficiency as such a widely accepted medical procedure, it would deeply undercut one of the major ethics arguments against it: that it would require egg donations by countless women - at some risk - to make enough embryos and stem cells to be medically useful. (outsidethebeltway.com)
  • Researchers believe they can be coaxed to grow into heart, brain or nerve cells that could be used to renew ailing organs.Last year, Hwang's team at Seoul National University created the world's first cloned human embryos. (vaildaily.com)
  • This time, the researchers collected more mature eggs from the donors' fallopian tubes.They implanted 1,095 cloned embryos into 123 dogs and just three pregnancies resulted. (vaildaily.com)
  • The current techniques for cloning involve sperm or egg removal, for example, from the last known White Rhino, and storage of embryos and sperm until they can be implanted into a female. (minddebris.com)
  • I address the Review's terms of reference with respect to community standards, particularly the ethics of human cloning but also research involving human embryos. (ethicalrights.com)
  • I propose three principles that should be used in formulating policy on cloning and embryo research, that the same weight should be given to the interests of others as one gives to one's own interests, that genetic discrimination is unacceptable, and that scientifically, embryos are collections of cells, and not persons. (ethicalrights.com)
  • For stem-cell therapy to really count, it has to come from embryos. (cbc-network.org)
  • In the US, where a portion of the population is opposed to destruction of human embryos to obtain stem cells, what avenues are open to scientists for obtaining pluripotent cells that do not offend the moral sensibilities of a significant number of citizens? (asu.edu)
  • In addition to greater expression of CD8 T cells, high-clonality patients also showed reduced expression of inflammation-related genes. (medpagetoday.com)
  • To identify genes upregulated during the process of ciliated cell differentiation of airway epithelial cells, differential display was used to compare RNA from rat tracheal epithelial (RTE) cells cultured under conditions that inhibit/promote ciliated cell differentiation. (uab.edu)
  • I was very lucky to be there at the time when they were first starting to clone the genes for CSFs. (edu.au)
  • We will use the CRISPR/Cas9 method to identify genes that play essential roles in the survival of cancer cells under the hypoxic condition as well as the adoption of a metastatic phenotype. (cinj.org)
  • While the transfer of already existing genes from one cell to another characterized an earlier phase of the field of biotechnology, synthetic biology involves the design, assembly, synthesis, or manufacture of new genomes, biological pathways, devices or organisms not found in nature. (cdc.gov)
  • A second capability of synthetic biology involves the re-design of existing genes, cells or organisms for the purpose of gene therapy. (cdc.gov)
  • Modification of existing genes in living animal and human cells is enabled by engineered nucleases such as meganucleases, zinc finger nucleases, transcription activator-like effector-based nucleases, and the CRISPR-Cas system. (cdc.gov)
  • Scientists have cloned the first US endangered species, a black-footed ferret duplicated from the genes of an animal that died over 30 years ago. (digitalsevaa.com)
  • Scientists have cloned the first U.S. endangered species, a black-footed ferret duplicated from the genes of an animal that died over 30 years ago. (digitalsevaa.com)
  • Eventually scientists may be able to modify those genes to help cloned animals survive. (digitalsevaa.com)
  • Cloning makes a new plant or animal by copying the genes of an existing animal. (digitalsevaa.com)
  • One cloning technology that has been developed for mammalian and human cells is somatic cell nuclear transfer (SCNT). (news-medical.net)
  • PPL said the cloned calf and the cloned sheep were produced by a process called somatic cell nuclear transfer. (mndaily.com)
  • After an unfertilized egg is taken from a cow on PPL's ranch outside Blacksburg and brought to the lab, a technician removes the nucleus and replaces it with the nucleus of a somatic cell from a fetus. (mndaily.com)
  • Although the scientists did a somatic cell nuclear transfer and retrieved the nucleus, it holds all of the necessary genetic information to form an early blastocyst. (minddebris.com)
  • For example, freeze-drying creates more DNA damage than other methods, and somatic cell cloning has a reputation for congenital disabilities. (minddebris.com)
  • Cloning in higher species involves somatic cell nuclear transfer, a process in which the nucleus of a somatic (non-germ) cell is taken out and inserted into an enucleated fertilized female germ cell (egg, ovum). (who.int)
  • This cell then has the capacity to divide and grow into an exact replica of the original from whom the somatic cell was taken. (who.int)
  • She was cloned using a technique called somatic cell nuclear transfer, where a cell nucleus from one adult is transferred into an unfertilised developing egg cell of another that has had its nucleus removed, which is then implanted into a surrogate mother. (soci.org)
  • By using the cloned cells, the scientists hope to replace the brain's dwindling supply of dopamine-producing cells to ease tremors. (cnn.com)
  • Using somatic cells from mice, the scientists freeze-dried them and then stored them at -30°C for up to nine months. (moviesonline.ca)
  • The single previous claim that stem cells had been derived from a cloned human embryo, reported last year by the same team at Seoul National University's College of Veterinary Medicine, left some scientists doubting the results. (outsidethebeltway.com)
  • Scientists duplicated this Afghan hound, born 14 weeks ago, using a skin cell plucked from another hound. (vaildaily.com)
  • The achievement could be a prospective technology to preserve genetic resources for a long period, according to the team, at a time when scientists around the world are starting to preserve seeds and animal egg cells to ensure biodiversity. (nippon.com)
  • Because scientists had removed the egg's nucleus, the part of a cell that holds its DNA, nearly all of the genetic material came from the stallion. (pacificsandiego.com)
  • Using a sample of somatic cells of mice, the scientists exposed them to freeze-drying, where the sample is frozen before removing the ice. (minddebris.com)
  • 1. Cloning is an umbrella term traditionally used by scientists to describe different processes for duplicating biological material. (who.int)
  • The concept of human cloning has long been in the imagination of many scientists, scholars and fiction writers [1]. (who.int)
  • Scientists got into the act just 34 years ago when John Gurdon, a professor at Cambridge University in England, cloned a frog. (infobasepublishing.com)
  • The recent development of induced pluripotent stem cells (iPSCs) and related technologies has caught the attention of scientists, activists, politicians, and ethicists alike. (asu.edu)
  • Having placed it in an egg cell and using appropriate methods, you can even lead to the development of a new organism. (moviesonline.ca)
  • Cloning describes the processes used to create an exact genetic replica of another cell, tissue or organism. (medlineplus.gov)
  • A clone is an organism that is a genetic copy of an existing one. (who.int)
  • These became the early embryonic cell lines that were used to bring cloned mice into the world. (moviesonline.ca)
  • Tokyo, July 6 (Jiji Press)--A team of researchers at the University of Yamanashi in Japan has cloned mice from freeze-dried mouse cells preserved for up to nine months. (nippon.com)
  • The team used the catechin to freeze-dry somatic cells extracted from mice. (nippon.com)
  • Mice carrying the H‐2 b haplotype (e.g., inbred strains C57BL/6 and C57BL/10) are low responders to sperm whale myoglobin when tested in the T cell proliferation assay. (elsevier.com)
  • To determine whether T cells from the low and high‐responder mice recognize the same or different epitopes on the immunizing antigen, we obtained sets of T cell clones from both strains and tested them against peptides representing different regions of the myoglobin molecule, as well as against myoglobins from species other than the sperm whale. (elsevier.com)
  • Four types of T cell clones were obtained from the DBA/2 mice: 3 types responded to the peptide 107-120 (9 clones altogether), and 1 type responded to the peptide 133-149 (4 clones altogether). (elsevier.com)
  • These results demonstrate the diversity of epitopes in single antigenic regions and show equivalent heterogeneity of T cell repertoires in high and low responder mice. (elsevier.com)
  • Supporting this, we demonstrated that loss of MIF expression in the primary tumor led to an increased abundance of intra-tumoral IFNgamma-producing CD4+ and CD8+ T cells, and that depletion of T cells from mice bearing MIF-deficient tumors restored growth to the level of MIF-expressing tumors. (bioxcell.com)
  • Since little is known about the in vivo behaviour of cultured tumor-specific CTL, a fast and simple method has been developed utilizing a lipophilic carbocyanine, 1,1'-dioctadecyl 3,3,3',3'-tetramethylin-docarbocyanine perchlorate (DiI), for the in vivo detection of tumor-specific CTL clones in (tumor-bearing) mice. (vumc.nl)
  • New studies have shown a way to clone mice using freeze-dried somatic cells (not an egg or sperm cells), which is significantly more suitable for the task. (minddebris.com)
  • Once it was implanted into the females, the mice had healthy cloned babies, and they were then mated further to prove they could reproduce. (minddebris.com)
  • The T cell repertoire of healthy mice and humans harbors self -reactive CD4+ conventional T (Tconv) cells capable of inducing autoimmunity . (bvsalud.org)
  • By 'bringing cells to life,' if you will, making an animal out of a cell, we can bring back a portion of the gene pool that would otherwise be lost," said Oliver Ryder, director of genetics at San Diego Zoo Global. (pacificsandiego.com)
  • Cloning of human p45 NF-E2 should permit studies of the role of NF-E2 in globin gene regulation and erythroid differentiation. (monash.edu)
  • Rearrangements to the T-cell receptor (TcR) beta and gamma gene loci were studied in T cells derived from the thyroid glands of a patient with Hashimoto's (HT) and another with Graves' (GD) autoimmune thyroiditis. (ox.ac.uk)
  • Repetitive busulfan administration after hematopoietic stem cell gene therapy associated with a dominant HDAC7 clone in a nonhuman primate. (omicsdi.org)
  • We administered four monthly busulfan (Bu) infusions to induce hematopoietic stress in a healthy rhesus macaque previously transplanted with CD34+ cells transduced with retroviral vectors carrying a simple marker gene. (omicsdi.org)
  • Unexpectedly, we found no evidence of selection of the MDS1/EVI1 clones present before Bu administration, but a clone with a vector integration in intron 1 of the histone deacetylase-7 (HDAC7) gene became dominant in granulocytes over time after Bu administration. (omicsdi.org)
  • This model may both accelerate the detection of abnormal clones to facilitate analysis of genotoxicity for human gene therapy, and help assess the safety of administering myelotoxic chemotherapeutic agents in patients previously engrafted with vector-containing cells. (omicsdi.org)
  • 2. Nuclear transfer is a technique used to duplicate genetic material by creating an embryo through the transfer and fusion of a diploid cell in an enucleated female oocyte.2 Cloning has a broader meaning than nuclear transfer as it also involves gene replication and natural or induced embryo splitting (see Annex 1). (who.int)
  • 2013), a human cell gene mutation assay in the TK locus (Budinsky et al. (europa.eu)
  • A human cell gene mutation assay in the HPRT locus is also available, although experimental methodology is limited (Budinsky et al. (europa.eu)
  • If you dont see any interesting for you, use our search form on bottom v. In order to facilitate the topics of restriction enzyme digestion and the generation of compatible ends in the process of gene cloning, an inclass activity was designed. (web.app)
  • He was cloned from skin cells taken from a stallion in 1980 and safeguarded at the Frozen Zoo, San Diego Zoo Global's vast repository of 10,000 cell lines from more than 1,100 species and subspecies. (pacificsandiego.com)
  • It's the first time anyone has successfully cloned a Przewalski's horse, which is only the third species San Diego Zoo Global has ever cloned - joining the gaur and banteng, two endangered cattle species cloned in the early 2000s. (pacificsandiego.com)
  • Many now are at a point where breeding and conservation efforts are the only way to keep the species alive, and one scientific solution to this is cloning. (minddebris.com)
  • Multi-cellular organisms and higher species replicate naturally through a reproduction mechanism involving male and female germ cells. (who.int)
  • We also know that within humans (and other animal species) there are cells called stem cells. (who.int)
  • Her creation has led to further cloning projects and could be used in the future to preserve the populations of endangered or extinct species, and has led to significant developments in stem cell research. (soci.org)
  • In this photo provided by the US Fish and Wildlife Service is Elizabeth Ann, the first cloned black-footed ferret and first-ever cloned US endangered species, at 50-days old on Jan. 29, 2021. (digitalsevaa.com)
  • Cloning eventually could bring back extinct species such as the passenger pigeon. (digitalsevaa.com)
  • For now, the technique holds promise for helping endangered species including a Mongolian wild horse that was cloned and last summer-born at a Texas facility. (digitalsevaa.com)
  • When Willa died, the Wyoming Game and Fish Department sent her tissues to a "frozen zoo" run by San Diego Zoo Global that maintains cells from more than 1,100 species and subspecies worldwide. (digitalsevaa.com)
  • Texas-based Viagen, a company that clones pet cats for $35,000 and dogs for $50,000, cloned a Przewalski's horse, a wild horse species from Mongolia born last summer. (digitalsevaa.com)
  • Despite cell death and DNA damage, the researchers were able to extract the rest of the genetic information and then insert it into new cells. (moviesonline.ca)
  • Genetic abnormalities resulting from DNA damage were also observed in some individuals, so it was difficult to call them a true clone. (moviesonline.ca)
  • But his genetic fingerprint says otherwise.Meet Snuppy, the world's first cloned dog. (vaildaily.com)
  • In silico, those targeted by miR-23b and -27b defined 2 hitherto unknown pathways involving the cell cycle and genetic disorders. (biomedcentral.com)
  • The copied material, which has the same genetic makeup as the original, is referred to as a clone. (medlineplus.gov)
  • Teruhiko Wakayama and researchers from the University of Yamanashi looked to expand this by utilizing freeze-dried somatic cells to deliver the proper genetic material for cloning. (minddebris.com)
  • The genetic alterations in these clones include mutations, deletions, or insertions that affect both the constant and variable regions. (medscape.com)
  • Besides cloning, the nonprofit in Sausalito, California, promotes genetic research into imperiled life forms ranging from sea stars to jaguars. (digitalsevaa.com)
  • Acute myelogenous leukemia (AML) is a group of neoplastic disorders of the hematopoietic precursor cells of the bone marrow. (medscape.com)
  • The time for 1 cell division is prolonged with respect to that of normal bone marrow blast cells. (medscape.com)
  • The bone marrow is gradually replaced by blast cells. (medscape.com)
  • Right now," she said, "incredible therapies" are happening "with their own stem cells, whether dental pulp or nasal tissues, or bone-marrow tissues. (cbc-network.org)
  • Had he followed up, even skeptically, by demanding that Tada give examples of these incredible breakthroughs, she could have told him about human heart patients who have already benefited from treatment with their own bone marrow or blood stem cells. (cbc-network.org)
  • The study authors also found that a preexisting B-cell clone, detected in the bone marrow in three of the four patients who later developed lymphoma, appears to be associated with the risk for subsequent lymphoma. (medscape.com)
  • Study coauthor Ulrich Jäger, MD, head of the Division of Hematology and Hemostaseology at the Medical University of Vienna, Austria, noted that the patients in whom this preexisting B-cell clone was present in bone marrow are most at risk for developing aggressive lymphoma. (medscape.com)
  • Myelophthisis is a form of bone marrow failure that results from the destruction of bone marrow precursor cells and their stroma, which nurture these cells to maturation and differentiation. (medscape.com)
  • Infiltrating lesions caused by nonhematopoietic cells invading bone marrow can result in varying degrees of cytopenia, including anemia , thrombocytopenia, neutropenia, and pancytopenia. (medscape.com)
  • [ 1 ] Bone marrow failure resulting from secondary infiltration is a possible cause of lack of blood cell production (as differentiated from a primary cause of failure). (medscape.com)
  • Bone marrow cells are completely replaced by large carcinoma cells with clear nucleoli. (medscape.com)
  • The bone marrow becomes infiltrated by collagen, reticulin, and other forms of fibrosis, which replace the normal, hematopoietic cells. (medscape.com)
  • The expanding number and volume of pathologic cells and the release of suppressive cytokines can eventually lead to bone marrow failure without the characteristic morphologic features of myelophthisis. (medscape.com)
  • Leukemic cells, such as those occurring in chronic leukemias in which the expanding cells are mature and coexist peacefully with the normal bone marrow cells, show no evidence of myelophthisis, and marrow damage does not occur. (medscape.com)
  • The reconstructed egg holding the DNA from the donor cell was zapped with an electric current to stimulate cell division.Dog eggs have been problematic because they are released from the ovary at an earlier, less mature stage than in other mammal. (vaildaily.com)
  • SCNT is a method of cloning mammalian cells that can be used to create personalized embryonic stem cells from an adult animal or human. (news-medical.net)
  • Embryonic stem cells are immortal, and have the potential to develop into any type of adult cell, even after months growing in culture dishes. (news-medical.net)
  • By transferring adult cell DNA into an embryonic stem cell, it is possible to create a line of immortal embryonic cells that are able to develop into any type of adult cell, genetically identical to the donor. (news-medical.net)
  • The cloning method is based on the fact that cytoplasmic factors in mature, metaphase II oocytes are able to reset the identity of a transplanted adult cell nucleus to an embryonic state. (news-medical.net)
  • Another successful attempt at human SCNT was made using cells from two adult males. (news-medical.net)
  • The adult cell nuclei were transferred into metaphase-II stage human oocytes, producing a karyotypically normal diploid embryonic stem cell line from each of the adult male donor cells. (news-medical.net)
  • The therapeutic potential of cloned human cells has been demonstrated by another study using human oocytes to reprogram adult cells of a type 1 diabetic. (news-medical.net)
  • How has adult stem cell research helped medicine? (creation.com)
  • To these commentators, cures using adult stem cells just aren't the "right" cures. (cbc-network.org)
  • Indeed, even the most astonishing research advances using adult cells are ignored by these arbiters of public policy as if they never happened. (cbc-network.org)
  • It thus came as no surprise that King cared nothing about adult-stem-cell research breakthroughs when the noted artist, evangelist, and disability-rights activist Joni Eareckson Tada raised the issue in an August interview. (cbc-network.org)
  • Tada: That may very well happen using incredible therapies…using adult-stem-cell research. (cbc-network.org)
  • Tada told King patiently that she opposes embryonic-stem-cell research, in part because she advocates channeling scarce resources "into [adult] therapies which have the most promise, which are the most effective. (cbc-network.org)
  • She could have given great hope to people with Parkinson's disease by describing the successes already achieved treating patients with adult cells and their derivatives. (cbc-network.org)
  • A factory produces a contaminated product, and the lives of a cell connect a retired person on a limited income to a young adult consuming the same product in a different county. (cdc.gov)
  • There's no relationship between cloning cows or cloning sheep or cloning pigs for therapeutic uses and the potential for cloning human beings," Freed said. (cnn.com)
  • While PPL was the first to clone a sheep, the company lost the race to clone the first calf. (mndaily.com)
  • This nonreciprocal cross-reactivity was also reflected in the relative responses of the two sets of T cell clones to the interchange of u- and k-derived residues in the A beta chain. (ox.ac.uk)
  • The in vivo localization in the spleen of an adoptively transferred DiI-labeled Ad5E1-specific CTL clone is described. (vumc.nl)
  • Sayaka Wakayama of Yamanashi University in Ionian explains that freeze-dried somatic cells can produce healthy and fertile clones. (moviesonline.ca)
  • Kelso's expertise with T cells and their behaviour assists in a significant milestone cloning of the first recombinant CSF - GM-CSF - which leads to preclinical testing of the effectiveness of CSFs in boosting white blood cells. (edu.au)
  • Clone cells also include populations of recombinant DNA molecules all carrying the same inserted sequence. (bvsalud.org)
  • We report on a new integrated platform for automated harvesting of whole unclarified cell-culture broths, followed by in-line tandem affinity-capture, pH neutralization and size-exclusion chromatography of recombinant antibodies expressed transiently in mammalian human embryonic kidney 293T-cells at the 1-L scale. (cyberleninka.org)
  • The system was validated with a random panel of 45 whole-cell culture broths containing recombinant antibodies in the early profiling phase. (cyberleninka.org)
  • We construct a network motif in mammalian cells exhibiting a 'toggle-switch' phenotype in which two alternative protein expression levels define its ON and OFF states. (nature.com)
  • Why is embryonic stem cell research wrong? (creation.com)
  • Canberra, Australia (LifeNews.com) - Australia Health Minister Tony Abbott is arguing that the island nation should keep its regulations limiting human cloning and embryonic stem cell research. (lifenews.com)
  • Stem Cell Research and Cloning 101: A Primer is hosted by Rev. Dr. James I. Lamb. (lutheransforlife.org)
  • I will be presenting the basics of stem cell research and cloning. (lutheransforlife.org)
  • In recent years, she has become an outspoken opponent of human cloning and of federally funded embryonic-stem-cell research. (cbc-network.org)
  • Instead, almost reflexively, he promoted embryonic-stem-cell research, stating, "Everyone says it will be faster if embryonic is also used. (cbc-network.org)
  • Instead, he demanded to know who is harmed by embryonic-stem-cell research and asked whether she would agree to debate Christopher Reeve. (cbc-network.org)
  • One potential advantage of cloning is to produce identical cells, genetically identical cells," he said. (cnn.com)
  • The experiments mark a significant advance in therapeutic cloning, the fast-paced but controversial field that aims to make customized heart tissues for heart attack patients, nerves for patients with spinal cord injuries, and a host of other laboratory-grown spare parts genetically tailored to the patients who need them. (outsidethebeltway.com)
  • In May, they created the first embryonic stem cells that genetically match injured or sick patients.The researchers insisted the dog experiment was aimed at a creating reliable research model.Monkeys are the closest model to humans and they are crucial to medical research, but Hwang told reporters that cloning a monkey "is technically impossible at the moment. (vaildaily.com)
  • As few as 10 polymorphic probe-enzyme combinations distinguished among all the inbreds and samples of 20 genetically characterized or 10 genetically uncharacterized clones distinguished all the virtual hybrids. (umn.edu)
  • A group of genetically identical cells all descended from a single common ancestral cell by mitosis in eukaryotes or by binary fission in prokaryotes. (bvsalud.org)
  • What about cloning other extinct animals? (creation.com)
  • In 2009, Spanish researchers announced the cloning of a Pyrenean ibex, which has been extinct since 2000, and was the first cloning of an extinct animal. (soci.org)
  • ATLANTA (CNN) -- Researchers are using cloned animal cells in an attempt to ease the tremors and erratic movements caused by Parkinson's disease. (cnn.com)
  • Researchers at the University of Colorado transplanted cloned bovine brain cells into the brains of rats. (cnn.com)
  • Cloning often raises fears, but researchers say there's a big difference between cloning brain cells and cloning humans. (cnn.com)
  • Researchers at Emory University are preparing to transplant pig cells into humans later this year. (cnn.com)
  • Researchers are not ready to use the cloned cells in people. (cnn.com)
  • This subset of patients could be potentially better treated with drugs targeting T cell-driven pathways," the researchers wrote. (medpagetoday.com)
  • At tissue analysis, the researchers divided the cohort according to the percentage of high-frequency clones in the mucosa, with high or low clonality defined as above or below 26.8%, respectively. (medpagetoday.com)
  • This technology could lead to a brave new world of puppy production if it were hijacked by profiteers seeking to use cloning to supply the pet trade," said Wayne Pacelle, president of the Humane Society of the United States.The researchers nicknamed their canine creation Snuppy, for "Seoul National University puppy," a reference to Hwang's lab. (vaildaily.com)
  • But now, researchers revived the cells and fused one of them with an unfertilized egg from a domestic horse. (pacificsandiego.com)
  • Researchers hope to use these cells to grow healthy tissue to replace injured or diseased tissues in the human body. (medlineplus.gov)
  • Our proprietary Mouse Quick-Hybridoma™ Platform allows generation of 50+ hybridoma clones per hybridoma cell fusion step. (advbiomart.net)
  • Retrieved on December 06, 2022 from https://www.news-medical.net/life-sciences/Cloning-Human-Cells.aspx. (news-medical.net)
  • By using C6/36 and Vero cell in particular, receives cattle from various parts of Chad. (cdc.gov)
  • Transmitted by a wide variety of mosquitoes from several natant of Vero cells infected with the RVFV clone 13. (cdc.gov)
  • Infection, dissemination, and transmission of WNV were measured by plaque titration on Vero cells of individual mosquito bodies, legs, or saliva, respectively, two weeks following WNV exposure. (cdc.gov)
  • ACAM2000, Smallpox (Vaccinia) Vaccine, Live, is a live vaccinia virus derived from plaque purification cloning from Dryvax® (Wyeth Laboratories, Marietta, PA, calf lymph vaccine, New York City Board of Health Strain) and grown in African Green Monkey kidney (Vero) cells and tested to be free of adventitious agents. (newstarget.com)
  • This chain was first identified in murine T cells by virtue of the fact that it coimmunoprecipitates with the TCR complex using antibodies directed against either the clonespecific subunits or invariant CD3 subunits of the receptor. (nova.edu)
  • We guarantee the positive clones for monoclonal antibodies developed in mouse. (advbiomart.net)
  • The investigators performed T cell receptor sequencing and microarray analysis in tissue samples from 57 patients in a prospective multicenter cohort. (medpagetoday.com)
  • T cell receptor testing, however, may not be broadly practical at present since it requires sophisticated laboratory techniques, he added. (medpagetoday.com)
  • Analysis of T-cell receptor usage in activated T-cell clones from Hashimoto's thyroiditis and Graves' disease. (ox.ac.uk)
  • The T-cell antigen receptor (TCR) is a multisubunit receptor complex specific to T cells subserving both antigen recognition and signal transduction functions. (nova.edu)
  • The CD8 antigen is a transmembrane glycoprotein that acts as a co-receptor for the T cell receptor (TCR). (bioxcell.com)
  • We identified dectin-1 as a major receptor involved in the recognition of these carbohydrates, including both soluble and particulate forms, such as the β-glucan-rich Saccharomyces cerevisiae cell wall fraction, zymosan ( 1 , 2 ). (aai.org)
  • IMSEAR at SEARO: Stem Cells Cloning and Therapeutic Potential. (who.int)
  • The stem cells possess pluripotential characteristics, and can differentiate into various cells and tissues when nurtured and grown in different culture media. (who.int)
  • PSC can differentiate in to Hematopoietic stem cells (HSC' (HSC 's) which become become leucocytes. (kupdf.net)
  • Mast cells: BM derived cells, differentiate in blood and connective tissue. (kupdf.net)
  • SHED was able to differentiate into epithelial like cells when cultured in keratinocyte growth medium (KGM) 2 . (bvsalud.org)
  • Recently, we described a murine helper T cell-derived molecule with T cell growth factor activity that is functionally and structurally distinct from IL-2, IL-4, and other known growth factors. (rupress.org)
  • This molecule, designated P40, was identified as a glycoprotein capable of supporting antigen-independent growth of certain helper T cell clones. (rupress.org)
  • T cell clones that adopt a follicular helper T cell-like phenotype at steady state. (bvsalud.org)
  • One of the greatest controversies triggered by the rapid pace of evolution in biology, particularly in genomics and biotechnology, has been the technique of cloning. (who.int)
  • Animal Cloning, Updated Edition discusses all aspects of this new biology, including the scientific, ethical, and legal issues. (infobasepublishing.com)
  • Synthetic biology is playing an increasing role in the commercial bioeconomy as providers of biological designs, optimized biological molecules, laboratory suppliers of customer-specified DNA, RNA, enzymes and cell-cloning services, and in drug development. (cdc.gov)
  • In June 2004, Australia's National Stem Cell Centre announced it would make new human embryonic stem cell lines 'freely available' for scientific research. (lifenews.com)
  • Gurdon found that nuclei from older donor cells were more likely to correctly direct differentiation and give rise to healthy tadpoles. (pearson.com)
  • Several partial complementary DNAs (cDNAs) were identified whose expression was regulated coordinately with ciliated cell differentiation. (uab.edu)
  • During differentiation of RTE cells, the expression of KPL2 closely paralleled that of an axonemal dynein heavy chain. (uab.edu)
  • These results suggest that KPL2 plays an important role in the differentiation or function of ciliated cells in the airway. (uab.edu)
  • Aim: To detect the expression of molecules associated with Notch signaling pathway in stem cells from human exfoliated deciduous teeth (SHED) cultured in specific differentiation medium, namely, keratinocyte growth medium (KGM). (bvsalud.org)
  • Notch-1, Jagged-1, Jagged-2, and stem cell marker Nanog are expressed in SHED cultured in KGM which may be involved in the differentiation into epithelial-like cells in human dental pulp tissues. (bvsalud.org)
  • Since the Notch signaling pathway molecules play an important role in differentiation of epithelial cells, it is important to identify the presence of notch signaling molecules in SHED during the process of cell differentiation. (bvsalud.org)
  • The Notch signaling pathway provides important intercellular signaling mechanisms essential for cell fate specification and it regulates differentiation and proliferation of stem or progenitor cells by para-inducing effects 3-4 . (bvsalud.org)
  • Notch signaling pathway is also involved in the regulation of epithelial cell differentiation in various tissues 5-6 . (bvsalud.org)
  • Thus, p18 appears to be the sole specific partner of p45 NF-E2 in erythroid cells. (monash.edu)
  • An accompanying proliferation of erythroid cells and megakaryocytes usually is present. (medscape.com)
  • This blood film at 1000X magnification demonstrates a leukoerythroblastic blood picture with the presence of precursor cells of the myeloid and erythroid lineage. (medscape.com)
  • We hypothesized that hematopoietic stress may accelerate the proliferation and therefore the detection of abnormal clones in these models. (omicsdi.org)
  • Among antineoplastic treatment modalities, radiotherapy and chemotherapy, when performed mainly in the head and neck region, are characterized for nonspecifically restraining the exacerbated proliferation of neoplastic cells. (bvsalud.org)
  • We hypothesized that this increase in cell death would promote detection by the host immune system in vivo , which could explain the observed impairment in tumor growth. (bioxcell.com)
  • Thus, in neither in vitro nor in vivo testing was the biological function of the CTL clones affected. (vumc.nl)
  • The overall marking level in the animal was increased significantly after Bu treatment and coincident with expansion of the HDAC7 clone, suggesting an in vivo advantage for this clone under stress. (omicsdi.org)
  • Additional reported applications (for the relevant formats) include: immunoprecipitation 1,2 , in vitro blocking of IL-2 binding to low- and high-affinity receptors 1-4 , growth inhibition of IL-2-dependent T-cell lines 1-4 , in vivo depletion of CD25 + CD4 + Treg cells 5-8,10 , and immunohistochemical staining of acetone-fixed frozen sections 2 . (biolegend.com)
  • IgE-induced mast cell degranulation in vivo is often followed by a late-phase reaction (LPR), a second wave of hypersensitivity responses occurring many hours after the acute reaction and dependent upon eosinophils. (jci.org)
  • Β-Glucans are structural components of fungal cell walls with well-characterized immunostimulatory properties and as such have been widely used to study the effector functions of leukocytes as well as inflammatory processes in vivo. (aai.org)
  • Cocospy is a cell phone cloning app that is loaded with a lot of features. (skenfrith.org)
  • One way to do it is to outsource mobile app development to create your own phone cloning app. (wordpress-gr.org)
  • Using transplanted animal cells, however, raises the concern that unknown viruses could be passed on to humans. (cnn.com)
  • Evidence in humans and animal models suggests that IgE-mediated mast cell activation gives rise to both the acute and late-phase responses. (jci.org)
  • Some of the arguments backing this assertion included wildly uninformed opinions such as, "there's no way the CDC would approve monkey kidney cells being injected into humans. (newstarget.com)
  • This release completes the inner work in Holochain needed to reach the Cell Cloning milestone. (holochain.org)
  • The stem cell lines are being derived from a Melbourne in-vitro fertilization clinic. (lifenews.com)
  • Human citoquines- Stem Cell Factor, CSF-GM, CSF-G, IL-3, IL-6, and EPO- get a stimulant growth effect in the in vitro canine hematopoiesis. (vin.com)
  • We subsequently discovered that loss of MIF expression in 4T1 cells led to decreased cell numbers and increased apoptosis in vitro under reduced serum culture conditions. (bioxcell.com)
  • Lastly, we demonstrated that loss of MIF expression led to a robust induction of a specialized form of cell death, immunogenic cell death (ICD), in vitro . (bioxcell.com)
  • The in-vitro conditions under which coinhibition of viral interferon induction occurred when mammalian cell monolayers were exposed to bioactivated benzo(a)pyrene (50328) (BaP) in conjunction with representative particles of coal, asbestos (1332214), metals, and silicates were investigated. (cdc.gov)
  • In support of the hypothesis, 7 supernatants from RRMS B cells induced death of rat OL in vitro, while 3 of 4 control samples did not. (jns-journal.com)
  • Here we used the GlyS kit to determine the relative sialylation level of representative glycoproteins, including erythropoietin (EPO), standard human monoclonal antibody (MAb) samples (NIST MAb), and fetuin glycoproteins, as well as crude biosimilar cell culture samples using an Octet HTX system. (bioprocessintl.com)
  • Specificity: This antibody recognizes a cell surface glycoprotein of 95/115/135kDa (depending upon the extent of glycosylation), identified as CD43 [Workshop IV]. (scytek.com)
  • Dominance of a cell clone forming antibody to DNP. (wikidata.org)
  • Senescence of an antibody-forming cell clone. (wikidata.org)
  • WHA50.37, which states "the use of cloning for the replication of human individuals is ethically unacceptable and contrary to human integrity and morality. (who.int)
  • In its simplest form, cloning is defined as the exact replication of cells. (who.int)
  • Some DNA differences result from the blunders during the DNA replication necessary for cell division. (cdc.gov)
  • Furthermore, we found that MIF depletion from the tumor cells resulted in greater numbers of activated intra-tumoral dendritic cells (DCs). (bioxcell.com)
  • The heavy chain diseases (HCDs) are B-cell proliferative disorders characterized by production of abnormal, structurally incomplete, immunoglobulin heavy chains without the corresponding light chains. (medscape.com)
  • In γ-HCD, a mutant lymphoplasmacytoid cell clone synthesizes an abnormal IgG protein. (medscape.com)
  • It is related to an abnormal stem cell clone that stimulates increased myelofibrosis and damage. (medscape.com)
  • Cloning of human cells is a technology that holds the potential to cure many diseases and provide a source of exactly matched transplant tissues and organs. (news-medical.net)
  • Robert describes part-human animals, otherwise known as chimeras, as those resulting from the intentional combination of human and nonhuman cells, tissues, or organs at any stage of development. (asu.edu)
  • Stem cells from human exfoliated deciduous teeth (SHED) are multipotent stem cells derived from the pulp tissues of extracted deciduous teeth 1 . (bvsalud.org)
  • In leukemias, a clone of malignant cells may arise at any stage of maturation, that is, in the lymphoid, myeloid, or pluripotential stage. (medscape.com)
  • These clones spontaneously adopted numerous hallmarks of follicular helper T (TFH) cells , including expression of Bcl6 and PD-1, exhibited an elevated propensity to localize within B cell follicles at steady state , and produced interferon -γ in non-lymphoid organs following sustained Treg cell depletion. (bvsalud.org)
  • α-HCD frequently presents as an extranodal marginal-zone lymphoma of the mucosa-associated lymphoid tissue (MALT), considered a variant of MALT lymphoma, and is the only HCD that can transform into diffuse large B-cell lymphoma. (medscape.com)
  • The cells studied were freshly isolated mononuclear cells, T-cell lines grown in the presence of anti-CD3 and IL-2 and T-cell clones. (ox.ac.uk)
  • Primary human CD4+CD45RO+ T cells were isolated from peripheral blood (PB) mononuclear cells (MNCs) using negative immunomagnetic separation techniques. (stemcell.com)
  • An improved tumor necrosis factor (TNF) bioassay using an isolated subclone from the murine fibroblastoid NCTC-clone-929 cell line and a new fluorescence indicator system for detecting target cell viability was described. (cdc.gov)
  • Like the TCR, CD8 binds to class I MHC molecules displayed by antigen presenting cells (APC). (bioxcell.com)
  • As the millennium draws to a close, it is clear that IgE production represents only one feature of a larger specific immune response orchestrated by the Th2 subset of CD4 + Th cells. (jci.org)
  • Microarray results, confirmed by quantitative RTPCR, showed that, upon infection, CD4+ and CD8+ clones yielded aberrant expression of 15 distinct miRs including miR-34b and miR-494 that were respectively over- and underexpressed in both compartments. (biomedcentral.com)
  • In 2003, Australia opposed the treaty and supported a competing proposal pushed by a Belgium and a smaller group of nations to allow human cloning for research. (lifenews.com)
  • As the authors of new research on this issue demonstrate, in the long run, even many years of cell storage and cloning can play a role. (moviesonline.ca)
  • Right here, we current a large-scale retrospective research of blood and cerebrospinal fluid (CSF) immune cell profiles of psychosis spectrum sufferers. (ccc-flow.org)
  • Dive into the research topics of 'Immunoregulation by T cells. (northwestern.edu)
  • She flew out to a position at the Swiss Institute for Experimental Cancer Research in Lausanne, Switzerland, undertaking research on cell-mediated immunity. (edu.au)
  • His research programme is aimed at understanding and developing effective therapies for inflammatory neurological diseases, particularly multiple sclerosis (MS). His scientific contributions include studies of T cell repertoires in health and autoimmune disorders, and the elucidation of the mechanisms of action of immuno-modulatory treatments and haematopoietic stem cell transplantation (HSCT) in MS. (imperial.ac.uk)
  • His research programme is funded by the Medical Research Council, the UK Multiple Sclerosis Society, the UK Stem Cell Foundation, the Wellcome Trust, and the Italian Multiple Sclerosis Society. (imperial.ac.uk)
  • Our second research program starts with massive profiling of the repertoires of tumor-infiltrating T cells in various solid cancer types. (cinj.org)
  • Drugs that target the Janus-kinase 1/2 (JAK1/2) pathway have become a mainstay of treatment for myeloproliferative neoplasms (MPNs), but new research suggests that their use may be associated with an increased risk for B-cell non-Hodgkin lymphomas. (medscape.com)
  • This review summarizes recent research contributions by Dr. Robert Lisak in collaboration with Dr. Joyce Benjamins on direct effects of secretory products of immune cells on neurons and glia. (jns-journal.com)
  • 2018). "Macrophage Migration Inhibitory Factor protects cancer cells from immunogenic cell death and impairs anti-tumor immune responses" PLoS One 13(6): e0197702. (bioxcell.com)
  • 2018). "Co-inhibitory Molecule B7 Superfamily Member 1 Expressed by Tumor-Infiltrating Myeloid Cells Induces Dysfunction of Anti-tumor CD8(+) T Cells" Immunity 48(4): 773-786 e775. (bioxcell.com)
  • This adoptively transferred CTL clone was also detectable at the site of a subcutaneously growing human Ad5E1-induced tumor within 1 day after intravenous injection. (vumc.nl)
  • However, very little is known about the antigen specificities of tumor-infiltrating T cells. (cinj.org)
  • A better understanding of the specificity landscape of tumor-infiltrating T cells can help us improve the current therapeutic strategies with immune checkpoint inhibitors. (cinj.org)
  • Our inhouse bioinformatic tools will prioritize candidate T cell clones that are inferred to be specific to potential tumor antigens with likely human leukocyte antigen (HLA) restriction. (cinj.org)
  • This effort will not only help us catalog a comprehensive T cell specificity landscape in cancer, but also lead to the identification of novel, shared tumor antigens. (cinj.org)
  • Secondary myelofibrosis is due to implantation or invasion by malignant cancer cells that have metastasized because of implantation of blood-borne tumor cells from a distant cancer. (medscape.com)
  • 1998), a mammalian cell cytogenetic assay (Jantunen et al. (europa.eu)