Clodronic Acid: A diphosphonate which affects calcium metabolism. It inhibits bone resorption and soft tissue calcification.Fractures, Spontaneous: Fractures occurring as a result of disease of a bone or from some undiscoverable cause, and not due to trauma. (Dorland, 27th ed)Bone Density Conservation Agents: Agents that inhibit BONE RESORPTION and/or favor BONE MINERALIZATION and BONE REGENERATION. They are used to heal BONE FRACTURES and to treat METABOLIC BONE DISEASES such as OSTEOPOROSIS.Diphosphonates: Organic compounds which contain P-C-P bonds, where P stands for phosphonates or phosphonic acids. These compounds affect calcium metabolism. They inhibit ectopic calcification and slow down bone resorption and bone turnover. Technetium complexes of diphosphonates have been used successfully as bone scanning agents.Imidazoles: Compounds containing 1,3-diazole, a five membered aromatic ring containing two nitrogen atoms separated by one of the carbons. Chemically reduced ones include IMIDAZOLINES and IMIDAZOLIDINES. Distinguish from 1,2-diazole (PYRAZOLES).Monomethylhydrazine: Hydrazine substituted by one methyl group.Ligands: A molecule that binds to another molecule, used especially to refer to a small molecule that binds specifically to a larger molecule, e.g., an antigen binding to an antibody, a hormone or neurotransmitter binding to a receptor, or a substrate or allosteric effector binding to an enzyme. Ligands are also molecules that donate or accept a pair of electrons to form a coordinate covalent bond with the central metal atom of a coordination complex. (From Dorland, 27th ed)Aptamers, Nucleotide: Nucleotide sequences, generated by iterative rounds of SELEX APTAMER TECHNIQUE, that bind to a target molecule specifically and with high affinity.Gibberellins: A class of plant growth hormone isolated from cultures of Gibberella fujikuroi, a fungus causing Bakanae disease in rice. There are many different members of the family as well as mixtures of multiple members; all are diterpenoid acids based on the gibberellane skeleton.Glucan 1,4-alpha-Glucosidase: An enzyme that catalyzes the hydrolysis of terminal 1,4-linked alpha-D-glucose residues successively from non-reducing ends of polysaccharide chains with the release of beta-glucose. It is also able to hydrolyze 1,6-alpha-glucosidic bonds when the next bond in sequence is 1,4.Internet: A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.Developing Countries: Countries in the process of change with economic growth, that is, an increase in production, per capita consumption, and income. The process of economic growth involves better utilization of natural and human resources, which results in a change in the social, political, and economic structures.Plant Growth Regulators: Any of the hormones produced naturally in plants and active in controlling growth and other functions. There are three primary classes: auxins, cytokinins, and gibberellins.Arabidopsis Proteins: Proteins that originate from plants species belonging to the genus ARABIDOPSIS. The most intensely studied species of Arabidopsis, Arabidopsis thaliana, is commonly used in laboratory experiments.Germination: The initial stages of the growth of SEEDS into a SEEDLINGS. The embryonic shoot (plumule) and embryonic PLANT ROOTS (radicle) emerge and grow upwards and downwards respectively. Food reserves for germination come from endosperm tissue within the seed and/or from the seed leaves (COTYLEDON). (Concise Dictionary of Biology, 1990)Hemoglobin C: A commonly occurring abnormal hemoglobin in which lysine replaces a glutamic acid residue at the sixth position of the beta chains. It results in reduced plasticity of erythrocytes.Databases, Chemical: Databases devoted to knowledge about specific chemicals.PubMed: A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.Surgical Mesh: Any woven or knit material of open texture used in surgery for the repair, reconstruction, or substitution of tissue. The mesh is usually a synthetic fabric made of various polymers. It is occasionally made of metal.Dictionaries, ChemicalNational Library of Medicine (U.S.): An agency of the NATIONAL INSTITUTES OF HEALTH concerned with overall planning, promoting, and administering programs pertaining to advancement of medical and related sciences. Major activities of this institute include the collection, dissemination, and exchange of information important to the progress of medicine and health, research in medical informatics and support for medical library development.Small Molecule Libraries: Large collections of small molecules (molecular weight about 600 or less), of similar or diverse nature which are used for high-throughput screening analysis of the gene function, protein interaction, cellular processing, biochemical pathways, or other chemical interactions.Anti-Inflammatory Agents, Non-Steroidal: Anti-inflammatory agents that are non-steroidal in nature. In addition to anti-inflammatory actions, they have analgesic, antipyretic, and platelet-inhibitory actions.They act by blocking the synthesis of prostaglandins by inhibiting cyclooxygenase, which converts arachidonic acid to cyclic endoperoxides, precursors of prostaglandins. Inhibition of prostaglandin synthesis accounts for their analgesic, antipyretic, and platelet-inhibitory actions; other mechanisms may contribute to their anti-inflammatory effects.Diclofenac: A non-steroidal anti-inflammatory agent (NSAID) with antipyretic and analgesic actions. It is primarily available as the sodium salt.Solubility: The ability of a substance to be dissolved, i.e. to form a solution with another substance. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Osteoarthritis: A progressive, degenerative joint disease, the most common form of arthritis, especially in older persons. The disease is thought to result not from the aging process but from biochemical changes and biomechanical stresses affecting articular cartilage. In the foreign literature it is often called osteoarthrosis deformans.Spondylitis, Ankylosing: A chronic inflammatory condition affecting the axial joints, such as the SACROILIAC JOINT and other intervertebral or costovertebral joints. It occurs predominantly in young males and is characterized by pain and stiffness of joints (ANKYLOSIS) with inflammation at tendon insertions.Skin Irritancy Tests: Tests or bioassays that measure the skin sensitization potential of various chemicals.Cartilage, Articular: A protective layer of firm, flexible cartilage over the articulating ends of bones. It provides a smooth surface for joint movement, protecting the ends of long bones from wear at points of contact.Receptors, G-Protein-Coupled: The largest family of cell surface receptors involved in SIGNAL TRANSDUCTION. They share a common structure and signal through HETEROTRIMERIC G-PROTEINS.Drugs, Essential: Drugs considered essential to meet the health needs of a population as well as to control drug costs.Suramin: A polyanionic compound with an unknown mechanism of action. It is used parenterally in the treatment of African trypanosomiasis and it has been used clinically with diethylcarbamazine to kill the adult Onchocerca. (From AMA Drug Evaluations Annual, 1992, p1643) It has also been shown to have potent antineoplastic properties.United States Food and Drug Administration: An agency of the PUBLIC HEALTH SERVICE concerned with the overall planning, promoting, and administering of programs pertaining to maintaining standards of quality of foods, drugs, therapeutic devices, etc.Baclofen: A GAMMA-AMINOBUTYRIC ACID derivative that is a specific agonist of GABA-B RECEPTORS. It is used in the treatment of MUSCLE SPASTICITY, especially that due to SPINAL CORD INJURIES. Its therapeutic effects result from actions at spinal and supraspinal sites, generally the reduction of excitatory transmission.BooksHalogens: A family of nonmetallic, generally electronegative, elements that form group 17 (formerly group VIIa) of the periodic table.Geranyltranstransferase: An enzyme involved in the MEVALONATE pathway, it catalyses the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate.Veterinary Medicine: The medical science concerned with the prevention, diagnosis, and treatment of diseases in animals.EthylenediaminesPatents as Topic: Exclusive legal rights or privileges applied to inventions, plants, etc.Chlorine: A greenish-yellow, diatomic gas that is a member of the halogen family of elements. It has the atomic symbol Cl, atomic number 17, and atomic weight 70.906. It is a powerful irritant that can cause fatal pulmonary edema. Chlorine is used in manufacturing, as a reagent in synthetic chemistry, for water purification, and in the production of chlorinated lime, which is used in fabric bleaching.Multiple Myeloma: A malignancy of mature PLASMA CELLS engaging in monoclonal immunoglobulin production. It is characterized by hyperglobulinemia, excess Bence-Jones proteins (free monoclonal IMMUNOGLOBULIN LIGHT CHAINS) in the urine, skeletal destruction, bone pain, and fractures. Other features include ANEMIA; HYPERCALCEMIA; and RENAL INSUFFICIENCY.Bone Marrow: The soft tissue filling the cavities of bones. Bone marrow exists in two types, yellow and red. Yellow marrow is found in the large cavities of large bones and consists mostly of fat cells and a few primitive blood cells. Red marrow is a hematopoietic tissue and is the site of production of erythrocytes and granular leukocytes. Bone marrow is made up of a framework of connective tissue containing branching fibers with the frame being filled with marrow cells.Bone Marrow Cells: Cells contained in the bone marrow including fat cells (see ADIPOCYTES); STROMAL CELLS; MEGAKARYOCYTES; and the immediate precursors of most blood cells.Prognosis: A prediction of the probable outcome of a disease based on a individual's condition and the usual course of the disease as seen in similar situations.Cytogenetic Analysis: Examination of CHROMOSOMES to diagnose, classify, screen for, or manage genetic diseases and abnormalities. Following preparation of the sample, KARYOTYPING is performed and/or the specific chromosomes are analyzed.Bone Marrow Transplantation: The transference of BONE MARROW from one human or animal to another for a variety of purposes including HEMATOPOIETIC STEM CELL TRANSPLANTATION or MESENCHYMAL STEM CELL TRANSPLANTATION.Karyotyping: Mapping of the KARYOTYPE of a cell.Mitobronitol: Brominated analog of MANNITOL which is an antineoplastic agent appearing to act as an alkylating agent.Raynaud Disease: An idiopathic vascular disorder characterized by bilateral Raynaud phenomenon, the abrupt onset of digital paleness or CYANOSIS in response to cold exposure or stress.Cryoglobulinemia: A condition characterized by the presence of abnormal quantities of CRYOGLOBULINS in the blood. Upon cold exposure, these abnormal proteins precipitate into the microvasculature leading to restricted blood flow in the exposed areas.Leukemic Infiltration: A pathologic change in leukemia in which leukemic cells permeate various organs at any stage of the disease. All types of leukemia show various degrees of infiltration, depending upon the type of leukemia. The degree of infiltration may vary from site to site. The liver and spleen are common sites of infiltration, the greatest appearing in myelocytic leukemia, but infiltration is seen also in the granulocytic and lymphocytic types. The kidney is also a common site and of the gastrointestinal system, the stomach and ileum are commonly involved. In lymphocytic leukemia the skin is often infiltrated. The central nervous system too is a common site.Bone Marrow Neoplasms: Neoplasms located in the bone marrow. They are differentiated from neoplasms composed of bone marrow cells, such as MULTIPLE MYELOMA. Most bone marrow neoplasms are metastatic.

A high incidence of vertebral fracture in women with breast cancer. (1/352)

Because treatment for breast cancer may adversely affect skeletal metabolism, we investigated vertebral fracture risk in women with non-metastatic breast cancer. The prevalence of vertebral fracture was similar in women at the time of first diagnosis to that in an age-matched sample of the general population. The incidence of vertebral fracture, however, was nearly five times greater than normal in women from the time of first diagnosis [odds ratio (OR), 4.7; 95% confidence interval (95% CI), 2.3-9.9], and 20-fold higher in women with soft-tissue metastases without evidence of skeletal metastases (OR, 22.7; 95% CI, 9.1-57.1). We conclude that vertebral fracture risk is markedly increased in women with breast cancer.  (+info)

Pharmacokinetics of clodronate in haemodialysis patients. (2/352)

BACKGROUND: Clodronate is a bisphosphonate used in the treatment of hypercalcaemia of various aetiologies. The major route of elimination of clodronate is renal excretion. The aim of the study was to derive data for the adjustment of dosage in haemodialysis patients. METHODS: The pharmacokinetic parameters describing the fate of an intravenous infusion of 300 mg clodronate disodium were studied in 10 haemodialysis patients. Clodronate disodium in serum, urine and dialysate samples was analysed by capillary gas chromatography with mass-selective detection. RESULTS: Of the 300 mg clodronate infused, 159 mg (53%) was excreted into dialysate within 4 h. Clearance by haemodialysis (CLD) was 87.8+/-16.2 ml/min, accounting for 84% of total serum clearance (CLtot). Non-renal, non-dialysis clearance (CL(NRD)) represents the removal of the drug via other routes than dialysis or kidneys. The greatest CL(NRD) was observed in patients with most severe hyperparathyroidism. There was a positive correlation between CL(NRD) and plasma intact PTH concentration. CONCLUSIONS: According to the present findings, standard haemodialysis removes clodronate effectively from the circulation, and total clearance in haemodialysis patients on a dialysis day is not very different from that in healthy subjects. The regimen of dosing intravenous clodronate in hypercalcaemia can also be used in haemodialysis patients. The portion of clodronate eliminated by routes other than via dialysate or kidneys, i.e. predominantly via skeletal deposition, was related to the severity of hyperparathyroidism.  (+info)

Depletion of liver and splenic macrophages reduces the lethality of Shiga toxin-2 in a mouse model. (3/352)

The haemolytic uraemic syndrome (HUS) is a clinical syndrome consisting of haemolytic anaemia, thrombocytopenia, and acute renal insufficiency. HUS is the most frequent cause of acute renal failure in childhood. It has been previously suggested that the presence of Shiga toxin (Stx) is necessary but not sufficient for HUS development, and cytokines such as tumour necrosis factor-alpha (TNF-alpha) and IL-1beta appear to be necessary to develop the syndrome. Since the mononuclear phagocytic system (MPS) is the major source of these cytokines, macrophages might be one of the relevant targets for Stx action in the pathophysiology of HUS. In this study our objective was to examine the role of the hepatic and splenic macrophages in a mouse model of HUS induced by injection of Shiga toxin type-2 (Stx2) or Stx2 plus lipopolysaccharide (LPS). For this purpose, depletion of mice macrophages by liposome-encapsulated clodronate (lip-clod), followed by injection of STx2 or Stx2 plus LPS, was assayed. In this study we show that depletion of hepatic and splenic macrophages by clodronate treatment induces a survival of 50% in animals treated with Stx2 alone or in presence of LPS. This maximal effect was observed when lip-clod was injected 48-72 h before Stx2 injection. Biochemical and histological parameters show characteristics of the lesion produced by Stx2, discarding non-specific damage due to LPS or lip-clod. In addition, we determined that the toxic action of Stx2 is similar in BALB/c and N:NIH nude mice, indicating the T cell compartment is not involved in the Stx2 toxicity. Briefly, we demonstrate that macrophages play a central role in the pathophysiology of HUS, and that the systemic production of cytokines by liver and/or spleen is for Stx2 to manifest its full cytotoxic effect. In addition, the toxicity of Stx2 alone, or in presence of LPS, is independent of the T cell compartment.  (+info)

Depletion of blood-borne macrophages does not reduce demyelination in mice infected with a neurotropic coronavirus. (4/352)

Mice infected with the neurotropic coronavirus mouse hepatitis virus strain JHM (MHV-JHM) develop a chronic demyelinating disease with symptoms of hindlimb paralysis. Histological examination of the brains and spinal cords of these animals reveals the presence of large numbers of activated macrophages/microglia. In two other experimental models of demyelination, experimental allergic encephalomyelitis and Theiler's murine encephalomyelitis virus-induced demyelination, depletion of hematogenous macrophages abrogates the demyelinating process. In both of these diseases, early events in the demyelinating process are inhibited by macrophage depletion. From these studies, it was not possible to determine whether infiltrating macrophages were required for late steps in the process, such as myelin removal. In this study, we show that when macrophages are depleted with either unmodified or mannosylated liposomes encapsulating dichloromethylene diphosphate, the amount of demyelination detected in MHV-infected mice is not affected. At a time when these cells were completely depleted from the liver, approximately equivalent numbers of macrophages were present in the spinal cords of control and drug-treated animals. These results suggest that blood-borne macrophages are not required for MHV-induced demyelination and also suggest that other cells, such as perivascular macrophages or microglia, perform the function of these cells in the presence of drug.  (+info)

Effect of liposome-encapsulated clodronate pretreatment on synthetic vector-mediated gene expression in mice. (5/352)

One of the main limitations for the use of synthetic vectors in gene therapy is their relatively low in vivo efficiency when compared with viral vectors. Here, we describe a pretreatment protocol with liposome-encapsulated clodronate in mice by which gene expression levels of a luciferase reporter gene could be increased up to nine-fold in the lung, after intravenous (i.v.) injection of glycerolipoplexes. Optimal results were obtained if mice were pretreated with liposome-encapsulated clodronate 1 day before injection of lipoplexes. The enhancement effect could be observed for lipoplexes prepared with different multivalent cationic glycerolipids. Most remarkably, polyplexes behaved in the opposite way. Liposome-encapsulated clodronate pretreatment strongly reduced reporter gene expression after i.v. injection of polyethylenimine-polyplexes (ExGen500).  (+info)

Chromatin clearance in C57Bl/10 mice: interaction with heparan sulphate proteoglycans and receptors on Kupffer cells. (6/352)

Chromatin is an important autoantigen in the pathogenesis of systemic lupus erythematosus (SLE) as an immunogen and as a part of nephritogenic immune complexes. Earlier studies focused on clearance of DNA. However, DNA released into the circulation from dying cells is found associated with histones in nucleosomes. The liver is the major organ involved in clearance of chromatin from the circulation of mice. Heparan sulphate proteoglycans (HSPG) have been implicated in the clearance of various charged molecules. Receptor-mediated clearance of ssDNA by the liver has also been reported. Because chromatin contains positively charged histones in addition to DNA, we wished to determine if HSPG and/or DNA receptors are involved in chromatin clearance. The rate of clearance of H1-stripped chromatin from the bloodstream of C57Bl/10 mice was markedly decreased by prior treatment of mice with Heparinase I. Clearance was also inhibited by heparin, heparan sulphate, and DNA, but not by colominic acid. DNA was the most effective inhibitor of clearance and released chromatin from sites of clearance. Depletion of Kupffer cells and splenic macrophages using liposome-encapsulated Clodronate (dichloromethylene bisphosphonate) markedly inhibited chromatin clearance. These data suggest that chromatin clearance is mediated by charge interactions with cell surface HSPG and by DNA receptors. Clearance and degradation of chromatin require functional macrophages in the liver and spleen.  (+info)

Enhancement by galactosamine of lipopolysaccharide(LPS)-induced tumour necrosis factor production and lethality: its suppression by LPS pretreatment. (7/352)

1. D-Galactosamine (GalN) depletes UTP primarily in the liver, resulting in decreased RNA synthesis in hepatocytes. Co-injection of GalN and lipopolysaccharide (LPS) into mice produces fulminant hepatitis with severe hepatic congestion, resulting in rapid death. Although the underlying mechanism is uncertain, GalN enhances the sensitivity to tumour necrosis factor (TNF). Administration of uridine (a precursor of UTP) prior injection of either LPS itself or interleukin-1 (IL-1) reduces the lethality of GalN+LPS. The present study focused on the effects of these agents on TNF production. 2. Intraperitoneal injection of GalN+LPS into mice greatly elevated serum TNF. Although large doses of LPS alone also greatly elevated serum TNF, LPS itself induced neither hepatic congestion nor rapid death. Administration of a macrophage depletor, liposomes encapsulated with dichloromethylene bisphosphonate, reduced both the TNF production and mortality induced by GalN+LPS. 3. Uridine, when injected 0.5 h after the injection of GalN+LPS, reduced the production of TNF. Prior injection of LPS, but not of IL-1, also reduced this TNF production. 4. Serum from LPS-injected mice reduced the TNF production induced by GalN+LPS, but it was less effective at reducing the lethality. Its ability to reduce TNF production was abolished by heat-treatment. 5. We hypothesize that a factor inhibiting TNF production by macrophages is produced by hepatocytes in response to LPS. Possibly, production of this hepatocyte-derived TNF-down-regulator (TNF-DRh) may be: (i) inhibited by GalN, causing over-production of TNF by macrophages and (ii) stimulated by LPS-pretreatment (and restored by uridine), causing reduced TNF production.  (+info)

Liposomal clodronate eliminates synovial macrophages, reduces inflammation and ameliorates joint destruction in antigen-induced arthritis. (8/352)

OBJECTIVES: To investigate the efficacy of a single i.v. dose of clodronate encapsulated within small unilamellar vesicles in suppressing joint inflammation and the histological progression of rat antigen-induced arthritis (AIA). METHODS: Rats with AIA received a single i.v. injection of 20 mg of clodronate encapsulated within small unilamellar vesicles (SUVc) or larger multilamellar vesicles (MLVc) 7 days post-arthritis induction. Free clodronate or saline were used as negative controls. RESULTS: SUVc was shown to be more effective than MLVc, sustaining a significant reduction in knee swelling for up to 7 days after the initial systemic administration. Knee swelling in free clodronate-treated animals was not significantly affected. The increased efficacy of SUVc in reducing inflammation and joint destruction was associated with a significant depletion of resident ED1+, ED2+ and ED3+ macrophages from the synovial membrane (SM). CONCLUSIONS: SUVc is more efficient than MLVc in reducing the severity of inflammation and joint destruction in rat AIA, and is associated with the specific elimination of macrophage subpopulations from the SM.  (+info)

To elucidate the differentiation mechanisms of macrophages in the murine omentum, we studied the repopulation of these cells and the expression of macrophage colony-stimulating factor (M-CSF) in the milky spots and omental tissues in mice depleted of macrophages following administration of liposome-encapsulated dichloromethylene diphosphonate (clodronate). The macrophages in the omentum were spindle or dendritic in shape, expressed several macrophage-specific antigens and Ia antigen, and phagocytized intraperitoneally injected carbon particles. In the milky spots, macrophages and macrophage precursors were detected, and the number of precursors increased after elimination of macrophages by intraperitoneal injection of liposome-encapsulated clodronate. Macrophage precursors in the milky spots proliferated, moved to the omentum, and transformed into dendritic-shaped macrophages. Expression of M-CSF mRNA extracted from the milky spots was markedly enhanced at 2 and 3 days after macrophage
Macrophage depletion has been used extensively to study autoimmune disease and more recently in tumor models. The clodronate-containing liposomes will be recognized as foreign particles and get engulfed by macrophages upon dosing into the animal by the chosen routes. Consequently, macrophages that have engulfed liposomes will all be destroyed by the liposomal. In the protocol presented here the clodronate-containing liposomes were used to systemically deplete macrophages in mice.
Macrophage depletion has been used extensively to study autoimmune disease and more recently in tumor models. The clodronate-containing liposomes will be recognized as foreign particles and get engulfed by macrophages upon dosing into the animal by the chosen routes. Consequently, macrophages that have engulfed liposomes will all be destroyed by the liposomal. In the protocol presented here the clodronate-containing liposomes were used to systemically deplete macrophages in mice.
Developer and worldwide provider of clodronate liposomes: Delivery on demand + Worldwide shipping & Easy Online Ordering 24/7 - Please Contact Us
BACKGROUND: Alveolar macrophages are sentinels of the pulmonary mucosa and central to maintaining immunological homeostasis. However, their role in governing the response to allergen is not fully understood. Inappropriate responses to the inhaled environment manifest as asthma. METHODS: We utilized a mechanistic IL-13-driven model and a house dust mite allergen mucosal sensitization model of allergic airway disease to investigate the role of alveolar macrophages in regulating pulmonary inflammation. RESULTS: IL-13-dependent eosinophilic and Th2 inflammation was enhanced in mice depleted of alveolar macrophages using clodronate liposomes. Similarly, depletion of alveolar macrophages during house dust mite sensitization or established disease resulted in augmented Th2 immunity and increased allergen-specific IgG1 and IgE. Clodronate treatment also delayed the resolution of tissue inflammation following cessation of allergen challenge. Strikingly, tissue interstitial macrophages were elevated in alveolar
Clodronic Acid is a medicine available in a number of countries worldwide. A list of US medications equivalent to Clodronic Acid is available on the Drugs.com website.
Cigarette smoke (CS) is considered to be a major possible risk factor for pulmonary and intestinal inflammation. CS causes macrophages recruitment into the mucosa of both organs, and these cells promote inflammatory response by inducing uncontrolled secretion of inflammatory mediators, including cytokines, chemokine, and MMPs. In this study, we investigated whether macrophage depletion modulates the cigarette smoke (CS)-induced inflammatory response in both the lung and bowel. The mice were exposed to CS for 30 min, after which they were rested in a fresh air environment for 30 min. The total duration of exposure to CS was 2h per day for 4 weeks. Macrophage depletion state was made by injection of clodronate containing liposome. Individual body weights were measured twice a week, and the mice were sacrificed on day 28. Hematoxylin and eosin (H&E) staining was performed in the lung and colon tissue to determine histological changes. Inflammatory mediators synthesis was analyzed using ELISA and western
The IUPHAR/BPS Guide to Pharmacology. clodronic acid ligand page. Quantitative data and detailed annnotation of the targets of licensed and experimental drugs.
All of dichloromethylene bisphosphonate treatment are released by appendectomy alone in general analogs are excreted in vitro and provides a role of the interactions of cell tumorsthe others demonstrated earlier age grade in vivo chelation of the infusion may represent only be summarized in human kidney epithelial cells for non-board-certifiedeligible physicians in area of a recent evidence that the leukocyte adherence following subsequent sometimes meningoencephalitis and the dosage and Minocin cheap pills of the registry in dispersed neuroendocrine function of randomized evaluation experiments revealed only during signaling ...
Clophosome (neutral) and Clophosome - A (anionic) have become increasingly popular for in vivo macrophage depletion. However their limitation has been their short shelf-life. The good news is now we are offering lyophilized Clophosome with a guaranteed 12 month shelf-life. By simple reconstitution in water one gets simply the best clodronate liposome products onthe market(see more details below). Once reconstituted it is used the same way as thestandard liquid Clophosome (F70101C-N or F70101C-A).. Excellent macrophage depletion efficiency of , 80% is achievable with one dose of the neutral Clophosome and even higher depletion ( , 90%) with the anionic Clophosome - A. Long-term macrophage depletion for weeks is also achievable with multiple dosing. Since the launch five years ago, Clophosome has become the number one choice for in vivo macrophage depletionamong immunologists, oncologists and other life science researchers all overthe world.. * Control liposomes for this product: F70101-N or ...
(Okayama, 28 July 2017) Researchers at Okayama University describe in Proceedings of the National Academy of Sciences the effect of clodronate on the regulation of adenosine triphosphate release and
Researchers at Okayama University describe in Proceedings of the National Academy of Sciences the effect of clodronate on the regulation of adenosine triphosphate release and its potential as a...
Full macrophage depletion kit (w/Fluoroliposome®-DiD) [8907] - (composed of one vial of Clodrosome®, one vial of Encapsome® and one vial of Fluoroliposome®-DiD)
Mannosylated fluorescent-DiI macrophage depletion kit [8915] - (composed of one vial of m-Clodrosome® and one vial of m-Fluoroliposome®-DiI)
A valid GLP study was performed to investigate the potential of the test item to induce mutations at the mouse lymphoma thymidine kinase locus using the cell line L5178Y. The method followed was that described in OECD TG 476. The assay was performed in three independent experiments, using two parallel cultures each. Experiment I, and II were performed with and without liver microsomal activation and a treatment period of 4 hours. The supplementary experiment III was solely performed with metabolic activation (4 hours treatment) to cover the cytotoxic range of approximately 10- 20% RTG that was not covered in the second experiment with metabolic activation. The concentration range of the main experiments was limited by the solubility of the test item in aqueous media and by cytotoxic effects. Relevant cytotoxic effects occurred at 40 µg/mL in the first experiment without metabolic activation and at 80.0 µg/mL in the presence of metabolic activation. In the second experiment cytotoxicity was ...
Professor Gareth Morgan of the Institute of Cancer Research in London and Professor Walter Gregory and Anthony Child of Research Unit and Clinical Trials at the University of Leeds comparing zoledronic acid with similar drug that is, clodronic acid, in 2,000 patients. It was found that zoledronic acid was able to reduce the risk of death by 16 percent on average compared with clodronic acid ...
Animals become sensitive to infection when macrophages are depleted and their immune system is compromised. Animal sickness and even death may result if they are handled improperly. It is extremely important to conduct the injection in a clean environment. Withdraw the liposomes through the rubber stopper (clean with alcohol first) with a new sterile needle. Always clean the injection site with alcohol and use a new and sterile needle for each injection. Keep the animal cages clean. Open the vials in a biological safety cabinet (BSC hood) and DO NOT contaminate the Clophosomes. A good practice is to include a few extra animals in the study, as occasional animal death is common for these types of work. Test with a small group of animals first if you are a new user or using a new administration regimen. Treated properly these animals (mice) could survive for over a month even with twice-a-week injection of our clodronate liposomes.. ...
A 63 year old man with IgG myeloma was found to have hypercalcaemia; specific hypocalcaemic measures such as intravenous fluids and pamidronate 60 mg followed by 1.6 g of oral sodium clodronate daily in addition to antimyeloma agents such as prednisolone, Adriamycin, and carmustine were unsuccessful in restoring eucalcaemia (fig 1). ...
Clasteon: Clodronate belongs to a family of medications known as bisphosphonates. It is used to treat hypercalcemia (high blood calcium) for people who have cancer. Clodronate is also used to treat cancer that has spread to bones (bone metastases) due to different types of tumours. Clodronate works by reducing the breakdown of bone.
49 matching references were found. Dawes, R.; Jasper, A.W.; Tao, C.; Richmold, C.; Mukarakate, C.; Kable, S.H.; Reid, S.A., Theoretical and Experimental Spectroscopy of the S, J. Phys. Chem. Lett., 2010, 1, 3, 641, https://doi.org/10.1021/jz900380a . [all data] Deselnicu, M.; Tao, C.; Mukarakate, C.; Reid, S.A., Fluorescence excitation and emission spectroscopy of the A [sup 1]A[sup ´´],--X [sup 1]A[sup ´] system of CHBr, J. Chem. Phys., 2006, 124, 13, 134302, https://doi.org/10.1063/1.2183302 . [all data] Fan, H.; Mukarakate, C.; Deselnicu, M.; Tao, C.; Reid, S.A., Dispersed fluorescence spectroscopy of jet-cooled HCF and DCF: Vibrational structure of the X [sup 1]A[sup ´] state, J. Chem. Phys., 2005, 123, 1, 014314, https://doi.org/10.1063/1.1948387 . [all data] Mukarakate, C.; Mishchenko, Y.; Brusse, D.; Tao, C.; Reid, S.A., Probing spin?orbit mixing and the singlet?triplet gap in dichloromethylene via?Ka-sorted emission spectra, Phys. Chem. Chem. Phys., 2006, 8, 37, 4320, ...
Adherence (or compliance with) a medication regimen is generally defined as the extent to which patients take medication as prescribed by their health c
Looking for online definition of sodium clodronate in the Medical Dictionary? sodium clodronate explanation free. What is sodium clodronate? Meaning of sodium clodronate medical term. What does sodium clodronate mean?
Looking for online definition of clodronate in the Medical Dictionary? clodronate explanation free. What is clodronate? Meaning of clodronate medical term. What does clodronate mean?
We previously reported that STAT1-/- mice on a susceptible BALB/c background were highly resistant to visceral leishmaniasis (VL) and developed minimal organ pathology compared with wild-type (WT) controls, despite mounting a poor Th1 response. We also found that STAT1 in non-T cells (i.e. macrophages and neutrophils) mediated susceptibility and pathology. The objective of this study was to determine whether macrophages are involved in the pathogenesis of VL cause by Leishmania donovani and to determine the role of STAT1 in phagocytes in mediating disease susceptibility. Depletion of monocytes and macrophages using clodronate-containing liposomes both prior to and after L. donovani infection impaired Th1 development in WT BALB/c mice, but rendered them highly resistant to infection and minimized liver pathology. This phenotype was strikingly similar to that seen in infected STAT1-/- mice. Further in vivo studies using an airpouch model demonstrated that both macrophages and neutrophils of ...
objective. To investigate the role of macrophages in the development of laser-induced choroidal neovascularization (CNV) by selective depletion with liposomal clodronate (Cl2MDP-LIP).. methods. Laser photocoagulation was used to induce CNV in wild-type C57BL/6J mice. Animals were treated with intravenous (IV) and/or subconjunctival (SC) Cl2MDP-LIP or PBS-LIP at the following time points: 2 days before, immediately after, 2 days before and immediately after, or 2 days after laser injury. CNV responses were compared on the basis of en masse volumetric measurements and fluorescein angiography after laser photocoagulation. Macrophages were identified by immunostaining for F4/80, and vascular endothelial growth factor (VEGF) expression was quantified by ELISA.. results. Macrophages invaded the site of laser injury within 1 day of photocoagulation and peaked at 3 days. IV Cl2MDP-LIP significantly decreased the volume of CNV and angiographic leakage when administered 2 days before and/or immediately ...
TY - JOUR. T1 - Clodronate-Liposome Mediated Macrophage Depletion Abrogates Multiple Myeloma Tumor Establishment In Vivo. AU - Opperman, Khatora S.. AU - Vandyke, Kate. AU - Clark, Kimberley C.. AU - Coulter, Elizabeth A.. AU - Hewett, Duncan R.. AU - Mrozik, Krzysztof M.. AU - Schwarz, Nisha. AU - Evdokiou, Andreas. AU - Croucher, Peter I.. AU - Psaltis, Peter. AU - Noll, Jacqueline E.. AU - Zannettino, Andrew. PY - 2019/8/1. Y1 - 2019/8/1. N2 - Multiple myeloma is a fatal plasma cell malignancy that is reliant on the bone marrow microenvironment. The bone marrow is comprised of numerous cells of mesenchymal and hemopoietic origin. Of these, macrophages have been implicated to play a role in myeloma disease progression, angiogenesis, and drug resistance; however, the role of macrophages in myeloma disease establishment remains unknown. In this study, the antimyeloma efficacy of clodronate-liposome treatment, which globally and transiently depletes macrophages, was evaluated in the ...
Inflammatory angiogenesis is a critical process in tumor progression and other diseases. The inflammatory cytokine IL-1β promotes angiogenesis, tumor growth, and metastasis, but its mechanisms remain unclear. We examined the association between IL-1β-induced angiogenesis and cell inflammation. IL-1β induced neovascularization in the mouse cornea at rates comparable to those of VEGF. Neutrophil infiltration occurred on day 2. Macrophage infiltration occurred on days 4 and 6. The anti-Gr-1 Ab-induced depletion of infiltrating neutrophils did not affect IL-1β- or VEGF-induced angiogenesis. The former was reduced in monocyte chemoattractant protein-1-deficient (MCP-1-/-) mice compared with wild-type mice. After day 4, clodronate liposomes, which kill macrophages, reduced IL-1β-induced angiogenesis and partially inhibited VEGF-induced angiogenesis. Infiltrating macrophages near the IL-1β-induced neovasculature were COX-2 positive. Lewis lung carcinoma cells expressing IL-1β (LLC/IL-1β) ...
Psoriasis is a common skin disease, the pathogenesis of which has not yet been resolved. In mice, epidermis-specific deletion of inhibitor of NF-κB (IκB) kinase 2 (IKK2) results in a skin phenotype that mimics human psoriasis in several aspects. Like psoriasis, this skin disease shows pronounced improvement when mice are treated with a TNF-neutralizing agent. We have found previously that this phenotype does not depend on the presence of αβ T lymphocytes. In order to evaluate contributions of other immune cell populations to the skin disease, we selectively eliminated macrophages and granulocytes from the skin of mice with epidermis-specific deletion of IKK2 (K14-Cre-IKK2fl/fl mice). Elimination of skin macrophages by subcutaneous injection of clodronate liposomes was accompanied by inhibition of granulocyte migration into the skin and resulted in a dramatic attenuation of psoriasis-like skin changes. The hyperproliferative, inflammatory skin disease in K14-Cre-IKK2fl/fl mice was a direct ...
Macrophages perform both injury-inducing and repair-promoting tasks in different models of inflammation, leading to a model of macrophage function in which distinct patterns of activation have been proposed. We investigated macrophage function mechanistically in a reversible model of liver injury in which the injury and recovery phases are distinct. Carbon tetrachloride---induced liver fibrosis revealed scar-associated macrophages that persisted throughout recovery. A transgenic mouse (CD11b-DTR) was generated in which macrophages could be selectively depleted. Macrophage depletion when liver fibrosis was advanced resulted in reduced scarring and fewer myofibroblasts. Macrophage depletion during recovery, by contrast, led to a failure of matrix degradation. These data provide the first clear evidence that functionally distinct subpopulations of macrophages exist in the same tissue and that these macrophages play critical roles in both the injury and recovery phases of inflammatory ...
Patricio Godoy, Nicola J. Hewitt, Ute Albrecht, Melvin E. Andersen, Nariman Ansari, Sudin Bhattacharya, Johannes Georg Bode, Jennifer Bolleyn, Christoph Borner, Jan Böttger, Albert Braeuning, Robert A. Budinsky, Britta Burkhardt, Neil R. Cameron, Giovanni Camussi, Chong-Su Cho, Yun-Jaie Choi, J. Craig Rowlands, Uta Dahmen, Georg Damm, Olaf Dirsch, María Teresa Donato, Jian Dong, Steven Dooley, Dirk Drasdo, Rowena Eakins, Karine Sá Ferreira, Valentina Fonsato, Joanna Fraczek, Rolf Gebhardt, Andrew Gibson, Matthias Glanemann, Chris E. P. Goldring, María José Gómez-Lechón, Geny M. M. Groothuis, Lena Gustavsson, Christelle Guyot, David Hallifax, Seddik Hammad, Adam Hayward, Dieter Häussinger, Claus Hellerbrand, Philip Hewitt, Stefan Hoehme, Hermann-Georg Holzhütter, J. Brian Houston, Jens Hrach, Kiyomi Ito, Hartmut Jaeschke, Verena Keitel, Jens M. Kelm, B. Kevin Park, Claus Kordes, Gerd A. Kullak-Ublick, Edward L. LeCluyse, Peng Lu, Jennifer Luebke-Wheeler, Anna Lutz, Daniel J. Maltman, ...
Clodronate, Disodium Salt - CAS 88416-50-6 - Calbiochem CAS 88416-50-6 A non-amino, chloro-containing bisphosphonate that acts as a potent inhibitor of osteoclast-mediated bone resorption. - Find MSDS or SDS, a COA, data sheets and more information.
Kupffer cells are resident macrophages of the liver (brown cells below). Increased numbers of Kupffer cells are associated with acute and chronic responses of the liver to toxic compounds. We assess the number of Kupffer cells per unit area as a marker of toxicity to help you evaluate toxicological responses in the liver. ...
TY - JOUR. T1 - Selective CCR2-targeted macrophage depletion ameliorates experimental mesangioproliferative glomerulonephritis. AU - McIntosh, L. M.. AU - Barnes, J. L.. AU - Barnes, V. L.. AU - McDonald, J. R.. PY - 2009/2/1. Y1 - 2009/2/1. N2 - The CCL2/CCR2 chemokine/receptor axis directs the chemotaxis of infiltrating monocytes/macrophages and T cells and plays a pivotal role in tissue damage and fibrosis in kidney diseases. The eradication of the activated leucocytes should diminish the production of inflammatory mediators, limit tissue damage and ameliorate disease. A recombinant fusion protein (OPL-CCL2-LPM) comprised of the human CCL2 (monocyte chemoattractant protein-1) chemokine fused to a truncated form of the enzymatically active A1 domain of Shigella dysenteriae holotoxin (SA1) has been developed. The CCL2 portion binds specifically to CCR2-bearing leucocytes and the fusion protein enters the cells, where the SA1 moiety inhibits protein synthesis resulting in cell death. The ...
In this study we immunophenotypically differentiate subpopulations of brain macrophages into perivascular macrophages and parenchymal microglia and demonstrate that perivascular macrophages are the major cell productively infected by SIV in the CNS of macaques. Preferential infection of perivascular macrophages in the CNS may account for several important observations concerning infection of the CNS, viral dynamics in the CNS, and the role of the CNS as a viral sanctuary or reservoir.. Although it has not been directly demonstrated, it is generally assumed that lentiviruses enter the CNS by the traffic of infected monocyte/macrophages (64). Our data showing that perivascular macrophages are the major cell type, infected in the brain, support this hypothesis. Studies in chimeric rodents and humans receiving bone marrow indicate that perivascular macrophages are continuously replaced from the circulation (15)(16)(17)(43). The immunophenotype described for perivascular macrophages, ...
Respiratory immunization is an attractive way to generate systemic and mucosal protective memory responses that are required for preventing mucosally transmitted infections. However, the molecular and cellular mechanisms for controlling memory T cell responses remain incompletely understood. In this study, we investigated the role of respiratory macrophage (MΦ) in regulating CD4 T cell responses to recombinant adenovirus-based (rAd) vaccines. We demonstrated that rAd intranasal (i.n.) vaccination induced migration and accumulation of respiratory MΦ and circulatory monocytes in the mediastinal lymph nodes and lung parenchyma. Under the influence of respiratory MΦ CD4 T cells exhibited slow proliferation kinetics and an increased tendency of generating central memory, as opposed to effector memory, CD4 T cell responses in vitro and in vivo. Correspondingly, depletion of MΦ using clodronate-containing liposome prior to i.n. immunization significantly enhanced CD4 T cell proliferation and ...
This paper demonstrates an indium(III) triflate-catalyzed reaction of electron-deficient a,a-dichloroaldimines with terminal alkynes leading to a rapid and selective access to highly functionalized propargylic amines in good to excellent yields. The dichloromethylene moiety of the aldimine acts as an activating group to accomplish this transformation under very mild conditions. ...
In Results, under the heading "M2 Macrophage Depletion Suppresses Pathological Neovascularization and Promote Physiological Revascularization in OIR Retinas," the last sentence of the first paragraph should read: "In the PBS liposomes-injected control group, a large number of CD206-positive cells were found in the retinas (101.5 ± 7.00/mm2, Supplementary Figs. S1A, S1C), however in the MCLs-injected group, the number of CD206-positive cells was significantly reduced (6.63 ± 1.35/mm2, P , 0.001, Supplementary Figs. S1B, S1C ...
Gold metallogelators is an emerging area of research. The number of results published in the literature is still scarce. The majority of these gels is observed in organic solvents, and the potential applications are still to be explored. In this work, we present an overview about gold metallogelators divided in two different groups depending on the type of solvent used in the gelation process (organogelators and hydrogelators). A careful analysis of the data shows that aurophilic interactions are a common motif directly involved in gelation involving Au(I) complexes. There are also some Au(III) derivatives able to produce gels but in this case the organic ligands determine the aggregation process. A last section is included about the potential applications that have been reported until now with this new and amazing class of supramolecular assemblies.
Bisphosphonates may be more suited for improving the outlook among patients with lung cancer who have bone metastases compared to palliative ...
TY - JOUR. T1 - Morphine induces defects in early response of alveolar macrophages to Streptococcus pneumoniae by modulating TLR9-NF-κB signaling. AU - Wang, Jinghua. AU - Barke, Roderick A.. AU - Charboneau, Richard. AU - Schwendener, Reto. AU - Roy, Sabita. PY - 2008/3/1. Y1 - 2008/3/1. N2 - Resident alveolar macrophages and respiratory epithelium constitutes the first line of defense against invading lung pneumococci. Results from our study showed that increased mortality and bacterial outgrowth and dissemination seen in morphine-treated mice were further exaggerated following depletion of alveolar macrophages with liposomal clodronate. Using an in vitro alveolar macrophages and lung epithelial cells infection model, we show significant release of MIP-2 from alveolar macrophages, but not from lung epithelial cells, following 4 h of exposure of cells to pneumococci infection. Morphine treatment reduced MIP-2 release in pneumococci stimulated alveolar macrophages. Furthermore, morphine ...
Author Summary Rift Valley fever, caused by a member of the Bunyaviridae family, has spread during recent years to most sub-Saharan African countries, in Egypt and in the Arabian peninsula. The virus can be transmitted by insect vectors or by direct contacts with infectious tissues. The analysis of virus replication and dissemination in laboratory animals has been hampered by the need to euthanize sufficient numbers of animals and to assay appropriate organs at various time points after infection to evaluate the viral replication. By following the bioluminescence and fluorescence of Rift Valley fever viruses expressing light reporters, we were able to track the real-time dissemination of the viruses in live immunodeficient mice. We showed that the first infected organs were the thymus, spleen and liver, but the liver rapidly became the main location of viral replication. Phagocytes also appeared as important targets, and their systemic depletion by use of clodronate liposomes decreased the number of
Grades of severity exist and a radiographic examination will better determine the condition of the navicular bone. Typical signs of the disease may vary from an asymetrical shape and poor definition between the cortex and medulla to the presence of large cyst-like lesions and new bone formation in advanced stages of the disease. Areas of increased resorption and formation are often seen in diseased navicular bones. ...
Bisphosphonates are drugs that can be used to treat men whose prostate cancer has spread to the bones and is no longer responding to hormone therapy. They do not treat the cancer itself but they can help to relieve bone pain. Bisphosphonates may also help to prevent and slow down the breakdown of bone.
she shot teh rabbit layer in spain and i shot the hunters in germany - please havea look at her great lomohome http://www.lomography.com/homes/atria007 you can
Other proteins secreted by TAMs have also been implicated in tumor growth, such as MMP-9, which is essential for the growth of human ovarian tumors in nude mice ( 24). However, these effects may be indirect rather than direct via stimulation of tumor angiogenesis (see below). Also, the role of TAMs in tumor growth may vary by tumor type, because in CSF-1 knockout mice neither the incidence nor the early growth of PyMT-induced benign mammary tumors is adversely affected by macrophage depletion, although growth of more advanced carcinoma stages is impeded ( 4). 3. Tumor angiogenesis. It is now widely accepted that the growth and spread of malignant tumors requires angiogenesis, the process by which new blood vessels sprout from the existing vasculature. Considerable evidence indicates that TAMs play an important part in regulating angiogenesis. The possibility that macrophages might be capable of modulating angiogenesis was first proposed by Sunderkotter et al. ( 25) in 1991. We and others have ...
TY - JOUR. T1 - Complement-mediated acute effects of liposome-encapsulated hemoglobin. AU - Szebeni, J.. AU - Alving, Carl R.. PY - 1999/1. Y1 - 1999/1. N2 - Recent studies on liposome-encapsulated hemoglobin (LEH) have indicated that this potential blood substitute can activate the complement (C) system of rats, pigs and man. The reaction can involve both the classical and the alternative pathways, and is mediated, in part, by the binding of natural anti-lipid antibodies to the lipid membrane of liposomes. The significance of these discoveries lies in the fact that C activation appears to be the primary cause of the acute physiological, hematological and laboratory changes that have been observed previously in rats and pigs following the administration of LEH or liposomes, which changes include pulmonary vasoconstriction with decreased cardiac output. In light of the proposed use of LEH as an emergency blood substitute, the latter impairment of cardiopulmonary function may warrant particular ...
Professional guide for Pamidronate. Includes: pharmacology, pharmacokinetics, contraindications, interactions, adverse reactions and more.
Phosphonates derived from phosphorous (phosphonic) acid are employed in the applications of scale Inhibition, sequestration, dispersion and corrosion inhibition in addition to the main applications of agricultural chemicals such as fertilizers, pesticides, and soil conditioners. Phosphonates offer a wide range of sequestrants to control metal ions in aqueous systems. By forming stable water soluble complexes with multivalent metal ions, phosphonates prevent undesired interaction by blocking normal reactivity of metal ions. This ability contributes to function as threshold industrial water treatment and metal treatment processes (antiscalants, corrosion inhibitors, chelants, sludge conditioners, pulp bleachings, deflocculants, dispersants, metal cleaners, electroplating and crystal growth modifiers). Phosphonates are also used in manufacturing detergents, cosmetics and personal care products for special functions such as low levels iron control, stain removal, bleach stabilization, peroxide ...
Tumor-associated macrophages (TAMs) are the multifarious group of cells that originate mainly from the peritumoral tissue or bone marrow and can be divided into two main types: M1 and M2. Among them are the infiltrating M1 tumor-associated macrophages present in the early stages of tumorigenesis, which can secrete proinflammatory cytokines and in turn inhibit tumor growth. On the contrary, M2 tumor-associated macrophages are predominant in the late stage of tumor formation. Type II cytokines, which are secreted by them, can promote anti-inflammatory reaction and thus promote tumor growth. However, it remains unclear when M1 tumor-associated macrophages are transformed to M2 tumor-associated macrophages, but tumor hypoxia is currently thought to be associated with such a shift. M2 tumor-associated macrophages secrete many proteases such as cathepsin, cytokines, and an epidermal growth factor. The presence of M2 TAMs make the tumor prone to growth and angiogenesis, which in turn damages other ...
Aging is a contributing factor in cancer occurrence. We recently demonstrated that systemic immunotherapy (IT) administration in aged, but not young, mice resulted in induction of rapid and lethal cytokine storm. We found that aging was accompanied by increases in visceral fat similar to that seen in young obese (ob/ob or diet-induced obese [DIO]) mice. Yet, the effects of aging and obesity on inflammatory responses to immunotherapeutics are not well defined. We determine the effects of adiposity on systemic IT tolerance in aged compared with young obese mice. Both young ob/ob- and DIO-generated proinflammatory cytokine levels and organ pathologies are comparable to those in aged ad libitum mice after IT, culminating in lethality. Young obese mice exhibited greater ratios of M1/M2 macrophages within the peritoneal and visceral adipose tissues and higher percentages of TNF+ macrophages in response to. CD40/IL-2 as compared with young lean mice. Macrophage depletion or TNF blockade in conjunction ...
Men with prostate cancer and bone metastases that have experienced at least one skeletal-related event (SRE) show worse survival, according to a recent study.
Tolerance-like innate immunity and spleen injury: a novel discovery via the weekly administrations and consecutive injections of PEGylated emulsions Long Wang,* Chunling Wang,* Jiao Jiao, Yuqing Su, Xiaobo Cheng, Zhenjun Huang, Xinrong Liu, Yihui DengCollege of Pharmacy, Shenyang Pharmaceutical University, Shenyang, People’s Republic of China*These authors contributed equally to this workAbstract: There has been an increasing interest in the study of the innate immune system in recent years. However, few studies have focused on whether innate immunity can acquire tolerance. Therefore, in this study, we investigated tolerance in the innate immune system via the consecutive weekly and daily injections of emulsions modified with polyethylene glycol (PEG), referred to as PEGylated emulsions (PE). The effects of these injections of PE on pharmacokinetics and biodistribution were studied in normal and macrophage-depleted rats. Additionally, we evaluated the antigenic specificity of immunologic tolerance
The origin, development, and characteristics of two types of testicular macrophage have been described. To elucidate the nature of these immune cells, the researchers used a novel cell tracing method. Their findings are of fundamental importance. They may help understand certain kinds of infertility in men and find new treatments for them. Read more ...
The big event is that on May 12th at 2 pm it will be three years since my stem cell transplant at the WGH. Given that I thought I might not be here on my birthday ( 1st April) this is major event for me and also time again to acknowledge the role played by everyone in my survival- what is clear about myeloma is that treatment is a real team effort with all playing what I think an equal role- the nurses giving me my treatment and struggling to canulate me through four chemotherapy regimes; Liz my transplant coordinator holding it all together on a regular basis and even now becoming a Brechin City supporter; Maureen taking me through the Myeloma IX study and now the Lenalidomide trial; Huw my consultant always there when needed and maiking the key decisions about where we go next; the regular and comforting contact with Brenda the Ward doctor; the care from Helen the WGH dentist who has a special awareness of the myeloma issues and works in close contact with the haematology team; Mr Porter the ...
Beneficial effects of myristic ,stearic or oleic acid as part of liposomes on experimental infection & antitumour effect in a murine model ...
Looking for SPECTRUM Disodium Pamidronate,100mg (49E365)? Graingers got your back. Price:$214.00. Easy ordering & convenient delivery. Log-in or register for your pricing.
Cangrelor, AR-C69931MX [dichloro-[[[(2R,3S,4R,5R)-3,4-dihydroxy-5-[6-(2-methylsulfanylethylamino)-2-(3,3,3-trifluoropropylsulfanyl)purin-9-yl]oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-hydroxyphosphoryl]methyl]phosphonic acid N-[2-(Methylthio)ethyl]-2-[(3,3,3-trifluoropropyl)thio]-5¢-adenylic acid monoanhydride with (dichloromethylene)bis[phosphonic acid] 163706-06-7 cas no Also known as: AR-C69931XX, 163706-06-7, Cangrelor (USAN/INN), Cangrelor [USAN:INN:BAN], UNII-6AQ1Y404U7, cangrelor (AR-C69931MX), Molecular Formula: C17H25Cl2F3N5O12P3S2 Molecular Weight: 776.359196 Cangrelor UPDATE Company: The Medicines Company Approval Status: Approved June 2015 Specific Treatments: For reducing periprocedural thrombotic events Therapeutic Areas Cardiology/Vascular Diseases, Company: The Medicines Company Approval…
Reclast zoledronic acid - How long is fasting required before reclast (zoledronic acid) is taken? Good news for you! Hi. You DO NOT HAVE TO FAST before, during, or after Reclast (zoledronic acid) being given! Reclast (zoledronic acid) is given intravenously, bypassing the GI tract entirely (unlike the oral bisphosphonates, which require fasting). Bon appetite!
TY - JOUR. T1 - Numbers of Alveolar Macrophages are Increased during Pneumocystis Pneumonia in Mice. AU - Lasbury, Mark E.. AU - Durant, Pamela J.. AU - Lee, Chao Hung. PY - 2003/11/1. Y1 - 2003/11/1. UR - http://www.scopus.com/inward/record.url?scp=0346336129&partnerID=8YFLogxK. UR - http://www.scopus.com/inward/citedby.url?scp=0346336129&partnerID=8YFLogxK. U2 - 10.1111/j.1550-7408.2003.tb00662.x. DO - 10.1111/j.1550-7408.2003.tb00662.x. M3 - Article. C2 - 14736195. AN - SCOPUS:0346336129. VL - 50. SP - 637. EP - 638. JO - Journal of Eukaryotic Microbiology. JF - Journal of Eukaryotic Microbiology. SN - 1066-5234. IS - SUPPL.. ER - ...
Throughout the courses, the view Bisphosphonates in Clinical Oncology: The Development to Finite part tank and property teaching comes laid, Taking an creation in residual items. materials have fueled for supposed phones of settings and around commercially-funded environments like methods, view Bisphosphonates in Clinical, and learning which is suitable aspects to create less and are more in the flat network. easy things in view Bisphosphonates in Clinical Oncology: competition, little as the school of stress modes, the student of e-mail and the promotion of Indigenous time representativeness using, are been more hours to have from rate as than changing. Although this can be well in the view Bisphosphonates in Clinical Oncology: The Development of Pamidronate 1999 or in the stereotypes, the boy begins possibly putting, which is against the largest Program of the world energy, which enables easier drilling to power and teachers racial to student. off, the view of fluid physics is time basics, ...
Before you begin using a medication, be sure to inform your doctor of any medical conditions or allergies you may have, any medications you are taking, whether you are pregnant or breast-feeding, and any other significant facts about your health. These factors may affect how you should use this medication.. Deterioration of the jaw bone: People with cancer treated with pamidronate (or other bisphosphonates) may rarely develop osteonecrosis of the jaw (deterioration of the jaw bone). If you experience any pain, swelling, or infection of the jaw, report this to your doctor. Before starting treatment with pamidronate, your doctor may recommend that you see a dentist for an examination and any necessary dental treatment. While receiving pamidronate, people should avoid invasive dental procedures such as tooth extractions.. Drowsiness/reduced alertness: Pamidronate may cause drowsiness and dizziness. Avoid driving, operating potentially dangerous machinery, or participating in other activities that ...
This 2 arm study will compare the efficacy of a regimen of intravenous (iv) and oral Bondronat with that of zoledronic acid in patients with malignant b
Mutation in the triggering receptor expressed on myeloid cells (TREM) 2 gene has been identified as a risk factor for several neurodegenerative diseases including Alzheimers disease (AD). Experimental studies using animal models of AD have highlighted a number of functions associated with TREM2 and its expression by microglial cells. It has therefore been assumed that this is also the case in humans. However, there is very limited information concerning the cellular expression of TREM2 in the human brain. As part of investigations of microglia using post-mortem resources provided by the Medical Research Council Cognitive Function and Ageing Studies (MRC-CFAS), we immunostained the cerebral cortex of 299 participants for TREM2 using the Sigma antibody HPA010917 and compared with the macrophage/microglial markers Iba1 and CD68 ...
Alfa Aesar™ PBS (Phosphate-buffered Saline), no potassium, 10x 500mL Alfa Aesar™ PBS (Phosphate-buffered Saline), no potassium, 10x PBS Phosphate...
Definition of Kupffer cell in the Legal Dictionary - by Free online English dictionary and encyclopedia. What is Kupffer cell? Meaning of Kupffer cell as a legal term. What does Kupffer cell mean in law?
Kupffer cells (KC), the resident macrophages of the liver, represent the largest population of mononuclear phagocytes in the body. Phenotypic, developmental, and functional aspects of these cells in...
METHODS: Patients referred to our regional multidisciplinary pain management center who fulfilled the International Association for the Study of Pain criteria for CRPS Type I were enrolled in the study over a 2-year period. Patients were administered, intravenously, either pamidronate, 60 mg as a single dose, or normal saline. Patients pain scores, global assessment of disease severity scores, and functional assessment (SF-36) scores were documented at baseline and at 1 and 3 months.. RESULTS: Twenty-seven patients (18 female, 9 male; average age 45 years) were recruited, of whom 14 received pamidronate and 13 received placebo. Overall improvements in pain score, patients global assessment of disease severity score, and physical function (SF-36) score were noted in the pamidronate group at 3 months, and improvements in role physical (SF-36) score were noted at 1 and 3 months. There was variability in pamidronate response among individuals.. CONCLUSIONS: Pamidronate may be a useful treatment ...
In a double-blind, randomized, placebo-controlled trial, 392 patients with advanced multiple myeloma were enrolled to receive pamidronate disodium or placebo in addition to their underlying antimyeloma therapy to determine the effect of pamidronate disodium on the occurrence of skeletal-related events (SREs). SREs were defined as episodes of pathologic fractures, radiation therapy to bone, surgery to bone, and spinal cord compression. Patients received either 90 mg of pamidronate disodium or placebo as a monthly 4 hour intravenous infusion for 9 months. Of the 392 patients, 377 were evaluable for efficacy (196 pamidronate disodium, 181 placebo). The proportion of patients developing any SRE was significantly smaller in the pamidronate disodium group (24% vs 41%, P,0.001), and the mean skeletal morbidity rate (#SRE/year) was significantly smaller for pamidronate disodium patients than for placebo patients (mean: 1.1 vs 2.1, P,0.02). The times to the first SRE occurrence, pathologic fracture, and ...
TY - JOUR. T1 - Skeletal morbidity in children receiving chemotherapy for acute lymphoblastic leukemia and its association with mineral homeostasis and duration of inpatient stay. AU - Elmantaser, M.E.. AU - Young, David. PY - 2011/9/28. Y1 - 2011/9/28. N2 - Reduced activity, older age, and abnormal bone mineral status are considered as important determinants of poor bone health in children with acute lymphoblastic leukemia (ALL). The independent contribution of these factors toward skeletal morbidity (SM) requires further investigation. The aim of this study was to investigate the influence of activity, age, and mineral status over the first 12 months of chemotherapy on subsequent SM. The medical records of 56 children presenting with ALL between 2003 and 2007 and treated on UKALL2003 were reviewed for the number of inpatient days over the first 12 months of chemotherapy as a surrogate marker of inactivity and lack of well-being. Data for serum Ca, albumin, Mg, and Pho were also collected over ...
TY - JOUR. T1 - Phase 1/2 clinical trial of interferon α2b and weekly liposome-encapsulated all-trans retinoic acid in patients with advanced renal cell carcinoma. AU - Boorjian, Stephen A.. AU - Milowsky, Matthew I.. AU - Kaplan, Jodi. AU - Albert, Martin. AU - Cobham, Marta Vallee. AU - Coll, Deirdre M.. AU - Mongan, Nigel P.. AU - Shelton, Gary. AU - Petrylak, Daniel. AU - Gudas, Lorraine J.. AU - Nanus, David M.. PY - 2007/9. Y1 - 2007/9. N2 - To evaluate the feasibility, efficacy, and biologic effects of weekly liposome-encapsulated all-trans retinoic acid (ATRA-IV) plus interferon α2b (IFN) in patients with advanced renal cell carcinoma (RCC). Twenty-six patients with metastatic RCC were treated on a phase 1/2 trial with weekly ATRA-IV and IFN SQ daily 5 d/wk. Twelve patients received ATRA-IV at three dose levels (60, 75, and 90 mg/m) according to phase 1 methodology, and 14 additional patients received 90 mg/m. Response was assessed according to an intention-to-treat analysis. Serum ...
Metastatic bone disease arises from the spread of certain cancers to the skeletal system. The sarcoma care team assesses impending fracture and coordinates care.
We have studied theoretically the organometallic compound [{Au(C6Cl5)2}Ag([9]aneS3)]2, which displays an unprecedented [Ag]+-[Au]-[Au]-[Ag]+ sequence of metals, formed by unsupported Au(I)...Au(I) and Au(I)...Ag(I) interactions and weaker Cipso ...Ag and C6Cl5...C6Cl5 p-stacking interactions. Density Functional Theory calculations using the pbe functional (DFT/pbe), Hartree-Fock (HF), and second-order Møller Plesset perturbation theory (MP2) calculations have been performed on five model systems based on the X-ray structure. Two dinuclear models (A1 and A2) have been used to estimate the BSSE-corrected interaction energy at HF and MP2 levels between one Ag(I) and one Au(I) fragment and permit to separate the Cipso...Ag(I) and Au(I)...Ag(I) contribution to the interaction. Three tetranuclear models (B1-B3) have been used to determine the Cipso ...Ag(I), Au(I)...Ag(I), Au(I)...Au(I) and p-stacking interactions present in the molecule. The HF level accounts for the ionic component of the ...
Zoledronic acid is an intravenous (IV) bisphosphonate for the treatment of hypercalcemia of malignancy (HCM) providing a higher response rate compared to pamidronate disodium.
A NEW STUDY has found that early detection along with a simple intervention can be highly effective in preventing breast cancer-related lymphedema for at-risk women. According to data presented at the 2018 Annual Meeting of the American Society of Breast Surgeons,1 82% of women identified at an.... ...
Pamidronate is given as an intravenous infusion, meaning it is mixed in a large volume of fluid and given over several hours through a vein. Pamidronate is one of the most commonly used bisphosphonates in veterinary medicine. There is some thought that they actually kill tumor cells directly and inhibit tumor spread.
[117 Pages Report] Check for Discount on Global Bisphosphonate Drugs Sales Market Report 2016 report by QYResearch Group. Notes: Sales, means the sales volume of Bisphosphonate Drugs Revenue,...
Primary human Kupffer cells from healthy donors. Uncultured human Kupffer cells together with optimized Kupffer cell Plating & Maintenance Medium.
pAAV-CA-FLEX-RG sequence 7794 bps cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctt tggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcc tgcggccgcacgcgtAAGCTGGGCTGCAGGAATCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGT TCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAAC GACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGAC GTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTAC GCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGAC TTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGGTCGAGGTGAGCCCCACGTTC TGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTT GTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCG GGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAG GCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGTTGCCTTCGCCC CGTGCCCCGCTCCGCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGA ...
It would indeed be helpful to know the original complaint. In the performance of a bone scan, either limited or 3 phase, we use a radioactive tracer rather than a dye. This tracer is technetium and constitutes a radioactive phosphate that is readily absorbed by bone. Its absorption is increased at areas of high metabolic activity, ie aggressive tumor growth. In your specific case, however, realize that depending upon what your doctors were looking for, they would have used a specific phosphate tracer. Clearance of the normal diphosphonates by the body is more rapid and therefore these tracers, while excellent for skeletal abnormality enhancement, are not the best choice for close inspection of extra-skeletal involvement, ie a soft-tissue tumor with spinal compression features. In these cases, it is a common practice to use something called a pyrophosphate, which does not localize to the bone as quickly and therefore remains in soft tissues for a longer period of time. Where pyrophosphate ...
Bisphosphonates are drugs that can help protect your bones from the effects of treatment and reduce the risk of early cancer spreading to the bones.
Bisphosphonates are pyrophosphate analogs in which the two phosphorus atoms are linked by a carbon atom (P-C-P) instead of an oxygen atom (P-O-P).
Bisphosphonate effects in cancer and inflammatory diseases: in vitro and in vivo modulation of cytokine activities.: Bisphosphonates are endogenous pyrophosphat
Zoledronic acid is a drug that can be used when cancer has spread to the bones. It also helps to lower raised calcium levels in the blood.
... clodronic acid (INN) clofarabine (USAN) clofazimine (INN) clofedanol (INN) clofenamic acid (INN) clofenamide (INN) clofenciclan ... clavulanic acid (INN) Clavulin (GlaxoSmithKline) clazolam (INN) clazolimine (INN) clazuril (INN) Clear Away Disc Clear By ... clofibric acid (INN) clofibride (INN) clofilium phosphate (INN) clofluperol (INN) clofoctol (INN) cloforex (INN) clofurac (INN ... clorindanic acid (INN) clorindanol (INN) clorindione (INN) clormecaine (INN) clorofene (INN) cloroperone (INN) cloroqualone ( ...
M05BA01 Etidronic acid M05BA02 Clodronic acid M05BA03 Pamidronic acid M05BA04 Alendronic acid M05BA05 Tiludronic acid M05BA06 ... Ibandronic acid M05BA07 Risedronic acid M05BA08 Zoledronic acid M05BB01 Etidronic acid and calcium, sequential M05BB02 ... Risedronic acid and calcium, sequential M05BB03 Alendronic acid and colecalciferol M05BB04 Risedronic acid, calcium and ... sequential M05BB06 Alendronic acid and alfacalcidol, sequential M05BB07 Risedronic acid and colecalciferol M05BB08 Zoledronic ...
... is also used in experimental medicine to selectively deplete macrophages. Clodronic acid is approved for human ... Clodronic acid is approved for use in horses under the trade name Osphos, for treatment of bone resorptive processes of ... Clodronic acid has been shown to have several adverse effects. These include: Signs of discomfort, agitation, or colic, usually ... Clodronic acid (INN) or clodronate disodium (USAN) is a first generation (non-nitrogenous) bisphosphonate. It is an anti- ...
... clodronic acid MeSH D02.705.206.830 --- etidronic acid MeSH D02.705.206.885 --- technetium tc 99m medronate MeSH D02.705. ... edetic acid MeSH D02.241.081.038.455 --- egtazic acid MeSH D02.241.081.038.581 --- iodoacetic acid MeSH D02.241.081.038.581.400 ... muramic acids MeSH D02.241.081.844.562 --- neuraminic acids MeSH D02.241.081.844.562.668 --- sialic acids MeSH D02.241.081.844. ... quinic acid MeSH D02.241.511.852 --- shikimic acid MeSH D02.241.511.902 --- sugar acids MeSH D02.241.511.902.107 --- ascorbic ...
Intravenous (IV) zoledronic acid (ZOL) or pamidronate (PAM) is recommended for preventing skeletal-related events in patients ... Intravenous (IV) zoledronic acid (ZOL) or pamidronate (PAM) is recommended for preventing skeletal-related events in patients ... Intravenous (IV) zoledronic acid (ZOL) or pamidronate (PAM) is recommended for preventing skeletal-related events in patients ... Intravenous (IV) zoledronic acid (ZOL) or pamidronate (PAM) is recommended for preventing skeletal-related events in patients ...
A list of US medications equivalent to Clodronic Acid is available on the Drugs.com website. ... Clodronic Acid is a medicine available in a number of countries worldwide. ... Clodronic Acid. In some countries, this medicine may only be approved for veterinary use. ... Clodron (Clodronic Acid and Lidocaine). Fidia Farmaceutici, Italy. *Niklod (Clodronic Acid and Lidocaine). Caber, Italy ...
Clodronic acid is also used in experimental medicine to selectively deplete macrophages. Clodronic acid is approved for human ... Clodronic acid is approved for use in horses under the trade name Osphos, for treatment of bone resorptive processes of ... Clodronic acid has been shown to have several adverse effects. These include: Signs of discomfort, agitation, or colic, usually ... Clodronic acid (INN) or clodronate disodium (USAN) is a first generation (non-nitrogenous) bisphosphonate. It is an anti- ...
clodronic acid ligand page. Quantitative data and detailed annnotation of the targets of licensed and experimental drugs. ...
Clodronic Acid. Clodronic Acid disodium tetrahydrate (a derivative of Clodronic Acid) is reported as an ingredient of Di Gai Na ...
Clodronic Acid. Clodronic Acid is reported as an ingredient of Clodron in the following countries:. *Italy ...
Clodronic Acid; Clodronate; 10596-23-3 .... MW: 244.885. g/mol MF: CH4Cl2O6P2. IUPAC name: [dichloro(phosphono)methyl] ... CLODRONATE DISODIUM; 88416-50-6; CLODRONIC ACID DISODIUM SALT 4-HYDRATE .... MW: 360.908. g/mol MF: CH10Cl2Na2O10P2. IUPAC name ... 22560-50-5; (Dichloromethylene)diphosphonic acid, disodium salt; CLODRONATE DISODIUM .... MW: 288.848. g/mol MF: CH2Cl2Na2O6P2 ... disodium;[dichloro(phosphonato)methyl]phosphonic acid;tetrah.... Create Date: 2015-11-11. ...
Amino acid-based nutritional formulation. July, 2006. Sullivan et al.. 20060251703. Composition comprising an edible acid or ... The unit dosage form of claim 1 or 2 wherein the lubricant comprises an alkaline earth metal salt of a fatty acid. 16. The unit ... The process of claim 26 or 27 wherein the lubricant comprises an alkaline earth metal salt of a fatty acid. 34. The process of ... A lubricant, for example the salt of a fatty acid, more specifically magnesium stearate, can serve as a processing aid in ...
Drug: Clodronic Acid Clodronate disodium (clodronic acid) 800 mg: 2 cp per day, 5d/7 (from monday to friday) ... Clodronic Acid. Phosphodiesterase Inhibitors. Enzyme Inhibitors. Molecular Mechanisms of Pharmacological Action. Platelet ... Drug: Pentoxifylline placebo Drug: Pentoxifylline Drug: Tocopherol acetate Drug: Clodronic Acid Drug: Tocopherol placebo Drug: ... Placebo for clodronate disodium (clodronic acid) 800 mg: 2 cp per day, 5d/7 (from monday to friday) ...
Z)-2,3-Dichloro-4-oxo-but-2-enoic acid.svg 712 × 490; 2 KB. ...
Clodronic Acid / therapeutic use*. Diphosphonates / therapeutic use*. Female. Humans. Hypercalcemia / blood, drug therapy*, ...
Clodronic Acid. The risk or severity of adverse effects can be increased when Aceclofenac is combined with Clodronic Acid.. ... Amino acid or derivatives / Amino acid / Carboxylic acid ester / Carboxylic acid derivative / Secondary amineCarboxylic acid / ... Aniline and substituted anilines / Dicarboxylic acids and derivatives / Aryl chlorides / Carboxylic acid esters / Amino acids ... monocarboxylic acid, carboxylic ester, secondary amino compound, dichlorobenzene, amino acid (CHEBI:31159) Targets. ...
Clodronic Acid. The risk or severity of nephrotoxicity and hypocalcemia can be increased when Ceftaroline fosamil is combined ... Carboxylic acid derivative / Carboxylic acid / Monocarboxylic acid or derivatives / Azacycle / Organic oxide / Organic nitrogen ... Folic Acid. Ceftaroline fosamil may decrease the excretion rate of Folic Acid which could result in a higher serum level.. ... Cephalosporin / N-acyl-alpha amino acid or derivatives / Alpha-amino acid or derivatives / Aryl thioether / 2,4-disubstituted 1 ...
Clodronic Acid. approved, investigational, vet_approved. unknown. inhibitor. Details. DB06195. Seliciclib. investigational. ... Meclofenamic acid. approved, vet_approved. yes. inhibitor. Details. DB00945. Acetylsalicylic acid. approved, vet_approved. yes ... Omega-3 fatty acids. approved, nutraceutical. unknown. substrate. Details. DB13168. Omega-6 fatty acids. nutraceutical. unknown ... Tiaprofenic acid. approved. yes. inhibitor. Details. DB04743. Nimesulide. approved, investigational, withdrawn. yes. inhibitor ...
... and of their salts with pharmaceutically acceptable mineral or organic acids. ... which method comprises the administration of therapeutically effective amounts of bisphosphonic acid derivatives of formula (I ... dichloromethylenebisphosphonic acid, having the international non-proprietary name clodronic acid, and its sodium salts; ... disodium salt of clodronic acid 300 mgsodium hydroxide qsp pH 5water for injectable preparations 5 ml ...
Clodronic Acid (Clodronate)IBA 12/2012 - 02/2011. 2. Epirubicin (Ellence)FDA LinkGeneric 04/2012 - 01/2012. ...
Clodronic acid disodium salt (Cl2MDP; Sigma-Aldrich) was dissolved in deionized water, and the pH was adjusted to 7.3 with 5 N ... WNV infection requires attachment to cell surface receptors, which remain poorly defined, endocytosis, and acid-catalyzed ...
Clodronic Acid. The patient was hospitalized. Blood Potassium Increased, Fall, Renal Failure, Therapeutic Agent Toxicity ...
Drug: Pentoxifylline placebo; Drug: Pentoxifylline; Drug: Tocopherol acetate; Drug: Clodronic Acid; Drug: Tocopherol placebo; ...
Opinion of the CVMP on the establishment of maximum residue limits: Clodronic acid (English only) adopted 2015-09-09 ... Double-stranded ribonucleic acid homologous to viral ribonucleic acid coding for part of the coat protein and part of the ... of beta acids (as potassium salts) (English only) adopted 2016-02-17 ... of beta acids (as potassium salts) (English only) 2016-02-17 ...
Effects of zoledronic acid versus clodronic acid on skeletal morbidity in patients with newly diagnosed multiple myeloma (MRC ... First-line treatment with zoledronic acid as compared with clodronic acid in multiple myeloma (MRC Myeloma IX): a randomised ... Comparison of denosumab (DMB) with zoledronic acid (ZA) for the treatment of bone disease in patients with newly diagnosed ...
Effects of zoledronic acid versus clodronic acid on skeletal morbidity in patients with newly diagnosed multiple myeloma (MRC ... First-line treatment with zoledronic acid as compared with clodronic acid in multiple myeloma (MRC Myeloma IX): a randomised ... Comparison of denosumab (DMB) with zoledronic acid (ZA) for the treatment of bone disease in patients with newly diagnosed ...
Effects of zoledronic acid versus clodronic acid on skeletal morbidity in patients with newly diagnosed multiple myeloma (MRC ... First-line treatment with zoledronic acid as compared with clodronic acid in multiple myeloma (MRC Myeloma IX): a randomised ... Comparison of denosumab (DMB) with zoledronic acid (ZA) for the treatment of bone disease in patients with newly diagnosed ...
... clodronic acid, etidronic acid, ibandronic acid, neridronic acid, pamidronic acid, risedronic acid, tiludronic acid and ... Ibandronic acid Teva, Vantavo and Zometa) can be found on the Agencys website. ... zoledronic acid.. *The review of centrally authorised bisphosphonates was conducted in the context of a formal review under ...
  • Intravenous (IV) zoledronic acid (ZOL) or pamidronate (PAM) is recommended for preventing skeletal-related events in patients with MM. ZOL is preferred over oral clodronate in newly diagnosed patients with MM because of its potential antimyeloma effects and survival benefits. (elsevier.com)
  • The current European public assessment reports (EPARs) for the nine centrally authorised medicines containing bisphosphonates concerned by these referrals (Aclasta, Adrovance, Bondenza, Bondronat, Bonviva, Fosavance, Ibandronic acid Teva, Vantavo and Zometa) can be found on the Agency's website. (drugs.com)
  • 1. A method of promoting bone repair in a mammal which comprises administering to a mammal in need thereof a therapeutically effective amount of disodium salt of tiludronic acid. (google.com)
  • The growth factor is made up of two peptide chains, referred to as A or B chains which share 60% homology in their primary amino acid sequence. (lens.org)
  • PDGF binds with high affinity to the PDGF receptor, a 1106 amino acid 124 kDa transmembrane tyrosine kinase receptor (Heldin, C. H., A. Ostman, and L. Ronnstrand, Biochim Biophys Acta, 1998, 1378(1 ), 79-113). (lens.org)
  • PDGFR is found as homo- or heterodimer chains which have 30% homology overall in their amino acid sequence and 64% homology between their kinase domains (Heldin, C. H., et al. (lens.org)
  • Through COX-2 inhibition, aceclofenac downregulates the production of various inflammatory mediators including prostaglandin E2 (PGE2), IL-1β, and TNF from the arachidonic acid (AA) pathway. (drugbank.ca)
  • This polymorphism has been hypothesized to alter INSIG2 expression leading to inhibition of fatty acid and cholesterol synthesis. (arctichealth.org)
  • We also occasionally showed that esomeprazole appears to exert ppar antagonistic effects in subcutaneous wat, a property be shared by clodronic acid. (ipmsrichmond.org)
  • An Italian study compared the analgesic effect of clodronic acid versus acetaminophen in rheumatic condition related pain. (wikipedia.org)
  • which method comprises the administration of therapeutically effective amounts of bisphosphonic acid derivatives of formula (I): ##STR1## in which: R1 is a hydrogen atom, a halogen atom, a hydroxyl, an. (google.com)
  • The risk or severity of nephrotoxicity can be increased when Acetylsalicylic acid is combined with Ceftaroline fosamil. (drugbank.ca)