Cleavage Stimulation Factor: A RNA-binding protein that stimulates the cleavage of the 3' end of MRNA near the POLYADENYLATION site. It is a heterotrimer of 55-, 64- and 77-kDa subunits and combines with CLEAVAGE STIMULATION FACTOR to form a stable complex with mRNA that directs the 3' cleavage and polyadenylation reaction.mRNA Cleavage and Polyadenylation Factors: Factors that are involved in directing the cleavage and POLYADENYLATION of the of MESSENGER RNA near the site of the RNA 3' POLYADENYLATION SIGNALS.Cleavage And Polyadenylation Specificity Factor: An RNA-binding protein that recognizes the AAUAAA RNA SEQUENCE at the 3' end of MRNA. It contains four subunits of 30, 73, 100 and 160 kDa molecular size and combines with CLEAVAGE STIMULATION FACTOR to form a stable complex with mRNA that directs the 3' cleavage and polyadenylation reaction.Polyadenylation: The addition of a tail of polyadenylic acid (POLY A) to the 3' end of mRNA (RNA, MESSENGER). Polyadenylation involves recognizing the processing site signal, (AAUAAA), and cleaving of the mRNA to create a 3' OH terminal end to which poly A polymerase (POLYNUCLEOTIDE ADENYLYLTRANSFERASE) adds 60-200 adenylate residues. The 3' end processing of some messenger RNAs, such as histone mRNA, is carried out by a different process that does not include the addition of poly A as described here.RNA-Binding Proteins: Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.RNA Precursors: RNA transcripts of the DNA that are in some unfinished stage of post-transcriptional processing (RNA PROCESSING, POST-TRANSCRIPTIONAL) required for function. RNA precursors may undergo several steps of RNA SPLICING during which the phosphodiester bonds at exon-intron boundaries are cleaved and the introns are excised. Consequently a new bond is formed between the ends of the exons. Resulting mature RNAs can then be used; for example, mature mRNA (RNA, MESSENGER) is used as a template for protein production.RNA Processing, Post-Transcriptional: Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Electric Stimulation: Use of electric potential or currents to elicit biological responses.

Cloning and characterization of Arabidopsis homologues of the animal CstF complex that regulates 3' mRNA cleavage and polyadenylation. (1/39)

The 3' cleavage and polyadenylation of mRNAs has been studied in detail in animals and yeast, but not in plants. Aimed at elucidating the regulation of mRNA 3' end formation in plants, three Arabidopsis cDNAs encoding homologues of the animal proteins CstF-64, CstF-77 and CstF-50 that form the cleavage stimulating factor of the polyadenylation machinery have been cloned. It is shown experimentally that the N-terminal domain of the Arabidopsis CstF-64 homologue binds the mRNA 3' non-coding region in an analogous manner to the animal protein. It is also shown that the Arabidopsis CstF-64 and CstF-77 homologues strongly interact with each other in a similar way to their animal counterparts. These results imply that these Arabidopsis homologues belong to the polyadenylation machinery of nuclear mRNAs.  (+info)

Polyadenylation: a tail of two complexes. (2/39)

Recent studies have uncovered new connections between the enzymes of mRNA 3' end processing and RNA polymerase II. These connections improve the efficiency of polyadenylation and signal to the polymerase to terminate transcription; their discovery reveals another level of gene regulation.  (+info)

An evolutionarily conserved role for SRm160 in 3'-end processing that functions independently of exon junction complex formation. (3/39)

SRm160 (the SR-related nuclear matrix protein of 160 kDa) functions as a splicing coactivator and 3'-end cleavage-stimulatory factor. It is also a component of the splicing-dependent exon-junction complex (EJC), which has been implicated in coupling of pre-mRNA splicing with mRNA turnover and mRNA export. We have investigated whether the association of SRm160 with the EJC is important for efficient 3'-end cleavage. The EJC components RNPS1, REF, UAP56, and Y14 interact with SRm160. However, when these factors were tethered to transcripts, only SRm160 and RNPS1 stimulated 3'-end cleavage. Whereas SRm160 stimulated cleavage to a similar extent in the presence or absence of an active intron, stimulation of 3'-end cleavage by tethered RNPS1 is dependent on an active intron. Assembly of an EJC adjacent to the cleavage and polyadenylation signal in vitro did not significantly affect cleavage efficiency. These results suggest that SRm160 stimulates cleavage independently of its association with EJC components and that the cleavage-stimulatory activity of RNPS1 may be an indirect consequence of its ability to stimulate splicing. Using RNA interference (RNAi) in Caenorhabditis elegans, we determined whether interactions between SRm160 and the cleavage machinery are important in a whole organism context. Simultaneous RNAi of SRm160 and the cleavage factor CstF-50 (Cleavage stimulation factor 50-kDa subunit) resulted in late embryonic developmental arrest. In contrast, RNAi of CstF-50 in combination with RNPS1 or REFs did not result in an apparent phenotype. Our combined results provide evidence for an evolutionarily conserved interaction between SRm160 and the 3'-end cleavage machinery that functions independently of EJC formation.  (+info)

Developmental distribution of the polyadenylation protein CstF-64 and the variant tauCstF-64 in mouse and rat testis. (4/39)

Messenger RNA polyadenylation is one of the processes that control gene expression in all eukaryotic cells and tissues. In mice, two forms of the regulatory polyadenylation protein CstF-64 are found. The gene Cstf2 on the X chromosome encodes this form, and it is expressed in all somatic tissues. The second form, tauCstF-64 (encoded by the autosomal gene Cstf2t), is expressed in a more limited set of tissues and cell types, largely in meiotic and postmeiotic male germ cells and, to a smaller extent, in brain. We report here that whereas CstF-64 and tauCstF-64 expression in rat tissues resembles their expression in mouse tissues, significant differences also are found. First, unlike in mice, in which CstF-64 was expressed in postmeiotic round and elongating spermatids, rat CstF-64 was absent in those cell types. Second, unlike in mice, tauCstF-64 was expressed at significant levels in rat liver. These differences in expression suggest interesting differences in X-chromosomal gene expression between these two rodent species.  (+info)

U1A inhibits cleavage at the immunoglobulin M heavy-chain secretory poly(A) site by binding between the two downstream GU-rich regions. (5/39)

The immunoglobulin M heavy-chain locus contains two poly(A) sites which are alternatively expressed during B-cell differentiation. Despite its promoter proximal location, the secretory poly(A) site is not expressed in undifferentiated cells. Crucial to the activation of the secretory poly(A) site during B-cell differentiation are changes in the binding of cleavage stimulatory factor 64K to GU-rich elements downstream of the poly(A) site. What regulates this change is not understood. The secretory poly(A) site contains two downstream GU-rich regions separated by a 29-nucleotide sequence. Both GU-rich regions are necessary for binding of the specific cleavage-polyadenylation complex. We demonstrate here that U1A binds two (AUGCN(1-3)C) motifs within the 29-nucleotide sequence and inhibits the binding of cleavage stimulatory factor 64K and cleavage at the secretory poly(A) site.  (+info)

Elevated levels of the 64-kDa cleavage stimulatory factor (CstF-64) in lipopolysaccharide-stimulated macrophages influence gene expression and induce alternative poly(A) site selection. (6/39)

Lipopolysaccharide (LPS) activation of murine RAW 264.7 macrophages influences the expression of multiple genes through transcriptional and post-transcriptional mechanisms. We observed a 5-fold increase in CstF-64 expression following LPS treatment of RAW macrophages. The increase in CstF-64 protein was specific in that several other factors involved in 3'-end processing were not affected by LPS stimulation. Activation of RAW macrophages with LPS caused an increase in proximal poly(A) site selection within a reporter mini-gene containing two linked poly(A) sites that occurred concomitant with the increase in CstF-64 expression. Furthermore, forced overexpression of the CstF-64 protein also induced alternative poly(A) site selection on the reporter minigene. Microarray analysis performed on CstF-64 overexpressing RAW macrophages revealed that elevated levels of CstF-64 altered the expression of 51 genes, 14 of which showed similar changes in gene expression with LPS stimulation. Sequence analysis of the 3'-untranslated regions of these 51 genes revealed that over 45% possess multiple putative poly(A) sites. Two of these 51 genes demonstrated alternative polyadenylation under both LPS-stimulating and CstF-64-overexpressing conditions. We concluded that the physiologically increased levels of CstF-64 observed in LPS-stimulated RAW macrophages contribute to the changes in expression and alternative polyadenylation of a number of genes, thus identifying another level of gene regulation that occurs in macrophages activated with LPS.  (+info)

Symplekin and multiple other polyadenylation factors participate in 3'-end maturation of histone mRNAs. (7/39)

Most metazoan messenger RNAs encoding histones are cleaved, but not polyadenylated at their 3' ends. Processing in mammalian cell extracts requires the U7 small nuclear ribonucleoprotein (U7 snRNP) and an unidentified heat-labile factor (HLF). We describe the identification of a heat-sensitive protein complex whose integrity is required for histone pre-mRNA cleavage. It includes all five subunits of the cleavage and polyadenylation specificity factor (CPSF), two subunits of the cleavage stimulation factor (CstF), and symplekin. Reconstitution experiments reveal that symplekin, previously shown to be necessary for cytoplasmic poly(A) tail elongation and translational activation of mRNAs during Xenopus oocyte maturation, is the essential heat-labile component. Thus, a common molecular machinery contributes to the nuclear maturation of mRNAs both lacking and possessing poly(A), as well as to cytoplasmic poly(A) tail elongation.  (+info)

Drosophila Sex-lethal protein mediates polyadenylation switching in the female germline. (8/39)

The Drosophila master sex-switch protein Sex-lethal (SXL) regulates the splicing and/or translation of three known targets to mediate somatic sexual differentiation. Genetic studies suggest that additional target(s) of SXL exist, particularly in the female germline. Surprisingly, our detailed molecular characterization of a new potential target of SXL, enhancer of rudimentary (e(r)), reveals that SXL regulates e(r) by a novel mechanism--polyadenylation switching--specifically in the female germline. SXL binds to multiple SXL-binding sites, which include the GU-rich poly(A) enhancer, and competes for the binding of CstF64 in vitro. The SXL-binding sites are able to confer sex-specific poly(A) switching onto an otherwise nonresponsive polyadenylation signal in vivo. The sex-specific poly(A) switching of e(r) provides a means for translational regulation in germ cells. We present a model for the SXL-dependent poly(A) site choice in the female germline.  (+info)

*CSTF1

Cleavage stimulation factor 50 kDa subunit is a protein that in humans is encoded by the CSTF1 gene. This gene encodes one of ... "Entrez Gene: CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa". Kleiman, F E; Manley J L (Sep 1999). "Functional ... three subunits which combine to form cleavage stimulation factor (CSTF). CSTF is involved in the polyadenylation and 3'end ... Rüegsegger U, Beyer K, Keller W (1996). "Purification and characterization of human cleavage factor Im involved in the 3' end ...

*CSTF2

The protein is a member of the cleavage stimulation factor (CSTF) complex that is involved in the 3' end cleavage and ... Cleavage stimulation factor 64 kDa subunit is a protein that in humans is encoded by the CSTF2 gene. This gene encodes a ... "Entrez Gene: CSTF2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa". Takagaki, Y; Manley J L (March 2000). "Complex ... 2002). "Association of human DEAD box protein DDX1 with a cleavage stimulation factor involved in 3'-end processing of pre-MRNA ...

*CSTF3

... cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in ... Cleavage stimulation factor 77 kDa subunit is a protein that in humans is encoded by the CSTF3 gene. The protein encoded by ... "Entrez Gene: CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa". Takagaki, Y; Manley J L (March 2000). "Complex ... Murthy KG, Manley JL (1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'- ...

*CSTF2T

Cleavage stimulation factor 64 kDa subunit, tau variant is a protein that in humans is encoded by the CSTF2T gene. GRCh38: ... "Entrez Gene: CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant". Human CSTF2T genome location and ...

*DDX1

2002). "Association of human DEAD box protein DDX1 with a cleavage stimulation factor involved in 3'-end processing of pre-MRNA ... 2005). "A DEAD box protein facilitates HIV-1 replication as a cellular co-factor of Rev". Virology. 330 (2): 471-480. doi: ...

*HNRPF

2001). "hnRNP F influences binding of a 64-kilodalton subunit of cleavage stimulation factor to mRNA precursors in mouse B ... Honoré B, Vorum H, Baandrup U (1999). "hnRNPs H, H' and F behave differently with respect to posttranslational cleavage and ...

*Terminator (genetics)

... the proteins cleavage and polyadenylation specificity factor (CPSF) and cleavage stimulation factor (CstF) transfer from the ... These two factors then recruit other proteins to the site to cleave the transcript, freeing the mRNA from the transcription ... After this cleavage, a so-called exonuclease binds to the residual RNA strand and removes the freshly transcribed nucleotides ... In eukaryotic transcription of mRNAs, terminator signals are recognized by protein factors that are associated with the RNA ...

*Post-transcriptional modification

... two multisubunit proteins called cleavage and polyadenylation specificity factor (CPSF) and cleavage stimulation factor (CStF) ... The two factors bind to the sequence elements. A protein complex forms and contains additional cleavage factors and the enzyme ... Cleavage and polyadenylation specificity factor 73 cuts mRNA between stem-loop and HDE Histone variants, such as H2A.Z or H3.3 ... processing is done independent of most cleavage and polyadenylation factors. Core histone mRNAs have a special stem-loop ...

*Cleavage stimulation factor

Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins ... Cleavage stimulation factor at the US National Library of Medicine Medical Subject Headings (MeSH). ... CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3' end ... "Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor during the G0 to S phase transition". ...

*Partial cleavage stimulation factor domain

The partial cleavage stimulation factor domain, or partial CstF domain, is a protein domain that occurs in proteins from ... However, it is homologous to the amino-terminal part of the cleavage stimulation factor, which is thought to be involved with ...

*Eukaryotic transcription

... cleavage and polyadenylation specificity factor) and CSTF (cleavage stimulation factor), recognize the poly-A signal in the ... General transcription factors are a group of proteins involved in transcription initiation and regulation. These factors ... There are different classes of elongation factors. Some factors can increase the overall rate of transcribing, some can help ... After escaping the promoter and shedding most of the transcription factors for initiation, the polymerase acquires new factors ...

*CPSF1

... namely cleavage and polyadenylation specificity factor (CPSF), cleavage stimulation factor (CstF), cleavage factors Im and IIm ... 2000). "Human pre-mRNA cleavage factor IIm contains homologs of yeast proteins and bridges two other cleavage factors". EMBO J ... Cleavage and polyadenylation specificity factor subunit 1 is a protein that in humans is encoded by the CPSF1 gene. In most ... "Entrez Gene: CPSF1 cleavage and polyadenylation specific factor 1, 160kDa". Yang Q, Doublié S (2011). "Structural biology of ...

*AXL receptor tyrosine kinase

It is involved in the stimulation of cell proliferation and survival. Proteolytic cleavage of the AXL extracellular domain by ... The AXL receptor transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K- ... Studies have shown that AXL knockdown leads to downregulation of transcription factors required for EMT, including Slug, Twist ... is post-translationally regulated by proteolytic cleavage". The Journal of Biological Chemistry. 270 (2): 551-7. doi:10.1074/ ...

*List of MeSH codes (D12.776)

... cleavage and polyadenylation specificity factor MeSH D12.776.664.962.444.249 - cleavage stimulation factor MeSH D12.776.664.962 ... vascular endothelial growth factor a MeSH D12.776.467.100.800.300 - vascular endothelial growth factor b MeSH D12.776.467.100. ... fibroblast growth factor 4 MeSH D12.776.624.664.700.112 - fibroblast growth factor 6 MeSH D12.776.624.664.700.114 - fms-like ... peptide elongation factor g MeSH D12.776.835.700.350.700 - peptide elongation factor tu MeSH D12.776.835.700.350.800 - peptide ...

*GLD-2

Likewise, it interacts with cytoplasmic polyadenylation factors, including Cleavage and polyadenylation specificity factor and ... In mammals, dendrite mRNAs are kept in a repressed state and are activated upon repetitive stimulation. Several regulatory ... that's why it can be used as a prognostic factor for early appearance in breast cancer patients. Moreover, PAP activity is used ...

*Interleukin

T-cell replacing factor III, B-cell activating factor, B-cell differentiation factor, and "Heidikine") and interleukin 2 (TSF, ... The protein is secreted as a single glycosylated polypeptide, and cleavage of a signal sequence is required for its activity. ... IL3 is produced by T lymphocytes and T-cell lymphomas only after stimulation with antigens, mitogens, or chemical activators ... These include granulocyte colony-stimulating factor (GCSF) and myelomonocytic growth factor (MGF). GCSF acts in hematopoiesis ...

*RELA

After NF-κB nuclear localization due to TNFα stimulation, p50/RELA heterodimer will function as a transcription factor and bind ... In parallel, there is a non-classical NF-κB activation pathway involving the proteolytic cleavage of p100 into p52 instead of ... Transcription factor p65 also known as nuclear factor NF-kappa-B p65 subunit is a protein that in humans is encoded by the RELA ... nuclear factor-kappaB, and serum response factor". The Journal of Biological Chemistry. 275 (17): 12470-4. doi:10.1074/jbc. ...

*Eukaryotic translation initiation factor 4 gamma 1

"Mapping the cleavage site in protein synthesis initiation factor eIF-4 gamma of the 2A proteases from human Coxsackievirus and ... Harris TE, Chi A, Shabanowitz J, Hunt DF, Rhoads RE, Lawrence JC (Apr 2006). "mTOR-dependent stimulation of the association of ... "The translation initiation factor eIF-4E binds to a common motif shared by the translation factor eIF-4 gamma and the ... "The translation initiation factor eIF-4E binds to a common motif shared by the translation factor eIF-4 gamma and the ...

*Heparin-binding EGF-like growth factor

"Heparin-binding epidermal growth factor-like growth factor: hypoxia-inducible expression in vitro and stimulation of ... "Dual intracellular signaling by proteolytic cleavage of membrane-anchored heparin-binding EGF-like growth factor". Cytokine ... 1992). "Tumor necrosis factor increases transcription of the heparin-binding epidermal growth factor-like growth factor gene in ... 1994). "Heparin-binding epidermal growth factor-like growth factor is an autocrine growth factor for human keratinocytes". J. ...

*RHOA

... conducted simultaneously via guanine nucleotide exchange factors and GTPase activating factor). RhoA is activated primarily by ... Similarly, RhoA's stimulation of PKN2 kinase activity regulates cell-cell adhesion through apical junction formation and ... RhoA-dependent diaphanous-related formins (DRFs) localize to the cleavage furrow during cytokinesis while stimulating local ... Transforming growth factor (TGF)-mediated pathways that control tumor progression and identity are also frequently noted to be ...

*List of MeSH codes (D12.776.157)

... cleavage stimulation factor MeSH D12.776.157.725.124.500 -- cleavage and polyadenylation specificity factor MeSH D12.776. ... adp-ribosylation factors MeSH D12.776.157.325.515.100.100 -- adp-ribosylation factor 1 MeSH D12.776.157.325.515.400 -- rab gtp- ... tnf receptor-associated factor 1 MeSH D12.776.157.057.500.750 -- tnf receptor-associated factor 2 MeSH D12.776.157.057.500.875 ... tnf receptor-associated factor 3 MeSH D12.776.157.057.500.937 -- tnf receptor-associated factor 5 MeSH D12.776.157.057.500.968 ...

*Robert Almer Harper

1912 Cleavage in Didymium mclanospermum, 1914 Physical factors in cleavage of coenocytes, 1914 Starchy and sugary foods, 1914 ... 1920 The Stimulation of Research after the War, 1920 The species concept from the point of view of a morphologist, 1923 ... 1905 Sex-determining factors in plants, 1907 The Organization of Certain Coenobic Plants, 1908 Nuclear phenomena of sexual ...

*Tumor necrosis factor superfamily

Cseh K, Beutler B (September 1989). "Alternative cleavage of the cachectin/tumor necrosis factor propeptide results in a larger ... 4-1BBL, an inducible T cell surface molecule that contributes to T-cell stimulation. OX40L, a cell surface protein that co- ... Tumor Necrosis Factors at the US National Library of Medicine Medical Subject Headings (MeSH) pex1 tumor necrosis factor gene. ... The tumor necrosis factor (TNF) superfamily refers to a superfamily of cytokines that can cause cell death (apoptosis). The ...

*CXCL7

Biologically active cleavage products of CTAP-III from human platelets". Biochem. Biophys. Res. Commun. 163 (2): 1071-8. doi: ... Comparison with the gene for platelet factor 4". J Biol Chem. 266 (9): 5785-9. PMID 1826003. Castor C, Miller J, Walz D (1983 ... Castor C, Furlong A, Carter-Su C (1985). "Connective tissue activation: stimulation of glucose transport by connective tissue ... Tunnacliffe A, Majumdar S, Yan B, Poncz M (1992). "Genes for beta-thromboglobulin and platelet factor 4 are closely linked and ...

*CXCL7

Biologically active cleavage products of CTAP-III from human platelets.". Biochem. Biophys. Res. Commun. 163 (2): 1071-8. PMID ... Comparison with the gene for platelet factor 4". J Biol Chem 266 (9): 5785-9. PMID 1826003. ... Castor C, Furlong A, Carter-Su C (1985). "Connective tissue activation: stimulation of glucose transport by connective tissue ... Comparison with the gene for platelet factor 4.". J. Biol. Chem. 266 (9): 5785-9. PMID 1826003. ...

*Terminal deoxynucleotidyl transferase

Zhang Y, Shi M, Wen Q, Luo W, Yang Z, Zhou M, Ma L (2012-01-01). "Antigenic stimulation induces recombination activating gene 1 ... the cleaved double stranded DNA is left with hairpin structures at the end of each DNA segment created by the cleavage event. ... with regulation influenced by stage-specific factors, and occurs in a developmentally restrictive manner. Although expression ... is typically found to be in the primary lymphoid organs, recent work has suggested that stimulation via antigen can result in ...

*Hypothalamic-pituitary-adrenal axis

Epinephrine and norepinephrine (E/NE) are produced by the adrenal medulla through sympathetic stimulation and the local effects ... This reduces the secretion of CRH and vasopressin, and also directly reduces the cleavage of proopiomelanocortin (POMC) into ... It comprises corticotropin-releasing factor (CRF), released by the hypothalamus; adrenocorticotropic hormone (ACTH), released ... the adrenal cortex, which produces glucocorticoid hormones (mainly cortisol in humans) in response to stimulation by ACTH. ...

*Blastula

The origin of the blastocoele in Xenopus has been shown to be from the first cleavage furrow, which is widened and sealed with ... In the mice, ninety percent of the females were induced by mechanical stimulation to undergo pregnancy and implant at least one ... By transplanting them to the eye field on the neural plate, and by inducing several mis-expressions of transcription factors, ... Prior to this transition, cleavage occurs with only the synthesis and mitosis phases of the cell cycle. The addition of the two ...
Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins CSTF1 (55kDa), CSTF2 (64kDa) and CSTF3 (77kDa), totalling about 200 kDa. It is involved in the cleavage of the 3 signaling region from a newly synthesized pre-messenger RNA (mRNA) molecule. CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3 end to promote the synthesis of a functional polyadenine tail, which results in a mature mRNA molecule ready to be exported from the cell nucleus to the cytosol for translation. The amount of CstF in a cell is dependent on the phase of the cell cycle, increasing significantly during the transition from G0 phase to S phase in mouse fibroblast and human splenic B cells. CSTF1, CSTF2, CSTF3 Martincic, K.; Campbell, R.; Edwalds-Gilbert, G.; Souan, L.; Lotze, M. T.; Milcarek, C. (1998). "Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor ...
Gentaur molecular products has all kinds of products like :search , GenWay \ Cleavage stimulation factor 50 kDa subunit - CSTF 50 kDa subunit; CF-1 50 kDa subunit; CstF-50 \ 10-288-22329F for more molecular products just contact us
Cstf3 - Cstf3 (GFP-tagged) - Mouse cleavage stimulation factor 3 pre-RNA subunit 3 (Cstf3) transcript variant 2, (10ug) available for purchase from OriGene - Your Gene Company.
Cstf2 - Lenti ORF clone of Cstf2 (mGFP-tagged) - Mouse cleavage stimulation factor, 3 pre-RNA subunit 2 (cDNA clone MGC:36412 IMAGE:5322335) available for purchase from OriGene - Your Gene Company.
Exogenous human granulocyte-colony stimulation factor (huG-CSF) restores autoantibody (autoAb) production in B6.Sle2c2 mice after induction of chronic graft vs
Human CSTF2 full-length ORF ( AAH17712, 1 a.a. - 577 a.a.) recombinant protein with GST-tag at N-terminal. (H00001478-P01) - Products - Abnova
Besides the splice site itself, only two sequences on the pre-mRNA play an important role in SL2-specific trans-splicing: the two presumptive signals for 3 end formation of the gene just upstream (Figure 2; Huang et al., 2001; Kuersten et al., 1997; Liu et al., 2001; Liu et al., 2003). The AAUAAA just 5 of the cleavage site, which is absolutely required for 3 end formation, binds the cleavage and polyadenylation specificity factor (CPSF), and a U-rich sequence just 3 of the cleavage site binds the cleavage stimulatory factor (CstF). CPSF and CstF bind cooperatively to these two sites and together position the site of cleavage. When the AAUAAA is mutated, 3 end cleavage fails to occur, and trans-splicing just downstream becomes less efficient and less specific for SL2. Nevertheless, AAUAAA is not required for SL2 trans-splicing since SL2 trans-splicing downstream still occurs in its absence. CPSF bound to AAUAAA may act by facilitating binding of CstF to the U-rich sequence or by catalyzing ...
Spermatogenesis is coordinated by the spatial and temporal expression of many transcriptional and posttranscriptional factors. The cyclic AMP-responsive element modulator (CREM) gene encodes both activator and repressor isoforms that act as transcription factors to regulate spermiogenesis. We found that the testis-expressed paralog of CstF-64, tauCstF-64 (gene symbol Cstf2t), is involved in a polyadenylation site choice switch of Crem mRNA and leads to an overall decrease of the Crem mRNAs that are generated from internal promoters in Cstf2t(-/-) mice. More surprisingly, loss of tauCstF-64 also leads to alternative splicing of Crem exon 4, which contains an important activation domain. Thus, testis-specific CREMtau2 isoform protein levels are reduced in Cstf2t(-/-) mice. Consequently, expression of 15 CREM-regulated genes is decreased in testes of Cstf2t(-/-) mice at 25 days postpartum. These effects might further contribute to the infertility phenotype of these animals. This demonstrates that tauCstF
Differential neutrophil mobilization in response to human granulocyte-colony stimulation factor (huG-CSF) in B6 and B6.Sle2c2 mice. Percentage of Ly6G+ CD11b+ n
Perform reliable qPCR with Bio-Rads pre-validated CSTF3 primer pair, for the Dog genome. Designed for SYBR Green-based detection.
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
HsCD00001919 ATGGCGGGTTTGACTGTGAGAGACCCAGCGGTGGATCGTTCTCTACGTTCTGTGTTCGTG NM_001325.2 ATGGCGGGTTTGACTGTGAGAGACCCAGCGGTGGATCGTTCTCTACGTTCTGTGTTCGTG ************************************************************ HsCD00001919 GGGAACATTCCTTATGAAGCTACTGAAGAGCAGTTGAAGGACATCTTTTCTGAGGTTGGA NM_001325.2 GGGAACATTCCTTATGAAGCTACTGAAGAGCAGTTGAAGGACATCTTTTCTGAGGTTGGA ************************************************************ HsCD00001919 CCTGTTGTTAGTTTCAGATTGGTATACGATAGAGAGACAGGAAAGCCAAAGGGTTATGGC NM_001325.2 CCTGTTGTTAGTTTCAGATTGGTATACGATAGAGAGACAGGAAAGCCAAAGGGTTATGGC ************************************************************ HsCD00001919 TTCTGTGAATACCAAGACCAAGAGACAGCACTTAGTGCCATGCGGAACCTGAATGGGCGC NM_001325.2 TTCTGTGAATACCAAGACCAAGAGACAGCACTTAGTGCCATGCGGAACCTGAATGGGCGC ************************************************************ HsCD00001919 GAATTCAGTGGGAGAGCACTTCGAGTGGACAATGCTGCCAGTGAAAAGAACAAAGAAGAG NM_001325.2 GAATTCAGTGGGAGAGCACTTCGAGTGGACAATGCTGCCAGTGAAAAGAACAAAGAAGAG ...
Dysfunction home remedies for ed to being theImpotence as score prostate stimulation factors, therapeutic about and to! Of, release and system threatening at as
CPSF2兔多克隆抗体(ab100807)可与小鼠, 人样本反应并经IHC实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
CPSF30小鼠单克隆抗体[2202C1](ab51343)可与人样本反应并经WB, Dot实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
mRNA cleavage and polyadenylation specificity factor complex, 5-3 exonuclease activity, endoribonuclease activity, RNA binding, mRNA 3-end processing by stem-loop binding and cleavage, mRNA cleavage, mRNA polyadenylation
Dental Traumatology 2003; 19: 175±182 Copyright # Blackwell Munksgaard 2003 Printed in Denmark. All rights reserved DENTAL TRAUMATOLOGY ISSN 1600±4469 Root resorption ^ diagnosis, classification and treatment
Neutrophils are one of the most important innate defence mechanisms against bacteria. They rapidly migrate to sites of colonisation and infection, where antimicrobial mechanisms (degranulation with release of antimicrobial proteins and release of neutrophil extracellular traps) and phagocytosis can then take place.2,3 Toxic granulation and cytoplasmic vacuolation are morphological changes that occur in the circumstances of bacterial infection, with other causes of inflammation or after administration of granulocyte colony stimulation factor. Predicting bacterial infections based on these morphological changes has been described in the past.4 The prognostic value of these findings is unclear. One study reports lower mortality in septic patients when neutrophils show higher phagocytic activity.5 However, excessive neutrophil migration to sites of inflammation can result in detrimental damage to surrounding tissues. To reduce this damage, the duration of neutrophil recruitment and toxic changes is ...
Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016 ...
In this study, we provide genome-wide, high-resolution polyadenylation maps of the human heart and show that in subsets of genes, 3′end formation of mRNA changes in failing hearts. For the vast majority of genes, the importance of APA remains unknown, but this work and that of others,8 indicate that APA shifts toward a proximal CS, resulting in shorter 3′UTRs, may contribute to an increased expression. Along the same lines, an APA shift toward a distal CS contributes to downregulation of the mRNA. We did not find global shifts in 3′UTR length in failing hearts, but identified groups of genes where the 3′UTR ratio changed. Genes displaying 3′UTR shortening were mostly enriched for categories related to RNA binding, whereas the genes that displayed 3′UTR lengthening were found in categories of actin binding and structural constituent of cytoskeleton. Strikingly, we did not find APA shifts in genes important for contractile functions, suggesting that APA does not play an important role ...
Complete information for CPSF4 gene (Protein Coding), Cleavage And Polyadenylation Specific Factor 4, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010 ...
Reaktivität: Fledermaus, Huhn, Rind (Kuh) and more. 67 verschiedene CPSF4 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
Abnova Human CPSF3 Partial ORF (NP_057291, 585 a.a. - 684 a.a.) Recombinant Protein with GST-tag at N-terminal 25µg Life Sciences:Protein Biology:Proteins:Proteins A-Z:Proteins
We have isolated the human homolog of S. cerevisiae Fip1p and have found that hFip1 is a genuine subunit of CPSF. Our results reported here indicate that hFip1 contributes to poly(A) site recognition and to CPSF‐dependent stimulation of polyadenylation. hFip1 binds to U‐rich sequence elements on the pre‐mRNA and is able to stimulate the activity of PAP.. CPSF has originally been described as a tetrameric complex containing the subunits CPSF160, CPSF100, CPSF73 and CPSF30, based on their stoichiometric cofractionation with CPSF activity. These polypeptides are related to four subunits of the yeast polyadenylation factor CPF (Yhh1p, Ydh1p, Ysh1p and Yth1p). However, CPF contains additional subunits (Preker et al, 1997; Dichtl et al, 2002a; Gavin et al, 2002; Walsh et al, 2002), one of which is Fip1p. Based on sequence conservation, we have identified the human homolog of yeast Fip1p and have shown that hFip1 is an additional, so far unrecognized subunit of CPSF. Most likely, hFip1 has not ...
CPSF3 Antibody 11609-1-AP has been identified with ELISA, IP, WB. 11609-1-AP detected 77 kDa band in HEK-293 cells with 1:500-1:2000 dilution...

Cleavage stimulation factor - WikipediaCleavage stimulation factor - Wikipedia

Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins ... Cleavage stimulation factor at the US National Library of Medicine Medical Subject Headings (MeSH). ... CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3 end ... "Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor during the G0 to S phase transition". ...
more infohttps://en.wikipedia.org/wiki/Cleavage_stimulation_factor

Gentaur Molecular :GenWay \ Cleavage stimulation factor 50 kDa subunit - CSTF 50 kDa subunit; CF-1 50 kDa subunit; CstF-50  \...Gentaur Molecular :GenWay \ Cleavage stimulation factor 50 kDa subunit - CSTF 50 kDa subunit; CF-1 50 kDa subunit; CstF-50 \...

Cleavage stimulation factor 50 kDa subunit - CSTF 50 kDa subunit; CF-1 50 kDa subunit; CstF-50 \ 10-288-22329F for more ... CSTF2] Cleavage stimulation factor subunit 2 (CF-1 64 kDa subunit) (Cleavage stimulation factor 64 kDa subunit) (CSTF 64 kDa ... CPSF6 CFIM68] Cleavage and polyadenylation specificity factor subunit 6 (Cleavage and polyadenylation specificity factor 68 kDa ... CPSF7] Cleavage and polyadenylation specificity factor subunit 7 (Cleavage and polyadenylation specificity factor 59 kDa ...
more infohttp://www.antibody-antibodies.com/product_det.php?id=1881115&supplier=search&name=Cleavage%20stimulation%20factor%2050%20kDa%20subunit%20_%20CSTF%2050%20kDa%20subunit%3B%20CF_1%2050%20kDa%20subunit%3B%20CstF_50%20

OriGene - Cstf2 (BC036719) Human ORF cDNA CloneOriGene - Cstf2 (BC036719) Human ORF cDNA Clone

Mouse cleavage stimulation factor, 3 pre-RNA subunit 2 (cDNA clone MGC:36412 IMAGE:5322335) available for purchase from ... CSTF2 (untagged)-Human cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa (CSTF2). $190. Next day. ... Lenti ORF clone of Human cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa (CSTF2) , Myc-DDK-tagged. $740. 3 weeks. ... Lenti ORF clone of Human cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa (CSTF2) , Myc-DDK-tagged. $740. 4 weeks. ...
more infohttp://www.origene.com/Mouse_ORF/MR208204L2.aspx

OriGene - Cstf3 (NM 177253) Human ORF cDNA CloneOriGene - Cstf3 (NM 177253) Human ORF cDNA Clone

Mouse cleavage stimulation factor 3 pre-RNA subunit 3 (Cstf3) transcript variant 2, (10ug) available for purchase from OriGene ... CSTF3 (untagged)-Human cleavage stimulation factor, 3 pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 2. $390. 3 weeks. ... CSTF3 (untagged)-Human cleavage stimulation factor, 3 pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 3. $390. 2 weeks. ... CSTF3 (untagged)-Human cleavage stimulation factor, 3 pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 1. $700. Next day ...
more infohttp://www.origene.com/Mouse_ORF/MG220126.aspx

Calmodulin Interacts with and Regulates the RNA-Binding Activity of an Arabidopsis Polyadenylation Factor Subunit | Plant...Calmodulin Interacts with and Regulates the RNA-Binding Activity of an Arabidopsis Polyadenylation Factor Subunit | Plant...

Two distinct forms of the 64,000 Mr protein of the cleavage stimulation factor are expressed in mouse male germ cells. Proc ... hnRNP F influences binding of a 64-kilodalton subunit of cleavage stimulation factor to mRNA precursors in mouse B cells. Mol ... Functional dissection of the zinc finger and flanking domains of the Yth1 cleavage/polyadenylation factor. Nucleic Acids Res 31 ... gene that encodes the probable ortholog of the 30-kD subunit of the mammalian cleavage and polyadenylation specificity factor ( ...
more infohttp://www.plantphysiol.org/content/140/4/1507.full

Human Fip1 is a subunit of CPSF that binds to U‐rich RNA elements and stimulates poly(A) polymerase | The EMBO JournalHuman Fip1 is a subunit of CPSF that binds to U‐rich RNA elements and stimulates poly(A) polymerase | The EMBO Journal

... cleavage and polyadenylation specificity factor (CPSF), cleavage stimulation factor (CstF), cleavage factors I and II (CF I, CF ... Bienroth S, Wahle E, Suter‐Crazzolara C, Keller W (1991) Purification of the cleavage and polyadenylation factor involved in ... Keller W, Bienroth S, Lang KM, Christofori G (1991) Cleavage and polyadenylation factor CPF specifically interacts with the pre ... Rüegsegger U, Beyer K, Keller W (1996) Purification and characterization of human cleavage factor Im involved in the 3′ end ...
more infohttp://emboj.embopress.org/content/23/3/616

POLYADENYLATION. Post-transcriptional Processes II: Pre-mRNA Polyadenylation Most cytoplasmic mRNAs have a polyA tail (3 end)...POLYADENYLATION. Post-transcriptional Processes II: Pre-mRNA Polyadenylation Most cytoplasmic mRNAs have a polyA tail (3' end)...

... cleavage stimulation factor) binds to the G/U rich region cooperatively with CPSF 3.CFI and CFII (cleavage factors I and II), ... The cleavage factors are released, as is the downstream RNA cleavage product, which is rapidly degraded. Bound PAP then adds ≈ ... 10 Model for cleavage and polyadenylation of pre- mRNAs in mammalian cells. Cleavage-and-polyadenylation specificity factor ( ... Proteins required for efficient cleavage of pre-mRNA: 1.CPSF (cleavage and polyadenylation specificity factor), binds the ...
more infohttp://slideplayer.com/slide/4342993/

Analysis of CPEB Family Protein Member CPEB4 Function in Mammalian Neu by Ming-Chung Kan"Analysis of CPEB Family Protein Member CPEB4 Function in Mammalian Neu" by Ming-Chung Kan

Over-stimulation of neuron by glutamate induces the nuclear accumulation of CPEB family proteins possibly through disrupted ... The subcellular localization of CPEB family proteins during glutamate over stimulation is also studied. The CPEB family ... mRNA Cleavage and Polyadenylation Factors; Gene Expression Regulation; Academic Dissertations; Dissertations, UMMS ... Over-stimulation of neuron by glutamate induces the nuclear accumulation of CPEB family proteins possibly through disrupted ...
more infohttps://escholarship.umassmed.edu/gsbs_diss/362/

CSTF1 cleavage stimulation factor subunit 1 [Homo sapiens (human)] - Gene - NCBICSTF1 cleavage stimulation factor subunit 1 [Homo sapiens (human)] - Gene - NCBI

cleavage stimulation factor 50 kDa subunit. cleavage stimulation factor, 3 pre-RNA, subunit 1, 50kD. cleavage stimulation ... CSTF1 cleavage stimulation factor subunit 1 [Homo sapiens] CSTF1 cleavage stimulation factor subunit 1 [Homo sapiens]. Gene ID: ... Cleavage stimulation factor subunit 1, dimerisation domain. * NM_001033522.2 → NP_001028694.1 cleavage stimulation factor ... CSTF1_dimer; Cleavage stimulation factor subunit 1, dimerisation domain. * NM_001324.3 → NP_001315.1 cleavage stimulation ...
more infohttps://www.ncbi.nlm.nih.gov/gene/1477

Partial cleavage stimulation factor domain - WikipediaPartial cleavage stimulation factor domain - Wikipedia

The partial cleavage stimulation factor domain, or partial CstF domain, is a protein domain that occurs in proteins from ... However, it is homologous to the amino-terminal part of the cleavage stimulation factor, which is thought to be involved with ...
more infohttps://en.wikipedia.org/wiki/Partial_cleavage_stimulation_factor_domain

Cleavage stimulation factor 2 RNAi: Novus BiologicalsCleavage stimulation factor 2 RNAi: Novus Biologicals

Browse our Cleavage stimulation factor 2 RNAi catalog backed by our Guarantee+. ... Cleavage stimulation factor 2 RNAi available through Novus Biologicals. ... Cleavage stimulation factor 64 kDa subunit RNAi, cleavage stimulation factor subunit 2 RNAi, cleavage stimulation factor, 3 ... Cleavage stimulation factor 2 RNAi. We offer Cleavage stimulation factor 2 RNAi for use in common research applications. Each ...
more infohttps://www.novusbio.com/rnai/cleavage-stimulation-factor-2?related_pathways=Cell%20Growth

Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung...Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung...

Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung ... Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung ... Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung ... Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung ...
more infohttp://clincancerres.aacrjournals.org/content/17/18/5889

Cleavage Stimulation Factor | Profiles RNSCleavage Stimulation Factor | Profiles RNS

"Cleavage Stimulation Factor" by people in this website by year, and whether "Cleavage Stimulation Factor" was a major or minor ... "Cleavage Stimulation Factor" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH ( ... It is a heterotrimer of 55-, 64- and 77-kDa subunits and combines with CLEAVAGE STIMULATION FACTOR to form a stable complex ... Below are the most recent publications written about "Cleavage Stimulation Factor" by people in Profiles. ...
more infohttps://profiles.rush.edu/display/10785

IJMS  | Free Full-Text | New Insights into Functional Roles of the Polypyrimidine  Tract-Binding Protein | HTMLIJMS | Free Full-Text | New Insights into Functional Roles of the Polypyrimidine Tract-Binding Protein | HTML

In the present review, we will describe the structural properties of PTB, its paralogs and co-factors, the role in post- ... mRNA export factor Tap; PABP, Poly(A)-binding protein; CSTF64, cleavage stimulation factor 64; Y14, Y14 Magoh complex; HUD, Hu ... mRNA export factor Tap; PABP, Poly(A)-binding protein; CSTF64, cleavage stimulation factor 64; Y14, Y14 Magoh complex; HUD, Hu ... Additional factors, other than U2AF65, may antagonize the PTB repressive role such as the ETR3-like factor (CELF) proteins CUG- ...
more infohttp://www.mdpi.com/1422-0067/14/11/22906/htm

Common genes underlying asthma and COPD? Genome-wide analysis on the Dutch hypothesis | European Respiratory SocietyCommon genes underlying asthma and COPD? Genome-wide analysis on the Dutch hypothesis | European Respiratory Society

CSTF2: cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa; HNRNPK: heterogeneous nuclear ribonucleoprotein K; MRE11A: ... Bayes factor 11, p,0.0001) and telomere maintenance (Bayes factor 6, p,0.0001), possibly implicating COPD as a disease of ... The host factor in bronchitis. In: Bronchitis:an International Symposium, 27-29 April 1960, Gronigen. Assen, Royal Van Gorcum, ... CNSLD was defined to result from the interplay of endogenous factors like genetic predisposition, and exogenous factors like ...
more infohttps://erj.ersjournals.com/content/44/4/860?ctkey=ERJtw001914

Common genes underlying asthma and COPD? Genome-wide analysis on the Dutch hypothesis | European Respiratory SocietyCommon genes underlying asthma and COPD? Genome-wide analysis on the Dutch hypothesis | European Respiratory Society

CSTF2: cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa; HNRNPK: heterogeneous nuclear ribonucleoprotein K; MRE11A: ... Bayes factor 11, p,0.0001) and telomere maintenance (Bayes factor 6, p,0.0001), possibly implicating COPD as a disease of ... The host factor in bronchitis. In: Bronchitis:an International Symposium, 27-29 April 1960, Gronigen. Assen, Royal Van Gorcum, ... CNSLD was defined to result from the interplay of endogenous factors like genetic predisposition, and exogenous factors like ...
more infohttps://erj.ersjournals.com/node/74480.full.print

Browse ORF cDNA clones by species Bos taurus, page 1Browse ORF cDNA clones by species Bos taurus, page 1

cleavage stimulation factor subunit 1. protein-coding. LOC616964. olfactory receptor-like protein OLF4. protein-coding. ... ADP ribosylation factor like GTPase 5B. protein-coding. SCUBE3. signal peptide, CUB domain and EGF like domain containing 3. ... rho guanine nucleotide exchange factor 11-like. protein-coding. RSPH10B. radial spoke head 10 homolog B (Chlamydomonas). ...
more infohttps://www.genscript.com/gene/9913/bos-taurus

CSTF1 (human)CSTF1 (human)

Cleavage stimulation factor subunit 1 Show on y-axis - References (HTP + LTP). References (LTP). References (HTP). ...
more infohttps://www.phosphosite.org/proteinAction.action?id=4174&showAllSites=true

GCM DPF2GCM DPF2

cleavage stimulation factor, .... DGCR6. 8214. DGCR6. DiGeorge syndrome critical re.... DPF2. 5977. DPF2. D4, zinc and double ... TFT: transcription factor targets C4: computational gene sets CGN: cancer gene neighborhoods CM: cancer modules C5: GO gene ...
more infohttp://software.broadinstitute.org/gsea/msigdb/cards/GCM_DPF2.html

CstF-64T (human)CstF-64T (human)

Cleavage stimulation factor subunit 2 tau variant Show on y-axis - References (HTP + LTP). References (LTP). References (HTP). ...
more infohttps://www.phosphosite.org/proteinAction.action?id=6256&showAllSites=true

CSTF2 - PrimePCR Assay and Template | Life Science | Bio-RadCSTF2 - PrimePCR Assay and Template | Life Science | Bio-Rad

Cleavage stimulation factor subunit 2 Assay Type: SYBR® Green Assay Design: Intron-spanning Application: Gene Expression Unique ... Cleavage stimulation factor subunit 2 Assay Type: Probe Assay Design: Intron-spanning Application: Gene Expression Unique Assay ... Control assays and synthetic DNA templates were designed to facilitate the assessment of the key experimental factors impacting ...
more infohttp://www.bio-rad.com/en-us/prime-pcr-assays/gene/cstf2-cow

CSTF2 - PrimePCR Assay and Template | Life Science | Bio-RadCSTF2 - PrimePCR Assay and Template | Life Science | Bio-Rad

The protein is a member of the cleavage stimulation factor (CSTF) complex that is involved in the 3' end cleavage and ... cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa Assay Type: Probe Assay Design: exonic Application: Gene Expression ... cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa Assay Type: SYBR® Green Assay Design: exonic Application: Gene ... cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa Assay Type: SYBR® Green Assay Design: Intron-spanning Application: ...
more infohttp://www.bio-rad.com/en-us/prime-pcr-assays/gene/cstf2-human

MODULE 181MODULE 181

cleavage stimulation factor, 3 pre-RNA,.... 1485. 1485. CTAG1B. cancer/testis antigen 1B. ... TFT: transcription factor targets C4: computational gene sets CGN: cancer gene neighborhoods CM: cancer modules C5: GO gene ...
more infohttp://software.broadinstitute.org/gsea/msigdb/cards/MODULE_181.html

RNA-binding proteins : Top topics (The Full Wiki)RNA-binding proteins : Top topics (The Full Wiki)

Cleavage stimulation factor. 7. 3. Roxan (protein). less than 5 views. Parent categories. *Proteins ...
more infohttp://top-topics.thefullwiki.org/RNA-binding_proteins
  • It is involved in the cleavage of the 3' signaling region from a newly synthesized pre-messenger RNA (mRNA) molecule. (wikipedia.org)
  • Three loci showed potential involvement in both diseases: chr2p24.3, chr5q23.1 and chr13q14.2, containing DDX1 , COMMD10 (both participating in the nuclear factor (NF) κβ pathway) and GNG5P5 , respectively. (ersjournals.com)
  • Altogether more than 700 proteins were analyzed representing all major types of protein families, i.e. protein receptors, kinases, phosphatases, transcription factors, and nuclear receptors. (mcponline.org)
  • Immunohistochemical analysis using tissue microarray showed an association of strong CSTF2 expression with poor prognosis of patients with non-small cell lung cancer ( P = 0.0079), and multivariate analysis showed that CSTF2 positivity is an independent prognostic factor. (aacrjournals.org)
  • The initial steps take place in the nucleus where promoter recognition, mediated by transcription factors, requires chromatin and nucleosome modifications driven by epigenetic events, and allows the regulation of the RNA polymerase transcriptional activity. (mdpi.com)
  • We investigated whether asthma and COPD have common underlying genetic factors, performing genome-wide association studies for both asthma and COPD and combining the results in meta-analyses. (ersjournals.com)
  • Control assays and synthetic DNA templates were designed to facilitate the assessment of the key experimental factors impacting your real-time PCR results. (bio-rad.com)
  • We offer Cleavage stimulation factor 2 RNAi for use in common research applications. (novusbio.com)
  • This graph shows the total number of publications written about "Cleavage Stimulation Factor" by people in this website by year, and whether "Cleavage Stimulation Factor" was a major or minor topic of these publications. (rush.edu)
  • Our Cleavage stimulation factor 2 RNAi can be used in a variety of model species: Human. (novusbio.com)
  • To date, a lot of molecular targeting agents have been used in the clinical practice of lung cancer treatment, including tyrosine kinase inhibitors of epidermal growth factor or VEGF as well as monoclonal antibodies against them ( 4, 5 ). (aacrjournals.org)