A RNA-binding protein that stimulates the cleavage of the 3' end of MRNA near the POLYADENYLATION site. It is a heterotrimer of 55-, 64- and 77-kDa subunits and combines with CLEAVAGE STIMULATION FACTOR to form a stable complex with mRNA that directs the 3' cleavage and polyadenylation reaction.
Factors that are involved in directing the cleavage and POLYADENYLATION of the of MESSENGER RNA near the site of the RNA 3' POLYADENYLATION SIGNALS.
An RNA-binding protein that recognizes the AAUAAA RNA SEQUENCE at the 3' end of MRNA. It contains four subunits of 30, 73, 100 and 160 kDa molecular size and combines with CLEAVAGE STIMULATION FACTOR to form a stable complex with mRNA that directs the 3' cleavage and polyadenylation reaction.
The addition of a tail of polyadenylic acid (POLY A) to the 3' end of mRNA (RNA, MESSENGER). Polyadenylation involves recognizing the processing site signal, (AAUAAA), and cleaving of the mRNA to create a 3' OH terminal end to which poly A polymerase (POLYNUCLEOTIDE ADENYLYLTRANSFERASE) adds 60-200 adenylate residues. The 3' end processing of some messenger RNAs, such as histone mRNA, is carried out by a different process that does not include the addition of poly A as described here.
Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.
RNA transcripts of the DNA that are in some unfinished stage of post-transcriptional processing (RNA PROCESSING, POST-TRANSCRIPTIONAL) required for function. RNA precursors may undergo several steps of RNA SPLICING during which the phosphodiester bonds at exon-intron boundaries are cleaved and the introns are excised. Consequently a new bond is formed between the ends of the exons. Resulting mature RNAs can then be used; for example, mature mRNA (RNA, MESSENGER) is used as a template for protein production.
Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Use of electric potential or currents to elicit biological responses.
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
Databases containing information about PROTEINS such as AMINO ACID SEQUENCE; PROTEIN CONFORMATION; and other properties.
A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.
The portion of an interactive computer program that issues messages to and receives commands from a user.
A RNA-binding protein that binds to polypyriminidine rich regions in the INTRONS of messenger RNAs. Polypyrimidine tract-binding protein may be involved in regulating the ALTERNATIVE SPLICING of mRNAs since its presence on an intronic RNA region that is upstream of an EXON inhibits the splicing of the exon into the final mRNA product.
Complexes of RNA-binding proteins with ribonucleic acids (RNA).
A family of ribonucleoproteins that were originally found as proteins bound to nascent RNA transcripts in the form of ribonucleoprotein particles. Although considered ribonucleoproteins they are primarily classified by their protein component. They are involved in a variety of processes such as packaging of RNA and RNA TRANSPORT within the nucleus. A subset of heterogeneous-nuclear ribonucleoproteins are involved in additional functions such as nucleocytoplasmic transport (ACTIVE TRANSPORT, CELL NUCLEUS) of RNA and mRNA stability in the CYTOPLASM.
Multicomponent ribonucleoprotein structures found in the CYTOPLASM of all cells, and in MITOCHONDRIA, and PLASTIDS. They function in PROTEIN BIOSYNTHESIS via GENETIC TRANSLATION.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.
All of the divisions of the natural sciences dealing with the various aspects of the phenomena of life and vital processes. The concept includes anatomy and physiology, biochemistry and biophysics, and the biology of animals, plants, and microorganisms. It should be differentiated from BIOLOGY, one of its subdivisions, concerned specifically with the origin and life processes of living organisms.
Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.
The study of natural phenomena by observation, measurement, and experimentation.
Commercially prepared reagent sets, with accessory devices, containing all of the major components and literature necessary to perform one or more designated diagnostic tests or procedures. They may be for laboratory or personal use.
DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.
Male germ cells derived from the haploid secondary SPERMATOCYTES. Without further division, spermatids undergo structural changes and give rise to SPERMATOZOA.
DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Recombinases that insert exogenous DNA into the host genome. Examples include proteins encoded by the POL GENE of RETROVIRIDAE and also by temperate BACTERIOPHAGES, the best known being BACTERIOPHAGE LAMBDA.
The process of germ cell development in the male from the primordial germ cells, through SPERMATOGONIA; SPERMATOCYTES; SPERMATIDS; to the mature haploid SPERMATOZOA.
An infectious dermatitis of sheep and goats, affecting primarily the muzzle and lips. It is caused by a poxvirus and may be transmitted to man.
The type species of PARAPOXVIRUS which causes a skin infection in natural hosts, usually young sheep. Humans may contract local skin lesions by contact. The virus apparently persists in soil.
Proteins prepared by recombinant DNA technology.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
Sequences found near the 3' end of MESSENGER RNA that direct the cleavage and addition of multiple ADENINE NUCLEOTIDES to the 3' end of mRNA.

Cloning and characterization of Arabidopsis homologues of the animal CstF complex that regulates 3' mRNA cleavage and polyadenylation. (1/39)

The 3' cleavage and polyadenylation of mRNAs has been studied in detail in animals and yeast, but not in plants. Aimed at elucidating the regulation of mRNA 3' end formation in plants, three Arabidopsis cDNAs encoding homologues of the animal proteins CstF-64, CstF-77 and CstF-50 that form the cleavage stimulating factor of the polyadenylation machinery have been cloned. It is shown experimentally that the N-terminal domain of the Arabidopsis CstF-64 homologue binds the mRNA 3' non-coding region in an analogous manner to the animal protein. It is also shown that the Arabidopsis CstF-64 and CstF-77 homologues strongly interact with each other in a similar way to their animal counterparts. These results imply that these Arabidopsis homologues belong to the polyadenylation machinery of nuclear mRNAs.  (+info)

Polyadenylation: a tail of two complexes. (2/39)

Recent studies have uncovered new connections between the enzymes of mRNA 3' end processing and RNA polymerase II. These connections improve the efficiency of polyadenylation and signal to the polymerase to terminate transcription; their discovery reveals another level of gene regulation.  (+info)

An evolutionarily conserved role for SRm160 in 3'-end processing that functions independently of exon junction complex formation. (3/39)

SRm160 (the SR-related nuclear matrix protein of 160 kDa) functions as a splicing coactivator and 3'-end cleavage-stimulatory factor. It is also a component of the splicing-dependent exon-junction complex (EJC), which has been implicated in coupling of pre-mRNA splicing with mRNA turnover and mRNA export. We have investigated whether the association of SRm160 with the EJC is important for efficient 3'-end cleavage. The EJC components RNPS1, REF, UAP56, and Y14 interact with SRm160. However, when these factors were tethered to transcripts, only SRm160 and RNPS1 stimulated 3'-end cleavage. Whereas SRm160 stimulated cleavage to a similar extent in the presence or absence of an active intron, stimulation of 3'-end cleavage by tethered RNPS1 is dependent on an active intron. Assembly of an EJC adjacent to the cleavage and polyadenylation signal in vitro did not significantly affect cleavage efficiency. These results suggest that SRm160 stimulates cleavage independently of its association with EJC components and that the cleavage-stimulatory activity of RNPS1 may be an indirect consequence of its ability to stimulate splicing. Using RNA interference (RNAi) in Caenorhabditis elegans, we determined whether interactions between SRm160 and the cleavage machinery are important in a whole organism context. Simultaneous RNAi of SRm160 and the cleavage factor CstF-50 (Cleavage stimulation factor 50-kDa subunit) resulted in late embryonic developmental arrest. In contrast, RNAi of CstF-50 in combination with RNPS1 or REFs did not result in an apparent phenotype. Our combined results provide evidence for an evolutionarily conserved interaction between SRm160 and the 3'-end cleavage machinery that functions independently of EJC formation.  (+info)

Developmental distribution of the polyadenylation protein CstF-64 and the variant tauCstF-64 in mouse and rat testis. (4/39)

Messenger RNA polyadenylation is one of the processes that control gene expression in all eukaryotic cells and tissues. In mice, two forms of the regulatory polyadenylation protein CstF-64 are found. The gene Cstf2 on the X chromosome encodes this form, and it is expressed in all somatic tissues. The second form, tauCstF-64 (encoded by the autosomal gene Cstf2t), is expressed in a more limited set of tissues and cell types, largely in meiotic and postmeiotic male germ cells and, to a smaller extent, in brain. We report here that whereas CstF-64 and tauCstF-64 expression in rat tissues resembles their expression in mouse tissues, significant differences also are found. First, unlike in mice, in which CstF-64 was expressed in postmeiotic round and elongating spermatids, rat CstF-64 was absent in those cell types. Second, unlike in mice, tauCstF-64 was expressed at significant levels in rat liver. These differences in expression suggest interesting differences in X-chromosomal gene expression between these two rodent species.  (+info)

U1A inhibits cleavage at the immunoglobulin M heavy-chain secretory poly(A) site by binding between the two downstream GU-rich regions. (5/39)

The immunoglobulin M heavy-chain locus contains two poly(A) sites which are alternatively expressed during B-cell differentiation. Despite its promoter proximal location, the secretory poly(A) site is not expressed in undifferentiated cells. Crucial to the activation of the secretory poly(A) site during B-cell differentiation are changes in the binding of cleavage stimulatory factor 64K to GU-rich elements downstream of the poly(A) site. What regulates this change is not understood. The secretory poly(A) site contains two downstream GU-rich regions separated by a 29-nucleotide sequence. Both GU-rich regions are necessary for binding of the specific cleavage-polyadenylation complex. We demonstrate here that U1A binds two (AUGCN(1-3)C) motifs within the 29-nucleotide sequence and inhibits the binding of cleavage stimulatory factor 64K and cleavage at the secretory poly(A) site.  (+info)

Elevated levels of the 64-kDa cleavage stimulatory factor (CstF-64) in lipopolysaccharide-stimulated macrophages influence gene expression and induce alternative poly(A) site selection. (6/39)

Lipopolysaccharide (LPS) activation of murine RAW 264.7 macrophages influences the expression of multiple genes through transcriptional and post-transcriptional mechanisms. We observed a 5-fold increase in CstF-64 expression following LPS treatment of RAW macrophages. The increase in CstF-64 protein was specific in that several other factors involved in 3'-end processing were not affected by LPS stimulation. Activation of RAW macrophages with LPS caused an increase in proximal poly(A) site selection within a reporter mini-gene containing two linked poly(A) sites that occurred concomitant with the increase in CstF-64 expression. Furthermore, forced overexpression of the CstF-64 protein also induced alternative poly(A) site selection on the reporter minigene. Microarray analysis performed on CstF-64 overexpressing RAW macrophages revealed that elevated levels of CstF-64 altered the expression of 51 genes, 14 of which showed similar changes in gene expression with LPS stimulation. Sequence analysis of the 3'-untranslated regions of these 51 genes revealed that over 45% possess multiple putative poly(A) sites. Two of these 51 genes demonstrated alternative polyadenylation under both LPS-stimulating and CstF-64-overexpressing conditions. We concluded that the physiologically increased levels of CstF-64 observed in LPS-stimulated RAW macrophages contribute to the changes in expression and alternative polyadenylation of a number of genes, thus identifying another level of gene regulation that occurs in macrophages activated with LPS.  (+info)

Symplekin and multiple other polyadenylation factors participate in 3'-end maturation of histone mRNAs. (7/39)

Most metazoan messenger RNAs encoding histones are cleaved, but not polyadenylated at their 3' ends. Processing in mammalian cell extracts requires the U7 small nuclear ribonucleoprotein (U7 snRNP) and an unidentified heat-labile factor (HLF). We describe the identification of a heat-sensitive protein complex whose integrity is required for histone pre-mRNA cleavage. It includes all five subunits of the cleavage and polyadenylation specificity factor (CPSF), two subunits of the cleavage stimulation factor (CstF), and symplekin. Reconstitution experiments reveal that symplekin, previously shown to be necessary for cytoplasmic poly(A) tail elongation and translational activation of mRNAs during Xenopus oocyte maturation, is the essential heat-labile component. Thus, a common molecular machinery contributes to the nuclear maturation of mRNAs both lacking and possessing poly(A), as well as to cytoplasmic poly(A) tail elongation.  (+info)

Drosophila Sex-lethal protein mediates polyadenylation switching in the female germline. (8/39)

The Drosophila master sex-switch protein Sex-lethal (SXL) regulates the splicing and/or translation of three known targets to mediate somatic sexual differentiation. Genetic studies suggest that additional target(s) of SXL exist, particularly in the female germline. Surprisingly, our detailed molecular characterization of a new potential target of SXL, enhancer of rudimentary (e(r)), reveals that SXL regulates e(r) by a novel mechanism--polyadenylation switching--specifically in the female germline. SXL binds to multiple SXL-binding sites, which include the GU-rich poly(A) enhancer, and competes for the binding of CstF64 in vitro. The SXL-binding sites are able to confer sex-specific poly(A) switching onto an otherwise nonresponsive polyadenylation signal in vivo. The sex-specific poly(A) switching of e(r) provides a means for translational regulation in germ cells. We present a model for the SXL-dependent poly(A) site choice in the female germline.  (+info)

Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins CSTF1 (55kDa), CSTF2 (64kDa) and CSTF3 (77kDa), totalling about 200 kDa. It is involved in the cleavage of the 3 signaling region from a newly synthesized pre-messenger RNA (mRNA) molecule. CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3 end to promote the synthesis of a functional polyadenine tail, which results in a mature mRNA molecule ready to be exported from the cell nucleus to the cytosol for translation. The amount of CstF in a cell is dependent on the phase of the cell cycle, increasing significantly during the transition from G0 phase to S phase in mouse fibroblast and human splenic B cells. CSTF1, CSTF2, CSTF3 Martincic, K.; Campbell, R.; Edwalds-Gilbert, G.; Souan, L.; Lotze, M. T.; Milcarek, C. (1998). Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor ...
Gentaur molecular products has all kinds of products like :search , GenWay \ Cleavage stimulation factor 50 kDa subunit - CSTF 50 kDa subunit; CF-1 50 kDa subunit; CstF-50 \ 10-288-22329F for more molecular products just contact us
Cstf3 - Cstf3 (GFP-tagged) - Mouse cleavage stimulation factor 3 pre-RNA subunit 3 (Cstf3) transcript variant 2, (10ug) available for purchase from OriGene - Your Gene Company.
Cstf2 - Lenti ORF clone of Cstf2 (mGFP-tagged) - Mouse cleavage stimulation factor, 3 pre-RNA subunit 2 (cDNA clone MGC:36412 IMAGE:5322335) available for purchase from OriGene - Your Gene Company.
Exogenous human granulocyte-colony stimulation factor (huG-CSF) restores autoantibody (autoAb) production in B6.Sle2c2 mice after induction of chronic graft vs
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
Human CSTF2 full-length ORF ( AAH17712, 1 a.a. - 577 a.a.) recombinant protein with GST-tag at N-terminal. (H00001478-P01) - Products - Abnova
Besides the splice site itself, only two sequences on the pre-mRNA play an important role in SL2-specific trans-splicing: the two presumptive signals for 3 end formation of the gene just upstream (Figure 2; Huang et al., 2001; Kuersten et al., 1997; Liu et al., 2001; Liu et al., 2003). The AAUAAA just 5 of the cleavage site, which is absolutely required for 3 end formation, binds the cleavage and polyadenylation specificity factor (CPSF), and a U-rich sequence just 3 of the cleavage site binds the cleavage stimulatory factor (CstF). CPSF and CstF bind cooperatively to these two sites and together position the site of cleavage. When the AAUAAA is mutated, 3 end cleavage fails to occur, and trans-splicing just downstream becomes less efficient and less specific for SL2. Nevertheless, AAUAAA is not required for SL2 trans-splicing since SL2 trans-splicing downstream still occurs in its absence. CPSF bound to AAUAAA may act by facilitating binding of CstF to the U-rich sequence or by catalyzing ...
Spermatogenesis is coordinated by the spatial and temporal expression of many transcriptional and posttranscriptional factors. The cyclic AMP-responsive element modulator (CREM) gene encodes both activator and repressor isoforms that act as transcription factors to regulate spermiogenesis. We found that the testis-expressed paralog of CstF-64, tauCstF-64 (gene symbol Cstf2t), is involved in a polyadenylation site choice switch of Crem mRNA and leads to an overall decrease of the Crem mRNAs that are generated from internal promoters in Cstf2t(-/-) mice. More surprisingly, loss of tauCstF-64 also leads to alternative splicing of Crem exon 4, which contains an important activation domain. Thus, testis-specific CREMtau2 isoform protein levels are reduced in Cstf2t(-/-) mice. Consequently, expression of 15 CREM-regulated genes is decreased in testes of Cstf2t(-/-) mice at 25 days postpartum. These effects might further contribute to the infertility phenotype of these animals. This demonstrates that tauCstF
Differential neutrophil mobilization in response to human granulocyte-colony stimulation factor (huG-CSF) in B6 and B6.Sle2c2 mice. Percentage of Ly6G+ CD11b+ n
Perform reliable qPCR with Bio-Rads pre-validated CSTF3 primer pair, for the Dog genome. Designed for SYBR Green-based detection.
CSTF Resuscitation Adults Levels 1, 2 & 3 - This course is a mandatory requirement for those who work in health and social care services, including but not l...
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
Reactome is pathway database which provides intuitive bioinformatics tools for the visualisation, interpretation and analysis of pathway knowledge.
HsCD00001919 ATGGCGGGTTTGACTGTGAGAGACCCAGCGGTGGATCGTTCTCTACGTTCTGTGTTCGTG NM_001325.2 ATGGCGGGTTTGACTGTGAGAGACCCAGCGGTGGATCGTTCTCTACGTTCTGTGTTCGTG ************************************************************ HsCD00001919 GGGAACATTCCTTATGAAGCTACTGAAGAGCAGTTGAAGGACATCTTTTCTGAGGTTGGA NM_001325.2 GGGAACATTCCTTATGAAGCTACTGAAGAGCAGTTGAAGGACATCTTTTCTGAGGTTGGA ************************************************************ HsCD00001919 CCTGTTGTTAGTTTCAGATTGGTATACGATAGAGAGACAGGAAAGCCAAAGGGTTATGGC NM_001325.2 CCTGTTGTTAGTTTCAGATTGGTATACGATAGAGAGACAGGAAAGCCAAAGGGTTATGGC ************************************************************ HsCD00001919 TTCTGTGAATACCAAGACCAAGAGACAGCACTTAGTGCCATGCGGAACCTGAATGGGCGC NM_001325.2 TTCTGTGAATACCAAGACCAAGAGACAGCACTTAGTGCCATGCGGAACCTGAATGGGCGC ************************************************************ HsCD00001919 GAATTCAGTGGGAGAGCACTTCGAGTGGACAATGCTGCCAGTGAAAAGAACAAAGAAGAG NM_001325.2 GAATTCAGTGGGAGAGCACTTCGAGTGGACAATGCTGCCAGTGAAAAGAACAAAGAAGAG ...
Following DNA damage, mRNA levels decrease, reflecting a coordinated interaction of the DNA repair, transcription and RNA processing machineries. In this study, we provide evidence that transcription and polyadenylation of mRNA precursors are both affected in vivo by UV treatment. We next show that the polyadenylation factor CstF, plays a direct role in the DNA damage response. Cells with reduced levels of CstF display decreased viability following UV treatment, reduced ability to ubiquitinate RNA polymerase II (RNAP II), and defects in repair of DNA damage. Furthermore, we show that CstF, RNAP II and BARD1 are all found at sites of repaired DNA. Our results indicate that CstF plays an active role in the response to DNA damage, providing a link between transcription-coupled RNA processing and DNA repair.
Dysfunction home remedies for ed to being theImpotence as score prostate stimulation factors, therapeutic about and to! Of, release and system threatening at as
CPSF2兔多克隆抗体(ab100807)可与小鼠, 人样本反应并经IHC实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
CPSF30小鼠单克隆抗体[2202C1](ab51343)可与人样本反应并经WB, Dot实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
mRNA cleavage and polyadenylation specificity factor complex, 5-3 exonuclease activity, endoribonuclease activity, RNA binding, mRNA 3-end processing by stem-loop binding and cleavage, mRNA cleavage, mRNA polyadenylation
Dental Traumatology 2003; 19: 175±182 Copyright # Blackwell Munksgaard 2003 Printed in Denmark. All rights reserved DENTAL TRAUMATOLOGY ISSN 1600±4469 Root resorption ^ diagnosis, classification and treatment
Neutrophils are one of the most important innate defence mechanisms against bacteria. They rapidly migrate to sites of colonisation and infection, where antimicrobial mechanisms (degranulation with release of antimicrobial proteins and release of neutrophil extracellular traps) and phagocytosis can then take place.2,3 Toxic granulation and cytoplasmic vacuolation are morphological changes that occur in the circumstances of bacterial infection, with other causes of inflammation or after administration of granulocyte colony stimulation factor. Predicting bacterial infections based on these morphological changes has been described in the past.4 The prognostic value of these findings is unclear. One study reports lower mortality in septic patients when neutrophils show higher phagocytic activity.5 However, excessive neutrophil migration to sites of inflammation can result in detrimental damage to surrounding tissues. To reduce this damage, the duration of neutrophil recruitment and toxic changes is ...
A maquinaria de poliadenilación no núcleo de eucariotas actúa sobre os produtos orixinados pola ARN polimerase II, como son os ARNm precursores. Aquí, un complexo multiproteico (cuxos compoñentes poden verse na táboa da dereita) clivan a parte final do extremo 3 do ARN que se acaba de formar, e poliadenila o extremo que se orixina por esta clivaxe. A clivaxe está catalizada polo encima CPSF[7] e ten lugar 10-30 nucleótidos corrente abaixo do seu sitio de unión.[12] Este sitio é xeralmente a secuencia AAUAAA do ARN, pero hai variantes del aos que tamén se une máis debilmente o CPSF.[13] Outras dúas proteínas que engaden especificidade á unión a un ARN son CstF e CFI. O CstF únese a unha rexión rica en GU situada máis corrente abaixo do sitio do CPSF.[14] O CFI recoñece un terceiro sitio no ARN (un conxunto de secuencias UGUAA en mamíferos[15][16][17]) e pode recrutar o CPSF mesmo se se perde a secuencia AAUAAA.[18][19] O sinal de poliadenilación (a secuencia motivo ...
Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016 ...
Cleavage and polyadenylation specificity factor (CPSF) is relevant to the cleavage of the 3′ signaling region from a newly synthesized pre-messenger RNA (pre-mRNA) molecule. Specifically, it is in the process…. Read More Read More. ...
In this study, we provide genome-wide, high-resolution polyadenylation maps of the human heart and show that in subsets of genes, 3′end formation of mRNA changes in failing hearts. For the vast majority of genes, the importance of APA remains unknown, but this work and that of others,8 indicate that APA shifts toward a proximal CS, resulting in shorter 3′UTRs, may contribute to an increased expression. Along the same lines, an APA shift toward a distal CS contributes to downregulation of the mRNA. We did not find global shifts in 3′UTR length in failing hearts, but identified groups of genes where the 3′UTR ratio changed. Genes displaying 3′UTR shortening were mostly enriched for categories related to RNA binding, whereas the genes that displayed 3′UTR lengthening were found in categories of actin binding and structural constituent of cytoskeleton. Strikingly, we did not find APA shifts in genes important for contractile functions, suggesting that APA does not play an important role ...
Complete information for CPSF4 gene (Protein Coding), Cleavage And Polyadenylation Specific Factor 4, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010 ...
Reaktivität: Fledermaus, Huhn, Rind (Kuh) and more. 67 verschiedene CPSF4 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
Abnova Human CPSF3 Partial ORF (NP_057291, 585 a.a. - 684 a.a.) Recombinant Protein with GST-tag at N-terminal 25µg Life Sciences:Protein Biology:Proteins:Proteins A-Z:Proteins
We have isolated the human homolog of S. cerevisiae Fip1p and have found that hFip1 is a genuine subunit of CPSF. Our results reported here indicate that hFip1 contributes to poly(A) site recognition and to CPSF‐dependent stimulation of polyadenylation. hFip1 binds to U‐rich sequence elements on the pre‐mRNA and is able to stimulate the activity of PAP.. CPSF has originally been described as a tetrameric complex containing the subunits CPSF160, CPSF100, CPSF73 and CPSF30, based on their stoichiometric cofractionation with CPSF activity. These polypeptides are related to four subunits of the yeast polyadenylation factor CPF (Yhh1p, Ydh1p, Ysh1p and Yth1p). However, CPF contains additional subunits (Preker et al, 1997; Dichtl et al, 2002a; Gavin et al, 2002; Walsh et al, 2002), one of which is Fip1p. Based on sequence conservation, we have identified the human homolog of yeast Fip1p and have shown that hFip1 is an additional, so far unrecognized subunit of CPSF. Most likely, hFip1 has not ...
CPSF3 Antibody 11609-1-AP has been identified with ELISA, IP, WB. 11609-1-AP detected 77 kDa band in HEK-293 cells with 1:500-1:2000 dilution...
Cleavage stimulation factor 50 kDa subunit is a protein that in humans is encoded by the CSTF1 gene. This gene encodes one of ... "Entrez Gene: CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa". Kleiman FE, Manley JL (September 1999). " ... three subunits which combine to form cleavage stimulation factor (CSTF). CSTF is involved in the polyadenylation and 3' end ... Rüegsegger U, Beyer K, Keller W (March 1996). "Purification and characterization of human cleavage factor Im involved in the 3 ...
The protein is a member of the cleavage stimulation factor (CSTF) complex that is involved in the 3' end cleavage and ... Cleavage stimulation factor 64 kDa subunit is a protein that in humans is encoded by the CSTF2 gene. This gene encodes a ... "Entrez Gene: CSTF2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa". Takagaki, Y; Manley J L (March 2000). "Complex ... 2002). "Association of human DEAD box protein DDX1 with a cleavage stimulation factor involved in 3'-end processing of pre-MRNA ...
... cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in ... Cleavage stimulation factor 77 kDa subunit is a protein that in humans is encoded by the CSTF3 gene. The protein encoded by ... "Entrez Gene: CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa". Takagaki, Y; Manley J L (March 2000). "Complex ... Murthy KG, Manley JL (1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'- ...
Cleavage stimulation factor 64 kDa subunit, tau variant is a protein that in humans is encoded by the CSTF2T gene. GRCh38: ... "Entrez Gene: CSTF2T cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant". Human CSTF2T genome location and ...
"Association of human DEAD box protein DDX1 with a cleavage stimulation factor involved in 3'-end processing of pre-MRNA". ... "A DEAD box protein facilitates HIV-1 replication as a cellular co-factor of Rev". Virology. 330 (2): 471-80. doi:10.1016/j. ...
2001). "hnRNP F influences binding of a 64-kilodalton subunit of cleavage stimulation factor to mRNA precursors in mouse B ... Honoré B, Vorum H, Baandrup U (1999). "hnRNPs H, H' and F behave differently with respect to posttranslational cleavage and ...
... the proteins cleavage and polyadenylation specificity factor (CPSF) and cleavage stimulation factor (CstF) transfer from the ... These two factors then recruit other proteins to the site to cleave the transcript, freeing the mRNA from the transcription ... After this cleavage, a so-called exonuclease binds to the residual RNA strand and removes the freshly transcribed nucleotides ... Termination codon Termination factor Terminator gene Transcription (genetics) Richardson, J. P. (1996). "Rho-dependent ...
Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins ... Cleavage+stimulation+factor at the US National Library of Medicine Medical Subject Headings (MeSH) v t e. ... CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3' end ... "Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor during the G0 to S phase transition". ...
... cleavage and polyadenylation specificity factor) and CSTF (cleavage stimulation factor), recognize the poly-A signal in the ... General transcription factors are a group of proteins involved in transcription initiation and regulation. These factors ... There are different classes of elongation factors. Some factors can increase the overall rate of transcribing, some can help ... After escaping the promoter and shedding most of the transcription factors for initiation, the polymerase acquires new factors ...
The partial cleavage stimulation factor domain, or partial CstF domain, is a protein domain that occurs in proteins from ... However, it is homologous to the amino-terminal part of the cleavage stimulation factor, which is thought to be involved with ...
... namely cleavage and polyadenylation specificity factor (CPSF), cleavage stimulation factor (CstF), cleavage factors Im and IIm ... 2000). "Human pre-mRNA cleavage factor IIm contains homologs of yeast proteins and bridges two other cleavage factors". EMBO J ... Cleavage and polyadenylation specificity factor subunit 1 is a protein that in humans is encoded by the CPSF1 gene. In most ... "Entrez Gene: CPSF1 cleavage and polyadenylation specific factor 1, 160kDa". Shi Y, Di Giammartino DC, Taylor D, Sarkeshik A, ...
It is involved in the stimulation of cell proliferation and survival. Proteolytic cleavage of the AXL extracellular domain by ... The AXL receptor transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K- ... Studies have shown that AXL knockdown leads to downregulation of transcription factors required for EMT, including Slug, Twist ... is post-translationally regulated by proteolytic cleavage". The Journal of Biological Chemistry. 270 (2): 551-7. doi:10.1074/ ...
... cleavage and polyadenylation specificity factor MeSH D12.776.664.962.444.249 - cleavage stimulation factor MeSH D12.776.664.962 ... vascular endothelial growth factor a MeSH D12.776.467.100.800.300 - vascular endothelial growth factor b MeSH D12.776.467.100. ... fibroblast growth factor 4 MeSH D12.776.624.664.700.112 - fibroblast growth factor 6 MeSH D12.776.624.664.700.114 - fms-like ... peptide elongation factor g MeSH D12.776.835.700.350.700 - peptide elongation factor tu MeSH D12.776.835.700.350.800 - peptide ...
T-cell replacing factor III, B-cell activating factor, B-cell differentiation factor, and "Heidikine") and interleukin 2 (TSF, ... IL-8 is initially produced as a precursor peptide of 99 amino acids which then undergoes cleavage to create several active IL-8 ... IL3 is produced by T lymphocytes and T-cell lymphomas only after stimulation with antigens, mitogens, or chemical activators ... These include granulocyte colony-stimulating factor (GCSF) and myelomonocytic growth factor (MGF). GCSF acts in hematopoiesis ...
After NF-κB nuclear localization due to TNFα stimulation, p50/RELA heterodimer will function as a transcription factor and bind ... In parallel, there is a non-classical NF-κB activation pathway involving the proteolytic cleavage of p100 into p52 instead of ... Transcription factor p65 also known as nuclear factor NF-kappa-B p65 subunit is a protein that in humans is encoded by the RELA ... nuclear factor-kappaB, and serum response factor". The Journal of Biological Chemistry. 275 (17): 12470-4. doi:10.1074/jbc. ...
Likewise, it interacts with cytoplasmic polyadenylation factors, including Cleavage and polyadenylation specificity factor and ... In mammals, dendrite mRNAs are kept in a repressed state and are activated upon repetitive stimulation. Several regulatory ... that's why it can be used as a prognostic factor for early appearance in breast cancer patients. Moreover, PAP activity is used ...
... cleavage stimulation factor MeSH D12.776.157.725.124.500 - cleavage and polyadenylation specificity factor MeSH D12.776.157.725 ... MeSH D12.776.157.057.030.124 - interferon regulatory factor-1 MeSH D12.776.157.057.030.249 - interferon regulatory factor-2 ... peptide elongation factor g MeSH D12.776.157.325.150.700 - peptide elongation factor tu MeSH D12.776.157.325.150.800 - peptide ... adp-ribosylation factors MeSH D12.776.157.325.515.100.100 - adp-ribosylation factor 1 MeSH D12.776.157.325.515.400 - rab gtp- ...
"Heparin-binding epidermal growth factor-like growth factor: hypoxia-inducible expression in vitro and stimulation of ... "Dual intracellular signaling by proteolytic cleavage of membrane-anchored heparin-binding EGF-like growth factor". Cytokine ... 1992). "Tumor necrosis factor increases transcription of the heparin-binding epidermal growth factor-like growth factor gene in ... 1994). "Heparin-binding epidermal growth factor-like growth factor is an autocrine growth factor for human keratinocytes". J. ...
... conducted simultaneously via guanine nucleotide exchange factors and GTPase activating factor). RhoA is activated primarily by ... Similarly, RhoA's stimulation of PKN2 kinase activity regulates cell-cell adhesion through apical junction formation and ... RhoA-dependent diaphanous-related formins (DRFs) localize to the cleavage furrow during cytokinesis while stimulating local ... Serum response factors (SRFs) are known to mediate androgen receptors in prostate cancer cells, including roles ranging from ...
"Mapping the cleavage site in protein synthesis initiation factor eIF-4 gamma of the 2A proteases from human Coxsackievirus and ... Harris TE, Chi A, Shabanowitz J, Hunt DF, Rhoads RE, Lawrence JC (Apr 2006). "mTOR-dependent stimulation of the association of ... "The translation initiation factor eIF-4E binds to a common motif shared by the translation factor eIF-4 gamma and the ... "The translation initiation factor eIF-4E binds to a common motif shared by the translation factor eIF-4 gamma and the ...
1912 Cleavage in Didymium mclanospermum, 1914 Physical factors in cleavage of coenocytes, 1914 Starchy and sugary foods, 1914 ... 1920 The Stimulation of Research after the War, 1920 The species concept from the point of view of a morphologist, 1923 ... 1905 Sex-determining factors in plants, 1907 The Organization of Certain Coenobic Plants, 1908 Nuclear phenomena of sexual ...
Cleavage Factor I (CF I) and cleavage stimulation factor (CStF) occurs from RNA Polymerase II. The three factors bind to the ... Cleavage and polyadenylation specificity factor 73 cuts mRNA between stem-loop and HDE Histone variants, such as H2A.Z or H3.3 ... For UGUA dependent processing sites, binding of the multi protein complex is done by Cleavage Factor I (CF I). The resultant ... The transfer of these sequence specific binding proteins cleavage and polyadenylation specificity factor (CPSF), ...
Biologically active cleavage products of CTAP-III from human platelets". Biochem. Biophys. Res. Commun. 163 (2): 1071-8. doi: ... Comparison with the gene for platelet factor 4". J Biol Chem. 266 (9): 5785-9. PMID 1826003. Castor C, Miller J, Walz D (1983 ... Castor C, Furlong A, Carter-Su C (1985). "Connective tissue activation: stimulation of glucose transport by connective tissue ... Tunnacliffe A, Majumdar S, Yan B, Poncz M (1992). "Genes for beta-thromboglobulin and platelet factor 4 are closely linked and ...
However, it is required for B cell proliferation induced by stimulation of TLR3 and TLR4. Activation of nuclear factor kappa B ... autocatalytic cleavage occurs at an aspartate residue within their own structures, resulting in an activated protein. This ... Normally, upon stimulation of the receptors TL4 or IL-1R1, the adaptor protein, MyD88, is recruited to the plasma membrane ... Upon stimulation by the Fas ligand, the Fas receptor trimerises. Many receptors, including Fas, contain a cytoplasmic DD and ...
The origin of the blastocoel in Xenopus has been shown to be from the first cleavage furrow, which is widened and sealed with ... In the mice, ninety percent of the females were induced by mechanical stimulation to undergo pregnancy and implant at least one ... By transplanting them to the eye field on the neural plate, and by inducing several mis-expressions of transcription factors, ... Prior to this transition, cleavage occurs with only the synthesis and mitosis phases of the cell cycle. The addition of the two ...
Biologically active cleavage products of CTAP-III from human platelets.". Biochem. Biophys. Res. Commun. 163 (2): 1071-8. PMID ... Comparison with the gene for platelet factor 4". J Biol Chem 266 (9): 5785-9. PMID 1826003. ... Castor C, Furlong A, Carter-Su C (1985). "Connective tissue activation: stimulation of glucose transport by connective tissue ... Comparison with the gene for platelet factor 4.". J. Biol. Chem. 266 (9): 5785-9. PMID 1826003. ...
This proteolytic cleavage is irreversible and the loose peptide, often referred to as parstatin, is then released outside of ... Coupling can also occur with Gq, leading to phospholipase C-β activation; this pathway results in the stimulation of protein ... The affinity of thrombin to this specific cleavage site in PAR1 is further aided by secondary interactions between thrombin's ... Proteinase-activated receptor 1 (PAR1) also known as Protease-activated receptor 1 or coagulation factor II (thrombin) receptor ...
The study confirmed that there was cleavage of caspase-3, -8, and -9. All three of these cysteine proteases play an important ... This ultimately results in the stimulation of B cells to proliferate and increase their antibody production. This ultimately ... The phosphorylated STATs then dissociate from the receptor heterodimer and form an interferon transcription factor with p48 and ... IRF9 to form the interferon stimulate transcription factor-3 (ISGF3). This transcription factor then translocates to the ...
Following cleavage, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols ... Wang X, Sato R, Brown MS, Hua X, Goldstein JL (Apr 1994). "SREBP-1, a membrane-bound transcription factor released by sterol- ... Bennett MK, Ngo TT, Athanikar JN, Rosenfeld JM, Osborne TF (May 1999). "Co-stimulation of promoter for low density lipoprotein ... The protein is a member of the basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor family. SREBP-1a regulates ...
Conversely, uncoupled GTPase activity occurs when the ribosome stimulation of GTP cleavage is not directly dependent on protein ... Prokaryotic elongation factors Eukaryotic elongation factors Youngman EM, Green R (February 2007). "Ribosomal translocation: ... An assay was then conducted with both PRE and POST states, and cleavage studies revealed enhanced positional cleavage in the ... "GTP-binding membrane protein of Escherichia coli with sequence homology to initiation factor 2 and elongation factors Tu and G ...
Epinephrine and norepinephrine (E/NE) are produced by the adrenal medulla through sympathetic stimulation and the local effects ... This reduces the secretion of CRH and vasopressin, and also directly reduces the cleavage of proopiomelanocortin (POMC) into ... It comprises corticotropin-releasing factor (CRF), released by the hypothalamus; adrenocorticotropic hormone (ACTH), released ... the adrenal cortex, which produces glucocorticoid hormones (mainly cortisol in humans) in response to stimulation by ACTH. ...
Cleavage products/derivatives with unknown target: Glypromate (GPE, (1-3)IGF-1) ... The increased visual, physical, and cognitive stimulation all translates into more neuronal activity and synaptic communication ... BDNF, brain-derived neurotrophic factor, ANON2, BULN2, Brain-derived neurotrophic factor, brain derived neurotrophic factor. ... Brain-derived neurotrophic factor (BDNF), or abrineurin,[5] is a protein[6] that, in humans, is encoded by the BDNF gene.[7][8] ...
The cell then releases IL-2, which binds to its own new IL-2 receptors, causing self-stimulation and ultimately a monoclonal ... One approach used by tumors to upregulate growth and survival is through autocrine production of growth and survival factors. ... RANTES contribute to the maintenance of drug resistance by upregulating anti-apoptotic signals and inhibiting caspase cleavage ... For example, despite widespread expression of epidermal growth factor receptors (EGFRs) and EGF family ligands in non-small- ...
... are dependent on stimulation-protocol and genetic background". Exp Brain Res 179 (4): 621-30. PMID 17171334. doi:10.1007/s00221 ... funcionando como un factor de transcrición,[12][13] e actividades antimicrobianas (potencialmente asociadas con actividades ... "Beta-secretase cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE". Science 286 ( ... que son tamén un factor de risco tenmperán para a formación de amiloides. ...
Other factors, such as cell type, concurrent stimulation of other cytokines, or the amount of reactive oxygen species (ROS) can ... is released via proteolytic cleavage by the metalloprotease TNF alpha converting enzyme (TACE, also called ADAM17).[26] The ... TNF, DIF, TNF-alpha, TNFA, TNFSF2, Tumour necrosis factor, TNF-α, tumor necrosis factor, TNLG1F, Tumor necrosis factor alpha. ... Tumor necrosis factor (TNF, tumor necrosis factor alpha, TNFα, cachexin, or cachectin) is a cell signaling protein (cytokine) ...
Stimulation of the larynx by ingested matter produces a strong cough reflex in order to protect the lungs. ... The parietal cells in the fundus of the stomach, produce a glycoprotein called intrinsic factor which is essential for the ... further cleavage results in chymotripsin. ... The freed vitamin B12 then binds to intrinsic factor which is ... pancreatic enzymes break down the glycoprotein and free the vitamin which then binds with intrinsic factor. ...
He built a philosophy based in part on the idea of permanent cleavage between faith and reason. This was an existentialism ... likewise the one who has become addicted to promises and good intentions continually needs more and more stimulation-in order ... comparatively early and manifold philosophical and theological reception in Germany was one of the decisive factors of ...
These include mutations to the SF1 transcription factor, congenital adrenal hypoplasia due to DAX-1 gene mutations and ... Absent or insufficient levels of aldosterone stimulation of the renal distal tubule leads to sodium wasting in the urine and H+ ... The subunit ACTH undergoes further cleavage to produce alpha-MSH, the most important MSH for skin pigmentation. In secondary ... In suspected cases of Addison's disease, demonstration of low adrenal hormone levels even after appropriate stimulation (called ...
The rapid actions of ACTH include stimulation of cholesterol delivery to the mitochondria where the P450scc enzyme is located. ... P450scc catalyzes the first step of steroidogenesis that is cleavage of the side-chain of cholesterol. ACTH also stimulates ... As indicated above, ACTH is a cleavage product of the pro-hormone, proopiomelanocortin (POMC), which also produces other ... The long term actions of ACTH include stimulation of the transcription of the genes coding for steroidogenic enzymes, ...
eukaryotic translation initiation factor 3 complex, eIF3e. • eukaryotic translation initiation factor 3 complex, eIF3m. • ... "mTOR-dependent stimulation of the association of eIF4G and eIF3 by insulin". EMBO J. 25 (8): 1659-68. doi:10.1038/sj.emboj. ... "A novel form of DAP5 protein accumulates in apoptotic cells as a result of caspase cleavage and internal ribosome entry site- ... Eukaryotic initiation factor 3 (eIF3). References[edit]. *^ a b c GRCh38: Ensembl release 89: ENSG00000107581 - Ensembl, May ...
Stimulation of immune responseEdit. The human immune system is divided into two separate branches: the innate immune system and ... In contrast, siRNAs typically base-pair perfectly and induce mRNA cleavage only in a single, specific target.[23] In Drosophila ... including transcription factors as well as F-box proteins.[99] In many organisms, including humans, miRNAs are linked to the ... The dicer protein from Giardia intestinalis, which catalyzes the cleavage of dsRNA to siRNAs. The RNase domains are colored ...
... stimulation of DNA synthesis as well as mucosal protection from intraluminal injurious factors such as gastric acid, bile acids ... Cleavage products/derivatives with unknown target: Glypromate (GPE, (1-3)IGF-1) ... Transforming growth factor (Alpha) Epithelial cell Similar to Epidermal growth factor 4 Transforming growth factor (Beta) ... Selected Polypeptide Growth Factors[11][edit]. Sr.No Growth factor Source Major function ...
The stimulation causes neurons that make oxytocin to fire action potentials in intermittent bursts; these bursts result in the ... It has thus been hypothesized that this hormone may be a factor in xenophobic tendencies secondary to this effect. Thus, ... is a large peptide fragment of the larger precursor protein molecule from which oxytocin is derived by enzymatic cleavage. ... In a study measuring oxytocin serum levels in women before and after sexual stimulation, the author suggests it serves an ...
In the alternative pathway, C3b binds to Factor B. Factor D releases Factor Ba from Factor B bound to C3b. The complex of C3b(2 ... The end result of this complement activation or complement fixation cascade is stimulation of phagocytes to clear foreign and ... which promotes cleavage of C3 into C3a and C3b. C3b later joins with C4b2b to make C5 convertase (C4b2b3b complex). ... complement factor B, and complement factor I, as well as deletion of complement factor H-related 3 and complement factor H- ...
Kawas CH (2006). "Medications and diet: protective factors for AD?". Alzheimer Dis Assoc Disord 20 (3 Suppl 2): S89-96. PMID ... Chun W, Johnson GV (2007). "The role of tau phosphorylation and cleavage in neuronal cell death". Front Biosci 12: 733-56. doi: ... Spector A, Thorgrimsen L, Woods B, et al. (2003). "Efficacy of an evidence-based cognitive stimulation therapy programme for ... 114.0 114.1 Solfrizzi V, Capurso C, D'Introno A, et al. (Januari 2008). "Lifestyle-related factors in predementia and dementia ...
... with cleavage of the side chain.[14] The enzyme performing this task is cytochrome P450scc, located in the mitochondria, and ... response to acute adrenocorticotropin stimulation". J. Clin. Endocrinol. Metab. 54 (1): 187-91. doi:10.1210/jcem-54-1-187. PMID ... induce tubule polymerization in neuronal cultures and to increase neurite growth in PC12 cells treated with nerve growth factor ...
Cleavage products/derivatives with unknown target: Glypromate (GPE, (1-3)IGF-1) ... Warshamana-Greene G, Litz J, Buchdunger E, García-Echeverría C, Hofmann F, Krystal G (2005). "The insulin-like growth factor-I ... which allow increased activation of Akt independent of stimulation by EGFR.[26] ... Approximately 20% of drug resistance is caused by amplification of the hepatocyte growth factor receptor, which drives ERBB3 ...
... is a coagulation factor that inactivates tPA and urokinase. It is present in most cells, especially monocytes/macrophages. PAI- ... the target serine protease docks to PAI-2 and catalyzes cleavage of the RCL, between residues Arg-380 and Thr-381. At this ... Fibrinolysis (simplified). Blue arrows denote stimulation, and red arrows inhibition.. It is present only at detectable ... gene are associated with basal and tumor necrosis factor-alpha-induced transcription in monocytes". European Journal of ...
The cell then releases IL-2, which binds to its own new IL-2 receptors, causing self-stimulation and ultimately a monoclonal ... For example, despite widespread expression of epidermal growth factor receptors (EGFRs) and EGF family ligands in non-small- ... RANTES contribute to the maintenance of drug resistance by upregulating anti-apoptotic signals and inhibiting caspase cleavage ... Gene expression profiling revealed the prevalence of specific fibroblast growth factors (FGFs) and FGF receptors in NSCLC cell ...
Main article: Nipple stimulation. Nipples can be sensitive to touch, and nipple stimulation can incite sexual arousal.[50] Few ... any portion of the cleavage of the human female breast exhibited by a dress, blouse, skirt, leotard, bathing suit, or other ... "Prevalence and factors associated with cracked nipples in the first month postpartum". BMC Pregnancy and Childbirth. 16 (1): ... A few women can even experience orgasm from breast stimulation alone.. *^ a b Merril D. Smith (2014). Cultural Encyclopedia of ...
Smoking is a significant AD risk factor.[82] Systemic markers of the innate immune system are risk factors for late-onset AD.[ ... The efficacy of non-invasive brain stimulation and invasive brain stimulation in AD remains uncertain.[198] ... Chun W, Johnson GV (January 2007). "The role of tau phosphorylation and cleavage in neuronal cell death". Frontiers in ... in which environmental and genetic differences may act as risk factors. The best known genetic risk factor is the inheritance ...
Chun W, Johnson GV (2007). «The Role of Tau Phosphorylation and Cleavage in Neuronal Cell Death». Frontiers in Bioscience: A ... Kawas CH (2006). «Medications and Diet: Protective Factors for AD?». Alzheimer Disease and Associated Disorders. 20 (3 Supl. 2 ... Unique visual stimulation may be new treatment for Alzheimer'sNoninvasive technique reduces beta amyloid plaques in mouse ... Lott IT, Head E (2005). «Alzheimer Disease and Down Syndrome: Factors in Pathogenesis». Neurobiology of Aging. 26 (3): 383-89. ...
The order of cleavage depends on the order of insect. In the Lepidoptera, the order is as given here; ester cleavage preceding ... The primary control of juvenile hormone is by 1) the stimulation of the corpora allata by allatotropins short peptides which ... "Juvenile Hormone Stimulates Pheromonotropic Brain Factor Release in the Female Black Cutworm, Agrotis Ipsilon ." J. Insect ... Transfer of Juvenile Hormone During Copulation by Male to Female and Stimulation of Biosynthesis of Endogenous Juvenile Hormone ...
Factors of semen quality for the sperm provider.. *Level of DNA fragmentation[19] as measured e.g. by Comet assay, advanced ... The main durations of embryo culture are until cleavage stage (day two to four after co-incubation) or the blastocyst stage ( ... Louise Brown was born as a result of natural cycle IVF where no stimulation was made. The procedure took place at Dr Kershaw's ... Factors affecting IVF success - February 2011, from IVF-infertility.com *^ Siristatidis CS, Basios G, Pergialiotis V, Vogiatzi ...
Stimulation by ATII of the adrenal cortex to release aldosterone, a hormone that acts on kidney tubules, causes sodium and ... Brazilian scientist Sérgio Henrique Ferreira reported a bradykinin-potentiating factor (BPF) present in the venom of Bothrops ... Renin activates a circulating liver derived prohormone angiotensinogen by proteolytic cleavage of all but its first ten amino ... Stimulation of the posterior pituitary to release vasopressin (antidiuretic hormone, ADH) also acts on the kidneys to increase ...
... canonical signaling factors like Sonic hedgehog (SHH), Fibroblast growth factor (FGFs), WNTs and bone morphogenetic proteins ( ... which induces pro-IL-1β cleavage and sustains astrocyte activation. In this chronic signaling pathway, p38 is activated as a ... since the mid-1990s has shown that astrocytes propagate intercellular Ca2+ waves over long distances in response to stimulation ... and down-regulated by a number of different factors. One factor at the forefront of recent research is in the pain-potentiating ...
Factors reducing cortisol levels[edit]. *Magnesium supplementation decreases serum cortisol levels after aerobic exercise,[67][ ... Especially valuable for immune response is cortisol's stimulation of the superoxide dismutase,[13] since this copper enzyme is ... side-chain cleavage enzyme).[95] ... 6.1 Factors reducing cortisol levels. *6.2 Factors increasing ... Factors increasing cortisol levels[edit]. *Viral infections increase cortisol levels through activation of the HPA axis by ...
The orexin system was initially suggested to be primarily involved in the stimulation of food intake, based on the finding that ... Ghrelin is a short-term factor secreted by the stomach just before an expected meal, and strongly promotes food intake. ... produced by cleavage of a single precursor protein. Orexin-A is 33 amino acid residues long and has two intrachain disulfide ...
They described these observations in a 1959 publication, naming the responsible factor viral inhibitory factor (VIF).[47] It ... Whitehead KA, Dahlman JE, Langer RS, Anderson DG (2011). "Silencing or stimulation? siRNA delivery and the immune system". ... "Proteolytic cleavage of the reovirus sigma 3 protein results in enhanced double-stranded RNA-binding activity: identification ... Other cytokines, such as interleukin 1, interleukin 2, interleukin-12, tumor necrosis factor and colony-stimulating factor, can ...
File:TPP stimulation of KGDHC activity.jpg Figure 11:TPP stimulation of KGDHC activity in four cerebral cortex, hippocampus, ... Other Factors[edit]. Unlike the thiamine deficiency, pH and lactate level are found to have no effect on α-KGDHC activity in AD ... In general, Aβ peptide is produced by the cleavage of the parental amyloid precursor protein (APP) that is located at plasma ... it is thought to be caused by both genetic and environmental factors. The most significant risk factor for developing ...
Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins ... Cleavage+stimulation+factor at the US National Library of Medicine Medical Subject Headings (MeSH) v t e. ... CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3 end ... "Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor during the G0 to S phase transition". ...
cleavage stimulation factor 50 kDa subunit. cleavage stimulation factor, 3 pre-RNA, subunit 1, 50kD. cleavage stimulation ... CSTF1 cleavage stimulation factor subunit 1 [Homo sapiens] CSTF1 cleavage stimulation factor subunit 1 [Homo sapiens]. Gene ID: ... Cleavage stimulation factor subunit 1, dimerisation domain. * NM_001033522.2 → NP_001028694.1 cleavage stimulation factor ... CSTF1_dimer; Cleavage stimulation factor subunit 1, dimerisation domain. * NM_001324.3 → NP_001315.1 cleavage stimulation ...
The partial cleavage stimulation factor domain, or partial CstF domain, is a protein domain that occurs in proteins from ... However, it is homologous to the amino-terminal part of the cleavage stimulation factor, which is thought to be involved with ...
Browse our Cleavage stimulation factor 2 RNAi catalog backed by our Guarantee+. ... Cleavage stimulation factor 2 RNAi available through Novus Biologicals. ... Cleavage stimulation factor 64 kDa subunit RNAi, cleavage stimulation factor subunit 2 RNAi, cleavage stimulation factor, 3 ... Cleavage stimulation factor 2 RNAi. We offer Cleavage stimulation factor 2 RNAi for use in common research applications. Each ...
... cleavage stimulation factor 64 kDa subunit tau , cleavage stimulation factor 64 kDa subunit, tau , cleavage stimulation factor ... Target Cleavage Stimulation Factor, 3 Pre-RNA, Subunit 2, 64kDa, tau Variant (CSTF2T) * Cleavage Stimulation Factor, 3 Pre- ... anti-Cleavage Stimulation Factor, 3 Pre-RNA, Subunit 2, 64kDa Antikörper * anti-Cleavage Stimulation Factor, 3 Pre-RNA, ... cleavage stimulation factor, 3 pre-RNA subunit 2, tau (Cstf2t) Antikörper * cleavage stimulation factor subunit 2 tau variant ...
Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung ... Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung ... Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung ... Characterization of a Cleavage Stimulation Factor, 3′ pre-RNA, Subunit 2, 64 kDa (CSTF2) as a Therapeutic Target for Lung ...
"Cleavage Stimulation Factor" by people in this website by year, and whether "Cleavage Stimulation Factor" was a major or minor ... "Cleavage Stimulation Factor" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH ( ... It is a heterotrimer of 55-, 64- and 77-kDa subunits and combines with CLEAVAGE STIMULATION FACTOR to form a stable complex ... Below are the most recent publications written about "Cleavage Stimulation Factor" by people in Profiles. ...
One of the multiple factors required for polyadenylation and 3-end cleavage of mammalian pre-mRNAs. This subunit is directly ...
Cleavage stimulation factor 50 kDa subunit - CSTF 50 kDa subunit; CF-1 50 kDa subunit; CstF-50 \ 10-288-22329F for more ... CSTF2] Cleavage stimulation factor subunit 2 (CF-1 64 kDa subunit) (Cleavage stimulation factor 64 kDa subunit) (CSTF 64 kDa ... CPSF6 CFIM68] Cleavage and polyadenylation specificity factor subunit 6 (Cleavage and polyadenylation specificity factor 68 kDa ... CPSF7] Cleavage and polyadenylation specificity factor subunit 7 (Cleavage and polyadenylation specificity factor 59 kDa ...
Two distinct forms of the 64,000 Mr protein of the cleavage stimulation factor are expressed in mouse male germ cells. ... protein of the cleavage stimulation factor are expressed in mouse male germ cells. Together they form a unique fingerprint. * ...
RNA ligands selected by cleavage stimulation factor contain distinct sequence motifs that function as downstream elements in 3 ... RNA ligands selected by cleavage stimulation factor contain distinct sequence motifs that function as downstream elements in 3 ... and the binding of cleavage stimulation factor (CstF) via its 64-kDa subunit to the downstream element. The stability of this ... Critical events in 3-end processing of pre-mRNA are the recognition of the AAUAAA polyadenylation signal by cleavage and ...
In the present review, we will describe the structural properties of PTB, its paralogs and co-factors, the role in post- ... mRNA export factor Tap; PABP, Poly(A)-binding protein; CSTF64, cleavage stimulation factor 64; Y14, Y14 Magoh complex; HUD, Hu ... mRNA export factor Tap; PABP, Poly(A)-binding protein; CSTF64, cleavage stimulation factor 64; Y14, Y14 Magoh complex; HUD, Hu ... Additional factors, other than U2AF65, may antagonize the PTB repressive role such as the ETR3-like factor (CELF) proteins CUG- ...
cleavage and polyadenylation specificity factor. CstF. cleavage stimulation factor. GO. gene ontology. IVT. in vitro ... containing the cleavage stimulation factor (CstF) and the cleavage and polyadenylation specificity factor (CPSF), can identify ... transcription factor. Treg. regulatory T cell. UTR. untranslated region. WGCNA. weighted correlation network analysis.. ... The cleavage and polyadenylation of the pre-mRNA 3′ end are determined by the interaction of cis-acting elements with various ...
CSTF2: cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa; HNRNPK: heterogeneous nuclear ribonucleoprotein K; MRE11A: ... Bayes factor 11, p,0.0001) and telomere maintenance (Bayes factor 6, p,0.0001), possibly implicating COPD as a disease of ... The host factor in bronchitis. In: Bronchitis:an International Symposium, 27-29 April 1960, Gronigen. Assen, Royal Van Gorcum, ... CNSLD was defined to result from the interplay of endogenous factors like genetic predisposition, and exogenous factors like ...
cleavage stimulation factor subunit 1. protein-coding. LOC616964. olfactory receptor-like protein OLF4. protein-coding. ... ADP ribosylation factor like GTPase 5B. protein-coding. SCUBE3. signal peptide, CUB domain and EGF like domain containing 3. ... rho guanine nucleotide exchange factor 11-like. protein-coding. RSPH10B. radial spoke head 10 homolog B (Chlamydomonas). ...
Cleavage stimulation factor subunit 1 Show on y-axis - References (HTP + LTP). References (LTP). References (HTP). ...
cleavage stimulation factor, .... DGCR6. 8214. DGCR6. DiGeorge syndrome critical re.... DPF2. 5977. DPF2. D4, zinc and double ... TFT: transcription factor targets C4: computational gene sets CGN: cancer gene neighborhoods CM: cancer modules C5: GO gene ...
Cleavage stimulation factor subunit 2 tau variant Show on y-axis - References (HTP + LTP). References (LTP). References (HTP). ...
Cleavage stimulation factor subunit 1, CF-1 50 kDa subunit, Cleavage stimulation factor 50 kDa subunit, CSTF 50 kDa subunit, ... Cleavage stimulation factor subunit 1 (CSTF1) is involved in the polyadenylation and 3end cleavage of pre-mRNAs. The CSTF1 ... gene encodes one of three subunits which merge to produce cleavage stimulation factor (CSTF). Like the mammalian G protein beta ... CSTF1 is one of the numerous factors necessary for polyadenylation and 3-end cleavage of mammalian pre-mRNAs. CSTF1 is ...
Gene Name: cleavage stimulation factor, 3 pre-RNA, subunit 2 Anatomy terms ...
Cleavage stimulation factor subunit 2 Assay Type: SYBR® Green Assay Design: Intron-spanning Application: Gene Expression Unique ... Cleavage stimulation factor subunit 2 Assay Type: Probe Assay Design: Intron-spanning Application: Gene Expression Unique Assay ... Control assays and synthetic DNA templates were designed to facilitate the assessment of the key experimental factors impacting ...
The protein is a member of the cleavage stimulation factor (CSTF) complex that is involved in the 3' end cleavage and ... cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa Assay Type: Probe Assay Design: exonic Application: Gene Expression ... cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa Assay Type: SYBR® Green Assay Design: exonic Application: Gene ... cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa Assay Type: SYBR® Green Assay Design: Intron-spanning Application: ...
cleavage stimulation factor, 3 pre-RNA,.... 1485. 1485. CTAG1B. cancer/testis antigen 1B. ... TFT: transcription factor targets C4: computational gene sets CGN: cancer gene neighborhoods CM: cancer modules C5: GO gene ...
Cleavage stimulation factor. 7. 3. Roxan (protein). less than 5 views. Parent categories. *Proteins ...
... and cleavage stimulation factor, 3′ pre-RNA subunit 2, tau-null (Cstf2t-null) mice have a failure of spermiation (53). ... E) Ladder RNA fragments were generated by cleavage of poly(A) tail. Total testis RNA of WT and Paip2a/Paip2b-DKO mice was ... C) Crosslinking of initiation factors to the cap structure. Control RRL (lanes 1 and 2) or Pabp-depleted RRL (lanes 3-5) was ... Null mice for the transcription factor SRY-related HMG box 8 (Sox8) show age-dependant spermatogenesis disorganization and ...
Mouse cleavage stimulation factor, 3 pre-RNA subunit 2 (cDNA clone MGC:36412 IMAGE:5322335) available for purchase from ... CSTF2 (untagged)-Human cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa (CSTF2). $190. Next day. ... Lenti ORF clone of Human cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa (CSTF2) , Myc-DDK-tagged. $740. 3 weeks. ... Lenti ORF clone of Human cleavage stimulation factor, 3 pre-RNA, subunit 2, 64kDa (CSTF2) , Myc-DDK-tagged. $740. 4 weeks. ...
CF-1 64 kDa subunit,OTTHUMP00000024310,betaCstF-64 variant 2,cleavage stimulation factor subunit 2,cleavage stimulation factor ... The protein is a member of the cleavage stimulation factor (CSTF) complex that is involved in the 3 end cleavage and ...
The closest Arabidopsis homologue has been annotated as a putative cleavage stimulation factor subunit 1 (BAB10643). ...
Mouse cleavage stimulation factor 3 pre-RNA subunit 3 (Cstf3) transcript variant 2, (10ug) available for purchase from OriGene ... CSTF3 (untagged)-Human cleavage stimulation factor, 3 pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 2. $390. 3 weeks. ... CSTF3 (untagged)-Human cleavage stimulation factor, 3 pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 3. $390. 2 weeks. ... CSTF3 (untagged)-Human cleavage stimulation factor, 3 pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 1. $700. Next day ...
a, antibody HPR000427 generated toward the 61-kDa cleavage stimulation factor subunit encoded by the CSTF2 gene located on the ... Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000) RNAi: double-stranded RNA directs the ATP-dependent cleavage ... The protein may play a role in central nervous system development by interacting with growth factors implicated in motor neuron ... Tirode, F., Busso, D., Coin, F., and Egly, J. M. (1999) Reconstitution of the transcription factor TFIIH: assignment of ...
  • Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins CSTF1 (55kDa), CSTF2 (64kDa) and CSTF3 (77kDa), totalling about 200 kDa. (wikipedia.org)
  • CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3' end to promote the synthesis of a functional polyadenine tail, which results in a mature mRNA molecule ready to be exported from the cell nucleus to the cytosol for translation. (wikipedia.org)
  • This gene encodes one of three subunits which combine to form cleavage stimulation factor (CSTF). (nih.gov)
  • CSTF is involved in the polyadenylation and 3'end cleavage of pre-mRNAs. (nih.gov)
  • The BARD1 C-terminal domain structure and interactions with polyadenylation factor CstF-50. (nih.gov)
  • The partial cleavage stimulation factor domain, or partial CstF domain, is a protein domain that occurs in proteins from apicomplexan parasites. (wikipedia.org)
  • Critical events in 3'-end processing of pre-mRNA are the recognition of the AAUAAA polyadenylation signal by cleavage and polyadenylation specificity factor (CPSF) and the binding of cleavage stimulation factor (CstF) via its 64-kDa subunit to the downstream element. (unibas.ch)
  • The CSTF1 gene encodes one of three subunits which merge to produce cleavage stimulation factor (CSTF). (prospecbio.com)
  • CSTF1 is responsible for the interaction of CSTF with other factors to create a stable complex on the pre-mRNA. (prospecbio.com)
  • The specificity and efficiency of this process are determined by the binding of two core multi-protein complexes (CPSF and CSTF, for "cleavage and polyadenylation specificity factor" and "cleavage stimulation factor") to sequences surrounding the poly(A) site as soon as the nascent pre-mRNA transcript emerges from the elongating RNA polymerase II (POL2). (springer.com)
  • Cleavage stimulation factor subunit 3 (CSTF3 or CstF-77) and crooked neck-like protein 1 (CRNKL1) from mammals. (embl.de)
  • IE63 expression leads to enhanced binding of cleavage stimulation factor (CstF) to the polyadenylation signal of HSV genes ( 43 , 44 ), and IE63 has recently been shown to shuttle between the nucleus and cytoplasm, indicating a role in facilitating RNA transport ( 60 , 68 , 83 ). (asm.org)
  • CSTF3 is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). (lsbio.com)
  • Quiescent fibroblasts contain reduced levels of the cleavage and polyadenylation factor CstF-64. (biomedcentral.com)
  • CSTF1 is one of three (including CSTF2 and CSTF3) cleavage stimulation factors which combine to form CSTF which is involved in the polyadenylation and 3'end cleavage of pre-mRNAs. (lsbio.com)
  • The PAS2 read-through occurs due to a reduced recruitment of the CstF-64 subunit of the pre-mRNA cleavage stimulation factor in the presence of the GRE-bound HuR. (ntu.edu.sg)
  • Connects PAF1C with the cleavage and polyadenylation specificity factor (CPSF) complex and the cleavage stimulation factor (CSTF) complex, and with Wnt signaling. (nih.gov)
  • It is involved in the cleavage of the 3' signaling region from a newly synthesized pre-messenger RNA (mRNA) molecule. (wikipedia.org)
  • However, it is homologous to the amino-terminal part of the cleavage stimulation factor, which is thought to be involved with mRNA maturation in mammals. (wikipedia.org)
  • A RNA-binding protein that stimulates the cleavage of the 3' end of MRNA near the POLYADENYLATION site. (rush.edu)
  • It is a heterotrimer of 55-, 64- and 77-kDa subunits and combines with CLEAVAGE STIMULATION FACTOR to form a stable complex with mRNA that directs the 3' cleavage and polyadenylation reaction. (rush.edu)
  • The Drosophila melanogaster suppressor of forked [Su(f)] protein shares homology with the Saccharomyces cerevisiae RNA14 protein and the 77 kDa subunit of Homo sapiens cleavage stimulation factor, which are proteins involved in mRNA 3' end formation. (ebi.ac.uk)
  • Using the polymerase processivity factor BMRF1 as an example, we found that in transfected cells, total BMRF1 mRNA levels were unaffected by Mta but that the amounts of cytoplasmic BMRF1 RNA and protein were greatly increased in the presence of Mta. (asm.org)
  • RNA sequencing of fibroblasts induced into quiescence by contact inhibition reveals downregulation of genes involved in mRNA processing, including splicing and cleavage and polyadenylation factors. (biomedcentral.com)
  • Transcription factor S-II (TFIIS) induces mRNA cleavage by enhancing the intrinsic nuclease activity of RNA polymerase (Pol) II, past template-encoded pause sites. (ebi.ac.uk)
  • Heterogeneity and tissue-specific expression of eukaryotic transcription factor S-II-related protein mRNA. (ebi.ac.uk)
  • Architecture of the RNA polymerase II-TFIIS complex and implications for mRNA cleavage. (ebi.ac.uk)
  • In eukaryotes, 3′ end cleavage of transcripts generated by RNA polymerase II (pol II) is a universal step of gene expression that proceeds through the recognition of cis -acting elements of the pre-messenger RNA (mRNA) [defined as the poly(A) signal] by a complex machinery. (pubmedcentralcanada.ca)
  • Although cleavage and polyadenylation can be studied as isolated processes in vitro , mRNA 3′ end formation in vivo is an integral component of the coupled network in which the different machines carrying out separate steps of the gene expression pathway are tethered to each other to form a gene expression factory. (pubmedcentralcanada.ca)
  • The functional interdependence between splicing and 3′ end processing is mediated by the molecular link between splicing factors bound at the last intron 3′ splice site and pA factors associated to the poly(A) signal in the terminal exon [( 12-16 ) and references inside] and contributes to define the last exon of a pre-mRNA ( 17 ). (pubmedcentralcanada.ca)
  • mRNA Cleavage and Polyadenylation Factors" is a descriptor in the National Library of Medicine's controlled vocabulary thesaurus, MeSH (Medical Subject Headings) . (umassmed.edu)
  • This graph shows the total number of publications written about "mRNA Cleavage and Polyadenylation Factors" by people in this website by year, and whether "mRNA Cleavage and Polyadenylation Factors" was a major or minor topic of these publications. (umassmed.edu)
  • Below are the most recent publications written about "mRNA Cleavage and Polyadenylation Factors" by people in Profiles. (umassmed.edu)
  • PAF1C is involved in mRNA 3' end formation probably through association with cleavage and poly(A) factors. (nih.gov)
  • This protein appears to facilitate the association of 3' mRNA processing factors with actively-transcribed chromatin. (nih.gov)
  • A human polyadenylation factor is a G protein beta-subunit homologue. (nih.gov)
  • Altogether more than 700 proteins were analyzed representing all major types of protein families, i.e. protein receptors, kinases, phosphatases, transcription factors, and nuclear receptors. (mcponline.org)
  • Both TNFAIP3 (A20, at the protein level) and REL are key mediators in the nuclear factor kappa B (NF-kappaB) inflammatory signalling pathway. (genes2cognition.org)
  • To identify new cancer biomarkers and therapeutic targets for colorectal cancers (CRCs), we performed immunohistochemical analysis using tissue microarrays covering archival tumor tissue samples from 434 CRC patients and antibodies to cell division cycle-associated protein 1 (CDCA1) that was originally identified as an oncoantigen by our gene expression profile database, and compared its expression with several clinicopathological factors. (spandidos-publications.com)
  • In an initial evaluation of the requirements for oriLyt replication in a cotransfection replication assay, both Zta and Mta were required to obtain replication in transfected Vero cells in addition to the six core replication genes, BMRF1 (polymerase-associated factor), BALF2 (single-stranded DNA binding protein), BALF5 (DNA polymerase), BSLF1 (primase), BBLF4 (helicase), and BBLF2/3 (primase accessory protein) ( 19 ). (asm.org)
  • Publications] K.Saso, T.Ito, S.Natori, K.Sekimizu: 'Identification of a novel tissue-specific transcriptional activator FESTA as a protein that interacts with the transcription elongation factor S-II. (nii.ac.jp)
  • A large number of protein factors associates with this machinery to regulate the efficiency and specificity of this process and to mediate its interaction with other nuclear events. (pubmedcentralcanada.ca)
  • Tumor necrosis factor alpha-induced protein 3 (TNFAIP3) is an anti-inflammatory protein implicated in multiple autoimmune and rheumatologic conditions. (frontiersin.org)
  • For example, transcript elongation factor TFIIS is highly conserved among eukaryotes, and yet the TFIIS protein from Saccharomyces cerevisiae cannot function with mammalian RNA polymerase II and vice versa. (embl-heidelberg.de)
  • Lastly, we showed that Tip110 protein interacted with cleavage stimulation factor 64 (CstF64) protein and that more CstF64 was recruited to the promixal polyadenylation site than the distal polyadenylation site within its 3′UTR. (unthsc.edu)
  • For rhinoviruses and enteroviruses, the shutoff has been explained in part by the cleavage of eukaryotic initiation factor 4GI (eIF4GI), a component of the cap-binding protein complex eIF4F. (asm.org)
  • The inhibition of host protein synthesis after infection with human rhinovirus 14 (HRV-14) lags behind the cleavage of eIF4GI. (asm.org)
  • Recently, we discovered a functional homolog of eIF4GI, termed eIF4GII, and showed that cleavage of eIF4GII coincides with the shutoff of host cell protein synthesis after poliovirus infection (Gradi et al. (asm.org)
  • We wished to determine whether eIF4GII cleavage kinetics could also explain the lack of correlation between the kinetics of eIF4GI cleavage and the shutoff of host protein synthesis after rhinovirus infection. (asm.org)
  • In this study, we examined the correlation between human rhinovirus-induced shutoff of host protein synthesis and cleavage of eIF4GI and eIF4GII. (asm.org)
  • These results suggest that cleavage of both eIF4GI and eIF4GII is required for HRV-mediated inhibition of host cell protein synthesis and that the cleavage of eIF4GII is the rate-limiting step in the shutoff of host cell protein synthesis after rhinovirus infection. (asm.org)
  • Protease 2A pro performs the initial cleavage of the nascent polyprotein that liberates the capsid protein precursor (P1), while 3C pro is responsible for the remaining cleavage events ( 33 ). (asm.org)
  • In rhinovirus- and enterovirus-infected cells, a cap-binding protein complex, the eukaryotic initiation factor 4F (eIF4F), is altered, both structurally and functionally ( 11 ). (asm.org)
  • In addition, cap-independent viral protein synthesis is stimulated by the C-terminal cleavage product of eIF4G of several ( 6 , 31 , 47 , 48 ), but not all ( 5 , 41 ), picornaviruses. (asm.org)
  • The transactivation of epidermal growth factor receptor (EGFR)-dependent signalling pathways upon stimulation of G-protein-coupled receptors (GPCRs), which are critical for the mitogenic activity of ligands such as lysophosphatidic acid, endothelin, thrombin, bombesin and carbachol, provides evidence for such an interconnected communication network. (nih.gov)
  • Bone morphogenetic protein 7 (BMP-7) belongs to the BMP family and to the transforming growth factor β (TGF-β) superfamily. (miltenyibiotec.com)
  • These responses were partly attributable to activation of other MMPs, notably MMP-3 and MMP-8, and to stimulation of the mitogen-activated protein kinase and phosphatidylinositol 3-kinase signaling pathways. (aacrjournals.org)
  • Using a proteomic approach, we identified insulin-like growth factor binding protein-5 (IGFBP-5) as a previously unsuspected target of MMP-7 produced by colonic myofibroblasts. (aacrjournals.org)
  • Using a proteomic approach, we identify insulin-like growth factor binding protein-5 (IGFBP-5) as a previously unidentified substrate of MMP-7 and provide evidence that the effects of MMP-7 are a consequence of liberation of IGF-II which then acts as an autocrine growth factor. (aacrjournals.org)
  • The most prominent stimulatory effect (threefold to about sixfold) of GreA was observed for genes of ribosomal protein operons and the tna operon, suggesting that transcript cleavage by GreA contributes to optimal expression levels of these genes in vivo. (asm.org)
  • The M proteins also possess an unusual hexapeptide-repeat region rich in methionine and arginine residues (MR repeat motif) that resembles a repeat in the 64kDa subunit of cleavage stimulation factor, which is involved in 3'-end maturation of pre-mRNAs. (thermofisher.com)
  • In this process, we detected a gene encoding cleavage stimulation factor, 3′ pre-RNA, subunit 2, 64 kDa (CSTF2) as a candidate. (aacrjournals.org)
  • Immunohistochemical analysis using tissue microarray showed an association of strong CSTF2 expression with poor prognosis of patients with non-small cell lung cancer ( P = 0.0079), and multivariate analysis showed that CSTF2 positivity is an independent prognostic factor. (aacrjournals.org)
  • Because there is a significant correlation of cleavage stimulation factor, 3′ pre-RNA, subunit 2, 64 kDa (CSTF2) expression with poor prognosis for patients with lung cancers, CSTF2 positivity in resected specimens could be an index that provides useful information to physicians in applying adjuvant therapy and intensive follow-up to the cancer patients who are likely to relapse. (aacrjournals.org)
  • This systematic approach revealed that cleavage stimulation factor, 3′ pre-RNA, subunit 2, 64 kDa ( CSTF2 ) gene was frequently transactivated in the majority of primary lung cancers. (aacrjournals.org)
  • Grozdanov, P. N. and MacDonald, C. C. (2015) "Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1α promoter using the Gibson assembly cloning. (ttuhsc.edu)
  • Caspase activity results in the cleavage of several cellular proteins, which leads to the apoptotic response (for a review, see reference 7). (rupress.org)
  • This domain is found in the central region of transcription elongation factor S-II and in several hypothetical proteins. (ebi.ac.uk)
  • The collection of newly identified proteins includes many candidate regulators of primary mesenchyme morphogenesis, including PMC-specific extracellular matrix proteins, cell surface proteins, spicule matrix proteins and transcription factors. (biologists.org)
  • High mobility group proteins 1 and 2 function as general class II transcription factors. (semanticscholar.org)
  • Are DNA transcription factor proteins maxwellian demons? (semanticscholar.org)
  • In conclusion, we demonstrate that neutrophil-derived ROI modify selected serum proteins, which, in turn, act as proinflammatory mediators of neutrophil stimulation. (jimmunol.org)
  • In addition to digestion of extracellular matrix proteins, it is now clear that MMP-7 like other MMPs, may act on a variety of substrates to liberate growth factors and other signaling molecules, thereby potentially producing a diverse range of cellular responses ( 3 , 8 , 12 , 14 , 15 ). (aacrjournals.org)
  • The Arabidopsis ( Arabidopsis thaliana ) gene that encodes the probable ortholog of the 30-kD subunit of the mammalian cleavage and polyadenylation specificity factor (CPSF) is a complex one, encoding small (approximately 28 kD) and large (approximately 68 kD) polypeptides. (plantphysiol.org)
  • Putative tfIIs gene of Sulfolobus acidocaldarius encoding an archaeal transcription elongation factor is situated directly downstream of the gene for a small subunit of DNA-dependent RNA polymerase. (ebi.ac.uk)
  • Isolation and characterization of a cDNA encoding a new type of human transcription elongation factor S-II. (ebi.ac.uk)
  • Nowadays, S-II is recognized as a transcription elongation factor ubiquitously present in eukaryotic cells. (nii.ac.jp)
  • Publications] T.Ubukata, T.Shimizu, N.Adachi, K.Sekimizu, T.Nakanishi: 'Cleavage, but not read-through, stimulation activity is responsible for three biologic functions of transcription elongation factor S-II. (nii.ac.jp)
  • Publications] H.Koyama, T.Ito, T.Nakanishi, N.Kawamura, K.Sekimizu: 'Transcription elongation factor S-II maintains transcriptional fidelity and confers oxidative stress resistance. (nii.ac.jp)
  • Publications] T.Ubukata, T.Shimizu, N.Adachi, K.Sekimizu, T.Nakanishi: 'Cleavage, but not read-through, stimulation activity is responsible for three biologic functions of transcription elongation factor S-II'J Biol Chem. (nii.ac.jp)
  • TFIIS is a transcription elongation factor that consists of three domains. (embl-heidelberg.de)
  • The RPB9 subunit of RNA polymerase II regulates transcription elongation activity and is required for the action of the transcription elongation factor, TFIIS. (embl-heidelberg.de)
  • Here, we demonstrate, using RNA interference, that the TFIIS4 gene encoding a development-specific homolog of RNA polymerase II elongation factor TFIIS, is indispensable for ncRNA synthesis in the new somatic nucleus. (prolekare.cz)
  • Transcription elongation factor GreA induces nucleolytic activity of bacterial RNA polymerase (RNAP). (asm.org)
  • An arrested complex can resume transcript elongation only following endonucleolytic cleavage of the nascent RNA that generates a new 3′ end of the transcript in the RNAP catalytic center. (asm.org)
  • The current model suggests that after apoptotic stimulation, activation of "upstream" caspases containing a large prodomain such as caspase-8, -2, or -9 leads to the proteolytic cleavage of "downstream" caspases (caspase-3, -6, and -7), which mediate the apoptotic response ( 1 )( 6 ). (rupress.org)
  • Furthermore, AIMP1 is involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. (prospecbio.com)
  • The initial steps take place in the nucleus where promoter recognition, mediated by transcription factors, requires chromatin and nucleosome modifications driven by epigenetic events, and allows the regulation of the RNA polymerase transcriptional activity. (mdpi.com)
  • Most importantly, caspase activity results in a selective substrate specificity, since poly(ADP-ribose) polymerase (PARP), lamin B, and Wee1 kinase, but not DNA fragmentation factor (DFF45) or replication factor C (RFC140), are processed. (rupress.org)
  • S-II was originally identified as a stimulatory factor of RNA polymerase II in vitro. (nii.ac.jp)
  • Human transcription factor IIIC (hTFIIIC) is a multisubunit complex that mediates transcription of class III genes through direct recognition of promoters (for tRNA and virus-associated RNA genes) or promoter-TFIIIA complexes (for the 5S RNA gene) and subsequent recruitment of TFIIIB and RNA polymerase III. (embl-heidelberg.de)
  • Activation of Jun kinase and NFkappaB and poly(ADP-ribose) polymerase cleavage are identical in mock- and nSMase-transfected cells. (mendeley.com)
  • This process, which consists in the recognition of defined poly(A) signals of the pre-mRNAs by a large cleavage/polyadenylation machinery, plays a critical role in gene expression. (pubmedcentralcanada.ca)
  • The polyadenylation machinery recognizes a combination of two patterns: a conserved AAUAAA consensus polyadenylation signal located between 10 and 30 nucleotides upstream of the cleavage site, and a relatively flexible GU-rich enhancer element located between 20 and 40 nucleotides downstream of the cleavage site [ 10 , 11 ]. (biomedcentral.com)
  • Cis-acting regulatory sequence elements are sequences contained in the 3′ and 5′ untranslated region, introns, or coding regions of precursor RNAs and mature mRNAs that are selectively recognized by a complementary set of one or more trans-acting factors to regulate posttranscriptional gene expression. (intechopen.com)
  • The mechanisms that regulate cleavage of proNGF, therefore, are critical determinants of whether this factor promotes neuronal survival or death. (jneurosci.org)
  • Background: Interferon regulatory factors (IRFs) comprise a family of transcription factors that function within the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection (1). (cellsignal.com)
  • However, the mechanisms that regulate caspase-3 cleavage remain elusive. (ahajournals.org)
  • In contrast, the factors derived from normal or neoplastic epithelial cells that might regulate the proliferation and migration of myofibroblasts remain relatively poorly understood. (aacrjournals.org)
  • TFIIS is a modular factor that comprises an N-terminal domain I, a central domain II, and a C-terminal domain III [ PMID: 12914699 ]. (ebi.ac.uk)
  • Two essential and invariant acidic residues in a TFIIS loop complement the Pol II active site and could position a metal ion and a water molecule for hydrolytic RNA cleavage. (ebi.ac.uk)
  • Structure of a conserved domain common to the transcription factors TFIIS, elongin A, and CRSP70. (embl-heidelberg.de)
  • The Rpc11p subunit of Pol III shows homology with the zinc ribbon of TFIIS and is known to mediate RNA 3′ cleavage and to be important for termination. (pubmedcentralcanada.ca)
  • The mature form of BMP-7 is generated by cleavage of the signal peptide and propeptide, and homo-dimerization. (miltenyibiotec.com)
  • Edwalds-Gilbert G, Milcarek C: Regulation of poly(A) site use during mouse B-cell development involves a change in the binding of a general polyadenylation factor in a B-cell stage-specific manner. (springer.com)
  • Indeed, 3′ end polyadenylation factors (or pA factors, including factors involved in both cleavage and polyadenylation) and sequence elements of the poly(A) signal modulate transcription termination ( 2-5 ) and, in turn, transcription factors/activators affect processing at the poly(A) signal ( 6-9 ). (pubmedcentralcanada.ca)
  • This inverse correlation between caspase-3 glutathiolation and cleavage was further confirmed by the observation that in vitro glutathiolation of caspase-3 inhibited its cleavage with recombinant caspase-8. (ahajournals.org)
  • In the presence of Ag-MHC stimulation and IL induction, naive CD4 + T cells are activated and differentiated into subsets, including Th1, Th2, Th17, and regulatory T cells (Treg) ( 1 - 3 ). (jimmunol.org)
  • Naive T cells are primed for Th1 cells in the presence of IL-12 and express transcription factor (TF) T-bet, which in turn facilitates the production of the type 1 cytokine IFN-γ ( 4 , 5 ). (jimmunol.org)
  • Examination of Mta localization in transfected cells by indirect immunofluorescence revealed that Mta colocalized with the splicing factor SC35. (asm.org)
  • Grx activity was significantly upregulated by tumor necrosis factor-α in endothelial cells. (ahajournals.org)
  • Analysis of dermal excisional wounds in mice reveals that proliferating cells adjacent to wounds express higher levels of cleavage and polyadenylation factors than quiescent fibroblasts in unwounded skin. (biomedcentral.com)
  • We also discovered that APA factors are functionally important for the transition to a more migratory state in proliferating versus quiescent fibroblasts and affect migration in cancer cells as well. (biomedcentral.com)
  • Cleavage (embryo), in embryology, is the division of cells in the early embryo. (primidi.com)
  • In cell biology, the Cleavage furrow is the indentation that begins the process of cleavage, by which animal cells undergo cytokinesis. (primidi.com)
  • however, it was concluded that the major eIF4G-specific cleavage activity in poliovirus-infected HeLa cells is not associated with a 2A pro ( 8 ). (asm.org)
  • As part of the innate immune system, inflammasome activation has been identified in RPE cells and proposed to be a causal factor for RPE dysfunction and degeneration. (hindawi.com)
  • Here, we will first review the classic model of inflammasome activation, then discuss the potentials of AMD-related factors to activate the inflammasome in both nonocular immune cells and RPE cells, and finally introduce several novel mechanisms for regulating the inflammasome activity. (hindawi.com)
  • Thus, MMP-7 may act as a signal from epithelial cells for local recruitment of myofibroblasts and stimulation of their proliferation. (aacrjournals.org)
  • Subepithelial cells (e.g., myofibroblasts) produce a variety of key growth factors thought to play a role both in the maintenance of normal epithelial cell proliferation and to drive tumor growth ( 1 ). (aacrjournals.org)
  • Furthermore, we demonstrate both in vitro and in vivo that exogenous MMP-7 enhances proNGF cleavage and provides neuroprotection following kainic acid treatment. (jneurosci.org)
  • In vitro, transcript cleavage by GreA contributes to transcription efficiency by (i) suppressing pauses and arrests, (ii) stimulating RNAP promoter escape, and (iii) enhancing transcription fidelity. (asm.org)
  • To date, a lot of molecular targeting agents have been used in the clinical practice of lung cancer treatment, including tyrosine kinase inhibitors of epidermal growth factor or VEGF as well as monoclonal antibodies against them ( 4, 5 ). (aacrjournals.org)
  • One unifying concept states that posttranscriptional regulation is mediated by two major molecular components: cis-acting regulatory sequence elements and trans-acting factors. (intechopen.com)
  • Here, we review the eukaryotic 3′ end processing machineries as well as the comprehensive set of regulatory factors and discuss the different molecular mechanisms of 3′ end processing regulation by proposing several overlapping models of regulation. (pubmedcentralcanada.ca)
  • Caspase-3 cleavage was also reported during T cell stimulation in the absence of apoptosis, although the physiological relevance of this response remains unclear. (rupress.org)
  • We show here that the caspase inhibitor benzyloxycarbonyl (Cbz)-Val-Ala-Asp(OMe)-fluoromethylketone (zVAD) blocks proliferation, major histocompatibility complex class II expression, and blastic transformation during stimulation of peripheral blood lymphocytes. (rupress.org)
  • Caspase-3 cleavage also occurs in vivo during negative selection of thymocytes through TCR signaling, where only the p17 is detected ( 4 )( 5 ). (rupress.org)
  • A critical substrate for caspase-3 during apoptosis is the 45-kD subunit of DNA fragmentation factor (DFF45) that once cleaved by caspase-3 activates DNA fragmentation by releasing the caspase-activated DNase ( 14 )( 15 )( 16 ). (rupress.org)
  • Caspase-3 cleavage and activation are known to play central roles in apoptosis. (ahajournals.org)
  • Here we show the essential role of Grx in caspase-3 cleavage via regulation of caspase-3 glutathiolation. (ahajournals.org)
  • Small interference RNA knock down of Grx significantly inhibited tumor necrosis factor-α-induced endothelial cell death because of attenuated caspase-3 cleavage concomitant with increased caspase-3 glutathiolation. (ahajournals.org)
  • Enhanced caspase-3 cleavage by wild-type Grx overexpression was reversed by catalytically inactive Grx (C22S), demonstrating a requirement for thioltransferase activity. (ahajournals.org)
  • Cysteine-to-serine mutations (C163S, C184S, and C220S) of caspase-3 that were predicted to prevent glutathiolation showed increased cleavage compared with wild-type caspase-3. (ahajournals.org)
  • Furthermore, Grx association with caspase-3 was decreased by tumor necrosis factor-α. (ahajournals.org)
  • These findings demonstrate a novel mechanism of caspase-3 regulation by Grx in tumor necrosis factor-α-induced apoptosis. (ahajournals.org)
  • Specifically, we show that Grx plays a key role in caspase-3 cleavage by regulating caspase-3 glutathiolation in response to TNF-α, thereby modulating TNF-α-induced death signaling. (ahajournals.org)
  • Although significant progress has been made in identifying the factors and steps involved in targeting nuclear mRNPs to NPCs for export, very little is still understood about the exact mechanisms involved in their translocation through NPCs. (asm.org)
  • The C-terminal cleavage product of eIF4G interacts with eIF4A and eIF3 and supports cap-independent translation ( 6 , 31 , 37 ). (asm.org)
  • This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. (lsbio.com)
  • The phosphorylated carboxyl-terminal domain (CTD) of pol II also plays a major role in this coupling network by serving as a gathering/delivering platform of pA factors and is an integral component of the 3′ end processing complex (10, 11 ). (pubmedcentralcanada.ca)
  • Being a complex disease, the pathogenesis and progression of AMD are influenced by a variety of risk factors. (hindawi.com)
  • Alternative processing of pre-mRNAs is an important factor in sculpting the proteome of eukaryotes, including plants. (plantphysiol.org)
  • One of the multiple factors required for polyadenylation and 3'-end cleavage of mammalian pre-mRNAs. (rcsb.org)
  • After cleavage, most pre-mRNAs, with the exception of histone replication-dependent transcripts, acquire a polyadenylated tail. (pubmedcentralcanada.ca)
  • Background: The Stat3 transcription factor is an important signaling molecule for many cytokines and growth factor receptors (1) and is required for murine fetal development (2). (cellsignal.com)
  • For example, cetuximab, a therapeutic antibody to an epidermal growth factor receptor (EGFR), was reported to be effective in CRC treatment. (spandidos-publications.com)
  • Here we show that EGFR transactivation upon GPCR stimulation involves proHB-EGF and a metalloproteinase activity that is rapidly induced upon GPCR-ligand interaction. (nih.gov)
  • Helicobacter pylori transactivates the Epidermal Growth Factor Receptor (EGFR) and predisposes to gastric cancer development in humans and animal models. (mdpi.com)
  • tumor necrosis factor receptor superfami. (broadinstitute.org)
  • Nerve growth factor (NGF) influences neuronal survival through binding with the TrkA receptor ( Levi-Montalcini, 1964 , 1987 ). (jneurosci.org)
  • Our Cleavage stimulation factor 2 RNAi can be used in a variety of model species: Human. (novusbio.com)
  • Finally and most intriguingly, we will discuss to what extent alternative cleavage and polyadenylation represent the driver or passenger in the pathogenesis of human disorders. (springer.com)
  • Region between residue 550 and 600 of human cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD using the numbering given in entry NP_001317.1 (GeneID 1479). (lsbio.com)
  • Domain I is conserved in evolution from yeast to human species and is homologous to the transcription factors elongin A and CRSP70. (embl-heidelberg.de)
  • We present evidence that the MMP-7 cleavage of IGFBP-5 liberates IGF-II that functions as an autocrine myofibroblast growth factor. (aacrjournals.org)
  • We found that APA factors are expressed at lower levels as fibroblasts become quiescent, and that knockdown of these factors results in APA and gene expression changes that overlap with the changes that occur with quiescence. (biomedcentral.com)
  • By comparing global gene expression profiles of Escherichia coli strains lacking Gre factors and strains expressing either the wild type (wt) or a functionally inactive GreA mutant, we identified genes that are potential targets of GreA action. (asm.org)
  • We propose that transcript cleavage during early stages of initiation is thus the main in vivo function of GreA. (asm.org)
  • Our findings support cleavage and polyadenylation factors as a link between cellular proliferation state and migration. (biomedcentral.com)
  • Despite the sequence similarities, there are many factors that do not function across species. (embl-heidelberg.de)