Cleavage And Polyadenylation Specificity Factor: An RNA-binding protein that recognizes the AAUAAA RNA SEQUENCE at the 3' end of MRNA. It contains four subunits of 30, 73, 100 and 160 kDa molecular size and combines with CLEAVAGE STIMULATION FACTOR to form a stable complex with mRNA that directs the 3' cleavage and polyadenylation reaction.mRNA Cleavage and Polyadenylation Factors: Factors that are involved in directing the cleavage and POLYADENYLATION of the of MESSENGER RNA near the site of the RNA 3' POLYADENYLATION SIGNALS.Polyadenylation: The addition of a tail of polyadenylic acid (POLY A) to the 3' end of mRNA (RNA, MESSENGER). Polyadenylation involves recognizing the processing site signal, (AAUAAA), and cleaving of the mRNA to create a 3' OH terminal end to which poly A polymerase (POLYNUCLEOTIDE ADENYLYLTRANSFERASE) adds 60-200 adenylate residues. The 3' end processing of some messenger RNAs, such as histone mRNA, is carried out by a different process that does not include the addition of poly A as described here.Cleavage Stimulation Factor: A RNA-binding protein that stimulates the cleavage of the 3' end of MRNA near the POLYADENYLATION site. It is a heterotrimer of 55-, 64- and 77-kDa subunits and combines with CLEAVAGE STIMULATION FACTOR to form a stable complex with mRNA that directs the 3' cleavage and polyadenylation reaction.Polynucleotide Adenylyltransferase: An enzyme that catalyzes the synthesis of polyadenylic acid from ATP. May be due to the action of RNA polymerase (EC 2.7.7.6) or polynucleotide adenylyltransferase (EC 2.7.7.19). EC 2.7.7.19.RNA 3' End Processing: The steps that generate the 3' ends of mature RNA molecules. For most mRNAs (RNA, MESSENGER), 3' end processing referred to as POLYADENYLATION includes the addition of POLY A.RNA Precursors: RNA transcripts of the DNA that are in some unfinished stage of post-transcriptional processing (RNA PROCESSING, POST-TRANSCRIPTIONAL) required for function. RNA precursors may undergo several steps of RNA SPLICING during which the phosphodiester bonds at exon-intron boundaries are cleaved and the introns are excised. Consequently a new bond is formed between the ends of the exons. Resulting mature RNAs can then be used; for example, mature mRNA (RNA, MESSENGER) is used as a template for protein production.RNA Processing, Post-Transcriptional: Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.Poly A: A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.RNA-Binding Proteins: Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.RNA 3' Polyadenylation Signals: Sequences found near the 3' end of MESSENGER RNA that direct the cleavage and addition of multiple ADENINE NUCLEOTIDES to the 3' end of mRNA.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Ribulose-Bisphosphate Carboxylase: A carboxy-lyase that plays a key role in photosynthetic carbon assimilation in the CALVIN-BENSON CYCLE by catalyzing the formation of 3-phosphoglycerate from ribulose 1,5-biphosphate and CARBON DIOXIDE. It can also utilize OXYGEN as a substrate to catalyze the synthesis of 2-phosphoglycolate and 3-phosphoglycerate in a process referred to as photorespiration.Plasmodium falciparum: A species of protozoa that is the causal agent of falciparum malaria (MALARIA, FALCIPARUM). It is most prevalent in the tropics and subtropics.Ribonucleoproteins: Complexes of RNA-binding proteins with ribonucleic acids (RNA).Search Engine: Software used to locate data or information stored in machine-readable form locally or at a distance such as an INTERNET site.Databases, Genetic: Databases devoted to knowledge about specific genes and gene products.Genome, Human: The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.Antibodies: Immunoglobulin molecules having a specific amino acid sequence by virtue of which they interact only with the ANTIGEN (or a very similar shape) that induced their synthesis in cells of the lymphoid series (especially PLASMA CELLS).Internet: A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.Oligonucleotide Array Sequence Analysis: Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.Gene Expression Profiling: The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.Microdissection: The performance of dissections with the aid of a microscope.RNA Interference: A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.Microarray Analysis: The simultaneous analysis, on a microchip, of multiple samples or targets arranged in an array format.Cell SeparationImmunohistochemistry: Histochemical localization of immunoreactive substances using labeled antibodies as reagents.Nerve Net: A meshlike structure composed of interconnecting nerve cells that are separated at the synaptic junction or joined to one another by cytoplasmic processes. In invertebrates, for example, the nerve net allows nerve impulses to spread over a wide area of the net because synapses can pass information in any direction.Gene Regulatory Networks: Interacting DNA-encoded regulatory subsystems in the GENOME that coordinate input from activator and repressor TRANSCRIPTION FACTORS during development, cell differentiation, or in response to environmental cues. The networks function to ultimately specify expression of particular sets of GENES for specific conditions, times, or locations.Neural Networks (Computer): A computer architecture, implementable in either hardware or software, modeled after biological neural networks. Like the biological system in which the processing capability is a result of the interconnection strengths between arrays of nonlinear processing nodes, computerized neural networks, often called perceptrons or multilayer connectionist models, consist of neuron-like units. A homogeneous group of units makes up a layer. These networks are good at pattern recognition. They are adaptive, performing tasks by example, and thus are better for decision-making than are linear learning machines or cluster analysis. They do not require explicit programming.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Algorithms: A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task.Phosphates: Inorganic salts of phosphoric acid.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Zinc Fingers: Motifs in DNA- and RNA-binding proteins whose amino acids are folded into a single structural unit around a zinc atom. In the classic zinc finger, one zinc atom is bound to two cysteines and two histidines. In between the cysteines and histidines are 12 residues which form a DNA binding fingertip. By variations in the composition of the sequences in the fingertip and the number and spacing of tandem repeats of the motif, zinc fingers can form a large number of different sequence specific binding sites.Seed Storage Proteins: One or more types of plant seed proteins providing the large amounts of AMINO ACIDS utilized in GERMINATION and SEEDLING growth. As seeds are the major food source from AGRICULTURAL CROPS, seed storage proteins are a major source of DIETARY PROTEINS.Seeds: The encapsulated embryos of flowering plants. They are used as is or for animal feed because of the high content of concentrated nutrients like starches, proteins, and fats. Rapeseed, cottonseed, and sunflower seed are also produced for the oils (fats) they yield.GlobulinsProlamins: A group of seed storage proteins restricted to the POACEAE family. They are rich in GLUTAMINE and PROLINE.Plant Proteins: Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.2S Albumins, Plant: A major class of water-soluble seed storage proteins. Many proteins from this class are major PLANT ALLERGENS.Cell Cycle: The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.Biological Science Disciplines: All of the divisions of the natural sciences dealing with the various aspects of the phenomena of life and vital processes. The concept includes anatomy and physiology, biochemistry and biophysics, and the biology of animals, plants, and microorganisms. It should be differentiated from BIOLOGY, one of its subdivisions, concerned specifically with the origin and life processes of living organisms.Cell Cycle Proteins: Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.Portraits as Topic: Graphic representations, especially of the face, of real persons, usually posed, living or dead. (From Thesaurus for Graphic Materials II, p540, 1995)Societies, Scientific: Societies whose membership is limited to scientists.History, 17th Century: Time period from 1601 through 1700 of the common era.

Characterization of a specificity factor for an AAA+ ATPase: assembly of SspB dimers with ssrA-tagged proteins and the ClpX hexamer. (1/56)

SspB, a specificity factor for the ATP-dependent ClpXP protease, stimulates proteolysis of protein substrates bearing the ssrA degradation tag. The SspB protein is shown here to form a stable homodimer with two independent binding sites for ssrA-tagged proteins or peptides. SspB by itself binds to ClpX and stimulates the ATPase activity of this enzyme. In the presence of ATPgammaS, a ternary complex of SspB, GFP-ssrA, and the ClpX ATPase was sufficiently stable to isolate by gel-filtration or ion-exchange chromatography. This complex consists of one SspB dimer, two molecules of GFP-ssrA, and one ClpX hexamer. SspB dimers do not commit bound substrates to ClpXP degradation but increase the affinity and cooperativity of binding of ssrA-tagged substrates to ClpX, facilitating enhanced degradation at low substrate concentrations.  (+info)

Cellular antiviral responses against influenza A virus are countered at the posttranscriptional level by the viral NS1A protein via its binding to a cellular protein required for the 3' end processing of cellular pre-mRNAS. (2/56)

The influenza A virus NS1 protein (NS1A protein) binds and inhibits the function of the 30-kDa subunit of CPSF, a cellular factor that is required for the 3'-end processing of cellular pre-mRNAs. Here we generate a recombinant influenza A/Udorn/72 virus that encodes an NS1A protein containing a mutated binding site for the 30-kDa subunit of CPSF. This mutant virus is substantially attenuated, indicating that this binding site in the NS1A protein is required for efficient virus replication. Using this mutant virus, we show that NS1A binding to CPSF mediates the viral posttranscriptional countermeasure against the initial cellular antiviral response--the interferon-alpha/beta (IFN-alpha/beta)-independent activation of the transcription of cellular antiviral genes, which requires the interferon regulatory factor-3 (IRF-3) transcription factor that is activated by virus infection. Whereas the posttranscriptional processing of these cellular antiviral pre-mRNAs is inhibited in cells infected by wild-type influenza A virus, functional antiviral mRNAs are produced in cells infected by the mutant virus. These results establish that the binding of 30-kDa CPSF to the NS1A protein is largely responsible for the posttranscriptional inhibition of the processing of these cellular antiviral pre-mRNAs. Mutation of this binding site in the NS1A protein also affects a second cellular antiviral response: in cells infected by the mutant virus, IFN-beta mRNA is produced earlier and in larger amounts.  (+info)

tbCPSF30 depletion by RNA interference disrupts polycistronic RNA processing in Trypanosoma brucei. (3/56)

Gene expression in eukaryotes requires the post-transcriptional cleavage of mRNA precursors into mature mRNAs. In Trypanosoma brucei, mRNA processing is of particular importance, since most transcripts are derived from polycistronic transcription units. This organization dictates that regulated gene expression is promoter-independent and governed at the posttranscriptional level. We have identified tbCPSF30, a protein containing five CCCH zinc finger motifs, which is a homologue of the cleavage and polyadenylation specificity factor (CPSF) 30-kDa subunit, a component of the machinery required for 3'-end formation in yeast and mammals. Using gene silencing of tbCPSF30 by RNA interference, we demonstrate that this gene is essential in bloodstream and procyclic forms of T. brucei. Interestingly, tbCPSF30-specific RNA interference results in the accumulation of an aberrant tbCPSF30 mRNA species concomitant with depletion of tbCPSF30 protein. tbCPSF30 protein depletion is accompanied by the accumulation of unprocessed tubulin RNAs, implicating tbCPSF30 in polycistronic RNA processing. By genome data base mining, we also identify several other putative components of the T. brucei cleavage and polyadenylation machinery, indicating their conservation throughout eukaryotic evolution. This study is the first to identify and characterize a core component of the T. brucei CPSF and show its involvement in polycistronic RNA processing.  (+info)

Evidence that polyadenylation factor CPSF-73 is the mRNA 3' processing endonuclease. (4/56)

Generation of the polyadenylated 3' end of an mRNA requires an endonucleolytic cleavage followed by synthesis of the poly(A) tail. Despite the seeming simplicity of the reaction, more than a dozen polypeptides are required, and nearly all appear to be necessary for the cleavage reaction. Because of this complexity, the identity of the endonuclease has remained a mystery. Here we present evidence that a component of the cleavage-polyadenylation specificity factor CPSF-73 is the long-sought endonuclease. We first show, using site-specific labeling and UV-cross-linking, that a protein with properties of CPSF-73 is one of only two polypeptides in HeLa nuclear extract to contact the cleavage site in an AAUAAA-dependent manner. The recent identification of CPSF-73 as a possible member of the metallo-beta-lactamase family of Zn(2+)-dependent hydrolytic enzymes suggests that this contact may identify CPSF-73 as the nuclease. Supporting the significance of the putative hydrolytic lactamase domain in CPSF-73, we show that mutation of key residues predicted to be required for activity in the yeast CPSF-73 homolog result in lethality. Furthermore, in contrast to long held belief, but consistent with properties of metallo-beta-lactamases, we show that 3' cleavage is metal-dependent, likely reflecting a requirement for tightly protein-bound Zn(2+). Taken together, the available data provide strong evidence that CPSF-73 is the 3' processing endonuclease.  (+info)

Human immunodeficiency virus type 1 Tat increases the expression of cleavage and polyadenylation specificity factor 73-kilodalton subunit modulating cellular and viral expression. (5/56)

The human immunodeficiency virus type 1 (HIV-1) Tat protein, which is essential for HIV gene expression and viral replication, is known to mediate pleiotropic effects on various cell functions. For instance, Tat protein is able to regulate the rate of transcription of host cellular genes and to interact with the signaling machinery, leading to cellular dysfunction. To study the effect that HIV-1 Tat exerts on the host cell, we identified several genes that were up- or down-regulated in tat-expressing cell lines by using the differential display method. HIV-1 Tat specifically increases the expression of the cleavage and polyadenylation specificity factor (CPSF) 73-kDa subunit (CPSF3) without affecting the expression of the 160- and 100-kDa subunits of the CPSF complex. This complex comprises four subunits and has a key function in the 3'-end processing of pre-mRNAs by a coordinated interaction with other factors. CPSF3 overexpression experiments and knockdown of the endogenous CPSF3 by mRNA interference have shown that this subunit of the complex is an important regulatory protein for both viral and cellular gene expression. In addition to the known CPSF3 function in RNA polyadenylation, we also present evidence that this protein exerts transcriptional activities by repressing the mdm2 gene promoter. Thus, HIV-1-Tat up-regulation of CPSF3 could represent a novel mechanism by which this virus increases mRNA processing, causing an increase in both cell and viral gene expression.  (+info)

Structure of primate and rodent orthologs of the prostate cancer susceptibility gene ELAC2. (6/56)

The human ELAC2 gene was the first candidate prostate cancer susceptibility gene identified by linkage analysis and positional cloning. DNA sequence indicates a protein of 826 amino acids encoded by 24 exons. In the present study, we characterized the coding sequence of chimpanzee and gorilla ELAC2 orthologs by direct sequencing of genomic fragments, and of cynomolgus monkey and rat orthologs by screening cDNA libraries. The orthologs characterized in the chimpanzee, gorilla and cynomolgus monkey also encode proteins of 826 amino acids, sharing 98.9%, 98.5% and 93.7% sequence identity with the human protein. Our analyses of the mouse ELAC2 gene identified two alternative mRNA transcripts. One is translated into a protein of 824 a.a. (mouse ELAC2), whereas the other one encodes a protein of 831 amino acids (mouse ELAC2A) resulting from an alternatively spliced form of 25 exons. The rat ELAC2 gene ortholog also expressed two similar alternatively spliced transcripts. These two forms are ubiquitously expressed in mouse and rat tissues. The highest levels of expression of the ELAC2 form are observed in the testis while the lowest levels are seen in the prostate and in the muscle. However, it is of interest to note that the relative abundance of the rat and mouse ELAC2 transcripts, measured by real-time quantitative PCR, is higher than the respective ELAC2A forms in all surveyed tissues except for the prostate and the muscle. The ELAC2A transcript levels are 4.1 to 5.0-fold higher than the ELAC2 levels in the prostate of rat and mouse, respectively. A fine analysis of the conserved domains on the primary structure of ELAC2 orthologs revealed the presence of a putative beta-CASP domain shared by the PSO2 (SNM1) DNA interstrand cross-link repair proteins, and the 73-kDa subunit of mRNA 3' end cleavage and polyadenylation specificity factor (CPSF73) as well as Artemis proteins, thus suggesting a potential interaction of ELAC2 gene product with nucleic acids and more specifically with RNA targets. Taken together, these data offer useful tools to further study the regulation and cellular function of ELAC2 gene in experimental models and provide further insight concerning conserved amino acid motifs that could have biological significance.  (+info)

A CPSF-73 homologue is required for cell cycle progression but not cell growth and interacts with a protein having features of CPSF-100. (7/56)

Formation of the mature 3' ends of the vast majority of cellular mRNAs occurs through cleavage and polyadenylation and requires a cleavage and polyadenylation specificity factor (CPSF) containing, among other proteins, CPSF-73 and CPSF-100. These two proteins belong to a superfamily of zinc-dependent beta-lactamase fold proteins with catalytic specificity for a wide range of substrates including nucleic acids. CPSF-73 contains a zinc-binding histidine motif involved in catalysis in other members of the beta-lactamase superfamily, whereas CPSF-100 has substitutions within the histidine motif and thus is unlikely to be catalytically active. Here we describe two previously unknown human proteins, designated RC-68 and RC-74, which are related to CPSF-73 and CPSF-100 and which form a complex in HeLa and mouse cells. RC-68 contains the intact histidine motif, and hence it might be a functional counterpart of CPSF-73, whereas RC-74 lacks this motif, thus resembling CPSF-100. In HeLa cells RC-68 is present in both the cytoplasm and the nucleus whereas RC-74 is exclusively nuclear. RC-74 does not interact with CPSF-73, and neither RC-68 nor RC-74 is found in a complex with CPSF-160, indicating that these two proteins form a separate entity independent of the CPSF complex and are likely involved in a pre-mRNA processing event other than cleavage and polyadenylation of the vast majority of cellular pre-mRNAs. RNA interference-mediated depletion of RC-68 arrests HeLa cells early in G(1) phase, but surprisingly the arrested cells continue growing and reach the size typical of G(2) cells. RC-68 is highly conserved from plants to humans and may function in conjunction with RC-74 in the 3' end processing of a distinct subset of cellular pre-mRNAs encoding proteins required for G(1) progression and entry into S phase.  (+info)

The polyadenylation factor CPSF-73 is involved in histone-pre-mRNA processing. (8/56)

During 3' end processing, histone pre-mRNAs are cleaved 5 nucleotides after a conserved stem loop by an endonuclease dependent on the U7 small nuclear ribonucleoprotein (snRNP). The upstream cleavage product corresponds to the mature histone mRNA, while the downstream product is degraded by a 5'-3' exonuclease, also dependent on the U7 snRNP. To identify the two nuclease activities, we carried out UV-crosslinking studies using both the complete RNA substrate and the downstream cleavage product, each containing a single radioactive phosphate and a phosphorothioate modification at the cleavage site. We detected a protein migrating at 85 kDa that crosslinked to each substrate in a U7-dependent manner. Immunoprecipitation experiments identified this protein as CPSF-73, a known component of the cleavage/polyadenylation machinery. These studies suggest that CPSF-73 is both the endonuclease and 5'-3' exonuclease in histone-pre-mRNA processing and reveal an evolutionary link between 3' end formation of histone mRNAs and polyadenylated mRNAs.  (+info)

*Cleavage and polyadenylation specificity factor

... (CPSF) is involved in the cleavage of the 3' signaling region from a newly ... Cleavage And Polyadenylation Specificity Factor at the US National Library of Medicine Medical Subject Headings (MeSH). ... Murthy, KG; Manley, JL (1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3 ... "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'-end formation". Genes & ...

*NS1 influenza protein

At the effector domain, it interacts and inhibits cleavage and polyadenylation specificity factor (CPSF30). CPSF30 is part of ... It prevents polyadenylation of cellular mRNAs to circumvent antiviral responses of the host, e.g., maturation and translation ... This kinase phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 (elF-2 alpha), leading to a decrease ... double-stranded RNA inhibits the activation of the protein kinase that phosphorylates the elF-2 translation initiation factor. ...

*CPSF2

Cleavage and polyadenylation specificity factor subunit 2 is a protein that in humans is encoded by the CPSF2 gene. GRCh38: ... Murthy KG, Manley JL (1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'- ... 2000). "Human pre-mRNA cleavage factor II(m) contains homologs of yeast proteins and bridges two other cleavage factors". EMBO ... "Characterization of cleavage and polyadenylation specificity factor and cloning of its 100-kilodalton subunit". Mol Cell Biol. ...

*CPSF3

Cleavage and polyadenylation specificity factor subunit 3 is a protein that in humans is encoded by the CPSF3 gene. Model ... Murthy KG, Manley JL (1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'- ... Jenny A, Hauri HP, Keller W (1994). "Characterization of cleavage and polyadenylation specificity factor and cloning of its 100 ... 2000). "Human pre-mRNA cleavage factor II(m) contains homologs of yeast proteins and bridges two other cleavage factors". EMBO ...

*CSTF2

Murthy KG, Manley JL (1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'- ... 1998). "Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor during the G0 to S phase transition ... The protein is a member of the cleavage stimulation factor (CSTF) complex that is involved in the 3' end cleavage and ... Cleavage stimulation factor 64 kDa subunit is a protein that in humans is encoded by the CSTF2 gene. This gene encodes a ...

*CSTF3

Murthy KG, Manley JL (1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'- ... cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in ... Cleavage stimulation factor 77 kDa subunit is a protein that in humans is encoded by the CSTF3 gene. The protein encoded by ... "Entrez Gene: CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa". Takagaki, Y; Manley J L (March 2000). "Complex ...

*CPSF1

... namely cleavage and polyadenylation specificity factor (CPSF), cleavage stimulation factor (CstF), cleavage factors Im and IIm ... Cleavage and polyadenylation specificity factor subunit 1 is a protein that in humans is encoded by the CPSF1 gene. In most ... 2002). "Cleavage and polyadenylation specificity factor (CPSF)-derived peptides can induce HLA-A2-restricted and tumor-specific ... Murthy KG, Manley JL (Dec 1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA ...

*CPSF7

Cleavage and polyadenylation specificity factor subunit 7 is a protein that in humans is encoded by the CPSF7 gene. GRCh38: ... "Entrez Gene: FLJ12529 pre-mRNA cleavage factor I, 59 kDa subunit". Olsen JV, Blagoev B, Gnad F, et al. (2006). "Global, in vivo ... Rüegsegger U, Beyer K, Keller W (1996). "Purification and characterization of human cleavage factor Im involved in the 3' end ...

*CPSF4

Cleavage and polyadenylation specificity factor subunit 4 is a protein that in humans is encoded by the CPSF4 gene. Inhibition ... Jenny A, Hauri HP, Keller W (1994). "Characterization of cleavage and polyadenylation specificity factor and cloning of its 100 ... 2000). "Human pre-mRNA cleavage factor II(m) contains homologs of yeast proteins and bridges two other cleavage factors". EMBO ... "The 30-kD subunit of mammalian cleavage and polyadenylation specificity factor and its yeast homolog are RNA-binding zinc ...

*CPSF6

Cleavage and polyadenylation specificity factor subunit 6 is a protein that in humans is encoded by the CPSF6 gene. The protein ... "Human pre-mRNA cleavage factor II(m) contains homologs of yeast proteins and bridges two other cleavage factors". The EMBO ... "Entrez Gene: CPSF6 cleavage and polyadenylation specific factor 6, 68kDa". Rual JF, Venkatesan K, Hao T, Hirozane-Kishikawa T, ... Awasthi S, Alwine JC (Nov 2003). "Association of polyadenylation cleavage factor I with U1 snRNP". RNA. 9 (11): 1400-9. doi: ...

*GLD-2

Likewise, it interacts with cytoplasmic polyadenylation factors, including Cleavage and polyadenylation specificity factor and ... which is a process known as polyadenylation. For RNA specificity, GLD-2 associates with an RNA-binding protein, typically a GLD ... The polyadenylation activity of GLD-2, as we previously mentioned, is stimulated by physical interaction with an RNA binding ... PAP heterodimer in which GLD-2 contains the active site and GLD-3 provides RNA-binding specificity. MS2 coat protein was joined ...

*NUDT21

Cleavage and polyadenylation specificity factor subunit 5 (CPSF5) is a enzyme that in humans is encoded by the NUDT21 gene. It ... 2000). "Human pre-mRNA cleavage factor IIm contains homologs of yeast proteins and bridges two other cleavage factors". EMBO J ... Awasthi S, Alwine JC (2003). "Association of polyadenylation cleavage factor I with U1 snRNP". RNA. 9 (11): 1400-9. doi:10.1261 ... The protein encoded by this gene is one subunit of the cleavage factor Im complex required for 3' RNA cleavage and ...

*CSTF1

Murthy KG, Manley JL (1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3'- ... Cleavage stimulation factor 50 kDa subunit is a protein that in humans is encoded by the CSTF1 gene. This gene encodes one of ... "Entrez Gene: CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa". Kleiman, F E; Manley J L (Sep 1999). "Functional ... three subunits which combine to form cleavage stimulation factor (CSTF). CSTF is involved in the polyadenylation and 3'end ...

*PAPOLG

... cleavage and polyadenylation specificity factor)/AAUAAA-dependent polyadenylation activity. This gene is located on chromosome ...

*PAPOLA

... binds to FIP1L1 (Factor interacting with PAPOLA and CPSF1), a subunit of the cleavage and polyadenylation specificity ... 2005). "Distinct sequence motifs within the 68-kDa subunit of cleavage factor Im mediate RNA binding, protein-protein ... Pendurthi UR, Alok D, Rao LV (1997). "Binding of factor VIIa to tissue factor induces alterations in gene expression in human ... end-processing factor. FIP1L1 gene fusions between it and either the platelet-derived growth factor receptor, alpha (PGDFRA) or ...

*FIP1L1

... is a subunit of the cleavage and polyadenylation specificity factor subunit 1 (CPSF1) complex that polyadenylates the 3 ... Factor interacting with PAPOLA and CPSF1 (i.e, FIP1L1; also termed Pre-mRNA 3'-end-processing factor FIP1) is a protein that in ... end-processing factor. FIP1L1 gene fusions between it and either the platelet-derived growth factor receptor, alpha (PGDFRA) or ... The product of PDGFRA, platelet-derived growth factor receptor alpha (PDGFRA), is a tyrosine kinase receptor of the RTK class ...

*Chromosome 11 (human)

Cleavage and polyadenylation specificity factor subunit 7 CPT1A: carnitine palmitoyltransferase 1A (liver) CREBZF encoding ... Yip1 interacting factor homolog A ZFP91-CNTF ZNF408: zinc finger protein 408 The following diseases and disorders are some of ... remodeling and spacing factor 1 SAA1: serum amyloid A1 SAA2: serum amyloid A2 SAC3D1: SAC3 domain-containing protein 1 SART1: ... tumor necrosis factor recepteor REXO2: RNA exonuclease 2 RNH1: ribonuclease inhibitor 1 RNU2-2: encoding protein RNA, U2 small ...

*Terminator (genetics)

... the proteins cleavage and polyadenylation specificity factor (CPSF) and cleavage stimulation factor (CstF) transfer from the ... These two factors then recruit other proteins to the site to cleave the transcript, freeing the mRNA from the transcription ... After this cleavage, a so-called exonuclease binds to the residual RNA strand and removes the freshly transcribed nucleotides ... In eukaryotic transcription of mRNAs, terminator signals are recognized by protein factors that are associated with the RNA ...

*Cleavage factor

... complexes are recruited to the cleavage site by cleavage and polyadenylation specificity factor and cleavage stimulatory factor ... Cleavage factors are two closely associated protein complexes involved in the cleavage of the 3' untranslated region of a newly ... "Cleavage factor Im (CFIm) as a regulator of alternative polyadenylation". Biochemical Society Transactions. 44 (4): 1051-1057. ... In mammals the two cleavage factors are known as CFIm and CFIIm. The proteins that constitute these ...

*Post-transcriptional modification

... two multisubunit proteins called cleavage and polyadenylation specificity factor (CPSF) and cleavage stimulation factor (CStF) ... Cleavage and polyadenylation specificity factor 73 cuts mRNA between stem-loop and HDE Histone variants, such as H2A.Z or H3.3 ... The two factors bind to the sequence elements. A protein complex forms and contains additional cleavage factors and the enzyme ... processing is done independent of most cleavage and polyadenylation factors. Core histone mRNAs have a special stem-loop ...

*Cleavage stimulation factor

CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3' end ... Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins ... "Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor during the G0 to S phase transition". ... Cleavage stimulation factor at the US National Library of Medicine Medical Subject Headings (MeSH). ...

*Polynucleotide adenylyltransferase

... to a large protein complex that also contains smaller assemblies known as the cleavage and polyadenylation specificity factor ( ... CPSF) and cleavage stimulatory factor (CtSF) and its binding is a necessary prerequisite to the cleavage of the 3' end of the ... After cleavage of the 3' signaling region that directs the assembly of the complex, polyadenylate polymerase (PAP) adds the ... PAP is phosphorylated by mitosis-promoting factor , a key regulator of the cell cycle. High phosphorylation levels decrease PAP ...

*Eukaryotic transcription

... cleavage and polyadenylation specificity factor) and CSTF (cleavage stimulation factor), recognize the poly-A signal in the ... Poly-A-bound CPSF and CSTF recruit other proteins to carry out RNA cleavage and then polyadenylation. Poly-A polymerase adds ... General transcription factors are a group of proteins involved in transcription initiation and regulation. These factors ... There are different classes of elongation factors. Some factors can increase the overall rate of transcribing, some can help ...

*List of MeSH codes (D12.776)

... cleavage and polyadenylation specificity factor MeSH D12.776.664.962.444.249 - cleavage stimulation factor MeSH D12.776.664.962 ... vascular endothelial growth factor a MeSH D12.776.467.100.800.300 - vascular endothelial growth factor b MeSH D12.776.467.100. ... fibroblast growth factor 4 MeSH D12.776.624.664.700.112 - fibroblast growth factor 6 MeSH D12.776.624.664.700.114 - fms-like ... peptide elongation factor g MeSH D12.776.835.700.350.700 - peptide elongation factor tu MeSH D12.776.835.700.350.800 - peptide ...

*List of MeSH codes (D12.776.157)

... cleavage stimulation factor MeSH D12.776.157.725.124.500 -- cleavage and polyadenylation specificity factor MeSH D12.776. ... adp-ribosylation factors MeSH D12.776.157.325.515.100.100 -- adp-ribosylation factor 1 MeSH D12.776.157.325.515.400 -- rab gtp- ... tnf receptor-associated factor 1 MeSH D12.776.157.057.500.750 -- tnf receptor-associated factor 2 MeSH D12.776.157.057.500.875 ... tnf receptor-associated factor 3 MeSH D12.776.157.057.500.937 -- tnf receptor-associated factor 5 MeSH D12.776.157.057.500.968 ...

*Cathepsin S

For instance, cleavage of laminin-5 by cathepsin S leads to generation of proangiogenic peptides. The expression of cathepsin S ... Hall A, Håkansson K, Mason RW, Grubb A, Abrahamson M (March 1995). "Structural basis for the biological specificity of cystatin ... Cathepsin S has been shown to be a significant prognostic factor for patients with type IV astrocytomas (glioblastoma ... Transcript variants utilizing alternative polyadenylation signals exist for this gene. Cathepsin S is a member of the peptidase ...
AtCPSF30 is the only Arabidopsis protein with a degree of sequence similarity to other eukaryotic CPSF30 proteins that extends beyond the typical spacing of Cys and His residues in the CCCH zinc-finger motif, and a number of lines of evidence support the conclusion that AtCPSF30 is an authentic polyadenylation factor subunit. As is the case with its yeast counterpart (Yth1p; Barabino et al., 1997), AtCPSF30 interacts with another Arabidopsis polyadenylation subunit homolog, AtFip1(V) (Forbes et al., 2006); AtFip1(V) also interacts with poly(A) polymerase and thereby provides a conceptual link between AtCPSF30 and poly(A) polymerase. The results presented in this study show that AtCPSF30 is present in the nucleus (Fig. 2B), as would be expected of a polyadenylation factor subunit. The coimmunoprecipitation of AtCPSF30 by antibodies raised against AtCPSF100 (Fig. 2C) indicates that AtCPSF30 resides, at least in part, in a complex with another Arabidopsis polyadenylation factor subunit. AtCPSF30 is ...
mRNA cleavage and polyadenylation specificity factor complex, 5-3 exonuclease activity, endoribonuclease activity, RNA binding, mRNA 3-end processing by stem-loop binding and cleavage, mRNA cleavage, mRNA polyadenylation
Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016 ...
This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010 ...
We have isolated the human homolog of S. cerevisiae Fip1p and have found that hFip1 is a genuine subunit of CPSF. Our results reported here indicate that hFip1 contributes to poly(A) site recognition and to CPSF‐dependent stimulation of polyadenylation. hFip1 binds to U‐rich sequence elements on the pre‐mRNA and is able to stimulate the activity of PAP.. CPSF has originally been described as a tetrameric complex containing the subunits CPSF160, CPSF100, CPSF73 and CPSF30, based on their stoichiometric cofractionation with CPSF activity. These polypeptides are related to four subunits of the yeast polyadenylation factor CPF (Yhh1p, Ydh1p, Ysh1p and Yth1p). However, CPF contains additional subunits (Preker et al, 1997; Dichtl et al, 2002a; Gavin et al, 2002; Walsh et al, 2002), one of which is Fip1p. Based on sequence conservation, we have identified the human homolog of yeast Fip1p and have shown that hFip1 is an additional, so far unrecognized subunit of CPSF. Most likely, hFip1 has not ...
Provides general gene info and summarizes expression data for all features of the gene SNAPC1 (aka ENSG00000023608, SNAPC1): snRNA-activating protein complex subunit 1 (SNAPc subunit 1)(snRNA-activating protein complex 43 kDa subunit)(SNAPc 43 kDa subunit)(Small nuclear RNA-activating complex polypeptide 1)(Proximal sequence element-binding transcription factor subunit gamma)(PSE-binding factor subunit gamma)(PTF subunit gamma) [Source:UniProtKB/Swiss-Prot;Acc:Q16533]
Plays an essential role in viral RNA transcription and replication by forming the heterotrimeric polymerase complex together with PB1 and PB2 subunits. The complex transcribes viral mRNAs by using a unique mechanism called cap-snatching. It consists in the hijacking and cleavage of host capped pre-mRNAs. These short capped RNAs are then used as primers for viral mRNAs. The PB2 subunit is responsible for the binding of the 5 cap of cellular pre-mRNAs which are subsequently cleaved after 10-13 nucleotides by the PA subunit that carries the endonuclease activity.
Complete information for CPSF4 gene (Protein Coding), Cleavage And Polyadenylation Specific Factor 4, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Complete information for JUND gene (Protein Coding), JunD Proto-Oncogene, AP-1 Transcription Factor Subunit, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
OphthoTech Corporation is developing pegpleranib, a 32-mer pegylated, anti-platelet derived growth factor subunit B (PDGF-B) aptamer, for the treatment of wet
CPSF3 Antibody 11609-1-AP has been identified with ELISA, IP, WB. 11609-1-AP detected 77 kDa band in HEK-293 cells with 1:500-1:2000 dilution...
CPSF2兔多克隆抗体(ab100807)可与小鼠, 人样本反应并经IHC实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
CPSF30小鼠单克隆抗体[2202C1](ab51343)可与人样本反应并经WB, Dot实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
Kit Component:- KN200936G1, NUDT21 gRNA vector 1 in pCas-Guide vector- KN200936G2, NUDT21 gRNA vector 2 in pCas-Guide vector- KN200936D, donor vector…
Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins CSTF1 (55kDa), CSTF2 (64kDa) and CSTF3 (77kDa), totalling about 200 kDa. It is involved in the cleavage of the 3 signaling region from a newly synthesized pre-messenger RNA (mRNA) molecule. CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3 end to promote the synthesis of a functional polyadenine tail, which results in a mature mRNA molecule ready to be exported from the cell nucleus to the cytosol for translation. The amount of CstF in a cell is dependent on the phase of the cell cycle, increasing significantly during the transition from G0 phase to S phase in mouse fibroblast and human splenic B cells. CSTF1, CSTF2, CSTF3 Martincic, K.; Campbell, R.; Edwalds-Gilbert, G.; Souan, L.; Lotze, M. T.; Milcarek, C. (1998). "Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor ...
1. WahleE (1991) A novel poly(A)-binding protein acts as a specificity factor in the second phase of messenger RNA polyadenylation. Cell 66: 759-768.. 2. KuhnU, NemethA, MeyerS, WahleE (2003) The RNA binding domains of the nuclear poly(A)-binding protein. J Biol Chem 278: 16916-16925.. 3. KerwitzY, KuhnU, LilieH, KnothA, ScheuermannT, et al. (2003) Stimulation of poly(A) polymerase through a direct interaction with the nuclear poly(A) binding protein allosterically regulated by RNA. Embo J 22: 3705-3714.. 4. KuhnU, GundelM, KnothA, KerwitzY, RudelS, et al. (2009) Poly(A) tail length is controlled by the nuclear poly(A)-binding protein regulating the interaction between poly(A) polymerase and the cleavage and polyadenylation specificity factor. J Biol Chem 284: 22803-22814.. 5. KuhnU, WahleE (2004) Structure and function of poly(A) binding proteins. Biochim Biophys Acta 1678: 67-84.. 6. ApponiLH, LeungSW, WilliamsKR, ValentiniSR, CorbettAH, et al. (2010) Loss of nuclear poly(A)-binding protein 1 ...
Reaktivität: Fledermaus, Huhn, Rind (Kuh) and more. 67 verschiedene CPSF4 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
Abnova Human CPSF3 Partial ORF (NP_057291, 585 a.a. - 684 a.a.) Recombinant Protein with GST-tag at N-terminal 25µg Life Sciences:Protein Biology:Proteins:Proteins A-Z:Proteins
Besides the splice site itself, only two sequences on the pre-mRNA play an important role in SL2-specific trans-splicing: the two presumptive signals for 3 end formation of the gene just upstream (Figure 2; Huang et al., 2001; Kuersten et al., 1997; Liu et al., 2001; Liu et al., 2003). The AAUAAA just 5 of the cleavage site, which is absolutely required for 3 end formation, binds the cleavage and polyadenylation specificity factor (CPSF), and a U-rich sequence just 3 of the cleavage site binds the cleavage stimulatory factor (CstF). CPSF and CstF bind cooperatively to these two sites and together position the site of cleavage. When the AAUAAA is mutated, 3 end cleavage fails to occur, and trans-splicing just downstream becomes less efficient and less specific for SL2. Nevertheless, AAUAAA is not required for SL2 trans-splicing since SL2 trans-splicing downstream still occurs in its absence. CPSF bound to AAUAAA may act by facilitating binding of CstF to the U-rich sequence or by catalyzing ...
Gentaur molecular products has all kinds of products like :search , GenWay \ Cleavage stimulation factor 50 kDa subunit - CSTF 50 kDa subunit; CF-1 50 kDa subunit; CstF-50 \ 10-288-22329F for more molecular products just contact us
Dr. Verma research involves understanding the pathogenesis of tumor viruses, specifically Epstein Barr Virus (EBV) and Kaposis sarcoma associated herpesvirus (KSHV). Both viruses undergo lytic replication in epithelial cells during primary infection and during reactivation from latent infection in B-lymphocytes. Epstein Barr virus SM is an RNA binding protein essential for viral replication that enhances EBV gene expression by enhancing RNA stability and RNA export. Dr. Verma has shown that SM interacts with cellular splicing factors and influences splicing of both EBV and cellular pre-mRNAs. Like EBV SM, KSHV ORF57 is also a post-transcriptional regulatory protein, essential for KSHV lytic replication and has high degree of gene specificity. His current research is focused on regulation of gene expression and antiviral drug screening in the following areas ...
CPSF3 Polyclonal Antibody from Invitrogen for Western Blot applications. This antibody reacts with Human samples. Supplied as 100 µL purified antibody (1 mg/ml) in PBS with 1% BSA, 20% glycerol and 0.01% thimerosal; pH 7.
Global antibody supplier and research reagent supplier to the life science community. Find antibodies and reagents all backed by our Guarantee+.
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
EE, PE and poly(A)‐site signals were suggested to be sufficient to direct cleavage and polyadenylation of yeast pre‐mRNAs (Guo and Sherman, 1996b). CF IA, CF IB and CF II trans‐acting factors were initially defined as sufficient for cleavage in vitro (Kessler et al., 1996). Subsequent work showed, however, that CF IB is dispensable for cleavage activity and instead controls cleavage‐site selection (Minvielle‐Sebastia et al., 1998). These observations also resulted in the surprising finding that CYC1‐512 RNA is cleaved by CF IA and CF II in vitro when CF IB is absent, suggesting that both EE and PE are dispensable for cleavage.. We extended this observation by analysing cleavage of a short CYC1 substrate by CPF and CF IA in vitro. Consistent with previous results CF IB was not required for cleavage activity but restricted cleavage to the poly(A) site. While deletion of EE sequences in sCYC1 did not influence poly(A)‐site cleavage, removal of the PE had a strong effect. In contrast, ...
Cstf3 - Cstf3 (GFP-tagged) - Mouse cleavage stimulation factor 3 pre-RNA subunit 3 (Cstf3) transcript variant 2, (10ug) available for purchase from OriGene - Your Gene Company.
Cstf2 - Lenti ORF clone of Cstf2 (mGFP-tagged) - Mouse cleavage stimulation factor, 3 pre-RNA subunit 2 (cDNA clone MGC:36412 IMAGE:5322335) available for purchase from OriGene - Your Gene Company.
Exogenous human granulocyte-colony stimulation factor (huG-CSF) restores autoantibody (autoAb) production in B6.Sle2c2 mice after induction of chronic graft vs
The process of 3′ end formation/polyadenylation occurs co-transcriptionally on cellular and HIV mRNAs generated by RNA Pol II and influences the termination of transcription at a site several hundred bases downstream of the mature 3′ end of the mRNA [50]. The 3′ end of most human mRNAs is generated first by an endonucleolytic cleavage event (catalyzed by CPSF73, aka CPSF3) followed by the addition of 100-250 adenylate residues by poly(A) polymerase (PAP). A typical polyadenylation signal contains two types of elements. The core elements consist of an AAUAAA or similar hexanucleotide and a short (about 5 base long) U- or GU-rich tract located within approximately 25-30 bases upstream or downstream, respectively, of the site. The core elements serve as the assembly site of the complex of polyadenylation factors. Many polyadenylation signals also contain auxiliary elements that are located upstream or downstream of the core elements. These auxiliary elements bind to a variety of cellular ...
Human CSTF2 full-length ORF ( AAH17712, 1 a.a. - 577 a.a.) recombinant protein with GST-tag at N-terminal. (H00001478-P01) - Products - Abnova
Available drugs to treat toxoplasmosis have limitations in efficacy and can cause serious adverse effects. Moreover, toxoplasmosis is now recognized as a leading cause of foodborne illness in the United States (Scallan et al, 2011). Since a Toxoplasma vaccine for use in humans is not currently available, new classes of drugs, preferably directed against novel targets, are needed. Here we report that the benzoxaborole AN3661 inhibits Toxoplasma growth in vitro and, when orally administered to mice, is not only effective against otherwise lethal infections but also enables protective immunity against subsequent Toxoplasma infections. Genetic evidence reported herein supports the conclusion that AN3661 acts via the inhibition of a novel target of T. gondii, TgCPSF3, which is homologous to the endonuclease subunit (CPSF‐73) within the human CPSF complex that cleaves 3′‐mRNAs (Ryan et al, 2004; Mandel et al, 2006).. In another study, it is shown that AN3661 is also active against the human ...
Available drugs to treat toxoplasmosis have limitations in efficacy and can cause serious adverse effects. Moreover, toxoplasmosis is now recognized as a leading cause of foodborne illness in the United States (Scallan et al, 2011). Since a Toxoplasma vaccine for use in humans is not currently available, new classes of drugs, preferably directed against novel targets, are needed. Here we report that the benzoxaborole AN3661 inhibits Toxoplasma growth in vitro and, when orally administered to mice, is not only effective against otherwise lethal infections but also enables protective immunity against subsequent Toxoplasma infections. Genetic evidence reported herein supports the conclusion that AN3661 acts via the inhibition of a novel target of T. gondii, TgCPSF3, which is homologous to the endonuclease subunit (CPSF‐73) within the human CPSF complex that cleaves 3′‐mRNAs (Ryan et al, 2004; Mandel et al, 2006).. In another study, it is shown that AN3661 is also active against the human ...
Constitutive STAT3 activation by tyrosine phosphorylation of mutated or amplified tyrosine kinases (pYSTAT3) is critical for cancer initiation, progression, invasion, and motility of carcinoma cells. We showed that AF1q is associated with STAT3 signaling in breast cancer cells. In xenograft models, enhanced AF1q expression activated STAT3 and promoted tumor growth and metastasis in immunodeficient NSG mice. The cytokine secretory phenotype of MDA-MB-231LN breast cancer cells with altered AF1q expression revealed changes in expression of platelet-derived growth factor subunit B (PDGF-B). AF1q-induced PDGF-B stimulated motility, migration, and invasion of MDA-MB-231LN cells, and AF1q up-regulated platelet-derived growth factor receptor (PDGFR) signaling. Further, AF1q-induced PDGFR signaling enhanced STAT3 activity through Src kinase activation, which could be blocked by the Src kinase inhibitor PP1. Moreover, AF1q up-regulated tyrosine kinase signaling through PDGFR signaling, which was blockable by
IPF is a deadly disease with a high prevalence (14.0-42.7 per 100,000 persons) and low survival rate (20%-40% 5-year survival rate) (1). The proliferation and activation of ECM-producing myofibroblasts is a central but not yet fully understood process that contributes to the progression of IPF. Thus, the identification of targets that promote abnormal myofibroblast proliferation and differentiation or enhance profibrotic gene expression could prove highly beneficial in designing therapies for pulmonary fibrosis. In our study, we explored the expression of a key APA complex in pulmonary fibrosis and showed, for the first time to our knowledge, that there is a significant decrease of CFIm components (CFIm25, CPSF59, and CPSF68) in myofibroblasts from the lungs of patients with IPF and mice with pulmonary fibrosis, suggesting a possible global 3′-UTR shortening during fibroblast-to-myofibroblast differentiation. In addition, downregulation of CFIm25 was sufficient to shorten the 3′-UTR of ...
Rabbit polyclonal CPSF7 antibody. Validated in WB, ELISA, IHC and tested in Human. Cited in 1 publication(s). Immunogen corresponding to synthetic peptide.
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
In several cases, the homologous WDR proteins are highly conserved throughout the length of the proteins, and appear to operate in highly analogous mechanisms, with specificity in function conferred by changes in upstream signaling pathways and/or downstream effectors. One case is AGB1, the only clear Arabidopsis ortholog of Gβ [31] (Fig. 1). Loss of AGB1 function leads to developmental pleiotropy including shortened fruits [32] and changes in patterns of cell division in the hypocotyl and root [33]. These phenotypes are associated with the derepression of genes that are normally turned on by auxin, suggesting a role for AGB1 as a negative regulator of auxin signaling [33]. There appears to be one Gα-like protein (GPA1) and two Gγ-like proteins (AGG1 and AGG2) in the Arabidopsis proteome [31], and molecular modeling and yeast two-hybrid studies of potential interactions among AGB1, GPA1 and AGG1 are not inconsistent with the possibility that these could form a heterotrimeric protein [33, 34]. ...
HsCD00001919 ATGGCGGGTTTGACTGTGAGAGACCCAGCGGTGGATCGTTCTCTACGTTCTGTGTTCGTG NM_001325.2 ATGGCGGGTTTGACTGTGAGAGACCCAGCGGTGGATCGTTCTCTACGTTCTGTGTTCGTG ************************************************************ HsCD00001919 GGGAACATTCCTTATGAAGCTACTGAAGAGCAGTTGAAGGACATCTTTTCTGAGGTTGGA NM_001325.2 GGGAACATTCCTTATGAAGCTACTGAAGAGCAGTTGAAGGACATCTTTTCTGAGGTTGGA ************************************************************ HsCD00001919 CCTGTTGTTAGTTTCAGATTGGTATACGATAGAGAGACAGGAAAGCCAAAGGGTTATGGC NM_001325.2 CCTGTTGTTAGTTTCAGATTGGTATACGATAGAGAGACAGGAAAGCCAAAGGGTTATGGC ************************************************************ HsCD00001919 TTCTGTGAATACCAAGACCAAGAGACAGCACTTAGTGCCATGCGGAACCTGAATGGGCGC NM_001325.2 TTCTGTGAATACCAAGACCAAGAGACAGCACTTAGTGCCATGCGGAACCTGAATGGGCGC ************************************************************ HsCD00001919 GAATTCAGTGGGAGAGCACTTCGAGTGGACAATGCTGCCAGTGAAAAGAACAAAGAAGAG NM_001325.2 GAATTCAGTGGGAGAGCACTTCGAGTGGACAATGCTGCCAGTGAAAAGAACAAAGAAGAG ...
Pre-mRNA cleavage/polyadenylation (C/P) defines the 3end of a mature transcript. Over half of the human genes have multiple C/P sites (pAs), resulting in mRNA...
In a world of ever-changing brands, products and trends, ELAC builds on its heritage with vision to push thinking beyond the present. This is ELAC, founded on a commitment to making the best sound in the world. It began on September 1, 1926 in Kiel, Germany, when Electroacustic GmbH was founded to focus on the development of sonar technology and the research of signal and sound channels in air and water.. ELACs passion for music and fascination with sound followed with their first consumer audio product, the PW1 record player in 1948. ELAC continued to lead the burgeoning audio industry with innovative turntables and electronics. During the 1970s and 1980s, every serious music lover had a high-quality turntable, and the fortunate few owned an ELAC, the backbone of the finest sound systems.. ...
Differential neutrophil mobilization in response to human granulocyte-colony stimulation factor (huG-CSF) in B6 and B6.Sle2c2 mice. Percentage of Ly6G+ CD11b+ n

PF3D7 1438500 - Cleavage and polyadenylation specificity factor subunit 3, putative - Plasmodium falciparum (isolate 3D7) -...PF3D7 1438500 - Cleavage and polyadenylation specificity factor subunit 3, putative - Plasmodium falciparum (isolate 3D7) -...

... end processing by stem-loop binding and cleavage, mRNA cleavage, mRNA polyadenylation ... mRNA cleavage and polyadenylation specificity factor complex, 5-3 exonuclease activity, endoribonuclease activity, RNA ... mRNA cleavage and polyadenylation specificity factor complex Source: GeneDBInferred from sequence or structural similarityi*. " ... Cleavage and polyadenylation specificity factor subunit 3, putativeImported. ,p>Information which has been imported from ...
more infohttps://www.uniprot.org/uniprot/Q8IL83

Cleavage and polyadenylation specificity factor subunit 7Cleavage and polyadenylation specificity factor subunit 7

Binds to cleavage and polyadenylation RNA substrates. Cleavage factor Im (CFIm) is one of six factors necessary for correct ... Evidence that cleavage factor Im is a heterotetrameric protein complex controlling alternative polyadenylation.. ... Tandem affinity purification and mass spectrometry analysis identify 59kDa cleavage and polyadenylation specific factor 7 ( ... Tandem affinity purification and mass spectrometry analysis identify 59kDa cleavage and polyadenylation specific factor 7 ( ...
more infohttps://pharos.nih.gov/idg/targets/Q8N684

Functions of the CCCH type zinc finger protein OsGZF1 in regulation of the seed storage protein GluB-1 from rice, Plant...Functions of the CCCH type zinc finger protein OsGZF1 in regulation of the seed storage protein GluB-1 from rice, Plant...

... activity associated with the Arabidopsis ortholog of the 30-kDa subunit of cleavage and polyadenylation specificity factor ... Vectors for transcription factor cloning and target site identification by means of genetic selection in yeast ... The maize transcription factor Opaque-2 activates a wheat glutenin promoter in plant and yeast cells ... Interaction of an immature seed-specific trans-acting factor with the 5′ upstream region of a rice glutelin gene ...
more infohttps://www.deepdyve.com/lp/springer_journal/functions-of-the-ccch-type-zinc-finger-protein-osgzf1-in-regulation-of-ZsXIHBuRJp

Calmodulin Interacts with and Regulates the RNA-Binding Activity of an Arabidopsis Polyadenylation Factor Subunit | Plant...Calmodulin Interacts with and Regulates the RNA-Binding Activity of an Arabidopsis Polyadenylation Factor Subunit | Plant...

... gene that encodes the probable ortholog of the 30-kD subunit of the mammalian cleavage and polyadenylation specificity factor ( ... The 30-kD subunit of mammalian cleavage and polyadenylation specificity factor and its yeast homolog are RNA-binding zinc ... is a gene that encodes a protein similar to the 30-kD subunit of the mammalian cleavage and polyadenylation specificity factor ... Functional dissection of the zinc finger and flanking domains of the Yth1 cleavage/polyadenylation factor. Nucleic Acids Res 31 ...
more infohttp://www.plantphysiol.org/content/140/4/1507.full

Analysis of CPEB Family Protein Member CPEB4 Function in Mammalian Neu by Ming-Chung Kan"Analysis of CPEB Family Protein Member CPEB4 Function in Mammalian Neu" by Ming-Chung Kan

For CPEB2-4 have distinct RNA binding specificity compared to CPEB1, they are referred as CPEB-like proteins. One of CPEB-like ... mediates both translational repression and activation of its target mRNAs by regulating mRNA polyadenylation. Mouse with CPEB1 ... This distinction RNA binding specificity between CPEB1 and CPEB2-4 suggests CPEB2-4 cannot replace CPEB1 in mediating local ... the RNA binding specificity of these homologs are studied by SELEX. The result shows CPEB2-4 bind to RNAs with consensus ...
more infohttps://escholarship.umassmed.edu/gsbs_diss/362/

Cleavage and polyadenylation specificity factor complex | SGDCleavage and polyadenylation specificity factor complex | SGD

Complex: Cleavage and polyadenylation specificity factor complex Macromolecular complex annotations are imported from the ...
more infohttps://www.yeastgenome.org/complex/CPX-1053

Cleavage and polyadenylation specificity factor - WikipediaCleavage and polyadenylation specificity factor - Wikipedia

Cleavage and polyadenylation specificity factor (CPSF) is involved in the cleavage of the 3 signaling region from a newly ... Cleavage And Polyadenylation Specificity Factor at the US National Library of Medicine Medical Subject Headings (MeSH). ... Murthy, KG; Manley, JL (1995). "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3 ... "The 160-kD subunit of human cleavage-polyadenylation specificity factor coordinates pre-mRNA 3-end formation". Genes & ...
more infohttps://en.wikipedia.org/wiki/Cleavage_and_polyadenylation_specificity_factor

CPSF1 - Cleavage and polyadenylation-specificity factor subunit 1 - Homo sapiens (Human) - CPSF1 gene & proteinCPSF1 - Cleavage and polyadenylation-specificity factor subunit 1 - Homo sapiens (Human) - CPSF1 gene & protein

Cleavage and polyadenylation specif.... Cleavage and polyadenylation specificity factor subunit 1 (Cleavage and polyadenylation ... Cleavage and polyadenylation-specificity factor subunit 1Imported. ,p>Information which has been imported from another database ... tr,E9PIM1,E9PIM1_HUMAN Cleavage and polyadenylation-specificity factor subunit 1 OS=Homo sapiens OX=9606 GN=CPSF1 PE=1 SV=3 ... Cleavage and polyadenylation specificity factor subunit 1 (Fragment). Bengalese finch. 163. UniRef50_A0A218U8Z9. ...
more infohttps://www.uniprot.org/uniprot/E9PIM1

RCSB PDB - 2XR1: DIMERIC ARCHAEAL CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR WITH N-TERMINAL KH DOMAINS (KH-CPSF) FROM...RCSB PDB - 2XR1: DIMERIC ARCHAEAL CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR WITH N-TERMINAL KH DOMAINS (KH-CPSF) FROM...

DIMERIC ARCHAEAL CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR WITH N-TERMINAL KH DOMAINS (KH-CPSF) FROM METHANOSARCINA MAZEI ... CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR 100 KD SUBUNIT. A, B. 640. Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 ... DIMERIC ARCHAEAL CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR WITH N-TERMINAL KH DOMAINS (KH-CPSF) FROM METHANOSARCINA MAZEI ... Crystal Structure of a Dimeric Archaeal Cleavage and Polyadenylation Specificity Factor.. Mir-Montazeri, B., Ammelburg, M., ...
more infohttps://www.rcsb.org/structure/2XR1

Cleavage and polyadenylation specificity factor subunit 7Cleavage and polyadenylation specificity factor subunit 7

Binds to cleavage and polyadenylation RNA substrates. Cleavage factor Im (CFIm) is one of six factors necessary for correct ... HCA RNA Cell Line for Cleavage and polyadenylation specificity factor subunit 7. ... which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation ... Component of the cleavage factor Im complex (CFIm) that plays a key role in pre-mRNA 3-processing. ...
more infohttps://pharos.nih.gov/idg/targets/CPSF7

CFIM68 ELISA Kits from MyBioSource.com | Biocompare.comCFIM68 ELISA Kits from MyBioSource.com | Biocompare.com

Guinea pig Cleavage and polyadenylation specificity factor subunit 6 (CPSF6) ELISA Kit MyBioSource.com ... Bovine Cleavage and polyadenylation specificity factor subunit 6 (CPSF6) ELISA Kit MyBioSource.com ... Canine Cleavage and polyadenylation specificity factor subunit 6 (CPSF6) ELISA Kit MyBioSource.com ... Chicken Cleavage and polyadenylation specificity factor subunit 6 (CPSF6) ELISA Kit MyBioSource.com ...
more infohttps://www.biocompare.com/pfu/110627/soids/2-606987/ELISA_Kit/ELISA_CFIM68?vids=104355

nature.com searchnature.com search

A potent antimalarial benzoxaborole targets a Plasmodium falciparum cleavage and polyadenylation specificity factor homologue * ... cleavage and polyadenylation specificity factor homologue . Opens in a new window. ...
more infohttp://www.nature.com/search?author=%22Patrick%20G.%20Schupp%22&error=cookies_not_supported&code=6e69c575-a3cc-4306-9272-c8a4dd1cc273

Global mapping of herpesvirus-host protein complexes reveals a transcription strategy for late genes.  - PubMed - NCBIGlobal mapping of herpesvirus-host protein complexes reveals a transcription strategy for late genes. - PubMed - NCBI

... cleavage and polyadenylation specificity factor complex; APC: anaphase-promoting complex; CTLH: C-terminal to LisH motif ... Tubulin was used as a loading and IP specificity control.. (C-D) iSLK cells infected with WT KSHV or KSHV.24.Stop were ... GAPDH was used as a loading and IP specificity control. In this and all subsequent IPs, input represents 5% of lysate used for ... Where indicated, the TATT motif in the K8.1 promoter probe was mutated to CCCC. The specificity of the interaction was ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/25544563?dopt=Abstract

Pre-mRNA 3-end-processing factor FIP1 (Q6UN15) | InterPro | EMBL-EBIPre-mRNA 3'-end-processing factor FIP1 (Q6UN15) | InterPro | EMBL-EBI

GO:0098789 pre-mRNA cleavage required for polyadenylation Molecular Function. None predicted. ...
more infohttp://www.ebi.ac.uk/interpro/protein/Q6UN15

Comparative GO Graph (mouse, human, rat)Comparative GO Graph (mouse, human, rat)

mRNA cleavage and polyadenylation specificity factor complex. PIP5K1A. IDA. Human. PMID:18305108. Cellular Component. GO: ...
more infohttp://www.informatics.jax.org/homology/GOGraph/93492

MPE1 | SGDMPE1 | SGD

Pre-mRNA binding subunit of the mRNA cleavage and polyadenylation specificity factor complex; involved in mRNA polyadenylation ... Essential conserved subunit of CPF cleavage and polyadenylation factor; plays a role in 3 end formation of mRNA via the ... pre-mRNA cleavage required for polyadenylation, and protein ubiquitination; localizes to both nucleus and cytosol. View ... specific cleavage and polyadenylation of pre-mRNA; contains a ubiquitin-like (UBL) domain, a RNA-binding zinc knuckle motif and ...
more infohttps://www.yeastgenome.org/locus/S000001542

Recombinant Human CPSF7 protein (ab164145) | AbcamRecombinant Human CPSF7 protein (ab164145) | Abcam

Cleavage and polyadenylation specificity factor 7. *Cleavage and polyadenylation specificity factor subunit 7 ... Component of the cleavage factor Im complex (CFIm) that plays a key role in pre-mRNA 3 processing. Binds to cleavage and ... Cleavage and polyadenylation specificity factor 59 kDa subunit. * ... Pre mRNA cleavage factor Im 59 kDa subunit. *Pre-mRNA cleavage ...
more infohttps://www.abcam.com/recombinant-human-cpsf7-protein-ab164145.html

Drosophila melanogaster retrotransposon and inverted repeat-derived endogenous siRNAs are differentially processed in distinct...Drosophila melanogaster retrotransposon and inverted repeat-derived endogenous siRNAs are differentially processed in distinct...

This interaction is mediated by the N-terminal 271 amino acids of Symplekin; CCC factors CPSF73 and CPSF100 do not contact Dcr2 ... a component of the core cleavage complex (CCC) required for 3 end processing of all eukaryotic mRNAs. ... CPSF73 or Symplekin results in nuclear retention of both hairpin and retrotransposon precursors suggesting that polyadenylation ... We have identified a nucleus-specific interaction between the essential esiRNA cleavage enzyme Dicer2 (Dcr2) and Symplekin, ...
more infohttps://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-3692-8

CPSF4 Gene - GeneCards | CPSF4 Protein | CPSF4 AntibodyCPSF4 Gene - GeneCards | CPSF4 Protein | CPSF4 Antibody

Cleavage And Polyadenylation Specific Factor 4, including: function, proteins, disorders, pathways, orthologs, and expression. ... Cleavage and polyadenylation specificity factor subunit 4 Protein Accession:. O95639. Secondary Accessions: *D6W5S8 ... mRNA cleavage and polyadenylation specificity factor complex. IDA. 21102410. GO:0043231. intracellular membrane-bounded ... Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in pre-mRNA 3-end ...
more infohttp://www.genecards.org/cgi-bin/carddisp.pl?gene=CPSF4

CPSF4 Gene - GeneCards | CPSF4 Protein | CPSF4 AntibodyCPSF4 Gene - GeneCards | CPSF4 Protein | CPSF4 Antibody

Cleavage And Polyadenylation Specific Factor 4, including: function, proteins, disorders, pathways, orthologs, and expression. ... Cleavage and polyadenylation specificity factor subunit 4. Protein Accession:. O95639. Secondary Accessions: *D6W5S8 ... mRNA cleavage and polyadenylation specificity factor complex. IDA. 21102410. GO:0043231. intracellular membrane-bounded ... Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in pre-mRNA 3-end ...
more infohttps://www.genecards.org/cgi-bin/carddisp.pl?id_type=entrezgene&id=10898

GO Gene ListGO Gene List

Cleavage and polyadenylation specific factor 2. NM_016856. Gene Info. Cpsf3. Cleavage and polyadenylation specificity factor 3 ... Cleavage and polyadenylation specific factor 6. NM_001013391. Gene Info. Cstf2t. Cleavage stimulation factor, 3 pre-RNA ... Cleavage and polyadenylation specific factor 1. NM_053193. NM_001164173. Gene Info. ... Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae). NM_019458. Gene Info. ...
more infohttps://cgap.nci.nih.gov/Genes/GoGeneQuery?PAGE=1&ORG=Mm&GOID=0031124

Frontiers | Coding and Non-coding RNAs, the Frontier Has Never Been So Blurred | GeneticsFrontiers | Coding and Non-coding RNAs, the Frontier Has Never Been So Blurred | Genetics

Cleavage and polyadenylation specificity factor 1 (Hube et al., 2017); cRNA, coding RNA; ncRNA, non-coding RNA. NM_ and NR_ are ...
more infohttps://www.frontiersin.org/articles/10.3389/fgene.2018.00140/full

Anti-CPSF7 antibody (ab50965) | AbcamAnti-CPSF7 antibody (ab50965) | Abcam

Cleavage and polyadenylation specificity factor 7 antibody. *Cleavage and polyadenylation specificity factor subunit 7 antibody ... Cleavage and polyadenylation specificity factor 59 kDa subunit antibody. * ... Evidence that cleavage factor Im is a heterotetrameric protein complex controlling alternative polyadenylation.. Genes Cells 15 ... Component of the cleavage factor Im complex (CFIm) that plays a key role in pre-mRNA 3 processing. Binds to cleavage and ...
more infohttps://www.abcam.com/cpsf7-antibody-ab50965.html

Gene InfoGene Info

CC] mRNA cleavage and polyadenylation specificity factor complex *[CC] nucleoplasm *[MF] RNA binding *[MF] hydrolase activity * ...
more infohttps://cgap.nci.nih.gov/Genes/GeneInfo?ORG=Hs&CID=736541&LLNO=53981
more