A large family of transmembrane proteins found in TIGHT JUNCTIONS. They take part in the formation of paracellular barriers and pores that regulate paracellular permeability.
A ubiquitously-expressed claudin subtype that acts as a general barrier-forming protein in TIGHT JUNCTIONS. Elevated expression of claudin-3 is found in a variety of tumor cell types, suggesting its role as a therapeutic target for specific ANTINEOPLASTIC AGENTS.
An integral membrane protein that is localized to TIGHT JUNCTIONS, where it plays a role in controlling the paracellular permeability of polarized cells. Mutations in the gene for claudin-1 are associated with Neonatal Ichthyosis-Sclerosing Cholangitis (NISCH) Syndrome.
A claudin subtype that takes part in maintaining the barrier-forming property of TIGHT JUNCTIONS. Claudin-4 is found associated with CLAUDIN-8 in the KIDNEY COLLECTING DUCT where it may play a role in paracellular chloride ion reabsorption.
Cell-cell junctions that seal adjacent epithelial cells together, preventing the passage of most dissolved molecules from one side of the epithelial sheet to the other. (Alberts et al., Molecular Biology of the Cell, 2nd ed, p22)
A claudin subtype that is found localized to TIGHT JUNCTIONS in VASCULAR ENDOTHELIAL CELLS. The protein was initially identified as one of several proteins which are deleted in VELOCARDIOFACIAL SYNDROME and may play an important role in maintaining the integrity of the BLOOD-BRAIN BARRIER.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
A MARVEL domain protein that plays an important role in the formation and regulation of the TIGHT JUNCTION paracellular permeability barrier.
A 195-kDa zonula occludens protein that is distinguished by the presence of a ZU5 domain at the C-terminal of the molecule.
A zonula occludens protein subtype found in epithelial cell junctions. Several isoforms of zonula occludens-2 protein exist due to use of alternative promoter regions and alternative mRNA splicings.
A claudin subtype that is associated with the formation of cation-selective channels and increased epithelial permeability. It is localized to the TIGHT JUNCTIONS of the PROXIMAL KIDNEY TUBULE and INTESTINAL EPITHELIUM.
A specialized barrier, in the TESTIS, between the interstitial BLOOD compartment and the adluminal compartment of the SEMINIFEROUS TUBULES. The barrier is formed by layers of cells from the VASCULAR ENDOTHELIUM of the capillary BLOOD VESSELS, to the SEMINIFEROUS EPITHELIUM of the seminiferous tubules. TIGHT JUNCTIONS form between adjacent SERTOLI CELLS, as well as between the ENDOTHELIAL CELLS.
Property of membranes and other structures to permit passage of light, heat, gases, liquids, metabolites, and mineral ions.
The resistance to the flow of either alternating or direct electrical current.
The technique of placing cells or tissue in a supporting medium so that thin sections can be cut using a microtome. The medium can be paraffin wax (PARAFFIN EMBEDDING) or plastics (PLASTIC EMBEDDING) such as epoxy resins.
A genus of pufferfish commonly used for research.
Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.
Excretion of abnormally high level of CALCIUM in the URINE, greater than 4 mg/kg/day.
An inherited renal disorder characterized by defective NaCl reabsorption in the convoluted DISTAL KIDNEY TUBULE leading to HYPOKALEMIA. In contrast with BARTTER SYNDROME, Gitelman syndrome includes hypomagnesemia and normocalcemic hypocalciuria, and is caused by mutations in the thiazide-sensitive SODIUM-POTASSIUM-CHLORIDE SYMPORTERS.
A condition characterized by calcification of the renal tissue itself. It is usually seen in distal RENAL TUBULAR ACIDOSIS with calcium deposition in the DISTAL KIDNEY TUBULES and the surrounding interstitium. Nephrocalcinosis causes RENAL INSUFFICIENCY.
A quality of cell membranes which permits the passage of solvents and solutes into and out of cells.
Human colonic ADENOCARCINOMA cells that are able to express differentiation features characteristic of mature intestinal cells, such as ENTEROCYTES. These cells are valuable in vitro tools for studies related to intestinal cell function and differentiation.
The U-shaped portion of the renal tubule in the KIDNEY MEDULLA, consisting of a descending limb and an ascending limb. It is situated between the PROXIMAL KIDNEY TUBULE and the DISTAL KIDNEY TUBULE.
Preparation for electron microscopy of minute replicas of exposed surfaces of the cell which have been ruptured in the frozen state. The specimen is frozen, then cleaved under high vacuum at the same temperature. The exposed surface is shadowed with carbon and platinum and coated with carbon to obtain a carbon replica.
Cells of epithelial origin possessing specialized sensory functions. They include cells that are found in the TASTE BUDS; OLFACTORY MUCOSA; COCHLEA; and NEUROEPITHELIAL BODIES.
One or more layers of EPITHELIAL CELLS, supported by the basal lamina, which covers the inner or outer surfaces of the body.
Paired respiratory organs of fishes and some amphibians that are analogous to lungs. They are richly supplied with blood vessels by which oxygen and carbon dioxide are exchanged directly with the environment.
The domestic dog, Canis familiaris, comprising about 400 breeds, of the carnivore family CANIDAE. They are worldwide in distribution and live in association with people. (Walker's Mammals of the World, 5th ed, p1065)
Anchoring points where the CYTOSKELETON of neighboring cells are connected to each other. They are composed of specialized areas of the plasma membrane where bundles of the ACTIN CYTOSKELETON attach to the membrane through the transmembrane linkers, CADHERINS, which in turn attach through their extracellular domains to cadherins in the neighboring cell membranes. In sheets of cells, they form into adhesion belts (zonula adherens) that go all the way around a cell.
Supporting cells projecting inward from the basement membrane of SEMINIFEROUS TUBULES. They surround and nourish the developing male germ cells and secrete ANDROGEN-BINDING PROTEIN and hormones such as ANTI-MULLERIAN HORMONE. The tight junctions of Sertoli cells with the SPERMATOGONIA and SPERMATOCYTES provide a BLOOD-TESTIS BARRIER.
A usually benign glandular tumor composed of oxyphil cells, large cells with small irregular nuclei and dense acidophilic granules due to the presence of abundant MITOCHONDRIA. Oxyphil cells, also known as oncocytes, are found in oncocytomas of the kidney, salivary glands, and endocrine glands. In the thyroid gland, oxyphil cells are known as Hurthle cells and Askanazy cells.
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
Direct contact of a cell with a neighboring cell. Most such junctions are too small to be resolved by light microscopy, but they can be visualized by conventional or freeze-fracture electron microscopy, both of which show that the interacting CELL MEMBRANE and often the underlying CYTOPLASM and the intervening EXTRACELLULAR SPACE are highly specialized in these regions. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p792)
Established cell cultures that have the potential to propagate indefinitely.
Different forms of a protein that may be produced from different GENES, or from the same gene by ALTERNATIVE SPLICING.
The artificial induction of GENE SILENCING by the use of RNA INTERFERENCE to reduce the expression of a specific gene. It includes the use of DOUBLE-STRANDED RNA, such as SMALL INTERFERING RNA and RNA containing HAIRPIN LOOP SEQUENCE, and ANTI-SENSE OLIGONUCLEOTIDES.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.
Body organ that filters blood for the secretion of URINE and that regulates ion concentrations.
A form of fluorescent antibody technique commonly used to detect serum antibodies and immune complexes in tissues and microorganisms in specimens from patients with infectious diseases. The technique involves formation of an antigen-antibody complex which is labeled with fluorescein-conjugated anti-immunoglobulin antibody. (From Bennington, Saunders Dictionary & Encyclopedia of Laboratory Medicine and Technology, 1984)
Degree of saltiness, which is largely the OSMOLAR CONCENTRATION of SODIUM CHLORIDE plus any other SALTS present. It is an ecological factor of considerable importance, influencing the types of organisms that live in an ENVIRONMENT.
The simultaneous analysis of multiple samples of TISSUES or CELLS from BIOPSY or in vitro culture that have been arranged in an array format on slides or microchips.
The most common etiologic agent of GAS GANGRENE. It is differentiable into several distinct types based on the distribution of twelve different toxins.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A general term for the complete or partial loss of the ability to hear from one or both ears.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Lining of the INTESTINES, consisting of an inner EPITHELIUM, a middle LAMINA PROPRIA, and an outer MUSCULARIS MUCOSAE. In the SMALL INTESTINE, the mucosa is characterized by a series of folds and abundance of absorptive cells (ENTEROCYTES) with MICROVILLI.
The part of the inner ear (LABYRINTH) that is concerned with hearing. It forms the anterior part of the labyrinth, as a snail-like structure that is situated almost horizontally anterior to the VESTIBULAR LABYRINTH.
Phenotypic changes of EPITHELIAL CELLS to MESENCHYME type, which increase cell mobility critical in many developmental processes such as NEURAL TUBE development. NEOPLASM METASTASIS and DISEASE PROGRESSION may also induce this transition.
The portion of renal tubule that begins from the enlarged segment of the ascending limb of the LOOP OF HENLE. It reenters the KIDNEY CORTEX and forms the convoluted segments of the distal tubule.
Substances that are toxic to the intestinal tract causing vomiting, diarrhea, etc.; most common enterotoxins are produced by bacteria.
Male germ cells derived from SPERMATOGONIA. The euploid primary spermatocytes undergo MEIOSIS and give rise to the haploid secondary spermatocytes which in turn give rise to SPERMATIDS.
Membrane-limited structures derived from the plasma membrane or various intracellular membranes which function in storage, transport or metabolism.
A malignant neoplasm arising from tenosynovial tissue of the joints and in synovial cells of tendons and bursae. The legs are the most common site, but the tumor can occur in the abdominal wall and other trunk muscles. There are two recognized types: the monophasic (characterized by sheaths of monotonous spindle cells) and the biphasic (characterized by slit-like spaces or clefts within the tumor, lined by cuboidal or tall columnar epithelial cells). These sarcomas occur most commonly in the second and fourth decades of life. (From Dorland, 27th ed; DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1363)
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
The mucous membrane lining the RESPIRATORY TRACT, including the NASAL CAVITY; the LARYNX; the TRACHEA; and the BRONCHI tree. The respiratory mucosa consists of various types of epithelial cells ranging from ciliated columnar to simple squamous, mucous GOBLET CELLS, and glands containing both mucous and serous cells.
Carcinoma that arises from the PANCREATIC DUCTS. It accounts for the majority of cancers derived from the PANCREAS.
Molecular products metabolized and secreted by neoplastic tissue and characterized biochemically in cells or body fluids. They are indicators of tumor stage and grade as well as useful for monitoring responses to treatment and predicting recurrence. Many chemical groups are represented including hormones, antigens, amino and nucleic acids, enzymes, polyamines, and specific cell membrane proteins and lipids.
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
An EPITHELIUM with MUCUS-secreting cells, such as GOBLET CELLS. It forms the lining of many body cavities, such as the DIGESTIVE TRACT, the RESPIRATORY TRACT, and the reproductive tract. Mucosa, rich in blood and lymph vessels, comprises an inner epithelium, a middle layer (lamina propria) of loose CONNECTIVE TISSUE, and an outer layer (muscularis mucosae) of SMOOTH MUSCLE CELLS that separates the mucosa from submucosa.
Stratified squamous epithelium that covers the outer surface of the CORNEA. It is smooth and contains many free nerve endings.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
The physical or physiological processes by which substances, tissue, cells, etc. take up or take in other substances or energy.
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
The sequential location of genes on a chromosome.
Specialized non-fenestrated tightly-joined ENDOTHELIAL CELLS with TIGHT JUNCTIONS that form a transport barrier for certain substances between the cerebral capillaries and the BRAIN tissue.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
Small polyhedral outpouchings along the walls of the alveolar sacs, alveolar ducts and terminal bronchioles through the walls of which gas exchange between alveolar air and pulmonary capillary blood takes place.
Proteins obtained from the ZEBRAFISH. Many of the proteins in this species have been the subject of studies involving basic embryological development (EMBRYOLOGY).
Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.
Calcium-dependent cell adhesion proteins. They are important in the formation of ADHERENS JUNCTIONS between cells. Cadherins are classified by their distinct immunological and tissue specificities, either by letters (E- for epithelial, N- for neural, and P- for placental cadherins) or by numbers (cadherin-12 or N-cadherin 2 for brain-cadherin). Cadherins promote cell adhesion via a homophilic mechanism as in the construction of tissues and of the whole animal body.
A carcinoma discovered by Dr. Margaret R. Lewis of the Wistar Institute in 1951. This tumor originated spontaneously as a carcinoma of the lung of a C57BL mouse. The tumor does not appear to be grossly hemorrhagic and the majority of the tumor tissue is a semifirm homogeneous mass. (From Cancer Chemother Rep 2 1972 Nov;(3)1:325) It is also called 3LL and LLC and is used as a transplantable malignancy.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
An exotic species of the family CYPRINIDAE, originally from Asia, that has been introduced in North America. They are used in embryological studies and to study the effects of certain chemicals on development.
The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.
A light microscopic technique in which only a small spot is illuminated and observed at a time. An image is constructed through point-by-point scanning of the field in this manner. Light sources may be conventional or laser, and fluorescence or transmitted observations are possible.
A cell line derived from cultured tumor cells.
Interruption or suppression of the expression of a gene at transcriptional or translational levels.
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
The process of germ cell development in the male from the primordial germ cells, through SPERMATOGONIA; SPERMATOCYTES; SPERMATIDS; to the mature haploid SPERMATOZOA.
Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.
The pattern of GENE EXPRESSION at the level of genetic transcription in a specific organism or under specific circumstances in specific cells.
Orientation of intracellular structures especially with respect to the apical and basolateral domains of the plasma membrane. Polarized cells must direct proteins from the Golgi apparatus to the appropriate domain since tight junctions prevent proteins from diffusing between the two domains.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.
Refers to animals in the period of time just after birth.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.
Methods used for detecting the amplified DNA products from the polymerase chain reaction as they accumulate instead of at the end of the reaction.
The relationships of groups of organisms as reflected by their genetic makeup.
A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Highly specialized EPITHELIAL CELLS that line the HEART; BLOOD VESSELS; and lymph vessels, forming the ENDOTHELIUM. They are polygonal in shape and joined together by TIGHT JUNCTIONS. The tight junctions allow for variable permeability to specific macromolecules that are transported across the endothelial layer.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.
MAMMARY GLANDS in the non-human MAMMALS.
A nonparametric method of compiling LIFE TABLES or survival tables. It combines calculated probabilities of survival and estimates to allow for observations occurring beyond a measurement threshold, which are assumed to occur randomly. Time intervals are defined as ending each time an event occurs and are therefore unequal. (From Last, A Dictionary of Epidemiology, 1995)
Surface ligands, usually glycoproteins, that mediate cell-to-cell adhesion. Their functions include the assembly and interconnection of various vertebrate systems, as well as maintenance of tissue integration, wound healing, morphogenic movements, cellular migrations, and metastasis.
A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Tumors or cancer of the human BREAST.
A set of statistical methods used to group variables or observations into strongly inter-related subgroups. In epidemiology, it may be used to analyze a closely grouped series of events or cases of disease or other health-related phenomenon with well-defined distribution patterns in relation to time or place or both.
Adherence of cells to surfaces or to other cells.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.
Tumors or cancer of the PANCREAS. Depending on the types of ISLET CELLS present in the tumors, various hormones can be secreted: GLUCAGON from PANCREATIC ALPHA CELLS; INSULIN from PANCREATIC BETA CELLS; and SOMATOSTATIN from the SOMATOSTATIN-SECRETING CELLS. Most are malignant except the insulin-producing tumors (INSULINOMA).
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
Laboratory tests used to evaluate how well the kidneys are working through examination of blood and urine.
Proteins prepared by recombinant DNA technology.

Clostridium perfringens enterotoxin fragment removes specific claudins from tight junction strands: Evidence for direct involvement of claudins in tight junction barrier. (1/170)

Claudins, comprising a multigene family, constitute tight junction (TJ) strands. Clostridium perfringens enterotoxin (CPE), a single approximately 35-kD polypeptide, was reported to specifically bind to claudin-3/RVP1 and claudin-4/CPE-R at its COOH-terminal half. We examined the effects of the COOH-terminal half fragment of CPE (C-CPE) on TJs in L transfectants expressing claudin-1 to -4 (C1L to C4L, respectively), and in MDCK I cells expressing claudin-1 and -4. C-CPE bound to claudin-3 and -4 with high affinity, but not to claudin-1 or -2. In the presence of C-CPE, reconstituted TJ strands in C3L cells gradually disintegrated and disappeared from their cell surface. In MDCK I cells incubated with C-CPE, claudin-4 was selectively removed from TJs with its concomitant degradation. At 4 h after incubation with C-CPE, TJ strands were disintegrated, and the number of TJ strands and the complexity of their network were markedly decreased. In good agreement with the time course of these morphological changes, the TJ barrier (TER and paracellular flux) of MDCK I cells was downregulated by C-CPE in a dose-dependent manner. These findings provided evidence for the direct involvement of claudins in the barrier functions of TJs.  (+info)

Regulated expression of claudin-4 decreases paracellular conductance through a selective decrease in sodium permeability. (2/170)

Tight junctions regulate paracellular conductance and ionic selectivity. These properties vary among epithelia but the molecular basis of this variation remains unknown. To test whether members of the claudin family of tight junction proteins influence paracellular ionic selectivity, we expressed human claudin-4 in cultured MDCK cells using an inducible promoter. Overexpression increased the complexity of tight junction strands visible by freeze-fracture microscopy without affecting the levels of claudin-1, -2, or -3, occludin, or ZO-1. A decrease in conductance correlated directly with the kinetics of claudin-4 induction. Dilution potentials revealed that the decrease in paracellular conductance resulted from a selective decrease in Na(+) permeability without a significant effect on Cl(-) permeability. Flux for an uncharged solute, mannitol, and the rank order of permeabilities for the alkali metal cations were unchanged. A paracellular site for these effects was supported by the lack of apical/basal directionality of the dilution potentials, the linearity of current-voltage relationships, and the lack of influence of inhibitors of major transcellular transporters. These results provide, to our knowledge, the first direct demonstration of the ability of a claudin to influence paracellular ion selectivity and support a role for the claudins in creating selective channels through the tight-junction barrier.  (+info)

Expression of Clostridium perfringens enterotoxin receptors claudin-3 and claudin-4 in prostate cancer epithelium. (3/170)

The mRNA for Rvp.1 (rat ventral prostate) increases in abundance before gland involution after androgen deprivation. Rvp.1 is homologous to CPE-R, the high-affinity intestinal epithelial receptor for Clostridium perfringens enterotoxin (CPE), and is sufficient to mediate CPE binding and trigger subsequent toxin-mediated cytolysis. Rvp.1 (claudin-3) and CPE-R (claudin-4) are members of a larger family of transmembrane tissue-specific claudin proteins that are essential components of intercellular tight junction structures regulating paracellular ion flux. However, claudin-3 and claudin-4 are the only family members capable of mediating CPE binding and cytolysis. The present study was designed to study the expression of claudin-3 and claudin-4 in human prostate tissue as potential targets for CPE toxin-mediated therapy for prostate cancer. On human multiple-tissue Northern blot analysis, mRNAs for both claudin-3 and claudin-4 were expressed at high levels in prostate tissue. In normal prostate tissue, expression of claudin-3 was localized exclusively within acinar epithelial cells by in situ mRNA hybridization. Compared with expression within prostate epithelial cells in surrounding normal glandular tissue, expression of claudin-3 mRNA remained high in the epithelium of prostate adenocarcinoma (10 of 10) and prostatic intraepithelial neoplasia (five of five). Prostate adenocarcinoma cells metastatic to bone were obtained from a patient with disease progression during antiandrogen therapy. These metastatic cells were prostate-specific antigen-positive by immunohistochemical staining and also expressed functional CPE receptors as measured by sensitivity to CPE-induced cell lysis. The persistent high level of claudin-3 expression in prostate adenocarcinoma and functional cytotoxicity of CPE in metastatic androgen-independent prostate adenocarcinoma suggests a new potential therapeutic strategy for prostate cancer.  (+info)

Molecular regulation of urothelial renewal and host defenses during infection with uropathogenic Escherichia coli. (4/170)

Uropathogenic Escherichia coli (UPEC), the principal cause of urinary tract infection in women, attaches to the superficial facet cell layer of the bladder epithelium (urothelium) via its FimH adhesin. Attachment triggers exfoliation of bacteria-laden superficial facet cells, followed by rapid reconstitution of the urothelium through differentiation of underlying basal and intermediate cells. We have used DNA microarrays to define the molecular regulators of urothelial renewal and host defense expressed in adult C57Bl/6 female mice during the early phases of infection with isogenic virulent (FimH+) or avirulent (FimH-) UPEC strains. The temporal evolution and cellular origins of selected responses were then characterized by real time quantitative reverse transcriptase-PCR, in situ hybridization, and immunohistochemical analyses. Well before exfoliation is evident, FimH-mediated attachment suppresses transforming growth factor-beta (Bmp4) and Wnt5a/Ca(2+) signaling to promote subsequent differentiation of basal/intermediate cells. The early transcriptional responses to attachment also include induction of regulators of proliferation (e.g. epidermal growth factor family members), induction of the ETS transcription factor Elf3, which transactivates genes involved in epithelial differentiation and host defense (inducible nitric-oxide synthase), induction of modulators, and mediators of pro-inflammatory responses (e.g. Socs3, Cebp/delta, Bcl3, and CC/CXC chemokines), induction of modulators of apoptotic responses (A20), and induction of intermediate cell tight junction components (claudin-4). Both early and late phases of the host response exhibit remarkable specificity for the FimH+ strain and provide new insights about the molecular cascade mobilized to combat UPEC-associated urinary tract infection.  (+info)

Claudins create charge-selective channels in the paracellular pathway between epithelial cells. (5/170)

Epithelia separate tissue spaces by regulating the passage of ions, solutes, and water through both the transcellular and paracellular pathways. Paracellular permeability is defined by intercellular tight junctions, which vary widely among tissues with respect to solute flux, electrical resistance, and ionic charge selectivity. To test the hypothesis that members of the claudin family of tight junction proteins create charge selectivity, we assessed the effect of reversing the charge of selected extracellular amino acids in two claudins using site-directed mutagenesis. Claudins were expressed in cultured Madin-Darby canine kidney cell monolayers under an inducible promoter, and clones were compared with and without induction for transmonolayer electrical resistance and dilution potentials. Expression and localization of claudins were determined by immunoblotting, immunofluorescence microscopy, and freeze-fracture electron microscopy. We observed that substituting a negative for a positive charge at position 65 in the first extracellular domain of claudin-4 increased paracellular Na+ permeability. Conversely, substituting positive for negative charges at three positions in the first extracellular domain of claudin-15, singly and in combination, reversed paracellular charge selectivity from a preference for Na+ to Cl-. These results support a model where claudins create charge-selective channels in the paracellular space.  (+info)

The renal segmental distribution of claudins changes with development. (6/170)

BACKGROUND: Permeability properties of mammalian nephron are tuned during postnatal maturation. The transepithelial electrical resistance (TER) and complexity of tight junctions (TJs) vary along the different tubular segments, suggesting that the molecules constituting this structure change. We studied the differential expression of occludin and several claudins in isolated renal tubules from newborn and adult rabbits. METHODS: Isolated renal tubules from newborn and adult rabbits were processed for occludin, claudin-1 and claudin-2 immunofluorescence, and Western blot detection of claudin-1 and -2. Claudin-5 was detected in whole kidney frozen sections. RT-PCR from isolated tubules was performed for claudins-1 to -8. RESULTS: Immunofluorescence revealed that occludin, claudin-1 and -2 were present at the cell boundaries at the neonatal stage of development. Claudin-1 was detected in the tighter segments of the nephron (distal and collecting duct), while claudin-2 was found in the leaky portions (proximal). Claudin 5 was found in the kidney vasculature. PCR amplification revealed the presence of claudins-1 to -4 in tubules of newborns. In adults, claudins-1, -2 and -4 were present in proximal, Henle's loop and collecting segments; claudin-3 was in proximal and collecting tubules, while claudins-5 and -6 were absent from all tubular portions. Claudin-7 was restricted to proximal tubules, while claudin-8 was present in proximal and Henle's segments. CONCLUSIONS: The pattern of occludin distribution is present from the neonatal age. Claudins-7 and -8 are up-regulated after birth. Each tubular segment expresses a peculiar set of claudins that might be responsible for the permeability properties of their TJs.  (+info)

Changes in gene expression during the early to mid-luteal (receptive phase) transition in human endometrium detected by high-density microarray screening. (7/170)

High density cDNA microarray screening was used to determine changes in gene expression occurring during the transition between the early luteal (prereceptive) and mid-luteal (receptive) phases in human endometrium. Of approximately 12,000 genes profiled, 693 (5.8%) displayed >2-fold differences in relative levels of expression between these stages. Of these, 370 genes (3.1%) displayed decreases ranging from 2- to >100-fold while 323 genes (2.7%) displayed increases ranging from 2- to >45-fold. Many genes correspond to mRNAs encoding proteins previously shown to change in a similar manner between the proliferative and mid-luteal phases, serving as one validation of the microarray screening results. In addition, novel genes were identified. Genes encoding cell surface receptors, adhesion and extracellular matrix proteins and growth factors accounted for 20% of the changes. Several genes were studied further by Northern blot analyses. These results confirmed that claudin-4/Clostridium perfringens enterotoxin (CPE) receptor and osteopontin (OPN) mRNA increased approximately 4- and 12-fold respectively, while betaig-H3 (BIGH3) decreased >80% during the early to mid-luteal transition. Immunostaining also revealed strong specific staining for claudin-4/CPE, EP(1) and prostaglandin receptor in epithelia, and leukotriene B4 receptor in both epithelia and stroma, at the mid-luteal stage. Collectively, these studies identify multiple new candidate markers that may be used to predict the receptive phase in humans. Some of these gene products, e.g. OPN, may play direct roles in embryo-uterine interactions during the implantation process.  (+info)

Expression, solubilization, and biochemical characterization of the tight junction transmembrane protein claudin-4. (8/170)

The tight junction tetraspan protein claudin-4 creates a charge-selective pore in the paracellular pathway across epithelia. The structure of the pore is unknown, but is presumed to result from transcellular adhesive contacts between claudin's extracellular loops. Here we report the expression of claudin-4 by baculovirus infection of Sf9 cells and describe the biochemical analysis suggesting it has a hexameric quaternary configuration. We show the detergent perfluoro-octanoic acid is able to maintain oligomeric claudin species. Sucrose velocity centrifugation and laser light scattering are also used to investigate the oligomeric state of claudin-4. In contrast to proteins of similar topology, such as gap junction family connexins, the oligomeric state of claudins appears more dynamic. These data suggest the structural organization of claudins in tight junction pores is unique.  (+info)

Claudin-4 (Clostridium perfringens enterotoxin receptor) is a tight junction protein encoded by the gene CLDN4. Expression of Claudin-4 has been associated with either poor prognosis or a more favorable diagnosis, depending on the type of cancer. Claudin-4 has been shown to distinguish adenocarcinoma from malignant mesothelioma with 99% specificity in malignant effusions (1). Claudin-4 overexpression was able to independently predict survival in a breast cancer multivariate analysis as it was associated with poor prognosis, high tumor grade and Her2 expression and was inversely correlated with estrogen receptor staining (2). In luminal breast cancer, the increase of Claudin-4 protein was correlated with the increase of tumor grade and with Ki-67, and thus demonstrated an overall shorter life survival (3). Basal-like tumors also demonstrated overexpression of Claudin-4 (4). Counter to the above breast cancer subtypes, the presence of Claudin-4 in triple negative breast cancer was a biomarker that
Read Claudin-8 Expression in Renal Epithelial Cells Augments the Paracellular Barrier by Replacing Endogenous Claudin-2, The Journal of Membrane Biology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
Development of innovative, effective therapies against recurrent/chemotherapy-resistant ovarian cancer remains a high priority. Using high-throughput technologies to analyze genetic fingerprints of ovarian cancer, we have discovered extremely high expression of the genes encoding the proteins claudin-3 and claudin-4. Because claudin-3 and -4 are the epithelial receptors for Clostridium perfringens enterotoxin (CPE), and are sufficient to mediate CPE binding, in this study we evaluated the in vitro and in vivo bioactivity of the carboxy-terminal fragment of CPE (i.e., CPE290-319 binding peptide) as a carrier for tumor imaging agents and intracellular delivery of therapeutic drugs. Claudin-3 and -4 expression was examined with rt-PCR and flow cytometry in multiple primary ovarian carcinoma cell lines. Cell binding assays were used to assess the accuracy and specificity of the CPE peptide in vitro against primary chemotherapy-resistant ovarian carcinoma cell lines. Confocal microscopy and biodistribution
The entire human body and its many compartments are shielded from their external environments by the barrier function of epithelial cell sheets. The paracellular barrier function of tight junctions (TJs) is critical for maintaining homeostasis in any multicellular organism, especially in the skin and internal organs and at the blood-brain barrier. One of the major components of TJs is a family of adhesive membrane proteins known as claudins. Several members of the claudin family are receptors for the bacterial toxin Clostridium perfringens enterotoxin. This toxin often causes food-borne illness both in humans and animals. Saitoh et al. crystallized a complex between the toxin and a claudin that reveals just how the toxin damages epithelial barriers (see the Perspective by Artursson and Knight).. Science, this issue p. 775; see also p. 716 ...
We investigated some immunogenic properties of Clostridium perfringens enterotoxin (CPE) in vitro using murine J774A macrophages (MPhi) and in vivo using Swiss Webster (SW) mice. CPE was a potent mitogen in vitro, where cell proliferation increased with CPE concentration. CPE was nonmitogenic when M …
As mentioned in our introduction, the availability of CPE-directed therapeutics could be helpful for ameliorating several CPE-associated medical conditions. A previous study had suggested that the drug mepacrine might be a candidate CPE therapeutic because the presence of this drug interferes with CPE-induced electrophysiologic activity in artificial lipid bilayers (24). However, that study did not distinguish whether mepacrine inactivates the CPE protein or instead interferes with some step in CPE action, i.e., whether this drug affects CPE binding, CPE pore formation, or CPE pore activity. Furthermore, it was specifically important to determine whether mepacrine is not only protective against CPE electrophysiologic activity in artificial membranes but also inhibits CPE-induced cytotoxicity in mammalian cells, where receptors are present and complex phenomena like membrane vesicle release occur (30).. Therefore, a first major contribution of the current study entailed demonstrating that ...
Open peer review is a system where authors know who the reviewers are, and the reviewers know who the authors are. If the manuscript is accepted, the named reviewer reports are published alongside the article. Pre-publication versions of the article and author comments to reviewers are available by contacting [email protected] All previous versions of the manuscript and all author responses to the reviewers are also available.. You can find further information about the peer review system here.. ...
The ability to invade host tissues and metastasize is the major cause of cancer-related death. During tumor invasion, metastasizing cells disrupt normal cell-matrix adhesion and acquire an invasive phenotype. Claudins are adhesion proteins localized at tight junctions (TJs). Claudin-7 is a unique TJ membrane protein in that it has a stronger basolateral membrane distribution than that of apical TJs in epithelial cells. To study the basolateral function of claudin-7, claudin-7 gene silencing experiments were carried out in a lung cancer cell line using the lentivirus shRNA approach. We found that claudin-7 knockdown (KD) cells showed disrupted cell-matrix interactions. Consequently, when claudin-7 KD cells were plated on the uncoated glass surface, they were unable to attach to the glass and died the day after plating. In contrast, control cells adhered well and grew normally. Using immunofluorescent microscopy and biochemistry methods, we found that claudin-7 co-localized and ...
Shop a large selection of Proteins A-Z products and learn more about Novus Biologicals Claudin-2 Recombinant Protein Antigen Quantity: 100µL:Life Quantity: 100µL.
DESCRIPTION (provided by applicant): Disruption of the cell-cell junction with concomitant changes in the expression of junctional proteins is a hallmark of cancer metastasis and invasion. Role of adherent junction proteins have been studied extensively in cancer, however the role of tight junction proteins is less understood. Claudins are the recently identified tetraspanins, which are integral to the structure and function of tight junctions (TJs). Recent studies have shown changes in expression/cellular localization for claudins during tumorigenesis, however a cause and effect relationship has not been established. Here, we report a highly increased expression for claudin-1 in human primary colon carcinoma and metastatic tissues and cell lines derived from similar sources with relatively frequent nuclear localization. Furthermore, using genetic manipulations of claudin-1 expression in colon cancer cell lines, we demonstrate a role for claudin-1 in the regulation of epithelial to mesenchymal ...
The aim of this study was to characterize the hCMEC/D3 cell line, an in vitro model of the human Blood Brain Barrier (BBB) for the expression of brain endothelial specific claudins-3 and -12. hCMEC/D3 cells express claudins-3 and -12. Claudin-3 is distinctly localized to the TJ whereas claudin -12 is observed in the perinuclear region and completely absent from TJs. We show that the expression of both proteins is lost in cell passage numbers where the BBB properties are no longer fully conserved. Expression and localization of claudin-3 is not modulated by simvastatin shown to improve barrier function in vitro and also recommended for routine hCMEC/D3 culture. These results support conservation of claudin-3 and -12 expression in the hCMEC/D3 cell line and make claudin-3 a potential marker for BBB characteristics in vitro.
Sigma-Aldrich offers abstracts and full-text articles by [S K Tiwari-Woodruff, A G Buznikov, T Q Vu, P E Micevych, K Chen, H I Kornblum, J M Bronstein].
View mouse Cldn15 Chr5:136966616-136975858 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
Reaktivität: Huhn, Rind (Kuh), Hund and more. 60 verschiedene CLDN18 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
The expression of claudin-11 in benign and malignant bladder tissue and the effect of forced expression of claudin-11 on tight junction function and invasiveness of bladder cancer cells were studied. Claudin-11 expression was tested in bladder cancer cell lines (T24/83, RT 112/84 and EJ138) using reverse transcription-polymerase chain reaction (RT-PCR) and in benign and malignant bladder tissue by quantitative RT-PCR and immunohistochemistry. T24/83 cells were transfected with the pcDNA.1/NT-GFP-TOPO vector containing full-length human claudin-11 sequence. Stable-transfected cells overexpressing claudin-11 (T24Cl-11Ex), wild-type cells (T24WT) and the empty plasmid control clone (T24GFP) were compared using transurothelial resistance (TUR), in vitro adhesion, invasion and growth assays. Claudin-11 was strongly expressed in the non-invasive RT112/84 cell line compared to the invasive T24/83 and EJ138 TCC cell lines. Benign bladder tissue demonstrated equal expression of claudin-11 mRNA as ...
The protein encoded by this intronless gene belongs to the claudin family. Claudins are integral membrane proteins that are components of the epithelial cell tight junctions, which regulate movement of solutes and ions through the paracellular space. This protein is a high-affinity receptor for Clostridium perfringens enterotoxin (CPE) and may play a role in internal organ development and function during pre- and postnatal life. This gene is deleted in Williams-Beuren syndrome, a neurodevelopmental disorder affecting multiple systems. [provided by RefSeq, Sep 2013 ...
Claudin-1 is an integral membrane protein component of tight junctions. The Snail family of transcription factors are repressors that play a central role in the epithelial-mesenchymal transition, a process that occurs during cancer progression. Snail and Slug members are direct repressors of E-cadherin and act by binding to the specific E-boxes of its proximal promoter. In the present study, we demonstrate that overexpression of Slug or Snail causes a decrease in transepithelial electrical resistance. Overexpression of Slug and Snail in MDCK (Madin-Darby canine kidney) cells down-regulated Claudin-1 at protein and mRNA levels. In addition, Snail and Slug are able to effectively repress human Claudin-1-driven reporter gene constructs containing the wild-type promoter sequence, but not those with mutations in two proximal E-box elements. We also demonstrate by band-shift assay that Snail and Slug bind to the E-box motifs present in the human Claudin-1 promoter. Moreover, an inverse correlation in ...
TY - JOUR. T1 - Interendothelial claudin-5 expression depends on cerebral endothelial cell-matrix adhesion by Β 1-integrins. AU - Osada, Takashi. AU - Gu, Yu Huan. AU - Kanazawa, Masato. AU - Tsubota, Yoshiaki. AU - Hawkins, Brian T.. AU - Spatz, Maria. AU - Milner, Richard. AU - Del Zoppo, Gregory J.. PY - 2011/10. Y1 - 2011/10. N2 - The hypothesis tested by these studies states that in addition to interendothelial cell tight junction proteins, matrix adhesion by Β 1-integrin receptors expressed by endothelial cells have an important role in maintaining the cerebral microvessel permeability barrier. Primary brain endothelial cells from C57 BL/6 mice were incubated with Β 1-integrin function-blocking antibody (Ha2/5) or isotype control and the impacts on claudin-5 expression and microvessel permeability were quantified. Both flow cytometry and immunofluorescence studies demonstrated that the interendothelial claudin-5 expression by confluent endothelial cells was significantly decreased in a ...
HCV is a leading cause of hepatocellular carcinoma and cirrhosis all over the world. Claudins belong to family of tight junctions proteins that are responsible for establishing barriers for controlling the flow of molecules around cells. For therapeutic strategies, regulation of viral entry into the host cells holds a lot of promise. During HCV infection claudin-1 is highly expressed in liver and believed to be associated with HCV virus entry after HCV binding with or without co-receptor CD81. The claudin-1 assembly with tight junctions is regulated by post translational modifications. During claudins assembly and disassembly with tight junctions, phosphorylation is required at C-terminal tail. In cellular proteins, interplay between phosphorylation and O-β-GlcNAc modification is believed to be functional switch, but it is very difficult to monitor these functional and vibrant changes in vivo. Netphos 2.0 and Disphos 1.3 programs were used for potential phosphorylation; NetPhosK 1.0 and KinasePhos for
Recent investigations revealed that epithelial TJs contain charge- and size-selective pores, which control the paracellular flux of charged and uncharged solutes. The paracellular flux occurs through two distinct pathways: one high-capacity pathway with size-restrictive pores and one low-capacity pathway that is size independent, at least for substances with radii of up to 7 Å (Van Itallie et al., 2008; Watson et al., 2001). The physical basis of the low-capacity pathway is not yet completely understood, whereas the high-capacity pathway is well described. It consists of small pores with radii of ~4 Å, and is responsible for the flux of small charged and uncharged solutes. Expression of claudin-2 affects only the high-capacity pathway, by inducing an increase in pore number and a change in charge selectivity (Van Itallie et al., 2008). In a recent attempt to model the claudin-2-induced channel (Yu et al., 2009), the pore diameter, calculated from permeability to organic cations and from the ...
GGRNA , 2020-04-07 23:23:15 , RefSeq release 60 (20130726)] RefSeq ID Version Symbol GeneID Definition NM_001101389 NM_001101389.1 CLDN25 644672 Homo sapiens claudin 25 (CLDN25), mRNA. NM_001111319 NM_001111319.1 CLDN22 53842 Homo sapiens claudin 22 (CLDN22), mRNA. NM_020982 NM_020982.3 CLDN9 9080 Homo sapiens claudin 9 (CLDN9), mRNA. NM_001001346 NM_001001346.3 CLDN20 49861 Homo sapiens claudin 20 (CLDN20), mRNA. NM_001306 NM_001306.3 CLDN3 1365 Homo sapiens claudin 3 (CLDN3), mRNA. NM_012131 NM_012131.2 CLDN17 26285 Homo sapiens claudin 17 (CLDN17), mRNA. NM_016369 NM_016369.3 CLDN18 51208 Homo sapiens claudin 18 (CLDN18), transcript variant 1, mRNA. NM_001185056 NM_001185056.1 CLDN11 5010 Homo sapiens claudin 11 (CLDN11), transcript variant 2, mRNA. NM_005602 NM_005602.5 CLDN11 5010 Homo sapiens claudin 11 (CLDN11), transcript variant 1, mRNA. NM_182848 NM_182848.3 CLDN10 9071 Homo sapiens claudin 10 (CLDN10), transcript variant a, mRNA. NM_006984 NM_006984.4 CLDN10 9071 Homo sapiens claudin ...
Claudins are a family of proteins that are the most important components of the tight junctions, where they establish the paracellular barrier that controls the flow of molecules in the intercellular space between the cells of an epithelium. They have four transmembrane domains, with the N-terminus and the C-terminus in the cytoplasm. Claudins are small (20-27 kilodalton (kDa)) transmembrane proteins which are found in many organisms, ranging from nematodes to human beings, and are very similar in their structure, although this conservation is not observed on the genetic level. Claudins span the cellular membrane 4 times, with the N-terminal end and the C-terminal end both located in the cytoplasm, and two extracellular loops which show the highest degree of conservation. The first extracellular loop consists on average of 53 amino acids and the second one, being slightly smaller, of 24 amino acids. The N-terminal end is usually very short (4-10 amino acids), the C-terminal end varies in length ...
Shop a large selection of products and learn more about Claudin-9 Rabbit anti-Human, Polyclonal, Novus Biologicals 100µL; 100µL; Unlabeled.
In this work, we assessed the effects of sinomenine (SN) on intestinal octreotide (OCT) absorption both in Caco-2 cell monolayers and in rats. We also investigated the molecular mechanisms of tight junction (TJ) disruption and recovery by SN-mediated changes in the claudin-1 and protein kinase C (PKC) signaling pathway. The data showed that exposure to SN resulted in a significant decrease in the expression of claudin-1, which represented TJ weakening and paracellular permeability enhancement. Then, the recovery of TJ after SN removal required an increase in claudin-1, which demonstrated the transient and reversible opening for TJ. Meanwhile, the SN-mediated translocation of PKC-α from the cytosol to the membrane was found to prove PKC activation. Finally, SN significantly improved the absolute OCT bioavailability in rats and the transport rate in Caco-2 cell monolayers. We conclude that SN has the ability to enhance intestinal OCT absorption and that these mechanisms are related at least in part to
For every experimental group, brains from at minimum 3 distinct litter had been analyzed and when compared to the in accordance NaCl handle group. qPCR approach improvement exposed that only samples must be when compared to every other which have gone through experimental treatment, mind isolation, storage, purification and evaluation preparing steps with each other. Therefore, for every DEX-treatment the according NaCl handle group was carried out at the exact same time. In addition, owing to the large complete variety of samples, but limited sample variety which could be purified at the same time, only samples from mice at the same age and identical variety of antenatal injections ended up compared to every other by using a two-tailed Student`s t-take a look at. Data are offered as the signifies ± SEM. The major tight junction molecule and mind endothelial mobile marker claudin-five was investigated originally. Triple maternal DEX remedy drastically decreased claudin-5 mRNA expression to .54 ...
Claudin-3 is a major protein of tight junctions (TJs) in the intestinal epithelium and is critical for maintaining cell-cell adhesion, barrier function, and epithelium polarity. Recent studies have shown high claudin-3 levels in several solid tumors, but the regulation mechanism of claudin-3 expression remains poorly understood. In the present study, colorectal cancer (CRC) tissues, HT-29 and DLD-1 CRC cell lines, CRC murine model (C57BL/6 mice) and c-kit loss-of-function mutant mice were used. We demonstrated that elevated claudin-3 levels were positively correlated with highly expressed c-kit in CRC tissues based upon analysis of protein expression. In vitro, claudin-3 expression was clearly increased in CRC cells by overexpressed c-kit or stimulated by exogenous recombinant human stem cell factor (rhSCF), while significantly decreased by the treatment with c-kit or c-Jun N-terminal kinase (JNK) inhibitors. Chromatin immunoprecipitation (ChIP) and luciferase reporter assay showed that SCF/c-kit
Epithelial barrier dysfunction is a significant factor in many allergic diseases, including eosinophilic esophagitis (EoE). Infiltrating leukocytes and tissue adaptations increase metabolic demands and decrease oxygen availability at barrier surfaces. Understanding of how these processes impact barrier is limited, particularly in allergy. Here, we identified a regulatory axis whereby the oxygen-sensing transcription factor HIF-1α orchestrated epithelial barrier integrity, selectively controlling tight junction CLDN1 (claudin-1). Prolonged experimental hypoxia or HIF1A knockdown suppressed HIF-1α-dependent claudin-1 expression and epithelial barrier function, as documented in 3D organotypic epithelial cultures. L2-IL5OXA mice with EoE-relevant allergic inflammation displayed localized eosinophil oxygen metabolism, tissue hypoxia, and impaired claudin-1 barrier via repression of HIF-1α/claudin-1 signaling, which was restored by transgenic expression of esophageal epithelial-targeted stabilized ...
Epithelioid mesothelioma is a cancer caused by asbestos. It is the most common cell type and is most responsive to treatment. Discover more about the disease.
Findings: hCMEC/D3 cells express claudins-3 and -12. Claudin-3 is distinctly localized to the TJ whereas claudin -12 is observed in the perinuclear region and completely absent from TJs. We show that the expression of both proteins is lost in cell passage numbers where the BBB properties are no longer fully conserved. Expression and localization of claudin-3 is not modulated by simvastatin shown to improve barrier function in vitro and also recommended for routine hCMEC/D3 culture ...
Cytoplasmic expression of claudin-1 in metastatic melanoma cells correlates to increased migration, and increased secretion of MMP-2 in a PKC dependent manner, whereas claudin-1 nuclear expressi...
Reaktivität: Huhn, Rind (Kuh), Hund and more. 16 verschiedene CLDN16 ELISA Kits vergleichen. Alle direkt auf antikoerper-online.de bestellbar!
PubMed.pro是医学,生命科学领域的数据库,简洁易用的PubMed中文版,PubMed手机版, 支持中英文关键词检索,标题摘要翻译,自动显示期刊影响因子,桌面手机均可使用
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Mammals are able to rapidly produce red blood cells in response to stress. The molecular pathways used in this process are important in understanding responses to anaemia in multiple biological settings. Here we characterise the novel gene Claudin 13 (Cldn13), a member of the Claudin family of tight junction proteins using RNA expression, microarray and phylogenetic analysis. We present evidence that Cldn13 appears to be co-ordinately regulated as part of a stress induced erythropoiesis pathway and is a mouse-specific gene mainly expressed in tissues associated with haematopoietic function. CLDN13 phylogenetically groups with its genomic neighbour CLDN4, a conserved tight junction protein with a putative role in epithelial to mesenchymal transition, suggesting a recent duplication event. Mechanisms of mammalian stress erythropoiesis are of importance in anaemic responses and expression microarray analyses demonstrate that Cldn13 is the most abundant Claudin in spleen from mice infected with ...
Crohns disease; infective colitis is often a cause of one episode of colitis which is mislabelled as ulcerative colitis e.g. transverse colon the portion Causes and symptoms. Biocare Probiotics 30 Billion Which Uk Are Best benefits of Digestive Enzymes for Cats. John McDougall in his book The McDougall Plan summarizes the multiple benefits of fiber (some info Ive taken from other sources too): Fiber has no calories since Probiotic dosages are listed Introduction Giardia Clostridium perfringens enterotoxin and Cryptosporidium are important causes of diarrhea in dogs and cats. Find and study online flashcards from Pathophysiology 3400. Colorectal cancer commonly known as colon cancer or bowel cancer is a melanoma from uncontrolled cell growth in the Probiotics can also play Biocare Probiotics 30 Billion Which Uk Are Best a role in maintaining oral health (bad eath). I know there have been some posts dealing with probiotics and many have questions about wh Stage IIB: Cancer has C colon ...
& 2004 USCAP, Inc All rights reserved /04 $ immunostaining in distinguishing epithelial mesothelioma and lung adenocarcinoma Karine Llinares 1,2, Fabienne Escande
https://doi.org/10.18632/oncotarget.14974 Lianmin Zhang, Yuan Wang, Bin Zhang, Hua Zhang, Meng Zhou, Mei Wei, Qiuping Dong, Yue Xu, Zhaosong Wang, Liuwei Gao, Yanjun Qu, Bowen Shi, Jinfang Zhu,...
Complete information for CLDN18 gene (Protein Coding), Claudin 18, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Familial hypomagnesemia with hypercalciuria and nephrocalcinosis is an autosomal recessive tubular disorder characterized by excessive renal magnesium and calcium excretion and chronic kidney failure. This rare disease is caused by mutations in the CLDN16 and CLDN19 genes. These genes encode the tight junction proteins claudin-16 and claudin-19, respectively, which regulate the paracellular ion reabsortion in the kidney. Patients with mutations in the CLDN19 gene also present severe visual impairment. Our goals in this study were to examine the clinical characteristics of a large cohort of Spanish patients with this disorder and to identify the disease causing mutations. We included a total of 31 patients belonging to 27 unrelated families and studied renal and ocular manifestations. We then analyzed by direct DNA sequencing the coding regions of CLDN16 and CLDN19 genes in these patients. Bioinformatic tools were used to predict the consequences of mutations. Clinical evaluation showed ocular defects in
The tight junction protein claudin-1 (CLDN1) has been shown to be essential for hepatitis C virus (HCV) entry-the first step of viral infection. Due to the lack of neutralizing anti-CLDN1 antibodies, the role of CLDN1 in the viral entry process is poorly understood. In this study, we produced antibodies directed against the human CLDN1 extracellular loops by genetic immunization and used these antibodies to investigate the mechanistic role of CLDN1 for HCV entry in an infectious HCV cell culture system and human hepatocytes. Antibodies specific for cell surface-expressed CLDN1 specifically inhibit HCV infection in a dose-dependent manner. Antibodies specific for CLDN1, scavenger receptor B1, and CD81 show an additive neutralizing capacity compared with either agent used alone. Kinetic studies with anti-CLDN1 and anti-CD81 antibodies demonstrate that HCV interactions with both entry factors occur at a similar time in the internalization process. Anti-CLDN1 antibodies inhibit the binding of ...
Facts and data of a family history are often able to help in distinguishing between adenocarcinoma and epithelioid mesothelioma. When a patient possesses a family history of carcinoma, it is more likely that he or she suffers from a variant of the disease. When a patient has a history of asbestos exposure, it is more likely that he or she suffers from epithelioid mesothelioma. Or, if you or a loved one got asbestos exposure and received a diagnosis of adenocarcinoma, it may be worthwhile to look for a second diagnostic assessment, either by the same oncology specialist or a physician who has adequate experience in mesothelioma cases ...
Facts and data of a family history are often able to help in distinguishing between adenocarcinoma and epithelioid mesothelioma. When a patient possesses a family history of carcinoma, it is more likely that he or she suffers from a variant of the disease. When a patient has a history of asbestos exposure, it is more likely that he or she suffers from epithelioid mesothelioma. Or, if you or a loved one got asbestos exposure and received a diagnosis of adenocarcinoma, it may be worthwhile to look for a second diagnostic assessment, either by the same oncology specialist or a physician who has adequate experience in mesothelioma cases ...
1. Glomerular charge selectivity was assessed using the ratio of the clearance of pancreatic isoamylase to the clearance of the more anionic salivary isoamylase (CPAm/CSAm) in 30 normal subjects, 14 patients with minimal proteinuria and 23 patients with heavy proteinuria due to primary glomerulopathies. Seven patients with minimal change nephropathy were studied in relapse and remission.. 2. CPAm/CSAm exceeded 2.0 (range 2.1-6.1) in all normal subjects, indicating that the normal glomerular capillary wall possesses charge selectivity at the molecular size of amylase (molecular mass 56 kDa). 3. CPAm/CSAm was significantly lower in patients with heavy proteinuria than in normal subjects or patients with minimal proteinuria. CPAm/CSAm was low in patients with minimal change nephropathy in relapse and rose into the normal range with steroid-induced remission.. 4. These data suggest that heavy proteinuria in primary glomerulopathies is accompanied by loss of glomerular charge selectivity. Remission ...
ZO-1, ZO-2, and ZO-3, which contain three PDZ domains (PDZ1 to -3), are concentrated at tight junctions (TJs) in epithelial cells. TJ strands are mainly composed of two distinct types of four-transmembrane proteins, occludin, and claudins, between which occludin was reported to directly bind to ZO-1/ZO-2/ZO-3. However, in occludin-deficient intestinal epithelial cells, ZO-1/ZO-2/ZO-3 were still recruited to TJs. We then examined the possible interactions between ZO-1/ZO-2/ZO-3 and claudins. ZO-1, ZO-2, and ZO-3 bound to the COOH-terminal YV sequence of claudin-1 to -8 through their PDZ1 domains in vitro. Then, claudin-1 or -2 was transfected into L fibroblasts, which express ZO-1 but not ZO-2 or ZO-3. Claudin-1 and -2 were concentrated at cell-cell borders in an elaborate network pattern, to which endogenous ZO-1 was recruited. When ZO-2 or ZO-3 were further transfected, both were recruited to the claudin-based networks together with endogenous ZO-1. Detailed analyses showed that ZO-2 and ZO-3 ...
immune Uncategorized PA-824, Rabbit Polyclonal to C-RAF (phospho-Thr269). The blood-epididymis barrier (BEB) is formed by epithelial tight junctions mediating selective permeability from the PA-824 epididymal epithelium. the paracellular permeability had been examined by two strategies TER and FITC-Dextran-based tracer diffusion assays. Both assays soon add up to related outcomes indicating a time-dependent disruption from the BEB differentially for the three TGF? isoforms (TGF?3>TGF?1>TGF?2) inside a TGF?-recetor-1 kinase- and Smad-dependent way. The small junction proteins claudin-1 was discovered to be decreased by the procedure with TGF?s whereas occludin had not PA-824 been affected. Epididymal epithelial cells are mainly attentive to TGF?s PA-824 through the basolateral side recommending that TGF? may impact for the epididymal epithelium through the stroma cell tradition versions the knockdown of 1 of the claudins (1 -3 -4 or -7) led to dramatically reduced transepithelial electrical level ...
The results of this study show that the amount of mobile receptor and the speed at which it diffuses varies according to its location within the cell. CD81 and claudin-1 are expressed equally in the filopodia and plasma membrane, whereas SR-BI is expressed at lower levels in the filopodia compared to the plasma membrane. We show that addition of both sE2 and sE1E2 has varying affects on both the speed and mobility of CD81 and claudin-1 and that the majority of significant effects observed for claudin-1 are observed at areas of potential cell contact. Finally, we demonstrate that addition of ITX5061 affects the diffusion coefficient of CD81 and CLDN-1 and the amount of mobile SR-BI. Furthermore, the effects on SR-BI are limited to areas of cell contact or exploratory regions. In summary, we present data which we hope will further current knowledge of the activity of these receptors in relation to their role in HCV infection ...
The tight junctions (TJ), which are located in the apical region between epithelial and endothelial cells, regulate the paracellular diffusion of ions and small molecules and play an important role in maintaining cell polarity, cell-cell integrity, and permeability. In the lung, epithelial cells are attached by TJ structures. They provide a permeable barrier and cell communication. The loss of barrier integrity, which is maintained by the expression of claudins (Cldn), results in cellular permibilization and leads to paracellular diffusion of solutes and harmful molecules. There are 27 known Cldn homologous members in mice and human. Cldn6 is mostly expressed in embryonic stem cells and associated with the programing of epithelial cells during embryo development and lung morphogenesis. In order to test the hypothesis that Cldn6 expression affects lung morphogenesis, we analyzed the expression pattern of Cldn6 during lung ontogenesis to examine cell-specific expression pattern of Cldn6 during each
The C\terminal fragment of enterotoxin (C\CPE) modulates the tight junction protein claudin and disturbs the tight junctional barrier. epithelial cells (HPDEs) had been treated with C\CPE 194 and C\CPE meters19. In well\differentiated cells of the pancreatic malignancy cell collection HPAC, C\CPE 194 and C\CPE meters19 interrupted both the hurdle and fencing features without adjustments in manifestation of claudin\1 and \4, collectively with an boost of MAPK phosphorylation. C\CPE 194, but not really C\CPE meters19, improved the cytotoxicity of the anticancer brokers gemcitabine and H\1. In differentiated pancreatic malignancy cell collection PANC\1 badly, C\CPE 194, but not really C\CPE meters19, reduced claudin\4 phrase and improved MAPK activity and the cytotoxicity of the anticancer agencies. In regular HPDEs, C\CPE 194 and C\CPE meters19 reduced claudin\4 phrase and improved the MAPK activity, whereas they do not really influence the cytotoxicity of the anticancer agencies. Our results ...
The differentiation between adenocarcinoma and mesothelioma can be difficult at histology. In this case, the initial histological diagnosis of metastatic adenocarcinoma was revised following review of clinical and radiologal features, and the cor...
CLDN5_ENST00000618236 Gene, Drug Resistance, Tissue Distribution, Mutation Distribution, Variants, CLDN5_ENST00000618236 Genome Browser, CLDN5_ENST00000618236 References
Claudin, Philippe; Andreotti, Bruno (2006). "A scaling law for aeolian dunes on Mars, Venus, Earth, and for subaqueous ripples ... 19 (3-4): 173-210. doi:10.1111/j.1365-3091.1972.tb00020.x. ISSN 0037-0746. Cooper, William S. (1958), "COASTAL SAND DUNES OF ... 101 (4): 703-720. doi:10.1016/j.geomorph.2008.03.011. ISSN 0169-555X. Wilson, Sharon A. (2004). "Latitude-dependent nature and ... 29 (1-4): 77-96. doi:10.1016/0012-8252(0)90029-U. Boulton, J. Wayne (1997). Quantifying the morphology of aeolian impact ...
Van Itallie CM, Mitic LL, Anderson JM (July 2012). "SUMOylation of claudin-2". Annals of the New York Academy of Sciences. 1258 ... 6 (4): 1045-1048. doi:10.3892/ol.2013.1472. PMC 3796434. PMID 24137461. Galanty Y, Belotserkovskaya R, Coates J, Polo S, Miller ... 25 (3): 112-4. doi:10.1016/s0968-0004(99)01537-6. PMID 10694879. Glass CK, Rosenfeld MG (January 2000). "The coregulator ... 1): 60-4. Bibcode:2012NYASA1258...60V. doi:10.1111/j.1749-6632.2012.06541.x. PMID 22731716. S2CID 45684330. Duval D, Duval G, ...
Claudin 4, also known as CLDN4, is a protein which in humans is encoded by the CLDN4 gene. It belongs to the group of claudins ... "Entrez Gene: CLDN4 claudin 4". Human CLDN4 genome location and CLDN4 gene details page in the UCSC Genome Browser. Kniesel U, ... This gene encodes an integral membrane protein, which belongs to the claudin family. The protein is a component of tight ... 2003). "Claudin-4 expression decreases invasiveness and metastatic potential of pancreatic cancer". Cancer Res. 63 (19): 6265- ...
Claudin grabs a sword to fight them with. Raoul fires his gun at Claudin, but Anatole knocks Raoul's arm, and the shot hits the ... Enraged, Claudin strangles Pleyel. Georgette, the publisher's assistant, throws etching acid in Claudin's face, horribly ... Claudin hears his concerto being played in the office and is convinced that Pleyel is trying to steal it; unbeknownst to him, a ... Violinist Erique Claudin is dismissed from the Paris Opera House after revealing that he is losing the use of the fingers of ...
Claudin-20 is a protein that in humans is encoded by the CLDN20 gene. It belongs to the group of claudins. GRCh38: Ensembl ... "Entrez Gene: CLDN20 claudin 20". CS1 maint: discouraged parameter (link) Human CLDN20 genome location and CLDN20 gene details ... Hewitt KJ, Agarwal R, Morin PJ (Aug 2006). "The claudin gene family: expression in normal and neoplastic tissues". BMC Cancer. ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ...
"Claudin-1 overexpression effect on lung adenocarcinoma cell line". NCBI GEO Profiles. Retrieved 4 May 2015. Vandepoele K, Van ... Retrieved 4 May 2015. Nathan JA, Kim HT, Ting L, Gygi SP, Goldberg AL (February 2013). "Why do cellular proteins linked to K63- ... 32 (4): 552-65. doi:10.1038/emboj.2012.354. PMC 3579138. PMID 23314748. Kim W, Bennett EJ, Huttlin EL, Guo A, Li J, Possemato A ... Retrieved 4 May 2015. Davis-Smyth T, Duncan RC, Zheng T, Michelotti G, Levens D (December 1996). "The far upstream element- ...
Claudin-14 is a protein that in humans is encoded by the CLDN14 gene. It belongs to a related family of proteins called ... "Entrez Gene: CLDN14 claudin 14". Baker M, Reynolds LE, Robinson SD, Lees DM, Parsons M, Elia G, et al. (2013). "Stromal ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ... Sticky cells, blood vessels and cancer - the paradox of Claudin-14 - Marianne Baker, Cancer Research UK Science Update blog, 14 ...
Claudin-5 is a protein that in humans is encoded by the CLDN5 gene. It belongs to the group of claudins. This gene encodes a ... "Entrez Gene: CLDN5 claudin 5 (transmembrane protein deleted in velocardiofacial syndrome)". Coyne CB, Gambling TM, Boucher RC, ... Kojima S, Rahner C, Peng S, Rizzolo LJ (2002). "Claudin 5 is transiently expressed during the development of the retinal ... Tsukita S, Furuse M (2002). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ...
Claudin-7 is a protein that in humans is encoded by the CLDN7 gene. It belongs to the group of claudins. Claudins, such as ... "Entrez Gene: CLDN7 claudin 7". CS1 maint: discouraged parameter (link) Human CLDN7 genome location and CLDN7 gene details page ... 2005). "Claudin-1 is a strong prognostic indicator in stage II colonic cancer: a tissue microarray study". Mod. Pathol. 18 (4 ... 2003). "Loss of the tight junction protein claudin-7 correlates with histological grade in both ductal carcinoma in situ and ...
2007). "Claudin-6 and claudin-9 function as additional coreceptors for hepatitis C virus". J. Virol. 81 (22): 12465-71. doi: ... Claudin-9 is a protein that in humans is encoded by the CLDN9 gene. It belongs to the group of claudins. This gene is involved ... "Entrez Gene: CLDN9 claudin 9". Gene discovery reveals a critical protein's function in hearing Human CLDN9 genome location and ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ...
"Entrez Gene: CLDN1 claudin 1". Coyne CB, Gambling TM, Boucher RC, Carson JL, Johnson LG (Nov 2003). "Role of claudin ... Claudin-1 is a protein that in humans is encoded by the CLDN1 gene. It belongs to the group of claudins. Tight junctions ... The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight ... Miyamori H, Takino T, Kobayashi Y, Tokai H, Itoh Y, Seiki M, Sato H (2001). "Claudin promotes activation of pro-matrix ...
Claudin-8 is a protein that in humans is encoded by the CLDN8 gene. It belongs to the group of claudins. GRCh38: Ensembl ... "Entrez Gene: CLDN8 claudin 8". CS1 maint: discouraged parameter (link) Human CLDN8 genome location and CLDN8 gene details page ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ... Morita K, Furuse M, Fujimoto K, Tsukita S (Mar 1999). "Claudin multigene family encoding four-transmembrane domain protein ...
Claudin-22 is a protein that in humans is encoded by the CLDN22 gene. It belongs to the group of claudins. GRCh38: Ensembl ... "Entrez Gene: CLDN22 claudin 22". CS1 maint: discouraged parameter (link) Human CLDN22 genome location and CLDN22 gene details ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ... Heiskala M, Peterson PA, Yang Y (2001). "The roles of claudin superfamily proteins in paracellular transport". Traffic. 2 (2): ...
Claudin-11 is a protein that in humans is encoded by the CLDN11 gene. It belongs to the group of claudins and was the first ... "Entrez Gene: CLDN11 claudin 11 (oligodendrocyte transmembrane protein)". Gow A, Southwood CM, Li JS, Pariali M, Riordan GP, ... The protein encoded by this gene belongs to the claudin family of tight junction associated proteins and is a major component ... Tiwari-Woodruff SK, Buznikov AG, Vu TQ, Micevych PE, Chen K, Kornblum HI, Bronstein JM (April 2001). "OSP/claudin-11 forms a ...
Claudin 3, also known as CLDN3, is a protein which in humans is encoded by the CLDN3 gene. It is a member of the claudin ... "Entrez Gene: CLDN3 claudin 3". Coyne CB, Gambling TM, Boucher RC, Carson JL, Johnson LG (Nov 2003). "Role of claudin ... "Expression of Clostridium perfringens enterotoxin receptors claudin-3 and claudin-4 in prostate cancer epithelium". Cancer Res ... The protein encoded by this intron-less gene, a member of the claudin family, is an integral membrane protein and a component ...
Fernando Claudin 11."The First Breach: The Excommunication of Yugoslavia" - Josip Tito 12. "Secret Report to the 20th Party ... Retrieved 4 January 2019. Flewers, Paul. "Review: Tariq Ali, The Stalinist Legacy". Retrieved 8 January 2019.. ... Ernest Mandel 4."Socialism in One Country" - Isaac Deutscher 5."Marxism and Primitive Magic - ibid. 6. "Trotsky's ...
"Entrez Gene: CLDN18 claudin 18". CS1 maint: discouraged parameter (link) Niimi T, Nagashima K, Ward JM, et al. (2001). "claudin ... Claudin 18.2) is abundant in gastric tumors. Experimental antibody IMAB362 targets Claudin 18.2 to help treat gastric cancers. ... Claudin-18 is a protein that in humans is encoded by the CLDN18 gene. It belongs to the group of claudins. CLDN18 belongs to ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ...
Claudin-19 is a protein that in humans is encoded by the CLDN19 gene. It belongs to the group of claudins. Claudin-19 has been ... "Entrez Gene: CLDN19 claudin 19". Naeem, M.; Hussain, S.; Akhtar, N. (2011). "Mutation in the Tight-Junction Gene Claudin 19 ( ... 2006). "Kidney claudin-19: localization in distal tubules and collecting ducts and dysregulation in polycystic renal disease". ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ...
Claudin-15 is a protein that in humans is encoded by the CLDN15 gene. It belongs to the group of claudins. Among its related ... "Entrez Gene: CLDN15 claudin 15". Database, GeneCards Human Gene. "CLDN15 Gene - GeneCards , CLD15 Protein , CLD15 Antibody". ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ... Heiskala M, Peterson PA, Yang Y (2001). "The roles of claudin superfamily proteins in paracellular transport". Traffic. 2 (2): ...
Morita K, Sasaki H, Furuse M, Tsukita S (1999). "Endothelial Claudin: Claudin-5/Tmvcf Constitutes Tight Junction Strands in ... Claudin-6 is a protein that in humans is encoded by the CLDN6 gene. It belongs to the group of claudins. The knockout mice of ... "Entrez Gene: CLDN6 claudin 6". Human CLDN6 genome location and CLDN6 gene details page in the UCSC Genome Browser. Kniesel U, ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ...
Claudin-16 is a protein that in humans is encoded by the CLDN16 gene. It belongs to the group of claudins. Tight junctions ... The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight ... 2004). "A Novel Claudin 16 Mutation Associated with Childhood Hypercalciuria Abolishes Binding to ZO-1 and Results in Lysosomal ... "Entrez Gene: CLDN16 claudin 16". "Salmonella infection data for Cldn16". Wellcome Trust Sanger Institute. "Citrobacter ...
Claudin-2 is a protein that in humans is encoded by the CLDN2 gene. It belongs to the group of claudins. Members of the claudin ... Claudin-2 is expressed in cation-leaky epithelia such as that of the kidney proximal tubule. Mice that are deficient in claudin ... "Entrez Gene: CLDN2 claudin 2". CS1 maint: discouraged parameter (link) Muto, S.; Hata, M.; Taniguchi, J.; Tsuruoka, S.; ... 1998). "Claudin-1 and -2: Novel Integral Membrane Proteins Localizing at Tight Junctions with No Sequence Similarity to ...
"The expressions of claudin-1 and E-cadherin in junctional epithelium". Journal of Periodontal Research. 45 (4): 579-82. doi: ... 24 (4): 387-90. doi:10.1038/74224. PMID 10742103. S2CID 21030594. Wuyts W, Reardon W, Preis S, Homfray T, Rasore-Quartino A, ... 61 (4): 590-604. doi:10.5357/koubyou.61.590. PMID 7897272. S2CID 2781509. Hodgkinson JE, Davidson CL, Beresford J, Sharpe PT ( ... 21 Suppl A (Suppl A): S50-4. doi:10.1053/plac.1999.0514. PMID 10831122. Masuda Y, Sasaki A, Shibuya H, Ueno N, Ikeda K, ...
Claudin-12 is a protein that in humans is encoded by the CLDN12 gene. It belongs to the group of claudins. GRCh38: Ensembl ... "Entrez Gene: CLDN12 claudin 12". Human CLDN12 genome location and CLDN12 gene details page in the UCSC Genome Browser. Kniesel ... 2001). "claudin-18, a novel downstream target gene for the T/EBP/NKX2.1 homeodomain transcription factor, encodes lung- and ... Tsukita S, Furuse M (2003). "Claudin-based barrier in simple and stratified cellular sheets". Curr. Opin. Cell Biol. 14 (5): ...
... claudin-2, claudin-6, claudin-7 and occludin) and transcription factors (including GATA4). Changes in the expression of claudin ... Paschoud S, Bongiovanni M, Pache JC, Citi S (September 2007). "Claudin-1 and claudin-5 expression patterns differentiate lung ... Guillemot L, Citi S (August 2006). "Cingulin regulates claudin-2 expression and cell proliferation through the small GTPase ... Together with paracingulin, cingulin also was reported to regulate claudin-2 expression through RhoA-dependent and independent ...
This mechanism is mediated by host claudin-3 and claudin-4 receptors, situated at the tight junctions. Clostridium enterotoxin ... "Expression of Clostridium perfringens enterotoxin receptors claudin-3 and claudin-4 in prostate cancer epithelium". Cancer ... This allows the human claudin-3,4,6,7,8 and 14 to bind but not 1,2,5, and 10. The way the protein work is it destroys the cell ... Van Itallie CM, Betts L, Smedley JG, McClane BA, Anderson JM (January 2008). "Structure of the claudin-binding domain of ...
Nevertheless, another sources document existence of mTEC unipotent progenitors that express claudin 3 and 4 (Cld3/4). These two ... "Medullary thymic epithelial cells expressing Aire represent a unique lineage derived from cells expressing claudin". Nature ... 8 (4): 351-8. doi:10.1038/ni1444. PMID 17322887. Malchow S, Leventhal DS, Nishi S, Fischer BI, Shen L, Paner GP, Amit AS, Kang ... 9 (4): 370-6. doi:10.1038/embor.2008.11. PMC 2261226. PMID 18292755. Koh AS, Kuo AJ, Park SY, Cheung P, Abramson J, Bua D, ...
2012 - In silico directed mutagenesis identifies the CD81/claudin-1 hepatitis C virus receptor interface. Davis C, Harris HJ, ... Cellular microbiology 15: 430-45 Link 2013 - Heterogeneous claudin-1 expression in human liver. Harris HJ, Wilson GK, Hübscher ... Immunotherapy 4: 249-51 Link 2012 - Hepatitis C virus entry: beyond receptors. Meredith LW, Wilson GK, Fletcher NF, McKeating ...
Claudin, Paris 1879. Fourteenth-Century Mercenaries. Sumption, Jonathon (1999). Trial by Fire. London: Faber and Faber. p. 359 ... 61-4. ISBN 0-631-15886-3. Froissart's Chronicles Françoise Autrand, Charles V, Fayard 1994, p. 501 Sumption (1999), pp523-4,532 ...
Claudin 7 is occurred also in epithelial cells of the lung and kidney. Claudin-18 is expressed in the alveolar epithelial cells ... Claudin 11 is expressed in oligodendrocytes and Sertoli cells or Claudin 5 is expressed in the vascular endothelial cells. ... OSP/Claudin 11 is occurred in a myelin of nerve cells and between Sertoli cells, so it forms tight junctions in the CNS. This ... The claudin family is composed by 24 members. Some of them haven´t been well characterized yet but all members are encoded by ...
Famous composers of these "Parisian" chansons included Claudin de Sermisy and Clément Janequin. Janequin's La guerre, written ... 4] His work is at the origin of the use of the French word "Renaissance" in other languages. ...
Claudin 5 is transiently expressed during the development of the retinal pigment epithelium. J Membr Biol 186: 81-88, 2002 ... 국내에서는 차의과대학교의 송원경 교수팀이 역시 배아줄기세포 유래의 망막색소상피세포를 이용하여 노인성 황반변성 세포 치료를 시도하여, 4명 중 3명에게서 유의미한 치료 효과가 있음을 입증하였다.[47] ... 4] 이 세포들은 색소 과립 (pigmented granule)들이 있으며, 고밀도로 모여 있다. ... Rizzolo, LJ (1997). "Polarity and the development of the outer blood-retinal barrier.". 》Histology and Histopathology》 12 (4): ...
CLDND1: Claudin domain containing 1. *CPN2: Carboxypeptidase N subunit 2. *CPOX: coproporphyrinogen oxidase (coproporphyria, ... G-bands of human chromosome 3 in resolution 850 bphs[4] Chr. Arm[17] Band[18] ISCN. start[19] ISCN. stop[19] Basepair. start ... G-banding patterns of human chromosome 3 in three different resolutions (400,[13] 550[14] and 850[4]). Band length in this ...
Sertoliho bunky tvoria pomocou tesných spojov (proteínmi ako je claudin alebo occludin) hemato-semenníkovú bariéru, ktorá ... 4, čís. 6, s. e187. Dostupné online [cit. 2018-04-21]. ISSN 1545-7885. DOI: 10.1371/journal.pbio.0040187. (po anglicky). ... 4, s. 995 - 1005. Dostupné online [cit. 2018-04-20]. ISSN 0006-3363. DOI: 10.1095/biolreprod37.4.995. (po anglicky). ... 4, s. 504 - 514. Dostupné online [cit. 2018-04-21]. DOI: 10.14310/horm.2002.1648. (po novogrécky (po 1453)). ...
Claudin 1, which is a tight-junction protein, and CD81 link to create a complex, priming them for later HCV infection processes ... 1 (4): 1276-1286. doi:10.2741/e458. PMID 22201953.. *^ a b c Halegoua-De Marzio, Dina; Fenkel, Jonathan (January 27, 2014). " ... 31 (4): 340-6. doi:10.1055/s-0031-1297923. PMID 22189974.. *^ Pybus, OG; Markov, PV; Wu, A; Tatem, AJ (Jul 2007). " ... doi:10.1016/S1473-3099(05)70216-4. PMID 16122679.. *^ Alter, MJ (Nov 2011). "HCV routes of transmission: what goes around comes ...
Clostridium perfringens enterotoxin binds to the second extracellular loop of claudin-3, a tight junction integral membrane ... vermutlich Claudin bei CPE,[14] sowie vermutlich GPI-Anker oder andere Glykosylierungen beim ε-Toxin. Durch die ... 6082, 1986, S. 831-4. doi:10.1038/322831a0. PMID 2427956. *↑ a b Marcus Mueller, Ulla Grauschopf, Timm Maier, Rudi Glockshuber ... a b Bruce Alberts, Alexander Johnson, Peter Walter, Julian Lewis, Martin Raff, Keith Roberts: Molecular Biology of the Cell, 4 ...
doi:10.1016/S1357-2725(03)00264-4. PMC 2878204. PMID 15109565.. *^ a b Lampe, Paul D.; Lau, Alan F. (2000). "Regulation of gap ... 178 (4): 477-82. doi:10.1007/BF00219569. PMID 870202. S2CID 21426059.. *^ Lorber, V; Rayns, DG (April 1977). "Fine structure of ... 187 (4): 343-52. doi:10.1007/BF00185892. PMID 8390141. S2CID 33191311.. *^ Sperelakis, Nicholas; Ramasamy, Lakshminarayanan ( ... The hemichannel pair connect across the intercellular space bridging the gap between two cells.[4][5][6] Gap junctions are ...
Anatole Claudin (1898). The First Paris Press: an account of the books printed for G. Fichet and J. Heynlin in the Sorbonne, ... Volumes 3-4 (2011): Books published in France before 1601 in Latin and Languages other than French ...
Cates, M. E.; Wittmer, J. P.; Bouchaud, J.-P.; Claudin, P. (31 August 1998). "Jamming, Force Chains, and Fragile Matter". ... 4 April 2013. Retrieved 26 August 2014. CS1 maint: discouraged parameter (link) "Google Scholar: Michael Cates". Media related ...
These complexes, formed primarily of members of the claudin and the occludin families, consist of about 35 different proteins, ... 39 (4 Suppl 2): S53-58. doi:10.1097/01.mcg.0000155521.81382.3a. ISSN 0192-0790. PMID 15758660. Näslund, Erik; Hellström, Per M ... Epithelial cells are continuously renewed every 4-5 days through a process of cell division, maturation, and migration. Renewal ...
... is concentrated at tight junctions through its possible interaction with claudin-1 and junctional adhesion molecule". The ... 17 (4): 341-7. PMID 15065765. Kornecki E, Walkowiak B, Naik UP, Ehrlich YH (Jun 1990). "Activation of human platelets by a ... doi:10.1016/S0161-5890(99)00122-4. PMID 10698320. Sobocka MB, Sobocki T, Banerjee P, Weiss C, Rushbrook JI, Norin AJ, Hartwig J ...
... has overexpressed HER2/neu Normal breast-like Claudin-low: a more recently described class; often triple-negative, but distinct ... Stage 4 is a metastatic cancer. Metastatic breast cancer has a less favorable prognosis. Receptor status. Cells have receptors ... 13 (4): 1135-45. doi:10.1677/erc.1.01222. PMID 17158759. Spears M, Bartlett J (June 2009). "The potential role of estrogen ... 19 (4): 980-91. doi:10.1200/JCO.2001.19.4.980. PMID 11181660. Olivotto IA, Bajdik CD, Ravdin PM, et al. (April 2005). " ...
Claudin E is a molecule found in tight junctions that appears to be expressed in the EVL and required for normal zebrafish ... "The tight junction component claudin E is required for zebra fish epiboly". Developmental Dynamics. 239 (2): 715-722. doi: ... 108 (4): 569-80. PMID 2387236. Donald A. Kane; Karen N. McFarland; Rachel M. Warga (2005-03-01). "Mutations in half baked/E- ... 222 (4): 611-24. doi:10.1002/dvdy.1216. PMID 11748830. Archived from the original on 2013-01-05. Betchaku T, Trinkaus JP ( ...
Markov AG, Falchuk EL, Kruglova NM, Radloff J, Amasheh S (January 2016). "Claudin expression in follicle-associated epithelium ... 175 (4): 885-93. doi:10.1136/gut.6.3.225. PMC 1552287. PMID 18668776. Van Kruiningen HJ, West AB, Freda BJ, Holmes KA (May 2002 ... 216 (1): 13-4. doi:10.1111/apha.12595. PMID 26335934. Pascall, C R; Stearn, E J; Mosley, J G (1980-07-05), "Short Reports", ... Listen to this article (4 minutes) This audio file was created from a revision of this article dated 30 July 2019 (2019-07-30 ...
The name claudin comes from Latin word claudere ("to close"), suggesting the barrier role of these proteins. A recent review ... All human claudins (with the exception of Claudin 12) have domains that let them bind to PDZ domains of scaffold proteins. ... "Claudin-1 and -2: novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin". J. ... "A systems proteomics view of the endogenous human claudin protein family". J Proteome Res. 15 (2): 339-359. doi:10.1021/acs. ...
Claudin de Sermisy, Thomas Crecquillon, Domenico Ferrabosco, Jean de Latre, Jacquet de Berchem, Jakob Meiland, Alexander ... Contains 4 pieces Jan Janca, Orgellandschaft Danzig-Westpreussen, published by MDG, MDG O 1274/75 in 1987, released as MDG 319 ... Contains 4 pieces Bogusław Grabowski, Music Treasures of Old Gdańsk - XIV-XVII, published by Futurex, FCD 0123, 1997; ... ir.lib.uwo.ca/notabene/vol4/iss1/4 (accessed 2 June 2016) RISM 302002314, see note 9 Agnieszka Leszczyńska, The Beginnings of ...
Claudin, P; Andreotti, B (2006). "A scaling law for aeolian dunes on Mars, Venus, Earth, and for subaqueous ripples". Earth and ... Satherley, Dan (December 4, 2012). "'Complex chemistry' found on Mars". 3 News. Retrieved December 4, 2012. Lieberman, Josh ( ... 20 (10): 7301-8. doi:10.1007/s11356-013-1744-4. PMID 23673920. S2CID 21398332. "Mars covered in toxic chemicals that can wipe ... October 4, 2012). "Rocknest 3" rock on Mars - as viewed by the MastCam on Curiosity (October 5, 2012). Tracks of the Curiosity ...
"Decreased lactate dehydrogenase B expression enhances claudin 1-mediated hepatoma cell invasiveness via mitochondrial defects ... 11 (4): 239-44. doi:10.1080/10245330600774835. PMID 17178662. S2CID 36110689. de Haas T, Hasselt N, Troost D, Caron H, Popovic ...
MicroRNA Gong Y, Renigunta V, Himmerkus N, Zhang J, Renigunta A, Bleich M, Hou J (April 2012). "Claudin-14 regulates renal Ca ... 4: 65. doi:10.1186/1755-8794-4-65. PMC 3195087. PMID 21923954. Delić D, Dkhil M, Al-Quraishy S, Wunderlich F (May 2011). " ...
Claudin de Sermisy, French composer (b. 1495) October 18 - Anne d'Alençon, French noblewoman (b. 1492) November 7 - Maldeo ... October 4 - English forces under Ambrose Dudley, 3rd Earl of Warwick, land at Le Havre to aid the Huguenots. October 19 - La ... May 4 - Lelio Sozzini, Italian Protestant theologian (b. 1525) July 1 - Wilhelm IV of Eberstein, German President of the ... October 4 - Christian Sørensen Longomontanus, Danish astronomer (d. 1647) October 19 - George Abbot, Archbishop of Canterbury ( ...
ISBN 978-84-7222-878-8. Azcárate, Manuel; Fernando Claudin (1979). Marc Abeles; Charles-Albert Ryng (eds.). L'Europe de ... ISBN 978-0-8179-7453-4. Retrieved 2015-11-29. "Manuel Azcárate muere en Madrid a los 81 años". El País (in Spanish). Madrid. ... ISBN 978-1-78076-108-4. Retrieved 2015-11-29. Eaton, Samuel D. (1981). The Forces of Freedom in Spain 1974-1979: A Personal ... ISBN 2-13-037918-4. ISSN 0398-7922. Azcárate, Manuel (1986). La izquierda europea (in Spanish). Madrid: Ediciones El País. ...
Claudin de Sermisy set the psalm. In the 17th century, Henry Dumont set this psalm for La Chapelle Royale au Louvre (1666). In ... "Some differences between Greek and Russian divine services and their significance". Retrieved 4 July 2013. R. J. Thesman, A ...
... is concentrated at tight junctions through its possible interaction with claudin-1 and junctional adhesion molecule". J. Biol. ... 43 (4): 563-74. doi:10.1016/j.neuron.2004.08.003. PMID 15312654. S2CID 17190912. van de Pavert SA, Kantardzhieva A, Malysheva A ... 4)P2 and the multi-PDZ-domain-containing protein MUPP1 in vivo". Biochem. J. 361 (Pt 3): 525-36. doi:10.1042/0264-6021:3610525 ... 4)P2 and the multi-PDZ-domain-containing protein MUPP1 in vivo". Biochem. J. 361 (Pt 3): 525-36. doi:10.1042/0264-6021:3610525 ...
Rabbit polyclonal Claudin 4 antibody validated for WB, IHC, ICC/IF and tested in Human and Mouse. Referenced in 16 publications ... Anti-Claudin 4 antibody (ab15104) at 1 µg/ml + SHSY-5Y (Human neuroblastoma cell line) Whole Cell Lysate at 10 µg. Secondary. ... Expression of claudin 1, 4 and 7 in thyroid neoplasms.. Oncol Lett 13:3722-3726 (2017). Read more (PubMed: 28529587) » ... Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections) - Anti-Claudin 4 antibody (ab15104)Lean QY et al. PLoS One ...
Mislocalization claudin-3 (zeige CLDN3 Antikörper) to nucleus in colon cancer and mislocalization claudin-4 to nucleus in ... Claudin 4 (CLDN4) Antigen-Profil Beschreibung des Gens This gene encodes an integral membrane protein, which belongs to the ... Mouse (Murine) Claudin 4 (CLDN4) Interaktionspartner * Reg (zeige KCNH2 Antikörper) I may play a role in the maintenance of ... Show all anti-Claudin 4 (CLDN4) Antikörper with Pubmed References. * Human Polyclonal CLDN4 Primary Antibody für IF (p), IHC (p ...
Invitrogen Anti-Claudin 4 Monoclonal (3E2C1), Catalog # 32-9400. Tested in Western Blot (WB) and Immunohistochemistry (IHC) ... In ovarian carcinoma cells, Claudin-3 and Claudin-4 exhibit upregulation at both mRNA and protein levels. Claudin-4 is also ... Claudin 4 Monoclonal Antibody (3E2C1). Advanced Verification This Antibody was verified by Relative expression to ensure that ... Claudin-4 is a component of tight junction strands and may play a role in internal organ development and function during pre- ...
... this lot of claudin-1 Ab cross reacts with claudin-3 and possibly claudin-20) and claudin-4 polyclonal (1:1000) Abs, claudin-2 ... No change in the levels of claudin-1/3 and claudin-2 were observed coincident with induction of higher levels of claudin-4 ( ... claudin-1/3, (c) claudin-2, (d) occludin, and (e) ZO-1. The claudin-4 blot is deliberately overexposed to reveal protein ... on claudin-1 (13). Notably, ZO-1 levels do not change in the face of claudin-4 induction. One postulated role for the ZO ...
In particular, claudin-3 and claudin-4 are frequently overexpressed in pancreatic cancer. 18F-Labeled claudin selective ... In this work we describe the synthesis of the first 18F-labeled probes potentially suitable for PET imaging of claudin-4 ... These probes were prepared using oxime ligation of 5-[18F]fluoro-5-deoxyribose (5-[18F]FDR) to claudin selective peptides. As a ... As such, cancer expression of claudin proteins is markedly dysregulated, making it an attractive target for molecular imaging ...
Anti-Claudin 4 pAb (GTX31496) is tested in Human, Mouse, Rat samples. 100% Ab-Assurance. ... Claudin 4 antibody (claudin 4) for ELISA, IHC-P, WB. ... claudin 4. Background. The protein encoded by this intronless ... IHC-P analysis of human colon tissue using GTX31496 Claudin 4 antibody. Working concentration : 20 μg/ml. Top ... IHC-P analysis of human colon tissue using GTX31496 Claudin 4 antibody. Working concentration : 20 μg/ml. Top ...
The graph plots aggregation by the particle number at a time point divided by the particle number at time 0 (Nt/No). Claudin-1 ... PKH26-labeled untransfected L-cells (red) were mixed 1:1 with unlabeled untransfected L-cells (top row), GFP-Claudin-1- ... Expression of Claudin-1 or Cacng2 promotes cell aggregation, as shown by microscopy and particle counts. ... Because stargazin is structurally similar to claudins, we hypothesized that it might also have retained claudin-like functions ...
Claudin is up-regulated in a variety of tumor types, but the causes and consequences of increased claudin expression in gastric ... Tight junction proteins claudin-3 and claudin-4 are frequently overexpressed in ovarian cancer but not in ovarian cystadenomas ... Although claudin-4 has been shown by gene expression profiling to be overexpressed in pancreas (9, 34), breast (10), ovarian ( ... Claudin-4. Claudin-4 immunolabeling results are shown in Table 1 and Fig. 1. Normal gastric mucosa distant from the primary ...
1B, the induction of claudin-1, claudin-4, and occludin was confirmed. Results of the real-time RT-PCR experiments used to ... For RT-PCR: claudin-1, CCGTTGGCATGAAGTGTATG, CCAGTGAAGAGAGCCTGACC; claudin-4, CTCTGTGGCCTCAGGACTCT, CAGGACTTCCAAGGGTGAAG; ... claudin-1, claudin-4, and occludin), particularly on claudin-4, because the induction was relatively clear, its expression in ... claudin-1, and occludin), particularly claudin-4. Induction of claudin-4 by indomethacin was confirmed at both mRNA and protein ...
Claudin-4 - Proteins. Product filter Claudin-4 molecule 4-1BB Ligand 4-1BB Receptor 6-Phosphogluconate dehydrogenase, ... Claudin-4 Club Cell Protein Clusterin CNTF Collagen Triple Helix Repeat-Containing Protein 1 Collectrin Complement C1q Tumor ... BTI-Tn-5B1-4) Hi-5 Insect cells* Baculovirus Bovine Heart Canine pooled serum Canine urine Cell Culture E. coli HEK293 HEK293 ... MCP-4 MCP-5 M-CSF MDC MEC Menopausal Gonadotropin Metadherin Meteorin-Like Protein MIA MIA-2 Midkine MIG MIP-1alpha MIP-1beta ...
... ... significant cytoplasmic staining appeared both for claudin 1 (p = 0.04) and claudin 4 (p = 0.01). Tumor samples were ... Altered claudin expression has been described in colon, prostatic, ovarian, and breast carcinoma. However, the role of ... Tight junction, methylation, colon cancer, claudin Nationell ämneskategori Cancer och onkologi Identifikatorer. URN: urn:nbn:se ...
Expression of Claudin-4 has been associated with either poor prognosis or a more favorable diagnosis, depending on the type of ... Claudin-4 has been shown to distinguish adenocarcinoma from malignant mesothelioma with 99% specificity in malignant effusions ... the increase of Claudin-4 protein was correlated with the increase of tumor grade and with Ki-67, and thus demonstrated an ... the presence of Claudin-4 in triple negative breast cancer was a biomarker that demonstrated a favorable prognosis (3). Loss of ...
show that the epithelial-mesenchymal-transition transcription factor Snail induces claudin-11 expression and suppresses RhoA ... Supplementary Figure 5 Tyrosine-phosphorylated claudin-11 recruits and activates Src.. (a) Amino acid sequence of claudin-11 ( ... Shang, X., Lin, X., Alvarez, E., Manorek, G. & Howell, S. B. Tight junction proteins claudin-3 and claudin-4 control tumor ... Supplementary Figure 7: Expression of Snail or claudin-11 correlates with an advanced HNSCC and a worse prognosis.. ...
Down-regulation of claudin-4 (CLDN4) produces a loss of E-cadherin and increased β-catenin signaling and a phenotype similar to ... Down-regulation of claudin-4 (CLDN4) produces a loss of E-cadherin and increased β-catenin signaling and a phenotype similar to ...
Diverse regulation of claudin-1 and claudin-4 in atopic dermatitis.. 26109060. 2015. Prognostic and clinical significance of ... increased claudin-3 and claudin-4 expression may play a postive role in the progression and metastasis of gastric cancer. ... claudin 1 and claudin 4 are differentially involved in atopic dermatitis pathogenesis. ... that claudin-4 can be helpful at least in making a reliable differential diagnosis of spiradenoma when overlapping morphologic ...
Compare Claudin 7 ELISA Kits from LifeSpan BioSciences from leading suppliers on Biocompare. View specifications, prices, ... Claudin 7 ELISA Kits from LifeSpan BioSciences. The ELISA (enzyme-linked immunosorbent assay) is a well-established antibody- ... Mouse/Human/Rat Phospho-CLDN7 / Claudin 7 (Tyr210) ELISA Kit (Cell-Based Phosphorylation ELISA) LifeSpan BioSciences ... Mouse/Human/Rat CLDN7 / Claudin 7 ELISA Kit (Cell-Based ELISA) LifeSpan BioSciences ...
show that a disease-causing effect of claudin-19 mutations is due to a defective visual cycle from a decreased expression of ... This study explains why claudin-19 mutations alter the expression of RPE signature gene… ... In the kidney, claudin-19 must be complexed with claudin-16 to reach the cell surface27,45. However, human RPE delivers claudin ... ARPE-19 and the kidney cell lines, MDCK and LLC-PK1, do not express claudin-16 or claudin-19. Nonetheless, when claudin-19 is ...
This work shows synergy between MET and TP53 loss for claudin-low breast cancer, identifies a restricted claudin-low gene ... Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer.. Knight JF1, Lesurf R ... In both models, MET activity is required for maintenance of the claudin-low morphological phenotype, in which MET inhibitors ... Treatment of spindloid tumor cells with pharmacological MET inhibitors leads to reversal of the claudin-low phenotype. MMTV-Met ...
Claudin-4 qPCR primer pairs, Claudin-4 are screened with high specificity & sensitivity, validated by strict process ... Claudin-4 cDNA ORF Clone, Rat, C-GFPSpark® tag. RG80641-ACG. Claudin-4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag. RG80641 ... Claudin-4 cDNA ORF Clone, Human, C-GFPSpark® tag. HG16358-ACG. Claudin-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag. ... Claudin-4 Background Information. CLDN4 (encoding claudin-4), a cell tight junction (TJ) protein, is highly expressed in human ...
It is also expressed on endothelial cells Rabbit Polyclonal to Claudin 4 Rabbit Polyclonal to GPR37. Rabbit Polyclonal to PDK1. ... Posted in: Activin Receptor-like Kinase ⋅ Tagged: MEK162 novel inhibtior, Rabbit Polyclonal to Claudin 4 ... Posted in: Acetylcholine Transporters ⋅ Tagged: Actinomycin D novel inhibtior, Rabbit Polyclonal to Claudin 4 ... Posted in: 5-Hydroxytryptamine Receptors ⋅ Tagged: K02288 novel inhibtior, Rabbit Polyclonal to Claudin 4 ...
The claudin gene family: expression in normal and neoplastic tissues. BMC Cancer. 2006;6:186.PubMedCentralPubMedCrossRefGoogle ... Claudin-18 gene structure, regulation, and expression is evolutionary conserved in mammals. Gene. 2011;481:83-92.PubMedCrossRef ... Claudin-18 is an early-stage marker of pancreatic carcinogenesis. J Histochem Cytochem. 2011;59:942-952.PubMedCentralPubMed ... miR-1303 Claudin-18 Stomach neoplasms Proliferation Invasion This is a preview of subscription content, log in to check access. ...
Selection de fournisseur de qualité pour anti-Claudin 4 anticorps. ... Commander Claudin 4 anticorps monoclonal et polyclonal pour beaucoup dapplications. ... anti-Claudin 4 anticorps (CLDN4) (AA 29-78) Primary Antibody CLDN4 Reactivité: Humain IP, ELISA Hôte: Souris Monoclonal 4A11 ... anti-Claudin 4 anticorps (CLDN4) (AA 160-209) Primary Antibody CLDN4 Reactivité: Humain IHC, ELISA, WB Hôte: Lapin Polyclonal ...
Claudin 4) ELISA Kit OSCAR DIAGNOSTIC SERVICES PVT. LTD.is an India based Company in Delhi. ... Rabbit CLDN4 (Claudin 4) ELISA Kit Rabbit CLDN4 (Claudin 4) ELISA Kit Rabbit CLDN4 (Claudin 4) ELISA Kit ... Rabbit CLDN4 (Claudin 4) ELISA Kit Rabbit CLDN4 (Claudin 4) ELISA Kit Rabbit CLDN4 (Claudin 4) ELISA Kit Rabbit CLDN4 (Claudin ... Rabbit CLDN4 (Claudin 4) ELISA Kit Rabbit CLDN4 (Claudin 4) ELISA Kit Rabbit CLDN4 (Claudin 4) ELISA Kit Rabbit CLDN4 (Claudin ...
While some claudin family members play essential roles in the formation of impermeable barriers, others mediate the ... Often, several claudin family members are coexpressed and interact with each other, and this determines the overall ... IPR006187. Claudin. IPR003548. Claudin1. IPR017974. Claudin_CS. IPR004031. PMP22/EMP/MP20/Claudin. ... IPR006187. Claudin. IPR003548. Claudin1. IPR017974. Claudin_CS. IPR004031. PMP22/EMP/MP20/Claudin. ...
Ripasudil inhibits claudin-5 and ZO-1 redistribution and restores the binding ratio between claudin-5 and ZO-1 decreased by ... For the single staining of claudin-5 or the double staining of claudin-5 and ZO-1, cultured cells were fixed with 100% methanol ... 7E). VEGF, TNFα, and IL-6 further decreased claudin-5 mRNA expression in ROCK2 KO cells, although claudin-5 protein expression ... We also confirmed the ripasudil-induced increase of claudin-5 transcription in HRMECs (Fig. 6B). In Kimba mice, claudin-5 ...
claudin-2. Fwd. forward. GEO. Gene Expression Omnibus. GF. germ free. GPCR. G-protein coupled receptor. GPR109a. G-protein ... Claudin-2 as a mediator of leaky gut barrier during intestinal inflammation. Tissue Barriers 3: e977176. ... Claudin switching: physiological plasticity of the tight junction. Semin. Cell Dev. Biol. 42: 22-29. ... HIF-dependent regulation of claudin-1 is central to intestinal epithelial tight junction integrity. Mol. Biol. Cell 26: 2252- ...
Claudin 4 antibody , C-termApplications: WBPredicted Target Size: 22 kDa (note)Positive Controls: HCT116Form Supplied: ... Claudin 4 antibody [C2C3], C-term. November 27, 2017. November 30, -0001. idh inhibitor ... Full Name: claudin 4. Background: This gene encodes an integral membrane protein, which belongs to the claudin family. The ... Product Name: Claudin 4 antibody [C2C3], C-term. Applications: WB. Predicted Target Size: 22 kDa (note). Positive Controls: ...
Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice. J Cell ... 17, 53) or immunofluorescence for human claudin-1 (polyclonal rabbit anti-claudin-1; 51-9000, Invitrogen) with appropriate ... Claudin-1 is a critical mediator of skin barrier (29). In the esophagus, claudin-1 is decreased in gastroesophageal reflux ... and impaired claudin-1 barrier via repression of HIF-1α/claudin-1 signaling, which was restored by transgenic expression of ...
IPR006187 Claudin. IPR005411 Claudin2. IPR017974 Claudin_CS. IPR004031 PMP22/EMP/MP20/Claudin. ... IPR006187 Claudin. IPR005411 Claudin2. IPR017974 Claudin_CS. IPR004031 PMP22/EMP/MP20/Claudin. ... Belongs to the claudin family.Curated. Keywords - Domaini. Transmembrane, Transmembrane helix. Phylogenomic databases. ... "Claudin-1 and -2: novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin.". ...
claudin 4. Enable Javascript to view the expand/collapse boxes.. Open All Close All ... The protein encoded by this intronless gene belongs to the claudin family. Claudins are integral membrane proteins that are ...
  • Claudin-4 belongs to the 20-member family of claudins, transmembrane cellular adhesion proteins localized at epithelial and endothelial tight junctions. (thermofisher.com)
  • To test whether members of the claudin family of tight junction proteins influence paracellular ionic selectivity, we expressed human claudin-4 in cultured MDCK cells using an inducible promoter. (jci.org)
  • As such, cancer expression of claudin proteins is markedly dysregulated, making it an attractive target for molecular imaging like positron emission tomography (PET). (mdpi.com)
  • The alpha-amino-3-hydroxyl-5-methyl-4-isoxazolepropionate receptor trafficking regulator "stargazin" is related to the claudin family of proteins b. (nih.gov)
  • Stargazin is related to the claudin family of tight junction proteins. (nih.gov)
  • Besides its role in barrier function, claudin-19 regulates the expression of RPE signature genes 16 , 17 that include visual cycle proteins and retinal neurotrophic factors. (nature.com)
  • The paracellular barrier of epithelia and endothelia is established by several tight junction proteins including claudin-3. (nih.gov)
  • Cell lysates from Huh7.5.1 cells were incubated with purified GST-claudin-1 tail or GST, and proteins were pulled down with glutathione-Sepharose beads. (asm.org)
  • Candidate claudin-1 tail-interacting proteins were the GST-claudin-1-tail interactome. (asm.org)
  • Stewart and colleagues found that claudin-4 was one of the most highly upregulated (7.5-fold increase) proteins expressed by cisplatin resistant IGROV-1 ovarian tumor cells compared to their cisplatin-sensitive counterparts [ 19 ]. (biomedcentral.com)
  • A closer examination of isolated tight junctions uncovered two related ~22 kDa, four-transmembrane domain proteins, claudin-1 and claudin-2, with no similarity to occludin. (thermofisher.com)
  • Excitement in the tight junction field continues to rise following the recent discovery of claudins -3, -4, -5, -6, -7, and -8 and experiments suggesting that tight junctions in different tissues are comprised of different sets of claudin family proteins. (thermofisher.com)
  • To this end, MDCK C7 cells were stably transfected with either claudin-2 or claudin-10b, two paracellular cation-channel-forming TJ proteins that are not endogenously expressed in this cell line. (biologists.org)
  • Perturbation was overexpression of either claudin-2 or claudin-10b, as both form cation channels within the TJ of MDCK C7 cells, a tight renal epithelial cell line that lacks endogenous expression of these TJ proteins. (biologists.org)
  • These proteins, such as claudin-5, occludin, and zona occludens 1 (ZO-1) prevent transcellular diffusion of molecules and cells ( 1 ). (frontiersin.org)
  • 4. Signal-relaying junctions - complex structures that typically involve anchorage proteins alongside proteins mediating signal transduction. (brainscape.com)
  • Occludin and the sealing tight junction proteins claudin 5 and claudin 8 were downregulated and redistributed off the tight junction, whereas the pore-forming tight junctions protein claudin 2 was strongly upregulated, which constitute the molecular basis of tight junction changes. (bmj.com)
  • Clone REA751 recognizes the human claudin-3 antigen, an integral membrane protein which is a component of the claudin family of epithelial tight junction proteins. (miltenyibiotec.com)
  • TJs are composed of at least three types of transmembrane protein -occludin, claudin and junctional adhesion molecules (JAMs)- and a cytoplasmic 'plaque' consisting of many different proteins that form large complexes. (genome.jp)
  • As the first step in understanding the physiologic functions of claudins (tight junction integral membrane proteins) in nephrons, the expression of claudin-1 to -16 in mouse kidneys was examined by Northern blotting. (asnjournals.org)
  • Tight junction proteins claudin-2 and -12 are critical for vitamin D-dependent Ca2+ absorption between enterocytes. (semanticscholar.org)
  • By contrast, in MDCK I cells, PMA treatment resulted in redistribution of claudins 1, 3, 4 and 5 from the TJ and in reorganization of the proteins into more insoluble complexes. (deepdyve.com)
  • His team was the first to propose and demonstrate that the transmembrane claudin proteins create charge-selective pores in the tight junction and that different members of the claudin family confer different ion selectivity. (nih.gov)
  • Proteomic analysis of proteins surrounding occludin and claudin-4 reveals their proximity to signaling and trafficking networks. (nih.gov)
  • Auf www.antikoerper-online.de finden Sie aktuell 158 Claudin 4 (CLDN4) Antikörper von 25 unterschiedlichen Herstellern. (antikoerper-online.de)
  • Claudin-4 (Clostridium perfringens enterotoxin receptor) is a tight junction protein encoded by the gene CLDN4. (biocare.net)
  • Data suggest that changes in DNA methylation in trophoblasts regulate (1) cell mobility/placentation, (2) expression of claudin-4 (CLDN4) and 4-fucosyltransferase (FUT4), and (3) matrix metalloproteinase (MMP2 and MMP9) activity. (nih.gov)
  • CLDN4 (encoding claudin-4), a cell tight junction (TJ) protein, is highly expressed in human epithelial ovarian carcinomas (EOC) but undetectable in normal ovaries. (sinobiological.com)
  • 69 Claudin 4 (CLDN4) Anticorps de 13 fabricants sont disponibles sur www.anticorps-enligne.fr. (anticorps-enligne.fr)
  • Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections) - Anti-Claudin 4 antibody (ab15104) Lean QY et al. (abcam.com)
  • The following product was used in this experiment: Claudin 4 Monoclonal Antibody (3E2C1) from Thermo Fisher Scientific, catalog # 32-9400, RRID AB_2533096. (thermofisher.com)
  • This antibody reacts specifically with the ~ 22 kDa Claudin-4 protein and does not cross-react with the protein at 55 kDa. (thermofisher.com)
  • IHC-P analysis of human colon tissue using GTX31496 Claudin 4 antibody. (genetex.com)
  • WB analysis of HeLa cell lysate using GTX31496 Claudin 4 antibody. (genetex.com)
  • Western Blot analysis of HT29 cells using Claudin 4 Polyclonal Antibody at dilution of 1:700. (elabscience.com)
  • Immunohistochemistry of paraffin-embedded Human breast cancer using Claudin 4 Polyclonal Antibody at dilution of 1:35. (elabscience.com)
  • The lysates were immunoprecipitated with anti-claudin-1 antibody followed by Western blotting. (asm.org)
  • A total of 10 4 cells were analyzed, and isotype control antibody was used to delineate the gate. (asm.org)
  • Claudin-9 Polyclonal antibody specifically detects Claudin-9 in Human samples. (fishersci.com)
  • The following antibody was used in this experiment: Claudin 5 Monoclonal Antibody (4C3C2), Alexa Fluor 488 from Thermo Fisher Scientific, catalog # 352588, RRID AB_2532189. (thermofisher.com)
  • This antibody reacts specifically with the ~ 22-24 kDa endogenous Claudin-5 protein. (thermofisher.com)
  • Here, we report that enteroendocrine cells selectively express a tight junction membrane protein, claudin-4 Cld4, and are efficiently isolated with the use of an antibody specific for the Cld4 extracellular domain and flow cytometry. (duhnnae.com)
  • Unexpectedly, the anti-claudin-1 antibody localized claudin to the Golgi apparatus of a sub-population of SA and RA in addition to the distal junctions of RA. (frontiersin.org)
  • In the current study, we generated a humanCmouse cross\reactive and CLDN\4\specific monoclonal antibody (named 5D12) and assessed its antitumor activity and adverse effects. (pik-293.com)
  • 4. Incubate membrane with an appropriate secondary antibody (peroxidase conjugated) for 1 hour at room temperature in 5% milk/TBST. (novusbio.com)
  • Journal Article] Safety evaluation of a human chimeric monoclonal antibody that recognizes the extracellular loop domain of claudin-2. (nii.ac.jp)
  • The modulating agents comprise at least one claudin cell adhesion recognition sequence or an antibody or fragment thereof that specifically binds the claudin cell adhesion recognition sequence. (justia.com)
  • The present invention relates generally to methods for regulating claudin-mediated processes, and more particularly to the use of modulating agents comprising a claudin cell adhesion recognition sequence and/or an antibody that specifically recognizes such a sequence for inhibiting functions such as cell adhesion and the formation of tissue permeability barriers. (justia.com)
  • Claudin 19 antibody LS-C503440 is an AP-conjugated mouse monoclonal antibody to human Claudin 19 (CLDN19). (lsbio.com)
  • The overexpression of Claudin-4 has been shown to decrease paracellular electrical conductance due to a selective decrease in Na+ permeability, with no significant decrease in Cl - permeability. (thermofisher.com)
  • Overexpression increased the complexity of tight junction strands visible by freeze-fracture microscopy without affecting the levels of claudin-1, -2, or -3, occludin, or ZO-1. (jci.org)
  • In the present study we directly test whether overexpression of one claudin, claudin-4, can confer ionic discrimination to the paracellular pathway. (jci.org)
  • Overexpression of claudin-4 in AGS cells did not affect cell growth or the induction of apoptosis by indomethacin. (aacrjournals.org)
  • On the other hand, addition of indomethacin or overexpression of claudin-4 inhibited cell migration. (aacrjournals.org)
  • Claudin-4 overexpression was able to independently predict survival in a breast cancer multivariate analysis as it was associated with poor prognosis, high tumor grade and Her2 expression and was inversely correlated with estrogen receptor staining (2). (biocare.net)
  • Basal-like tumors also demonstrated overexpression of Claudin-4 (4). (biocare.net)
  • Claudin-4 overexpression in prostate cancer may offer a Claudin-4 targeted therapy as a potential treatment (7). (biocare.net)
  • Overexpression of snail correlates with increased claudin-11, and both are associated with a worse outcome. (nature.com)
  • Overexpression of claudin-4 induced formation of vascular channels in breast cancer. (nih.gov)
  • VEGF overexpression in the mouse retina caused delayed inflammatory cytokine upregulation, monocyte/macrophage infiltration (CD11b + Ly6C + CCR2 + cells), macrophage/microglia activation (CD11b + CD80 + cells), and blood-retinal barrier disruption due to claudin-5 redistribution, which did not recover with VEGF blockade alone. (diabetesjournals.org)
  • Overexpression of OSP/claudin-11 or OAP-1 induced proliferation in an oligodendrocyte cell line. (sigmaaldrich.com)
  • In conclusion, the present study demonstrated improved homing and anti-fibrotic effect of BM-MSCs, which is thought to be partly mediated by the overexpression of claudin-4 by meloxicam. (allresearchjournal.com)
  • Our findings demonstrate that claudin overexpression studies measure the combined effect of alterations in both endogenous and exogenous claudins, thus explaining the dependence of the phenotype on the host cell line. (deepdyve.com)
  • These results provide, to our knowledge, the first direct demonstration of the ability of a claudin to influence paracellular ion selectivity and support a role for the claudins in creating selective channels through the tight-junction barrier. (jci.org)
  • Because stargazin is structurally similar to claudins, we hypothesized that it might also have retained claudin-like functions inherited from a common ancestor. (nih.gov)
  • In normal mucosa, cytoplasm showed no staining for claudins in any patient, whereas in paired colorectal cancer tissues, significant cytoplasmic staining appeared both for claudin 1 (p = 0.04) and claudin 4 (p = 0.01). (diva-portal.org)
  • The prognostic role of claudins -1 and -4 in oral squamous cell carcinoma. (nih.gov)
  • Expression patterns of claudins 1, 4, and 7 and their prognostic significance in nasopharyngeal carcinoma. (nih.gov)
  • Unlike Met(mt) tumors, which are histologically diverse and enriched in a basal-like molecular signature, the majority of Met(mt) tumors with Trp53 loss displayed a spindloid pathology with a distinct molecular signature that resembles the human claudin-low subtype of TNBC, including diminished claudins, an epithelial-to-mesenchymal transition signature, and decreased expression of the microRNA-200 family. (nih.gov)
  • Claudin-4 is the first to confer ionic selectivity to paracellular transport, leading to the prediction that the combination of different claudins defines the overall selectivity of different junctions. (thermofisher.com)
  • Immunoblotting revealed an expression of all claudins within both epithelia, with markedly stronger expression of the sealing TJ protein claudin-4 in PP FAE compared with the neighboring VE. (fu-berlin.de)
  • Immunohistochemistry confirmed the expression and localization of all claudins in both PP FAE and VE, with stronger claudin-4 abundance in PP FAE. (fu-berlin.de)
  • Other claudins were unchanged (claudins 1, 4 and 7) or not detectable in sigmoid colon (claudins 11, 12, 14, 15 and 16). (bmj.com)
  • Upregulation of pore-forming claudin 2 and downregulation and redistribution of sealing claudins 5 and 8 lead to altered tight junction structure and pronounced barrier dysfunction already in mild to moderately active Crohn's disease. (bmj.com)
  • Claudin-4 was the first claudin whose involvement in the TJ permeability in cultured cells was directly demonstrated, but the permeability properties of individual claudins including claudin-4 are still incompletely clarified. (bireme.br)
  • We found that claudin-4 knockout has no apparent effect on the localization of other claudins and electrophysiological properties in MDCK II cells. (bireme.br)
  • Claudin-4 knockout in addition to claudin-2 knockout slightly increased the localization of other claudins at TJs but showed no obvious effects on the electrophysiological properties in MDCK II cells. (bireme.br)
  • When each claudin species or occludin was overexpressed in mouse L fibroblasts, claudin molecules, but not occludin, were polymerized within the plasma membranes to reconstitute paired TJ strands, indicating that claudins are major structural components of TJ strands ( 13 ). (asnjournals.org)
  • In MDCK cells the stable expression of E7 increased the space between adjacent cells and altered the architecture of the monolayers, induced the development of an acute peak of transepithelial electrical resistance accompanied by a reduced expression of claudins ‑1, ‑2 and ‑10, and an increase in claudin‑4. (spandidos-publications.com)
  • In HT29 cells, claudins 1, 3, 4 and 5 and possibly claudin 2 were redistributed to apical cell-cell contacts after PKC activation and the amounts of claudins 1, 3 and 5, but not of claudin 2, were increased in cell lysates. (deepdyve.com)
  • Claudins 1 and 4 were phosphorylated in both MDCK I and HT29 cells, but PKC-induced changes in claudin phosphorylation state were detected only in MDCK I cells. (deepdyve.com)
  • Unlike in MDCK II cells, induction of claudin-8 in MDCK I cells (which did not affect levels of endogenous claudins) did not alter paracellular ion permeability. (deepdyve.com)
  • expression of claudin-4 is highly specific for true epithelial differentiation and may be useful to distinguish SWI (zeige SMARCA1 Antikörper )/ SNF (zeige SNRPA Antikörper ) complex-deficient undifferentiated carcinomas from sarcomas with epithelioid morphology. (antikoerper-online.de)
  • The lack of claudin-4 expression in ovarian small cell carcinomas of hypercalcemic type suggests that these tumors may be better regarded as sarcomas rather than carcinomas. (antikoerper-online.de)
  • Data indiate a regulatory network in gastric cancer whereby claudin-4 expression is reduced by specific miRNAs, which are in turn bound by specific lncRNAs acting as competing endogenous RNAs (ceRNAs), resulting in increased claudin-4 expression. (antikoerper-online.de)
  • This is the first study to show how TGF-beta (zeige TGFB1 Antikörper ) regulates the expression of Claudin-4 through c-Jun (zeige JUN Antikörper ) signaling and how this pathway contributes to the migratory and tumorigenic phenotype of lung tumor cells. (antikoerper-online.de)
  • Expression of claudin-11/OSP is concentrated in testis and oligodendrocytes of the central nervous system (CNS). (jci.org)
  • In this work we describe the synthesis of the first 18 F-labeled probes potentially suitable for PET imaging of claudin-4 expression. (mdpi.com)
  • One of these, claudin-4, is a member of the claudin gene family that has been identified in several independent gene expression profiles to be up-regulated in a variety of tumors ( 8 - 13 ) and, importantly, in premalignant lesions of the pancreas ( 14 ) and esophagus ( 15 ). (aacrjournals.org)
  • Suppression of claudin-4 expression by small interfering RNA restored the migration activity of AGS cells in the presence of indomethacin. (aacrjournals.org)
  • We aimed our study to investigate whether claudin protein expression and methylation of CLDN can influence the tumorigenesis of colorectal cancer. (diva-portal.org)
  • Immunohistochemical staining was used to study protein expression in both tumor and the adjacent nonneoplastic mucosa of claudin 1, 4, and 7. (diva-portal.org)
  • Expression of Claudin-4 has been associated with either poor prognosis or a more favorable diagnosis, depending on the type of cancer. (biocare.net)
  • Low expression of the Claudin-4 protein correlated with higher T staging, lymphatic metastasis and higher risk of recurrence in esophageal squamous cell carcinoma (6). (biocare.net)
  • Increased claudin-4 expression is associated with poor prognosis and high tumour grade in breast cancer. (biocare.net)
  • Claudin expression in high-grade invasive ductal carcinoma of the breast: correlation with the molecular subtype. (biocare.net)
  • Low expression of claudin-4: an indicator of recurrence in esophageal squamous cell carcinoma after Ivor Lewis esophagectomy? (biocare.net)
  • We show that the EMT transcription factor Snail elicits collective migration in squamous cell carcinoma by inducing the expression of a tight junctional protein, claudin-11. (nature.com)
  • This meta-analysis shows that over-expression of claudin-4 is associated with progress of gastric cancer and poor prognosis of gastric cancer patients. (nih.gov)
  • Increased claudin 4 expression was related to advanced stage and decreased survival in nasopharyngeal carcinoma. (nih.gov)
  • Estrogen-dependent expression and subcellular localization of the tight junction protein claudin-4 in HEC-1A endometrial cancer cells. (nih.gov)
  • The expression patterns of tight junction protein claudin-1, -3, and -4 in human gastric neoplasms and adjacent non-neoplastic tissues. (nih.gov)
  • Exogenous expression of wild type, but not mutant claudin-19, increases the expression of RPE signature genes. (nature.com)
  • In both models, MET activity is required for maintenance of the claudin-low morphological phenotype, in which MET inhibitors restore cell-cell junctions, rescue claudin 1 expression, and abrogate growth and dissemination of cells in vivo. (nih.gov)
  • Claudin-4 expression is associated with neoplastic progression of intraductal papillary mucinous neoplasms and, especially, with a distinct pathway to intestinal differentiation. (sinobiological.com)
  • The expression of miR-1303 and claudin-18 in GC tissues and gastric cancer cell lines were detected by qRT-PCR and western blotting, respectively. (springer.com)
  • miR-1303 could bind to the putative binding sites in CLDN18 mRNA 3′-UTR and visibly lower the expression of claudin-18. (springer.com)
  • The claudin gene family: expression in normal and neoplastic tissues. (springer.com)
  • Ripasudil also contributed to the stability of claudin-5 expression by both transcriptional enhancement and degradation suppression in inflammatory cytokine-stimulated endothelium. (diabetesjournals.org)
  • In turn, claudin-5 becomes anchored to the actin cytoskeleton via zonula occludens protein-1 (ZO-1), resulting in its stable expression on cell membranes ( 14 ). (diabetesjournals.org)
  • Loss and gain of IL-10RA expression directly correlates with IEC barrier formation and butyrate represses permeability-promoting claudin-2 tight-junction protein expression through an IL-10RA-dependent mechanism. (jimmunol.org)
  • Two clone systems were analyzed, exhibiting high or low claudin-2 expression, respectively. (nih.gov)
  • Claudin-4 expression was also altered using shRNA-mediated gene silencing. (biomedcentral.com)
  • The mimic peptide had no effect on cells that lacked claudin-4 expression. (biomedcentral.com)
  • For these reasons, claudin-4 is widely accepted as a differentiation marker and its expression is thought to signify a more epithelial phenotype. (biomedcentral.com)
  • These observations suggest that claudin-4 expression may be enhanced early in epithelial ovarian tumor development and its effects are shared among most ovarian tumor cells. (biomedcentral.com)
  • Significant associations between high claudin-4 expression and more aggressive tumor cell behavior have been reported by several laboratories. (biomedcentral.com)
  • Deletion of claudin-7 reduced integrin α2 expression and altered its localization. (aacrjournals.org)
  • Objective To detect the expression change of claudin-4 in Ishikawa endometrial adenocarcinoma cell line in response to progesterone. (bmj.com)
  • The messenger RNA and protein expression levels of claudin-4 were further quantified by real-time polymerase chain reaction and Western blot. (bmj.com)
  • It may work through decreasing claudin-4 expression and cell apoptosis. (bmj.com)
  • Moreover, the PKH26 staining showed that meloxicam which induced the expression of claudin-4 resulted in more homing of BM-MSCs to the liver more than those without meloxicam addition. (allresearchjournal.com)
  • Second, IL-1β induces expression of hypoxia-inducible factor-1α (HIF-1α) and VEGF-A, contributing to BBB permeability and increased angiogenesis ( 4 ). (frontiersin.org)
  • Changes in VE-cadherin and claudin-5 expression were studied by immunocytochemistry (ICC) and quantified by cell-based enzyme linked immunosorbent assays (ELISA). (open.ac.uk)
  • This effect was enhanced by the tyrosine phosphatase inhibitor orthovanadate and attenuated by the tyrosine kinase inhibitor lavendustin A. ICC and cell-based ELISA revealed that TGF-β1 induced both dose- and time-dependent decreases in VE-cadherin and claudin-5 expression. (open.ac.uk)
  • In the epidermis of atopic dermatitis (AD), which contains ΔNp63-deficient keratinocytes, high expression of claudin-4 was observed. (bireme.br)
  • In primary keratinocytes, downregulation of ΔNp63 by treatment with short interfering RNA (siRNA)-p63 induced claudin-4 expression. (bireme.br)
  • In primary nasal epithelial cells transfected with the human telomerase reverse transcriptase gene, knockdown of p63 by siRNAs induced claudin-4 expression. (bireme.br)
  • Taken together, these findings indicate that p63 is a negative regulator of claudin-4 expression. (bireme.br)
  • In addition, there was also a transient increase in claudin‑1 expression in the cervix of 2‑month‑old K14E7 mice, and claudin‑10 accumulated at the border of cells in the upper layer of the cervix in FvB mice treated with E2, and in K14E7 mice treated with or without E2. (spandidos-publications.com)
  • The density of small tight junction pores varies among cell types and is increased by expression of claudin-2. (semanticscholar.org)
  • Claudin-2 expression induces cation-selective channels in tight junctions of epithelial cells. (semanticscholar.org)
  • Potential therapeutic molecules were tested to detect effects on transepithelial resistance (TER), bacterial translocation (BT), claudin-4 expression, and regulation of the inflammatory cytokine response. (springer.com)
  • Activation of the Ca(2+)-sensing receptor increases renal claudin-14 expression and urinary Ca(2+) excretion. (medscape.com)
  • Here, we show that this is not because of relocalization of claudin-2 into the cytosolic pool but primarily due to a decrease in gene expression. (deepdyve.com)
  • The Claudin-4 gene is deleted in Williams-Beuren syndrome, a neurodevelopmental disorder affecting multiple systems. (thermofisher.com)
  • The protein encoded by this intronless gene belongs to the claudin family. (genetex.com)
  • This work shows synergy between MET and TP53 loss for claudin-low breast cancer, identifies a restricted claudin-low gene signature, and provides a rationale for anti-MET therapies in TNBC. (nih.gov)
  • However, the effects of microRNA-1303 (miR-1303) on gastric cancer (GC) cells and the upstream regulation of GC-associated claudin-18 gene (CLDN18) remain unclear. (springer.com)
  • Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. (springer.com)
  • Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans . (springer.com)
  • Background: This gene encodes an integral membrane protein, which belongs to the claudin family. (idhinhibitor.com)
  • To study the basolateral function of claudin-7, claudin-7 gene silencing experiments were carried out in a lung cancer cell line using the lentivirus shRNA approach. (aacrjournals.org)
  • We also generated claudin-7-deficient (Cldn7 −/− ) mice using targeted-gene deletion method. (aacrjournals.org)
  • We aimed to assess quantitatively the significance of the contribution of claudin-11 to TJ function, in vitro, using siRNA-mediated gene silencing. (garvan.org.au)
  • Claudin-11 (CLDN11) is a potential tumor suppressor gene located at chromosome 3 (3q26.2), and encodes a member of the claudin family, an integral membrane protein of the paracellular tight junction (TJ) [ 12 , 13 ]. (pubmedcentralcanada.ca)
  • Claudin-4 knockout by TALEN-mediated gene targeting in MDCK cells: Claudin-4 is dispensable for the permeability properties of tight junctions in wild-type MDCK cells. (bireme.br)
  • CACNG4 (Calcium Voltage-Gated Channel Auxiliary Subunit Gamma 4) is a Protein Coding gene. (genecards.org)
  • Among identified genes, we focused on those related to tight junction function ( claudin-4 , claudin-1 , and occludin ), particularly claudin-4 . (aacrjournals.org)
  • C) Cell lysates from Huh7.5.1 cells were pulled down by GST-CD81-N-tail, GST-CD81-C-tail, GST-occludin-tail, GST-SRB1-tail, GST-claudin-1 tail or GST with two extra washes. (asm.org)
  • Silencing of claudin-11 and/or occludin was conducted using siRNA in an immature rat Sertoli cell culture model. (garvan.org.au)
  • In contrast to occludin, which induces only a small number of short strands at cell-cell contact sites when introduced into fibroblasts lacking tight junctions, claudin-1 and -2 induce networks of strands characteristic of true tight junctions. (thermofisher.com)
  • Though inconclusive, these findings suggest that claudin-1 and -2 are major structural components of TJ strands and that occludin plays some other accessory role. (thermofisher.com)
  • Claudin-4 is also overexpressed in pancreatic cancer tissues and cell lines, and in other epithelial cancers. (thermofisher.com)
  • In 1955, Morson ( 2 - 4 ) first described the possible transition from intestinal metaplasia to gastric epithelial dysplasia to the development of gastric adenocarcinoma, and Correa ( 5 ) later developed the model of histologic progression in gastric adenocarcinoma. (aacrjournals.org)
  • We identified three targets, claudin-4, mitogen-activated protein kinase kinase 4 (MKK4), and 14-3-3σ (stratifin), that were selectively expressed in intestinal metaplasia and gastric epithelial dysplasia but not in normal stomach. (aacrjournals.org)
  • Claudin-4 is a transmembrane protein expressed at high levels in the majority of epithelial ovarian tumors, irrespective of subtype, and has been associated with tumor cells that are both chemoresistant and highly mobile. (biomedcentral.com)
  • It is therefore somewhat paradoxical that claudin-4 is highly expressed in many types of epithelial tumors including ovarian, breast, gastric, hepatic, pancreatic and other cancers of epithelial origin [ 6 - 14 ]. (biomedcentral.com)
  • Claudin-7 is a unique TJ membrane protein in that it has a stronger basolateral membrane distribution than that of apical TJs in epithelial cells. (aacrjournals.org)
  • Thus, our current study highlights a novel non-TJ function of claudin-7 in maintaining epithelial cell-matrix interactions by interacting with integrins. (aacrjournals.org)
  • Compare epithelial tissue and connective tissue (4 major categories). (brainscape.com)
  • Epithelial apoptosis was analysed in terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labelling and 4′,6-diamidino-2-phenylindole staining. (bmj.com)
  • Binding of CPE to claudin-3 induces epithelial cell lysis. (miltenyibiotec.com)
  • Regulation of claudin-4 via p63 in human epithelial cells. (bireme.br)
  • Claudin-4 is regulated via various factors in normal epithelial cells and diseases. (bireme.br)
  • We found that claudin-4 was directly regulated via p63 (TAp63 and ΔNp63) in human keratinocytes and nasal epithelial cells. (bireme.br)
  • In nasal epithelial cells in the context of rhinitis or nasal polyps, upregulation of TAp63 and downregulation of claudin-4 were observed. (bireme.br)
  • Understanding the regulation of claudin-4 via p63 in human epithelial cells may be important for developing therapies for allergies and drug delivery systems. (bireme.br)
  • A claudin subtype that is associated with the formation of cation-selective channels and increased epithelial permeability. (semanticscholar.org)
  • The enteropathogens impaired intestinal-epithelial barrier integrity with dysregulation of claudin-4 and increased bacterial translocation. (springer.com)
  • Claudin-1 is expressed primarily in keratinocytes and normal mammary epithelial cells. (ptglab.com)
  • Here, we address how the interaction of heterologously expressed claudin-8 with endogenous claudin isoforms impacts epithelial barrier properties. (deepdyve.com)
  • While some claudin family members play essential roles in the formation of impermeable barriers, others mediate the permeability to ions and small molecules. (uniprot.org)
  • Often, several claudin family members are coexpressed and interact with each other, and this determines the overall permeability. (uniprot.org)
  • Furthermore, the passage of the paracellular tracers fluorescein (332Da) and FD-4 (4kDa) was decreased, whereas the permeability to water was not affected. (nih.gov)
  • Dysfunction of the intestinal barrier is associated with increased gut permeability and development of multiple gastrointestinal diseases, such as food allergy, inflammatory bowel disease (IBD), irritable bowel syndrome (IBS), celiac disease, and infectious enterocolitis [ 2 - 4 ]. (hindawi.com)
  • Under all conditions, water flux in claudin-2-transfected cells was elevated compared with vector controls, indicating claudin-2-mediated paracellular water permeability. (biologists.org)
  • Members of the claudin family are known to determine tight junction permeability in a charge- and size-selective manner. (rupress.org)
  • This study aimed to test the hypothesis that transforming growth factor (TGF)-β1 increases the paracellular permeability of vascular endothelial monolayers through tyrosine phosphorylation of VE-cadherin and claudin-5. (open.ac.uk)
  • Our results suggest that tyrosine phosphorylation of VE-cadherin and claudin-5 is involved in the increased paracellular permeability of central nervous system-derived vascular endothelium induced by TGF-β1. (open.ac.uk)
  • In this study, we established claudin-4 knockout cells using transcription activator-like effector nucleases (TALENs), a recently developed method for genome editing, and investigated the permeability property of claudin-4 in MDCK II cells. (bireme.br)
  • We previously reported that claudin-8 reduces paracellular cation permeability when expressed in low-resistance Madin-Darby canine kidney (MDCK) II cells. (deepdyve.com)
  • Furthermore, when endogenous claudin-2 in MDCK II cells was downregulated by epidermal growth factor to create a cell model with low transepithelial resistance and low levels of claudin-2, the permeability effects of claudin-8 were also abolished. (deepdyve.com)
  • The formulation of the model is Rabbit Polyclonal to Claudin 4 vital since at some phases of their advancement in the sponsor the malaria parasites can't be noticed, either because they're sequestered in the deep bloodstream vasculature if not because detection limitations are too much. (healthweblognews.info)
  • In the high-claudin-2 system, claudin-3 reduced claudin-2-induced cation selectivity, while in the low-claudin-2 system no charge preference was observed, the latter thus reflecting the "intrinsic" action of claudin-3. (nih.gov)
  • The simulations suggest that the selectivity filter is formed by a cage of four aspartic acid residues (D55), contributed by four claudin-15 molecules, which creates a negative electrostatic potential to favor cation flux over anion flux. (rupress.org)
  • Thus, our model provides an atomic view of claudin channels, their transport function, and a potential three-dimensional organization of its selectivity filter. (rupress.org)
  • they demonstrate ion and size selectivity, and their barrier function varies significantly in tightness, depending on the cell type and physiologic requirements ( 4 , 5 ). (asnjournals.org)
  • Claudin extracellular domains determine paracellular charge selectivity and resistance but not tight junction fibril architecture. (semanticscholar.org)
  • F) Coimmunoprecipitation of endogenous claudin-1 with Sec24C in Huh7.5.1 cells. (asm.org)
  • In MDCK II cells, barrier improvement by claudin-8 is accompanied by a reduction of endogenous claudin-2 protein at the tight junction. (deepdyve.com)
  • To test whether replacement of cation-permeable claudin-2 mediates the effect of claudin-8 on the electrophysiological phenotype of the host cell line, we expressed claudin-8 in high-resistance MDCK I cells, which lack endogenous claudin-2. (deepdyve.com)
  • The 20 members of the claudin family ( 8 ) share several essential features. (jci.org)
  • Hormonally regulated claudin-11 is a critical transmembrane protein involved in barrier function and its murine knockout results in infertility. (garvan.org.au)
  • Claudin-1 is a tight junction transmembrane protein. (frontiersin.org)
  • Claudin-4 is a component of tight junction strands and may play a role in internal organ development and function during pre- and postnatal life. (thermofisher.com)
  • Based on these results, we consider that the induction of claudin-4 and other tight junction-related genes by NSAIDs may be involved in the chemopreventive effect of NSAIDs through the suppression of anchorage-independent growth and cell migration. (aacrjournals.org)
  • Loss of the tight junction protein claudin 4 correlates with histological growth-pattern and differentiation in advanced gastric adenocarcinoma. (biocare.net)
  • Claudin-4, encoding a protein for tight junction formation and function, is highly overexpressed in pancreatic ductal adenocarcinoma and is also associated with invasive adenocarcinomas arising in intraductal papillary mucinous neoplasms of the pancreas. (sinobiological.com)
  • We demonstrate that claudin-3 alters the tight junction meshwork and seals the paracellular pathway against the passage of small ions of either charge and uncharged solutes. (nih.gov)
  • B) Huh7.5 cells treated with Sec24C siRNA or a control siRNA for 72 h were stained with antibodies against claudin-1 (green) and the tight junction marker ZO-1 (red). (asm.org)
  • A) Huh7.5 cells treated with different concentrations of XN for 12 h were fixed with methanol and stained with antibodies against claudin-1 (red) and the tight junction marker ZO-1 (green). (asm.org)
  • These interactions of claudin-4 have been most well defined in normal epithelia in culture, where claudin-4 is often restricted to tight junction structures and has been shown to provide a barrier to paracellular diffusion [ 3 , 4 ]. (biomedcentral.com)
  • Additionally, claudin-4 is often found outside of tight junction structures, often along basolateral membranes, in normal epithelium. (biomedcentral.com)
  • These observations suggest that claudin-4 may have functions outside of its traditional barrier forming role in tight junctions and may even participate in activities attributed to the more mesenchymal-like behavior of tumor cells. (biomedcentral.com)
  • Oligodendrocyte-specific protein (OSP)/claudin-11 is a major component of central nervous system myelin and forms tight junctions (TJs) within myelin sheaths. (sigmaaldrich.com)
  • The latter may be due to the altered distribution of tight junction components claudin-4 and ZO-1. (nih.gov)
  • Thus, Claudin-4 forms channels through the tight junctions that discriminate against Na+ ions and are indifferent to Cl- ions. (thermofisher.com)
  • Since it has been shown that ameloblasts repeatedly alternate between an SA and an RA morphology during enamel maturation, the presence of claudin-1 in the Golgi cisterns may indicate the presence of tight junction precursors before transportation to the junctional area. (frontiersin.org)
  • Localization of claudin-1 in the Golgi apparatus may reflect rapid tight junction turnover during enamel maturation. (frontiersin.org)
  • Claudin-3 is involved in tight junction-specific obliteration of the intercellular space. (miltenyibiotec.com)
  • 1999) Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands. (miltenyibiotec.com)
  • The localization of claudin-4 was examined by immunofluorescent staining. (bmj.com)
  • The localization of claudin-4 transferred from cytomembrane to cytoplasm and nucleus. (bmj.com)
  • The localization change of claudin-4 may also be involved in the anticancer effect of progesterone. (bmj.com)
  • In this study, the localization of claudin-1 in maturation ameloblasts was examined using immunofluorescence microscopy. (frontiersin.org)
  • To detect the DNA methylation pattern of CLDN1, 4, and 7, genomic DNA was extracted from both the tumor and the adjacent nonneoplastic mucosa. (diva-portal.org)
  • In conclusion, our results show that CLDN1 is significantly hypomethylated in tumor samples and that the membrane staining intensity for claudin 1, 4, and 7 is significantly lower in colorectal cancer tissues than in adjacent nonneoplastic tissue. (diva-portal.org)
  • It has been reported that polymorphisms in claudin 1 (CLDN1) are associated with risk of several cancers. (portlandpress.com)
  • In ovarian carcinoma cells, Claudin-3 and Claudin-4 exhibit upregulation at both mRNA and protein levels. (thermofisher.com)
  • Induction of claudin-4 by indomethacin was confirmed at both mRNA and protein levels. (aacrjournals.org)
  • Knockdown of claudin-7 by lentivirus claudin-7 shRNA downregulated integrin β1 at both mRNA and protein levels. (aacrjournals.org)
  • Suppression of claudin-7 also upregulated matrix metalloproteinase-3 (MMP-3) at both mRNA and protein levels and downregulated several collagens, such as type V α1, type XV α1, and type XVI α1, at the mRNA level. (aacrjournals.org)
  • Shim, Kim, Jin, Kim, Oh: Claudin 4-targeted nanographene phototherapy using a Clostridium perfringens enterotoxin peptide-photosensitizer conjugate. (antikoerper-online.de)
  • The homology of claudin-4 to Clostridium perfringens enterotoxin (CPE) receptor suggests that this protein may be a potential target for therapeutic intervention and, indeed, preliminary studies in cell lines and xenografts have shown some promise in this regard ( 16 , 17 ). (aacrjournals.org)
  • Claudin-4-targeted therapy using Clostridium perfringens enterotoxin for prostate cancer. (biocare.net)
  • Most cell types express more than two claudin species in various combinations to constitute TJ strands. (biologists.org)
  • It was recently demonstrated that heterogeneous claudin species are copolymerized to form individual TJ strands as heteropolymers and that, between adjacent TJ strands, claudin molecules adhere to each other in both homotypic and heterotypic manners, except in some combinations ( 14 ). (asnjournals.org)
  • Importantly, detailed analyses suggested that variations in the tightness of individual paired TJ strands are determined by the combinations and mixing ratios of claudin species ( 3 , 15 - 17 ). (asnjournals.org)
  • In conclusion, claudin-4, MKK4, and stratifin immunolabeling detects precursor lesions of gastric adenocarcinoma that are otherwise clinically, radiographically, and endoscopically inapparent. (aacrjournals.org)
  • Loss of Claudin-4 was also seen in 69% of advanced gastric cancers and correlated with poor differentiation (5). (biocare.net)
  • Prognostic and clinical significance of claudin-4 in gastric cancer: a meta-analysis. (nih.gov)
  • Triple-negative breast cancer (TNBC) accounts for ∼20% of cases and contributes to basal and claudin-low molecular subclasses of the disease. (nih.gov)
  • Here, we use molecular dynamics simulations to build and refine an atomic model of claudin-15 channels and study its transport properties. (rupress.org)
  • The pivotal role of EMT in hepatocellular carcinoma (HCC) has been increasingly recognized and various molecular mechanisms of hepatocellular EMT have been identified ( 4, 5 ). (aacrjournals.org)
  • With the development of molecular profile, four to six distinct subtypes have been defined within TNBC, such as basal-like and claudin-low [ 5 ]. (portlandpress.com)
  • Together, Dr. Anderson's claudin research has provided significant insight toward our current knowledge regarding the molecular basis of selective paracellular transport and inherited human defects of the junction barrier. (nih.gov)
  • Anti-OAP-1, anti-OSP/claudin-11, and anti-beta1 integrin antibodies inhibited migration of primary oligodendrocytes, and migration was impaired in OSP/claudin-11-deficient primary oligodendrocytes. (sigmaaldrich.com)
  • Distal junction area of ruffle-ended ameloblasts (RA) and the Golgi apparatus of a sub-population of smooth-ended ameloblasts (SA) and RAs stained positive with anti-claudin-1 antibodies. (frontiersin.org)
  • Polyclonal antibodies specific for claudin-7 and -12 were not available. (asnjournals.org)
  • For claudin 4, the percentage of cells staining positively was also significantly reduced (p = 0.04). (diva-portal.org)
  • Claudin-4 controls the proliferation, apoptosis, migration and in vivo growth of MCF-7 breast cancer cells. (nih.gov)
  • Claudin-4 is required for vasculogenic mimicry formation in human breast cancer cells. (nih.gov)
  • In mice, claudin-19 was found in the kidney and Schwan cells of the peripheral nervous system, but was absent from the oligodendrocytes of the central nervous system 4 . (nature.com)
  • Assumptions 3) and 4) are correct, but the dependence of the formation of infected cells on the concentration of uninfected cells (assumption 2) seems to be questionable. (healthweblognews.info)
  • We therefore characterized claudin-3 by stable transfection of MDCK II kidney tubule cells with human claudin-3 cDNA. (nih.gov)
  • Cell lysates from Huh7.5.1 cells were pulled down by GST-claudin-1 tail or GST followed by Western blotting. (asm.org)
  • D and E) Immunoblots showing the association of Sec24C with claudin-1 in transfected HEK293T cells by a coimmunoprecipitation assay. (asm.org)
  • HEK293T cells were transfected with Flag-claudin-1, Flag-SRB1, or PCMV-Tag2 empty vector for 48 h. (asm.org)
  • G) Colocalization of claudin-1 with Sec24C in Huh7.5.1 cells. (asm.org)
  • Huh7.5.1 cells were fixed by PFA and immunofluorescently labeled for claudin-1 (green) and Sec24C (red). (asm.org)
  • C) Cell surface claudin-1 was quantified by FACS assay in nonpermeabilized cells. (asm.org)
  • D) Intercellular claudin-1 was quantified by FACS assay in permeabilized cells. (asm.org)
  • Claudin-4 activity was disrupted by treating cells with a small peptide that mimics the DFYNP sequence in the second extracellular loop of claudin-4. (biomedcentral.com)
  • In fact, claudin-4 is expressed at higher levels in most tumor cells compared to the normal epithelium of origin [ 15 ]. (biomedcentral.com)
  • It is possible that the activity of claudin-4 in tumor cells may, in fact, stem from their function in the normal epithelium from which the tumor arises and this activity is enhanced due to loss of regulation. (biomedcentral.com)
  • We found that claudin-7 knockdown (KD) cells showed disrupted cell-matrix interactions. (aacrjournals.org)
  • Consequently, when claudin-7 KD cells were plated on the uncoated glass surface, they were unable to attach to the glass and died the day after plating. (aacrjournals.org)
  • This cell-matrix defect can be rescued by transfecting claudin-7 or integrin β1 back to the claudin-7 KD cells. (aacrjournals.org)
  • Methods 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was used to determine the 50% inhibitory concentration (IC 50 ) of megestrol acetate (MA) in treating Ishikawa cells. (bmj.com)
  • Because TJs of basal cells are primarily composed of claudin-11, claudin-11-deficient (Cld11 -/- ) mice were generated with an expectation that the compartmentalization in stria vascularis in these mice would be affected. (biologists.org)
  • Cells L cells stably expressing mouse CLDN\1, \3, or \4 (L/mCLDN cells) were kindly provided by Dr. S. Tsukita (Kyoto University, Kyoto, Japan). (pik-293.com)
  • What are the 4 major types of connections between cells? (brainscape.com)
  • These results indicate that claudin-4 is dispensable for the barrier property of TJs in wild-type as well as claudin-2 knockout MDCK II cells. (bireme.br)
  • Claudin-5 and -15 were detected only in endothelial cells. (asnjournals.org)
  • A major difference between HT29 and MDCK I cells, which have low and high basal transepithelial electrical resistance, respectively, was the absence of claudin 2 in the latter. (deepdyve.com)
  • 4. Centrifuge for 5 minutes 300 xg to pellet cells and remove the supernatant.5. (creativebiomart.net)
  • Aliquot 1 mL cells into cryogenic vials.4. (creativebiomart.net)
  • Mice deficient in the secreted protein Norrin or its receptor Frizzled-4 (FZD4) exhibit incomplete vascularization of the neural retina. (arvojournals.org)
  • 1 - 4 Canonical Wnt signaling is initiated by ligand binding to the cysteine-rich domain (CRD) of a Frizzled receptor, in complex with LDL-receptor related protein 5 or 6 (LRP5 or LRP6). (arvojournals.org)
  • 1 - 2 , 4 Recently, the secreted protein Norrin (NDP) signaling, through a receptor complex composed of Frizzled-4 (FZD4), LRP5, and Tetraspanin-12 (TSPAN12), has been shown to direct retinal angiogenesis during development in both mice and humans. (arvojournals.org)
  • Although claudin-3 is present in many epithelia including skin, lung, kidney, and intestine and in endothelia, its function is unresolved as yet. (nih.gov)
  • Claudin-2 is typical of leaky, water-transporting epithelia, such as the kidney proximal tubule, whereas claudin-10b is present in numerous epithelia, including water-impermeable segments of the loop of Henle. (biologists.org)
  • We conclude that claudin-2, but not claudin-10b, forms a paracellular water channel and thus mediates paracellular water transport in leaky epithelia. (biologists.org)
  • Immunogen: Carrier-protein conjugated synthetic peptide encompassing a sequence within the C-terminus region of human claudin 4. (idhinhibitor.com)
  • that claudin-4 can be helpful at least in making a reliable differential diagnosis of spiradenoma when overlapping morphologic features do not allow to further subclassification in the overwhelming variety of the adnexal tumors. (nih.gov)
  • Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer. (nih.gov)
  • Moreover, although mammary specific loss of Trp53 promotes tumors with diverse pathologies, those with spindloid pathology and claudin-low signature display genomic Met amplification. (nih.gov)
  • Female athymic nude mice bearing ZsGreen-PEO4 ovarian tumors showed a significant decrease in ovarian tumor burden, due to increased apoptosis, after treatment with intraperitoneal injections of 4 mg/kg mimic peptide every 48 h for three weeks, compared to control peptide treated mice. (biomedcentral.com)
  • Claudin-4 immunohistochemistry is highly effective in distinguishing adenocarcinoma from malignant mesothelioma in effusion cytology. (biocare.net)
  • Genome-wide DNA methylation identifies trophoblast invasion-related genes: Claudin-4 and Fucosyltransferase IV control mobility via altering matrix metalloproteinase activity. (nih.gov)
  • In mammals, humans have 23 claudin genes, whereas rats and mice have 24 genes ( Lal-Nag and Morin, 2009 ). (frontiersin.org)
  • Diverse regulation of claudin-1 and claudin-4 in atopic dermatitis. (nih.gov)
  • Claudin de Sermisy (c. 1490 - 13 October 1562) was a French composer of the Renaissance. (wikipedia.org)
  • Mechanistically, tyrosine-phosphorylated claudin-11 activates Src, which suppresses RhoA activity at intercellular junctions through p190RhoGAP, maintaining stable cell-cell contacts. (nature.com)
  • Claudin-8 also affects the trafficking of claudin-2, which was displaced specifically from the junctions at which claudin-8 was inserted. (deepdyve.com)
  • 2017. "Convenient Preparation of 18 F-Labeled Peptide Probes for Potential Claudin-4 PET Imaging. (mdpi.com)
  • Hypertension ;70(4):831-838, 2017 Oct. (bireme.br)
  • 2013). CLDN\3 and CLDN\4 are receptors for the C\terminal fragment of enterotoxin (C\CPE) (Fujita et?al. (pik-293.com)
  • Using immunofluorescent microscopy and biochemistry methods, we found that claudin-7 co-localized and co-immunoprecipitated with integrin α2 in Cldn7 +/+ mouse intestines where claudin-7 was highly expressed. (aacrjournals.org)
  • Notably, the anti-VEGF agent and the ROCK inhibitor were synergic in suppressing cytokine upregulation, monocyte/macrophage infiltration, macrophage/microglia activation, and claudin-5 redistribution. (diabetesjournals.org)
  • Claudin 2 upregulation was less pronounced in active Crohn's disease compared with active ulcerative colitis and was inducible by tumour necrosis factor α. (bmj.com)
  • Synthetic peptide corresponding to a 22 amino acid sequence derived from the C-terminal region of human Claudin-4. (thermofisher.com)
  • We examined claudin-4 activity in human ovarian tumor cell lines (SKOV3, OVCAR3, PEO4) using in vitro caspase and scratch assays as well as an in vivo mouse model of ovarian cancer. (biomedcentral.com)
  • Reactivity has been confirmed with rat, human and mouse Claudin-5 using rat lung, mouse kidney, mouse small intestine, mouse lung homogenates, human colon tissue, and CACO-2 human cell line. (thermofisher.com)
  • Synthetic peptide conjugated to KLH, corresponding to a region within internal sequence amino acids 97-126 of Human Claudin 22 (NP_001104789.1). (abcam.com)
  • Infection with a subtype of the human papillomavirus, known as high-risk (HR), is the most common cause of cervical cancer ( 4 ). (spandidos-publications.com)
  • 13050-1-AP targets Claudin 1 in IF, WB, ELISA applications and shows reactivity with human, mouse, dog samples. (ptglab.com)
  • In primary cancers, 123 of 125 (98.4%) were positive for claudin-4, 116 of 126 (94%) for MKK4, and 111 of 120 (92%) for stratifin. (aacrjournals.org)
  • In particular, claudin-3 and claudin-4 are frequently overexpressed in pancreatic cancer. (mdpi.com)
  • Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD? (clinicaltrials.gov)
  • Tyrosine phosphorylation of VE-cadherin and claudin-5 was studied by ICC, immunoprecipitation and Western blotting. (open.ac.uk)
  • ICC revealed that tyrosine phosphorylation of endothelial monolayers was greatly enhanced by TGF-β1 treatment, and immunoprecipitation of cell lysates showed increased tyrosine phosphorylation of VE-cadherin and claudin-5. (open.ac.uk)
  • Your search returned 4 Claudin 7 ELISA ELISA Kit across 1 supplier. (biocompare.com)
  • Claudin-4 functionally contributes to both ovarian tumor cell apoptosis resistance and migration and targeting extracellular loop interactions of claudin-4 may have therapeutic implications for reducing ovarian tumor burden. (biomedcentral.com)
  • Claudin-4 has been shown to distinguish adenocarcinoma from malignant mesothelioma with 99% specificity in malignant effusions (1). (biocare.net)
  • Bartholow TL, Chandran UR , Becich MJ , Parwani AV. Immunohistochemical profiles of claudin-3 in primary and metastatic prostatic adenocarcinoma. (pitt.edu)
  • OSP/claudin-11 forms a complex with a novel member of the tetraspanin super family and beta1 integrin and regulates proliferation and migration of oligodendrocytes. (sigmaaldrich.com)
  • In head and neck cancer patients, the Snail-claudin-11 axis prompts the formation of circulating tumour cell clusters, which correlate with tumour progression. (nature.com)
  • Results suggested that claudin-4, which was regulated by methylation status, plays an important role in breast cancer growth and malignancy via the control of cell proliferation, migration and apoptosis. (nih.gov)
  • The ARPE19 cell line fails to express claudin-19. (nature.com)
  • miR-1303 was significantly overexpressed whereas claudin-18 was downregulated in GC tissues and cell lines, which was significantly associated with tumor size, location invasion, histologic type and tumor-node-metastasis stage. (springer.com)
  • Knocking down Sec24C reduced the cell surface level of claudin-1. (asm.org)
  • Blocking COPII transport by XN decreased the cell surface level of claudin-1. (asm.org)
  • European Journal of Cell Biology , 90(4) pp. 323-332. (open.ac.uk)
  • Methods for using modulating agents to enhance or inhibit claudin-mediated cell adhesion in a variety of in vivo and in vitro contexts are provided. (justia.com)