A cysteine endopeptidase isolated from papaya latex. Preferential cleavage at glutamic and aspartic acid residues. EC 3.4.22.6.
The dissolving of the nucleus pulposus, the semi-gelatinous tissue of a displaced INTERVERTEBRAL DISC. It is usually achieved by the direct injection of a proteolytic enzyme, especially CHYMOPAPAIN, into the herniated disc.
A sulfhydryl proteinase with cysteine at the active site from ficus latex. Preferential cleavage is at tyrosine and phenylalanine residues. EC 3.4.22.3.
Protein-digesting and milk-clotting enzymes found in PINEAPPLE fruit juice and stem tissue. Enzymes from the two sources are distinguished as fruit bromelain and stem bromelain. This enzyme was formerly listed as EC 3.4.22.4.
A proteolytic enzyme obtained from Carica papaya. It is also the name used for a purified mixture of papain and CHYMOPAPAIN that is used as a topical enzymatic debriding agent. EC 3.4.22.2.
A homologous group of endogenous CYSTEINE PROTEINASE INHIBITORS. The cystatins inhibit most CYSTEINE ENDOPEPTIDASES such as PAPAIN, and other peptidases which have a sulfhydryl group at the active site.
A reagent used for the determination of iron.
An INTERVERTEBRAL DISC in which the nucleus pulposus has protruded through surrounding fibrocartilage. This occurs most frequently in the lower lumbar region.

Enrichment of peripheral blood CD34+ cells for transplantation using a fully automated immunomagnetic cell selection system and a novel octapeptide releasing agent. (1/37)

Positive selection of CD34+ cells is being increasingly performed to support hematological reconstitution following high-dose and dose-intensive chemotherapy and to reduce the non-target cell content of transplants. The present study was designed to evaluate the performance of an immunomagnetic cell selection system, including comparison of enzyme and peptide releasing agents and of semi-automated and fully automated selection systems. A total of 74 immunomagnetic CD34+ cell selection procedures were performed involving 55 subjects, the majority of whom had hematologic malignancies. Median CD34+ cell purity with a newly developed specific octapeptide releasing agent (98.5%; 81.0-99.0%) was significantly higher (P = 0.002) than that with chymopapain (85.8%; 28.1-99.7%). No significant differences were observed between semi-automated and fully automated systems in CD34+ cell purity or yield or time to WBC or platelet recovery. Immunomagnetic selection was found to provide highly purified populations of CD34+ cells in sufficient numbers for use in transplantation procedures. CD34+ cell transplants supported rapid and reliable hematologic reconstitution. Use of a fully automated system markedly reduced the time and labor required for immunomagnetic selection, potentially affording more standardized and reproducible positive selection of CD34+ cells.  (+info)

Single-blind randomised controlled trial of chemonucleolysis and manipulation in the treatment of symptomatic lumbar disc herniation. (2/37)

This single-blind randomised clinical trial compared osteopathic manipulative treatment with chemonucleolysis (used as a control of known efficacy) for symptomatic lumbar disc herniation. Forty patients with sciatica due to this diagnosis (confirmed by imaging) were treated either by chemonucleolysis or manipulation. Outcomes (leg pain, back pain and self-reported disability) were measured at 2 weeks, 6 weeks and 12 months. The mean values for all outcomes improved in both groups. By 12 months, there was no statistically significant difference in outcome between the treatments, but manipulation produced a statistically significant greater improvement for back pain and disability in the first few weeks. A similar number from both groups required additional orthopaedic intervention; there were no serious complications. Crude cost analysis suggested an overall financial advantage from manipulation. Because osteopathic manipulation produced a 12-month outcome that was equivalent to chemonucleolysis, it can be considered as an option for the treatment of symptomatic lumbar disc herniation, at least in the absence of clear indications for surgery. Further study into the value of manipulation at a more acute stage is warranted.  (+info)

Intradiscal pressure after intradiscal injection of hypertonic saline: an experimental study. (3/37)

Although chemonucleolysis with chymopapain is a long-established treatment for lumbar intervertebral disc herniation, serious complications have been reported. Accordingly, alternative substances for chemonucleolysis have been sought. The main beneficial effect of chemonucleolysis derives from the decrease in intradiscal pressure. Several previous studies have investigated the relationship between physiological saline injection and disc mechanics in cadaveric specimens [2, 5, 16]. However, no previous study has assessed the intradiscal pressure after intradiscal injection of "hypertonic saline" in living animals. The present study compared the changes in intradiscal pressure after intradiscal injection of hypertonic saline with those after chymopapain injection. The lumbar intervertebral discs of 26 living rabbits were examined: 10% hypertonic saline was injected in ten rabbits, and chymopapain (10 pikokatal units) was injected intradiscally in another ten, with the remaining six being used as controls. The intradiscal pressure was measured at 1, 4, and 12 weeks after injection. The intradiscal pressure of the hypertonic saline-injected group at 4 weeks was significantly lower than that of the control group, but by 12 weeks it had recovered. On the other hand, that of the chymopapain-injected group remained significantly lower than that of the control group at 12 weeks. The results of this study found that hypertonic saline injected into the intervertebral discs temporarily decreased the intradiscal pressure.  (+info)

Chemonucleolysis: the state of the art. (4/37)

This review presents the history of chemonucleolysis, the techniques, indications, contraindications, and complications. Presenting an historical overview and comparison of success rates with surgical discectomy may provide a fresh understanding of the controversy surrounding chemonucleolysis and establish its efficacy in relation to more invasive treatments. A review of the literature from 1973 through 1998 for chemonucleolysis, open discectomy, and microdiscectomy provided published success rates for these procedures, and a mean rate with standard deviation was determined. In the experience and opinion of the authors, chemonucleolysis remains a viable alternative for patients who have exhausted all conservative means of treatment. Proper patient selection leads to success rates comparable to open discectomy and microdiscectomy.  (+info)

Insight to structural subsite recognition in plant thiol protease-inhibitor complexes : understanding the basis of differential inhibition and the role of water. (5/37)

BACKGROUND: This work represents an extensive MD simulation / water-dynamics studies on a series of complexes of inhibitors (leupeptin, E-64, E-64-C, ZPACK) and plant cysteine proteases (actinidin, caricain, chymopapain, calotropin DI) of papain family to understand the various interactions, water binding mode, factors influencing it and the structural basis of differential inhibition. RESULTS: The tertiary structure of the enzyme-inhibitor complexes were built by visual interactive modeling and energy minimization followed by dynamic simulation of 120 ps in water environment. DASA study with and without the inhibitor revealed the potential subsite residues involved in inhibition. Though the interaction involving main chain atoms are similar, critical inspection of the complexes reveal significant differences in the side chain interactions in S2-P2 and S3-P3 pairs due to sequence differences in the equivalent positions of respective subsites leading to differential inhibition. CONCLUSION: The key finding of the study is a conserved site of a water molecule near oxyanion hole of the enzyme active site, which is found in all the modeled complexes and in most crystal structures of papain family either native or complexed. Conserved water molecules at the ligand binding sites of these homologous proteins suggest the structural importance of the water, which changes the conventional definition of chemical geometry of inhibitor binding domain, its shape and complimentarity. The water mediated recognition of inhibitor to enzyme subsites (Pn.H2O.Sn) of leupeptin acetyl oxygen to caricain, chymopapain and calotropinDI is an additional information and offer valuable insight to potent inhibitor design.  (+info)

The effect of bone remodeling inhibition by zoledronic acid in an animal model of cartilage matrix damage. (6/37)

OBJECTIVE: The purpose of this work was to test the effect of inhibition of bone remodeling, through the use of the bisphosphonate, zoledronic acid, on cartilage matrix damage in an animal model of cartilage matrix damage. DESIGN: New Zealand white rabbits were divided into four groups for treatment purposes: (1) untreated controls; (2) injected into one knee joint with the cartilage matrix degradation enzyme, chymopapain; (3) injected into one knee joint with chymopapain and also given subcutaneous injections of the bisphosphonate, zoledronic acid, three times per week until sacrifice at either day 28 or 56 post-chymopapain-injection; (4) received only the zoledronic acid injections. At sacrifice, the knee joints were examined grossly and histologically, and biochemically for proteoglycan content. Urine samples were analysed, at intervals, for levels of collagen cross-links which are biochemical markers of cartilage and bone. RESULTS: Animals receiving both intraarticular chymopapain injections and subcutaneous zoledronic acid injections displayed a significantly lower degree of grossly and histologically detectable cartilage degeneration on the tibial articular surfaces (the articular surface displaying the greatest degree of degeneration) than did animals only receiving the chymopapain injections. In addition, urinary levels of collagen cross-links for bone and cartilage were significantly higher in those animals only receiving chymopapain injections. CONCLUSION: The bone resorption observed after chymopapain injection into the rabbit knee joint can be inhibited through the use of the bisphosphonate, zoledronic acid. Furthermore, zoledronic acid does not increase the level of cartilage degeneration and appears to provide some level of chondroprotection in this model.  (+info)

Effect of oral glucosamine on cartilage and meniscus in normal and chymopapain-injected knees of young rabbits. (7/37)

OBJECTIVE: To determine if oral glucosamine (GlcN) improves joint biology after acute damage by a protease. METHODS: The effect of 8 weeks of dietary GlcN (20 or 100 mg/kg/day) on knee joint cartilage was evaluated in 2.2-kg male NZW rabbits with and without damage introduced by intraarticular injection of chymopapain (CP). Cartilage was evaluated histologically and scored according to the Mankin scale. Analyses of total hydroxyproline and glycosaminoglycan (GAG) contents and reverse transcription-polymerase chain reaction (RT-PCR) analysis of selected genes were performed. RESULTS: After 8 weeks, there was no effect of GlcN on the GAG content of normal cartilage. Both levels of GlcN treatment significantly increased the sulfated GAG content in the cartilage of the medial femoral condyle in damaged and contralateral knees, but did not change the collagen content. In CP-injected knees, there was still some loss of surface proteoglycan (PG) that was not completely corrected by dietary GlcN. Even after 8 weeks, levels of messenger RNA (mRNA) detected by RT-PCR showed changes indicative of damage and repair, such as elevated type II collagen mRNA, and these levels were not influenced by GlcN treatment. Meniscal GAG content was increased in the contralateral knee of rabbits receiving high-dose GlcN, but was decreased in those receiving no GlcN or low-dose GlcN. Neither diet nor treatment affected the meniscal collagen content. CONCLUSION: These results suggest that oral GlcN treatment might be useful in a situation where GlcN is limiting, such as where there is a rapid replacement of cartilage PG.  (+info)

Chemonucleolysis. (8/37)

A prospective study of 480 patients who underwent enzymatic dissolution of the nucleus pulposus with chymopapain is reported. Seventy per cent of patients with the clincial criteria for a disc herniation had a favourable response to chemonucleolysis. The commonest cause of failure was persistent back pain. In patients with sequestered discs or lateral recess stenosis surgical intervention was not made more difficult by chemonucleolysis. Those with a previous operation, spinal stenosis or psychogenic components to the disability had very poor results. Complications were few and easily managed.  (+info)

Chymopapain is a proteolytic enzyme that is derived from the papaya fruit (Carica papaya). It is specifically obtained from the latex of unripe papayas. Chymopapain is used in medical treatments, particularly as an enzyme therapy for disc herniation in the spine, which can cause pain, numbness, or weakness due to pressure on nearby nerves.

The procedure, called chemonucleolysis, involves injecting chymopapain directly into the damaged intervertebral disc. The enzyme breaks down and dissolves part of the proteoglycan matrix in the nucleus pulposus (the inner, gel-like portion of the intervertebral disc), reducing its size and relieving pressure on the affected nerves. This can help alleviate pain and improve function in some patients with herniated discs.

However, the use of chymopapain for disc herniation has declined over time due to the development of other treatment options, such as minimally invasive surgical techniques, and concerns about potential side effects and allergic reactions associated with its use. It is essential to consult a healthcare professional for appropriate evaluation and management of spinal conditions.

I am unable to find a medical definition for "Intervertebral Disc Chemolysis" as it is not a widely recognized or established term in the field of medicine. The term "chemolysis" refers to the breakdown of chemical compounds by chemical means, and "intervertebral disc" refers to the cushion-like structure found between the vertebrae in the spine.

However, I can tell you that there is a medical procedure called "chemonucleolysis," which involves the use of enzymes or chemicals to break down the nucleus pulposus (the inner, gel-like material) of an intervertebral disc in order to reduce the pressure on surrounding nerves and relieve pain.

Therefore, it is possible that "Intervertebral Disc Chemolysis" may refer to a similar process, but I cannot confirm this without further context or information.

Ficain is not typically defined in the context of human medicine, but it is a term used in biochemistry and molecular biology. Ficain is a proteolytic enzyme, also known as ficin, that is isolated from the latex of the fig tree (Ficus species). It has the ability to break down other proteins into smaller peptides or individual amino acids by cleaving specific peptide bonds. Ficain is often used in research and industrial applications, such as protein degradation, digestion studies, and biochemical assays.

Bromelains are a group of enzymes found in pineapple plants, primarily in the stem and fruit. These enzymes have been studied for their potential medicinal properties, including anti-inflammatory, analgesic, and digestive benefits. Bromelains can help break down proteins, which may support digestion and reduce inflammation in the body. They have been used in complementary medicine to treat a variety of conditions, such as osteoarthritis, sinusitis, and post-surgical inflammation. However, more research is needed to fully understand their effectiveness and safety.

Papain is defined as a proteolytic enzyme that is derived from the latex of the papaya tree (Carica papaya). It has the ability to break down other proteins into smaller peptides or individual amino acids. Papain is widely used in various industries, including the food industry for tenderizing meat and brewing beer, as well as in the medical field for its digestive and anti-inflammatory properties.

In medicine, papain is sometimes used topically to help heal burns, wounds, and skin ulcers. It can also be taken orally to treat indigestion, parasitic infections, and other gastrointestinal disorders. However, its use as a medical treatment is not widely accepted and more research is needed to establish its safety and efficacy.

Cystatins are a group of proteins that inhibit cysteine proteases, which are enzymes that break down other proteins. Cystatins are found in various biological fluids and tissues, including tears, saliva, seminal plasma, and urine. They play an important role in regulating protein catabolism and protecting cells from excessive protease activity. There are three main types of cystatins: type 1 (cystatin C), type 2 (cystatin M, cystatin N, and fetuin), and type 3 (kininogens). Abnormal levels of cystatins have been associated with various pathological conditions, such as cancer, neurodegenerative diseases, and inflammatory disorders.

'2,2'-Dipyridyl is an organic compound with the formula (C5H4N)2. It is a bidentate chelating ligand, which means that it can form stable coordination complexes with many metal ions by donating both of its nitrogen atoms to the metal. This ability to form complexes makes '2,2'-Dipyridyl useful in various applications, including as a catalyst in chemical reactions and as a reagent in the analysis of metal ions.

The compound is a solid at room temperature and has a molecular weight of 108.13 g/mol. It is soluble in organic solvents such as ethanol, acetone, and dichloromethane, but is insoluble in water. '2,2'-Dipyridyl is synthesized by the reaction of pyridine with formaldehyde and hydrochloric acid.

In medical contexts, '2,2'-Dipyridyl may be used as a reagent in diagnostic tests to detect the presence of certain metal ions in biological samples. However, it is not itself a drug or therapeutic agent.

Intervertebral disc displacement, also known as a slipped disc or herniated disc, is a medical condition where the inner, softer material (nucleus pulposus) of the intervertebral disc bulges or ruptures through its outer, tougher ring (annulus fibrosus). This can put pressure on nearby nerves and cause pain, numbness, tingling, or weakness in the affected area, often in the lower back or neck. The displacement may also lead to inflammation and irritation of the surrounding spinal structures, further exacerbating the symptoms. The condition is typically caused by age-related wear and tear (degenerative disc disease) or sudden trauma.

... (EC 3.4.22.6, chymopapain A, chymopapain B, chymopapain S, brand name Chymodiactin) is a proteolytic enzyme ... Studying A280 chymopapain is found in the fraction of 750-1000 ml. Once chymopapain has been isolated, it can be crystallized ... Chymopapain's structure was solved by X-ray diffraction techniques. Analysis of this structure showed chymopapain to have 7 ... Chymopapain presents a quaternary structure characterized by the formation of homo dimers, which means that two chymopapain ...
... may refer to one of two enzymes: Chymopapain Caricain This disambiguation page lists articles associated with the ... title Chymopapain S. If an internal link led you here, you may wish to change the link to point directly to the intended ...
29 were also cleaved by chymopapain. An earlier study had highlighted the similarity in specificity of caricain, chymopapain ... Caricain and chymopapain appeared to prefer an aliphatic to a hydrophobic residue at P2. The similarity in specificity of ... Proteolytic specificities of chymopa- pain and papaya Ω proteinase determined by digestion of α-globin chains. Biol. Chem. ... The protein is 216 amino acids in length, and is 68% identical in sequence to papain, 65% to chymopapain and 81% to glycyl ...
Polgár L (April 1981). "Isolation of highly active papaya peptidases A and B from commercial chymopapain". Biochimica et ... Glycyl endopeptidase (EC 3.4.22.25, papaya peptidase B, papaya proteinase IV, glycine-specific proteinase, chymopapain, Papaya ... proteinase 4, PPIV, chymopapain M) is an enzyme. This enzyme catalyses the following chemical reaction Preferential cleavage: ...
The procedure was first reported by Lyman W. Smith in 1964, and used chymopapain. Discolysis using chymopapain is no longer ...
"Transforaminal Posterolateral Endoscopic Discectomy With or Without the Combination of a Low-Dose Chymopapain: A Prospective ...
Patients with allergies to papain, chymopapain, other papaya extracts or the pineapple enzyme bromelain may also be at risk for ...
Chronovera Chronulac Chymex Chymodiactin chymopapain (INN) chymotrypsin (INN) (Articles with short description, Short ...
... and chymopapain. Cysteine endopeptidases with similar properties known generically as ficins are present in other members of ...
... chymopapain MeSH D08.811.277.656.300.215.350 - ficain MeSH D08.811.277.656.300.215.585 - papain MeSH D08.811.277.656.300.480 - ...
M09AA01 Hydroquinine M09AA72 Quinine, combinations with psycholeptics M09AB01 Chymopapain M09AB02 Collagenase clostridium ...
... chymopapain EC 3.4.4.12: Now EC 3.4.22.3, ficain EC 3.4.4.13: Now EC 3.4.21.5, thrombin EC 3.4.4.14: Now EC 3.4.21.7, plasmin ... chymopapain EC 3.4.22.7: asclepain EC 3.4.22.8: clostripain EC 3.4.22.9: Now EC 3.4.21.48, cerevisin EC 3.4.22.10: streptopain ...
Chymopapain (EC 3.4.22.6, chymopapain A, chymopapain B, chymopapain S, brand name Chymodiactin) is a proteolytic enzyme ... Studying A280 chymopapain is found in the fraction of 750-1000 ml. Once chymopapain has been isolated, it can be crystallized ... Chymopapains structure was solved by X-ray diffraction techniques. Analysis of this structure showed chymopapain to have 7 ... Chymopapain presents a quaternary structure characterized by the formation of homo dimers, which means that two chymopapain ...
... contained disc herniations at the L4-5 and L5-S1 levels will be randomized to injection of 1000 or 2000 pKat of Chymopapain. ...
Injection of chymopapain For excellent patient education resources, see eMedicineHealths patient education article Low Back ...
Chymopapain and semipurified collagenase had similar morphologic and mechanical effects. The temporary increases in flexibility ... The largest increase was noted in flexion in discs injected with chymopapain. By 3 months, all lateral bending flexibilities ... or chymopapain. Controls consisted of saline-injected and uninjected discs. The bending and torsional properties of each disc ...
Papayas. This tropical fruit contains the enzymes papain and chymopapain, which reduce indigestion and upset stomach. ... Papayas. This tropical fruit contains the enzymes papain and chymopapain, which reduce indigestion and upset stomach. ...
Chemonucleolysis, using intradiskal injection of chymopapain, is no longer used.. Predictors of poor surgical outcome include ...
CHYMOPAPAIN 51215 CHYMOTRYPSIN 51218 CICLOPIROX 51219 CILASTATIN 51220 CIMETIDINE 51223 CINNAMEDRINE 51225 CINNAMON OIL 51227 ...
Inmans may be her lioresal kaposvár Aryanise isohemagglutination round others militant chymopapain. Vasoxyl, belonging https ...
Chymopapain - Preferred Concept UI. M0004458. Scope note. A cysteine endopeptidase isolated from papaya latex. Preferential ...
Papain and chymopapain in papaya lend it its antibacterial properties.. IMPORTANT: You can now Click "HERE" to receive More ...
The chymopapain and papain extracts of the leaves are useful in the treatment of several digestive disorders. The leaf extracts ...
They also contain enzymes like papain and chymopapain that can aid in protein digestion and reduce inflammation in the body. ...
XX AC ; XX DT 29-NOV-2004 DT 11-MAY-2016 XX DE Qualitative PCR method for detection of papaya chymopapain gene (Wei et al., ... chymopapain gene FT primer_bind 1..22 FT /standard_name=Primer forward: Chy-1F FT /note=ATCTACAATCTTGCTAACCCTA FT /target ...
Cysteine proteinase found in many tissues. Hydrolyzes a variety of endogenous proteins including NEUROPEPTIDES; CYTOSKELETAL PROTEINS; proteins from SMOOTH MUSCLE; CARDIAC MUSCLE; liver; platelets; and erythrocytes. Two subclasses having high and low calcium sensitivity are known. Removes Z-discs and M-lines from myofibrils. Activates phosphorylase kinase and cyclic nucleotide-independent protein kinase. This enzyme was formerly listed as EC 3.4.22.4 ...
The enzymes papain and chymopapain in papaya can decrease inflammation. The protein-dissolving papain can be found in many ...
... the barrack an ambilateralities hurled chymopapain. Stichomythic baptize effervescingly all of several , switch off with regard ...
The use of contrast material is kept to a minimum, and the chymopapain must be refrigerated until the time of use. The dose is ... Chemonucleolysis with chymopapain or collagenase. The posterolateral extradural approach with a two-plane image intensifier ... This procedure is safer than chymopapain intradiskal injection. It allows debulking of the central disk material by placement ... Because of complications and effectiveness problems, chymopapain injection is rarely performed in current practice. ...
Chymopapain and semipurified collagenase had similar morphologic and mechanical effects. The temporary increases in flexibility ... The largest increase was noted in flexion in discs injected with chymopapain. By 3 months, all lateral bending flexibilities ... or chymopapain. Controls consisted of saline-injected and uninjected discs. The bending and torsional properties of each disc ...
It appears to be a well-tolerated alternative to surgical diskectomy and chymopapain nucleolysis. ...
Removal of nucleus pulposus from the intervertebral disc - the use of chymopapain enhances mechanical removal with rongeurs: a ...
9. [Construction and identification of anti-chymopapain scFv phage display library].. Wang JP; Zhao SJ; Wang J; Wu J; Yang TC; ...
Patients allergic to papain, chymopapain, other papaya extracts, or the pineapple enzyme bromelain may also have an allergic ... Patients allergic to papain, chymopapain, papaya extracts, or bromelain (pineapple enzyme), may react to CROFAB (5.2) ...
Chymopapain,N0000006975, mangafodipir trisodium,N0000006974, Indocyanine Green,N0000006973, ferrous oxide,N0000006972, ...
Brain Activation in a Cynomolgus Macaque Model of Chymopapain-Induced Discogenic Low Back Pain: A Preliminary Study. Ushirozako ...
Chemonucleolysis, using intradiskal injection of chymopapain, is no longer used.. Predictors of poor surgical outcome include ...
... fruit contains the proteolytic enzymes papain and chymopapain before ripening, but they are not present in the ripe fruit. ... Papaya (Carica papaya) fruit contains the proteolytic enzymes papain and chymopapain before ripening, but they are not present ...
Chymopapain (substance). Code System Preferred Concept Name. Chymopapain (substance). Concept Status. Published. ...
Chymopapain A Chymopapain B Discase Registry Number. EC 3.4.22.6. Related Numbers. 9001-09-6. CAS Type 1 Name. Chymopapain. ... Chymopapain B Narrower Concept UI. M0004460. Registry Number. 0. Terms. Chymopapain B Preferred Term Term UI T008447. Date10/02 ... Chymopapain A Narrower Concept UI. M0004459. Registry Number. 0. Terms. Chymopapain A Preferred Term Term UI T008446. Date10/07 ... Chymopapain Preferred Concept UI. M0004458. Registry Number. EC 3.4.22.6. Related Numbers. 9001-09-6. Scope Note. A cysteine ...
Chymopapain A Chymopapain B Discase Registry Number. EC 3.4.22.6. Related Numbers. 9001-09-6. CAS Type 1 Name. Chymopapain. ... Chymopapain B Narrower Concept UI. M0004460. Registry Number. 0. Terms. Chymopapain B Preferred Term Term UI T008447. Date10/02 ... Chymopapain A Narrower Concept UI. M0004459. Registry Number. 0. Terms. Chymopapain A Preferred Term Term UI T008446. Date10/07 ... Chymopapain Preferred Concept UI. M0004458. Registry Number. EC 3.4.22.6. Related Numbers. 9001-09-6. Scope Note. A cysteine ...
... chymopapain, E0300972,Ketanest,ketamine, E0300976,Eureceptor,cimetidine, E0300977,Histodil,cimetidine, E0300978,Cincain, ...
Kandungan enzim papain dan chymopapain dalam pepaya muda memiliki peran untuk menjaga kesehatan saluran pencernaan dengan ... Selain vitamin dan mineral, pepaya muda juga memiliki kandungan enzim papain, fitonutrien, dan chymopapain. ...
Buy generic labetalol uk Chymopapain consider counteract improvisatorially against introvert according to the pulls against ... Chymopapain consider www.tcgroup.sk counteract improvisatorially willowgrove-dental.ca against introvert according to the ...
The procedure involves the targeted injection of enzymes, typically chymopapain, directly into the herniated or bulging disc. ...
Patients allergic to papain, chymopapain, other papaya extracts, or the pineapple enzyme bromelain may also have an allergic ... Patients allergic to papain, chymopapain, papaya extracts, or bromelain (pineapple enzyme), may react to CROFAB (5.2) ...
ITC measurements revealed that ANS molecules bound to chymopapain via hydrophobic interaction were more at pH 1.5 than at pH ... We conclude that maximum ANS-fluorescence alone may not be the criteria for determining the MG of chymopapain. Hence a ... 1-Anilino-8-naphthalene sulfonate (ANS) is not a desirable probe for determining the molten globule state of chymopapain. ... In this work, we explored the acid-induced unfolding pathway of chymopapain, a cysteine proteases from Carica papaya, by ...
HYDROLASES CHYMOPAPAIN HYDROLASES CHYMOSIN HYDROLASES CHYMOTRYPSIN HYDROLASES COLLAGENASES HYDROLASES COMPLEMENT 1R HYDROLASES ...
... x CHYMOPAPAIN x CHYMOSIN x CHYMOTRYPSINS x CONJUGASE x DEHYDROPEPTIDASE x DEPEPTIDASES x DERMOPEPTTDASE x DIPEPTIDASES x ... CHYMOPAPAIN see PROTEASES CHYMOSIN see PROTEASES CHYMOTRYPSINOGEN see ENZYME PRECURSORS CHYMOTRYPSINS see PROTEASES CICATRIX x ...
Chronic Brain Damages Chymopapain A,Chymopapain A Chymopapain B,Chymopapain B Chymosin A,Chymosin A Chymosin C,Chymosin C ...
Chronic Brain Damages Chymopapain A,Chymopapain A Chymopapain B,Chymopapain B Chymosin A,Chymosin A Chymosin C,Chymosin C ...
  • This tropical fruit contains the enzymes papain and chymopapain, which reduce indigestion and upset stomach. (stack.com)
  • Papain and chymopapain in papaya lend it its antibacterial properties. (worldfamilydigest.com)
  • The enzymes papain and chymopapain in papaya can decrease inflammation. (wecareyours.com)
  • Chymopapain (EC 3.4.22.6, chymopapain A, chymopapain B, chymopapain S, brand name Chymodiactin) is a proteolytic enzyme isolated from the latex of papaya (Carica papaya). (wikipedia.org)
  • Cisteína endopeptidasa que se encuentra en el látex de la papaya. (bvsalud.org)
  • XX DT 29-NOV-2004 DT 11-MAY-2016 XX DE Qualitative PCR method for detection of papaya chymopapain gene (Wei et al. (europa.eu)
  • 282 FT /standard_name='PCR 282 bp amplicon' FT /note='taxon-specific PCR for papaya' FT /target='chymopapain gene' FT primer_bind 1. (europa.eu)
  • As well as all the other enzymes in the PLCPs group, chymopapain is a cysteine protease. (wikipedia.org)
  • Patients with contained disc herniations at the L4-5 and L5-S1 levels will be randomized to injection of 1000 or 2000 pKat of Chymopapain. (spinesurgeons.ac.uk)
  • Chymopapain and semipurified collagenase had similar morphologic and mechanical effects. (cdc.gov)
  • Chymopapain is no longer used as a standard method to treat chronic low back pain because of its potential side effects. (wikipedia.org)
  • Removal of nucleus pulposus from the intervertebral disc - the use of chymopapain enhances mechanical removal with rongeurs: a laboratory study. (medscape.com)
  • Chymopapain and semipurified collagenase had similar morphologic and mechanical effects. (cdc.gov)
  • The procedure involves the targeted injection of enzymes, typically chymopapain, directly into the herniated or bulging disc. (drkieranslevin.com)