Chromosomes: In a prokaryotic cell or in the nucleus of a eukaryotic cell, a structure consisting of or containing DNA which carries the genetic information essential to the cell. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Chromosome Banding: Staining of bands, or chromosome segments, allowing the precise identification of individual chromosomes or parts of chromosomes. Applications include the determination of chromosome rearrangements in malformation syndromes and cancer, the chemistry of chromosome segments, chromosome changes during evolution, and, in conjunction with cell hybridization studies, chromosome mapping.X Chromosome: The female sex chromosome, being the differential sex chromosome carried by half the male gametes and all female gametes in human and other male-heterogametic species.Chromosome Aberrations: Abnormal number or structure of chromosomes. Chromosome aberrations may result in CHROMOSOME DISORDERS.Sex Chromosomes: The homologous chromosomes that are dissimilar in the heterogametic sex. There are the X CHROMOSOME, the Y CHROMOSOME, and the W, Z chromosomes (in animals in which the female is the heterogametic sex (the silkworm moth Bombyx mori, for example)). In such cases the W chromosome is the female-determining and the male is ZZ. (From King & Stansfield, A Dictionary of Genetics, 4th ed)Chromosomes, Human, Pair 1: A specific pair of human chromosomes in group A (CHROMOSOMES, HUMAN, 1-3) of the human chromosome classification.Chromosomes, Human: Very long DNA molecules and associated proteins, HISTONES, and non-histone chromosomal proteins (CHROMOSOMAL PROTEINS, NON-HISTONE). Normally 46 chromosomes, including two sex chromosomes are found in the nucleus of human cells. They carry the hereditary information of the individual.Chromosomes, Bacterial: Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.Chromosome Segregation: The orderly segregation of CHROMOSOMES during MEIOSIS or MITOSIS.Chromosomes, Human, Pair 7: A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Pair 11: A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Pair 17: A specific pair of GROUP E CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Pair 6: A specific pair GROUP C CHROMSOMES of the human chromosome classification.Chromosome Deletion: Actual loss of portion of a chromosome.Chromosomes, Human, Pair 9: A specific pair of GROUP C CHROMSOMES of the human chromosome classification.Chromosomes, Human, Pair 21: A specific pair of GROUP G CHROMOSOMES of the human chromosome classification.Chromosomes, Plant: Complex nucleoprotein structures which contain the genomic DNA and are part of the CELL NUCLEUS of PLANTS.Chromosomes, Fungal: Structures within the nucleus of fungal cells consisting of or containing DNA, which carry genetic information essential to the cell.Chromosomes, Human, 6-12 and X: The medium-sized, submetacentric human chromosomes, called group C in the human chromosome classification. This group consists of chromosome pairs 6, 7, 8, 9, 10, 11, and 12 and the X chromosome.Chromosomes, Human, Pair 16: A specific pair of GROUP E CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Pair 22: A specific pair of GROUP G CHROMOSOMES of the human chromosome classification.Chromosome Pairing: The alignment of CHROMOSOMES at homologous sequences.Chromosomes, Human, Pair 13: A specific pair of GROUP D CHROMOSOMES of the human chromosome classification.Chromosomes, Mammalian: Complex nucleoprotein structures which contain the genomic DNA and are part of the CELL NUCLEUS of MAMMALS.Chromosomes, Human, Pair 4: A specific pair of GROUP B CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Pair 10: A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Pair 19: A specific pair of GROUP F CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Pair 8: A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Y: The human male sex chromosome, being the differential sex chromosome carried by half the male gametes and none of the female gametes in humans.Chromosome Disorders: Clinical conditions caused by an abnormal chromosome constitution in which there is extra or missing chromosome material (either a whole chromosome or a chromosome segment). (from Thompson et al., Genetics in Medicine, 5th ed, p429)Chromosomes, Artificial, Bacterial: DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.Chromosomes, Human, Pair 12: A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Pair 5: One of the two pairs of human chromosomes in the group B class (CHROMOSOMES, HUMAN, 4-5).Chromosomes, Human, X: The human female sex chromosome, being the differential sex chromosome carried by half the male gametes and all female gametes in humans.Chromosome Painting: A technique for visualizing CHROMOSOME ABERRATIONS using fluorescently labeled DNA probes which are hybridized to chromosomal DNA. Multiple fluorochromes may be attached to the probes. Upon hybridization, this produces a multicolored, or painted, effect with a unique color at each site of hybridization. This technique may also be used to identify cross-species homology by labeling probes from one species for hybridization with chromosomes from another species.Chromosomes, Human, 1-3: The large, metacentric human chromosomes, called group A in the human chromosome classification. This group consists of chromosome pairs 1, 2, and 3.Chromosomes, Human, Pair 15: A specific pair of GROUP D CHROMOSOMES of the human chromosome classification.Karyotyping: Mapping of the KARYOTYPE of a cell.Chromosomes, Human, Pair 18: A specific pair of GROUP E CHROMOSOMES of the human chromosome classification.Chromosomes, Human, Pair 20: A specific pair of GROUP F CHROMOSOMES of the human chromosome classification.In Situ Hybridization, Fluorescence: A type of IN SITU HYBRIDIZATION in which target sequences are stained with fluorescent dye so their location and size can be determined using fluorescence microscopy. This staining is sufficiently distinct that the hybridization signal can be seen both in metaphase spreads and in interphase nuclei.Chromosomes, Human, 16-18: The short, submetacentric human chromosomes, called group E in the human chromosome classification. This group consists of chromosome pairs 16, 17, and 18.Chromosomes, Artificial, Yeast: Chromosomes in which fragments of exogenous DNA ranging in length up to several hundred kilobase pairs have been cloned into yeast through ligation to vector sequences. These artificial chromosomes are used extensively in molecular biology for the construction of comprehensive genomic libraries of higher organisms.Genetic Linkage: The co-inheritance of two or more non-allelic GENES due to their being located more or less closely on the same CHROMOSOME.Chromosomes, Human, 13-15: The medium-sized, acrocentric human chromosomes, called group D in the human chromosome classification. This group consists of chromosome pairs 13, 14, and 15.Chromosome Breakage: A type of chromosomal aberration involving DNA BREAKS. Chromosome breakage can result in CHROMOSOMAL TRANSLOCATION; CHROMOSOME INVERSION; or SEQUENCE DELETION.Chromosomes, Human, 21-22 and Y: The short, acrocentric human chromosomes, called group G in the human chromosome classification. This group consists of chromosome pairs 21 and 22 and the Y chromosome.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Ring Chromosomes: Aberrant chromosomes with no ends, i.e., circular.Genetic Markers: A phenotypically recognizable genetic trait which can be used to identify a genetic locus, a linkage group, or a recombination event.Chromosome Inversion: An aberration in which a chromosomal segment is deleted and reinserted in the same place but turned 180 degrees from its original orientation, so that the gene sequence for the segment is reversed with respect to that of the rest of the chromosome.Chromosome Positioning: The mechanisms of eukaryotic CELLS that place or keep the CHROMOSOMES in a particular SUBNUCLEAR SPACE.Chromosomes, Human, 4-5: The large, submetacentric human chromosomes, called group B in the human chromosome classification. This group consists of chromosome pairs 4 and 5.X Chromosome Inactivation: A dosage compensation process occurring at an early embryonic stage in mammalian development whereby, at random, one X CHROMOSOME of the pair is repressed in the somatic cells of females.Centromere: The clear constricted portion of the chromosome at which the chromatids are joined and by which the chromosome is attached to the spindle during cell division.Meiosis: A type of CELL NUCLEUS division, occurring during maturation of the GERM CELLS. Two successive cell nucleus divisions following a single chromosome duplication (S PHASE) result in daughter cells with half the number of CHROMOSOMES as the parent cells.Chromosomes, Insect: Structures within the CELL NUCLEUS of insect cells containing DNA.Translocation, Genetic: A type of chromosome aberration characterized by CHROMOSOME BREAKAGE and transfer of the broken-off portion to another location, often to a different chromosome.Hybrid Cells: Any cell, other than a ZYGOTE, that contains elements (such as NUCLEI and CYTOPLASM) from two or more different cells, usually produced by artificial CELL FUSION.Chromosome Structures: Structures which are contained in or part of CHROMOSOMES.Chromosomes, Human, 19-20: The short, metacentric human chromosomes, called group F in the human chromosome classification. This group consists of chromosome pairs 19 and 20.Aneuploidy: The chromosomal constitution of cells which deviate from the normal by the addition or subtraction of CHROMOSOMES, chromosome pairs, or chromosome fragments. In a normally diploid cell (DIPLOIDY) the loss of a chromosome pair is termed nullisomy (symbol: 2N-2), the loss of a single chromosome is MONOSOMY (symbol: 2N-1), the addition of a chromosome pair is tetrasomy (symbol: 2N+2), the addition of a single chromosome is TRISOMY (symbol: 2N+1).Metaphase: The phase of cell nucleus division following PROMETAPHASE, in which the CHROMOSOMES line up across the equatorial plane of the SPINDLE APPARATUS prior to separation.Mitosis: A type of CELL NUCLEUS division by means of which the two daughter nuclei normally receive identical complements of the number of CHROMOSOMES of the somatic cells of the species.Recombination, Genetic: Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Microsatellite Repeats: A variety of simple repeat sequences that are distributed throughout the GENOME. They are characterized by a short repeat unit of 2-8 basepairs that is repeated up to 100 times. They are also known as short tandem repeats (STRs).Lod Score: The total relative probability, expressed on a logarithmic scale, that a linkage relationship exists among selected loci. Lod is an acronym for "logarithmic odds."Pedigree: The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.Crosses, Genetic: Deliberate breeding of two different individuals that results in offspring that carry part of the genetic material of each parent. The parent organisms must be genetically compatible and may be from different varieties or closely related species.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)Models, Genetic: Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.Trisomy: The possession of a third chromosome of any one type in an otherwise diploid cell.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Nondisjunction, Genetic: The failure of homologous CHROMOSOMES or CHROMATIDS to segregate during MITOSIS or MEIOSIS with the result that one daughter cell has both of a pair of parental chromosomes or chromatids and the other has none.Kinetochores: Large multiprotein complexes that bind the centromeres of the chromosomes to the microtubules of the mitotic spindle during metaphase in the cell cycle.Chromosomes, Artificial, Human: DNA constructs that are composed of, at least, all elements, such as a REPLICATION ORIGIN; TELOMERE; and CENTROMERE, required for successful replication, propagation to and maintainance in progeny human cells. In addition, they are constructed to carry other sequences for analysis or gene transfer.Telomere: A terminal section of a chromosome which has a specialized structure and which is involved in chromosomal replication and stability. Its length is believed to be a few hundred base pairs.Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Chromosome Walking: A technique with which an unknown region of a chromosome can be explored. It is generally used to isolate a locus of interest for which no probe is available but that is known to be linked to a gene which has been identified and cloned. A fragment containing a known gene is selected and used as a probe to identify other overlapping fragments which contain the same gene. The nucleotide sequences of these fragments can then be characterized. This process continues for the length of the chromosome.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Chromosomal Proteins, Non-Histone: Nucleoproteins, which in contrast to HISTONES, are acid insoluble. They are involved in chromosomal functions; e.g. they bind selectively to DNA, stimulate transcription resulting in tissue-specific RNA synthesis and undergo specific changes in response to various hormones or phytomitogens.Haplotypes: The genetic constitution of individuals with respect to one member of a pair of allelic genes, or sets of genes that are closely linked and tend to be inherited together such as those of the MAJOR HISTOCOMPATIBILITY COMPLEX.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).Spindle Apparatus: A microtubule structure that forms during CELL DIVISION. It consists of two SPINDLE POLES, and sets of MICROTUBULES that may include the astral microtubules, the polar microtubules, and the kinetochore microtubules.Quantitative Trait Loci: Genetic loci associated with a QUANTITATIVE TRAIT.Chromosomal Instability: An increased tendency to acquire CHROMOSOME ABERRATIONS when various processes involved in chromosome replication, repair, or segregation are dysfunctional.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Chromosome Fragility: Susceptibility of chromosomes to breakage leading to translocation; CHROMOSOME INVERSION; SEQUENCE DELETION; or other CHROMOSOME BREAKAGE related aberrations.DNA Probes: Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.Chromosome Duplication: An aberration in which an extra chromosome or a chromosomal segment is made.DNA, Satellite: Highly repetitive DNA sequences found in HETEROCHROMATIN, mainly near centromeres. They are composed of simple sequences (very short) (see MINISATELLITE REPEATS) repeated in tandem many times to form large blocks of sequence. Additionally, following the accumulation of mutations, these blocks of repeats have been repeated in tandem themselves. The degree of repetition is on the order of 1000 to 10 million at each locus. Loci are few, usually one or two per chromosome. They were called satellites since in density gradients, they often sediment as distinct, satellite bands separate from the bulk of genomic DNA owing to a distinct BASE COMPOSITION.Drosophila melanogaster: A species of fruit fly much used in genetics because of the large size of its chromosomes.Diploidy: The chromosomal constitution of cells, in which each type of CHROMOSOME is represented twice. Symbol: 2N or 2X.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Heterozygote: An individual having different alleles at one or more loci regarding a specific character.Chromatids: Either of the two longitudinally adjacent threads formed when a eukaryotic chromosome replicates prior to mitosis. The chromatids are held together at the centromere. Sister chromatids are derived from the same chromosome. (Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Multigene Family: A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)Genetic Variation: Genotypic differences observed among individuals in a population.Mosaicism: The occurrence in an individual of two or more cell populations of different chromosomal constitutions, derived from a single ZYGOTE, as opposed to CHIMERISM in which the different cell populations are derived from more than one zygote.DNA Replication: The process by which a DNA molecule is duplicated.Polyploidy: The chromosomal constitution of a cell containing multiples of the normal number of CHROMOSOMES; includes triploidy (symbol: 3N), tetraploidy (symbol: 4N), etc.Abnormalities, MultipleDNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Gene Deletion: A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.Polymorphism, Genetic: The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Polytene Chromosomes: Extra large CHROMOSOMES, each consisting of many identical copies of a chromosome lying next to each other in parallel.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.Gene Dosage: The number of copies of a given gene present in the cell of an organism. An increase in gene dosage (by GENE DUPLICATION for example) can result in higher levels of gene product formation. GENE DOSAGE COMPENSATION mechanisms result in adjustments to the level GENE EXPRESSION when there are changes or differences in gene dosage.Prophase: The first phase of cell nucleus division, in which the CHROMOSOMES become visible, the CELL NUCLEUS starts to lose its identity, the SPINDLE APPARATUS appears, and the CENTRIOLES migrate toward opposite poles.Interphase: The interval between two successive CELL DIVISIONS during which the CHROMOSOMES are not individually distinguishable. It is composed of the G phases (G1 PHASE; G0 PHASE; G2 PHASE) and S PHASE (when DNA replication occurs).Cell Cycle Proteins: Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Loss of Heterozygosity: The loss of one allele at a specific locus, caused by a deletion mutation; or loss of a chromosome from a chromosome pair, resulting in abnormal HEMIZYGOSITY. It is detected when heterozygous markers for a locus appear monomorphic because one of the ALLELES was deleted.Karyotype: The full set of CHROMOSOMES presented as a systematized array of METAPHASE chromosomes from a photomicrograph of a single CELL NUCLEUS arranged in pairs in descending order of size and according to the position of the CENTROMERE. (From Stedman, 25th ed)Cosmids: Plasmids containing at least one cos (cohesive-end site) of PHAGE LAMBDA. They are used as cloning vehicles.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Cytogenetic Analysis: Examination of CHROMOSOMES to diagnose, classify, screen for, or manage genetic diseases and abnormalities. Following preparation of the sample, KARYOTYPING is performed and/or the specific chromosomes are analyzed.Chromatin: The material of CHROMOSOMES. It is a complex of DNA; HISTONES; and nonhistone proteins (CHROMOSOMAL PROTEINS, NON-HISTONE) found within the nucleus of a cell.Cytogenetics: A subdiscipline of genetics which deals with the cytological and molecular analysis of the CHROMOSOMES, and location of the GENES on chromosomes, and the movements of chromosomes during the CELL CYCLE.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Genome, Human: The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.Gene Rearrangement: The ordered rearrangement of gene regions by DNA recombination such as that which occurs normally during development.Polymorphism, Restriction Fragment Length: Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.Cell Line: Established cell cultures that have the potential to propagate indefinitely.DNA Transposable Elements: Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Polymorphism, Single Nucleotide: A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.Chromosome Fragile Sites: Specific loci that show up during KARYOTYPING as a gap (an uncondensed stretch in closer views) on a CHROMATID arm after culturing cells under specific conditions. These sites are associated with an increase in CHROMOSOME FRAGILITY. They are classified as common or rare, and by the specific culture conditions under which they develop. Fragile site loci are named by the letters "FRA" followed by a designation for the specific chromosome, and a letter which refers to which fragile site of that chromosome (e.g. FRAXA refers to fragile site A on the X chromosome. It is a rare, folic acid-sensitive fragile site associated with FRAGILE X SYNDROME.)Genetic Predisposition to Disease: A latent susceptibility to disease at the genetic level, which may be activated under certain conditions.Sequence Tagged Sites: Short tracts of DNA sequence that are used as landmarks in GENOME mapping. In most instances, 200 to 500 base pairs of sequence define a Sequence Tagged Site (STS) that is operationally unique in the human genome (i.e., can be specifically detected by the polymerase chain reaction in the presence of all other genomic sequences). The overwhelming advantage of STSs over mapping landmarks defined in other ways is that the means of testing for the presence of a particular STS can be completely described as information in a database.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Spermatocytes: Male germ cells derived from SPERMATOGONIA. The euploid primary spermatocytes undergo MEIOSIS and give rise to the haploid secondary spermatocytes which in turn give rise to SPERMATIDS.Societies, Scientific: Societies whose membership is limited to scientists.Genes, X-Linked: Genes that are located on the X CHROMOSOME.Sex Chromosome Disorders: Clinical conditions caused by an abnormal sex chromosome constitution (SEX CHROMOSOME ABERRATIONS), in which there is extra or missing sex chromosome material (either a whole chromosome or a chromosome segment).Nutritive Value: An indication of the contribution of a food to the nutrient content of the diet. This value depends on the quantity of a food which is digested and absorbed and the amounts of the essential nutrients (protein, fat, carbohydrate, minerals, vitamins) which it contains. This value can be affected by soil and growing conditions, handling and storage, and processing.Genome: The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Cell Nucleus: Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Genes, Recessive: Genes that influence the PHENOTYPE only in the homozygous state.Genes, Bacterial: The functional hereditary units of BACTERIA.Fuel Oils: Complex petroleum hydrocarbons consisting mainly of residues from crude oil distillation. These liquid products include heating oils, stove oils, and furnace oils and are burned to generate energy.Contig Mapping: Overlapping of cloned or sequenced DNA to construct a continuous region of a gene, chromosome or genome.DNA Restriction Enzymes: Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.Homozygote: An individual in which both alleles at a given locus are identical.Philadelphia Chromosome: An aberrant form of human CHROMOSOME 22 characterized by translocation of the distal end of chromosome 9 from 9q34, to the long arm of chromosome 22 at 22q11. It is present in the bone marrow cells of 80 to 90 per cent of patients with chronic myelocytic leukemia (LEUKEMIA, MYELOGENOUS, CHRONIC, BCR-ABL POSITIVE).Chromosome Breakpoints: The locations in specific DNA sequences where CHROMOSOME BREAKS have occurred.Gene Duplication: Processes occurring in various organisms by which new genes are copied. Gene duplication may result in a MULTIGENE FAMILY; supergenes or PSEUDOGENES.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.Chromosomes, Archaeal: Structures within the nucleus of archaeal cells consisting of or containing DNA, which carry genetic information essential to the cell.Haploidy: The chromosomal constitution of cells, in which each type of CHROMOSOME is represented once. Symbol: N.Ploidies: The degree of replication of the chromosome set in the karyotype.Genetic Loci: Specific regions that are mapped within a GENOME. Genetic loci are usually identified with a shorthand notation that indicates the chromosome number and the position of a specific band along the P or Q arm of the chromosome where they are found. For example the locus 6p21 is found within band 21 of the P-arm of CHROMOSOME 6. Many well known genetic loci are also known by common names that are associated with a genetic function or HEREDITARY DISEASE.Hybridization, Genetic: The genetic process of crossbreeding between genetically dissimilar parents to produce a hybrid.Drosophila: A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.Genome, Plant: The genetic complement of a plant (PLANTS) as represented in its DNA.Base Pairing: Pairing of purine and pyrimidine bases by HYDROGEN BONDING in double-stranded DNA or RNA.Gene Amplification: A selective increase in the number of copies of a gene coding for a specific protein without a proportional increase in other genes. It occurs naturally via the excision of a copy of the repeating sequence from the chromosome and its extrachromosomal replication in a plasmid, or via the production of an RNA transcript of the entire repeating sequence of ribosomal RNA followed by the reverse transcription of the molecule to produce an additional copy of the original DNA sequence. Laboratory techniques have been introduced for inducing disproportional replication by unequal crossing over, uptake of DNA from lysed cells, or generation of extrachromosomal sequences from rolling circle replication.DNA, Fungal: Deoxyribonucleic acid that makes up the genetic material of fungi.Genomic Imprinting: The variable phenotypic expression of a GENE depending on whether it is of paternal or maternal origin, which is a function of the DNA METHYLATION pattern. Imprinted regions are observed to be more methylated and less transcriptionally active. (Segen, Dictionary of Modern Medicine, 1992)Sex Chromatin: In the interphase nucleus, a condensed mass of chromatin representing an inactivated X chromosome. Each X CHROMOSOME, in excess of one, forms sex chromatin (Barr body) in the mammalian nucleus. (from King & Stansfield, A Dictionary of Genetics, 4th ed)Genes, Lethal: Genes whose loss of function or gain of function MUTATION leads to the death of the carrier prior to maturity. They may be essential genes (GENES, ESSENTIAL) required for viability, or genes which cause a block of function of an essential gene at a time when the essential gene function is required for viability.DNA, Neoplasm: DNA present in neoplastic tissue.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Histones: Small chromosomal proteins (approx 12-20 kD) possessing an open, unfolded structure and attached to the DNA in cell nuclei by ionic linkages. Classification into the various types (designated histone I, histone II, etc.) is based on the relative amounts of arginine and lysine in each.Intellectual Disability: Subnormal intellectual functioning which originates during the developmental period. This has multiple potential etiologies, including genetic defects and perinatal insults. Intelligence quotient (IQ) scores are commonly used to determine whether an individual has an intellectual disability. IQ scores between 70 and 79 are in the borderline range. Scores below 67 are in the disabled range. (from Joynt, Clinical Neurology, 1992, Ch55, p28)Microtubules: Slender, cylindrical filaments found in the cytoskeleton of plant and animal cells. They are composed of the protein TUBULIN and are influenced by TUBULIN MODULATORS.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Syndrome: A characteristic symptom complex.Pachytene Stage: The stage in the first meiotic prophase, following ZYGOTENE STAGE, when CROSSING OVER between homologous CHROMOSOMES begins.DNA, Plant: Deoxyribonucleic acid that makes up the genetic material of plants.Sister Chromatid Exchange: An exchange of segments between the sister chromatids of a chromosome, either between the sister chromatids of a meiotic tetrad or between the sister chromatids of a duplicated somatic chromosome. Its frequency is increased by ultraviolet and ionizing radiation and other mutagenic agents and is particularly high in BLOOM SYNDROME.Bacterial Proteins: Proteins found in any species of bacterium.Chromosomes, Artificial: DNA constructs that are composed of, at least, elements such as a REPLICATION ORIGIN; TELOMERE; and CENTROMERE, that are required for successful replication, propagation to and maintenance in progeny cells. In addition, they are constructed to carry other sequences for analysis or gene transfer.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Gene Library: A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.Nucleic Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.Introns: Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.Quantitative Trait, Heritable: A characteristic showing quantitative inheritance such as SKIN PIGMENTATION in humans. (From A Dictionary of Genetics, 4th ed)Triticum: A plant genus of the family POACEAE that is the source of EDIBLE GRAIN. A hybrid with rye (SECALE CEREALE) is called TRITICALE. The seed is ground into FLOUR and used to make BREAD, and is the source of WHEAT GERM AGGLUTININS.Genes, Y-Linked: Genes that are located on the Y CHROMOSOME.Biological Evolution: The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.Euchromatin: Chromosome regions that are loosely packaged and more accessible to RNA polymerases than HETEROCHROMATIN. These regions also stain differentially in CHROMOSOME BANDING preparations.Oncogene Fusion: The GENETIC RECOMBINATION of the parts of two or more GENES, including an ONCOGENE as at least one of the fusion partners. Such gene fusions are often detected in neoplastic cells and are transcribed into ONCOGENE FUSION PROTEINS.Sex Determination Processes: The mechanisms by which the SEX of an individual's GONADS are fixed.Sequence Deletion: Deletion of sequences of nucleic acids from the genetic material of an individual.Genes, Insect: The functional hereditary units of INSECTS.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.

Mutations in the organic cation/carnitine transporter OCTN2 in primary carnitine deficiency. (1/1003)

Primary carnitine deficiency is an autosomal recessive disorder of fatty acid oxidation caused by defective carnitine transport. This disease presents early in life with hypoketotic hypoglycemia or later in life with skeletal myopathy or cardiomyopathy. The gene for this condition maps to 5q31.2-32 and OCTN2, an organic cation/carnitine transporter, also maps to the same chromosomal region. Here we test the causative role of OCTN2 in primary carnitine deficiency by searching for mutations in this gene in affected patients. Fibroblasts from patients with primary carnitine deficiency lacked mediated carnitine transport. Transfection of patient's fibroblasts with the OCTN2 cDNA partially restored carnitine transport. Sequencing of the OCTN2 gene revealed different mutations in two unrelated patients. The first patient was homozygous (and both parents heterozygous) for a single base pair substitution converting the codon for Arg-282 to a STOP codon (R282X). The second patient was a compound heterozygote for a paternal 1-bp insertion producing a STOP codon (Y401X) and a maternal 1-bp deletion that produced a frameshift creating a subsequent STOP codon (458X). These mutations decreased the levels of mature OCTN2 mRNA and resulted in nonfunctional transporters, confirming that defects in the organic cation/carnitine transporter OCTN2 are responsible for primary carnitine deficiency.  (+info)

Multipoint oligogenic analysis of age-at-onset data with applications to Alzheimer disease pedigrees. (2/1003)

It is usually difficult to localize genes that cause diseases with late ages at onset. These diseases frequently exhibit complex modes of inheritance, and only recent generations are available to be genotyped and phenotyped. In this situation, multipoint analysis using traditional exact linkage analysis methods, with many markers and full pedigree information, is a computationally intractable problem. Fortunately, Monte Carlo Markov chain sampling provides a tool to address this issue. By treating age at onset as a right-censored quantitative trait, we expand the methods used by Heath (1997) and illustrate them using an Alzheimer disease (AD) data set. This approach estimates the number, sizes, allele frequencies, and positions of quantitative trait loci (QTLs). In this simultaneous multipoint linkage and segregation analysis method, the QTLs are assumed to be diallelic and to interact additively. In the AD data set, we were able to localize correctly, quickly, and accurately two known genes, despite the existence of substantial genetic heterogeneity, thus demonstrating the great promise of these methods for the dissection of late-onset oligogenic diseases.  (+info)

Full results of the genome-wide scan which localises a locus controlling the intensity of infection by Schistosoma mansoni on chromosome 5q31-q33. (3/1003)

Three hundred million individuals are at risk of infection by schistosomes, and thousands die each year of severe hepatic disease. Previous studies have shown that the intensity of infection by Schistosoma mansoni in a Brazilian population is controlled by a major gene, denoted as SM1. We report here the full results of a genome-wide search that was performed on this population to localise SM1. Two hundred and forty-six microsatellites were used for the primary map, and only one region in 5q31-q33 provided significant evidence of linkage. SM1 was subsequently mapped to this region, which contains several genes encoding cytokines or cytokine receptors which are involved in protection against schistosomes. Three additional regions, 1p22.2, 7q36 and 21q22-22-qter, yielded promising, although not significant, lod-score values. These regions contain candidate genes encoding cytokines or molecules relevant to anti-schistosome immunity.  (+info)

Frequent loss of heterozygosity at the DNA mismatch-repair loci hMLH1 and hMSH3 in sporadic breast cancer. (4/1003)

To study the involvement of DNA mismatch-repair genes in sporadic breast cancer, matched normal and tumoral DNA samples of 22 patients were analysed for genetic instability and loss of heterozygosity (LOH) with 42 microsatellites at or linked to hMLH1 (3p21), hMSH2 (2p16), hMSH3 (5q11-q13), hMSH6 (2p16), hPMS1 (2q32) and hPMS2 (7p22) loci. Chromosomal regions 3p21 and 5q11-q13 were found hemizygously deleted in 46% and 23% of patients respectively. Half of the patients deleted at hMLH1 were also deleted at hMSH3. The shortest regions of overlapping (SRO) deletions were delimited by markers D3S1298 and D3S1266 at 3p21 and by D5S647 and D5S418 at 5q11-q13. Currently, the genes hMLH1 (3p21) and hMSH3 (5q11-q13) are the only known candidates located within these regions. The consequence of these allelic losses is still unclear because none of the breast cancers examined displayed microsatellite instability, a hallmark of mismatch-repair defect during replication error correction. We suggest that hMLH1 and hMSH3 could be involved in breast tumorigenesis through cellular functions other than replication error correction.  (+info)

New reciprocal translocation t(5;10)(q33;q22) associated with atypical chronic myeloid leukemia. (5/1003)

We report a new chromosomal reciprocal translocation t(5;10)(q33;q22) in a 49-year-old man with atypical chronic myeloid leukemia (a-CML) and history of occupational exposure to petroleum products including benzene and other hydrocarbons. The t(5;10) (q33;q22) was found in 94% and 84% of metaphases in peripheral blood and bone marrow cells, respectively. Cytogenetic analysis of single colonies derived from granulocyte-macrophage (CFU-GM), and erythroid (BFU-E) hematopoietic progenitors showed that 88% and 40% of CFU-GM and BFU-E, respectively, had the t(5;10)(q33;q22). In contrast, peripheral blood T-lymphocytes, and cutaneous fibroblasts had normal 46,XY karyotype. Molecular analysis of the t(5;10)(q33;q22) translocation breakpoint is currently underway in order to identify genes located in this region which might provide insights into the pathogenesis of atypical myeloproliferative disorders.  (+info)

Adverse effects of activated cytotoxic T lymphocytes on the clinical outcome of nodal anaplastic large cell lymphoma. (6/1003)

Systemic (nodal) anaplastic large cell lymphoma (ALCL) is a subgroup of T-cell non-Hodgkin's lymphomas with a relatively favorable clinical outcome. Part of systemic ALCLs harbor a genetic aberration (usually the t(2;5)(p23;q35) translocation) containing the anaplastic lymphoma kinase (ALK) gene at 2p23, which results in aberrant expression of the ALK protein. Recently, we have shown that the presence of high percentages of activated cytotoxic T lymphocytes (CTLs) in tumor biopsy specimens of Hodgkin's disease (HD) is associated with a poor prognosis. In the present study, we investigated the prognostic value of percentages of activated CTLs in combination with ALK expression in primary nodal ALCL. Primary nodal biopsies of 42 patients with ALCL were investigated for the percentage of activated CTLs (quantified using Q-PRODIT) and the expression of ALK by immunohistochemistry using monoclonal antibodies (MoAbs) directed against T-cell antigen granzyme B (GrB) and ALK, respectively. These parameters were evaluated for their predictive value regarding progression-free and overall survival time. The presence of a high percentage of activated CTLs (ie, >/=15%) was found to be an unfavorable prognostic marker. In combination with a lack of ALK expression, it was possible to identify a group of patients with a very poor prognosis. In this group, 13 of 16 patients died within 2 years as a result of the disease. Of the remaining 26 patients, only three (all ALK negative) died (P <.0001). Furthermore, the percentage of activated CTLs combined with ALK status appeared to be of stronger prognostic value than the International Prognostic Index (IPI). We conclude that a high percentage of activated CTLs present in biopsy material of patients with primary nodal ALCL is a strong indicator for an unfavorable clinical outcome. The combination of ALK expression and percentage of activated CTLs appears to be more sensitive than the IPI in identifying a group of patients with a highly unfavorable clinical outcome who may be eligible for alternative (high dose) therapy schemes.  (+info)

Association and linkage analysis of candidate chromosomal regions in multiple sclerosis: indication of disease genes in 12q23 and 7ptr-15. (7/1003)

Four recent genome-wide screen studies in multiple sclerosis (MS) identified a number of candidate regions for susceptibility genes in addition to the HLA complex in 6p21. However, none of these regions provided formally significant evidence for genome-wide linkage. We have investigated such regions in 46 Swedish multiplex MS families, 28 singleton families, 190 sporadic MS patients and 148 normal controls by parametric and nonparametric linkage and association analysis. One microsatellite marker, in 12q23, provided evidence for association in addition to suggestive transmission distortion and slightly positive linkage. In addition, a marker in 7ptr-15 showed a significant transmission distortion as well as a highly significant score in affected pedigree member analysis, but not quite significant deviations in association analysis. One of three markers in 5p, a region implicated in all four previous studies, showed a weakly positive lod score, but no other evidence of importance. Markers in 2p23, 5q11-13, 6q25, 7q21-22, 11q21-23, 13q33-34, 16p13.2, 18p11.32-23, Xp21.3 provided little or no evidence of importance for MS. In summary, these data support the importance of genome-wide screens in the identification of new candidate loci in polygenic disorders.  (+info)

Cytogenetic analysis of sperm chromosomes and sperm nuclei in a male heterozygous for a reciprocal translocation t(5;7)(q21;q32) by in situ hybridisation. (8/1003)

We have studied the meiotic segregation of a reciprocal translocation t(5;7)(q21;q32) in a male carrier, using the human sperm-hamster oocyte fusion technique and the whole chromosome painting. A total of 296 sperm complements were analysed by dual chromosome painting. The frequencies of alternate, adjacent-1, adjacent-2 and 3:1 segregation were 49.7%, 32.4%, 16.2% and 1.7% respectively. Aneuploidy frequencies for chromosomes not involved in the translocation were determined by FISH on decondensed sperm heads using probes from chromosomes X, Y, 6, 18 and 21. A total of 20,118 spermatozoa was analysed, 10,201 by two-colour FISH (probes for chromosomes 6 and 21) and 9917 by three-colour FISH (probes for chromosomes X, Y, and 18). There was no evidence of an interchromosomal effect, since disomy frequencies were within the range of normal controls.  (+info)

*TMEM33

This 1069 base pair promoter sequence spans 41936535-41937603 on human chromosome 4. The promoter sequence overlaps with the 5 ... Transcripts a, b, and c have a 744 base pair long coding range and a particularly long 3' UTR that is 6000 base pairs long. In ... The human protein has a predicted molecular weight of 28 kDa and an isoelectric point of 9.88. TMEM33 has a significantly high ... Using human proteins, an affinity chromatography ran on TMEM33 showed that the protein bound to reticulon 4C, 1A, 2B, 3C, and ...

*Jane Grimwood

"320 million base pairs . . . comprising more than 10% of the human genome." They discovered that chromosome 19 has the highest ... "GNN - Two More Human Chromosomes Are Complete". www.genomenewsnetwork.org. Retrieved 2017-03-02. Grimwood, Jane; Gordon, Laurie ... gene density of any human chromosome, and were able to link certain genes on the chromosome to genetic diseases including ... Grimwood was an important part of the Human Genome Project effort, working from the Stanford Human Genome Center. Grimwood ...

*Arachidonate 5-lipoxygenase

The ALOX5 gene, which occupies 71.9 kilobase pairs (kb) on chromosome 10 (all other human lipoxygenases are clustered together ... Aberrant expression of LOX5 is seen in various types of human cancer tumors in vivo as well as in various types of human cancer ... Studies with cultured human cells have found that there are a large number of ALOX5 mRNA splice variants due to Alternative ... Human ALOX5 is a soluble, monomeric protein consisting of 673 amino acids with a molecular weight of ~78 kDa. Structurally, ...

*Human chorionic gonadotropin

... encoded by six highly homologous genes that are arranged in tandem and inverted pairs on chromosome 19q13.3 - CGB (1, 2, 3, 5, ... Talwar GP (1997). "Fertility regulating and immunotherapeutic vaccines reaching human trials stage" (PDF). Human Reproduction ... Human chorionic gonadotropin (hCG) is a hormone produced by the placenta after implantation. The presence of hCG is detected in ... Human chorionic gonadotropin interacts with the LHCG receptor of the ovary and promotes the maintenance of the corpus luteum ...

*LSMEM1

Aliases for LSMEM1 include C7orf53, chromosome 7 open reading frame 53, and FLJ39575. The human mRNA is 1686 base pairs long ... Scherer, S. W. (10 April 2003). "Human Chromosome 7: DNA Sequence and Biology". Science. 300 (5620): 767-772. doi:10.1126/ ... The human mRNA also has a 5' UTR and a 3' UTR. The 5' UTR goes from mRNA position 1 to 341, and the 3' UTR goes from mRNA ... When the human protein encoded by LSMEM1 is compared to a known quickly evolving protein (fibrinopeptides) and a known slowly ...

*TMCO6

The human TMCO6 is found on chromosome 5 (position 5q31.3). The entire gene spans 5568 base pairs on the positive strand of ... 1,925 base pair mRNA sequence. Variant 2 is the second longest at 1,907 base pairs in length and also consists of 12 exons. ... Variant 3 has a total length of 1,614 base pairs and differs from variant 1 because it lacks two consecutive exons. It has an ... Variant X2 is predicted using computational analysis and is 1,892 base pairs in length. The TMCO6 protein is found in the ...

*Ribose-5-phosphate isomerase

RpiA in human beings is encoded on the second chromosome on the short arm (p arm) at position 11.2. Its encoding sequence is ... nearly 60,000 base pairs long. The only known naturally occurring genetic mutation results in ribose-5-phosphate isomerase ... Human ribose-5-phosphate isomerase A (RpiA) plays a role in human hepatocellular carcinoma (HCC). A significant increase in ... A pseudogene is found on chromosome 18. In the non-oxidative part of the pentose phosphate pathway, RPIA converts Ru5P to R5P ...

*Chromosome 7 (human)

Chromosome 7 is one of the 23 pairs of chromosomes in humans. People normally have two copies of this chromosome. Chromosome 7 ... A ring chromosome occurs when both ends of a broken chromosome are reunited. G-banding ideograms of human chromosome 7 In the ... See also: Category:Genes on human chromosome 7. The following is a partial list of genes on human chromosome 7. For complete ... "Chromosome 7". Genetics Home Reference. Retrieved 2017-05-06. "Chromosome 7". Human Genome Project Information Archive 1990- ...

*1q21.1 deletion syndrome

A human cell has one pair of identical chromosomes on chromosome 1. With the 1q21.1 deletion syndrome, one chromosome of the ... the chromosome pairs split and a representative of each pair goes to one daughter cell. In this way the number of chromosomes ... pair is not complete, because a part of the sequence of the chromosome is missing. One chromosome has the normal length and the ... In 1q21.1, the '1' stands for chromosome 1, the 'q' stands for the long arm of the chromosome and '21.1' stands for the part of ...

*IRX1

The human gene product is a 1858 base pair mRNA with 4 predicted exons in humans. Promoter analysis was performed using El ... IRX1, IRX2, and IRX4 are found on human chromosome 5, and their orientation corresponds to that of IRX3, IRX5, and IRX6 found ... The predicted promoter region spans 1040 base pairs from position 3595468 through 3595468 on the forward strand of chromosome 5 ... "Cloning and chromosome mapping of human and chicken Iroquois (IRX) genes". Cytogenet. Cell Genet. 92 (3-4): 320-5. doi:10.1159/ ...

*MTRR (gene)

Mitochondrial EC 1.16.1.8 CblE The gene was mapped to human chromosome 5. Gene specific primer pairs resulted in PCR ... MTRR):r.1462_1557del96 - Associated with splicing of exon 11 due to a 7 base pair deletion. A large deletion of this mutant ... Micronucleus frequency in human lymphocytes, dependent on homocysteine levels increases reactive oxygen species and uracil ... Leal NA, Olteanu H, Banerjee R, Bobik TA (November 2004). "Human ATP:Cob(I)alamin adenosyltransferase and its interaction with ...

*Haplogroup I-M170

2004). "Mitochondrial DNA and Y-Chromosome Variation in the Caucasus" (PDF). Annals of Human Genetics. 68 (Pt 3): 205-221. doi: ... base pair): 275 Total size (base pairs): 220 Forward 5′→ 3′: aaggggatatgacgactgatt Reverse 5′→ 3′: cagctcctcttttcaactctca ... "Y-chromosome diversity in Sweden - A long-time perspective". European Journal of Human Genetics. 14 (8): 963-970. doi:10.1038/ ... "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127-148. doi:10.1007/s00439-003-1031-4. ISSN ...

*Chromosome 5 (human)

A ring chromosome occurs when both ends of a broken chromosome are reunited. G-banding ideograms of human chromosome 5 "Human ... See also: Category:Genes on human chromosome 5. The following is a partial list of genes on human chromosome 5. For complete ... One example would be acute myeloid leukemia (AML). The following are some of the gene count estimates of human chromosome 5. ... Chromosome 5q deletion syndrome is caused by the deletion of the q arm (long arm) of chromosome 5. This deletion has been ...

*Vertebrate and Genome Annotation Project

Pairwise comparisons between three pairs of full length mouse and human chromosomes: human chromosome 1 and mouse chromosome 4 ... human chromosome 17 and mouse chromosome 11 human chromosome X and mouse chromosome X "Vega Genome Browser". Wellcome Sanger ... gorilla and human (nine haplotypes): pig chromosome 6 (53.6Mbp to 54.0Mbp) gorilla chromosome 19-LRC human chromosome 19q13.4 ( ... mouse and eight human haplotypes: dog chromosome 12-MHC gorilla chromosome 6-MHC chimpanzee chromosome 6-MHC wallaby chromosome ...

*TMEM143

Located on the negative strand of human DNA, TMEM143 spans 31,882 base pairs on human chromosome 19 (19q13.33), neighbored by ... human)]". NCBI. "Tmem143 (human)". NCBI. "TMEM143 Gene". GeneCards. "TMEM143 - Normal human tissue expression profiling". NCBI ... There are no known paralogs for the human TMEM143 sequence. Possible human expression of TMEM143 protein occurs in Jurkat cells ... Chromosome 14 open reading frame 28 (C14orf28), Chromosome 14 open reading frame 28 (TRIN71), and Cytoplasmic polyadenylation ...

*C10orf76

"Human PubMed Reference:". "Mouse PubMed Reference:". "Entrez Gene: Chromosome 10 open reading frame 76 (Human)". Retrieved 28 ... the largest of which being 4101 base pairs in length. The human c10orf76 locus is flanked on the left and right sides by HPS6 ... spans 210,577 base pairs on the reverse strand of the long arm of chromosome 10. Its 26 alternatively spliced exons encode 5 ... C10orf76 or chromosome 10 open reading frame 76, also known as UPF0668, is a protein that in humans is encoded by the c10orf76 ...

*FAM83H

The FAM83H gene spans 14097 base pairs and is orientated on the-strand. The coding region is made up of 5,604 base pairs and 5 ... "Genecards". The Gene Human Database. "Aceview". NCBI. "Genecards". The Gene Human Database. "BLAST". NCBI. Hedges, SB. " ... FAM83H is located on the long arm of chromosome 8 (8q24.3), starting at 143723933 and ending at 143738030. ... Orthologs of the human protein FAM83H are listed above in descending order or date of divergence and then ascending order of ...

*CCDC94

The gene product is a 1,441 base pair mRNA with 8 predicted exons in the human gene. As predicted by Ensemble, there exists one ... The predicted promoter region spans 714 basepairs from 4,246,532 to 4,247,245 on the plus strand of chromosome 19. CCDC94 is ... The human form as 323 amino acid residues, with an isoelectric point of 5.618 and a molecular mass of 37,086 Daltons. There are ... Human CCDC94 genome location and CCDC94 gene details page in the UCSC Genome Browser.. ...

*CD300C

... gene structure predicts for an independently expressed member of an ITIM/ITAM pair of molecules localized to human chromosome ... "The gene encoding the immunoregulatory signaling molecule CMRF-35A localized to human chromosome 17 in close proximity to other ... "Entrez Gene: CD300C CD300c molecule". Human CD300C genome location and CD300C gene details page in the UCSC Genome Browser. ... "Human PubMed Reference:". "Mouse PubMed Reference:". Jackson DG, Hart DN, Starling G, Bell JI (Jun 1992). "Molecular cloning of ...

*Chimpanzee genome project

Humans have 23 pairs of chromosomes and other great apes have 24 pairs of chromosomes. In the human evolutionary lineage, two ... Human and chimpanzee chromosomes are very similar. The primary difference is that humans have one fewer pair of chromosomes ... Human evolutionary genetics Human chromosome 2 Human Genome Project McConkey EH (2004). "Orthologous numbering of great ape and ... chromosome segment inversions on human chromosomes 1, 4, 5, 9, 12, 15, 16, 17, and 18. After the completion of the Human genome ...

*ERICH2

... is located on human Chromosome 2, at 2q31.1. It contains 10 distinct exons. The gene itself is 28,930 base pairs long ... This variant is also shorter than the other two at 1,063 base pairs. The ERICH2 protein is 436 amino acids in length, and has a ... The longest transcript variant is 1,388 base pairs in length, 1,311 of which are coding. The second variant differs from the ... Database, GeneCards Human Gene. "IWS1 Gene - GeneCards , IWS1 Protein , IWS1 Antibody". www.genecards.org. Retrieved 2017-05-07 ...

*Human genetic variation

Chromosome abnormalities are detected in 1 of 160 live human births. Apart from sex chromosome disorders, most cases of ... The human nucleotide diversity is estimated to be 0.1% to 0.4% of base pairs. A difference of 1 in 1,000 amounts to ... According to a 2000 study of Y-chromosome sequence variation, human Y-chromosomes trace ancestry to Africa, and the descendants ... Human genome projects are scientific endeavors that determine or study the structure of the human genome. The Human Genome ...

*X chromosome

25,000 total genes in the human genome. Each person usually has one pair of sex chromosomes in each cell. Females have two X ... Since the father retains his X chromosome from his mother, a human female has one X chromosome from her paternal grandmother ( ... "X chromosome". Genetics Home Reference. Retrieved 2017-05-06. "X chromosome". Human Genome Project Information Archive 1990- ... He called this chromosome an accessory chromosome and insisted, correctly, that it was a proper chromosome, and theorized, ...

*TMEM98

This gene is found on the plus strand of chromosome 17 at locus 17q11.2. It spans from base pairs 31,254,928 to 31,272,124. ... "Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs". Genome ... This missing region corresponds to 85 base pairs near the end of the 5' UTR. Variant one is more abundant than Variant two with ... While not functional, there are two pseudogenes found on chromosome 6 and 14 in Homo sapiens. Transmembrane protein 98 is ...

*Occludin

The gene starts at base pair 69,492,292 and goes to base pair 69,558,104 and is 65,813 base pairs long. Occludin's structure ... Martin Tracey A., Mansel Robert E., Jiang Wen G. (2010). "Loss of occludin leads to the progression of human breast cancer". ... The OCLN gene is located on the long (q) arm of chromosome 5 at position q13.1. ... 2001). "Expression of ZO-1 and occludin in normal human placenta and in hydatidiform moles". Mol. Hum. Reprod. 7 (3): 279-285. ...

*TENM3

Odz1 to Mouse Chromosome 11; and ODZ3 to Human Chromosome Xq25". Genomics. 58 (1): 102-3. doi:10.1006/geno.1999.5798. PMID ... Levine A, Bashan-Ahrend A, Budai-Hadrian O, Gartenberg D, Menasherow S, Wides R (May 1994). "odd Oz: A novel Drosophila pair ... Odz1to Mouse Chromosome 11; and ODZ3 to Human Chromosome Xq25". Genomics. 58 (1): 102-103. doi:10.1006/geno.1999.5798. PMID ... Ben-Zur, T.; Feige, E.; Motro, B.; Wides, R. (2000). "The Mammalian Odz Gene Family: Homologs of a Drosophila Pair-Rule Gene ...
Cri Du Chat Syndrome Essay, Research Paper Cri Du Chat Syndrome (Cry of the Cat) By Chase Kuntz The Cri du Chat syndrome is the result of the deletion of segment 5p15.2 in the short arm of chromosome number five. No one is quite sure on how this deletion occurs, or even why it occurs. This deletion leads to deformities and mental retardation in the child.
While there is no specific treatment available for cri du chat syndrome, early intervention is recommended in the areas of physical. The disorder is characterized by intellectual disability and delayed development, small head size (microcephaly), low birth weight, and weak muscle tone (hypotonia) in infancy.
Cri Du Chat Syndrome - By: Grace Alvarez & Sydney Aledort by Grace Alvarez | This newsletter was created with Smore, an online tool for creating beautiful newsletters for for educators, nonprofits, businesses and more
Cri du chat syndrome (CdCS or 5p-) is a rare genetic disorder in which a variable portion of the short arm of chromosome 5 is missing or deleted. In 1963 the disorder was first described by doctor Lejeune who observed abnormal cat-like cry in newborn. In French, Cri du chat means "cry of the cat".Cri du chat syndrome(cats cry). The disorder is characterized by intellectual disability and delayed development, small head size (microcephaly), low birth weight, and weak muscle tone (hypotonia) in infancy. Affected individuals also have peculier facial features, including widely set eyes (hypertelorism), low-set ears, a small jaw, and a rounded face. Some children with cri-du-chat syndrome are born with a heart defect.. ...
Looking for information on Cri du chat? Medigest has all you need to know about Cri du chat - Symptoms and Signs, Causes, Treatments and definition
Cri du chat syndrome can either be diagnosed before birth (prenatally) or after birth. In these disorders, entire chromosomes, or large segments of them, are missing, duplicated, or otherwise altered.
Cri-du-chat is French for the cry of the cat. This syndrome affects between 1 in 20,000 and 1 in 50,000 babies. It is more common to spot on females with a ratio of 4:3. Interestingly, there is a prevalence of 1:305 among patients attending genetic counseling services.
Trial Design:. This clinical trial is a phase III multicenter, randomized, double blind and controlled with placebo trial and with two arms designed to assess the efficiency and toxicity of the scheme Lenalidomide versus observation in a series of 60 patients with low risk myelodysplastic syndrome associated to 5q deletion with anemia (Hb≤12g/dL) but without the need of transfusion. Patients are randomized in the study in a 2:1 ratio. They will receive treatment for 104 weeks until progression of the disease, which implies that the patient suffering from anemia due to myelodysplastic syndrome requires transfusion of at least 2 UCH/56 days (2 months) with a minimum follow up of 112 days (4 months), or unacceptable toxicity.. Disease:. Low risk myelodysplastic syndrome associated to the loss of 5q without transfusion requirements.. Total number of patients:. In total 60 patients will be included, 40 assigned to the treatment branch and 20 to the placebo branch.. Calendar:. First patient first ...
A rare chromosomal disorder that is apparent at birth, is characterized by a distinctive high, shrill, mewing, kitten-like cry during infancy.
The 5q- syndrome is the most distinct of the myelodysplastic syndromes (MDS) and patients with this disorder have a deletion of chromosome 5q [del(5q)] as the sole karyotypic abnormality. Several genes mapping to the commonly deleted region of the 5q- syndrome have been implicated in disease pathogenesis in recent years. Haploinsufficiency of the ribosomal gene RPS14 has been shown to cause the erythroid defect in the 5q- syndrome. Loss of the microRNA genes miR-145 and miR-146a has been associated with the thrombocytosis observed in 5q- syndrome patients. Haploinsufficiency of CSNK1A1 leads to hematopoietic stem cell expansion in mice and may play a role in the initial clonal expansion in patients with 5q- syndrome. Moreover, a subset of patients harbor mutation of the remaining CSNK1A1 allele. Mouse models of the 5q- syndrome, which recapitulate the key features of the human disease, indicate that a p53-dependent mechanism underlies the pathophysiology of this disorder. Importantly, activation of p53
OBJECTIVE: A subset analysis of the randomized, phase 3, MDS-004 study to evaluate outcomes in patients with International Prognostic Scoring System (IPSS)-defined Low-/Intermediate (Int)-1-risk myelodysplastic syndromes (MDS) with isolated del(5q).
This is a Phase 1 study during which patients with low or intermediate-1 risk myelodysplastic syndromes (MDS) will receive investigational study drug ARRY-614.. This study has 2 parts. In the first part, patients will receive increasing doses of study drug in order to achieve the highest dose of the study drug possible that will not cause unacceptable side effects. Approximately 50 patients from the US will be enrolled in Part 1 (Completed).. In the second part of the study, patients will receive the best dose of study drug determined from the first part of the study and will be followed to see what side effects and effectiveness the study drug has, if any, in treating the cancer. Approximately 30 patients from the US will be enrolled in Part 2 (Completed). ...
LA JOLLA, Calif., June 16, 2016-- Kura Oncology, Inc., a clinical stage biopharmaceutical company, today announced the first patient has been dosed in a Phase 2 clinical trial of tipifarnib in patients with lower risk myelodysplastic syndromes..
a. Sejarah PenemuanLejeune dan koleganya pertama kali mendeskripsikan aspek klinis dari sindrom tangisan kucing pada tahun 1963 Deskripsi pertama didapat dari observasi terhadap 3 orang anak yang tidak memiliki hubungan keluarga. Ketiga anak tersebut memiliki ciri-ciri yang meliputi keterbelakangan mental,cacat fisik, mikrochepal (kepal berukuran kecil), bentuk wajah yang abnormal, dan suara tangis menyerupai kucing saat bayi yang disertai kegagalan pertumbuhan. …
In 1963, Lejeune et al described a syndrome consisting of multiple congenital anomalies, mental retardation, microcephaly, abnormal face, and a mewing cry in infants with a deletion of a B group chromosome (Bp-), later identified as 5p-. Cri-du-chat syndrome is an autosomal deletion syndrome caused by a partial deletion of chromosome 5p and...
cri-du-chat syndrome: Congenital disorder caused by partial deletion of the short arm of chromosome 5. It is named for its characteristic symptom, a high-pitched wailing cry likened to that of a cat...
Celgene Corporation (NASDAQ: CELG) announced that the US Food and Drug Administration (FDA) granted approval of REVLIMID (lenalidomide) which is indicated for the treatment of patients with transfusion-dependent anemia due to low- or intermediate-1-risk myelodysplastic syndromes (MDS) associated with a deletion 5q cytogenetic abnormality with or without additional cytogenetic abnormalities. REVLIMID will be available through a REVLIMID Education and Prescribing Safety Program, called RevAssistsm via contracted pharmacies.
Ive got to be honest. One of the upsides of my anxiety is that I have cat-like reflex skills when it comes to my children. I can remember when my first child was learning to eat solids. Id cut up her apple and cheese into tiny, mouse sized bites. Even when I was taking pre-cautions and being ultra careful, that "breathe, chew, swallow" function would derail from time to time. Id go to give her another apple bit and she would start coughing and getting all red in the face. Before she knew what was happening, I had grabbed her from the highchair and turned her upside down, patting her on the back to dislodge the "foreign object" while my heart raced ...
Cri-du-chat syndrome is a genetic condition. Also called cats cry or 5P- (5P minus) syndrome, its a deletion on the short arm of chromosome 5. Its a rare condition, occurring in only about 1 in 20,000 to 1 in 50,000 newborns, according to the Genetics Home Reference. But its one of the more common syndromes caused by chromosomal deletion.. "Cri-du-chat" means "cry of the cat" in French. Infants with the syndrome produce a high-pitched cry that sounds like a cat. The larynx develops abnormally due to the chromosome deletion, which affects the sound of the childs cry. The syndrome is more noticeable as the child ages, but becomes difficult to diagnose past age 2.. Cri-du-chat also carries many disabilities and abnormalities. A small percentage of infants with cri-du-chat syndrome are born with serious organ defects (especially heart or kidney defects) or other life-threatening complications that can result in death. Most fatal complications occur before the childs first birthday.. Children ...
An example of this type of chromosomal abnormality is cri du chat syndrome, a deletion in the line short arm of chromosome 5, marked by mental retardation and sometimes congenital heart defects. This is definitely as well as dazzling chatting line and is particularly well known not only with gay individuals but even with bi-Curious males, transsexuals, shemales and just about everyone within the lgbt society. X chromosome the female sex chromosome, being carried by half the male gametes and all female gametes; female diploid cells have two X chromosomes. You will before long find that this system is amongst the most chat captivating and impressive gay chat lines free in Pennsylvania. This can be done on fetal cells obtained by amniocentesis or chorionic villus sampling, on lymphocytes from a blood sample, on skin cells from a biopsy, or on cells from products of conception such as an aborted fetus. Karyotyping is useful in determining the presence of chromosome defects. You'll discover the ...
It is well documented that mothers of children with challenging behavior (CB) experience elevated levels of stress and that this persists over time, but less is known about the experience of mothers of children with rare genetic syndromes. This article describes 2 studies, 1 cross-sectional and 1 longitudinal, comparing well-being in mothers of children with Angelman, Cornelia de Lange and Cri du Chat syndrome who have either shown chronic CB ( n = 18) or low/no CB ( n = 26) in the preceding 7 years. The presence of chronic, long-term CB increased maternal stress but not depression or anxiety, and did not influence positive well-being. Stress relating specifically to their childs genetic syndrome reduced with age, highlighting the need for further exploration in this area. ...
In recent years we have gained great insight into the molecular pathogenesis of the 5q- syndrome, a distinct subtype of myelodysplasia. The demonstration of haploinsufficiency of the ribosomal gene RPS14 (mapping to the commonly deleted region) and the finding that this is the cause of the erythroid defect in the 5qsyndrome represent major advances. A mouse model of the human 5q- syndrome generated by large-scale deletion of the Cd74-Nid67 interval (containing RPS14) further supports a critical role for RPS14 haploinsufficiency. It is widely accepted that ribosomal deficiency results in p53 activation and defective erythropoiesis and the crossing of the 5q- mice with p53 deficient mice ameliorated the erythroid progenitor defect. Emerging data suggests that the p53 activation observed in the mouse model may also apply to the human 5q- syndrome.
Listen toLe Syndrome du Chat on Deezer. With music streaming on Deezer you can discover more than 43 million tracks, create your own playlists, and share your favourite tracks with your friends.
BOUDRY, Switzerland-(BUSINESS WIRE)-Nov. 21, 2011- Celgene International Sàrl, a subsidiary of Celgene Corporation, (NASDAQ: CELG) today announced that REVLIMID (lenalidomide) has been granted approval by the Swiss agency for Therapeutic Products (Swissmedic) for use in patients with transfusion-dependent anemia due to low-or intermediate-1-risk myelodysplastic syndromes (MDS) associated with a deletion 5q cytogenic abnormality with or without additional cytogenic abnormalities. Myelodysplastic syndromes (MDS) are a group of hematologic malignancies that affect approximately 300,000 people worldwide. Myelodysplastic syndromes occur when bone marrow precursors of blood cells display abnormal morphological and cytogenetic features, preventing them from maturing into normally functioning peripheral blood cells. With time, most of the cells accumulate in their immature or "blast" stage and eventually the bone marrow may be filled with blasts suppressing normal cell development. Patients with MDS ...
The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.[8]. ...
http://www.youtube.com/watch?v=hrx9WIt64Gw bersyukur lah selalu karena di lahirkan sempurna. Lejeune dan koleganya pertama kali mendeskripsikan aspek klinis dari sindrom tangisan kucing pada tahun 1963 Deskripsi pertama didapat dari observasi terhadap 3 orang anak yang tidak memiliki hubungan keluarga. Ketiga anak tersebut memiliki ciri-ciri yang meliputi keterbelakangan mental,cacat fisik, mikrochepal (kepal berukuran kecil), bentuk wajah yang abnormal,…
Hello, My daughter, Siobhan, has severe developmental delays. Shell be four in July, learned to walk unaided two months ago, and cannot speak. She can vocalize, but is unable to make consonants. She is able to approximate a few words and can use them correctly. After years of searching for the cause of her condition Siobhan has been diagnosed by Dr. Barbara Crandall, geneticist, at UCLA Medical Center. Dr. Crandall has demonstrated that in 40 to 60 percent of Siobhans blood cells there is a deletion at the tip of the P5 (P5.3) chromosome. The syndrome in which this particular deletion appears is named cri-du-chat because the infant will cry like a cat. I downloaded an .au file from a web site on which there is a mention of this syndrome and the cry is eerily like that of a cat. I first heard the sound in that file because Siobhan never had that distinctive cry. Dr. Crandall theorizes that perhaps Siobhan does not have severe effects because the deletion does not happen in all cells, but ...
The following case study focuses on identifying one of the 5q- syndrome genes. Test your knowledge by reading the question below and making the proper selection.
Professional guide for Lenalidomide. Includes: pharmacology, pharmacokinetics, contraindications, interactions, adverse reactions and more.
There are many different types of genetic disorders, including cystic fibrosis, Marfan syndrome, sickle cell anemia, cri du chat...
In patients with low or intermediate-1 (int-1) risk myelodysplastic syndrome (MDS) and thrombocytopenia, use of the thrombopoietin (TPO)-receptor agonist, romiplostim, resulted in a 15-fold increase in platelet response as defined by the International Working Groups (IWG) 2006 criteria for hematologic improvement-platelets (HI-P). The data from this randomized, double-blind, placebo-controlled study was presented at the 53rd American Society of Hematology Annual Meeting and Exposition.
Oswald McWeany writes Reports swirling around the Internet are that a boy in China may have cat-like night vision. The boy with eerie blue-eyes was able to fill out a questionnaire in the dark and his eyes reflect like a cats when a light is shined on them. No reports yet if he marks his territor...
Rioux JD, Daly M.J, Silverberg MS, Lindblad K, Steinhart H, Cohen Z, Delmonte T, Kocher K, Miller K, Guschwan S, Kulbokas EJ, OLeary S, Winchester E, Dewar K, Green T, Stone V, Chow C, Cohen A, Langelier D, Lapointe G, Gaudet D, Faith J, Branco N, Bull SB, McLeod RS, Griffiths AM, Bitton A, Greenberg GR, Lander ES, Siminovitch KA, Hudson TJ. Genetic variation in the 5q31 cytokine gene cluster confers susceptibility to Crohns disease. Nature Genetics 2001:29:223-228. PubMed PMID: 11586304.. ...
History In 1963, Lejeune et al., High-pitched. Microcephaly. Growth failure Abnormal face.. Mental retardation Facial abnormalities. Multiple congenital anomalies.
Buy lenalidomide from Sinoway. Lenalidomide mechanism of action is available in products details here. Contact us if you are interested in lenalidomide powder.
Find and save ideas about Causas de hipotiroidismo on Pinterest. | See more ideas about Sintomas del hipertiroidismo, Síntomas del hipertiroidismo and Estreñimiento sintomas.
Find and save ideas about Representar funciones on Pinterest. | See more ideas about Arte del día del recuerdo, Imagenes creepy and Galletas flacas.
Q: My neighbor just had the most adorable baby, and she was diagnosed with Treacher Collins syndrome. What is that?A: Treacher Collins syndrome (TCS) is a genetic disorder that affects about one in every 25,000 to 50,000 births in the United States. It affects males and females, and all races, essentially equally.TCS, also called mandibulofacial dysostosis, is a disorder that affects the development of the bones and other tissues of the face and head. In some patients these changes can be very
Q: My neighbor just had the most adorable baby, and she was diagnosed with Treacher Collins syndrome. What is that?A: Treacher Collins syndrome (TCS) is a genetic disorder that affects about one in every 25,000 to 50,000 births in the United States. It affects males and females, and all races, essentially equally.TCS, also called mandibulofacial dysostosis, is a disorder that affects the development of the bones and other tissues of the face and head. In some patients these changes can be very
Q: My neighbor just had the most adorable baby, and she was diagnosed with Treacher Collins syndrome. What is that?A: Treacher Collins syndrome (TCS) is a genetic disorder that affects about one in every 25,000 to 50,000 births in the United States. It affects males and females, and all races, essentially equally.TCS, also called mandibulofacial dysostosis, is a disorder that affects the development of the bones and other tissues of the face and head. In some patients these changes can be very
Treacher Collins is a condition in which the cheek-bones and jawbones are underdeveloped. Children with this condition have very small or partially absent cheek bones and notches in or stretching of the lower eyelids. The ears are frequently abnormal and part of the outer ear is usually absent. Hearing loss is also associated with this syndrome.. For more detailed information, please download our free booklet, A Guide to Understanding Treacher Collins Syndrome.. ...
Treacher collins syndrome is one of the rare genetic disorders or a chromosomal abnormalities that can be observed by the physical look of a person.
Treacher collins syndrome is one of the rare genetic disorders or a chromosomal abnormalities that can be observed by the physical look of a person.
Treacher Collins Syndrome - Learn more about this disorder by Aivy Ta | This newsletter was created with Smore, an online tool for creating beautiful newsletters for for educators, nonprofits, businesses and more
Buy our Recombinant Human Treacher Collins syndrome protein. Ab114719 is a protein fragment produced in Wheat germ and has been validated in WB, ELISA…
About REVLIMID® (lenalidomide) treatment for deletion 5q myelodysplastic syndromes, mantle cell lymphoma and multiple myeloma including full indications, dosing, administration, efficacy, safety & prescribing information. Indication REVLIMID® (lenalidomide) is used with dexamethasone to treat patients with multiple myeloma (MM) REVLIMID® is used to treat patients who have low- or intermediate-1-risk myelodysplastic syndromes (MDS) where part of chromosome 5 is missing (del 5q). These patients have low red blood cell counts (anemia) that require blood transfusions REVLIMID® is used to treat patients with mantle cell lymphoma (MCL) when the disease comes back or becomes worse after treatment with two prior medicines, one of which included bortezomib REVLIMID should not be used to treat people who have chronic lymphocytic leukemia (CLL) unless they are participants in a controlled clinical trial It is not known if REVLIMID is safe and effective in children under 18 years of age Please see full
Acceleron Pharma Inc. (Nasdaq:XLRN) today announced that results from the MEDALIST and BELIEVE Phase 3 trials of luspatercept in patients with low-to-intermediate risk myelodysplastic syndromes (MDS) and transfusion-dependent beta-thalassemia, respectively, will be presented at the 60th...
A new patent for the iPhone could mean that the device when dropped could twist in the air and land so it sustains little or no damage -- like a cat landing on its feet.
Talore very quickly picked up on the sound of me picking up the laser pointer (the metal case usually clicks against my desk), the sound it makes when I turn it on, and the sound it makes when I turn it off. Her reactions are, respectively: perk up and look at me, crouch down and start looking for the dot, and look at me and settle down. Of course by the time I turn it off shes usually stopped really chasing it anyway.. In related news, the $10 worth of watch batteries are getting noticeably dimmer 1 week after installation. Ill probably be buying a new laser pointer soon - one that takes reasonably sized batteries. My other option is to go by radio shack and get a battery holder for 4 probably AA batteries and wire it in, but considering my current laser pointer is part of a nice (or at least decent) pen Ill probably just leave it as is.. ...
Empire Genomics CLPTM1LP1 FISH probe is used to detect translocations of the CLPTM1LP1 gene and can be labeled in one of five colors, using standard nick translation protocols. Each probe is sold in 20 test kits (~20 slides - 22x22 mm area) and includes hybridization buffer. Order 5 or more of the CLPTM1LP1 FISH probe and save 10%!
Genetics Home Reference : 25 5q minus (5q-) syndrome is a type of bone marrow disorder called myelodysplastic syndrome (MDS). MDS comprises a group of conditions in which immature blood cells fail to develop normally, resulting in too many immature cells and too few normal mature blood cells. In 5q- syndrome, development of red blood cells is particularly affected, leading to a shortage of these cells (anemia). In addition, the red blood cells that are present are unusually large (macrocytic). Although many people with 5q- syndrome have no symptoms related to anemia, especially in the early stages of the condition, some affected individuals develop extreme tiredness (fatigue), weakness, and an abnormally pale appearance (pallor) as the condition worsens. Individuals with 5q- syndrome also have abnormal development of bone marrow cells called megakaryocytes, which produce platelets, the cell fragments involved in blood clotting. A common finding in people with 5q- syndrome is abnormal cells ...
Interleukin-1 family member 10 is a protein that in humans is encoded by the IL1F10 gene. The protein encoded by this gene is a member of the interleukin 1 cytokine family. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. This cytokine is thought to participate in a network of interleukin 1 family members to regulate adapted and innate immune responses. Two alternatively spliced transcript variants encoding the same protein have been reported. GRCh38: Ensembl release 89: ENSG00000136697 - Ensembl, May 2017 GRCm38: Ensembl release 89: ENSMUSG00000046845 - Ensembl, May 2017 "Human PubMed Reference:". "Mouse PubMed Reference:". Bensen JT, Dawson PA, Mychaleckyj JC, Bowden DW (Dec 2001). "Identification of a novel human cytokine gene in the interleukin gene cluster on chromosome 2q12-14". J Interferon Cytokine Res. 21 (11): 899-904. doi:10.1089/107999001753289505. PMID 11747621. Taylor SL, Renshaw BR, Garka KE, Smith DE, Sims JE (May 2002). "Genomic ...
Gene Information This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene interleukin 28A (IL28A) and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor beta (IL10RB) and interleukin 28 receptor alpha (IL28RA). [provided by RefSeq Jul 2008]. ...
168682-53-9 - GWEJFLVSOGNLSS-WPFOTENUSA-N - Ezatiostat [INN] - Similar structures search, synonyms, formulas, resource links, and other chemical information.
Pdgfrb - Pdgfrb (GFP-tagged) - Mouse platelet derived growth factor receptor beta polypeptide (Pdgfrb) transcript variant 2, (10ug) available for purchase from OriGene - Your Gene Company.
LOSS OF DELTA-CATENIN, A NEURONAL ADHERENS JUNCTION PROTEIN INTERACTING WITH PRESENILIN-1, LEADS TO SEVERE IMPAIRMENTS IN LEARNING AND SYNAPTIC PLASTICITY, AND MAY UNDERLIE THE MENTAL RETARDATION IN CRI-DU-CHAT SYNDROME.. A040.14. Poster 46 - Sun 11/07, 16:00 - Hall ...
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
We evaluated autism spectrum disorder (ASD) characteristics and social behavior in Angelman (AS; n = 19; mean age = 10.35 years), Cornelia de Lange (CdLS; n = 15; mean age = 12.40 years), and Cri du Chat (CdCS, also known as 5 p-syndrome; n = 19; mean age = 8.80 years) syndromes. The proportion of individuals meeting the ASD cutoff on the Social Communication Questionnaire was significantly higher in the AS and CdLS groups than in the CdCS group (p , .01). The groups demonstrated divergent social behavior profiles during social conditions in which adult availability, adult familiarity, and social demand were manipulated. Social enjoyment was significantly heightened in AS, whereas social approaches were heightened in individuals with CdCS. Social motivation, social communication, and enjoyment were significantly lower in CdLS. The findings highlight the importance of detailed observation when evaluating ASD and social behavior in genetic syndromes. ...
Clinical trial for Preleukemia | MYELODYSPLASTIC SYNDROME , Efficacy and Safety Study of Luspatercept (ACE-536) Versus Epoetin Alfa for the Treatment of Anemia Due to IPSS-R Very Low Low or Intermediate Risk Myelodysplastic Syndromes (MDS) in ESA Na ve Subjects Who Require Red Blood Cell Transfusions
Rioux JD, Daly M.J, Silverberg MS, Lindblad K, Steinhart H, Cohen Z, Delmonte T, Kocher K, Miller K, Guschwan S, Kulbokas EJ, OLeary S, Winchester E, Dewar K, Green T, Stone V, Chow C, Cohen A, Langelier D, Lapointe G, Gaudet D, Faith J, Branco N, Bull SB, McLeod RS, Griffiths AM, Bitton A, Greenberg GR, Lander ES, Siminovitch KA, Hudson TJ. Genetic variation in the 5q31 cytokine gene cluster confers susceptibility to Crohns disease. Nature Genetics 2001:29:223-228. PubMed PMID: 11586304.. ...
What is myelodysplastic syndromes mds? Learn about myelodysplastic syndromes mds symptoms, myelodysplastic syndromes mds causes, diagnosis, and more.
What is myelodysplastic syndromes mds? Learn about myelodysplastic syndromes mds symptoms, myelodysplastic syndromes mds causes, diagnosis, and more.
FYI - According to a recent article in the Journal of Clinical Oncology re: myelodysplastic syndromes (MDS): April 30, 2010 - Myelodysplastic syndromes (MDS) appear to be nearly 5 times more common...
Learn more about Cancer In Depth: Myelodysplastic Syndrome (MDS) at Coliseum Health System Main Page Risk Factors ...
Learn more about Other Treatments for Myelodysplastic Syndrome (MDS) at Grand Strand Medical Center Main Page Risk Factors ...
Learn more about Myelodysplastic Syndromes at Grand Strand Medical Center DefinitionCausesRisk FactorsSymptomsDiagnosisTreatmentPreventionrevision ...
Knowing what to expect if you have MDS can help. Learn about myelodysplastic syndromes, including risk factors, symptoms, diagnosis, and treatment.
Conor McGregor in a state of cat-like readiness. / Photo via Getty). Conor McGregor wowed Irish audiences with his destruction of Diego Brandao at UFC Fight Night 46. The Irish crowd was in love not only with McGregor, but with the sport itself. Their enthusiasm was infectious, bringing the festivities up from an 8/10 to a 10/10.. The action started off with a bang-especially on the prelims which saw four out of fix fights finished in dramatic fashion. Of note, The Wiki-less legend Ilir Latifi brutalized Chris Dempsey via TKO in the first round. He blasted Dempseys leg with kicks, and then just bum rushed him with punches. Wed describe it in more technical terms but thats pretty much exactly how the fight looked. The main card started off just as strong as the prelims. Norman Parke steamrolled through Naoyuki Kotani. Parke used him as a punching bag throughout the entire first round, landing punches, kicks, knees, and elbows and nearly finishing him as well. In the second, Parke picked up ...
National Geographic Emerging Explorer Dr. Luke Dollar, a biologist, has been returning to Madagascar for the past 17 years. Luke originally came to study lemurs, but after his study animal was eaten by the islands top predator, the Fossa, Luke switched to studying these mysterious cat-like animals. Madagascars forests, the fossas habitat, have declined nearly 93 percent, with the remaining 7 percent under pressure from an expanding human population. Lukes hope is to find a sustainable balance between the Malagasy people who depend on the forests, and the natural species that live there.
H. Joachim Deeg, Myelodysplastic Syndromes, 2nd edition English | ISBN: 3642362281 | 2013 | 220 pages | PDF | 4 MB The diagnosis of myelodysplastic
J Plast Reconstr Aesthet Surg. 2013 Jan;66(1):43-6. doi: 10.1016/j.bjps.2012.07.028. Epub 2012 Aug 20. Research Support, Non-U.S. Govt
Get online consultation for best treatment of Myelodysplastic Syndrome (MDS), Get a free 2nd opinion on Your Medical Problem, connect to the best doctors and hospitals for Myelodysplastic Syndrome (MDS) Treatment cost in India, Save upto 70-80% on cost of your treatment. ihealthkonnect
Kudos to anyone who can name this little critter. Its a Small-spotted Genet. Heres some info on this little creature, who seems to have a wild cats body and a raccoons tail. "Common genets have a slender, cat-like body 17-22" in length and a tail measuring 13-20." The legs are short, with cat-like feet and semi-retractile claws. They have a small head with a pointed muzzle, large oval ears, large eyes, and well-developed whiskers.The fur is dense and soft, and the coat is pale grey, with numerous black markings. The back and flanks are marked with about five rows of black spots, and a long black stripe runs along the middle of the back from the shoulders to the rump. There is also a black stripe on the forehead, and dark patches beneath the eyes, which are offset against the white fur of the chin and throat. The tail is striped, with anything from eight to thirteen rings along its length." Believe it or not, these curious animals were kept as pets and were introduced to the Iberian peninsula ...
To estimate the market of Myelodysplastic Syndrome (MDS) Treatment all over the world, market.us presents a report titled Myelodysplastic Syndrome (MDS) Treatment Market : Global Industry Analysis (2012 - 2018) and Opportunity Assessment (2019 - 2029). The research report offers a quantitative analysis of the my...
Learn more about Risk Factors for Myelodysplastic Syndrome (MDS) at Sky Ridge Medical Center Main Page Risk Factors Reducing Your Risk ...
The long-term goal of this project is to identify and characterize genes that contribute to the development and progression of myelodysplastic syndromes (MDS)....
Stevenson, W. and Garcia-Manero, G. (2010) Myelodysplastic Syndromes, in Leukemias: Principles and Practice of Therapy (eds S. Faderl and H. Kantarjian), Wiley-Blackwell, Oxford, UK. doi: 10.1002/9781444327359.ch8 ...
The purpose of this study is to determine the overall response rate in patients with myelodysplastic syndromes (MDS) given a daily dosing schedule of de
Cameron continued past the white-furred wolf, barely missing him as she passed his tree and widened her eyes in horror as a large branch appeared in front of her. Reacting with cat-like reflexes, Cam extended her claws and swung them over her head, cutting the wires from the chute cords and started to fall. She reached up and gripped the branch she was about to hit and caught the lower half of it before she lost her grip and was falling once again from about 25 feet above the ground. "Crap!" she called out as she righted herself in mid air and spotted another branch nearby. She reached over with her left paw and managed to catch this one, stopping her fall for a moment before the branch broke off and she was falling again. The brief moment she had contact with the second branch had given her a chance to regain her balance however, and the cheetahess managed to fall parallel to the tree the branch was attached to and dig her claws into the bark. She gritted her teeth as the handy feline claws dug ...
... Classification & external resources ICD-10 D46. ICD-9 238.7 ICD-O: 9980/0-9989/3 DiseasesDB 8604 eMedicine
I had been ill for sometime and when I went to hospital, the blood test showed something wrong, then a spinal tap was done and that confirmed it. I had chemo first and have had rituximab off and o ...
BioAssay record AID 161259 submitted by ChEMBL: Inhibitory concentration against platelet-derived growth factor receptor beta phosphorylation in CHO cells.
What is Sotos Syndrome ? Sotos syndrome is a genetic disorder that is rare and is characterized by excessive physical growth before birth and after it. It is
Find the best myelodysplastic syndrome doctors in Delhi NCR. Get guidance from medical experts to select myelodysplastic syndrome specialist in Delhi NCR from trusted hospitals - credihealth.com
Hi Tamara, Thanks for your interesting comments. Re the mitlas short tail: this feature was not given in Fawcetts own description of it, it only featured in relation to the alleged mitla skin obtained by Ivan Sanderson, which may, or may not, have been an actual mitla skin. Also, I hate to say it but I do worry somewhat about Sandersons extraordinary ability to encounter (at least according to his own claims) living specimens of unknown species (e.g. olitiau, an unidentified giant Cameroon bat; an African living dinosaur; a giant pink salamander on his own farm in North America; a fish that could make itself invisible in Trinidad) and skins or dead specimens of unknown animals(e.g. Bolivian mitla; Mexican ruffed cat; Minnesota iceman). If all of these claims were true, it would make him the most successful cryptozoologist of all time, yet they all share a common fundamental feature - there is no physical evidence to support any of them. Even skins that he claims to have obtained are always ...
Hi Pam We just purchased a Monoclonal Mouse Anti-Human ALK Protein, Clone ALK1 from DAKO. I havent had a chance to try it yet though. The code No. is M 7195. You can give them a call at 800-235-5763. Good Luck Denise Sapier Fred Hutchinson Cancer Research Center Clinical Pathology Shared Resources 206-667-2385 SC-111 ...
Learn more about Reducing Your Risk of Myelodysplastic Syndrome (MDS) at Medical City Dallas Main Page Risk Factors ...
Characteristic features of myelodysplastic syndrome (MDS) in humans. MDS is thought to originate from a mutated Hematopoietic stem cell (HSC). Approximately 30%
High-dose (40,000 IU twice/week) alpha recombinant human erythropoietin as single agent in low/intermediate risk myelodysplastic syndromes: a retrospective investigation on 133 patients treated in a single institution. - Antonio Azzarà, Giovanni Carulli, Sara Galimberti, Claudia Baratè, Rita Fazzi, Giulia Cervetti, Mario Petrini

A novel quantitative trait locus, qCL1, involved in semi-dwarfism derived from Japanese rice cultivar Nipponbare<...A novel quantitative trait locus, qCL1, involved in semi-dwarfism derived from Japanese rice cultivar Nipponbare<...

A QTL located on the short arm of chromosome 1, qCL1, was commonly detected near the simple sequence repeat (SSR) marker RM8068 ... A QTL located on the short arm of chromosome 1, qCL1, was commonly detected near the simple sequence repeat (SSR) marker RM8068 ... A QTL located on the short arm of chromosome 1, qCL1, was commonly detected near the simple sequence repeat (SSR) marker RM8068 ... A QTL located on the short arm of chromosome 1, qCL1, was commonly detected near the simple sequence repeat (SSR) marker RM8068 ...
more infohttps://okayama.pure.elsevier.com/en/publications/a-novel-quantitative-trait-locus-qcl1-involved-in-semi-dwarfism-d

Human apolipoprotein B transgenic mice generated with 207- and 145-kilobase pair bacterial artificial chromosomes. Evidence...Human apolipoprotein B transgenic mice generated with 207- and 145-kilobase pair bacterial artificial chromosomes. Evidence...

... and 145-kilobase pair bacterial artificial chromosomes. Evidence that a distant 5-element confers appropriate transgene ... Human apolipoprotein B transgenic mice generated with 207- and 145-kilobase pair bacterial artificial chromosomes. Evidence ... We reported previously that approximately 80-kilobase pair (kb) P1 bacteriophage clones spanning either the human or mouse apoB ... To test this possibility, transgenic mice were generated with 145- and 207-kb bacterial artificial chromosomes (BACs) that ...
more infohttps://scholars.duke.edu/display/pub643255

Homozygosity mapping of a gene locus for primary ciliary dyskinesia on chromosome 5p and identification of the heavy dynein...Homozygosity mapping of a gene locus for primary ciliary dyskinesia on chromosome 5p and identification of the heavy dynein...

Chromosome Mapping*. Chromosomes, Human, Pair 5*. Ciliary Motility Disorders / genetics*. Dyneins / genetics*. Genetic Markers ... 16923799 - Evidence for a colorectal cancer susceptibility locus on chromosome 3q21-q24 from a hig.... 8016089 - Chromosome 18 ... Previous Document: Epoxide formation from diallyl sulfone is associated with CYP2E1 inactivation in murine and human lu.... ... Next Document: Esterification of all-trans-retinol in normal human epithelial cell strains and carcinoma lines from.... ...
more infohttp://www.biomedsearch.com/nih/Homozygosity-mapping-gene-locus-primary/11062149.html

Theoretical model for the formation of a CatSper hetero | Open-iTheoretical model for the formation of a CatSper hetero | Open-i

Chromosome Mapping. *Chromosomes, Human, Pair 1/genetics. *Chromosomes, Human, Pair 5/genetics ... Health and Human Services • 8600 Rockville Pike,Bethesda,MD 20894 Privacy • Accessibility • Freedom of Information Act • ... Health and Human Services • 8600 Rockville Pike,Bethesda,MD 20894 Privacy • Accessibility • Freedom of Information Act • ... Identification of human and mouse CatSper3 and CatSper4 genes: characterisation of a common interaction domain and evidence for ...
more infohttps://openi.nlm.nih.gov/detailedresult.php?img=PMC184451_1477-7827-1-53-10&req=4

Meta-analysis of Genome-Wide Association Studies Identifies Three New Risk Loci for Atopic Dermatitis - PubMedMeta-analysis of Genome-Wide Association Studies Identifies Three New Risk Loci for Atopic Dermatitis - PubMed

Chromosomes, Human, Pair 11 / genetics Actions. * Search in PubMed * Search in MeSH ... Chromosome 11q13.5 Variant Associated With Childhood Eczema: An Effect Supplementary to Filaggrin Mutations GM ORegan et al. J ...
more infohttps://pubmed.ncbi.nlm.nih.gov/22197932/

acute myeloblastic leukaemia without maturation 2005:2010[pubdate] *count=100 - BioMedLib™ search engineacute myeloblastic leukaemia without maturation 2005:2010[pubdate] *count=100 - BioMedLib™ search engine

MeSH-major] Chromosome Aberrations. Chromosomes, Human, Pair 12. Chromosomes, Human, Pair 7. Leukemia, Myeloid, Acute / ... MeSH-major] Chromosome Deletion. Chromosomes, Human, Pair 11 / genetics. Chromosomes, Human, Pair 5 / genetics. Chromosomes, ... MeSH-major] Chromosomes, Human, Pair 15. Chromosomes, Human, Pair 17. Leukemia, Myeloid, Acute / genetics. Leukemia, ... MeSH-major] Chromosomes, Human, Pair 16 / genetics. Chromosomes, Human, Pair 22 / genetics. Leukemia, Myeloid, Acute / genetics ...
more infohttp://www.bmlsearch.com/?kwr=acute+myeloblastic+leukaemia+without+maturation+2005:2010%5Bpubdate%5D&cxts=100&stmp=b0

acute myelogenous leukemia without maturation fab m1 2005:2010[pubdate] *count=100 - BioMedLib™ search engineacute myelogenous leukemia without maturation fab m1 2005:2010[pubdate] *count=100 - BioMedLib™ search engine

MeSH-major] Chromosome Aberrations. Chromosomes, Human, Pair 12. Chromosomes, Human, Pair 7. Leukemia, Myeloid, Acute / ... MeSH-major] Chromosome Deletion. Chromosomes, Human, Pair 11 / genetics. Chromosomes, Human, Pair 5 / genetics. Chromosomes, ... MeSH-major] Chromosomes, Human, Pair 15. Chromosomes, Human, Pair 17. Leukemia, Myeloid, Acute / genetics. Leukemia, ... MeSH-major] Chromosomes, Human, Pair 16 / genetics. Chromosomes, Human, Pair 22 / genetics. Leukemia, Myeloid, Acute / genetics ...
more infohttp://www.bmlsearch.com/?kwr=acute+myelogenous+leukemia+without+maturation+fab+m1+2005:2010%5Bpubdate%5D&cxts=100&stmp=b0

Equine synteny mapping of comparative anchor tagged sequences (CATS) from human Chromosome 5<...Equine synteny mapping of comparative anchor tagged sequences (CATS) from human Chromosome 5<...

Equine synteny mapping of comparative anchor tagged sequences (CATS) from human Chromosome 5. / Caetano, Alexandre R.; Lyons, ... Equine synteny mapping of comparative anchor tagged sequences (CATS) from human Chromosome 5. Mammalian Genome. 1999;10(11): ... These data, in conjunction with earlier human chromosome painting studies of the horse karyotype and synteny mapping of horse ... These data, in conjunction with earlier human chromosome painting studies of the horse karyotype and synteny mapping of horse ...
more infohttps://ucdavis.pure.elsevier.com/en/publications/equine-synteny-mapping-of-comparative-anchor-tagged-sequences-cat

Unusual Stüve-Wiedemann syndrome with complete maternal chromosome 5 isodisomy<...Unusual Stüve-Wiedemann syndrome with complete maternal chromosome 5 isodisomy<...

Skin biopsies provide the first human evidence of failed postnatal cholinergic differentiation of sympathetic neurons ... Unusual Stüve-Wiedemann syndrome with complete maternal chromosome 5 isodisomy. Mariarosa A.B. Melone, Michael J. Pellegrino, ... Unusual Stüve-Wiedemann syndrome with complete maternal chromosome 5 isodisomy. Annals of Clinical and Translational Neurology ... Unusual Stüve-Wiedemann syndrome with complete maternal chromosome 5 isodisomy. / Melone, Mariarosa A.B.; Pellegrino, Michael J ...
more infohttps://ohsu.pure.elsevier.com/en/publications/unusual-st%C3%BCve-wiedemann-syndrome-with-complete-maternal-chromosom

John Douglas Mcpherson - Fingerprint
     - UC DavisJohn Douglas Mcpherson - Fingerprint - UC Davis

Chromosomes, Human, Pair 7 Cell Line RNA Sequence Analysis Gene Library Shaw Potassium Channels ...
more infohttps://ucdavis.pure.elsevier.com/en/persons/john-douglas-mcpherson/fingerprints/

Daniel Hale, MD - Research Output
     - Penn StateDaniel Hale, MD - Research Output - Penn State

Chromosomes, Human, Pair 18 Gene Dosage Chromosome Duplication Phenotype Molecular Sequence Annotation ... Recombinant human growth hormone plus recombinant human insulin-like growth factor-1 coadministration therapy in short children ... Genome Mapping and Genomics in Human and Non-Human Primates. Springer Berlin Heidelberg, p. 181-245 65 p.. Research output: ... Chromosome 18 gene dosage map 2.0. Cody, J. D., Heard, P., Rupert, D., Hasi-Zogaj, M., Hill, A., Sebold, C. & Hale, D., Dec 1 ...
more infohttps://pennstate.pure.elsevier.com/en/persons/daniel-hale/publications/

A fine physical map of the rice chromosome 5<...A fine physical map of the rice chromosome 5<...

Bacterial Artificial Chromosomes Chromosomes, Human, Pair 5 Artificial Chromosomes Clone Cells Centromere ... A fine physical map of the rice chromosome 5. Chia Hsiung Cheng, Mei Chu Chung, Shu Mei Liu, Shi Kuang Chen, Fang Yi Kao, Shu ... A fine physical map of the rice chromosome 5. / Cheng, Chia Hsiung; Chung, Mei Chu; Liu, Shu Mei; Chen, Shi Kuang; Kao, Fang Yi ... A fine physical map of the rice chromosome 5. 於: Molecular Genetics and Genomics. 2005 ; 卷 274, 編號 4. 頁 337-345. ...
more infohttps://tmu.pure.elsevier.com/zh/publications/a-fine-physical-map-of-the-rice-chromosome-5

Genomic organization of the genes GTF2IRD1, GTF2I, and Ncf1 at the mouse chromosome 5 region syntenic to the human chromosome...Genomic organization of the genes GTF2IRD1, GTF2I, and Ncf1 at the mouse chromosome 5 region syntenic to the human chromosome...

We have isolated and analyzed the sequence of bacterial artificial chromosome clones from the syntenic mouse chromosome 5 ... We have isolated and analyzed the sequence of bacterial artificial chromosome clones from the syntenic mouse chromosome 5 ... We have isolated and analyzed the sequence of bacterial artificial chromosome clones from the syntenic mouse chromosome 5 ... We have isolated and analyzed the sequence of bacterial artificial chromosome clones from the syntenic mouse chromosome 5 ...
more infohttps://einstein.pure.elsevier.com/en/publications/genomic-organization-of-the-genes-gtf2ird1-gtf2i-and-ncf1-at-the--2

Mette Sørensen - Publikationer
     - Syddansk UniversitetMette Sørensen - Publikationer - Syddansk Universitet

Tan, Q., Jacobsen, R., Sørensen, M., Christiansen, L., Kruse, T. A. & Christensen, K., 2013, I : European Journal of Human ... Age‐dependent DNA methylation patterns on the Y chromosome in elderly males. Lund, J. B., Li, S., Christensen, K., Mengel-From ... A genome-wide integrative study of DNA methylation and gene expression on later life cognitive function focusing on intra-pair ... 2012, I : Annals of Human Genetics. 76, 5, s. 414-415. Publikation: Bidrag til tidsskrift › Konferenceabstrakt i tidsskrift › ...
more infohttps://portal.findresearcher.sdu.dk/da/persons/msoerensen/publications/

Marta Chesi, PhD - Research Output
     - Mayo ClinicMarta Chesi, PhD - Research Output - Mayo Clinic

A structurally distinct human mycoplasma protein that generically blocks antigen-antibody union. Grover, R. K., Zhu, X., ... Chromosomes Cyclin D Chromosomes, Human, Pair 5 Immunoglobulin Genes 22 Citations (Scopus) ... Importin-β and exportin-5 are strong biomarkers of productive reoviral infection of cancer cells. Nuovo, G., Tran, H., ... Preclinical screening of histone deacetylase inhibitors combined with ABT-737, rhTRAIL/MD5-1 or 5-azacytidine using syngeneic ...
more infohttps://mayoclinic.pure.elsevier.com/en/persons/marta-chesi/publications/?type=%2Fdk%2Fatira%2Fpure%2Fresearchoutput%2Fresearchoutputtypes%2Fcontributiontojournal%2Farticle

Elaine R Morgan - Research Output
     - Northwestern ScholarsElaine R Morgan - Research Output - Northwestern Scholars

Chromosomes Acute Myeloid Leukemia Chromosome Aberrations Chromosomes, Human, Pair 5 1988 36 Citations (Scopus) ... Shani-Adir, A., Chou, P. M., Morgan, E. R. & Mancini, A. J., Sep 1 2002, In : Pediatric dermatology. 19, 5, p. 419-422 4 p.. ... Bhisitkul, D. M., Morgan, E. R., Vozar, M. A. & Langman, C., Jan 1 1991, In : The Journal of pediatrics. 118, 5, p. 698-702 5 p ... Morgan, E. R. & Murphy, S. B., Feb 3 2000, In : New England Journal of Medicine. 342, 5, p. 347-348 2 p.. Research output: ...
more infohttps://www.scholars.northwestern.edu/en/persons/elaine-r-morgan/publications/

Jørgen Vestbo - Research Output
     - University of Southern DenmarkJørgen Vestbo - Research Output - University of Southern Denmark

Chromosomes, Human, Pair 5 Polygenic analysis of genome-wide SNP data identifies common variants on allergic rhinitis. ... Human microfibril-associated protein 4 is highly expressed in heart and lung. Johansson, H. W., Johansson, S. L., Schlosser, A. ...
more infohttps://portal.findresearcher.sdu.dk/en/persons/jvestbo/publications/?type=%2Fdk%2Fatira%2Fpure%2Fresearchoutput%2Fresearchoutputtypes%2Fcontributiontoconference%2Fposter

Function, molecular structure and gene expression of stem cell factor (SCF)<...Function, molecular structure and gene expression of stem cell factor (SCF)<...

Chromosomes, Human, Pair 10 Chromosomes, Human, Pair 5 Macrophage Colony-Stimulating Factor ... The W locus in murine chromosome 5 encodes the c-kit proto-oncogene and the Sl locus in chromosome 10 encodes the ligand for c- ... The W locus in murine chromosome 5 encodes the c-kit proto-oncogene and the Sl locus in chromosome 10 encodes the ligand for c- ... The W locus in murine chromosome 5 encodes the c-kit proto-oncogene and the Sl locus in chromosome 10 encodes the ligand for c- ...
more infohttps://keio.pure.elsevier.com/en/publications/function-molecular-structure-and-gene-expression-of-stem-cell-fac

Elaine R Morgan - Research Output
     - Northwestern ScholarsElaine R Morgan - Research Output - Northwestern Scholars

Chromosomes, Human, Pair 9 Genetic Translocation Chromosomes, Human, Pair 11 1987 28 Citations (Scopus) ... Bhisitkul, D. M., Morgan, E. R., Vozar, M. A. & Langman, C., Jan 1 1991, In : The Journal of pediatrics. 118, 5, p. 698-702 5 p ... Cohn, S. L., Morgan, E. R. & Mallette, L. E., Jan 1 1987, In : Cancer. 59, 2, p. 346-350 5 p.. Research output: Contribution to ... Morgan, E. R., Jan 1 1984, In : Medical and Pediatric Oncology. 12, 1, p. 4-8 5 p.. Research output: Contribution to journal › ...
more infohttps://www.scholars.northwestern.edu/en/persons/elaine-r-morgan/publications/?type=%2Fdk%2Fatira%2Fpure%2Fresearchoutput%2Fresearchoutputtypes%2Fcontributiontojournal%2Farticle

林 哲也 - 研究成果
     - 九州大学林 哲也 - 研究成果 - 九州大学

Complete chromosome sequence of a mycolactoneproducing mycobacterium, Mycobacterium pseudoshottsii. Yoshida, M., Miyamoto, Y., ... Escherichia coli in diarrhoeic calves and comparative genomics of O5 bovine and human STEC. Fakih, I., Thiry, D., Duprez, J. N ... Coli lineages are serving as evolutionary sources of the emergence of human intestinal pathogenic strains. Arimizu, Y., Kirino ... Inoue, K., Ogura, Y., Kawano, Y. & Hayashi, T., 5 1 2018, : : Genome Announcements. 6, 19, e00352-18.. 研究成果: ジャーナルへの寄稿 › 記事 ...
more infohttps://kyushu-u.pure.elsevier.com/ja/persons/tetsuya-hayashi/publications/?type=%2Fdk%2Fatira%2Fpure%2Fresearchoutput%2Fresearchoutputtypes%2Fcontributiontojournal%2Farticle

Beth Habecker - Publications
     - Oregon Health & Science UniversityBeth Habecker - Publications - Oregon Health & Science University

Unusual Stüve-Wiedemann syndrome with complete maternal chromosome 5 isodisomy. Melone, M. A. B., Pellegrino, M. J., Nolano, M ... Shi, X., Woodward, W. & Habecker, B., Jun 2012, In : Journal of Neurochemistry. 121, 5, p. 700-704 5 p.. Research output: ... Hasan, W., Woodward, W. & Habecker, B., Oct 31 2012, In : Neuroscience Letters. 529, 1, p. 55-59 5 p.. Research output: ... Pellegrino, M. J., McCully, B. & Habecker, B., Apr 30 2014, In : Neuroscience Letters. 566, p. 1-5 5 p.. Research output: ...
more infohttps://ohsu.pure.elsevier.com/en/persons/beth-habecker/publications/?type=%2Fdk%2Fatira%2Fpure%2Fresearchoutput%2Fresearchoutputtypes%2Fcontributiontojournal%2Farticle

Dysgranulopoiesis is an independent adverse prognostic factor in chronic myeloid disorders with an isolated interstitial...Dysgranulopoiesis is an independent adverse prognostic factor in chronic myeloid disorders with an isolated interstitial...

Chromosome Deletion Chromosomes, Human, Pair 5 Myelodysplastic Syndromes Granulocytes Young Adult Chronic Disease ... is an independent adverse prognostic factor in chronic myeloid disorders with an isolated interstitial deletion of chromosome ... is an independent adverse prognostic factor in chronic myeloid disorders with an isolated interstitial deletion of chromosome ... is an independent adverse prognostic factor in chronic myeloid disorders with an isolated interstitial deletion of chromosome ...
more infohttps://mayoclinic.pure.elsevier.com/en/publications/dysgranulopoiesis-is-an-independent-adverse-prognostic-factor-in-

Find Research Outputs
             - Discovery - the University of Dundee Research PortalFind Research Outputs - Discovery - the University of Dundee Research Portal

Chromosomes, Human, Pair 5 Chromosomes, Human, Pair 6 Caenorhabditis elegans Meiosis meiosis ... Carroll, T., Newton, I., Chen, Y., Blow, J. & Nathke, I., 7 May 2018, In : Journal of Cell Biology. 217, 5, p. 1667-1685 19 p. ... Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis ... 5, p. 425-429 5 p.. Research output: Contribution to journal › Article ...
more infohttps://discovery.dundee.ac.uk/en/publications/?showAdvanced=false&allConcepts=true&inferConcepts=true&publicationYear=2016&publicationYear=2017&publicationYear=2018&publicationYear=2019&publicationYear=2020&author=56c608e7-d3a1-4014-9a2a-6fd633060b32

Gendoo - Relevant featuresGendoo - Relevant features

Chromosomes, Human, Pair 2 ヒト第2染色体 Chromosomes, Human, Pair 3 ヒト第3染色体 ...
more infohttp://gendoo.dbcls.jp/cgi-bin/gendoo.cgi?geneid=10682&taxonomy=human

Find Research Outputs
             - UNT Health Science CenterFind Research Outputs - UNT Health Science Center

Genetic mapping of 15 human X chromosomal forensic short tandem repeat (STR) loci by means of multi-core parallelization. ... American Journal of Human Biology. 27, 3, p. 407-416 10 p.. Research output: Contribution to journal › Article ... 5, p. e456-e458. Research output: Contribution to journal › Article ... 207-211 5 p.. Research output: Contribution to journal › Article ...
more infohttps://experts.unthsc.edu/en/publications/?descending=true&showAdvanced=false&allConcepts=true&inferConcepts=true&publicationYear=2015&publicationYear=2016&publicationYear=2017&publicationYear=2018&publicationYear=2019&author=d4d18227-cdea-43e6-beee-56cf54dc63b1
  • Identification of human and mouse CatSper3 and CatSper4 genes: characterisation of a common interaction domain and evidence for expression in testis. (nih.gov)
  • However, neither CatSper1 or CatSper2 have been shown to function as cation channels when transfected into cells, singly or in conjunction.We have identified a further two novel CatSper genes, conserved in both the human and mouse genomes.Furthermore, all four of the CatSper proteins are predicted to contain a common coiled-coil protein-protein interaction domain in their C-terminal tail. (nih.gov)
  • We have identified a further two novel CatSper genes, conserved in both the human and mouse genomes. (nih.gov)
  • They discovered that chromosome 19 has the highest gene density of any human chromosome, and were able to link certain genes on the chromosome to genetic diseases including insulin-resistant diabetes. (wikipedia.org)
  • We reported previously that approximately 80-kilobase pair (kb) P1 bacteriophage clones spanning either the human or mouse apoB gene (clones p158 and p649, respectively) confer apoB expression in the liver of transgenic mice, but not in the intestine. (duke.edu)
  • We localized a new gene locus for PCD to a region of homozygosity by descent on chromosome 5p15-p14 with a parametric multipoint logarithm of odds ratio (LOD) score of Zmax = 3.51 flanked by markers D5S2095 and D5S502 within an interval of 20 centimorgans sex-averaged genetic distance. (biomedsearch.com)
  • The W locus in murine chromosome 5 encodes the c-kit proto-oncogene and the Sl locus in chromosome 10 encodes the ligand for c-kit, which has been named stem cell factor (SCF), mast cell growth factor (MGF), kit ligand (KL) and steel factor (SL). (elsevier.com)
  • Using human proteins, an affinity chromatography ran on TMEM33 showed that the protein bound to reticulon 4C, 1A, 2B, 3C, and Arl6IP1 in vitro. (wikipedia.org)
  • Evidence that a distant 5'-element confers appropriate transgene expression in the intestine. (duke.edu)
  • Skin biopsies provide the first human evidence of failed postnatal cholinergic differentiation of sympathetic neurons innervating sweat glands in cold-induced sweating, and of a neuropathy. (elsevier.com)
  • To determine whether the regulatory element was located 5' or 3' to the apoB gene, transgenic mice were generated by co-microinjecting embryos with p158 and either the 5'- or 3'-sequences from the 145-kb BAC. (duke.edu)
  • Human TMEM33 has phosphorylation predicted on serine residues 197 and 198 and threonine residues 5, 127, and 193. (wikipedia.org)
  • TMEM33 is conserved throughout all animals, similarity to human TMEM33 is >80% for all vertebrates and >60% for all invertebrates. (wikipedia.org)
  • POT1 is a 3′ telomeric single-stranded overhang binding protein that has been implicated in chromosome end protection,the regulation of telomerase function,and defining the 5chromosome terminus. (elsevier.com)
  • The largest and most common human TMEM33 protein is 247 amino acid long protein with 3 transmembrane domains. (wikipedia.org)
  • Here, we show that diploid human fibroblasts in which hPOT1 expression has been suppressed harbor telomeres that are longer than control cells. (elsevier.com)