An enzyme that catalyzes the oxidation of cholesterol in the presence of molecular oxygen to 4-cholesten-3-one and hydrogen peroxide. The enzyme is not specific for cholesterol, but will also oxidize other 3-hydroxysteroids. EC 1.1.3.6.
A gram-positive organism found in dairy products, fresh and salt water, marine organisms, insects, and decaying organic matter.
The principal sterol of all higher animals, distributed in body tissues, especially the brain and spinal cord, and in animal fats and oils.
CHOLESTENES with one or more double bonds and substituted by any number of keto groups.
Catalyze the oxidation of 3-hydroxysteroids to 3-ketosteroids.
Fatty acid esters of cholesterol which constitute about two-thirds of the cholesterol in the plasma. The accumulation of cholesterol esters in the arterial intima is a characteristic feature of atherosclerosis.
Steroids in which fission of one or more ring structures and concomitant addition of a hydrogen atom at each terminal group has occurred.
Cholesterol present in food, especially in animal products.
A flavoprotein enzyme that catalyzes the univalent reduction of OXYGEN using NADPH as an electron donor to create SUPEROXIDE ANION. The enzyme is dependent on a variety of CYTOCHROMES. Defects in the production of superoxide ions by enzymes such as NADPH oxidase result in GRANULOMATOUS DISEASE, CHRONIC.
Cholesterol which is contained in or bound to high-density lipoproteins (HDL), including CHOLESTEROL ESTERS and free cholesterol.
A colorless liquid made by oxidation of aliphatic hydrocarbons that is used as a solvent and chemical intermediate.
Cholesterol which is contained in or bound to low density lipoproteins (LDL), including CHOLESTEROL ESTERS and free cholesterol.
A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.
A genus of fleshy shelf basidiomycetous fungi, family Schizophyllaceae, order POLYPORALES, growing on woody substrata. It is pathogenic in humans.
An enzyme that catalyzes the hydrolysis of CHOLESTEROL ESTERS and some other sterol esters, to liberate cholesterol plus a fatty acid anion.
A condensation product of riboflavin and adenosine diphosphate. The coenzyme of various aerobic dehydrogenases, e.g., D-amino acid oxidase and L-amino acid oxidase. (Lehninger, Principles of Biochemistry, 1982, p972)
Derivatives of the dimethylisoalloxazine (7,8-dimethylbenzo[g]pteridine-2,4(3H,10H)-dione) skeleton. Flavin derivatives serve an electron transfer function as ENZYME COFACTORS in FLAVOPROTEINS.
Six-carbon saturated hydrocarbon group of the methane series. Include isomers and derivatives. Various polyneuropathies are caused by hexane poisoning.
A species of RHODOCOCCUS found in soil, herbivore dung, and in the intestinal tract of cows, horses, sheep, and pigs. It causes bronchopneumonia in foals and can be responsible for infection in humans compromised by immunosuppressive drug therapy, lymphoma, or AIDS.
A bacterial genus of the order ACTINOMYCETALES.
Steroids with a hydroxyl group at C-3 and most of the skeleton of cholestane. Additional carbon atoms may be present in the side chain. (IUPAC Steroid Nomenclature, 1987)
Cyclic GLUCANS consisting of seven (7) glucopyranose units linked by 1,4-glycosidic bonds.
A homologous group of cyclic GLUCANS consisting of alpha-1,4 bound glucose units obtained by the action of cyclodextrin glucanotransferase on starch or similar substrates. The enzyme is produced by certain species of Bacillus. Cyclodextrins form inclusion complexes with a wide variety of substances.
A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).
An extensive order of basidiomycetous fungi whose fruiting bodies are commonly called mushrooms.
The rate dynamics in chemical or physical systems.
A membrane-bound cytochrome P450 enzyme that catalyzes the 7-alpha-hydroxylation of CHOLESTEROL in the presence of molecular oxygen and NADPH-FERRIHEMOPROTEIN REDUCTASE. This enzyme, encoded by CYP7, converts cholesterol to 7-alpha-hydroxycholesterol which is the first and rate-limiting step in the synthesis of BILE ACIDS.
An iron-molybdenum flavoprotein containing FLAVIN-ADENINE DINUCLEOTIDE that oxidizes hypoxanthine, some other purines and pterins, and aldehydes. Deficiency of the enzyme, an autosomal recessive trait, causes xanthinuria.
A genus of gram-positive, aerobic bacteria whose species are widely distributed and are abundant in soil. Some strains are pathogenic opportunists for humans and animals.
An enzyme that catalyzes the oxidative deamination of naturally occurring monoamines. It is a flavin-containing enzyme that is localized in mitochondrial membranes, whether in nerve terminals, the liver, or other organs. Monoamine oxidase is important in regulating the metabolic degradation of catecholamines and serotonin in neural or target tissues. Hepatic monoamine oxidase has a crucial defensive role in inactivating circulating monoamines or those, such as tyramine, that originate in the gut and are absorbed into the portal circulation. (From Goodman and Gilman's, The Pharmacological Basis of Therapeutics, 8th ed, p415) EC 1.4.3.4.
Detailed account or statement or formal record of data resulting from empirical inquiry.
A non-essential amino acid that is involved in the metabolic control of cell functions in nerve and brain tissue. It is biosynthesized from ASPARTIC ACID and AMMONIA by asparagine synthetase. (From Concise Encyclopedia Biochemistry and Molecular Biology, 3rd ed)
A low-energy attractive force between hydrogen and another element. It plays a major role in determining the properties of water, proteins, and other compounds.
A 21-carbon steroid, derived from CHOLESTEROL and found in steroid hormone-producing tissues. Pregnenolone is the precursor to GONADAL STEROID HORMONES and the adrenal CORTICOSTEROIDS.
The outer layer of the adrenal gland. It is derived from MESODERM and comprised of three zones (outer ZONA GLOMERULOSA, middle ZONA FASCICULATA, and inner ZONA RETICULARIS) with each producing various steroids preferentially, such as ALDOSTERONE; HYDROCORTISONE; DEHYDROEPIANDROSTERONE; and ANDROSTENEDIONE. Adrenal cortex function is regulated by pituitary ADRENOCORTICOTROPIN.
The guidelines and policy statements set forth by the editor(s) or editorial board of a publication.
A publication issued at stated, more or less regular, intervals.
An organized procedure carried out by a select committee of professionals in evaluating the performance of other professionals in meeting the standards of their specialty. Review by peers is used by editors in the evaluation of articles and other papers submitted for publication. Peer review is used also in the evaluation of grant applications. It is applied also in evaluating the quality of health care provided to patients.
"The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.
The evaluation by experts of the quality and pertinence of research or research proposals of other experts in the same field. Peer review is used by editors in deciding which submissions warrant publication, by granting agencies to determine which proposals should be funded, and by academic institutions in tenure decisions.
A quantitative measure of the frequency on average with which articles in a journal have been cited in a given period of time.
Exclusive legal rights or privileges applied to inventions, plants, etc.
That phase of a muscle twitch during which a muscle returns to a resting position.
Any of a variety of procedures which use biomolecular probes to measure the presence or concentration of biological molecules, biological structures, microorganisms, etc., by translating a biochemical interaction at the probe surface into a quantifiable physical signal.
The utilization of an electrical current to measure, analyze, or alter chemicals or chemical reactions in solution, cells, or tissues.
Determination, by measurement or comparison with a standard, of the correct value of each scale reading on a meter or other measuring instrument; or determination of the settings of a control device that correspond to particular values of voltage, current, frequency or other output.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The study of chemical changes resulting from electrical action and electrical activity resulting from chemical changes.
The industry concerned with processing, preparing, preserving, distributing, and serving of foods and beverages.
Rare cutaneous eruption characterized by extensive KERATINOCYTE apoptosis resulting in skin detachment with mucosal involvement. It is often provoked by the use of drugs (e.g., antibiotics and anticonvulsants) or associated with PNEUMONIA, MYCOPLASMA. It is considered a continuum of Toxic Epidermal Necrolysis.
Fluids restored to the body in order to maintain normal water-electrolyte balance.
Chemistry dealing with the composition and preparation of agents having PHARMACOLOGIC ACTIONS or diagnostic use.
Therapy whose basic objective is to restore the volume and composition of the body fluids to normal with respect to WATER-ELECTROLYTE BALANCE. Fluids may be administered intravenously, orally, by intermittent gavage, or by HYPODERMOCLYSIS.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The condition that results from excessive loss of water from a living organism.
Usually inert substances added to a prescription in order to provide suitable consistency to the dosage form. These include binders, matrix, base or diluent in pills, tablets, creams, salves, etc.

Scavenger receptor BI (SR-BI) mediates free cholesterol flux independently of HDL tethering to the cell surface. (1/160)

In addition to its effect on high density lipoprotein (HDL) cholesteryl ester (CE) uptake, scavenger receptor BI (SR-BI) was recently reported to stimulate free cholesterol (FC) flux from Chinese hamster ovary (CHO) cells stably expressing mouse SR-BI, a novel function of SR-BI that may play a role in cholesterol removal from the vessel wall where the receptor can be found. It is possible that SR-BI stimulates flux simply by tethering acceptor HDL particles in close apposition to the cell surface thereby facilitating the movement of cholesterol between the plasma membrane and HDL. To test this, we used transiently transfected cells and compared the closely related class B scavenger receptors mouse SR-BI and rat CD36 for their ability to stimulate cholesterol efflux as both receptors bind HDL with high affinity. The results showed that, although acceptor binding to SR-BI may contribute to efflux to a modest extent, the major stimulation of FC efflux occurs independently of acceptor binding to cell surface receptors. Instead our data indicate that SR-BI mediates alterations to membrane FC domains which provoke enhanced bidirectional FC flux between cells and extracellular acceptors.  (+info)

Two moles of O2 consumption and one mole of H2O2 formation during cholesterol peroxidation with cholesterol oxidase from Pseudomonas sp. strain ST-200. (2/160)

Cholesterol oxidase from Pseudomonas sp. strain ST-200 oxidized cholesterol and cholestanol to 6beta-hydroperoxycholest-4-en-3-one and 5alpha-cholestan-3-one respectively. The former was converted spontaneously to several oxysteroids such as 6-hydroxycholest-4-en-3-one and cholest-4-ene-3,6-dione, with the consumption of 2 mol of O(2) and the formation of 1 mol of H(2)O(2) for each mole of cholesterol oxidized. An oxidized form of the cholesterol oxidase dehydrogenates cholesterol, probably to the 5-en-3-one derivative. A reduced form of the enzyme, yielded from the cholesterol dehydrogenation reaction, dioxygenated cholest-5-en-3-one to 6beta-hydroperoxycholest-4-en-3-one.  (+info)

Kinetic mechanisms of cholesterol oxidase from Streptomyces hygroscopicus and Brevibacterium sterolicum. (3/160)

The kinetic properties of two cholesterol oxidases, one from Brevibacterium sterolicum (BCO) the other from Streptomyces hygroscopicus (SCO) were investigated. BCO works via a ping-pong mechanism, whereas the catalytic pathway of SCO is sequential. The turnover numbers at infinite cholesterol and oxygen concentrations are 202 s-1 and 105 s-1 for SCO and BCO, respectively. The rates of flavin reduction extrapolated to saturating substrate concentration, under anaerobic conditions, are 235 s-1 for BCO and 232 s-1 for SCO (in the presence of 1% Thesit and 10% 2-propanol). With reduced SCO the rate of Delta5-6-->Delta4-5 isomerization of the intermediate 5-cholesten-3-one to final product is slow (0.3 s-1). With oxidized SCO and BCO the rate of isomerization is much faster ( approximately 300 s-1), thus it is not rate-limiting for catalysis. The kinetic behaviour of both reduced COs towards oxygen is unusual in that they exhibit apparent saturation with increasing oxygen concentrations (extrapolated rates approximately 250 s-1 and 1.3 s-1, for BCO and SCO, respectively): too slow to account for catalysis. For BCO the kinetic data are compatible with a step preceding the reaction with oxygen, involving interconversion of reactive and nonreactive forms of the enzyme. We suggest that the presence of micelles in the reaction medium, due to the necessary presence of detergents to solubilize the substrate, influence the availability or reactivity of oxygen towards the enzyme. The rate of re-oxidation of SCO in the presence of product is also too slow to account for catalysis, probably due to the impossibility of producing quantitatively the reduced enzyme-product complexes.  (+info)

Increased proximal tubular cholesterol content: implications for cell injury and "acquired cytoresistance". (4/160)

BACKGROUND: Acute renal failure (ARF) leads to secondary adaptive changes that serve to protect proximal tubules from subsequent ischemic or toxic damage [so-called "acquired cytoresistance" (CR)]. A characteristic of CR is increased plasma membrane resistance to attack. Therefore, this study sought to identify potential changes in plasma membrane lipid composition in CR tubules/renal cortex and, if present, to test whether they might mechanistically contribute to the CR state. METHODS: Renal cortices/isolated tubules were obtained from CR mouse kidneys (18-hr postinduction of ischemia reperfusion, myoglobinuria, or ureteral obstruction). Their plasma membrane phospholipid/cholesterol profiles were compared with those observed in either control tissues or tissues obtained one to two hours post-renal damage (that is, prior to emergence of CR). RESULTS: Either no changes or inconsistent changes in phospholipid profiles were observed in CR tissues. Conversely, CR (vs. control) tissues demonstrated a consistent 25 to 50% increase in membrane cholesterol content. To ascertain whether cholesterol impacts tubule susceptibility to injury, its levels were reduced in proximal tubule (HK-2) cells with either (a) mevastatin, (b) a cholesterol "stripping" agent, (c) cholesterol oxidase, or (d) cholesterol esterase. Then cell susceptibility to injury [adenosine 5'-triphosphate (ATP) depletion; Fe-mediated oxidant stress] was assessed. In each instance, cholesterol reductions dramatically sensitized to superimposed injury (for example, a 2 to 3 times increase in the % of lactate dehydrogenase release). When cholesterol levels were restored to normal in CR tubules (with a "stripping" agent), an increased tubule susceptibility to injury resulted. Because cholesterol decreases membrane fluidity, the impact of a membrane-fluidizing agent (A2C) on cell injury was assessed. A2C dramatically sensitized HK-2 cells to superimposed attack. CONCLUSIONS: ARF leads to an up-regulation of proximal tubule cholesterol content. The latter may then contribute to acquired CR, possibly by stabilizing the plasma membrane via its antifluidizing effect.  (+info)

Cholesterol oxidation switches the internalization pathway of endothelin receptor type A from caveolae to clathrin-coated pits in Chinese hamster ovary cells. (5/160)

We investigated the mechanism of endothelin receptor type A (ETA) internalization in Chinese hamster ovary cells using two assays; flow cytometric quantification of cell surface myc-ETA and in situ localization of Cy5-labeled ET-1. In both assays, agonist-dependent internalization of myc-ETA was inhibited by nystatin and filipin, both of which disrupt internalization via caveolae, whereas it was barely affected by chlorpromazine and hypertonic sucrose, both of which disrupt internalization via clathrin-coated pits. In addition to myc-ETA, ET-1 caused intracellular translocation of caveolin-1 and this translocation was also blocked by nystatin but not by chlorpromazine. These results strongly argue that ETA is internalized via caveolae but not clathrin-coated pits. Treatment of the cells with cholesterol oxidase reduced cellular cholesterol and caused intracellular translocation of caveolin-1 but did not affect cell surface localization of myc-ETA. In cholesterol oxidase-treated cells, however, both chlorpromazine and hypertonic sucrose effectively blocked ET-1-induced myc-ETA internalization and nystatin was less effective than in untreated cells. Accordingly, expression of a dominant negative form of beta-arrestin blocked myc-ETA internalization in cholesterol oxidase-treated cells but not in untreated cells. These results suggest that, in Chinese hamster ovary cells, 1) agonist-occupied ETA can be internalized either via caveolae or clathrin-coated pits; 2) of the two, the former is the default pathway; and 3) the oxidative state of cell surface cholesterol is one of the factors involved in the pathway selection.  (+info)

Comparison of a new method for the direct and simultaneous assessment of LDL- and HDL-cholesterol with ultracentrifugation and established methods. (6/160)

BACKGROUND: Automated electrophoresis combined with enzymatic cholesterol staining might improve routine assessment of LDL- and HDL-cholesterol (LDLC and HDLC), as an alternative to the Friedewald equation and precipitation. A new method (Hydrasys; SEBIA) that adapts the cholesterol esterase/cholesterol oxidase reaction within urea-free gels was evaluated. METHODS: Fresh sera from 725 subjects (512 dyslipidemics) were analyzed by electrophoresis, in parallel with sequential ultracentrifugation, beta-quantification, calculation, and precipitation. RESULTS: Electrophoresis was linear up to 4 g/L cholesterol, with a detection limit of 0.042 g/L cholesterol/band. Within-run, between-run, between-batch, and between-operator imprecision (CVs) were 1.6%, 2.0%, 1.5%, and 2.7% for LDLC, and 3.9%, 4.3%, 5.5%, and 4.9% for HDLC, and remained unchanged up to 6.3 g/L plasma triglycerides (TGs). Precision decreased with very low HDLC (<0.25 g/L). Serum storage for 3-7 days at +4 or -80 degrees C did not interfere significantly with the assay. Agreement with beta-quantification was stable for LDLC up to 5.07 g/L (r = 0.94), even at TG concentrations >4 g/L (r = 0.91). Bias (2.88% +/- 12%) and total error (7.84%) were unchanged at TG concentrations up to 18.5 g/L. Electrophoresis predicted National Cholesterol Education Program cut-points with <0.04 g/L error, exactly and appropriately classified 79% and 96% of the subjects, and divided by 2.4 (all subjects) and 5.8 (TGs >1.5 g/L) the percentage of subjects underestimated by calculation. One-half of the patients with TGs >4 g/L had LDLC >1.30 g/L. For HDLC, correlation was better with precipitation (r = 0.87) than ultracentrifugation (r = 0.76). Error (-0.10% +/- 26%) increased when HDLC decreased (<0.35 g/L). Direct assessment of the LDLC/HDLC ratio detected 45% more high-risk subjects than the calculation/precipitation combination. CONCLUSIONS: Electrophoresis provides reliable quantification of LDLC, improving precision, accuracy, and concordance over calculation, particularly with increasing plasma TGs. Implementation of methods to detect low cholesterol concentrations could extend the applications for HDLC assessment.  (+info)

Plasma membrane cholesterol: a critical determinant of cellular energetics and tubular resistance to attack. (7/160)

BACKGROUND: Cholesterol is a major component of plasma membranes, forming membrane microdomains ("rafts" or "caveolae") via hydrophobic interactions with sphingolipids. We have recently demonstrated that tubule cholesterol levels rise by 18 hours following diverse forms of injury, and this change helps to protect kidneys from further damage (so-called acquired cytoresistance). The present study was undertaken to better define the effects of membrane cholesterol/microdomains on tubule homeostasis and cell susceptibility to superimposed attack. METHODS: Plasma membrane cholesterol was perturbed in normal mouse proximal tubular segments with either cholesterol esterase (CE) or cholesterol oxidase (CO). Alternatively, cholesterol-sphingomyelin complexes were altered by sphingomyelinase (SMase) treatment. Changes in cell energetics (ATP/ADP ratios + ouabain), viability [lactate dehydrogenase (LDH) release], phospholipid profiles, and susceptibility to injury (Fe-induced oxidant stress, PLA2, Ca2+ ionophore) were determined. The impacts of selected cytoprotectants were also assessed. RESULTS: Within 15 minutes, CE and CO each induced approximately 90% ATP/ADP ratio suppressions. These were seen prior to lethal cell injury (LDH release), and it was ouabain resistant (suggesting decreased ATP production, not increased consumption). SMase also depressed ATP without inducing cell death. After 45 minutes, CE and CO each caused marked cytotoxicity (up to 70% LDH release). However, different injury mechanisms were operative since (1) CE, but not CO, toxicity significantly altered cell phospholipid profiles, and (2) 2 mmol/L glycine completely blocked CE- but not CO-mediated cell death. Antioxidants also failed to attenuate CO cytotoxicity. Disturbing cholesterol/microdomains with a sublytic CE dose dramatically increased tubule susceptibility to Fe-mediated oxidative stress and Ca2+ overload, but not PLA2-mediated damage. CONCLUSION: Intact plasma membrane cholesterol/microdomains are critical for maintaining cell viability both under basal conditions and during superimposed attack. When perturbed, complex injury pathways can be impacted, with potential implications for both the induction of acute tubular damage and the emergence of the postinjury cytoresistance state.  (+info)

Presence of oxidized cholesterol in caveolae uncouples active platelet-derived growth factor receptors from tyrosine kinase substrates. (8/160)

Platelet-derived growth factor receptor beta (PDGFRbeta) in fibroblasts is concentrated in caveolae where it controls the tyrosine phosphorylation of multiple proteins. Caveolae are enriched in cholesterol and sphingolipids, but the role of these lipids in PDGFR signal transduction is unknown. We report that introduction of cholest-4-en-3-one into caveolae membranes uncouples PDGFR autophosphorylation from tyrosine phosphorylation of neighboring proteins. Cholest-4-en-3-one appears to interfere with the normal interaction between PDGFR and its partners. The results suggest that tightly packed caveolae lipids form a membrane platform that functions as a lipid scaffold for organizing the molecular interactions of multiple signaling pathways.  (+info)

Cholesterol Oxidase, 0.1 mg. Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis.
Cholesterol Oxidase, 0.1 mg. Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis.
Cholesterol is a waxy, fat-like substance that is found in all cells of the body. Cholesterol enters the human body mainly through food [1], and the majority of the cholesterol in the body originates from the liver [2]. Cholesterol is required for the formation of sex hormones [3], Cholesterol can also be converted to bile acids in the liver and vitamin D in the skin and kidney [4] and the formation of bile acids that help the body to digest fat [5]. Many studies have reported the ability of different bacteria to reduce the cholesterol levels in aqueous systems, such as liquid media [6] and the blood serum [7].. Some bacteria not only utilize cholesterol as a sole carbon source [8] but also decompose cholesterol via the cholesterol oxidase enzyme (ChoX) and produce different intermediate compounds [9]. Enterococcus faecium CX and Lactobacillus acidophilus N5, which colonise the intestinal tract and survive under gastric conditions, assimilate cholesterol and reduce its level in serum [10]. ...
1. Cholesteryl 3beta-sulphate is oxidized in vitro by preparations of bovine adrenal-cortex mitochondria to pregnenolone sulphate and isocaproic acid (4-methyl-pentanoic acid) without hydrolysis of the ester linkage. 2. Free cholesterol is the preferred substrate for adrenal-cortex cholesterol oxidase; the apparent K(m) for cholesteryl sulphate is 500mum and for free cholesterol 50mum under the same conditions. 3. Cholesteryl 3beta-acetate is hydrolysed by bovine adrenal-cortex mitochondria in vitro to free cholesterol, which is subsequently oxidized to more polar steroids and isocaproic acid. Evidence was obtained that other cholesterol esters behave similarly. Cholesterol esters may thus act as precursors of steroid hormones. 4. Cholest-4-en-3-one is only poorly oxidized to isocaproic acid and more polar steroids and thus is probably not a significant precursor of steroid hormones. 5. Cholesteryl esters inhibit the oxidation of cholesterol competitively (K(i) for cholesteryl phosphate 28mum, ...
Cholesterol oxidase (CHO) is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatal..
1MXT: Sub-atomic resolution crystal structure of cholesterol oxidase: What atomic resolution crystallography reveals about enzyme mechanism and the role of FAD cofactor in redox activity
1COY: Crystal structure of cholesterol oxidase complexed with a steroid substrate: implications for flavin adenine dinucleotide dependent alcohol oxidases.
The Open Biotechnology Journal is an Open Access online journal, which publishes research articles, reviews, letters, case reports and guest-edited single topic issues in all areas of biotechnology. Bentham Open ensures speedy peer review process and accepted papers are published within 2 weeks of final acceptance.. The Open Biotechnology Journal is committed to ensuring high quality of research published. We believe that a dedicated and committed team of editors and reviewers make it possible to ensure the quality of the research papers. The overall standing of a journal is in a way, reflective of the quality of its Editor(s) and Editorial Board and its members.. The Open Biotechnology Journal is seeking energetic and qualified researchers to join its editorial board team as Editorial Board Members or reviewers.. The essential criteria to become Editorial Board Members of The Open Biotechnology Journal are as follows ...
Catalog #: P2010002 - 250 U Cholesterol oxidase is a flavoprotein involved in the first step of cholesterol catabolism. The enzyme first oxidizes cholesterol to cholest-5-en-3-one then isomerizes it to cholest-4-en-3-one while producing hydrogen peroxide H2O2. Available in a 250 Units and custom bulk sizes. Live Enquiry about this product via Text/SMS: 1-858-900-3210 (8 am - 8 pm PST ...
The layer-by-layer technique is one of the most used in the immobilization of molecules of biological interest, being largely employed in the fabrication of modified electrodes for biosensors. One of the main challenges in the development of biosensors is to eliminate interfering electroactive species within the detection system, therefore, this problem can be solved with the introduction of inorganic or organic electron mediators. Here, we carried out systematic studies for the application of hemoglobin acting as an electron mediator, and the self-assembly technique was used to immobilize haemoglobin in nanostructured thin films. The LbL films were tested with two polyelectrolytes, obtaining uniform films with activity kept during 15 days, without responses to possible interfering phospholipids. The layer-bylayer technique was also used to immobilize the enzyme cholesterol oxidase, alternated with different polyelectrolytes. The thin films showed a good performance as an amperometric biosensor ...
Our single-molecule experiments have shown that an enzyme is a dynamical entity whose conformation and enzymatic rate undergo constant fluctuation over a broad range of time scales. The phenomenon has been observed in several systems: cholesterol oxidase,
putative cholesterol oxidase [RimD] GTGATCGAGAACCAGCACCTGTCACGGCGCCGTCTGCTCGGACTGGCCGCCCTCGGCGGC GCCGCCGTCGCCGGAATGACCACGATTTCCGTCGCCCCGCGCGCCGCGGCCGCCGGGCAG GGAAGCCCGCGGGCCGGTGACGGCGCGTTCGTACCGGCGGTGGTGATCGGCACCGGTTAC GGTGCGGCGGTCTCCGCGCTGCGGCTCGGCGAGGCGGGAATTCCGACGCTCATGCTCGAA ATGGGCCAGCTGTGGAACAAGCCGGCCGACGACGGCAACATCTTCTGCGGAATGCTCAAG CCCGACCGCAGGTCCAGCTGGTTCAAGTCGCGCACCGAAGCCCCGCTGGGCTCGTTCCTG TGGCTGGATGTCATCAACCGCAACATCGACCCGTACGCGGGCGTCCTCGACAAGGTGCAC TTCGACGAGATGTCGGTGTACGTGGGACGGGGCGTCGGCGGCGGCTCGCTGGTCAACGGC GGCATGGCCGTCGTACCGAAGCGCTCGTACTTCGAAGAGGTCCTCCCACGGGTGGACGCC GCCCAGATGTACGACCGGTACTTCCCGCGCGCCAACTCCATGCTCAAGGTGAACCACATC GACAAGGGGTGGTTCGAGGACACGGAGTGGTACAAGTACGCGCGGGTCTCGCGCGAGCAG GCGGGCAAGGCGGGCCTGAGCACCACCTTCGTCCCCAACGTCTACGACTTCGACCACATG CGGCGCGAGGCGGACGGCACGGCGCCCAAGTCGGCGCTGGCCGGCGAGGTGATCTACGGC AACAACCACGGCAAGCAGAGCCTGGACAAGACCTATCTGGCCGCCGCGCTGGGCACCGGC AAGGTCACCATCGAGACGCTGCACCAGGTCAAGGCGATCCGGCGGCAGCCGGACGGCAGC ...
3-oxo-5 beta-steroid delta 4-dehydrogenase: do not confuse with EC 1.3.1.23 (cholestenone 5 beta-reductase) which is also steroid 5 beta-reductase in Chemline; do not use for enzyme using NAD(P)-see EC 1.3.1.23 & EC 1.3.1.3
Cindy A. Verberkt, Marieke H.J. van den Beuken-van Everdingen, Jos M.G.A. Schols, Sushma Datla, Carmen D. Dirksen, Miriam J. Johnson, Sander M.J. van Kuijk, Emiel F.M. Wouters, Daisy J.A. Janssen ...
Stabilized enzymes useful in the diagnostic assay of total cholesterol are prepared by dissolving a salt of cholic acid in a buffer solution providing a pH within the range of about 4 to about 9, to the solution is added a cholesterol esterase. The solution is then mixed with a polyhydroxy organic compound and TRITON-X-100. A cholesterol oxidase and a peroxidase are each dissolved in separate portions of buffer solution and introduced into the buffered solution containing the cholesterol esterase. 4-aminoantipyrine is then added to the solution. The resultant solution is a stabilized enzyme solution which can be used in the total cholesterol assay of a serum sample. The stabilized solution can be used in combination with a chromogen diluent solution which is made by dissolving phenol and TRITON-X-100 in water or a buffer solution. The combination of the stabilized enzyme solution and the chromogen diluent solution provides a solution which has utility
Chicken, fish, and egg powder in processed foods present greater risk from cholesterol oxidation byproducts, but there are things you can do to reduce exposure. Find out about the latest research on cholesterol, delivered in free, easy to understand videos.
In this paper, a novel amperometric cholesterol biosensor with immobilization of cholesterol oxidase on electrochemically polymerized polypyrrole-polyvinylsulphonate (PPy-PVS) films has been accomplished via the entrapment technique on the surface of a platinum electrode. Electropolymerization of pyrrole and polyvinylsulphonate on the Pt surface was carried out by cyclic voltammetry between -1.0 and +2.0 V (vs. Ag/AgCl) at a scan rate of 100 mV upon the Pt electrode with an electrochemical cell containing pyrrole and polyvinylsulphonate. The amperometric determination is based on the electrochemical detection of H2O2 generated in the enzymatic reaction of cholesterol. Determination of cholesterol was carried out by the oxidation of enzymatically produced H2O2 at 0.4 V vs. Ag/AgCl. The effects of pH and temperature were investigated and optimum parameters were found to be 7.25 and 35 °C, respectively. The storage stability and operational stability of the enzyme electrode were also studied. The results
AbstractFor a commercially viable recombinant intracellular protein production process, efficient cell lysis and protein release is a major bottleneck. The recovery of recombinant protein, cholesterol oxidase (COD) was studied in a continuous bead milling process. A full factorial Response Surface Model (RSM) design was employed and compared to Artificial Neural Networks coupled with Genetic Algorithm (ANN-GA). Significant process variables, cell slurry feed rate (A), bead load (B), cell load (C) and run time (D), were investigated and optimized for maximizing COD recovery. RSM predicted an optimum of feed rate of 310.73 mL/h, bead loading of 79.9% (v/v), cell loading OD600 nm of 74, and run time of 29.9 min with a recovery of ~3.2 g/L. ANN coupled with GA predicted a maximum COD recovery of ~3.5 g/L at an optimum feed rate (mL/h): 258.08, bead loading (%, v/v): 80%, cell loading (OD600 nm): 73.99, and run time of 32 min. An overall 3.7-fold increase in productivity is obtained when compared to a batch
Chemistry Tree: mentors, trainees, research areas and affiliations for Senyon Choe, Structural Biology Laboratory, Salk Institute for Biological Studies
The world of Choe Pho is young. The Council of Enlightenment came to Choe Pho seeking refuge from a terrible place known as the Fallen World. Carrying the soul energy, known as Marrow, of as many people as they could, the Council fled to a remote and hidden corner of the cosmos in the hopes of building a better world. Choe Pho would be a place where each soul would have the... [click here for more ...
Jeong Wan Seo (Seo JW), Ji A Jung (Jung JA), Hye Sook Park (Park HS), Jae Sung Ko (Ko JS), Yong Joo Kim (Kim YJ), Jae Young Kim (Kim JY), Eell Ryoo (Ryoo E), Sun Hwan Bae (Bae SH), Jae Geon Sim (Sim JG), Hye Ran Yang (Yang HR), Byung Ho Choe (Choe BH), Ky Young Cho (Cho KY ...
PAPER Cho SH, Choe YS, Kim HJ, Jang H, Kim Y, Kim SE, Kim SJ, Kim JP, Jung YH, Kim BC, Baker SL, Lockhart SN, Na DL, Park S, Seo SW ...
by Bae, Sang-Cheol and Cha, Jin-Hye and Choe, Jung-Yoon and Choi, Sung Jae and Cho, Soo-Kyung and Chung, Won-Tae and Joung, Chung-Il and Jung, Young-Ok and Kang, Young Mo and Kim, Dong-Wook and Kim, Jinseok and Kim, Young-Joo and Lee, Choong-Ki and Lee, Hye-Soon and Lee, Jisoo and Lee, Sang-Heon and Lee, Sang-Hoon and Lee, Shin-Seok and Lee, Yeon-Ah and Nah, Seong-Su and Shim, Seung Cheol and Song, Gwan-Gyu and Suh, Chang-Hee and Won, Soyoung and Yoo, Wan-Hee and Yoon, Bo Young ...
Most dogs go through periods of extreme exuberance. In my experience, my boys have always shown much more of this than my girls, but even Choe and Mia had
When hens consume a diet low in omega-6 fatty acids and high in antioxidants, eating their eggs causes less artery-clogging cholesterol oxidation in your blood, compared to when the hens eat a high-omega-6 diet, the study finds.. Turns out, people who ate two of the high-antioxidant eggs a day had the same LDL oxidation as those who ate two to four unhealthy eggs once a week.. More from MensHealth.com: The Best and Worst Foods for Your Cholesterol. Antioxidants in the eggs reduce the oxidation of cholesterol in the blood, says Niva Shapira, Ph.D., and professor of nutrition at Tel Aviv University. On the other hand, omega-6s increase inflammation, which can trigger oxidation.. Likewise, a 2008 experiment by Shapira showed that eating eggs high in omega-3s caused 30 percent less cholesterol oxidation than eating eggs higher in omega-6s. (Though omega-6s arent necessarily bad, Americans tend to eat too many omega-6s and not enough omega-3s.). So, how do you decode the labels on the carton to ...
Heo, D. H., Kang, Y. M., Song, K. H., Seo, J. W., Kim, J. H., Chun, J. Y., Jun, K. I., Kang, C. K., Moon, S. M., Choe, P. G., Park, W. B., Bang, J. H., Kim, E. S., Kim, H. B., Park, S. W., Oh, W. S., Kim, N. J. & Oh, M. D., 23 Mar 2020, In : Journal of Korean Medical Science. 35, 11, p. e77 e77.. Research output: Contribution to journal › Article ...
With TimeAware, we could decide whether the data would be shown in a positive way by highlighting productivity, or in a negative way by highlighting unproductive time, said Choe. I was curious which version might be more helpful in encouraging people to be more productive.. Quantifying the self. Choe has long been interested in self-monitoring - when a person collects personal data to learn more about themselves and make positive changes. After using an activity tracker like a FitBit, for example, a person might see theyre not walking as much as theyd like and then make an effort to fit in more exercise.. But with so many options for gadgets and apps that promise to help improve sleep, encourage exercise and increase productivity, Choe wanted to learn more about what makes them effective or not.. I like to look at lots of different types of data - such as sleep and exercise data - and create tools for people to collect this information and then make sense of it, said Choe. The data ...
Journal of colloid and interface science. VOL 308; NUMBER 1, ; 2007, 130-141 -- Elsevier Science B.V., Amsterdam Part: Part 1; (pages 130-141) -- ...
Ou, H. D.; Kwiatkowski, W.; Deerinck, T. J.; Noske, A.; Blain, K. Y.; Land, H. S.; Soria, C.; Powers, C. J.; May, A. P.; Shu, X.; Tsien, R. Y.; Fitzpatrick, J. A. J.; Long, J. A.; Ellisman, M. H.; Choe, S.; OSheaemail, C. C.. ...
Lachke, Salil A.; OConnell, Daniel J.; Aboukhalil, Anton; Choe, Sung E.; Turbe-Doan, Annick; Robertson, Erin A.; Amendt, Brad A. et al. (PLoS ONE, 2012) Link to Published Version ...
By Stan Choe And Alex Veiga, The Associated Press on March 30th, 2020. NEW YORK - U.S. stocks climbed Monday, led by big gains for health care companies announcing developments that could aid in the coronavirus outbreak. The rally tacked more gains onto a recent upswing for the market, which is coming off the best week for the S&P 500 in 11 years. Nascent optimism is budding that ... Read More ». Be the first to comment! ...
Boudreaux, H. B. 1979. Arthropod phylogeny, with special reference to insects. Wiley Interscience; New York, NY. Caudell, A.N. 1920. Zoraptera not an apterous order. Proceedings of the Entomological Society of Washington 22: 84-97.. Chao, R. F., and C. S. Chen. 2000. Formosozoros newi, a new genus and species of Zoraptera (Insecta) from Taiwan. Pan-Pacific Entomologist 76(1): 24-27.. Choe, J. C. 1989. Zorotypus gurneyi, new species, from Panama and redescription of Zorotypus barberi Gurney (Zoraptera, Zorotypidae). Annals of the Entomological Society of America 82(2): 149-155.. Choe, J. C. 1994a. Sexual selection and mating system in Zorotypus gurneyi Choe (Insecta: Zoraptera). I. Dominance hierarchy and mating success. Behavioral Ecology and Sociobiology 34: 87-93.. Choe, J. C. 1994b. Sexual selection and mating system in Zorotypus gurneyi Choe (Insecta: Zoraptera). II. Determinants and dynamics of dominance. Behavioral Ecology and Sociobiology 34: 233-237. Choe, J. C. 1995. Courtship feeding ...
EC 1.3.1.22. Accepted name: 3-oxo-5α-steroid 4-dehydrogenase (NADP+). Reaction: a 3-oxo-5α-steroid + NADP+ = a 3-oxo-Δ4-steroid + NADPH + H+. Other name(s): cholestenone 5α-reductase; testosterone Δ4-5α-reductase; steroid 5α-reductase; 3-oxosteroid Δ4-dehydrogenase; 5α-reductase; steroid 5α-hydrogenase; 3-oxosteroid 5α-reductase; testosterone Δ4-hydrogenase; 4-ene-3-oxosteroid 5α-reductase; reduced nicotinamide adenine dinucleotide phosphate:Δ4-3-ketosteroid 5α-oxidoreductase; 4-ene-5α-reductase; Δ4-3-ketosteroid 5α-oxidoreductase; cholest-4-en-3-one 5α-reductase; testosterone 5α-reductase; 3-oxo-5α-steroid 4-dehydrogenase. Systematic name: 3-oxo-5α-steroid:NADP+ Δ4-oxidoreductase. Comments: The enzyme catalyses the conversion of assorted 3-oxo-Δ4 steroids into their corresponding 5α form. Substrates for the mammalian enzyme include testosterone, progesterone, and corticosterone. Substrates for the plant enzyme are brassinosteroids such as campest-4-en-3-one and ...
DUGi: Viewing Item from repository Recercat: Cholesterol is ubiquitous and necessary for the biosynthesis of steroidal hormones, bile salts and to maintain the stability of biological membranes in animal cells. Its regulation and homeostasis is ensured by the conjugated action of specific factors/enzymes/receptors such as SREBP, HMG-CoA or LXR. LDL and HDL are responsible to transport cholesterol and provide the cells to build and maintain the membranes, etc. Cholesterol, as lipids in general, is susceptible to oxidation and some positions in the chemical structure are more prone to oxidative attack; the most common cholesterol derivatives produced by oxidative attack are hydroxyl derivatives, keto derivatives, hydroperoxydes, epoxides and carboxyl derivatives. Those oxidized cholesterol derivatives are called Oxysterols or Cholesterol Oxides. Cholesterol oxidation occurs by autoxidation processes in dietary food exposed to heating treatments in the presence of oxygen or have been stored for long
Its all about inflammation. If there is one thing to worry about instead of cholesterol, Moore argues, we should be much more concerned about inflammation in the body and the things that cause it. This is the true cause of atherosclerosis. In his words, without inflammation, cholesterol cant harm you. Its really all about cholesterol oxidation, which is nearly a two-fold better predictor of heart disease risk than simply looking at cholesterol alone. So, we should be focusing more on things that cause chronic inflammation in the body, which results from poor diet, smoking, lack of sleep, infrequent exercise, elevated stress, and a compromised gut, just to name a few that Moore references. One of the best blood markers for determining the amount of chronic inflammation in the body is something called high-sensitivity C-reactive protein, or hs-CRP. Many experts have argued that hs-CRP is a much better biomarker to track because its a much better predictor of heart disease and health ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Zhang, L., Jackson, C. B., Mou, H., Ojha, A., Rangarajan, E. S., Izard, T., Farzan, M., & Choe, H. (2020). The D614G mutation in the SARS-CoV-2 spike protein reduces S1 shedding and increases infectivity. BioRxiv, 2020.06.12.148726. https://doi.org/10.1101/2020.06.12.148726. ...
Hyun Jin Jo, Nayoung Kim, Ryoung Hee Nam, Jung Mook Kang, Joo-Hyon Kim, Gheeyoung Choe, Hye Seung Lee, Ji Hyun Park, Hyun Chang, Hyunjin Kim, Moon Young Lee, Yong Sung Kim, Joo Sung Kim, Hyun Chae Jung ...
You-Jung Choi, Eue-Keun Choi, Kyung-Do Han, Jiesuck Park, Inki Moon, Euijae Lee, Won-Seok Choe, So-Ryoung Lee, Myung-Jin Cha, Woo-Hyun Lim, Seil Oh ...
Porphocyanines are tetrapyrrolic macrocycles containing two dipyrromethene units linked together by two C=N-C bridges. The syntheses of 2,3,7,8,14,15,19,20-octaethylporphocyanine 5,17-diphenylporphocyanine, 2,3,7,8-tetraethyl-17-phenylporphocyanine and other meso-aryl and beta-alkyl, including a tetra-beta-propionate, derivatives and metal complexes are described. The physical and chemical properties of porphocyanines show them to be aromatic. The aromaticity is reflected in the large deshielding of the outer beta-protons and shielding of the inner pyrrolic protons in their NMR spectra. The optical spectra of these compounds exhibit Soret and Q bands similar to porphyrins but all significantly bathochromically shifted. The ability of porphocyanines to act as catalysts for the generation of singlet molecular oxygen was investigated using a cholesterol oxidation assay.. ...
This application focuses on upgrading the E. coli-based cell-free expression system and on optimizing the synergy between cell-free and NMR to screen and evalua...
Hi, my name is Jenneke and Im an illustrator/animator specialized in creating visual artwork that will help you communicate your (business) message in a fresh and playful way. I have years of experience with a broad range of media, ranging from web to animation to games. My biggest passion is creating cute characters.
German family-run drugmaker Boehringer Ingelheim has stressed its determination to remain independent and keep its pipeline stocked with innovative products as it posted solid financial results for 2006 at its annual press conference. - News - PharmaTimes
TARGET PharmaSolutions, Inc., a real-world clinical data company, is pleased to announce that Boehringer Ingelheim International GmbH has entered into a multi-year strategic partnership
Determination of seroreactivity of human sera against recombinant HPV 16L1 protein / Yong Hee Lee; Mi Ri Yoon; Joo Hyun Kang; Dur Han Kwon; In Seong Choe; Tai Wha Chung; Sue Nie Park , 1994 ...
A number of reports have shown that CD44 is present in cholesterol-enriched lipid raft microdomains in various cell types including T cells (Ilangumaran et al., 1998; Gómez-Móuton et al., 2001; Oliferenko et al., 1999; Seveau et al., 2001; Pierini et al., 2003; Bourguignon et al., 2004). However, the functional significance of CD44 localization in the lipid rafts had been largely unknown. This study demonstrated the functional significance of this association in T cell adhesion properties. We demonstrated in the present study that cellular cholesterol modulates the HA-binding ability of CD44. Using BW5147 T cells, which express CD44 with HA-binding ability, we showed that cholesterol depletion induced with MβCD upregulates both the HA-binding ability of CD44 (Fig. 1) and the loss of CD44 from detergent-insoluble fractions (Fig. 3). We also found that cholesterol oxidation and sequestration upregulate CD44s HA-binding ability (Fig. 2), suggesting that the lipid rafts modulate CD44 function. ...
Four hundred milliliters of a saturated aqueous solution of potassium-sodium tartrate (Note 4) is added to the mixture, and the organic layer becomes clear and orange. The stirrer assembly is removed, and the mixture is steam-distilled until about 6 l. of distillate has been collected. The residual mixture is cooled and extracted successively with one 300-ml. portion and two 100-ml. portions of chloroform. The combined extracts are washed with two 100-ml. portions of water and dried over anhydrous magnesium sulfate. The chloroform is removed by distillation on the steam bath at reduced pressure (water aspirator). The residual viscous amber oil (Note 5) is dissolved by heating in 150 ml. of methanol. When the solution has cooled to about 40°, seeds of cholestenone are added, and the flask is wrapped with a small towel to ensure slow cooling (Note 6). After the bulk of the material has crystallized, which requires several hours, the mixture is stored at 0° overnight (Note 7). The product is ...
Cholesterol and Coronary Heart Disease - Cholesterol is a type of fat (lipid) made by the body. About 80% of cholesterol is made by the body, the other 20% comes from the diet. Cholesterol is a building block for cell membranes. Cholesterol Test Kit - A delicate combination of steroid and alcohol, Cholesterol, also a combination of a lipid that is found in cell membranes of all of our body tissues. Cholesterol is also transported in the blood of all animals.. Develop High Cholesterol - The risk of heart disease is greatly increased if you have high cholesterol. This can include potentially fatal heart attacks. Lowering cholesterol is recommended to lead a more healthy life and maintain a healthy heart. Low Fat Cholesterol Recipes - Many low fat low colesterol recipes are usually bland and un-flavorful but you can find some unique and tasty treats on our website that are full of flavor. Good Cholesterol Level - While most people talk about cholesterol levels there is in fact more than one type ...
We have been told for years that cholesterol levels being too high are problematic, that it can contribute to heart disease and strokes. In fact, this is true for many people. However, what has gone unrecognized or ignored for many years is that too low cholesterol can be just as detrimental often leading to a myriad of mental health and disease conditions. There is a dynamic balance of all things in the body that must be achieved for optimal health to manifest, and cholesterol is a critically important component of that balance.. Sonic Cholesterol is an excellent choice for reviving low cholesterol levels:. Sonic Cholesterol is a pure and potent nutritional supplement designed specifically to support healthy cholesterol levels.. Sonic Cholesterol is the only cholesterol supplement on the market designed to help raise cholesterol to normal levels.. To learn more about the benefits of Sonic Cholesterol, the dangers of low cholesterol, and how to obtain your own supply of Sonic Cholesterol make ...
The incorporation and metabolism of both vesicle- and LDL (low-density lipoprotein)- derived [3H]cholesterol by LDL-receptor-negative fibroblasts were studied. Independent of the cholesterol source, free [3H]cholesterol was readily incorporated into the cells and was available for esterification. 7-Oxocholesterol stimulated both [3H]cholesterol incorporation, by increasing the exchange rate, and the subsequent esterification of it irrespective of the source of exogenous [3H]cholesterol. The 7-oxocholesterol-stimulated esterification of exogenously derived LDL free [3H]cholesterol was progesterone-sensitive and energy-requiring. ...
With all the news and warnings about the dangers of high cholesterol, many people view cholesterol as a “bad†substance that should be eliminated completely from our lives. In truth, cholesterol serves some important functions in the body. In order to understand how cholesterol affects the body, one must first understand what cholesterol is.. Cholesterol is a waxy substance that is attached to the fats in our bloodstream and is present in all of the cells of the body. Cholesterol comes from food that we eat, as well as being manufactured directly by the liver. Cholesterol is an important regulator in the bloodstream, as it helps to regulate the formation of many cells as well as hormones. However, to have too high or too low of a cholesterol count in the blood can be a very dangerous factor, often leading to a heart attack or a stroke. Although cholesterol is prevalent in the blood stream, it cannot dissipate in the blood. The cholesterol maneuvers throughout the body attached to ...
Bringing down cholesterol is imperative for everybody, including more youthful, moderately aged, and more established grown-ups, and individuals with or without coronary illness and/or stroke. Bringing down cholesterol is amazingly imperative key to diminishing the danger of coronary illness. Elevated amounts of LDL are connected with an expanded danger of coronary illness. Lower levels of LDL cholesterol mean a lower danger of coronary illness. Most specialists propose cholesterol levels ought to stay under 200 mg/dl. Bringing cholesterol is prescribed down to lead a more sound life and fundamental. Bringing down cholesterol is only one approach to take care of your heart. Bringing down cholesterol is really very basic, and doesnt oblige surgery or medications with solid way of life, actually bringing down cholesterol is simple since it aides standardize your cholesterol, normally and securely. One of the most straightforward approaches to beginning bringing cholesterol is down to farthest ...
Cholesterol. It is a word we often hear today when talking about leading a healthy lifestyle. For many people, the word evokes concern as they recall the warnings from their physicians that they need to watch what they eat since their cholesterol levels are a bit elevated. At William Osler Health Centre the Medical Risk Management Clinic staff help people understand what cholesterol is and how they can control it to prevent diseases caused by elevated or high levels of cholesterol. Cholesterol is a waxy substance made naturally in the body. Cholesterol helps form or repair cell membranes, some hormones, and other tissues.. Too much cholesterol in your blood can cause hardening of the arteries and you run the risk of heart attacks or stroke. There are two different types of Cholesterol. The bad cholesterol, low-density lipoprotein (LDL) is essential for cell repair and growth. But too much LDL in the blood is associated with the development of atherosclerosis (hardening of the arteries) and ...
Cholesterol is a mostly insoluble waxy substance that is carried around the blood stream by lipo-proteins. These transport molecules can be classified as LDL and HDL. The low density lipo-proteins (LDL) carries the cholesterol around the blood to the cells that need it. However too much cholesterol in the diet or overproduction can cause cholesterol to be deposited in the blood vessels and arteries. This can be especially dangerous in the heart and brain. Thus LDL the cholesterol is known as the bad cholesterol. The other type of transporter the high density lipo-proteins (HDL) carries cholesterol away from the blood stream to the liver. So just having high cholesterol is not the complete picture but it is the proportion of HDL to LDL that is also important. Generally the safe level for cholesterol is around 5mmol/l, however half the population is above this level.. ...
7alpha-hydroxycholesterol is an oxysterol and can serve as a biomarker for lipid peroxidation. (PMID: 17386651 ) Products of cholesterol oxidation accumulate within atherosclerotic plaque and have been proposed to contribute to inflammatory signalling in the diseased artery. (PMID: 17364953 ). 7alpha-hydroxycholesterol is a cholesterol oxide that has been described as biomarker of oxidative stress in subjects with impaired glucose tolerance and diabetes. (PMID: 16634125 ...
Cholesterol is a steroid, which is a waxy organic compound, that is found in every cell of the body and in the plasma. The presence of cholesterol is essential to life. Endogenous (internal) synthesis by the liver and other organs produces between 60-80% of the bodys cholesterol. The remainder comes from exogenous (external) dietary sources. Total cholesterol involves all of the cholesterol found in the body such as LDL cholesterol, HDL cholesterol, and triglycerides. The level of cholesterol in the body is primarily affected by metabolic rate. Generally speaking, increased levels are associated with thyroid or adrenal hypofunction, and decreased levels are associated with endocrine hyperfunction. ...
Introduction. With cardiovascular disease being the largest cause of death and disability (killing one person every 34 seconds, actually!) in the United States and Europe, reducing cholesterol levels by maintaining a healthy diet, has been cited as one of the ways by one can reduce the risk of heart disease and therefore increase the lifespan of an individual.. However, if uninformed, one will naturally assume that cholesterol is bad for your heart. And that is definitely not true, so let us understand what cholesterol is before we get into looking at the options available for a low cholesterol diet.. Good and Bad Cholesterol. Contrary to popular opinion, cholesterol is important for our body, that is produced in the liver and is used as an ingredient to generate bile, hormones and nerve tissue as well as Vitamin D.. So why all the fuss, anxiety and panic with cholesterol?. Cholesterol travel through the bloodstream from the liver to other tissues while being carried by lipoproteins, and ...
Boehringer Ingelheim Vetmedica, Inc. - Get up-to-date information on Boehringer Ingelheim Vetmedica, Inc. side effects, uses, dosage, overdose, pregnancy, alcohol and more. Learn more about Boehringer Ingelheim Vetmedica, Inc.
And yes, its even more complicated than this. Each of these categories is further broken down into subcategories which can also be measured in a blood test.. So cholesterol isnt simply cholesterol because it has very different effects on your body depending on which other molecules its bound to in your blood and what it is actually doing there.. Myth #2: Cholesterol is bad. Cholesterol is absolutely necessary for your body to produce critical things like vitamin D when your skin is exposed to the sun, your sex hormones (e.g. estrogen and testosterone), as well as bile to help you absorb dietary fats. Not to mention that its incorporated into the membranes of your cells.. Talk about an important molecule!. The overall amount of cholesterol in your blood (AKA total cholesterol) isnt nearly as important as how much of each kind you have in your blood.. While way too much LDL cholesterol as compared with HDL (the LDL:HDL ratio) may be associated with an increased risk of heart disease it is ...
Need to lower cholesterol? First, you must understand what it is and why its high. Cholesterol is a waxy molecule produced in the liver. Its a building block used all over the body to make neurotransmitters in your brain, hormones like testosterone/estrogens/progesterone/vitamin D (hormones with a cholesterol base are called steroid hormones), and its a component of every cell membrane in your body.. Remember, you cant pee in just one end of the pool. When you take a drug to lower cholesterol, every system that depends on cholesterol is affected. The side effects of memory loss, muscle pain, liver damage, and type 2 diabetes reflect the fundamental importance of cholesterol as a building block all over the body.. Cholesterol is made in the liver. Sooooo, why is the heart doctor giving you a drug to treat your liver. The reason is that its not really heart disease that causes heart attacks. These events, as well as most strokes, are caused by years of blood vessel inflammation. The final ...
Sep 21, 2013 - I have a cholesterol problem. I wish I did not have to take drugs for this. I am making a good effort to fix it. I hope some of these suggestions will help others. See more ideas about cholesterol, cholesterol lowering foods, lower cholesterol.
Animals utilize similar pathways in response to environmental or endogenous challenges from pathogenic, xenobiotic and oxidative stress (Kensler et al. 2007; Shore and Ruvkun 2013; Blackwell et al. 2015). At the core of the response is the conserved NRF2/Keap1 pathway in mammals or the SKN-1/WDR-23 pathway in C. elegans (Itoh et al. 1997; Itoh et al. 1999; An and Blackwell 2003; Kensler et al. 2007; Choe et al. 2009; Blackwell et al. 2015). When mammalian cells are under stress, Keap1 would dissociate from Nrf2, leading to the nuclear localization of Nrf2 and activation of gene expression that antagonizes the stress. In C. elegans, WDR-23 and SKN-1 appear to play similar roles as those of Keap1 and Nrf2 (Choe et al. 2009; Blackwell et al. 2015). The Nrf2/Keap1 pathway is also implicated in numerous human diseases, including neurodegeneration (Johnson and Johnson 2015), inflammation (Ahmed et al. 2017), cancer (Taguchi and Yamamoto 2017) and cardiovascular diseases (Barancik et al. 2016).. SKN-1 ...
Low prices on Cholesterol Support! Support healthy cholesterol levels already within the normal range*. Cholesterol can be both good and bad. LDL is usually referred to as bad cholesterol and HDL is good cholesterol. Numerous natural ingredients may help support healthy cholesterol levels already within the normal range.
Before you can understand diabetic hyperlipidemia (high cholesterol when you have diabetes), you need to understand cholesterol basics. Whats good cholesterol? Whats bad cholesterol? How often should you be tested? Whats a lipid profile. Find answers in this article.
GLOBAL - Sanofi and Boehringer Ingelheim have announced the signing of contracts to secure the strategic transaction initiated in December 2015 which consists of an exchange of Sanofi’s animal health business (“Merial”) and Boehringer Ingelheim’s consumer healthcare (CHC) business.
Boehringer Ingelheimhas struck a deal which positions the German drugmaker to participate in digital diabetes care. The pact between Boehringer and digital health outfit Healthrageous involves a study of Type 2 diabetics, who are expected to receive a combination of digital coaching, wireless glucose monitoring and other tools to manage their disease.
Ingelheim/Germany, 12 July 2004 - The Boehringer Ingelheim FENS Research Award was presented for the second time at this year s congress of the Federation...
Cholesterol is necessary to aid in body function, but sometimes we collect too much of the wrong kind of cholesterol. It is important to understand the differences between good and bad cholesterol and how you can control your cholesterol levels. (Tips.Net)
Description: This website provides basic information about getting your cholesterol checked. It covers how often to get your cholesterol checked, what is cholesterol, how can I tell if I have high cholesterol, how I can get my cholesterol checked and what do the test results mean. Additional resources are available the information is available in English and Spanish ...
Your body needs cholesterol to make hormones and to keep your cells healthy. Cholesterol comes from two sources: your liver and your diet. But if your diet exceeds the bodys need for cholesterol or saturated fats, your cholesterol level in your blood will increase. This video discusses treatments and lifestyle changes that may be prescribed by your doctor.
Boost Your Good Cholesterol - 15 Heart-Healthy Foods to Boost Your Good Cholesterol - Youve probably heard that HDL cholesterol and LDL cholesterol = bad.
Cholesterol News From Medical News Today comments, Description: Cholesterol is a fatty substance called a lipid that is important to aid the normal functionality of the body. Cholesterol is produced mainly by the liver but can also be found in foods. Cholesterol i, ID: 12887, By: Feedage Forager
Real name: Unknown. Status: Inactive. Series: Cholesterol Man appeared in the Blorg Trek series. Notes: Cholesterol Man is an inactive character, available for use. Known powers: Cholesterol Man can increase the fat levels of anyone he touches, to a point where the victim becomes ridiculously bloated. His thick layer of fat prevents him from being harmed by most attacks. Description: Obese is an understatement. So is chubby. The man is huge. Cholesterol Man wears a jogging suit (he tries, unsuccessfully, to lose weight in his spare time). ...
Here is everything you need to know about cholesterol. Causes symptoms diagnosis and prevention. How to lower cholesterol? How to choose low cholesterol foods?
AMBICA PHARMA - Manufacturer,Supplier,Exporter of Anti Cholesterol Drugs,Anti Cholesterol Medicine from India. We offer Anti Cholesterol Drugs at a best price.
David Strachan has been appointed head of the avian and swine business unit following Boehringer Ingelheims acquisition of Merial Animal Health.
Boehringer Ingelheim GmbH announced today that it has initiated and begun enrollment of patients in the ArTEN trial, which will compare the efficacy and safety of Viramune (nevirapine), a non-nucleos...
Understanding Cholesterol Levels on ThePaleoDiet.co.za | Understanding Your Cholesterol Test The issue with most (read all) common cholesterol tests is that…
Read about cholesterol and related information. Learn how to lower your LDL cholesterol levels, and food and diet related to good cholesterol health.
Read about cholesterol and related information. Learn how to lower your LDL cholesterol levels, and food and diet related to good cholesterol health.
Cholesterol is a structural part of a cell, the smallest unit of the human body. This cholesterol in its two distinct forms namely, high-density cholesterol
Cholesterol is a waxy fat-like substance found in your body. Your body needs cholesterol to keep your cells healthy. Too much LDL (bad) cholesterol causes plaque to collect in your arteries.
Most of us have heard about good cholesterol and bad cholesterol. But its not the cholesterol that causes harm, its the particles that carry it. And routine
Cholesterol is a type of fat found in your blood. The body needs some cholesterol, but too much can be a problem. Discover more about cholesterol in this article for teens.
Cholesterol is a type of fat found in your blood. The body needs some cholesterol, but too much can be a problem. Discover more about cholesterol in this article for teens.
Cholesterol is a type of fat found in your blood. The body needs some cholesterol, but too much can be a problem. Discover more about cholesterol in this article for teens.
Good vs Bad Cholesterol - Cholesterol is a waxy, fat-like substance thats found in all cells of the body. Your body makes all of the cholesterol it needs on its own to make hormones, vitamin D and to help digest your food.
Nearly Half of People Who Need Cholesterol Treatment Dont Get It Nearly Half of People Who Need Cholesterol Treatment Dont Get It WINSTON-SALEM, N.C. - Even though treatment for cholesterol disorders can reduce the risk of heart and blood vessel disease by about 30 percent over five years, many at-risk
How Can You Remember to Take Your Cholesterol Medications? - Our experts discuss strategies for staying on top of your cholesterol medication while away from home.
We can help you control your cholesterol to avoid heart and circulation problems. Plus discover the types of cholesterol and what level readings mean.
Read Controlling Cholesterol For Dummies by Carol Ann Rinzler with Rakuten Kobo. Need to get your cholesterol in check? Youll find the latest information about cholesterol, including treatments, drug ...
Cholesterol testing can play an important role in supporting overall health, but many people who are at risk for cardiovascular complications do not pursue this screening because they have a lack of understanding of how cholesterol affects their well-being. Individuals should improve their knowledge about the dangers of cholesterol in order to support well-being, experts say ...
How to Reduce Cholesterol Without Medicines. When there are more natural ways to keep your bad cholesterol down, taking medications seems inorganic and foreign. If you simply want to manage your cholesterol but dont want the fuss of...
Is there a way that you can lower cholesterol naturally with vitamins and supplements? I am looking into preventative ways of treating high cholesterol in our family.
Interested in lowering your cholesterol? Find out what your cholesterol test results mean & get plenty of advice about taking care of your heart here.
"Cholesterol oxidases illustrate nature's approach to protein design.". Gene Therapy Weekly, November 27, 2003. via Highbeam ( ...
Abbreviations CHOD = cholesterol oxidase GOD = glucose oxidase GPO = glycerol-3-phosphate oxidase PAP = phenol + aminophenazone ... Cholesterol (CHOD-PAP method) Cholesterol + oxygen --(enzyme cholesterol oxidase)--> cholestenone + hydrogen peroxide Hydrogen ... enzyme glucose oxidase)--> gluconate + hydrogen peroxide Hydrogen peroxide + ABTS --(enzyme peroxidase)--> colored complex In ... enzyme glycerol-3-phosphate oxidase) --> dihydroxyacetone phosphate + hydrogen peroxide Hydrogen peroxide + 4-aminophenazone + ...
Biosensors/diagnostics, e.g. glucose oxidase and cholesterol oxidase biosensors. Delivery of proteins as therapeutic agents or ...
"Cloning and sequencing of partial segment of cholesterol oxidase encoding gene fromStreptomyces luridus". Annals of ...
Li J, Vrielink A, Brick P, Blow DM (November 1993). "Crystal structure of cholesterol oxidase complexed with a steroid ... Vrielink A, Lloyd LF, Blow DM (1991). "Crystal structure of cholesterol oxidase from Brevibacterium sterolicum refined at 1.8 A ... These enzymes include a variety of proteins; choline dehydrogenase (CHD) EC 1.1.99.1, methanol oxidase (MOX) EC 1.1.3.13 and ... Bannwarth M, Bastian S, Heckmann-Pohl D, Giffhorn F, Schulz GE (2004). "Crystal structure of pyranose 2-oxidase from the white- ...
"Covalent attachment of cholesterol oxidase and horseradish peroxidase on perlite through silanization: Activity, stability and ...
Sampson, NS; Kass, IJ; Ghoshroy, KB (21 Apr 1998). "Assessment of the role of an omega loop of cholesterol oxidase: a truncated ...
... then coupling the products of a cholesterol oxidase reaction to an indicator reaction. The reference method still uses a ... "National Reference System for Cholesterol - Cholesterol Reference Method Laboratory Network - HDL Cholesterol Certification ... Cholesterol: The name cholesterol originates from the Greek chole- (bile) and stereos (solid), and the chemical suffix-ol for ... The remainder of the serum cholesterol after subtracting the HDL is the non-HDL cholesterol. The concentration of these other ...
Cholesterol oxidase Pfam entry: Retinal pigment epithelial membrane protein Pfam entry: Lipoxygenase PDBsum entry: Alpha Toxin ... phospholipases and cholesterol oxidases), cell wall oligosaccharides (glycosyltransferase and transglycosidases), or proteins ( ... and cholesterol. Protein association with membranes through the use of acylated residues is a reversible process, as the acyl ... "Modulation of the bilayer thickness of exocytic pathway membranes by membrane proteins rather than cholesterol". Proc Natl Acad ...
... malate oxidase EC 1.1.3.4: glucose oxidase EC 1.1.3.5: hexose oxidase EC 1.1.3.6: cholesterol oxidase EC 1.1.3.7: aryl-alcohol ... D-aspartate oxidase EC 1.4.3.2: L-amino-acid oxidase EC 1.4.3.3: D-amino-acid oxidase EC 1.4.3.4: amine oxidase (flavin- ... glycine oxidase EC 1.4.3.20: L-lysine 6-oxidase EC 1.4.3.21: primary-amine oxidase EC 1.4.3.22: diamine oxidase EC 1.4.3.23: 7- ... L-gulonolactone oxidase EC 1.1.3.9: galactose oxidase EC 1.1.3.10: pyranose oxidase EC 1.1.3.11: L-sorbose oxidase EC 1.1.3.12 ...
Brady, D.R.; Crowder, R.D.; Hayes, W.J. (1980). "Mixed function oxidases in sterol metabolism. Source of reducing equivalents ... Fukushima, H.; Grinstead, G.F.; Gaylor, J.L. (1981). "Total enzymic synthesis of cholesterol from lanosterol. Cytochrome b5- ... Methylsterol monooxygenase (EC 1.14.13.72, methylsterol hydroxylase, 4-methylsterol oxidase, 4,4-dimethyl-5alpha-cholest-7-en- ... dependence of 4-methyl sterol oxidase". J. Biol. Chem. 256 (10): 4822-4826. PMID 7228857. ...
In enzymology, a cholesterol oxidase (EC 1.1.3.6) is an enzyme that catalyzes the chemical reaction cholesterol + O2 ⇌ {\ ... Coulombe R, Yue KQ, Ghisla S, Vrielink A (August 2001). "Oxygen access to the active site of cholesterol oxidase through a ... The substrate-binding domain found in some bacterial cholesterol oxidases is composed of an eight-stranded mixed beta-pleated ... Richmond W (1973). "Preparation and properties of a cholesterol oxidase from Nocardia sp. and its application to the enzymatic ...
7-CHOLESTADIEN-3-BETA-OL IN CHOLESTEROL BIOSYNTHESIS". J. Biol. Chem. 239: 1381-7. PMID 14189869. Nishino H, Nakaya J, Nishi S ... In enzymology, a lathosterol oxidase (EC 1.14.21.6) is an enzyme that catalyzes the chemical reaction 5alpha-cholest-7-en-3beta ...
MacLachlan, J., Wotherspoon, A.T., Ansell, R.O. and Brooks, C.J. (2000). "Cholesterol oxidase: sources, physical properties and ...
Atherosclerosis is caused by the accumulation of macrophages containing cholesterol (foam cells) in artery walls (in the intima ... The NADPH oxidase (nicotinamide adenine dinucleotide phosphate-oxidase) is a membrane-bound enzyme complex that faces the ... NADPH + 2O2 ↔ NADP+ + 2O2− + H+ NADPH oxidase is a major cause of atherosclerosis, and NADPH oxidase inhibitors may reverse ... Apocynin prevents the assembly of the NADPH oxidase subunits. Using apocynin to inhibit NADPH oxidase may have clinical ...
... cholesterol oxidase MeSH D08.811.682.047.436.350.700 --- progesterone reductase MeSH D08.811.682.047.436.375 --- 17- ... sarcosine oxidase MeSH D08.811.682.662.640 --- proline oxidase MeSH D08.811.682.662.680 --- pyridoxamine-phosphate oxidase MeSH ... d-amino-acid oxidase MeSH D08.811.682.664.500.261 --- d-aspartate oxidase MeSH D08.811.682.664.500.398 --- glutamate ... cholesterol 7 alpha-hydroxylase MeSH D08.811.682.690.708.170.915.212 --- cholesterol side-chain cleavage enzyme MeSH D08.811. ...
Steroidogenic enzyme Cytochrome P450 oxidase GRCh38: Ensembl release 89: ENSG00000140459 - Ensembl, May 2017 GRCm38: Ensembl ... however its activity is limited by the supply of cholesterol in the inner membrane. The supplying of cholesterol to this ... Cholesterol side-chain cleavage enzyme is commonly referred to as P450scc, where "scc" is an acronym for side-chain cleavage. ... Cholesterol Pregnenolone Cytochrome P450scc at the US National Library of Medicine Medical Subject Headings (MeSH) Molecular ...
Lathosterol oxidase is an enzyme that in humans is encoded by the SC5DL gene. This gene encodes an enzyme of cholesterol ... 2004). "Lathosterolosis: an inborn error of human and murine cholesterol synthesis due to lathosterol 5-desaturase deficiency ...
... is a cholesterol-like molecule. Sterol-C5-desaturase-like acts upon it. It is accumulated in lathosterolosis. ... Lathosterol oxidase. ...
... bc1 complex Cytochrome c Cytochrome c oxidase F-ATPase ATP-ADP translocase ATP-binding cassette transporter Cholesterol side- ... HtrA serine peptidase 2 Adrenodoxin reductase Heme biosynthesis Protoporphyrinogen oxidase Ferrochelatase Uncoupling protein ... Electron-transferring-flavoprotein dehydrogenase Electron-transferring flavoprotein Succinate dehydrogenase Alternative oxidase ...
When the two methyl groups and eight carbon side chains (at C-17, as shown for cholesterol) are present, the steroid is said to ... The expression of the oxidase gene can be upregulated by the steroid sensor PXR when there is a high blood concentration of ... Steroids such as cholesterol decrease membrane fluidity. Similar to lipids, steroids are highly concentrated energy stores. ... Steroid metabolism in humans is also the target of cholesterol-lowering drugs, such as statins. In humans and other animals the ...
The first step in the biosynthesis involves the oxidative cleavage of the side-chain of cholesterol by cholesterol side-chain ... cleavage enzyme (P450scc, CYP11A1), a mitochondrial cytochrome P450 oxidase with the loss of six carbon atoms to give ... It is biosynthesized in several steps from cholesterol and is converted in the liver to inactive metabolites.[5] It exerts its ... The chemical synthesis of testosterone from cholesterol was achieved in August that year by Butenandt and Hanisch.[180] Only a ...
Sterol-C4-methyl oxidase-like protein was isolated based on its similarity to the yeast ERG25 protein. It contains a set of ... The protein is localized to the endoplasmic reticulum membrane and is believed to function in cholesterol biosynthesis. ... "Mutations in the human SC4MOL gene encoding a methyl sterol oxidase cause psoriasiform dermatitis, microcephaly, and ... "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations". J. ...
... monoamine oxidase [MAO]-B inhibitors), corticosteroids, estrogens, digoxin, iron, and opioids. The role of Helicobacter pylori ... cholesterol-lowering agents (niacin, fibrates), neuropsychiatric medications (cholinesterase inhibitors [donepezil, ...
... medications to control cholesterol, and medications for hypertension contributed to low levels of desire. However, in men, only ... monoamine-oxidase (MAO) inhibitors, and sedative drugs. However, the most severe decreases in sexual desire relating to ...
... is a gene encoding a cytochrome P450 oxidase, and is commonly known as sterol 27-hydroxylase. This enzyme is located in ... CYP27A1 participates in the degradation of cholesterol to bile acids in both the classic and acidic pathways. It is the ... In the acidic pathway, it produces 27-hydroxycholesterol from cholesterol whereas in the classic or neutral pathway, it ... Evidence against 27-hydroxycholesterol as a critical regulator of cholesterol homeostasis". The Journal of Biological Chemistry ...
Regarding the isoforms of monoamine oxidase, it shows slight preference for the MAOB isoenzyme over MAOA. This leads to an ... an enzyme that controls cholesterol turnover in the brain". The Journal of Biological Chemistry. 285 (41): 31783-95. doi: ... Al-Nuaimi, SK; Mackenzie, EM; Baker, GB (November 2012). "Monoamine oxidase inhibitors and neuroprotection: a review". American ... Blom-Peters, L; Lamy, M (1993). "Monoamine oxidase inhibitors and anesthesia: an updated literature review". Acta ...
nov., a novel cholesterol-oxidizing, denitrifying member of the -Proteobacteria". International Journal of Systematic and ... Sterolibacterium is a genus of gram-negative, oxidase- and catalase-positive rod-shaped bacteria from the family of ...
... for lowering LDL cholesterol inhibitors: hypolipidaemic agents. Drugs affecting the central nervous system include: ... monoamine oxidase inhibitors, lithium salts, and selective serotonin reuptake inhibitors (SSRIs)), antiemetics, Anticonvulsants ...
It produces oxidase, catalase, and urease. Outer membrane. H. pylori possesses five major outer membrane protein families. The ... The outer membrane also contains cholesterol glucosides, which are present in few other bacteria. H. pylori consists of a large ... McGee DJ, George AE, Trainor EA, Horton KE, Hildebrandt E, Testerman TL (2011). "Cholesterol enhances Helicobacter pylori ...
"Cytochrome c oxidase deficiency". Genetics Home Reference.. This article incorporates text from this source, which is in the ... Cholesterol side-chain cleavage enzyme. *Steroid 11-beta-hydroxylase. *Aldosterone synthase. *Frataxin ... also known as the cytochrome c oxidase deficiency. Cytochrome c oxidase deficiency is a rare genetic condition that can affect ... "Focal cytochrome c oxidase deficiency in the brain and dorsal root ganglia in a case with mitochondrial encephalomyopathy (tRNA ...
... s contain oxidative enzymes, such as D-amino acid oxidase and uric acid oxidase.[9] However the last enzyme is absent ... It is vigorously debated whether peroxisomes are involved in isoprenoid and cholesterol synthesis in animals.[4] Other known ...
HMG-CoA reductase inhibitors (statins) for lowering LDL cholesterol inhibitors: hypolipidaemic agents. ... monoamine oxidase inhibitors, lithium salts, and selective serotonin reuptake inhibitors (SSRIs)), antiemetics, Anticonvulsants ...
... (sold under the trade name Parnate among others)[1] is a monoamine oxidase inhibitor (MAOI); more specifically ... "Structural basis of drug binding to CYP46A1, an enzyme that controls cholesterol turnover in the brain". The Journal of ... Tranylcypromine acts as a nonselective and irreversible inhibitor of monoamine oxidase.[4] Regarding the isoforms of monoamine ... Al-Nuaimi, SK; Mackenzie, EM; Baker, GB (November 2012). "Monoamine oxidase inhibitors and neuroprotection: a review". American ...
Xanthine oxidase deficiencyEdit. Main article: Xanthine oxidase deficiency. Another possible cause of Kidney disease is due to ... Higher dietary intake of animal protein, animal fat, and cholesterol may increase risk for microalbuminuria, a sign of kidney ... Xanthine oxidase inhibitors, like allopurinol, can cause nephropathy. Polycystic disease of the kidneysEdit. Main article: ... Xanthine oxidase will degrade hypoxanthine to xanthine and then to uric acid. Xanthine is not very soluble in water; therefore ...
... monoamine oxidase inhibitors or food-drug interactions, glomerulonephritis, head trauma, neoplasias, preeclampsia and eclampsia ...
... and for the contribution to the maintenance of normal blood LDL-cholesterol levels by replacing saturated fats in the diet with ... Monoamine oxidase inhibitors. Hidden categories: *Articles containing Ancient Greek-language text. *Articles containing ... HDL cholesterol, malondialdehyde, and oxidized LDL when compared to low-polyphenol olive oils.[117] ... "Scientific Opinion on the substantiation of health claims related to olive oil and maintenance of normal blood LDL-cholesterol ...
The final step requires oxygen and involves the action of the enzyme ACC-oxidase (ACO), formerly known as the ethylene forming ... the ACC releases ethylene with ACC oxidase. ...
Reactive hydrogen peroxide (H2O2), the byproduct of oxalate oxidase reaction, can be neutralized by catalase. Alarm ... oxalate released from calcium oxalate crystals is converted to CO2 by an oxalate oxidase enzyme and the produced CO2 can ...
In 1985, both drugs were also reported to increase serum levels of high density lipoprotein (HDL) cholesterol, total ... Taking primidone with monoamine oxidase inhibitors (MAOIs) such as isocarboxazid (Marplan), phenelzine (Nardil), procarbazine ( ... cholesterol, and apolipoproteins A and B.[24]. It was first reported to exacerbate hepatic porphyria in 1975. In 1981, it was ...
... is a synthetic form of the isolated major active metabolite of venlafaxine, and is categorized as a serotonin-norepinephrine reuptake inhibitor (SNRI). When most normal metabolizers take venlafaxine, approximately 70% of the dose is metabolized into desvenlafaxine, so the effects of the two drugs are expected to be very similar.[5] It works by blocking the "reuptake" transporters for key neurotransmitters affecting mood, thereby leaving more active neurotransmitters in the synapse. The neurotransmitters affected are serotonin (5-hydroxytryptamine) and norepinephrine (noradrenaline). It is approximately 10 times more potent at inhibiting serotonin uptake than norepinephrine uptake.[6]. ...
Steroidogenesis entails processes by which cholesterol is converted to biologically active steroid hormones. Recent study shows ... inhibit monoamine oxidase (MAO) in the pineal gland, leading to increased melatonin and reduced LH and FSH by melatonin-induced ...
Copper required component of many redox enzymes, including cytochrome c oxidase Main article: Copper in health ... Cholesterol None Cardiovascular Disease Macrominerals Calcium Osteoporosis, tetany, carpopedal spasm, laryngospasm, cardiac ...
Free radicals and pro-oxidants in cigarettes damage blood vessels and oxidize LDL cholesterol.[186] Only oxidized LDL ... Guillem K, Vouillac C, Azar MR, Parsons LH, Koob GF, Cador M, Stinus L (September 2005). "Monoamine oxidase inhibition ... Smoking tends to increase blood cholesterol levels. Furthermore, the ratio of high-density lipoprotein (HDL, also known as the ... "good" cholesterol) to low-density lipoprotein (LDL, also known as the "bad" cholesterol) tends to be lower in smokers compared ...
Cholesterol 7 alpha-hydroxylase. *Methane monooxygenase. *3A4. *Lanosterol 14 alpha-demethylase. *24-hydroxycholesterol 7α- ...
CoQ10 shares a biosynthetic pathway with cholesterol. The synthesis of an intermediary precursor of CoQ10, mevalonate, is ... The "statin" family of cholesterol-reducing medications inhibits HMG-CoA reductase. One possible side effect of statins is ... inhibited by some beta blockers, blood pressure-lowering medication,[10] and statins, a class of cholesterol-lowering drugs.[11 ... Complex IV/Cytochrome c oxidase. *Coenzyme Q10 synthesis: COQ2. *COQ3. *COQ4. *COQ5 ...
Cytochrome P-450 is the terminal oxidase component of an electron transport chain. It is not a single enzyme, but rather ... cholesterol, steroid hormones, fatty acids, proteins) and exogenous substances (e.g., drugs, alcohol).[36] The central role ...
Ocsaíodáis Oxidase. *Ocsatóicin Oxytocin. P[cuir in eagar , athraigh foinse]. *p53. *Aigéid para-aimínbeansóch Para- ... Colaistéaról Cholesterol. *Coilín Choline. *Chondroitin sulfate. *Cinnamaldehyde. *Ciotral Citral. *Aigéad citreach Citric acid ...
Lecithin-cholesterol acyltransferase *Glycerol-3-phosphate O-acyltransferase. *1-acylglycerol-3-phosphate O-acyltransferase ... Complex IV/Cytochrome c oxidase. *Coenzyme Q10 synthesis: COQ2. *COQ3. *COQ4. *COQ5 ...
Most are oxidase-negative and catalase-negative, and many are facultative anaerobes. ... and interacts with cholesterol in the membrane of eukaryotic cells (mainly red and white blood cells, macrophages, and ...
Cholesterol during development: deficiencies in myelinization of the brain; demyelination of the brain and neurodegenerative ... Molybdenum required for xanthine oxidase and related oxidases. *Selenium required for peroxidase (antioxidant proteins) ... and reduced HDL cholesterol.[medical citation needed] ... including cytochrome c oxidase. *Chromium required for sugar ...
A. Glucose oxidase G. l. u. c. o. s. e. +. O. 2. →. O. x. i. d. a. t. i. o. n. g. l. u. c. o. s. e. o. x. i. d. a. s. e. D- ... a b What are mg/dl and mmol/l? How to convert? Glucose? Cholesterol? Advameg, Inc. ... The two most common employed enzymes are glucose oxidase and hexokinase.[28] Average blood glucose concentrations can also be ... More specific than glucose oxidase method due to G-6PO4, which inhibits interfering substances except when sample is hemolyzed ...
Dzugan, S. A. Is low cholesterol dangerous? Life Extension. December 2004. *↑ Mercola, J. Low cholesterol causes aggressive ... Piperine from the fruits of Piper longum with inhibitory effect on monoamine oxidase and antidepressant-like activity.». ... Relationship between cholesterol levels and depression in the elderly. Minerva Med. 86:251-256, 1995. ... Further evidence for low serum cholesterol and suicidal behaviour. J Affect Disord. 61(1-2):69-71, 2000. ...
The cytosolic acetyl-CoA is used for fatty acid synthesis and the production of cholesterol. Cholesterol can, in turn, be used ... Complex IV/Cytochrome c oxidase. *Coenzyme Q10 synthesis: COQ2. *COQ3. *COQ4. *COQ5 ...
... reacts with a wide variety of biomolecules, including DNA, RNA,[8][15][16][17] fatty acid groups, cholesterol ... Later studies[38] revealed that Ubiquinol oxidase activity ceases first, and the still-active cytochromes reduce the remaining ... Carr, AC; Van Den Berg, JJ; Winterbourn, CC (1996). "Chlorination of cholesterol in cell membranes by hypochlorous acid". ... Cholesterol chlorohydrin have also been observed,[19][22] but do not greatly affect permeability, and it is believed that Cl2 ...
Cholesterol side-chain cleavage enzyme. *Cytochrome b6f complex. *Electron transport chain. *Fatty acid synthetase complex ... Aldehyde oxidase. 1.2.4: disulfide. *Oxoglutarate dehydrogenase complex. *Pyruvate dehydrogenase. *Branched-chain alpha-keto ...
Begum R, Powner MB, Hudson N, Hogg C, Jeffery G.: Treatment with 670 nm light up regulates cytochrome C oxidase expression and ... "Anti-hypercholesterolemic and anti-atherosclerotic effects of polarized-light therapy in rabbits fed a high-cholesterol diet". ...
cholesterol 24-hydroxylase. 1 subfamily, 1 gene. CYP46A1 CYP51. cholesterol biosynthesis. 1 subfamily, 1 gene, 3 pseudogenes. ... They are, in general, the terminal oxidase enzymes in electron transfer chains, broadly categorized as P450-containing systems ... cholesterol synthesis, and vitamin D metabolism. Cytochrome P450 enzymes also function to metabolize potentially toxic ...
Dihydrouracil oxidase. *Tetrahydroberberine oxidase. *Secologanin synthase. *Tryptophan alpha,beta-oxidase. *Pyrroloquinoline- ... Cholesterol side-chain cleavage enzyme. *Steroid 11-beta-hydroxylase. *Aldosterone synthase. *Frataxin ...
... is synthesized from cholesterol. Synthesis takes place in the zona fasciculata of the adrenal cortex. (The name ... Cortisol stimulates many copper enzymes (often to 50% of their total potential), including lysyl oxidase, an enzyme that cross- ... It also stimulates the main rate-limiting step in cortisol synthesis, in which cholesterol is converted to pregnenolone and ... ACTH increases the concentration of cholesterol in the inner mitochondrial membrane, via regulation of the steroidogenic acute ...
... between asparagine 485 and the pi system of FAD modulates the redox potential in the reaction catalyzed by cholesterol oxidase. ... CHOLESTEROL OXIDASE A 504 Streptomyces sp. EC#: 1.1.3.6 IUBMB Mutation: N485L Details: FAD COFACTOR NON-COVALENTLY BOUND TO THE ...
Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis. ... Product Description for Cholesterol Oxidase. Goat anti Bacteria Cholesterol Oxidase.. Presentation: Ig Fraction. Product is ... This product detects Cholesterol oxidase (microorganism). Cross reactivity against Cholesterol oxidase from other sources is ... Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis. In addition, they ...
2. Free cholesterol is the preferred substrate for adrenal-cortex cholesterol oxidase; the apparent K(m) for cholesteryl ... Substrate and inhibitor specificity of the cholesterol oxidase in bovine adrenal cortex. PR Raggatt, MW Whitehouse ... Substrate and inhibitor specificity of the cholesterol oxidase in bovine adrenal cortex ... Substrate and inhibitor specificity of the cholesterol oxidase in bovine adrenal cortex ...
Cholesterol oxidases are bacterial oxidases widely used commercially for their application in the detection of cholesterol in ... Immobilization of Cholesterol Oxidase: An Overview Shubhrima Ghosh, Razi Ahmad, Sunil Kumar Khare*. Enzyme and Microbial ... However, the soluble form of cholesterol oxidases are found to be less stable when applied at higher temperatures, broader pH ... This review focuses on the immobilization of cholesterol oxidases on various macro/micro matrices as well as nanoparticles and ...
... measurement of serum cholesterol, food industry as a biocatal.. ... Cholesterol oxidase (CHO) is one of the valuable enzymes that ... Cholesterol oxidase (CHO) is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food ... The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a ... Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. ...
The phenomenon has been observed in several systems: cholesterol oxidase, ... The phenomenon has been observed in several systems: cholesterol oxidase, flavin reductase, and exo-nuclease. Various single- ...
17379143] Cholesterol oxidases act as signaling proteins for the biosynthesis of the polyene macrolide pimaricin. (Chem Biol ...
The layer-bylayer technique was also used to immobilize the enzyme cholesterol oxidase, alternated with different ... The thin films showed a good performance as an amperometric biosensor for the detection of cholesterol at low concentrations ( ...
In enzymology, a cholesterol oxidase (EC 1.1.3.6) is an enzyme that catalyzes the chemical reaction cholesterol + O2 ⇌ {\ ... Coulombe R, Yue KQ, Ghisla S, Vrielink A (August 2001). "Oxygen access to the active site of cholesterol oxidase through a ... The substrate-binding domain found in some bacterial cholesterol oxidases is composed of an eight-stranded mixed beta-pleated ... Richmond W (1973). "Preparation and properties of a cholesterol oxidase from Nocardia sp. and its application to the enzymatic ...
... the global Cholesterol Oxidase market is valued at USD XX million in 2016 and is expected to reach USD XX million by the end of ... 1 Cholesterol Oxidase Market Overview. 1.1 Product Overview and Scope of Cholesterol Oxidase. 1.2 Cholesterol Oxidase Segment ... 2.5.1 Cholesterol Oxidase Market Concentration Rate. 2.5.2 Cholesterol Oxidase Market Share of Top 3 and Top 5 Manufacturers. ... 1.4 Global Cholesterol Oxidase Market by Region (2012-2022). 1.4.1 Global Cholesterol Oxidase Market Size (Value) and CAGR (%) ...
... Katarzyna Bednarska, Michal Kielbik, ... Katarzyna Bednarska, Michal Kielbik, Zofia Sulowska, Jaroslaw Dziadek, and Magdalena Klink, "Cholesterol Oxidase Binds TLR2 and ...
... between asparagine 485 and the pi system of FAD modulates the redox potential in the reaction catalyzed by cholesterol oxidase. ...
There was a strong correlation between cell cholesterol content and NADPH oxidase lag phase (R(s) = 0.76, P , 0.01). Cell ... Cell cholesterol was in the unesterified from indicating that it was membrane-associated. Pre-treatment mean cell cholesterol ... Cholesterol Levels: What You Need to Know - MedlinePlus Health Information. *How to Lower Cholesterol - MedlinePlus Health ... Cell membrane cholesterol is an important determinant of membrane fluidity. Changes in fluidity have important consequences for ...
Global Cholesterol Oxidase Sales Market Report 2017 Size and Share Published in 2014-05-03 Available for US$ 4000 at ... 1 Cholesterol Oxidase Market Overview. 1.1 Product Overview and Scope of Cholesterol Oxidase. 1.2 Classification of Cholesterol ... 2.2 Global Cholesterol Oxidase (Volume and Value) by Type. 2.2.1 Global Cholesterol Oxidase Sales and Market Share by Type ( ... 4 China Cholesterol Oxidase (Volume, Value and Sales Price). 4.1 China Cholesterol Oxidase Sales and Value (2012-2017). 4.1.1 ...
Cholesterol Oxidase, Streptomyces sp. CAS 9028-76-6, is a native cholesterol oxidase that catalyzes the oxidation of ... cholesterol to cholesterone and hydrogen peroxide. - Find MSDS or SDS, a COA, data sheets and more information. ... More,, Cholesterol Oxidase, Streptomyces sp. CAS 9028-76-6, is a native cholesterol oxidase that catalyzes the oxidation of ... Cholesterol Oxidase, Streptomyces sp. CAS 9028-76-6, is a native cholesterol oxidase that catalyzes the oxidation of ...
CgChoA is a true cholesterol oxidase which activity ranges among the high performing described cholesterol oxidases from other ... The N-terminally His-tagged cholesterol oxidase (CgChoA) was assigned to be a monomer in solution by size exclusion ... The gene choA encoding a cholesterol oxidase from Chryseobacterium gleum DSM 16776 was cloned into the pQE-30 expression vector ... Thus, the enzyme broadens the available toolbox of cholesterol oxidases for e.g. synthetic and biosensing applications. ...
Cholesterol Oxidase from Streptomyces sp ctalyzing the two-step transformation of cholesterol to cholest-4-en-3-one and H2O2. ... Cholesterol + O₂ -, Cholest-4-en-3-one + H₂O₂. Unit Definition. One enzymatic unit of cholesterol oxidase converts 1.0 μmole of ... Cholesterol oxidase is a flavoprotein involved in the first step of cholesterol catabolism. The enzyme first oxidizes ... cholesterol to cholest-5-en-3-one then isomerizes it to cholest-4-en-3-one while producing hydrogen peroxide H2O2. Available in ...
... rabbit PAb against Nocardia erythropolis Cholesterol oxidase \ NE033/PAb for more molecular products just contact us ... WP632: Cholesterol metabolism. WP659: Cholesterol metabolism. WP833: Cholesterol Biosynthesis. WP952: Cholesterol Biosynthesis ... WP103: Cholesterol Biosynthesis. WP1070: Cholesterol Biosynthesis. WP1186: Cholesterol Biosynthesis. WP132: Cholesterol ... WP1795: Cholesterol biosynthesis. WP197: Cholesterol Biosynthesis. WP2011: SREBF and miR33 in cholesterol and lipid homeostasis ...
Use Cholesterol Oxidase in diagnostic tests for the determination of cholesterol in combination with Cholesterol Esterase, ... Contaminants (expressed as percentage of Cholesterol Oxidase activity):. Glucose oxidase: ≤0.01. Catalase: ≤1.00. Uricase: ≤ ... Will be supplied as "Cholesterol Oxidase, Streptomyces species". Unit of measure is "kU". +- ... Cholesterol Esterase. from Candida cylindracea, solution. Cholesterol Esterase. from Candida cylindracea, lyophilizate. ...
Oxidase Dropper Pk. 50, OxiDrop™, Oxidase Test, Oxidase Reagent according to Gaby-Hadley A, for microbiology, Oxidase.. ... Cholesterol Oxidase from Streptomyces sp. MP Biomedicals. Cholesterol oxidase (CHOD) catalyzes the first step in cholesterol ... Oxidase Dropper Pk. 50 BD. Oxidase Reagent Droppers are used in the Kovacs oxidase test as a qualitative reaction in the ... Bilirubin Oxidase from Myrothecium species MP Biomedicals. …oxidase system, Acyl coenzyme A oxidase system, and Glycerol-3- ...
... flavoprotein cholesterol oxidase (ChOx) [EC 1.1.3.6], aryl alcohol oxidase (AAO) [EC 1.1.3.7] and hydroxymethylfurfural oxidase ... such as alditol oxidase (AldO), aryl alcohol oxidase (AAO), hydroxymethyl furfuryl oxidase (HMFO), hexose oxidase (HOX, Dbv29 ... 2012). In contrast to galactose oxidase, which does not accept sec-allylic alcohols, cholesterol oxidase from Rhodococcus ... Murooka Y, Yamashita M (2001) Genetic and protein engineering of diagnostic enzymes, cholesterol oxidase and xylitol oxidase. J ...
Recombinant Cholesterol Oxidase belongs to the family of oxidoreductases, specifically those acting on the CH-OH group of donor ... cholesterol: oxygen oxidoreductase; cholesterol oxidase; EC 1.1.3.6 ... Recombinant Cholesterol Oxidase belongs to the family of oxidoreductases, specifically those acting on the CH-OH group of donor ... Recombinant Cholesterol Oxidase produced in E.coli has a molecular mass of about 34,000 Da. ...
Recombinant Cholesterol Oxidase belongs to the family of oxidoreductases, specifically those acting on the CH-OH group of donor ... Recombinant Cholesterol Oxidase belongs to the family of oxidoreductases, specifically those acting on the CH-OH group of donor ... EC 1.1.3.6, cholesterol-O2 oxidoreductase; 3β-hydroxy steroid oxidoreductase; 3β-hydroxysteroid:oxygen oxidoreductase; 9028-76- ... Creatinase/Creatininase/Sarcosine Oxidase Enzyme Discovery Collagen and Collagenase Enzyme Assays Tn5 Transposase Enzyme ...
Cholesterol oxidase from Brevibacterium sterolicum : the relationship between covalent flavinylation and redox properties. * ... The functional role of the histidyl-FAD bond in the latter cholesterol oxidase was addressed by studying the properties of the ... The functional role of the histidyl-FAD bond in the latter cholesterol oxidase was addressed by studying the properties of the ... Cholesterol oxidase from Brevibacterium sterolicum : the relationship between covalent flavinylation and redox properties. Type ...
Cholesterol Oxidase Cholesterol Oxidase View options Request a quote Add to Favorites ...
Cholesteryl ester + H2O -------------------------------------,cholesterol + fatty acid cholesterol oxidase Cholesterol + O2 ... LBDHDL - HDL-cholesterol (mg/dL). Variable Name: LBDHDL. SAS Label: HDL-cholesterol (mg/dL). English Text: HDL-cholesterol (mg/ ... LBXTC - Total cholesterol (mg/dL). Variable Name: LBXTC. SAS Label: Total cholesterol (mg/dL). English Text: Total cholesterol ... PEG-cholesterol oxidase Unesterified cholesterol + O2 -------------------------------------, cholestenone + H2O2 ...
Cholesteryl ester + H2O -------------------------------------,cholesterol + fatty acid cholesterol oxidase Cholesterol + O2 ... LBXTC - Total cholesterol (mg/dL). Variable Name: LBXTC. SAS Label: Total cholesterol (mg/dL). English Text: Total cholesterol ... Total Cholesterol( mmol/L). English Text: Total Cholesterol( mmol/L). Target: Both males and females 6 YEARS - 150 YEARS. Code ... Total Cholesterol There were changes in the instruments used to measure total cholesterol, but the method and lab site were the ...
Glucose oxidase. β-glucose. Cholesterol esterase; cholesterol oxidase. Cholesterol. Lipoprotein lipase; glycerol kinase; ... Polarographic analysis of cholesterol and other macromolecular substances. US4053381 *. 19 May 1976. 11 Oct 1977. Eastman Kodak ... The ionizing agent may be an analyte specific enzyme, such as glucose oxidase or glucose dehydrogenase, to catalyze the ... Thus, for a glucose sensor system including glucose oxidase and a ferricyanide mediator as reagents, additional ferrocyanide ( ...
Decomposition process of cholesterol by this strain results from its production of cholesterol oxidase enzyme (ChoX). The ... The cholesterol oxidase enzyme (ChoX) produced by E. hirae was extracted at an (NH4)2SO4 saturation level of 80 % and purified ... The bacterial isolate that displayed the highest cholesterol oxidase activity was identified as Enterococcus hirae. The maximal ... E. hirae Mil-31 isolated from milk had a great capacity to decompose cholesterol in basal medium supplemented with cholesterol ...
Improvement of a diagnostic enzyme, Streptomyces cholesterol oxidase, by site-directed mutagenesis. Default journal. 2000 Nov 1 ... Improvement of a diagnostic enzyme, Streptomyces cholesterol oxidase, by site-directed mutagenesis. In: Default journal. 2000. ... Improvement of a diagnostic enzyme, Streptomyces cholesterol oxidase, by site-directed mutagenesis. / Yamashita, Mitsuo; Toyama ... title = "Improvement of a diagnostic enzyme, Streptomyces cholesterol oxidase, by site-directed mutagenesis", ...
Ascorbate oxidase; Cholesterol esterase; Cholinesterase; Collagenase; DNase I; DNase II; Enterokinase; Glucose-6-phosphate ... Xanthine oxidase; Superoxide dismutase; Fibronectin; Restriction Endonucleases; Reverse transcriptase; M-MuLV; Monoclonal ... dehydrogenase; Glucose oxidase; Glucose Isomerase; Glutamate dehydrogenase; Glyceraldehyde-3-phosphate dehydrogenase; ...
Alteration of substrate specificity of cholesterol oxidase from Streptomyces sp. by site-directed mutagenesis. In: Protein ... Alteration of substrate specificity of cholesterol oxidase from Streptomyces sp. by site-directed mutagenesis. Protein ... Alteration of substrate specificity of cholesterol oxidase from Streptomyces sp. by site-directed mutagenesis. / Toyama, ... The amino acid substitutions chosen were based on structural comparisons of cholesterol oxidases from Streptomyces and ...
We report a straightforward and easy protocol for cholesterol oxidase production which can be performed in any laboratory. ... In this study, expression optimization of cholesterol oxidase from Streptomyces sp. SA-COO was investigated in Escherichia coli ... Applying the optimized protocol, the production of recombinant cholesterol oxidase was significantly enhanced from 3.2 to 158 U ... Accordingly, development of an efficient protocol for overexpression of cholesterol oxidase can be very valuable and beneficial ...
  • The layer-bylayer technique was also used to immobilize the enzyme cholesterol oxidase, alternated with different polyelectrolytes. (ufscar.br)
  • Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis. (acris-antibodies.com)
  • Cholesterol oxidases are bacterial oxidases widely used commercially for their application in the detection of cholesterol in blood serum, clinical or food samples. (openbiotechnologyjournal.com)
  • Immunoelectrophoresis give a single precipitin arc against anti-goat serum as well as purified and partially purified Cholesterol oxidase [microorganism]. (acris-antibodies.com)
  • Cholesterol oxidase (CHO) is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. (ijmrhs.com)
  • The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. (ijmrhs.com)
  • The thin films showed a good performance as an amperometric biosensor for the detection of cholesterol at low concentrations (10-5 M), with the functioning of the biosensor attributed to the use of hemoglobin in mediating the effects of excluding interfering ascorbic acid and uric acid. (ufscar.br)
  • This product has been assayed against 1.0 µg of Cholesterol oxidase [microorganism] in a standard sandwich ELISA using peroxidase conjugated affinity purified anti-Goat IgG and ABTS as a substrate for 30 minutes at room temperature. (acris-antibodies.com)
  • This product detects Cholesterol oxidase (microorganism). (acris-antibodies.com)
  • 4. The bioelectrode of claim 1 wherein the oxidase is cholesterol oxidase, xanthine oxidase, amino acid oxidase, lactic acid oxidase, alcohol oxidase, glycolate oxidase, pyridoxal-4-oxidase, sorbose oxidase, gulonolactose oxidase or galactose oxidase. (google.com)
  • Cholesterol oxidases are important enzymes for applications such as the analysis of cholesterol in clinical samples, the synthesis of steroid derived drugs, and are considered as potential antibacterial drug targets. (biomedcentral.com)
  • Turner 2011 ), and oxidases are a prominent subclass of redox enzymes, which use oxygen either as oxidant or as electron acceptor. (springer.com)
  • Cholesterol oxidase (CHO) is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. (ijmrhs.com)
  • These findings will provide several ideas for the design of more powerful enzymes that can be applied to clinical determination of serum cholesterol levels and as sterol probes. (elsevier.com)
  • Stabilized enzymes useful in the diagnostic assay of total cholesterol are prepared by dissolving a salt of cholic acid in a buffer solution providing a pH within the range of about 4 to about 9, to the solution is added a cholesterol esterase. (patentgenius.com)
  • 12. The bioelectrode of claim 1 further comprising depositing at least two oxidase enzymes atop the deposited monolayer-coated colloidal gold peroxidase layer. (google.com)
  • Other diverse functions the filters perform include separation of erythrocytes from plasma, addition of enzymes and detergents to the resulting plasma with complete mixing, retention of the plasma solution sufficiently long to ensure complete conversion of cholesterol and cholesterol esters into cholestenone and hydrogen peroxide, and subsequent release of the reacted plasma into the measurement area of the detection zone. (thefreedictionary.com)
  • Each organism elaborates lipid hydrolyzing enzymes (cholesterol oxidase by R. equi and sphingomyelinase D by A. haemolyticum ) that are toxic to animals and humans and damaging to mammalian cell membranes. (cdc.gov)
  • The result of this facile approach was investigated for the biomedical applications for real samples at room conditions with significant assembly (Au/TGA/ChOx) towards the development of selected cholesterol biosensors, which can offer analytical access to a large group of enzymes for wide range of biomedical applications in health-care fields. (jove.com)
  • EC Number: 2006-250-9 MDL Number: MFCD00599413 PubChem Substance ID: 24278141 Biochem/physiol Actions Inhibitor of xanthine oxidase and de novo pyrimidine biosynthesis. (thomassci.com)
  • glucose oxidase, cholesterol, urease and peroxidase. (igi-global.com)
  • Study of the deactivation process of the glucose oxidase-catalase enzymatic system by means of simulation (L.E. Romero, D. Cantero). (elsevier.com)
  • 5. The bioelectrode of claim 1 wherein the oxidase is glucose oxidase. (google.com)
  • 9. A bioelectrode for mediatorless electrochemical detection of glucose comprising a conducting surface having a first deposited layer of monolayer-coated colloidal gold-adsorbed horseradish peroxidase and a second deposited layer of colloidal gold-adsorbed glucose oxidase atop said first layer. (google.com)
  • 11. The bioelectrode of claim 9 wherein the first layer of colloidal gold-adsorbed horseradish peroxidase is evaporatively deposited onto the electrode surface prior to evaporative deposition of the second layer of colloidal gold-adsorbed glucose oxidase. (google.com)
  • In particular, mediatorless detection of glucose is possible with colloidal gold adsorbed horseradish peroxidase in the presence of glucose oxidase. (google.com)
  • The enzymatic overall cholesterol oxidation comprises three steps. (biomedcentral.com)
  • One enzymatic unit of cholesterol oxidase converts 1.0 μmole of cholesterol to 4-cholesten-3-one per min at pH 7.5 at 25 °C. (moleculardepot.com)
  • The apolipoprotein B containing lipoproteins in the specimen are reacted with a blocking reagent that renders them non-reactive with the enzymatic cholesterol reagent under conditions of the assay. (cdc.gov)
  • The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. (ijmrhs.com)
  • The reduction of food cholesterol levels may occur via enzymatic methods (Yehia et al. (springeropen.com)
  • The amperometric determination is based on the electrochemical detection of H 2 O 2 generated in the enzymatic reaction of cholesterol. (mdpi.com)
  • and its application to the enzymatic assay of total cholesterol in serum," Clinical Chemistry , vol. 19, no. 12, pp. 1350-1356, 1973. (hindawi.com)
  • Enzymatic Determination of Total Serum Cholesterol", Clinical Chem. (patentgenius.com)
  • To alter cholesterol content we employed acute pharmacological approaches to remove cholesterol, rather than slower genetic interventions or inhibitors of enzymatic activities, to bypass compensatory effects and/or accumulation of intermediary products. (europa.eu)
  • Both protocols produce a moderate but significant decrease of cholesterol levels in hippocampal slices, as probed by a fluorescence quantitative enzymatic assay. (europa.eu)
  • The substrate-binding domain found in some bacterial cholesterol oxidases is composed of an eight-stranded mixed beta-pleated sheet and six alpha-helices. (wikipedia.org)
  • This product has been assayed against 1.0 µg of Cholesterol oxidase [microorganism] in a standard sandwich ELISA using peroxidase conjugated affinity purified anti-Goat IgG and ABTS as a substrate for 30 minutes at room temperature. (acris-antibodies.com)
  • The maximal growth and cholesterol decomposition were achieved with a 1-day incubation under static conditions at 37 °C in cholesterol basal medium adjusted to pH 7 supplemented with 1 g/l cholesterol as the substrate, no additional carbon or nitrogen sources and 0.5 % CaSO 4 . (beds.ac.uk)
  • From previous studies and this study, the V145 residue seems to be important for the stability and substrate binding of the cholesterol oxidase. (elsevier.com)
  • 15. An instrument for measuring concentrations of oxidase substrate comprising the bioelectrode of claim 1. (google.com)
  • The method uses sulfated alpha-cyclodextrin in the presence of Mg +2 , which forms complexes with apoB containing lipoproteins, and polyethylene glycol-coupled cholesteryl esterase and cholesterol oxidase for the HDL-cholesterol measurement. (cdc.gov)
  • Suitable for determination of total cholesterol when coupled with cholinesterase and peroxidase. (emdmillipore.com)
  • A cholesterol oxidase and a peroxidase are each dissolved in separate portions of buffer solution and introduced into the buffered solution containing the cholesterol esterase. (patentgenius.com)
  • an oxidase layer atop the deposited colloidal gold adsorbed peroxidase wherein direct electron transfer to the conducting surface occurs in the presence of an analyte when the bioelectrode is suitably coupled with a reference/counter electrode. (google.com)
  • 3. The bioelectrode of claim 1 wherein colloidal gold adsorbed oxidase is deposited atop the peroxidase. (google.com)
  • Cholesterol oxidases are found exclusively in bacteria and have been described in various species including Brevibacterium sp. (biomedcentral.com)
  • Brevibacterium sterolicum possesses two forms of cholesterol oxidase, one containing noncovalently bound FAD, the second containing a FAD covalently linked to His69 of the protein backbone. (uni-konstanz.de)
  • 11. A solution as claimed in claim 1 or 8 wherein the cholesterol oxidase is recovered from a microorganism selected from the group consisting of pseudomonas sp, nocardia erythropolis, and brevibacterium stero licum. (patentgenius.com)
  • Abstract Macrophage uptake of oxidatively modified LDL (Ox-LDL), unlike the uptake of acetylated LDL (Ac-LDL), resulted in lysosomal accumulation of unesterified cholesterol (UC). (ahajournals.org)
  • Recombinant Cholesterol Oxidase belongs to the family of oxidoreductases, specifically those acting on the CH-OH group of donor with oxygen as acceptor. (creative-enzymes.com)
  • Recombinant Cholesterol Oxidase produced in E.coli has a molecular mass of about 34,000 Da. (creative-enzymes.com)
  • In attempts to define the molecular basis of differences in catalytic activity or stability, substitutions at six amino acid residues were introduced into cholesterol oxidase using site-directed mutagenesis of its gene. (elsevier.com)
  • We identified six highly hydrophobic regions in this domain that may be important for receptor activity and performed site-directed mutagenesis to investigate the importance of these regions in SR-BI-mediated cholesterol transport. (pubmedcentralcanada.ca)
  • Other names in common use include cholesterol- O2 oxidoreductase, 3beta-hydroxy steroid oxidoreductase, and 3beta-hydroxysteroid:oxygen oxidoreductase. (wikipedia.org)
  • Oxidoreductase that catalyzes the interconversion of cholesterol to cholest-4-en-3-one. (roche.com)
  • Cholesterol oxidases (EC 1.1.3.6) are bifunctional bacterial flavoenzymes belonging to the family of oxidoreductase which catalyze the first step in the catabolism of cholesterol. (springeropen.com)
  • Choline Oxidase from Alcaligenes sp. (thomassci.com)
  • has also been used in spectroscopic studies on the photoreaction of choline oxidase with covalently bound flavin. (thomassci.com)
  • 5. Cholesteryl esters inhibit the oxidation of cholesterol competitively (K(i) for cholesteryl phosphate 28mum, for cholesteryl sulphate 110mum, for cholesteryl acetate 65mum) but pregnenolone esters do not inhibit this system. (biochemj.org)
  • 6. Pregnenolone and 20alpha-hydroxycholesterol (both metabolites of cholesterol in this system) inhibit the oxidation of cholesterol non-competitively. (biochemj.org)
  • CAS 9028-76-6, is a native cholesterol oxidase that catalyzes the oxidation of cholesterol to cholesterone and hydrogen peroxide. (emdmillipore.com)
  • Catalyzes oxidation of cholesterol to cholesterone and hydrogen peroxide (isoelectric points: 6.1 and 7.3). (emdmillipore.com)
  • Cholesterol in the HDL-containing supernatant is measured as described above for total cholesterol. (cdc.gov)
  • There were changes in the instruments used to measure total cholesterol, but the method and lab site were the same as 2003- 2004. (cdc.gov)
  • In 2005, total cholesterol was measured enzymatically in serum using the Roche Hitachi 717. (cdc.gov)
  • No adjustment was necessary for the change in instrumentation for total cholesterol. (cdc.gov)
  • The total cholesterol in mg/dL (LBXTC) was converted to mmol/L (LBDTCSI) by multiplying by 0.02586. (cdc.gov)
  • The Lipid Laboratory Total Cholesterol data file contains laboratory test results for total cholesterol (LBXTC), which uses the reference analytic method. (cdc.gov)
  • However, the NHANES standard biochemistry profile laboratory also includes measurements of total cholesterol. (cdc.gov)
  • The biochemistry profile total cholesterol variable name is LBXSCH. (cdc.gov)
  • LDL-cholesterol=Total cholesterol-HDL-colesterol-0.46X triglycerides (all values are in m mol/l). (scribd.com)
  • however, the exact mechanisms by which these probiotic bacteria reduce total cholesterol levels are still unclear. (pubmedcentralcanada.ca)
  • This product detects Cholesterol oxidase (microorganism). (acris-antibodies.com)
  • Immunoelectrophoresis give a single precipitin arc against anti-goat serum as well as purified and partially purified Cholesterol oxidase [microorganism]. (acris-antibodies.com)
  • Rats fed wild-type L. acidophilus A4 showed a greater than 20% reduction in total serum cholesterol, but rats fed BA9 mutant L. acidophilus showed only an approximately 10% reduction in cholesterol. (pubmedcentralcanada.ca)
  • The ability to reduce serum cholesterol is a highly desirable attribute of probiotic cultures as a dietary component. (pubmedcentralcanada.ca)
  • Despite the fact that numerous studies have shown that Lactobacillus acidophilus can reduce serum cholesterol levels, neither the mechanisms of this process nor the molecules responsible for this activity are well understood. (pubmedcentralcanada.ca)
  • Since high serum cholesterol levels have been clearly shown to be a leading risk factor for human disease, more and more studies have focused on examining the effects of cholesterol on human health. (pubmedcentralcanada.ca)
  • They catalyze oxidation as well as isomerization of cholesterol and produce equimolar amounts of cholest-4-en-3-one coupled with hydrogen peroxide as the final products (Moradpour and Ghasemian 2016 ). (springeropen.com)
  • oxidase to dihydroxyacetone and hydrogen peroxide. (scribd.com)
  • Oxidation by hydrogen peroxide of D-amino acid oxidase from Rhodotorula gracilis (V. Obregón et al. ). (elsevier.com)
  • Oxidase Reagent Droppers are used in the Kovacs oxidase test as a qualitative reaction in the identification of nonfermenters and miscellaneous gram-negative bacteria. (thomassci.com)
  • OxiDrop™, Oxidase Test is a liquid ready-to-use reagent that is used in procedures to detect cytochrome oxidase activity in bacteria. (thomassci.com)
  • Oxidase Test is an important differential procedure which should be performed on all gram-negative bacteria that are to be identified. (thomassci.com)
  • BBL DrySlide Oxidase is used for determining the oxidase reaction of bacteria. (thomassci.com)
  • This article identifies novel factors involved in cholesterol reduction by probiotic bacteria, which were identified using genetic and proteomic approaches. (pubmedcentralcanada.ca)
  • These results provide important insights into the mechanism by which these lactic acid bacteria reduce cholesterol. (pubmedcentralcanada.ca)
  • Fatty acids and cholesterol were removed by a dilute acid / organic solvent partition procedure in which the contaminants passed into the organic phase leaving glycerol in the aqueous phase. (scribd.com)
  • Cholesterol is measured enzymatically in serum or plasma in a series of coupled reactions that hydrolyze cholesteryl esters and oxidize the 3-OH group of cholesterol. (cdc.gov)
  • Determination of cholesterol was carried out by the oxidation of enzymatically produced H 2 O 2 at 0.4 V vs. Ag/AgCl. (mdpi.com)
  • 1991 ). In addition, other investigations have addressed the role of cholesterol oxidase as an approach to pest control strategies (Cho et al. (springeropen.com)
  • We focused on the role of cholesterol in the regulation of STIM1-mediated Orai1 currents. (sciencemag.org)
  • Therefore, we believe that advancing our understanding of the role of cholesterol in neuronal mechanisms for learning and memory is of the outmost importance. (europa.eu)
  • In this study, we investigated the role of cholesterol and its contribution to the modification of synaptic functions. (europa.eu)
  • The srf-3 mutant emphasizes the relationship between the role of cholesterol in membrane fusion and virus exit, and most significantly, identifies a novel spike protein region involved in the virus cholesterol requirement. (rupress.org)
  • Increased cholesterol also increased aqueous content transfer between HAS cells and RBC over a broad range of HA expression levels, suggesting that cholesterol also favors fusion pore expansion. (rupress.org)
  • The extracellular domain of SR-BI is required for HDL binding and selective uptake of HDL-cholesterol. (pubmedcentralcanada.ca)
  • We conclude that the hydrophobicity of N-terminal extracellular regions of SR-BI is critical for cholesterol transport, possibly by mediating receptor-ligand and/or receptor-membrane interactions. (pubmedcentralcanada.ca)
  • Step 3: incubation of cells with extracellular acceptor and quantitation of movement of labelled cholesterol from cells to the acceptor. (jove.com)
  • Cholesterol oxidase is a flavoprotein involved in the first step of cholesterol catabolism. (moleculardepot.com)
  • Cholesterol oxidase, cholesterol, flavoprotein. (moleculardepot.com)
  • In this review, the mechanism of copper-containing and flavoprotein alcohol oxidases is discussed in view of their ability to accept electronically activated or non-activated alcohols and their propensity towards over-oxidation of aldehydes yielding carboxylic acids. (springer.com)
  • In flavoprotein oxidases, the oxidation proceeds via two half reactions, where the alcohol is first oxidised by a two-electron transfer during the reductive half reaction , yielding reduced flavin. (springer.com)
  • Preparation and properties of a cholesterol oxidase from Nocardia sp. (wikipedia.org)
  • rabbit PAb against Nocardia erythropolis Cholesterol oxidase polyclonal antibodies polyclonal antobodies can be directed against a recombinant proteine, the natural protein or an epitope. (antibody-antibodies.com)
  • Cholesterol oxidase (ChOx) has been electrochemically entrapped onto p -toluene sulphonate (PTS) doped poly (pyrrole-co- N -methyl pyrrole) (1:1) on indium-tin-oxide (ITO) glass plates. (springer.com)
  • To the best of our knowledge, this is the first statement with a very high sensitivity, low-detection limit, and low-sample volumes are required for cholesterol biosensor using Au/TGA/ChOx-chips assembly. (jove.com)
  • 3. Cholesteryl 3beta-acetate is hydrolysed by bovine adrenal-cortex mitochondria in vitro to free cholesterol, which is subsequently oxidized to more polar steroids and isocaproic acid. (biochemj.org)
  • 9 19 20 21 Although flavonoids in red wine and purple GJ reduce the susceptibility of low-density lipoprotein cholesterol (LDL-C) to oxidative stress in vitro, antioxidant effects in humans have been demonstrated only after ingestion of red wine, not purple GJ. (ahajournals.org)
  • the apparent K(m) for cholesteryl sulphate is 500mum and for free cholesterol 50mum under the same conditions. (biochemj.org)
  • Cells have two options to reduce their cholesterol content: to convert cholesterol into cholesteryl esters, an option with limited capacity as overloading cells with cholesteryl esters is also toxic, and cholesterol efflux, an option with potentially unlimited capacity. (jove.com)
  • The group of Prof. Nikolelis group has recently utilized graphene and ZnO (Zinc Oxide) to develop chemical nanosensors for species of clinical or food significance, such as urea, uric acid, cholesterol, etc. (benthamscience.com)
  • A number of other Delta(5)-3beta-hydroxy steroids inhibit cholesterol oxidation and evidence was obtained that the 3beta-hydroxyl group was necessary for inhibitory activity. (biochemj.org)
  • the detection of the cytochrome oxidase activity of microorganisms within 1 minute. (thomassci.com)
  • As an alternative to (thermodynamically disfavoured) nicotinamide-dependent alcohol dehydrogenases, alcohol oxidases make use of molecular oxygen but their application is under-represented in synthetic biotransformations. (springer.com)
  • Recently, stimulated-emission-depletion (STED) nanoscopy ( 21 , 22 ), delivering subdiffraction resolution in live cells, provided direct evidence that certain lipids are transiently trapped in cholesterol-assisted molecular complexes ( 23 , 24 ). (pnas.org)
  • A virulência deste pode estar associada a fatores como a cápsula de polissacarídeo, fosfolipase C e à enzima colesterol oxidase (fator equi). (scielo.br)
  • Evidence was obtained that other cholesterol esters behave similarly. (biochemj.org)
  • Cholesterol esters may thus act as precursors of steroid hormones. (biochemj.org)
  • Sponification liberated glycerol from triglycerides and phospholipids and converted the fatty acid from them and from cholesterol esters to soaps. (scribd.com)
  • In each case phospholipids and cholesterol esters had to be determined and the fatty acids present in them calculated and subtracted using factors derived from the average mol.wt. (scribd.com)
  • 14. A solution as recited in claim 1 or 8 wherein the cholesterol esterase is provided at least in an amount sufficient to complete the deesterification of cholesterol esters within a time of about ten minutes at a temperature of about37.degree. (patentgenius.com)
  • Effect of simvastatin therapy on cell membrane cholesterol content and membrane function as assessed by polymorphonuclear cell NADPH oxidase activity. (nih.gov)
  • Cell membrane cholesterol is an important determinant of membrane fluidity. (nih.gov)
  • Treatment of hypercholesterolaemia could therefore affect membrane function by reducing cell membrane cholesterol levels. (nih.gov)
  • The size of this confinement area is regulated by actin and membrane cholesterol. (jneurosci.org)
  • Pharmacological disruption of the cytoskeleton or membrane cholesterol significantly increased the dimensions of the confinement domain of Ca V channels, suggesting that macromolecular scaffolds are important for organizing the synapse. (jneurosci.org)
  • However, testing for a selective effect of native microdomains on the efficiency of fusion, without affecting membrane cholesterol density, has not been assessed. (biologists.org)
  • Semliki Forest virus (SFV) is an enveloped alphavirus that requires cellular membrane cholesterol for both membrane fusion and efficient exit of progeny virus from infected cells. (rupress.org)
  • It is concluded that the flavin 8α-linkage to a (N1)histidine is a pivotal factor in the modulation of the redox properties of this cholesterol oxidase to increase its oxidative power. (uni-konstanz.de)
  • Although cofactor-lacking oxidases are reported (Fetzner and Steiner 2010 ), commonly used alcohol oxidases depend on flavin (Macheroux et al. (springer.com)
  • In this paper, a novel amperometric cholesterol biosensor with immobilization of cholesterol oxidase on electrochemically polymerized polypyrrole-polyvinylsulphonate (PPy-PVS) films has been accomplished via the entrapment technique on the surface of a platinum electrode. (mdpi.com)
  • 6. The bioelectrode of claim 1 wherein the oxidase is immobilized in a matrix at the conducting surface of the electrode. (google.com)
  • sterols) together with suitable alcohol oxidases, their microbial source, relative activities and (stereo)selectivities. (springer.com)
  • On the other hand, a 50% reduction in SR-BI expression [ 17 ] or full disruption of the SR-BI gene in mice increased plasma HDL-cholesterol levels and reduced neutral lipid stores in the adrenal gland and ovary [ 24 , 25 ]. (pubmedcentralcanada.ca)
  • blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. (thefreelibrary.com)
  • Enrichment of HAS cells with cholesterol reduced the delay between triggering and lipid dye transfer between HAS cells and human red blood cells (RBC), indicating that cholesterol facilitates membrane lipid mixing prior to fusion pore opening. (rupress.org)
  • Since their proposal, the question of the existence and functional role of such cholesterol-mediated lipid assemblies has caused much controversy ( 13 - 16 ). (pnas.org)
  • A striking example of a defined lipid requirement in membrane fusion is the Semliki Forest virus (SFV) 1 fusion protein, which mediates the cholesterol and sphingolipid- dependent fusion of the virus membrane with the cellular membrane during virus infection. (rupress.org)
  • Potential association of SUG-induced alteration in cholesterol homeostasis with oxidative stress and apoptosis activation occurs. (medsci.org)
  • This phenotype was conferred by a single amino acid change in the E1 spike protein subunit, proline 226 to serine, that increased the cholesterol independence of both srf-3 fusion and exit. (rupress.org)
  • In NHANES 1999-2000, HDL-cholesterol was measured using two methods. (cdc.gov)