Cholesterol Oxidase: An enzyme that catalyzes the oxidation of cholesterol in the presence of molecular oxygen to 4-cholesten-3-one and hydrogen peroxide. The enzyme is not specific for cholesterol, but will also oxidize other 3-hydroxysteroids. EC 1.1.3.6.Research Report: Detailed account or statement or formal record of data resulting from empirical inquiry.Streptomyces: A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.Brevibacterium: A gram-positive organism found in dairy products, fresh and salt water, marine organisms, insects, and decaying organic matter.Cholesterol: The principal sterol of all higher animals, distributed in body tissues, especially the brain and spinal cord, and in animal fats and oils.Asparagine: A non-essential amino acid that is involved in the metabolic control of cell functions in nerve and brain tissue. It is biosynthesized from ASPARTIC ACID and AMMONIA by asparagine synthetase. (From Concise Encyclopedia Biochemistry and Molecular Biology, 3rd ed)Hydrogen Bonding: A low-energy attractive force between hydrogen and another element. It plays a major role in determining the properties of water, proteins, and other compounds.Cholestenones: CHOLESTENES with one or more double bonds and substituted by any number of keto groups.3-Hydroxysteroid Dehydrogenases: Catalyze the oxidation of 3-hydroxysteroids to 3-ketosteroids.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.NADPH Oxidase: A flavoprotein enzyme that catalyzes the univalent reduction of OXYGEN using NADPH as an electron donor to create SUPEROXIDE ANION. The enzyme is dependent on a variety of CYTOCHROMES. Defects in the production of superoxide ions by enzymes such as NADPH oxidase result in GRANULOMATOUS DISEASE, CHRONIC.Cholesterol Esters: Fatty acid esters of cholesterol which constitute about two-thirds of the cholesterol in the plasma. The accumulation of cholesterol esters in the arterial intima is a characteristic feature of atherosclerosis.Secosteroids: Steroids in which fission of one or more ring structures and concomitant addition of a hydrogen atom at each terminal group has occurred.Cholesterol, Dietary: Cholesterol present in food, especially in animal products.Cholesterol, HDL: Cholesterol which is contained in or bound to high-density lipoproteins (HDL), including CHOLESTEROL ESTERS and free cholesterol.Pregnenolone: A 21-carbon steroid, derived from CHOLESTEROL and found in steroid hormone-producing tissues. Pregnenolone is the precursor to GONADAL STEROID HORMONES and the adrenal CORTICOSTEROIDS.Adrenal Cortex: The outer layer of the adrenal gland. It is derived from MESODERM and comprised of three zones (outer ZONA GLOMERULOSA, middle ZONA FASCICULATA, and inner ZONA RETICULARIS) with each producing various steroids preferentially, such as ALDOSTERONE; HYDROCORTISONE; DEHYDROEPIANDROSTERONE; and ANDROSTENEDIONE. Adrenal cortex function is regulated by pituitary ADRENOCORTICOTROPIN.EstersCholesterol, LDL: Cholesterol which is contained in or bound to low density lipoproteins (LDL), including CHOLESTEROL ESTERS and free cholesterol.Editorial Policies: The guidelines and policy statements set forth by the editor(s) or editorial board of a publication.Periodicals as Topic: A publication issued at stated, more or less regular, intervals.Peer Review: An organized procedure carried out by a select committee of professionals in evaluating the performance of other professionals in meeting the standards of their specialty. Review by peers is used by editors in the evaluation of articles and other papers submitted for publication. Peer review is used also in the evaluation of grant applications. It is applied also in evaluating the quality of health care provided to patients.Publishing: "The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.Peer Review, Research: The evaluation by experts of the quality and pertinence of research or research proposals of other experts in the same field. Peer review is used by editors in deciding which submissions warrant publication, by granting agencies to determine which proposals should be funded, and by academic institutions in tenure decisions.Journal Impact Factor: A quantitative measure of the frequency on average with which articles in a journal have been cited in a given period of time.Biotechnology: Body of knowledge related to the use of organisms, cells or cell-derived constituents for the purpose of developing products which are technically, scientifically and clinically useful. Alteration of biologic function at the molecular level (i.e., GENETIC ENGINEERING) is a central focus; laboratory methods used include TRANSFECTION and CLONING technologies, sequence and structure analysis algorithms, computer databases, and gene and protein structure function analysis and prediction.Governing Board: The group in which legal authority is vested for the control of health-related institutions and organizations.Manuscripts as Topic: Compositions written by hand, as one written before the invention or adoption of printing. A manuscript may also refer to a handwritten copy of an ancient author. A manuscript may be handwritten or typewritten as distinguished from a printed copy, especially the copy of a writer's work from which printed copies are made. (Webster, 3d ed)Rhodococcus: A bacterial genus of the order ACTINOMYCETALES.Food Industry: The industry concerned with processing, preparing, preserving, distributing, and serving of foods and beverages.Rhodococcus equi: A species of RHODOCOCCUS found in soil, herbivore dung, and in the intestinal tract of cows, horses, sheep, and pigs. It causes bronchopneumonia in foals and can be responsible for infection in humans compromised by immunosuppressive drug therapy, lymphoma, or AIDS.

Scavenger receptor BI (SR-BI) mediates free cholesterol flux independently of HDL tethering to the cell surface. (1/160)

In addition to its effect on high density lipoprotein (HDL) cholesteryl ester (CE) uptake, scavenger receptor BI (SR-BI) was recently reported to stimulate free cholesterol (FC) flux from Chinese hamster ovary (CHO) cells stably expressing mouse SR-BI, a novel function of SR-BI that may play a role in cholesterol removal from the vessel wall where the receptor can be found. It is possible that SR-BI stimulates flux simply by tethering acceptor HDL particles in close apposition to the cell surface thereby facilitating the movement of cholesterol between the plasma membrane and HDL. To test this, we used transiently transfected cells and compared the closely related class B scavenger receptors mouse SR-BI and rat CD36 for their ability to stimulate cholesterol efflux as both receptors bind HDL with high affinity. The results showed that, although acceptor binding to SR-BI may contribute to efflux to a modest extent, the major stimulation of FC efflux occurs independently of acceptor binding to cell surface receptors. Instead our data indicate that SR-BI mediates alterations to membrane FC domains which provoke enhanced bidirectional FC flux between cells and extracellular acceptors.  (+info)

Two moles of O2 consumption and one mole of H2O2 formation during cholesterol peroxidation with cholesterol oxidase from Pseudomonas sp. strain ST-200. (2/160)

Cholesterol oxidase from Pseudomonas sp. strain ST-200 oxidized cholesterol and cholestanol to 6beta-hydroperoxycholest-4-en-3-one and 5alpha-cholestan-3-one respectively. The former was converted spontaneously to several oxysteroids such as 6-hydroxycholest-4-en-3-one and cholest-4-ene-3,6-dione, with the consumption of 2 mol of O(2) and the formation of 1 mol of H(2)O(2) for each mole of cholesterol oxidized. An oxidized form of the cholesterol oxidase dehydrogenates cholesterol, probably to the 5-en-3-one derivative. A reduced form of the enzyme, yielded from the cholesterol dehydrogenation reaction, dioxygenated cholest-5-en-3-one to 6beta-hydroperoxycholest-4-en-3-one.  (+info)

Kinetic mechanisms of cholesterol oxidase from Streptomyces hygroscopicus and Brevibacterium sterolicum. (3/160)

The kinetic properties of two cholesterol oxidases, one from Brevibacterium sterolicum (BCO) the other from Streptomyces hygroscopicus (SCO) were investigated. BCO works via a ping-pong mechanism, whereas the catalytic pathway of SCO is sequential. The turnover numbers at infinite cholesterol and oxygen concentrations are 202 s-1 and 105 s-1 for SCO and BCO, respectively. The rates of flavin reduction extrapolated to saturating substrate concentration, under anaerobic conditions, are 235 s-1 for BCO and 232 s-1 for SCO (in the presence of 1% Thesit and 10% 2-propanol). With reduced SCO the rate of Delta5-6-->Delta4-5 isomerization of the intermediate 5-cholesten-3-one to final product is slow (0.3 s-1). With oxidized SCO and BCO the rate of isomerization is much faster ( approximately 300 s-1), thus it is not rate-limiting for catalysis. The kinetic behaviour of both reduced COs towards oxygen is unusual in that they exhibit apparent saturation with increasing oxygen concentrations (extrapolated rates approximately 250 s-1 and 1.3 s-1, for BCO and SCO, respectively): too slow to account for catalysis. For BCO the kinetic data are compatible with a step preceding the reaction with oxygen, involving interconversion of reactive and nonreactive forms of the enzyme. We suggest that the presence of micelles in the reaction medium, due to the necessary presence of detergents to solubilize the substrate, influence the availability or reactivity of oxygen towards the enzyme. The rate of re-oxidation of SCO in the presence of product is also too slow to account for catalysis, probably due to the impossibility of producing quantitatively the reduced enzyme-product complexes.  (+info)

Increased proximal tubular cholesterol content: implications for cell injury and "acquired cytoresistance". (4/160)

BACKGROUND: Acute renal failure (ARF) leads to secondary adaptive changes that serve to protect proximal tubules from subsequent ischemic or toxic damage [so-called "acquired cytoresistance" (CR)]. A characteristic of CR is increased plasma membrane resistance to attack. Therefore, this study sought to identify potential changes in plasma membrane lipid composition in CR tubules/renal cortex and, if present, to test whether they might mechanistically contribute to the CR state. METHODS: Renal cortices/isolated tubules were obtained from CR mouse kidneys (18-hr postinduction of ischemia reperfusion, myoglobinuria, or ureteral obstruction). Their plasma membrane phospholipid/cholesterol profiles were compared with those observed in either control tissues or tissues obtained one to two hours post-renal damage (that is, prior to emergence of CR). RESULTS: Either no changes or inconsistent changes in phospholipid profiles were observed in CR tissues. Conversely, CR (vs. control) tissues demonstrated a consistent 25 to 50% increase in membrane cholesterol content. To ascertain whether cholesterol impacts tubule susceptibility to injury, its levels were reduced in proximal tubule (HK-2) cells with either (a) mevastatin, (b) a cholesterol "stripping" agent, (c) cholesterol oxidase, or (d) cholesterol esterase. Then cell susceptibility to injury [adenosine 5'-triphosphate (ATP) depletion; Fe-mediated oxidant stress] was assessed. In each instance, cholesterol reductions dramatically sensitized to superimposed injury (for example, a 2 to 3 times increase in the % of lactate dehydrogenase release). When cholesterol levels were restored to normal in CR tubules (with a "stripping" agent), an increased tubule susceptibility to injury resulted. Because cholesterol decreases membrane fluidity, the impact of a membrane-fluidizing agent (A2C) on cell injury was assessed. A2C dramatically sensitized HK-2 cells to superimposed attack. CONCLUSIONS: ARF leads to an up-regulation of proximal tubule cholesterol content. The latter may then contribute to acquired CR, possibly by stabilizing the plasma membrane via its antifluidizing effect.  (+info)

Cholesterol oxidation switches the internalization pathway of endothelin receptor type A from caveolae to clathrin-coated pits in Chinese hamster ovary cells. (5/160)

We investigated the mechanism of endothelin receptor type A (ETA) internalization in Chinese hamster ovary cells using two assays; flow cytometric quantification of cell surface myc-ETA and in situ localization of Cy5-labeled ET-1. In both assays, agonist-dependent internalization of myc-ETA was inhibited by nystatin and filipin, both of which disrupt internalization via caveolae, whereas it was barely affected by chlorpromazine and hypertonic sucrose, both of which disrupt internalization via clathrin-coated pits. In addition to myc-ETA, ET-1 caused intracellular translocation of caveolin-1 and this translocation was also blocked by nystatin but not by chlorpromazine. These results strongly argue that ETA is internalized via caveolae but not clathrin-coated pits. Treatment of the cells with cholesterol oxidase reduced cellular cholesterol and caused intracellular translocation of caveolin-1 but did not affect cell surface localization of myc-ETA. In cholesterol oxidase-treated cells, however, both chlorpromazine and hypertonic sucrose effectively blocked ET-1-induced myc-ETA internalization and nystatin was less effective than in untreated cells. Accordingly, expression of a dominant negative form of beta-arrestin blocked myc-ETA internalization in cholesterol oxidase-treated cells but not in untreated cells. These results suggest that, in Chinese hamster ovary cells, 1) agonist-occupied ETA can be internalized either via caveolae or clathrin-coated pits; 2) of the two, the former is the default pathway; and 3) the oxidative state of cell surface cholesterol is one of the factors involved in the pathway selection.  (+info)

Comparison of a new method for the direct and simultaneous assessment of LDL- and HDL-cholesterol with ultracentrifugation and established methods. (6/160)

BACKGROUND: Automated electrophoresis combined with enzymatic cholesterol staining might improve routine assessment of LDL- and HDL-cholesterol (LDLC and HDLC), as an alternative to the Friedewald equation and precipitation. A new method (Hydrasys; SEBIA) that adapts the cholesterol esterase/cholesterol oxidase reaction within urea-free gels was evaluated. METHODS: Fresh sera from 725 subjects (512 dyslipidemics) were analyzed by electrophoresis, in parallel with sequential ultracentrifugation, beta-quantification, calculation, and precipitation. RESULTS: Electrophoresis was linear up to 4 g/L cholesterol, with a detection limit of 0.042 g/L cholesterol/band. Within-run, between-run, between-batch, and between-operator imprecision (CVs) were 1.6%, 2.0%, 1.5%, and 2.7% for LDLC, and 3.9%, 4.3%, 5.5%, and 4.9% for HDLC, and remained unchanged up to 6.3 g/L plasma triglycerides (TGs). Precision decreased with very low HDLC (<0.25 g/L). Serum storage for 3-7 days at +4 or -80 degrees C did not interfere significantly with the assay. Agreement with beta-quantification was stable for LDLC up to 5.07 g/L (r = 0.94), even at TG concentrations >4 g/L (r = 0.91). Bias (2.88% +/- 12%) and total error (7.84%) were unchanged at TG concentrations up to 18.5 g/L. Electrophoresis predicted National Cholesterol Education Program cut-points with <0.04 g/L error, exactly and appropriately classified 79% and 96% of the subjects, and divided by 2.4 (all subjects) and 5.8 (TGs >1.5 g/L) the percentage of subjects underestimated by calculation. One-half of the patients with TGs >4 g/L had LDLC >1.30 g/L. For HDLC, correlation was better with precipitation (r = 0.87) than ultracentrifugation (r = 0.76). Error (-0.10% +/- 26%) increased when HDLC decreased (<0.35 g/L). Direct assessment of the LDLC/HDLC ratio detected 45% more high-risk subjects than the calculation/precipitation combination. CONCLUSIONS: Electrophoresis provides reliable quantification of LDLC, improving precision, accuracy, and concordance over calculation, particularly with increasing plasma TGs. Implementation of methods to detect low cholesterol concentrations could extend the applications for HDLC assessment.  (+info)

Plasma membrane cholesterol: a critical determinant of cellular energetics and tubular resistance to attack. (7/160)

BACKGROUND: Cholesterol is a major component of plasma membranes, forming membrane microdomains ("rafts" or "caveolae") via hydrophobic interactions with sphingolipids. We have recently demonstrated that tubule cholesterol levels rise by 18 hours following diverse forms of injury, and this change helps to protect kidneys from further damage (so-called acquired cytoresistance). The present study was undertaken to better define the effects of membrane cholesterol/microdomains on tubule homeostasis and cell susceptibility to superimposed attack. METHODS: Plasma membrane cholesterol was perturbed in normal mouse proximal tubular segments with either cholesterol esterase (CE) or cholesterol oxidase (CO). Alternatively, cholesterol-sphingomyelin complexes were altered by sphingomyelinase (SMase) treatment. Changes in cell energetics (ATP/ADP ratios + ouabain), viability [lactate dehydrogenase (LDH) release], phospholipid profiles, and susceptibility to injury (Fe-induced oxidant stress, PLA2, Ca2+ ionophore) were determined. The impacts of selected cytoprotectants were also assessed. RESULTS: Within 15 minutes, CE and CO each induced approximately 90% ATP/ADP ratio suppressions. These were seen prior to lethal cell injury (LDH release), and it was ouabain resistant (suggesting decreased ATP production, not increased consumption). SMase also depressed ATP without inducing cell death. After 45 minutes, CE and CO each caused marked cytotoxicity (up to 70% LDH release). However, different injury mechanisms were operative since (1) CE, but not CO, toxicity significantly altered cell phospholipid profiles, and (2) 2 mmol/L glycine completely blocked CE- but not CO-mediated cell death. Antioxidants also failed to attenuate CO cytotoxicity. Disturbing cholesterol/microdomains with a sublytic CE dose dramatically increased tubule susceptibility to Fe-mediated oxidative stress and Ca2+ overload, but not PLA2-mediated damage. CONCLUSION: Intact plasma membrane cholesterol/microdomains are critical for maintaining cell viability both under basal conditions and during superimposed attack. When perturbed, complex injury pathways can be impacted, with potential implications for both the induction of acute tubular damage and the emergence of the postinjury cytoresistance state.  (+info)

Presence of oxidized cholesterol in caveolae uncouples active platelet-derived growth factor receptors from tyrosine kinase substrates. (8/160)

Platelet-derived growth factor receptor beta (PDGFRbeta) in fibroblasts is concentrated in caveolae where it controls the tyrosine phosphorylation of multiple proteins. Caveolae are enriched in cholesterol and sphingolipids, but the role of these lipids in PDGFR signal transduction is unknown. We report that introduction of cholest-4-en-3-one into caveolae membranes uncouples PDGFR autophosphorylation from tyrosine phosphorylation of neighboring proteins. Cholest-4-en-3-one appears to interfere with the normal interaction between PDGFR and its partners. The results suggest that tightly packed caveolae lipids form a membrane platform that functions as a lipid scaffold for organizing the molecular interactions of multiple signaling pathways.  (+info)

*Cholesterol oxidase

In enzymology, a cholesterol oxidase (EC 1.1.3.6) is an enzyme that catalyzes the chemical reaction cholesterol + O2 ⇌ {\ ... Coulombe R, Yue KQ, Ghisla S, Vrielink A (August 2001). "Oxygen access to the active site of cholesterol oxidase through a ... The substrate-binding domain found in some bacterial cholesterol oxidases is composed of an eight-stranded mixed beta-pleated ... Richmond W (1973). "Preparation and properties of a cholesterol oxidase from Nocardia sp. and its application to the enzymatic ...

*Alice Vrielink

"Cholesterol oxidases illustrate nature's approach to protein design.". Gene Therapy Weekly, November 27, 2003. via Highbeam ( ...

*Colorimetric analysis

Abbreviations CHOD = cholesterol oxidase GOD = glucose oxidase GPO = glycerol-3-phosphate oxidase PAP = phenol + aminophenazone ... Cholesterol (CHOD-PAP method) Cholesterol + oxygen --(enzyme cholesterol oxidase)--> cholestenone + hydrogen peroxide Hydrogen ... enzyme glucose oxidase)--> gluconate + hydrogen peroxide Hydrogen peroxide + ABTS --(enzyme peroxidase)--> colored complex In ... enzyme glycerol-3-phosphate oxidase) --> dihydroxyacetone phosphate + hydrogen peroxide Hydrogen peroxide + 4-aminophenazone + ...

*Cross-linked enzyme aggregate

Biosensors/diagnostics, e.g. glucose oxidase and cholesterol oxidase biosensors. Delivery of proteins as therapeutic agents or ...

*Streptomyces luridus

"Cloning and sequencing of partial segment of cholesterol oxidase encoding gene fromStreptomyces luridus". Annals of ...

*Glucose-methanol-choline oxidoreductase family

Li J, Vrielink A, Brick P, Blow DM (November 1993). "Crystal structure of cholesterol oxidase complexed with a steroid ... Vrielink A, Lloyd LF, Blow DM (1991). "Crystal structure of cholesterol oxidase from Brevibacterium sterolicum refined at 1.8 A ... These enzymes include a variety of proteins; choline dehydrogenase (CHD) EC 1.1.99.1, methanol oxidase (MOX) EC 1.1.3.13 and ... Bannwarth M, Bastian S, Heckmann-Pohl D, Giffhorn F, Schulz GE (2004). "Crystal structure of pyranose 2-oxidase from the white- ...

*Perlite

"Covalent attachment of cholesterol oxidase and horseradish peroxidase on perlite through silanization: Activity, stability and ...

*Omega loop

Sampson, NS; Kass, IJ; Ghoshroy, KB (21 Apr 1998). "Assessment of the role of an omega loop of cholesterol oxidase: a truncated ...

*High-density lipoprotein

... then coupling the products of a cholesterol oxidase reaction to an indicator reaction. The reference method still uses a ... "National Reference System for Cholesterol - Cholesterol Reference Method Laboratory Network - HDL Cholesterol Certification ... Cholesterol: The name cholesterol originates from the Greek chole- (bile) and stereos (solid), and the chemical suffix-ol for ... The remainder of the serum cholesterol after subtracting the HDL is the non-HDL cholesterol. The concentration of these other ...

*Peripheral membrane protein

Cholesterol oxidase Pfam entry: Retinal pigment epithelial membrane protein Pfam entry: Lipoxygenase PDBsum entry: Alpha Toxin ... phospholipases and cholesterol oxidases), cell wall oligosaccharides (glycosyltransferase and transglycosidases), or proteins ( ... and cholesterol. Protein association with membranes through the use of acylated residues is a reversible process, as the acyl ... "Modulation of the bilayer thickness of exocytic pathway membranes by membrane proteins rather than cholesterol". Proc Natl Acad ...

*List of EC numbers (EC 1)

... malate oxidase EC 1.1.3.4: glucose oxidase EC 1.1.3.5: hexose oxidase EC 1.1.3.6: cholesterol oxidase EC 1.1.3.7: aryl-alcohol ... D-aspartate oxidase EC 1.4.3.2: L-amino-acid oxidase EC 1.4.3.3: D-amino-acid oxidase EC 1.4.3.4: amine oxidase (flavin- ... glycine oxidase EC 1.4.3.20: L-lysine 6-oxidase EC 1.4.3.21: primary-amine oxidase EC 1.4.3.22: diamine oxidase EC 1.4.3.23: 7- ... L-gulonolactone oxidase EC 1.1.3.9: galactose oxidase EC 1.1.3.10: pyranose oxidase EC 1.1.3.11: L-sorbose oxidase EC 1.1.3.12 ...

*List of MeSH codes (D08)

... cholesterol oxidase MeSH D08.811.682.047.436.350.700 --- progesterone reductase MeSH D08.811.682.047.436.375 --- 17- ... sarcosine oxidase MeSH D08.811.682.662.640 --- proline oxidase MeSH D08.811.682.662.680 --- pyridoxamine-phosphate oxidase MeSH ... d-amino-acid oxidase MeSH D08.811.682.664.500.261 --- d-aspartate oxidase MeSH D08.811.682.664.500.398 --- glutamate ... cholesterol 7 alpha-hydroxylase MeSH D08.811.682.690.708.170.915.212 --- cholesterol side-chain cleavage enzyme MeSH D08.811. ...

*Methylsterol monooxygenase

Brady, D.R.; Crowder, R.D.; Hayes, W.J. (1980). "Mixed function oxidases in sterol metabolism. Source of reducing equivalents ... Fukushima, H.; Grinstead, G.F.; Gaylor, J.L. (1981). "Total enzymic synthesis of cholesterol from lanosterol. Cytochrome b5- ... Methylsterol monooxygenase (EC 1.14.13.72, methylsterol hydroxylase, 4-methylsterol oxidase, 4,4-dimethyl-5alpha-cholest-7-en- ... dependence of 4-methyl sterol oxidase". J. Biol. Chem. 256 (10): 4822-4826. PMID 7228857. ...

*Lathosterol oxidase

7-CHOLESTADIEN-3-BETA-OL IN CHOLESTEROL BIOSYNTHESIS". J. Biol. Chem. 239: 1381-7. PMID 14189869. Nishino H, Nakaya J, Nishi S ... In enzymology, a lathosterol oxidase (EC 1.14.21.6) is an enzyme that catalyzes the chemical reaction 5alpha-cholest-7-en-3beta ...

*NADPH oxidase

Atherosclerosis is caused by the accumulation of macrophages containing cholesterol (foam cells) in artery walls (in the intima ... The NADPH oxidase (nicotinamide adenine dinucleotide phosphate-oxidase) is a membrane-bound enzyme complex that faces the ... NADPH + 2O2 ↔ NADP+ + 2O2− + H+ NADPH oxidase is a major cause of atherosclerosis, and NADPH oxidase inhibitors may reverse ... Apocynin prevents the assembly of the NADPH oxidase subunits. Using apocynin to inhibit NADPH oxidase may have clinical ...

*Cholesterol side-chain cleavage enzyme

Steroidogenic enzyme Cytochrome P450 oxidase GRCh38: Ensembl release 89: ENSG00000140459 - Ensembl, May 2017 GRCm38: Ensembl ... however its activity is limited by the supply of cholesterol in the inner membrane. The supplying of cholesterol to this ... Cholesterol side-chain cleavage enzyme is commonly referred to as P450scc, where "scc" is an acronym for side-chain cleavage. ... Cholesterol Pregnenolone Cytochrome P450scc at the US National Library of Medicine Medical Subject Headings (MeSH) Molecular ...

*Sterol-C5-desaturase-like

Lathosterol oxidase is an enzyme that in humans is encoded by the SC5DL gene. This gene encodes an enzyme of cholesterol ... 2004). "Lathosterolosis: an inborn error of human and murine cholesterol synthesis due to lathosterol 5-desaturase deficiency ...

*Lathosterol

... is a cholesterol-like molecule. Sterol-C5-desaturase-like acts upon it. It is accumulated in lathosterolosis. ... Lathosterol oxidase. ...

*Inner mitochondrial membrane

... bc1 complex Cytochrome c Cytochrome c oxidase F-ATPase ATP-ADP translocase ATP-binding cassette transporter Cholesterol side- ... HtrA serine peptidase 2 Adrenodoxin reductase Heme biosynthesis Protoporphyrinogen oxidase Ferrochelatase Uncoupling protein ... Electron-transferring-flavoprotein dehydrogenase Electron-transferring flavoprotein Succinate dehydrogenase Alternative oxidase ...

*Steroid

When the two methyl groups and eight carbon side chains (at C-17, as shown for cholesterol) are present, the steroid is said to ... The expression of the oxidase gene can be upregulated by the steroid sensor PXR when there is a high blood concentration of ... Steroids such as cholesterol decrease membrane fluidity. Similar to lipids, steroids are highly concentrated energy stores. ... Steroid metabolism in humans is also the target of cholesterol-lowering drugs, such as statins. In humans and other animals the ...

*MSMO1

Sterol-C4-methyl oxidase-like protein was isolated based on its similarity to the yeast ERG25 protein. It contains a set of ... The protein is localized to the endoplasmic reticulum membrane and is believed to function in cholesterol biosynthesis. ... "Mutations in the human SC4MOL gene encoding a methyl sterol oxidase cause psoriasiform dermatitis, microcephaly, and ... "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations". J. ...

*Indigestion

... monoamine oxidase [MAO]-B inhibitors), corticosteroids, estrogens, digoxin, iron, and opioids. The role of Helicobacter pylori ... cholesterol-lowering agents (niacin, fibrates), neuropsychiatric medications (cholinesterase inhibitors [donepezil, ...

*Sexual desire

... medications to control cholesterol, and medications for hypertension contributed to low levels of desire. However, in men, only ... monoamine-oxidase (MAO) inhibitors, and sedative drugs. However, the most severe decreases in sexual desire relating to ...

*CYP27A1

... is a gene encoding a cytochrome P450 oxidase, and is commonly known as sterol 27-hydroxylase. This enzyme is located in ... CYP27A1 participates in the degradation of cholesterol to bile acids in both the classic and acidic pathways. It is the ... In the acidic pathway, it produces 27-hydroxycholesterol from cholesterol whereas in the classic or neutral pathway, it ... Evidence against 27-hydroxycholesterol as a critical regulator of cholesterol homeostasis". The Journal of Biological Chemistry ...

*Tranylcypromine

Regarding the isoforms of monoamine oxidase, it shows slight preference for the MAOB isoenzyme over MAOA. This leads to an ... an enzyme that controls cholesterol turnover in the brain". The Journal of Biological Chemistry. 285 (41): 31783-95. doi: ... Al-Nuaimi, SK; Mackenzie, EM; Baker, GB (November 2012). "Monoamine oxidase inhibitors and neuroprotection: a review". American ... Blom-Peters, L; Lamy, M (1993). "Monoamine oxidase inhibitors and anesthesia: an updated literature review". Acta ...

*Metabolism

M. tuberculosis can also grow on the lipid cholesterol as a sole source of carbon, and genes involved in the cholesterol use ... In humans, these include cytochrome P450 oxidases, UDP-glucuronosyltransferases, and glutathione S-transferases. This system of ... Steroids such as cholesterol are another major class of lipids. Carbohydrates are aldehydes or ketones, with many hydroxyl ... Lanosterol can then be converted into other steroids such as cholesterol and ergosterol. Organisms vary in their ability to ...
Cholesterol Oxidase, 0.1 mg. Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis.
Cholesterol Oxidase, 0.1 mg. Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis.
Cholesterol is a waxy, fat-like substance that is found in all cells of the body. Cholesterol enters the human body mainly through food [1], and the majority of the cholesterol in the body originates from the liver [2]. Cholesterol is required for the formation of sex hormones [3], Cholesterol can also be converted to bile acids in the liver and vitamin D in the skin and kidney [4] and the formation of bile acids that help the body to digest fat [5]. Many studies have reported the ability of different bacteria to reduce the cholesterol levels in aqueous systems, such as liquid media [6] and the blood serum [7].. Some bacteria not only utilize cholesterol as a sole carbon source [8] but also decompose cholesterol via the cholesterol oxidase enzyme (ChoX) and produce different intermediate compounds [9]. Enterococcus faecium CX and Lactobacillus acidophilus N5, which colonise the intestinal tract and survive under gastric conditions, assimilate cholesterol and reduce its level in serum [10]. ...
1. Cholesteryl 3beta-sulphate is oxidized in vitro by preparations of bovine adrenal-cortex mitochondria to pregnenolone sulphate and isocaproic acid (4-methyl-pentanoic acid) without hydrolysis of the ester linkage. 2. Free cholesterol is the preferred substrate for adrenal-cortex cholesterol oxidase; the apparent K(m) for cholesteryl sulphate is 500mum and for free cholesterol 50mum under the same conditions. 3. Cholesteryl 3beta-acetate is hydrolysed by bovine adrenal-cortex mitochondria in vitro to free cholesterol, which is subsequently oxidized to more polar steroids and isocaproic acid. Evidence was obtained that other cholesterol esters behave similarly. Cholesterol esters may thus act as precursors of steroid hormones. 4. Cholest-4-en-3-one is only poorly oxidized to isocaproic acid and more polar steroids and thus is probably not a significant precursor of steroid hormones. 5. Cholesteryl esters inhibit the oxidation of cholesterol competitively (K(i) for cholesteryl phosphate 28mum, ...
1MXT: Sub-atomic resolution crystal structure of cholesterol oxidase: What atomic resolution crystallography reveals about enzyme mechanism and the role of FAD cofactor in redox activity
1COY: Crystal structure of cholesterol oxidase complexed with a steroid substrate: implications for flavin adenine dinucleotide dependent alcohol oxidases.
The Open Biotechnology Journal is an Open Access online journal, which publishes research articles, reviews, letters, case reports and guest-edited single topic issues in all areas of biotechnology. Bentham Open ensures speedy peer review process and accepted papers are published within 2 weeks of final acceptance.. The Open Biotechnology Journal is committed to ensuring high quality of research published. We believe that a dedicated and committed team of editors and reviewers make it possible to ensure the quality of the research papers. The overall standing of a journal is in a way, reflective of the quality of its Editor(s) and Editorial Board and its members.. The Open Biotechnology Journal is seeking energetic and qualified researchers to join its editorial board team as Editorial Board Members or reviewers.. The essential criteria to become Editorial Board Members of The Open Biotechnology Journal are as follows ...
Catalog #: P2010002 - 250 U Cholesterol oxidase is a flavoprotein involved in the first step of cholesterol catabolism. The enzyme first oxidizes cholesterol to cholest-5-en-3-one then isomerizes it to cholest-4-en-3-one while producing hydrogen peroxide H2O2. Available in a 250 Units and custom bulk sizes. Live Enquiry about this product via Text/SMS: 1-858-900-3210 (8 am - 8 pm PST ...
The layer-by-layer technique is one of the most used in the immobilization of molecules of biological interest, being largely employed in the fabrication of modified electrodes for biosensors. One of the main challenges in the development of biosensors is to eliminate interfering electroactive species within the detection system, therefore, this problem can be solved with the introduction of inorganic or organic electron mediators. Here, we carried out systematic studies for the application of hemoglobin acting as an electron mediator, and the self-assembly technique was used to immobilize haemoglobin in nanostructured thin films. The LbL films were tested with two polyelectrolytes, obtaining uniform films with activity kept during 15 days, without responses to possible interfering phospholipids. The layer-bylayer technique was also used to immobilize the enzyme cholesterol oxidase, alternated with different polyelectrolytes. The thin films showed a good performance as an amperometric biosensor ...
Our single-molecule experiments have shown that an enzyme is a dynamical entity whose conformation and enzymatic rate undergo constant fluctuation over a broad range of time scales. The phenomenon has been observed in several systems: cholesterol oxidase,
putative cholesterol oxidase [RimD] GTGATCGAGAACCAGCACCTGTCACGGCGCCGTCTGCTCGGACTGGCCGCCCTCGGCGGC GCCGCCGTCGCCGGAATGACCACGATTTCCGTCGCCCCGCGCGCCGCGGCCGCCGGGCAG GGAAGCCCGCGGGCCGGTGACGGCGCGTTCGTACCGGCGGTGGTGATCGGCACCGGTTAC GGTGCGGCGGTCTCCGCGCTGCGGCTCGGCGAGGCGGGAATTCCGACGCTCATGCTCGAA ATGGGCCAGCTGTGGAACAAGCCGGCCGACGACGGCAACATCTTCTGCGGAATGCTCAAG CCCGACCGCAGGTCCAGCTGGTTCAAGTCGCGCACCGAAGCCCCGCTGGGCTCGTTCCTG TGGCTGGATGTCATCAACCGCAACATCGACCCGTACGCGGGCGTCCTCGACAAGGTGCAC TTCGACGAGATGTCGGTGTACGTGGGACGGGGCGTCGGCGGCGGCTCGCTGGTCAACGGC GGCATGGCCGTCGTACCGAAGCGCTCGTACTTCGAAGAGGTCCTCCCACGGGTGGACGCC GCCCAGATGTACGACCGGTACTTCCCGCGCGCCAACTCCATGCTCAAGGTGAACCACATC GACAAGGGGTGGTTCGAGGACACGGAGTGGTACAAGTACGCGCGGGTCTCGCGCGAGCAG GCGGGCAAGGCGGGCCTGAGCACCACCTTCGTCCCCAACGTCTACGACTTCGACCACATG CGGCGCGAGGCGGACGGCACGGCGCCCAAGTCGGCGCTGGCCGGCGAGGTGATCTACGGC AACAACCACGGCAAGCAGAGCCTGGACAAGACCTATCTGGCCGCCGCGCTGGGCACCGGC AAGGTCACCATCGAGACGCTGCACCAGGTCAAGGCGATCCGGCGGCAGCCGGACGGCAGC ...
3-oxo-5 beta-steroid delta 4-dehydrogenase: do not confuse with EC 1.3.1.23 (cholestenone 5 beta-reductase) which is also steroid 5 beta-reductase in Chemline; do not use for enzyme using NAD(P)-see EC 1.3.1.23 & EC 1.3.1.3
Cindy A. Verberkt, Marieke H.J. van den Beuken-van Everdingen, Jos M.G.A. Schols, Sushma Datla, Carmen D. Dirksen, Miriam J. Johnson, Sander M.J. van Kuijk, Emiel F.M. Wouters, Daisy J.A. Janssen ...
Stabilized enzymes useful in the diagnostic assay of total cholesterol are prepared by dissolving a salt of cholic acid in a buffer solution providing a pH within the range of about 4 to about 9, to the solution is added a cholesterol esterase. The solution is then mixed with a polyhydroxy organic compound and TRITON-X-100. A cholesterol oxidase and a peroxidase are each dissolved in separate portions of buffer solution and introduced into the buffered solution containing the cholesterol esterase. 4-aminoantipyrine is then added to the solution. The resultant solution is a stabilized enzyme solution which can be used in the total cholesterol assay of a serum sample. The stabilized solution can be used in combination with a chromogen diluent solution which is made by dissolving phenol and TRITON-X-100 in water or a buffer solution. The combination of the stabilized enzyme solution and the chromogen diluent solution provides a solution which has utility
In this paper, a novel amperometric cholesterol biosensor with immobilization of cholesterol oxidase on electrochemically polymerized polypyrrole-polyvinylsulphonate (PPy-PVS) films has been accomplished via the entrapment technique on the surface of a platinum electrode. Electropolymerization of pyrrole and polyvinylsulphonate on the Pt surface was carried out by cyclic voltammetry between -1.0 and +2.0 V (vs. Ag/AgCl) at a scan rate of 100 mV upon the Pt electrode with an electrochemical cell containing pyrrole and polyvinylsulphonate. The amperometric determination is based on the electrochemical detection of H2O2 generated in the enzymatic reaction of cholesterol. Determination of cholesterol was carried out by the oxidation of enzymatically produced H2O2 at 0.4 V vs. Ag/AgCl. The effects of pH and temperature were investigated and optimum parameters were found to be 7.25 and 35 °C, respectively. The storage stability and operational stability of the enzyme electrode were also studied. The results
AbstractFor a commercially viable recombinant intracellular protein production process, efficient cell lysis and protein release is a major bottleneck. The recovery of recombinant protein, cholesterol oxidase (COD) was studied in a continuous bead milling process. A full factorial Response Surface Model (RSM) design was employed and compared to Artificial Neural Networks coupled with Genetic Algorithm (ANN-GA). Significant process variables, cell slurry feed rate (A), bead load (B), cell load (C) and run time (D), were investigated and optimized for maximizing COD recovery. RSM predicted an optimum of feed rate of 310.73 mL/h, bead loading of 79.9% (v/v), cell loading OD600 nm of 74, and run time of 29.9 min with a recovery of ~3.2 g/L. ANN coupled with GA predicted a maximum COD recovery of ~3.5 g/L at an optimum feed rate (mL/h): 258.08, bead loading (%, v/v): 80%, cell loading (OD600 nm): 73.99, and run time of 32 min. An overall 3.7-fold increase in productivity is obtained when compared to a batch
The world of Choe Pho is young. The Council of Enlightenment came to Choe Pho seeking refuge from a terrible place known as the Fallen World. Carrying the soul energy, known as Marrow, of as many people as they could, the Council fled to a remote and hidden corner of the cosmos in the hopes of building a better world. Choe Pho would be a place where each soul would have the... [click here for more ...
Jeong Wan Seo (Seo JW), Ji A Jung (Jung JA), Hye Sook Park (Park HS), Jae Sung Ko (Ko JS), Yong Joo Kim (Kim YJ), Jae Young Kim (Kim JY), Eell Ryoo (Ryoo E), Sun Hwan Bae (Bae SH), Jae Geon Sim (Sim JG), Hye Ran Yang (Yang HR), Byung Ho Choe (Choe BH), Ky Young Cho (Cho KY ...
PAPER Cho SH, Choe YS, Kim HJ, Jang H, Kim Y, Kim SE, Kim SJ, Kim JP, Jung YH, Kim BC, Baker SL, Lockhart SN, Na DL, Park S, Seo SW ...
With TimeAware, we could decide whether the data would be shown in a positive way by highlighting productivity, or in a negative way by highlighting unproductive time," said Choe. "I was curious which version might be more helpful in encouraging people to be more productive.". Quantifying the self. Choe has long been interested in "self-monitoring" - when a person collects personal data to learn more about themselves and make positive changes. After using an activity tracker like a FitBit, for example, a person might see theyre not walking as much as theyd like and then make an effort to fit in more exercise.. But with so many options for gadgets and apps that promise to help improve sleep, encourage exercise and increase productivity, Choe wanted to learn more about what makes them effective or not.. "I like to look at lots of different types of data - such as sleep and exercise data - and create tools for people to collect this information and then make sense of it," said Choe. "The data ...
Journal of colloid and interface science. VOL 308; NUMBER 1, ; 2007, 130-141 -- Elsevier Science B.V., Amsterdam Part: Part 1; (pages 130-141) -- ...
Ou, H. D.; Kwiatkowski, W.; Deerinck, T. J.; Noske, A.; Blain, K. Y.; Land, H. S.; Soria, C.; Powers, C. J.; May, A. P.; Shu, X.; Tsien, R. Y.; Fitzpatrick, J. A. J.; Long, J. A.; Ellisman, M. H.; Choe, S.; OSheaemail, C. C.. ...
Lachke, Salil A.; OConnell, Daniel J.; Aboukhalil, Anton; Choe, Sung E.; Turbe-Doan, Annick; Robertson, Erin A.; Amendt, Brad A. et al. (PLoS ONE, 2012) Link to Published Version ...
By Stan Choe And Alex Veiga, The Associated Press on March 30th, 2020. NEW YORK - U.S. stocks climbed Monday, led by big gains for health care companies announcing developments that could aid in the coronavirus outbreak. The rally tacked more gains onto a recent upswing for the market, which is coming off the best week for the S&P 500 in 11 years. Nascent optimism is budding that ... Read More ». Be the first to comment! ...
Boudreaux, H. B. 1979. Arthropod phylogeny, with special reference to insects. Wiley Interscience; New York, NY. Caudell, A.N. 1920. Zoraptera not an apterous order. Proceedings of the Entomological Society of Washington 22: 84-97.. Chao, R. F., and C. S. Chen. 2000. Formosozoros newi, a new genus and species of Zoraptera (Insecta) from Taiwan. Pan-Pacific Entomologist 76(1): 24-27.. Choe, J. C. 1989. Zorotypus gurneyi, new species, from Panama and redescription of Zorotypus barberi Gurney (Zoraptera, Zorotypidae). Annals of the Entomological Society of America 82(2): 149-155.. Choe, J. C. 1994a. Sexual selection and mating system in Zorotypus gurneyi Choe (Insecta: Zoraptera). I. Dominance hierarchy and mating success. Behavioral Ecology and Sociobiology 34: 87-93.. Choe, J. C. 1994b. Sexual selection and mating system in Zorotypus gurneyi Choe (Insecta: Zoraptera). II. Determinants and dynamics of dominance. Behavioral Ecology and Sociobiology 34: 233-237. Choe, J. C. 1995. Courtship feeding ...
EC 1.3.1.22. Accepted name: 3-oxo-5α-steroid 4-dehydrogenase (NADP+). Reaction: a 3-oxo-5α-steroid + NADP+ = a 3-oxo-Δ4-steroid + NADPH + H+. Other name(s): cholestenone 5α-reductase; testosterone Δ4-5α-reductase; steroid 5α-reductase; 3-oxosteroid Δ4-dehydrogenase; 5α-reductase; steroid 5α-hydrogenase; 3-oxosteroid 5α-reductase; testosterone Δ4-hydrogenase; 4-ene-3-oxosteroid 5α-reductase; reduced nicotinamide adenine dinucleotide phosphate:Δ4-3-ketosteroid 5α-oxidoreductase; 4-ene-5α-reductase; Δ4-3-ketosteroid 5α-oxidoreductase; cholest-4-en-3-one 5α-reductase; testosterone 5α-reductase; 3-oxo-5α-steroid 4-dehydrogenase. Systematic name: 3-oxo-5α-steroid:NADP+ Δ4-oxidoreductase. Comments: The enzyme catalyses the conversion of assorted 3-oxo-Δ4 steroids into their corresponding 5α form. Substrates for the mammalian enzyme include testosterone, progesterone, and corticosterone. Substrates for the plant enzyme are brassinosteroids such as campest-4-en-3-one and ...
Its all about inflammation. If there is one thing to worry about instead of cholesterol, Moore argues, we should be much more concerned about inflammation in the body and the things that cause it. This is the true cause of atherosclerosis. In his words, "without inflammation, cholesterol cant harm you." Its really all about cholesterol oxidation, which is nearly a two-fold better predictor of heart disease risk than simply looking at cholesterol alone. So, we should be focusing more on things that cause chronic inflammation in the body, which results from poor diet, smoking, lack of sleep, infrequent exercise, elevated stress, and a compromised gut, just to name a few that Moore references. One of the best blood markers for determining the amount of chronic inflammation in the body is something called high-sensitivity C-reactive protein, or hs-CRP. Many experts have argued that hs-CRP is a much better biomarker to track because its a much better predictor of heart disease and health ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Hyun Jin Jo, Nayoung Kim, Ryoung Hee Nam, Jung Mook Kang, Joo-Hyon Kim, Gheeyoung Choe, Hye Seung Lee, Ji Hyun Park, Hyun Chang, Hyunjin Kim, Moon Young Lee, Yong Sung Kim, Joo Sung Kim, Hyun Chae Jung ...
You-Jung Choi, Eue-Keun Choi, Kyung-Do Han, Jiesuck Park, Inki Moon, Euijae Lee, Won-Seok Choe, So-Ryoung Lee, Myung-Jin Cha, Woo-Hyun Lim, Seil Oh ...
German family-run drugmaker Boehringer Ingelheim has stressed its determination to remain independent and keep its pipeline stocked with innovative products as it posted solid financial results for 2006 at its annual press conference. - News - PharmaTimes
TARGET PharmaSolutions, Inc., a real-world clinical data company, is pleased to announce that Boehringer Ingelheim International GmbH has entered into a multi-year strategic partnership
Determination of seroreactivity of human sera against recombinant HPV 16L1 protein / Yong Hee Lee; Mi Ri Yoon; Joo Hyun Kang; Dur Han Kwon; In Seong Choe; Tai Wha Chung; Sue Nie Park , 1994 ...
A number of reports have shown that CD44 is present in cholesterol-enriched lipid raft microdomains in various cell types including T cells (Ilangumaran et al., 1998; Gómez-Móuton et al., 2001; Oliferenko et al., 1999; Seveau et al., 2001; Pierini et al., 2003; Bourguignon et al., 2004). However, the functional significance of CD44 localization in the lipid rafts had been largely unknown. This study demonstrated the functional significance of this association in T cell adhesion properties. We demonstrated in the present study that cellular cholesterol modulates the HA-binding ability of CD44. Using BW5147 T cells, which express CD44 with HA-binding ability, we showed that cholesterol depletion induced with MβCD upregulates both the HA-binding ability of CD44 (Fig. 1) and the loss of CD44 from detergent-insoluble fractions (Fig. 3). We also found that cholesterol oxidation and sequestration upregulate CD44s HA-binding ability (Fig. 2), suggesting that the lipid rafts modulate CD44 function. ...
Four hundred milliliters of a saturated aqueous solution of potassium-sodium tartrate (Note 4) is added to the mixture, and the organic layer becomes clear and orange. The stirrer assembly is removed, and the mixture is steam-distilled until about 6 l. of distillate has been collected. The residual mixture is cooled and extracted successively with one 300-ml. portion and two 100-ml. portions of chloroform. The combined extracts are washed with two 100-ml. portions of water and dried over anhydrous magnesium sulfate. The chloroform is removed by distillation on the steam bath at reduced pressure (water aspirator). The residual viscous amber oil (Note 5) is dissolved by heating in 150 ml. of methanol. When the solution has cooled to about 40°, seeds of cholestenone are added, and the flask is wrapped with a small towel to ensure slow cooling (Note 6). After the bulk of the material has crystallized, which requires several hours, the mixture is stored at 0° overnight (Note 7). The product is ...
Cholesterol and Coronary Heart Disease - Cholesterol is a type of fat (lipid) made by the body. About 80% of cholesterol is made by the body, the other 20% comes from the diet. Cholesterol is a building block for cell membranes. Cholesterol Test Kit - A delicate combination of steroid and alcohol, Cholesterol, also a combination of a lipid that is found in cell membranes of all of our body tissues. Cholesterol is also transported in the blood of all animals.. Develop High Cholesterol - The risk of heart disease is greatly increased if you have high cholesterol. This can include potentially fatal heart attacks. Lowering cholesterol is recommended to lead a more healthy life and maintain a healthy heart. Low Fat Cholesterol Recipes - Many low fat low colesterol recipes are usually bland and un-flavorful but you can find some unique and tasty treats on our website that are full of flavor. Good Cholesterol Level - While most people talk about "cholesterol levels" there is in fact more than one type ...
The incorporation and metabolism of both vesicle- and LDL (low-density lipoprotein)- derived [3H]cholesterol by LDL-receptor-negative fibroblasts were studied. Independent of the cholesterol source, free [3H]cholesterol was readily incorporated into the cells and was available for esterification. 7-Oxocholesterol stimulated both [3H]cholesterol incorporation, by increasing the exchange rate, and the subsequent esterification of it irrespective of the source of exogenous [3H]cholesterol. The 7-oxocholesterol-stimulated esterification of exogenously derived LDL free [3H]cholesterol was progesterone-sensitive and energy-requiring. ...
With all the news and warnings about the dangers of high cholesterol, many people view cholesterol as a “bad†substance that should be eliminated completely from our lives. In truth, cholesterol serves some important functions in the body. In order to understand how cholesterol affects the body, one must first understand what cholesterol is.. Cholesterol is a waxy substance that is attached to the fats in our bloodstream and is present in all of the cells of the body. Cholesterol comes from food that we eat, as well as being manufactured directly by the liver. Cholesterol is an important regulator in the bloodstream, as it helps to regulate the formation of many cells as well as hormones. However, to have too high or too low of a cholesterol count in the blood can be a very dangerous factor, often leading to a heart attack or a stroke. Although cholesterol is prevalent in the blood stream, it cannot dissipate in the blood. The cholesterol maneuvers throughout the body attached to ...
Bringing down cholesterol is imperative for everybody, including more youthful, moderately aged, and more established grown-ups, and individuals with or without coronary illness and/or stroke. Bringing down cholesterol is amazingly imperative key to diminishing the danger of coronary illness. Elevated amounts of LDL are connected with an expanded danger of coronary illness. Lower levels of LDL cholesterol mean a lower danger of coronary illness. Most specialists propose cholesterol levels ought to stay under 200 mg/dl. Bringing cholesterol is prescribed down to lead a more sound life and fundamental. Bringing down cholesterol is only one approach to take care of your heart. Bringing down cholesterol is really very basic, and doesnt oblige surgery or medications with solid way of life, actually bringing down cholesterol is simple since it aides standardize your cholesterol, normally and securely. One of the most straightforward approaches to beginning bringing cholesterol is down to farthest ...
Cholesterol. It is a word we often hear today when talking about leading a healthy lifestyle. For many people, the word evokes concern as they recall the warnings from their physicians that they need to watch what they eat since their cholesterol levels are a bit elevated. At William Osler Health Centre the Medical Risk Management Clinic staff help people understand what cholesterol is and how they can control it to prevent diseases caused by elevated or high levels of cholesterol. Cholesterol is a waxy substance made naturally in the body. Cholesterol helps form or repair cell membranes, some hormones, and other tissues.. Too much cholesterol in your blood can cause hardening of the arteries and you run the risk of heart attacks or stroke. There are two different types of Cholesterol. The "bad" cholesterol, low-density lipoprotein (LDL) is essential for cell repair and growth. But too much LDL in the blood is associated with the development of atherosclerosis (hardening of the arteries) and ...
... is a mostly insoluble waxy substance that is carried around the blood stream by lipo-proteins. These transport molecules can be classified as LDL and HDL. The low density lipo-proteins (LDL) carries the cholesterol around the blood to the cells that need it. However too much cholesterol in the diet or overproduction can cause cholesterol to be deposited in the blood vessels and arteries. This can be especially dangerous in the heart and brain. Thus LDL the cholesterol is known as the bad cholesterol. The other type of transporter the high density lipo-proteins (HDL) carries cholesterol away from the blood stream to the liver. So just having high cholesterol is not the complete picture but it is the proportion of HDL to LDL that is also important. Generally the safe level for cholesterol is around 5mmol/l, however half the population is above this level.. ...
7alpha-hydroxycholesterol is an oxysterol and can serve as a biomarker for lipid peroxidation. (PMID: 17386651 ) Products of cholesterol oxidation accumulate within atherosclerotic plaque and have been proposed to contribute to inflammatory signalling in the diseased artery. (PMID: 17364953 ). 7alpha-hydroxycholesterol is a cholesterol oxide that has been described as biomarker of oxidative stress in subjects with impaired glucose tolerance and diabetes. (PMID: 16634125 ...
Cholesterol is a steroid, which is a waxy organic compound, that is found in every cell of the body and in the plasma. The presence of cholesterol is essential to life. Endogenous (internal) synthesis by the liver and other organs produces between 60-80% of the bodys cholesterol. The remainder comes from exogenous (external) dietary sources. Total cholesterol involves all of the cholesterol found in the body such as LDL cholesterol, HDL cholesterol, and triglycerides. The level of cholesterol in the body is primarily affected by metabolic rate. Generally speaking, increased levels are associated with thyroid or adrenal hypofunction, and decreased levels are associated with endocrine hyperfunction. ...
Boehringer Ingelheim Vetmedica, Inc. - Get up-to-date information on Boehringer Ingelheim Vetmedica, Inc. side effects, uses, dosage, overdose, pregnancy, alcohol and more. Learn more about Boehringer Ingelheim Vetmedica, Inc.
Need to lower cholesterol? First, you must understand what it is and why its high. Cholesterol is a waxy molecule produced in the liver. Its a building block used all over the body to make neurotransmitters in your brain, hormones like testosterone/estrogens/progesterone/vitamin D (hormones with a cholesterol base are called "steroid hormones"), and its a component of every cell membrane in your body.. Remember, you cant pee in just one end of the pool. When you take a drug to lower cholesterol, every system that depends on cholesterol is affected. The side effects of memory loss, muscle pain, liver damage, and type 2 diabetes reflect the fundamental importance of cholesterol as a building block all over the body.. Cholesterol is made in the liver. Sooooo, why is the heart doctor giving you a drug to treat your liver. The reason is that its not really heart disease that causes "heart attacks". These events, as well as most strokes, are caused by years of blood vessel inflammation. The final ...
Animals utilize similar pathways in response to environmental or endogenous challenges from pathogenic, xenobiotic and oxidative stress (Kensler et al. 2007; Shore and Ruvkun 2013; Blackwell et al. 2015). At the core of the response is the conserved NRF2/Keap1 pathway in mammals or the SKN-1/WDR-23 pathway in C. elegans (Itoh et al. 1997; Itoh et al. 1999; An and Blackwell 2003; Kensler et al. 2007; Choe et al. 2009; Blackwell et al. 2015). When mammalian cells are under stress, Keap1 would dissociate from Nrf2, leading to the nuclear localization of Nrf2 and activation of gene expression that antagonizes the stress. In C. elegans, WDR-23 and SKN-1 appear to play similar roles as those of Keap1 and Nrf2 (Choe et al. 2009; Blackwell et al. 2015). The Nrf2/Keap1 pathway is also implicated in numerous human diseases, including neurodegeneration (Johnson and Johnson 2015), inflammation (Ahmed et al. 2017), cancer (Taguchi and Yamamoto 2017) and cardiovascular diseases (Barancik et al. 2016).. SKN-1 ...
Low prices on Cholesterol Support! Support healthy cholesterol levels already within the normal range*. Cholesterol can be both good and bad. LDL is usually referred to as bad cholesterol and HDL is good cholesterol. Numerous natural ingredients may help support healthy cholesterol levels already within the normal range.
GLOBAL - Sanofi and Boehringer Ingelheim have announced the signing of contracts to secure the strategic transaction initiated in December 2015 which consists of an exchange of Sanofi’s animal health business (“Merial”) and Boehringer Ingelheim’s consumer healthcare (CHC) business.
Boehringer Ingelheimhas struck a deal which positions the German drugmaker to participate in digital diabetes care. The pact between Boehringer and digital health outfit Healthrageous involves a study of Type 2 diabetics, who are expected to receive a combination of digital coaching, wireless glucose monitoring and other tools to manage their disease.
Description: This website provides basic information about getting your cholesterol checked. It covers how often to get your cholesterol checked, what is cholesterol, how can I tell if I have high cholesterol, how I can get my cholesterol checked and what do the test results mean. Additional resources are available the information is available in English and Spanish ...
Cholesterol News From Medical News Today comments, Description: Cholesterol is a fatty substance called a lipid that is important to aid the normal functionality of the body. Cholesterol is produced mainly by the liver but can also be found in foods. Cholesterol i, ID: 12887, By: Feedage Forager
Real name: Unknown. Status: Inactive. Series: Cholesterol Man appeared in the Blorg Trek series. Notes: Cholesterol Man is an inactive character, available for use. Known powers: Cholesterol Man can increase the fat levels of anyone he touches, to a point where the victim becomes ridiculously bloated. His thick layer of fat prevents him from being harmed by most attacks. Description: Obese is an understatement. So is chubby. The man is huge. Cholesterol Man wears a jogging suit (he tries, unsuccessfully, to lose weight in his spare time). ...
AMBICA PHARMA - Manufacturer,Supplier,Exporter of Anti Cholesterol Drugs,Anti Cholesterol Medicine from India. We offer Anti Cholesterol Drugs at a best price.
Here is everything you need to know about cholesterol. Causes symptoms diagnosis and prevention. How to lower cholesterol? How to choose low cholesterol foods?
Boehringer Ingelheim GmbH announced today that it has initiated and begun enrollment of patients in the ArTEN trial, which will compare the efficacy and safety of Viramune (nevirapine), a non-nucleos...
Understanding Cholesterol Levels on ThePaleoDiet.co.za | Understanding Your Cholesterol Test The issue with most (read all) common cholesterol tests is that…
Read about cholesterol and related information. Learn how to lower your LDL cholesterol levels, and food and diet related to good cholesterol health.
Read about cholesterol and related information. Learn how to lower your LDL cholesterol levels, and food and diet related to good cholesterol health.
Most of us have heard about good cholesterol and bad cholesterol. But its not the cholesterol that causes harm, its the particles that carry it. And routine
... is a type of fat found in your blood. The body needs some cholesterol, but too much can be a problem. Discover more about cholesterol in this article for teens.
Cholesterol is a type of fat found in your blood. The body needs some cholesterol, but too much can be a problem. Discover more about cholesterol in this article for teens.
... - Cholesterol is a waxy, fat-like substance thats found in all cells of the body. Your body makes all of the cholesterol it needs on its own to make hormones, vitamin D and to help digest your food.
Nearly Half of People Who Need Cholesterol Treatment Dont Get It Nearly Half of People Who Need Cholesterol Treatment Dont Get It WINSTON-SALEM, N.C. - Even though treatment for cholesterol disorders can reduce the risk of heart and blood vessel disease by about 30 percent over five years, many at-risk
How Can You Remember to Take Your Cholesterol Medications? - Our experts discuss strategies for staying on top of your cholesterol medication while away from home.
Read Controlling Cholesterol For Dummies by Carol Ann Rinzler with Rakuten Kobo. Need to get your cholesterol in check? Youll find the latest information about cholesterol, including treatments, drug ...
How to Reduce Cholesterol Without Medicines. When there are more natural ways to keep your bad cholesterol down, taking medications seems inorganic and foreign. If you simply want to manage your cholesterol but dont want the fuss of...
Is there a way that you can lower cholesterol naturally with vitamins and supplements? I am looking into preventative ways of treating high cholesterol in our family.
Cholesterol testing can play an important role in supporting overall health, but many people who are at risk for cardiovascular complications do not pursue this screening because they have a lack of understanding of how cholesterol affects their well-being. Individuals should improve their knowledge about the dangers of cholesterol in order to support well-being, experts say ...
Carrying high levels of LDL cholesterol in your blood ups the chance of heart attack and stroke. You want to do all you can to keep cholesterol levels healthy.
Articles, expert advice, and up-to-date information maintaining healthy cholesterol levels for women, along with plans for a cholesterol diet plan to keep you...
Articles, expert advice, and up-to-date information maintaining healthy cholesterol levels for women, along with plans for a cholesterol diet plan to keep you...
Think youre too young to worry about your cholesterol levels? Its never too early to learn the facts about cholesterol - the good, the bad and the ugly.
Cholesterol is an important component of cell membranes and has different functions in the human body, however high levels of cholesterol circulating in the
Cholesterol is a fat-like substance transported through the blood that is essential to bodily functions. It is derived from the food we eat and is also produced by our liver. When high levels are present in the blood stream, cholesterol can penetrate the walls of the arteries, forming deposits known as plaque. Plaque often enlarges and may combine with inflammatory elements causing rupture of the vessel wall. Now exposed to the blood stream, a clot can attach which may obstruct blood flow and the delivery of essential oxygen to vital organs such as the heart (heart attack) and brain (stroke).. ...
Too much cholesterol in your blood can cause a heart attack or a stroke. Share this resource to encourage people age 40 to 75 to get their cholesterol checked regularly.
Too much cholesterol in your blood can cause a heart attack or a stroke. Share this resource to encourage people age 40 to 75 to get their cholesterol checked regularly.
The only critical risk factor for artery plaque buildup is cholesterol. Get the latest research on cholesterol in free, easy to understand videos.
We offer cholesterol and cardiac tests in California. Visit one of our conveniently located test labs for heart and cholesterol screening near Barstow. Order online or call (760) 507-2786.
We offer cholesterol and cardiac tests in California. Visit one of our conveniently located test labs for heart and cholesterol screening near Santa Clarita. Order online or call (661) 367-8441.
Cholesterol, though vilified when it comes to heart health, actually plays an important role in the connections between brain cells. Scientists have long known that deficiencies in metabolizing cholesterol may contribute to an increase in Alzheimers risk. Additionally, diabetics are more prone to cognitive decline. The new findings may help explain this apparent connection ...
An excess of cholesterol can build up in the arteries, narrowing them and slowing or blocking blood flow to the heart. Take this quiz to learn more about cholesterol and its role in your health.
An excess of cholesterol can build up in the arteries, narrowing them and slowing or blocking blood flow to the heart. Take this quiz to learn more about cholesterol and its role in your health.
Most parents probably dont think about what cholesterol means for their kids. But high cholesterol is a risk factor for heart disease, which has its roots in childhood.
Contrary to popular belief, not all cholesterol is bad for you! If youve ever asked yourself, What is good cholesterol? Simplefill has the answers.
Most parents probably dont think about what cholesterol means for their kids. But high cholesterol is a risk factor for heart disease, which has its roots in childhood.
The risks of high cholesterol and cancer can be lowered by following these rules. Learn more about cholesterol and cancer how to lower your risks from Discovery Health.
... Cholesterol is a soft and waxy fatty substance present in the bloos streams and cells of both humans and animals.
High cholesterol is often thought of as a problem that you only have to deal with as an adult. Most people do not think they need to worry about cholesterol lev
Find out more about investigational BET inhibitor in the treatment of advanced malignancies. This website is intended for HCPs outside the US and the UK.
REGENSBURG, GERMANY--(Marketwire - June 24, 2008) - - The collaboration offers customers an integrated system solution from the design to the production of DNA-based pharmaceutical agents for clinical trials and the global market - GENEART will cover the gene optimization and the production of pharmaceutical agents in the form of...
Got my blood work results back today. Most things are normal. The total cholesterol which I care very little about has decreased from last year by about a hundred. The value has jumped around a lot over the years, while my diet and exercise have remained pretty much the same. Most people seem to worry…
Cholesterol is a chemical compound that the body requires as a building block for cell membranes ... greater your risk for developing heart disease
Gentaur molecular products has all kinds of products like :search , Bioquant \ Cholesterol, Liquid, 4 x 120 ml \ BQ013CR for more molecular products just contact us
Learn more about Cholesterol Test medical procedure, risk, preparation, definitions, what to expect after and results at FindaTopDoc.
Cholesterol Join our community. Leading products. Trusted For All specialize in supplying special featured medicines, developed to improve your life and makes better your health. We offer 60 Products in our store. ControlControl.
Cholesterol Join our community. Leading products. Trusted For All specialize in supplying special featured medicines, developed to improve your life and makes better your health. We offer 60 Products in our store. CakowityCakowity.
What is cholesterol?. Cholesterol is a fatty substance that is found in the blood. Cholesterol is made naturally in the body, and is also introduced to the body through the foods you eat. Most people consider cholesterol to be a bad thing, but not all cholesterol is created equal. There is actually good and bad cholesterol. To have healthy cholesterol is to have enough or a higher amount of "good" cholesterol, and low "bad" cholesterol.. Good Cholesterol. HDL (high density lipids) is also known as "good" cholesterol. HDL cholesterol actually helps to clean blood vessels and transport "bad" cholesterol out of the body.. Foods that have good cholesterol include fish, avocado, oats, some nuts, and berries. These foods can help you raise your HDL cholesterol levels and lower the bad.. Bad Cholesterol. LDL, or "low density lipids" is bad cholesterol. This is the kind of cholesterol that creates plaque that can clog your blood vessels and create problems such as high blood pressure, stroke and heart ...
A total of 182 patients were included in this study. Of all the 182 patients, 126 were male (69.23%) and 56 were female (30.77%). The mean age was (56.75±12.45) years. The median follow-up time was 48 months (3-99 months). At the end of the follow-up, 50 patients (27.47%) died due to the disease after a median of 29.74 months and 59 patients (32.42%) had tumor recurrence after a median of 22.12 months. The 5-year cancer-specific survival of all patients was 68.30% (95% CI: 60.16%-75.84%); the 5-year recurrence-free survival was 60.70% (95% CI: 53.16%-68.84%). In the univariate analysis, diabetes mellitus, tumor invasion status, Fuhrman grade, serum album, serum cholestenone, anemia, and neutrophils percentage were associated with the cancer-specific survival and Fuhrman grade, serum album and anemia were associated with the recurrence-free survival. Variables with significant differences on univariate analysis were included in Cox multivariate regression analysis. Multivariate Logistic ...
Children, young adults and older Americans can have high cholesterol. The food you eat and the lifestyle choices you make can help you reach personal cholesterol goals.. At least one in six Mississippians have high cholesterol - most may not even know it.. How do I know if my cholesterol is high?. High cholesterol usually doesnt have any symptoms. As a result, many people do not know that their cholesterol levels are too high. However, doctors can do a simple blood test to check your cholesterol. High cholesterol can be controlled through lifestyle changes or if necessary, through medications.. Its important to check your cholesterol levels. High cholesterol is a major risk factor for heart disease, the leading cause of death in the United States. What can I do to lower my cholesterol?. Your doctor may prescribe medications to treat your high cholesterol. In addition, you can lower your cholesterol levels through lifestyle changes:. ...
Cholesterol is a fat-like substance in the blood. The bodys cells need cholesterol, but too much of it creates problems. Approximately two thirds of the bodys cholesterol is made and stored in the liver; the remaining cholesterol comes from diet, especially from meat, chicken, fish, and dairy products. A simple blood test measures cholesterol, and laboratory tests report 3 values: low-density lipoprotein cholesterol, called LDL; high-density lipoprotein cholesterol, called HDL; and total cholesterol, which is the sum of LDL and HDL.. LDL and HDL have very different functions, and problems occur when patients have either too much LDL or too little HDL. Think of LDL as the carriers taking cholesterol from the liver to cells. Once the cells have what they need, they refuse delivery. The carriers do not know what to do with the extra cholesterol, so they dump it in the bloodstream and return to the liver for another batch.. Now think of HDL as the clean-up crew; they travel the bloodstream hauling ...

Cholesterol Oxidase - R1075PS | acris-antibodies.comCholesterol Oxidase - R1075PS | acris-antibodies.com

Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis. ... Product Description for Cholesterol Oxidase. Goat anti Bacteria Cholesterol Oxidase.. Presentation: Ig Fraction. Product is ... This product detects Cholesterol oxidase (microorganism). Cross reactivity against Cholesterol oxidase from other sources is ... Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis. In addition, they ...
more infohttps://www.acris-antibodies.com/antibodies/primary-antibodies/cholesterol-oxidase-r1075ps.htm

Substrate and inhibitor specificity of the cholesterol oxidase in bovine adrenal cortex | Biochemical JournalSubstrate and inhibitor specificity of the cholesterol oxidase in bovine adrenal cortex | Biochemical Journal

2. Free cholesterol is the preferred substrate for adrenal-cortex cholesterol oxidase; the apparent K(m) for cholesteryl ... Substrate and inhibitor specificity of the cholesterol oxidase in bovine adrenal cortex. PR Raggatt, MW Whitehouse ... Substrate and inhibitor specificity of the cholesterol oxidase in bovine adrenal cortex ... Substrate and inhibitor specificity of the cholesterol oxidase in bovine adrenal cortex ...
more infohttp://www.biochemj.org/content/101/3/819

Cholesterol Oxidase - R1075BS | acris-antibodies.comCholesterol Oxidase - R1075BS | acris-antibodies.com

Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis. ... Product Description for Cholesterol Oxidase. Goat anti Bacteria Cholesterol Oxidase.. Presentation: Biotin. Product is tested ... This product detects Cholesterol oxidase (microorganism). Cross reactivity against Cholesterol oxidase from other sources is ... Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis. In addition, they ...
more infohttps://us.acris-antibodies.com/antibodies/primary-antibodies/cholesterol-oxidase-r1075bs.htm

Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase
gene isolated from a native Rhodococcus sp |...Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp |...

... measurement of serum cholesterol, food industry as a biocatal.. ... Cholesterol oxidase (CHO) is one of the valuable enzymes that ... Cholesterol oxidase (CHO) is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food ... The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a ... Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. ...
more infohttps://www.ijmrhs.com/abstract/cloning-expression-and-enzymatic-activity-evaluation-of-cholesterol-oxidaserngene-isolated-from-a-native-rhodococcus-sp-1348.html

Cholesterol oxidase - WikipediaCholesterol oxidase - Wikipedia

In enzymology, a cholesterol oxidase (EC 1.1.3.6) is an enzyme that catalyzes the chemical reaction cholesterol + O2 ⇌ {\ ... Coulombe R, Yue KQ, Ghisla S, Vrielink A (August 2001). "Oxygen access to the active site of cholesterol oxidase through a ... The substrate-binding domain found in some bacterial cholesterol oxidases is composed of an eight-stranded mixed beta-pleated ... Richmond W (1973). "Preparation and properties of a cholesterol oxidase from Nocardia sp. and its application to the enzymatic ...
more infohttps://en.wikipedia.org/wiki/Cholesterol_oxidase

Global Cholesterol Oxidase Market Research Report 2017 | MedgadgetGlobal Cholesterol Oxidase Market Research Report 2017 | Medgadget

... the global Cholesterol Oxidase market is valued at USD XX million in 2016 and is expected to reach USD XX million by the end of ... 1 Cholesterol Oxidase Market Overview. 1.1 Product Overview and Scope of Cholesterol Oxidase. 1.2 Cholesterol Oxidase Segment ... 2.5.1 Cholesterol Oxidase Market Concentration Rate. 2.5.2 Cholesterol Oxidase Market Share of Top 3 and Top 5 Manufacturers. ... 1.4 Global Cholesterol Oxidase Market by Region (2012-2022). 1.4.1 Global Cholesterol Oxidase Market Size (Value) and CAGR (%) ...
more infohttps://www.medgadget.com/2017/09/global-cholesterol-oxidase-market-research-report-2017.html

Cholesterol Oxidase Binds TLR2 and Modulates Functional Responses of Human MacrophagesCholesterol Oxidase Binds TLR2 and Modulates Functional Responses of Human Macrophages

... Katarzyna Bednarska, Michal Kielbik, ... Katarzyna Bednarska, Michal Kielbik, Zofia Sulowska, Jaroslaw Dziadek, and Magdalena Klink, "Cholesterol Oxidase Binds TLR2 and ...
more infohttps://www.hindawi.com/journals/mi/2014/498395/cta/

RCSB PDB 









- 1IJH: CHOLESTEROL OXIDASE FROM STREPTOMYCES ASN485LEU MUTANT Methods Report PageRCSB PDB - 1IJH: CHOLESTEROL OXIDASE FROM STREPTOMYCES ASN485LEU MUTANT Methods Report Page

... between asparagine 485 and the pi system of FAD modulates the redox potential in the reaction catalyzed by cholesterol oxidase. ...
more infohttp://www.rcsb.org/pdb/explore/materialsAndMethods.do?structureId=1IJH

RCSB PDB 









- 1IJH: CHOLESTEROL OXIDASE FROM STREPTOMYCES ASN485LEU MUTANT Structure Summary PageRCSB PDB - 1IJH: CHOLESTEROL OXIDASE FROM STREPTOMYCES ASN485LEU MUTANT Structure Summary Page

... between asparagine 485 and the pi system of FAD modulates the redox potential in the reaction catalyzed by cholesterol oxidase. ... CHOLESTEROL OXIDASE A 504 Streptomyces sp. EC#: 1.1.3.6 IUBMB Mutation: N485L Details: FAD COFACTOR NON-COVALENTLY BOUND TO THE ...
more infohttp://www.rcsb.org/pdb/explore/explore.do?structureId=1IJH

Global Cholesterol Oxidase Sales Market Report 2017, Trends, Share, Size Research ReportGlobal Cholesterol Oxidase Sales Market Report 2017, Trends, Share, Size Research Report

Global Cholesterol Oxidase Sales Market Report 2017 Size and Share Published in 2014-05-03 Available for US$ 4000 at ... 1 Cholesterol Oxidase Market Overview. 1.1 Product Overview and Scope of Cholesterol Oxidase. 1.2 Classification of Cholesterol ... 2.2 Global Cholesterol Oxidase (Volume and Value) by Type. 2.2.1 Global Cholesterol Oxidase Sales and Market Share by Type ( ... 4 China Cholesterol Oxidase (Volume, Value and Sales Price). 4.1 China Cholesterol Oxidase Sales and Value (2012-2017). 4.1.1 ...
more infohttps://www.researchmoz.us/global-cholesterol-oxidase-sales-market-report-2017-report.html

Cholesterol Oxidase, Streptomyces sp. CAS 9028-76-6 | 228250Cholesterol Oxidase, Streptomyces sp. CAS 9028-76-6 | 228250

Cholesterol Oxidase, Streptomyces sp. CAS 9028-76-6, is a native cholesterol oxidase that catalyzes the oxidation of ... cholesterol to cholesterone and hydrogen peroxide. - Find MSDS or SDS, a COA, data sheets and more information. ... More,, Cholesterol Oxidase, Streptomyces sp. CAS 9028-76-6, is a native cholesterol oxidase that catalyzes the oxidation of ... Cholesterol Oxidase, Streptomyces sp. CAS 9028-76-6, is a native cholesterol oxidase that catalyzes the oxidation of ...
more infohttp://www.emdmillipore.com/US/en/product/Cholesterol-Oxidase-Streptomyces-sp.,EMD_BIO-228250

Cholesterol oxidase from E. coli, Recombinant (liquid)(EC 1.1.3.6) - Creative EnzymesCholesterol oxidase from E. coli, Recombinant (liquid)(EC 1.1.3.6) - Creative Enzymes

Recombinant Cholesterol Oxidase belongs to the family of oxidoreductases, specifically those acting on the CH-OH group of donor ... Recombinant Cholesterol Oxidase belongs to the family of oxidoreductases, specifically those acting on the CH-OH group of donor ... EC 1.1.3.6, cholesterol-O2 oxidoreductase; 3β-hydroxy steroid oxidoreductase; 3β-hydroxysteroid:oxygen oxidoreductase; 9028-76- ... Cholesterol oxidase from E. coli, Recombinant (liquid). Cholesterol oxidase from E. coli, Recombinant (liquid). ...
more infohttps://www.creative-enzymes.com/product/Cholesterol-Oxidase-From-E-Coli-Recombinant-liquid-_3431.html

Cholesterol Oxidase | Molecular DepotCholesterol Oxidase | Molecular Depot

Cholesterol Oxidase from Streptomyces sp ctalyzing the two-step transformation of cholesterol to cholest-4-en-3-one and H2O2. ... Cholesterol + O₂ -, Cholest-4-en-3-one + H₂O₂. Unit Definition. One enzymatic unit of cholesterol oxidase converts 1.0 μmole of ... Cholesterol oxidase is a flavoprotein involved in the first step of cholesterol catabolism. The enzyme first oxidizes ... cholesterol to cholest-5-en-3-one then isomerizes it to cholest-4-en-3-one while producing hydrogen peroxide H2O2. Available in ...
more infohttps://moleculardepot.com/product/cholesterol-oxidase-from-streptomyces-sp/

Cholesterol Oxidase from Streptomyces species, lyophilizateCholesterol Oxidase from Streptomyces species, lyophilizate

Use Cholesterol Oxidase in diagnostic tests for the determination of cholesterol in combination with Cholesterol Esterase, ... Contaminants (expressed as percentage of Cholesterol Oxidase activity):. Glucose oxidase: ≤0.01. Catalase: ≤1.00. Uricase: ≤ ... Will be supplied as "Cholesterol Oxidase, Streptomyces species". Unit of measure is "kU". +- ... Cholesterol Esterase. from Candida cylindracea, solution. Cholesterol Esterase. from Candida cylindracea, lyophilizate. ...
more infohttp://custombiotech.roche.com/home/Product_Details/3_1_4_1_11_1.html

Cloning, expression and biochemical characterization of the cholesterol oxidase CgChoA from Chryseobacterium gleum | BMC...Cloning, expression and biochemical characterization of the cholesterol oxidase CgChoA from Chryseobacterium gleum | BMC...

CgChoA is a true cholesterol oxidase which activity ranges among the high performing described cholesterol oxidases from other ... The N-terminally His-tagged cholesterol oxidase (CgChoA) was assigned to be a monomer in solution by size exclusion ... The gene choA encoding a cholesterol oxidase from Chryseobacterium gleum DSM 16776 was cloned into the pQE-30 expression vector ... Thus, the enzyme broadens the available toolbox of cholesterol oxidases for e.g. synthetic and biosensing applications. ...
more infohttps://bmcbiotechnol.biomedcentral.com/articles/10.1186/1472-6750-14-46

Immobilization of Cholesterol Oxidase: An Overview [Abstract]Immobilization of Cholesterol Oxidase: An Overview [Abstract]

Cholesterol oxidases are bacterial oxidases widely used commercially for their application in the detection of cholesterol in ... Immobilization of Cholesterol Oxidase: An Overview Shubhrima Ghosh, Razi Ahmad, Sunil Kumar Khare*. Enzyme and Microbial ... However, the soluble form of cholesterol oxidases are found to be less stable when applied at higher temperatures, broader pH ... This review focuses on the immobilization of cholesterol oxidases on various macro/micro matrices as well as nanoparticles and ...
more infohttps://openbiotechnologyjournal.com/VOLUME/12/PAGE/176/ABSTRACT/

Gentaur Molecular :Nordic Immunological Lab \ rabbit PAb against Nocardia erythropolis Cholesterol oxidase \ NE033/PAbGentaur Molecular :Nordic Immunological Lab \ rabbit PAb against Nocardia erythropolis Cholesterol oxidase \ NE033/PAb

... rabbit PAb against Nocardia erythropolis Cholesterol oxidase \ NE033/PAb for more molecular products just contact us ... WP632: Cholesterol metabolism. WP659: Cholesterol metabolism. WP833: Cholesterol Biosynthesis. WP952: Cholesterol Biosynthesis ... WP103: Cholesterol Biosynthesis. WP1070: Cholesterol Biosynthesis. WP1186: Cholesterol Biosynthesis. WP132: Cholesterol ... WP1795: Cholesterol biosynthesis. WP197: Cholesterol Biosynthesis. WP2011: SREBF and miR33 in cholesterol and lipid homeostasis ...
more infohttp://www.antibody-antibodies.com/product246631-search-rabbit%20PAb%20against%20Nocardia%20erythropolis%20Cholesterol%20oxidase.html

Purification and characterisation of the extracellular cholesterol oxidase enzyme from Enterococcus hirae | BMC Microbiology |...Purification and characterisation of the extracellular cholesterol oxidase enzyme from Enterococcus hirae | BMC Microbiology |...

Decomposition process of cholesterol by this strain results from its production of cholesterol oxidase enzyme (ChoX). The ... The cholesterol oxidase enzyme (ChoX) produced by E. hirae was extracted at an (NH4)2SO4 saturation level of 80 % and purified ... The bacterial isolate that displayed the highest cholesterol oxidase activity was identified as Enterococcus hirae. The maximal ... E. hirae Mil-31 isolated from milk had a great capacity to decompose cholesterol in basal medium supplemented with cholesterol ...
more infohttps://0-bmcmicrobiol-biomedcentral-com.brum.beds.ac.uk/articles/10.1186/s12866-015-0517-2

Alteration of substrate specificity of cholesterol oxidase from Streptomyces sp. by site-directed mutagenesis<...Alteration of substrate specificity of cholesterol oxidase from Streptomyces sp. by site-directed mutagenesis<...

Alteration of substrate specificity of cholesterol oxidase from Streptomyces sp. by site-directed mutagenesis. In: Protein ... Alteration of substrate specificity of cholesterol oxidase from Streptomyces sp. by site-directed mutagenesis. Protein ... Alteration of substrate specificity of cholesterol oxidase from Streptomyces sp. by site-directed mutagenesis. / Toyama, ... The amino acid substitutions chosen were based on structural comparisons of cholesterol oxidases from Streptomyces and ...
more infohttps://shibaura.pure.elsevier.com/en/publications/alteration-of-substrate-specificity-of-cholesterol-oxidase-from-s

Expression optimization of recombinant cholesterol oxidase in Escherichia coli and its purification and characterization | AMB...Expression optimization of recombinant cholesterol oxidase in Escherichia coli and its purification and characterization | AMB...

We report a straightforward and easy protocol for cholesterol oxidase production which can be performed in any laboratory. ... In this study, expression optimization of cholesterol oxidase from Streptomyces sp. SA-COO was investigated in Escherichia coli ... Applying the optimized protocol, the production of recombinant cholesterol oxidase was significantly enhanced from 3.2 to 158 U ... Accordingly, development of an efficient protocol for overexpression of cholesterol oxidase can be very valuable and beneficial ...
more infohttps://amb-express.springeropen.com/articles/10.1186/s13568-018-0711-3

Gold Nanoparticles Like A Matrix For Covalent Immobilization Of Cholesterol Oxidase - Application For Biosensing - Archives of...Gold Nanoparticles Like A Matrix For Covalent Immobilization Of Cholesterol Oxidase - Application For Biosensing - Archives of...

Gold Nanoparticles Like A Matrix For Covalent Immobilization Of Cholesterol Oxidase - Application For Biosensing - Archives of ... Gold Nanoparticles Like A Matrix For Covalent Immobilization Of Cholesterol Oxidase - Application For Biosensing Journal title ... Gold Nanoparticles Like A Matrix For Covalent Immobilization Of Cholesterol Oxidase - Application For Biosensing. R. ...
more infohttp://journals.pan.pl/dlibra/publication/104737/edition/90589/content/gold-nanoparticles-like-a-matrix-for-covalent-immobilization-of-cholesterol-oxidase-application-for-biosensing-r-wojnarowska-j-polit-d-broda-m-gonchar-e-m-sheregii?language=en

Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp.  -...Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. -...

ABSTRACT Cholesterol oxidase (CHO) is one of the valuable enzymes that play an important role in: measurement of serum ... The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a ... Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. ... and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. International Journal of ...
more infohttp://eprints.lums.ac.ir/648/

OxyreductaseOxyreductase

Cholesterol Oxidase Cholesterol Oxidase View options Request a quote Add to Favorites ...
more infohttps://www.mpbio.com/life-sciences/biochemicals/enzymes/oxyreductase

Current Biotechnology, Volume 2 - Number 2Current Biotechnology, Volume 2 - Number 2

Enhanced Production of Cholesterol Oxidase from Bacillus sp. COX-T3 in a Biphasic System. , 2(2): 147 - 154. Lata Kumari and ...
more infohttps://benthamscience.com/journals/current-biotechnology/volume/2/issue/2/

NHANES 1999-2000:
						Cholesterol - Total & HDL Data Documentation, Codebook, and FrequenciesNHANES 1999-2000: Cholesterol - Total & HDL Data Documentation, Codebook, and Frequencies

Cholesteryl ester + H2O -------------------------------------,cholesterol + fatty acid cholesterol oxidase Cholesterol + O2 ... LBDHDL - HDL-cholesterol (mg/dL). Variable Name: LBDHDL. SAS Label: HDL-cholesterol (mg/dL). English Text: HDL-cholesterol (mg/ ... LBXTC - Total cholesterol (mg/dL). Variable Name: LBXTC. SAS Label: Total cholesterol (mg/dL). English Text: Total cholesterol ... PEG-cholesterol oxidase Unesterified cholesterol + O2 -------------------------------------, cholestenone + H2O2 ...
more infohttps://wwwn.cdc.gov/Nchs/Nhanes/1999-2000/LAB13.htm
  • This product has been assayed against 1.0 µg of Cholesterol oxidase [microorganism] in a standard sandwich ELISA using peroxidase conjugated affinity purified anti-Goat IgG and ABTS as a substrate for 30 minutes at room temperature. (acris-antibodies.com)
  • Immunoelectrophoresis give a single precipitin arc against anti-goat serum as well as purified and partially purified Cholesterol oxidase [microorganism]. (acris-antibodies.com)
  • Cholesterol oxidase (CHO) is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. (ijmrhs.com)
  • The method uses sulfated alpha-cyclodextrin in the presence of Mg +2 , which forms complexes with apoB containing lipoproteins, and polyethylene glycol-coupled cholesteryl esterase and cholesterol oxidase for the HDL-cholesterol measurement. (cdc.gov)
  • The gene choA encoding a cholesterol oxidase from Chryseobacterium gleum DSM 16776 was cloned into the pQE-30 expression vector and heterologously expressed in Escherichia coli JM109 co-transformed with pRARE2. (biomedcentral.com)
  • In enzymology, a cholesterol oxidase (EC 1.1.3.6) is an enzyme that catalyzes the chemical reaction cholesterol + O2 ⇌ {\displaystyle \rightleftharpoons } cholest-4-en-3-one + H2O2 Thus, the two substrates of this enzyme are cholesterol and O2, whereas its two products are cholest-4-en-3-one and H2O2. (wikipedia.org)
  • In attempts to define the molecular basis of differences in catalytic activity or stability, substitutions at six amino acid residues were introduced into cholesterol oxidase using site-directed mutagenesis of its gene. (elsevier.com)
  • the apparent K(m) for cholesteryl sulphate is 500mum and for free cholesterol 50mum under the same conditions. (biochemj.org)
  • 3. Cholesteryl 3beta-acetate is hydrolysed by bovine adrenal-cortex mitochondria in vitro to free cholesterol, which is subsequently oxidized to more polar steroids and isocaproic acid. (biochemj.org)
  • Cholesterol is measured enzymatically in serum or plasma in a series of coupled reactions that hydrolyze cholesteryl esters and oxidize the 3-OH group of cholesterol. (cdc.gov)
  • This enzyme has a great commercial value because of its wide applications in cholesterol analysis of clinical samples, synthesis of steroid-derived drugs, food industries, and potentially insecticidal activity. (springeropen.com)
  • The group of Prof. Nikolelis group has recently utilized graphene and ZnO (Zinc Oxide) to develop chemical nanosensors for species of clinical or food significance, such as urea, uric acid, cholesterol, etc. (benthamscience.com)
  • What are the key market trends impacting the growth of the Cholesterol Oxidase Market? (medgadget.com)
  • Researchers are cautioned to interpret trends in HDL cholesterol for NHANES 1999-2008 in view of probable HDL cholesterol method effects. (cdc.gov)
  • In this report, the global Cholesterol Oxidase market is valued at USD XX million in 2016 and is expected to reach USD XX million by the end of 2022, growing at a CAGR of XX% between 2016 and 2022. (medgadget.com)
  • Cholesterol oxidase is the second most widely used enzyme in clinical laboratories (Doukyu et al. (springeropen.com)
  • The N-terminally His-tagged cholesterol oxidase (CgChoA) was assigned to be a monomer in solution by size exclusion chromatography, showed a temperature optimum of 35°C, and a pH optimum at 6.75 using 0.011 M MOPS buffer under the tested conditions. (biomedcentral.com)
  • Effect of simvastatin therapy on cell membrane cholesterol content and membrane function as assessed by polymorphonuclear cell NADPH oxidase activity. (nih.gov)
  • Cell membrane cholesterol is an important determinant of membrane fluidity. (nih.gov)
  • Treatment of hypercholesterolaemia could therefore affect membrane function by reducing cell membrane cholesterol levels. (nih.gov)
  • The aim of this study was to determine whether treatment with simvastatin affects membrane cholesterol and the activity of the polymorphonuclear cell membrane enzyme NADPH oxidase. (nih.gov)
  • The cholesterol oxidase enzyme (ChoX) produced by E. hirae was extracted at an (NH 4 ) 2 SO 4 saturation level of 80 % and purified with 79 % yield, resulting in 2.3-fold purification. (beds.ac.uk)
  • A number of other Delta(5)-3beta-hydroxy steroids inhibit cholesterol oxidation and evidence was obtained that the 3beta-hydroxyl group was necessary for inhibitory activity. (biochemj.org)
  • CgChoA is a true cholesterol oxidase which activity ranges among the high performing described cholesterol oxidases from other organisms. (biomedcentral.com)
  • The bacterial isolate that displayed the highest cholesterol oxidase activity was identified as Enterococcus hirae . (beds.ac.uk)
  • In the first one the 3β-OH group of cholesterol is oxidized to the corresponding ketone ( 2 ) with the concomitant reduction of the FAD cofactor. (biomedcentral.com)
  • Accordingly, development of an efficient protocol for overexpression of cholesterol oxidase can be very valuable and beneficial. (springeropen.com)
  • We report a straightforward and easy protocol for cholesterol oxidase production which can be performed in any laboratory. (springeropen.com)