Cholestenones: CHOLESTENES with one or more double bonds and substituted by any number of keto groups.Nobel Prizealpha-Macroglobulins: Glycoproteins with a molecular weight of approximately 620,000 to 680,000. Precipitation by electrophoresis is in the alpha region. They include alpha 1-macroglobulins and alpha 2-macroglobulins. These proteins exhibit trypsin-, chymotrypsin-, thrombin-, and plasmin-binding activity and function as hormonal transporters.Aedes: A genus of mosquitoes (CULICIDAE) frequently found in tropical and subtropical regions. YELLOW FEVER and DENGUE are two of the diseases that can be transmitted by species of this genus.Acute-Phase Proteins: Proteins that are secreted into the blood in increased or decreased quantities by hepatocytes in response to trauma, inflammation, or disease. These proteins can serve as inhibitors or mediators of the inflammatory processes. Certain acute-phase proteins have been used to diagnose and follow the course of diseases or as tumor markers.Macroglobulins: Serum globulins with high molecular weight. (Dorland, 28th ed)Adenosine Triphosphatases: A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.Alphavirus: A genus of TOGAVIRIDAE, also known as Group A arboviruses, serologically related to each other but not to other Togaviridae. The viruses are transmitted by mosquitoes. The type species is the SINDBIS VIRUS.

Presence of oxidized cholesterol in caveolae uncouples active platelet-derived growth factor receptors from tyrosine kinase substrates. (1/119)

Platelet-derived growth factor receptor beta (PDGFRbeta) in fibroblasts is concentrated in caveolae where it controls the tyrosine phosphorylation of multiple proteins. Caveolae are enriched in cholesterol and sphingolipids, but the role of these lipids in PDGFR signal transduction is unknown. We report that introduction of cholest-4-en-3-one into caveolae membranes uncouples PDGFR autophosphorylation from tyrosine phosphorylation of neighboring proteins. Cholest-4-en-3-one appears to interfere with the normal interaction between PDGFR and its partners. The results suggest that tightly packed caveolae lipids form a membrane platform that functions as a lipid scaffold for organizing the molecular interactions of multiple signaling pathways.  (+info)

Microsomal 12alpha-hydroxylation of 7alpha-[12alpha, 12beta-2H2]hydroxy-4-cholesten-3-one. (2/119)

The synthesis of 7alpha-[12alpha, 12beta-2 H2]hydroxy-4-cholesten-3-one is described. It was shown with different techniques that this compound was 12alpha-hydroxylated by the microsomal fraction of a rat liver homogenate without marked isotope effect, indicating that cleavage of the C--H bond is not the rate-limiting step in this hydroxylation. The rate of 12alpha-hydroxylation was decreased by about 20% when performed in a medium containing deuterated water. The findings were discussed with reference to the specific properties of the 12alpha-hydroxylating system and to the results of previous studies on rate-limiting step in microsomal hydroxylation of steroids.  (+info)

Determinants of variable response to statin treatment in patients with refractory familial hypercholesterolemia. (3/119)

Interindividual variability in low density lipoprotein (LDL) cholesterol (LDL-C) response during treatment with statins is well documented but poorly understood. To investigate potential metabolic and genetic determinants of statin responsiveness, 19 patients with refractory heterozygous familial hypercholesterolemia were sequentially treated with placebo, atorvastatin (10 mg/d), bile acid sequestrant, and the 2 combined, each for 4 weeks. Levels of LDL-C, mevalonic acid (MVA), 7-alpha-OH-4-cholesten-3-one, and leukocyte LDL receptor and hydroxymethylglutaryl coenzyme A reductase mRNA were determined after each treatment period. Atorvastatin (10 mg/d) reduced LDL-C by an overall mean of 32.5%. Above-average responders (LDL-C -39.5%) had higher basal MVA levels (34.4+/-6.1 micromol/L) than did below-average responders (LDL-C -23.6%, P<0.02; basal MVA 26.3+/-6.1 micromol/L, P<0.01). Fewer good responders compared with the poor responders had an apolipoprotein E4 allele (3 of 11 versus 6 of 8, respectively; P<0.05). There were no baseline differences between them in 7-alpha-OH-4-cholesten-3-one, hydroxymethylglutaryl coenzyme A reductase mRNA, or LDL receptor mRNA, but the latter increased in the good responders on combination therapy (P<0.05). Severe mutations were not more common in poor than in good responders. We conclude that poor responders to statins have a low basal rate of cholesterol synthesis that may be secondary to a genetically determined increase in cholesterol absorption, possibly mediated by apolipoprotein E4. If so, statin responsiveness could be enhanced by reducing dietary cholesterol intake or inhibiting absorption.  (+info)

27-hydroxycholesterol is an endogenous ligand for liver X receptor in cholesterol-loaded cells. (4/119)

The nuclear receptors liver X receptor alpha (LXRalpha) (NR1H3) and LXRbeta (NR1H2) are important regulators of genes involved in lipid metabolism, including ABCA1, ABCG1, and sterol regulatory element-binding protein-1c (SREBP-1c). Although it has been demonstrated that oxysterols are LXR ligands, little is known about the identity of the physiological activators of these receptors. Here we confirm earlier studies demonstrating a dose-dependent induction of ABCA1 and ABCG1 in human monocyte-derived macrophages by cholesterol loading. In addition, we show that formation of 27-hydroxycholesterol and cholestenoic acid, products of CYP27 action on cholesterol, is dependent on the dose of cholesterol used to load the cells. Other proposed LXR ligands, including 20(S)-hydroxycholesterol, 22(R)-hydroxycholesterol, and 24(S),25-epoxycholesterol, could not be detected under these conditions. A role for CYP27 in regulation of cholesterol-induced genes was demonstrated by the following findings. 1) Introduction of CYP27 into HEK-293 cells conferred an induction of ABCG1 and SREBP-1c; 2) upon cholesterol loading, CYP27-expressing cells induce these genes to a greater extent than in control cells; 3) in CYP27-deficient human skin fibroblasts, the induction of ABCA1 in response to cholesterol loading was ablated; and 4) in a coactivator association assay, 27-hydroxycholesterol functionally activated LXR. We conclude that 27-hydroxylation of cholesterol is an important pathway for LXR activation in response to cholesterol overload.  (+info)

Characterization of two steroidal ketones and two isoprenoid alcohols in dairy products. (5/119)

Two steroidal ketones, delta-4-cholesten-3-one and delta-3,-5-cholestadiene-7-one, were isolated and identified for the first time in anhydrous milk fat and in nonfat dry milk. Together with these, two isoprenoid alcohols, phytol and dihydrophytol, were identified in anhydrous milk fat. Their identities were established on the basis of chromatographic and mass spectral data and confirmed by comparison with authentic materials.  (+info)

Oxysterols: friends, foes, or just fellow passengers? (6/119)

Oxysterols are oxygenated derivatives of cholesterol that are intermediates or even end products in cholesterol excretion pathways. Because of their ability to pass cell membranes and the blood-brain barrier at a faster rate than cholesterol itself, they are also important as transport forms of cholesterol. In addition, oxysterols have been ascribed a number of important roles in connection with cholesterol turnover, atherosclerosis, apoptosis, necrosis, inflammation, immunosuppression, and the development of gallstones. According to current concepts, oxysterols are physiological mediators in connection with a number of cholesterol-induced metabolic effects. However, most of the evidence for this is still indirect, and there is a discrepancy between the documented potent effects of oxysterols under in vitro conditions and the studies demonstrating that they are of physiological importance in vivo. Oxysterol-binding proteins, such as liver X receptor-alpha (a nuclear receptor), do have a regulatory role in cholesterol turnover, but the physiological ligand of the protein has not yet been defined with certainty. Recently developed genetically engineered mouse models with markedly reduced or increased concentration of some of the oxysterols have exhibited surprisingly small changes in cholesterol turnover and homeostasis. The present review is a critical evaluation of the literature on oxysterols, in particular, the in vivo evidence for a role of oxysterols as physiological regulators of cholesterol homeostasis and as atherogenic factors.  (+info)

Oat bran stimulates bile acid synthesis within 8 h as measured by 7alpha-hydroxy-4-cholesten-3-one. (7/119)

BACKGROUND: Oat bran contains soluble fibers, such as beta-glucan, that increase bile acid excretion and thus decrease serum cholesterol. Bile acid synthesis correlates with serum concentrations of the metabolite 7alpha-hydroxy-4-cholesten-3-one (alpha-HC). OBJECTIVE: The objective was to investigate whether consumption of beta-glucan from oat bran increases bile acid synthesis, as measured by the serum alpha-HC concentration, within hours after consumption in response to the loss of bile acids from the liver. DESIGN: In a randomized, single-blind, wheat bran-controlled study with crossover design, 8 subjects were served a controlled diet during 2 periods of 3 d each, with an 11-d washout between the periods. Breakfast included either 75 g extruded oat bran, of which 11 g was beta-glucan, or 75 g wheat bran, of which 1 g was beta-glucan. Alpha-HC was measured by HPLC on each day at 0, 12, and 24 h after breakfast and also at 8 h after breakfast on the first day. RESULTS: After 8 and 12 h of the oat bran diet period, the serum alpha-HC concentration was 84% (P = 0.012) and 92% (P = 0.017) higher, respectively, than that before breakfast. Serum concentrations returned to the baseline value after 24 h. Wheat bran did not influence serum alpha-HC concentrations. CONCLUSIONS: Consumption of beta-glucan from oat bran nearly doubled the serum alpha-HC concentration within 8 h, indicating increased bile acid synthesis. alpha-HC in serum could be used as a marker of increased bile acid excretion induced by the diet.  (+info)

Monitoring hepatic cholesterol 7alpha-hydroxylase activity by assay of the stable bile acid intermediate 7alpha-hydroxy-4-cholesten-3-one in peripheral blood. (8/119)

We describe an accurate method for monitoring the enzymatic activity of hepatic cholesterol 7alpha-hydroxylase (C7alphaOH; CYP7A1), the rate-limiting and major regulatory enzyme in the synthesis of bile acids. Assay of 7alpha-hydroxy-4-cholesten-3-one (C4), an intermediate in bile acid synthesis, revealed that the level of C4 in peripheral blood serum or plasma showed a strong correlation to the enzymatic activity of hepatic C7alphaOH, both at steady-state conditions (r = 0.929) as well as during the rapid changes that occur during the diurnal phases. This assay should be of value in clarifying the regulation of bile acid synthesis in vivo in laboratory animals and humans since it allows for the monitoring of hepatic C7alphaOH activity using peripheral blood samples.  (+info)

5$\alpha$-Cholest-8(14)-en-3$\beta$-ol-15-one is a potent inhibitor of cholesterol biosynthesis which has been found to have significant hypocholesterolemic action upon oral administration to rodents and nonhuman primates. The metabolism of (2,4-$\sp3$H) 5$\alpha$-cholest-8(14)-3n-3$\beta$-ol-15-one was studied in Chinese hamster ovary (CHO-K1) cells. The incorporation of the labeled 15-ketosterol into the cells was linear with respect to sterol concentration in the medium over the range of concentrations studied and was higher than the uptake of cholesterol. The results of detailed analyses of the lipids recovered from the cells after 6 hours of incubation with the (2,4-$\sp3$H) -15-ketosterol indicated that most of the $\sp3$H was associated with the free 15-ketosterol. Considerably smaller amounts of $\sp3$H were associated with esters of the 15-ketosterol. No conversion of the 15-ketosterol to cholesterol or other C$\sb{27}$ monohydroxysterols was observed. The labeled material with the ...
This study is a multicenter, double-blind, randomized, adaptive, parallel groups, placebo controlled 3-stage study in patients with SMA type 2 or non ambulant type 3.. Stage 1 DMC 3-month safety assessment: An independent Data Monitoring Committee (DMC)will assess the safety of olesoxime every 3 months.. Stage 2 Efficacy/futility analyses at one year: A first interim efficacy analysis will be performed after all patients have been treated for one year (52 weeks) in order to assess the need to continue the study to reach the planned objective. In the event of positive and significant results in favor of olesoxime, the study will be considered as successful and all patients will be switched to olesoxime to allow the assessment of the sustainability of the treatment effect and safety. If the results are significantly in favor of placebo, the study will be discontinued for failure (futility).. Stage 3 Efficacy and safety analysis at two years: The expected study duration is of 2 years (104 weeks) to ...
Welcome! For price inquiries, please feel free to contact us through the form below through the form on the left side. We will get back to you as soon as possible.. ...
63977-77-5 - KPCLDXRCQCEGKE-UHFFFAOYSA-M - 1-alpha-H,5-alpha-H-Tropanium, 8-benzyl-3-alpha-hydroxy-, bromide, benzilate (ester) - Similar structures search, synonyms, formulas, resource links, and other chemical information.
1-O-(rhamnopyranosyl-(1-2)-6-O-acetyl-galactopyranosyl)-1,3,22,26-tetrahydroxy-furost-5(6)-en-26-O-glucopyranoside: structure in first source
7 alpha,26-Dihydroxy-4-cholesten-3-one is involved in primary bile acid biosynthesis. 7 alpha,26-Dihydroxy-4-cholesten-3-one is produced from 7 alpha,27-Dihydroxycholesterol through the action of HSD3B7 (EC:1.1.1.181). 7 alpha,26-Dihydroxy-4-cholesten-3-one can then be converted to 7 alpha-Hydroxy-3-oxo-4-cholestenoate by CYP27A (EC:1.14.13.15 ...
Creative-Proteomics offer cas 516-55-2 5-ALPHA-PREGNAN-3-BETA-OL-20-ONE (17A,21,21,21-D4, 97%+) 96% PURE. We are specialized in manufacturing Stabel Isotope Labeled Analytical Standard products.
Rodrigues, M., et al. Proteolytic hydrolysis of cowpea proteins is able to release peptides with hypocholesterolemic activity. Food Research International. 77(1), 43-48. 20/04/2015.. ...
11-o,o-isopropylidenebis-aboia-7(14)-ene 1beta,8-diangeloyloxy-2beta-acetoxy-4alpha-chloro-3beta-hydroxy-10: antineoplastic from Cremanthodium discoideum; structure in first source
You are viewing an interactive 3D depiction of the molecule 14alpha-ethyl-5alpha-cholest-7-ene-3beta,15alpha-diol (C29H50O2) from the PQR.
Actelion/Trophos: This deal -- in which Trophos granted Actelion an option to buy based on the results of a pivotal study for its lead ALS project -- puts the number of options-to-buy so far this year at at least six, compared to 2009s five. Actelion paid €10 million up-front to the French biotech and will pay €125 million to complete the deal upon conclusion of a Phase III pivotal trial of Trophos lead amyotrophic lateral sclerosis candidate, olesoxime. Enrollment in that 512-patient study is complete and results are expected by the end of 2011; thus, Actelion will need to make up its mind within a couple months of seeing the data or by the end of 2012, whichever comes first. Should Actelion exercise its option, Trophos backers could see up to €70 million in further milestone payments based on the clinical progress of the companys pipeline and the regulatory success of olesoxime. Meanwhile, Actelion has gained access to Trophos proprietary CNS assay technology and cholesterol-oxime ...
This page contains information on the chemical Benzeneacetic acid, alpha-hydroxy-, ((2-chlorophenyl)methylene)hydrazide, (E)- including: 3 synonyms/identifiers.
Roche (SIX:ROG; OTCQX:RHHBY) said it will discontinue development of spinal muscular atrophy candidate olesoxime (RG6083, TRO19622).
Increasing evidence suggests that the various components of açaí contribute to cardioprotection via mechanisms that affect cell membrane receptors, intracellular signaling pathway proteins, and the modulation of gene expression [37],. [38], [39], [40] and [41]. It has been demonstrated that flavonoids regulate the activity of the Alisertib nuclear receptor regulators of cellular lipid metabolism [42] and [43]. The present study was designed to investigate the hypocholesterolemic activity of açaí pulp using a rat model of dietary-induced hypercholesterolemia. A 2% açaí pulp dose was chosen because of its relevance to human nutrition. This dosage mimics the addition of a portion of this fruit in food [44] and selleck compound has demonstrated effects in previous studies [10], [15] and [16]. Corroborating our previous results [15], açaí supplementation improved the lipid profile in the rat. Thus, we focused on characterizing the effects that açaí pulp supplementation in the diet would ...
InChI=1S/C27H42O4/c1-16(6-5-7-17(2)25(30)31)20-8-9-21-24-22(11-13-27(20,21)4)26(3)12-10-19(28)14-18(26)15-23(24)29/h14,16-17,20-24,29H,5-13,15H2,1-4H3,(H,30,31)/t16-,17?,20?,21?,22?,23-,24?,26+,27-/m1/ ...
CAS: 15262-86-9 MF: C25H38O3 MW: 386.57 EINECS: 239-307-1 Synonyms: 17beta-hydroxyandrost-4-ene-3-one 4-methylvalerate;4-ANDROSTEN-17-BETA-OL-3-ONE ISOCAPROATE;4-ANDROSTEN-17BETA-OL-3-ONE ISOCAPRONATE;4-ANDROSTEN-17BETA-OL-3-ONE...
Cholesterol Oxidase, 0.1 mg. Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis.
Cholesterol Oxidase, 0.1 mg. Cholesterol oxidases exist as both type I and type II oxidases and are implicated in bacterial pathogenesis.
Products Testosterone Series Clostebol acetate/4-Chlorotestosterone Acetate Clostebol acetate (Steroids) Alias: 4-chlorotestosterone acetate; 4-chloroandrost-4-ene-17beta-ol-3-one acetate;Turinabol CAS NO.: 855-19-6 EINECS: 212-720-4 Assay: 98%...
Catalog #: P2010002 - 250 U Cholesterol oxidase is a flavoprotein involved in the first step of cholesterol catabolism. The enzyme first oxidizes cholesterol to cholest-5-en-3-one then isomerizes it to cholest-4-en-3-one while producing hydrogen peroxide H2O2. Available in a 250 Units and custom bulk sizes. Live Enquiry about this product via Text/SMS: 1-858-900-3210 (8 am - 8 pm PST ...
Thus, the two substrates of this enzyme are cholest-5-ene-3β,7α-diol and NAD+, whereas its 3 products are 7α-hydroxycholest-4-en-3-one, NADH, and H+. The systematic name of this enzyme class is cholest-5-ene-3β,7α-diol:NAD+ 3-oxidoreductase. This enzyme is also called 3β-hydroxy-Δ5-C27-steroid oxidoreductase. The human version of this enzyme is known as hydroxy-Δ-5-steroid dehydrogenase, 3 β- and steroid delta-isomerase 7 or HSD3B7 which is encoded by the HSD3B7 gene.[2][3] ...
More than 10 mutations in the AKR1D1 gene have been found to cause congenital bile acid synthesis defect type 2. This condition is characterized by cholestasis, a condition that impairs the production and release of a digestive fluid called bile from liver cells. Most of the AKR1D1 gene mutations replace single protein building blocks (amino acids) in the enzyme. These mutations result in production of a 3-oxo-5-β-steroid 4-dehydrogenase enzyme with severely reduced function. Without enough functional enzyme, the conversion of 7α-hydroxy-4-cholesten-3-one to 7α-hydroxy-5β-cholesten-3-one is impaired. The 7α-hydroxy-4-cholesten-3-one instead gets converted into abnormal bile acid compounds that cannot be transported out of the liver into the intestine, where the bile acids are needed to digest fats. This impaired production and release of bile acids leads to cholestasis. As a result, cholesterol and abnormal bile acids build up in the liver and fat-soluble vitamins are not absorbed, leading ...
Ze Xie is also known as Alisma. The sweet, bland and cold herb has been used in TCM as anti-pyretic , as anti-bacterial, hypoglycemic, hypotensive, anti tumor, anti-allergic, etc., as it eliminates water, clear Heat, diuretic, etc., by enchaining the functions of bladder and kidney channels. Ingredients 1. Alisol A、B、C 2. Alosol A monoacetate 3. …. ...
Cholestane glycosides from Ornithogalum saundersiae bulbs and the induction of apoptosis in HL-60 cells by OSW-1 through a mitochondrial-independent signaling pathway (2019 ...
putative cholesterol oxidase [RimD] GTGATCGAGAACCAGCACCTGTCACGGCGCCGTCTGCTCGGACTGGCCGCCCTCGGCGGC GCCGCCGTCGCCGGAATGACCACGATTTCCGTCGCCCCGCGCGCCGCGGCCGCCGGGCAG GGAAGCCCGCGGGCCGGTGACGGCGCGTTCGTACCGGCGGTGGTGATCGGCACCGGTTAC GGTGCGGCGGTCTCCGCGCTGCGGCTCGGCGAGGCGGGAATTCCGACGCTCATGCTCGAA ATGGGCCAGCTGTGGAACAAGCCGGCCGACGACGGCAACATCTTCTGCGGAATGCTCAAG CCCGACCGCAGGTCCAGCTGGTTCAAGTCGCGCACCGAAGCCCCGCTGGGCTCGTTCCTG TGGCTGGATGTCATCAACCGCAACATCGACCCGTACGCGGGCGTCCTCGACAAGGTGCAC TTCGACGAGATGTCGGTGTACGTGGGACGGGGCGTCGGCGGCGGCTCGCTGGTCAACGGC GGCATGGCCGTCGTACCGAAGCGCTCGTACTTCGAAGAGGTCCTCCCACGGGTGGACGCC GCCCAGATGTACGACCGGTACTTCCCGCGCGCCAACTCCATGCTCAAGGTGAACCACATC GACAAGGGGTGGTTCGAGGACACGGAGTGGTACAAGTACGCGCGGGTCTCGCGCGAGCAG GCGGGCAAGGCGGGCCTGAGCACCACCTTCGTCCCCAACGTCTACGACTTCGACCACATG CGGCGCGAGGCGGACGGCACGGCGCCCAAGTCGGCGCTGGCCGGCGAGGTGATCTACGGC AACAACCACGGCAAGCAGAGCCTGGACAAGACCTATCTGGCCGCCGCGCTGGGCACCGGC AAGGTCACCATCGAGACGCTGCACCAGGTCAAGGCGATCCGGCGGCAGCCGGACGGCAGC ...
Drug = 2011-2012 seasonal flu vaccine; 4-aminopyridine; 4-cholesten-3-one, oxime; 4-cholesten-3-one,oxime; Adipose derived mesenchymal stem cell; Amifampridine; Amifampridine phosphate; Amifampridine phosphate 10 mg oral tablet; Avxs-101; Avxs-101 (previously known as scaav9.cb.smn); Biocarn; Branaplam; Celecoxib; Ck-2127107; Ck-2127107 150 mg; Ck-2127107 450 mg; Human anti-promyostatin monoclonal antibody; Hydroxyurea; Isis 396443; Isis 396443 (biib058); Itraconazole; Leuprolide; Levocarnitine; Lmi070; Mestinon; Midazolam; N.a.; Nerve growth factor; Norditropin simplexx; Norditropin simplexx 15 mg/1.5 ml; Nusinersen; Olesoxime; Onasemnogene abeparvovec; Onasemnogene abeparvovec-xioi; Orfiril saft; Paracetamol; Paracetamol 120mg/5ml oral suspension; Phenylbutyrate; Phosphate; Placebo; Pyridostigmine; Pyridostigmine bromide; Riluzole; Risdiplam; Ro6885247/f03; Ro7034067; Ro7034067 / f12; Ro7034067 / f13; Ro7034067/f06 with solvent (ro7034067/f08); Ro7034067/f07 with solvent (ro7034067/f09); ...
Alisol: One of the 30 soil groups in the classification system of the Food and Agriculture Organization (FAO). Alisols are highly acidic, poorly drained soils prone to aluminum toxicity...
Studies have reported that guggulsterone has hypocholesterolemic activity. However, gugglesterone may also increase thyroid hormone levels.
1IJH: The presence of a hydrogen bond between asparagine 485 and the pi system of FAD modulates the redox potential in the reaction catalyzed by cholesterol oxidase.
Age-Factors, Alcohol-Oxidoreductases: me, Animal, Animals-Newborn, Brain: en, gd, me, Carbon-Dioxide: me, Carbon-Isotopes, Fatty-Acids: bi, Female, Fetus: me, Genes-Recessive, Glutarates, Male, Mevalonic-Acid: me, Mice, Microsomes: en, me, Mutation, Phospholipids: bi, Sex-Chromosomes, Sterols: bi. ...
Vol 70: 1-(3,4-Di-meth-oxy-phen-yl)-3-phenyl-prop-2-en-1-one.. This article is from Acta Crystallographica Section E: Structure Reports Online, volume 70.AbstractIn the title compound. Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
Multidrug resistance (MDR) is a prime reason for numerous failed oncotherapy approaches. In the present study, we investigated whether Alisol F 24 acetate (ALI) could reverse the MDR of MCF-7/DOX cells, a multidrug-resistant human breast cancer cell line. We found that ALI was a potent P-glycoprotein (P-gp) inhibitor, in the Caco-2-monolayer cell model. ALI showed a significant and concentration-dependent cytotoxic effect on MCF-7/DOX cells in combination with doxorubicin by increasing intracellular accumulation and inducing nuclear migration of doxorubicin. However, ALI had no such effect on MCF-7 cells. In addition, ALI also promoted doxorubicin-induced early apoptosis of MCF-7/DOX cells in a time-dependent manner. These results suggest that ALI can enhance chemosensitivity of doxorubicin and reinforce its anti-cancer effect by increasing its uptake, especially inducing its nuclear accumulation in MCF-7/DOX cells. Therefore, ALI could be developed as a potential MDR-reversing agent in cancer
Testosterone Decanoate (Steroids) Synonyms: testosterone caproate;4-Androsten-17beta-ol-3-one Decanoate CAS: 5721-91-5 EINECS: 227-226-4 Mocular Formula: C29H46O3 Mocular weight:442.68 Moculare Structure: Assay: 98% min. Packing: foil bag or tin....
Cholesterol oxidase (CHO) is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatal..
Alfa Chemistry is the worlds leading provider for special chemicals. We offer qualified products for 10322-03-9(Cholest-5-ene,3-butoxy-, (3b)-(9CI)),please inquire us for 10322-03-9(Cholest-5-ene,3-butoxy-, (3b)-(9CI)).
I just received an e-mail from someone I know. It has a file attached to it with the extension .dat and I do not know if it is OK to open it, or even what program to use to open it. He got the file...
PubMed Central Canada (PMC Canada) provides free access to a stable and permanent online digital archive of full-text, peer-reviewed health and life sciences research publications. It builds on PubMed Central (PMC), the U.S. National Institutes of Health (NIH) free digital archive of biomedical and life sciences journal literature and is a member of the broader PMC International (PMCI) network of e-repositories.
1IJH: The presence of a hydrogen bond between asparagine 485 and the pi system of FAD modulates the redox potential in the reaction catalyzed by cholesterol oxidase.
2-Methylene analogs of 1alpha-hydroxy-19-norvitamin D3: synthesis, biological activities and docking to the ligand binding domain of the rat vitamin D receptorGrzywacz, P. et al.The Journal of Steroid Biochemistry and Molecular Biology 89-90, 13-7, 2004. ...
Four new steroidal components (1−4) along with two known analogues (5−6) were obtained from the roots and rhizomes of Smilacina henryi. The components structures were determined as (25S)-5α-spirost-9(11)-ene-3β, 17α, 21-triol (1), (24S, 25S)-5α-spirost-9(11)-ene-3β, 17α, 24-triol (2), (25S)-5α-spirost-9(11)-ene-3β, 17α-dihydroxy-12-one (3), 5α-cholest-9(11)-ene-3β, 26-dihydroxy-16, 22-dione (4 ...
7,7-dimethyl-5-oxobicyclo[2.2.1]hept-2-en-1-yl acetate - chemical structural formula, chemical names, chemical properties, synthesis references
This page contains information on the chemical 1-alpha-H,5-alpha-H-Tropane-2-beta-carboxylic acid, 3-beta-hydroxy-, methyl ester,benzoate (ester), hydrochloride including: 2 synonyms/identifiers.
Pregnenolone, 3-alpha-hydroxy-5-beta-pregnen-20-one, is a natural steroid hormone produced in the body from cholesterol. It has been described as the "Grandmother of all Steroid Hormones," since all steroid hormones, over 150 of them, are derived from pregnenolone. Pregnenolone has been linked with positive support of the immune system, mood and memory. In the body, it takes… Read More ». ...
Modulation of the effectiveness of 17-alpha-hydroxy-20-beta-dihydroprogesterone or of a gonadotrophic extract on the in vitro intrafollicular maturation of oocytes of the rainbow trout Salmo gairdnerii by various non-maturing ...
Compounds::: 2a,3a-epithio-17a-methyl-5a-androstan- 17b-ol Mw- 320.5 2,17a-dimethyl-17b-hydroxy-5a-androst-1-en-3-one Mw- 316.5 Transdermal carrier:::
Bună sara! Ne-am mutat la casâ nouâ șî am zâs câ ar fi ghini sâ vă cinstesc oleacă! Am pentru voi o sacoșâ cu dulșiuri șî niști bieri. Aș fi vrut sâ vă dau o tavâ cu poale-n brâu șî Continue reading Bre, dam premii pi digeaba!→. ...
Our previous reports indicated that (+)-cholesten-3-one induces osteogenic differentiation of bone marrow mesenchymal stem cells (MSCs) by activating vitamin D receptor (VDR). However, whether and how miRNAs modulate osteogenic differentiation induced by (+)-cholesten-3-one have not been explored. In this study, miRNA array profiling and further validation by quantitative real-time PCR revealed that miR-351 was downregulated during (+)-cholesten-3-one-induced osteogenic differentiation of MSCs. Overexpression of miR-351 by miR-351 precursor transfection markedly inhibited the expression of osteoblast-specific genes, such as alkaline phosphatase (ALP), collagen type II, osteopontin (OPN), and runt-related transcription factor 2 (RUNX2), which consequently decreased a number of calcium mineralized nodules ...
Steroidal saponins are plant metabolites with a broad range of biological activities (Hostettmann & Marston, 1995). They are composed by a glycoside and a triterpene or steroidal fragment. Hydrolysis of saponins provides a glycoside free portion termed sapogenin which can be of the cholestane, furostane or spirostane type. The spirostane sapogenins also display economic importance due to their application in the synthesis of biologically active compounds such as insect hormones (Lee et al., 1976) cephalostatins and ritterazines (Lee et al., 2009, Phillips & Shair, 2007 and Pettit et al., 1988). In previous studies we reported the preparation of epoxycholestane derivatives as useful intermediates in the synthesis of norbrassinosteroid analogues (Rincón et al., 2006), in continuation with our studies we report herein on the synthesis and crystal structure of the title compound, (I), obtained by treatment of the previously reported ...
Department of Chemistry, UBC Faculty of Science. Vancouver Campus. 2036 Main Mall. Vancouver, BC Canada V6T 1Z1. Tel: 604.822.3266. Fax: 604.822.2847. ...
Department of Chemistry, UBC Faculty of Science. Vancouver Campus. 2036 Main Mall. Vancouver, BC Canada V6T 1Z1. Tel: 604.822.3266. Fax: 604.822.2847. ...
trans-Calcipotriol-bis-TBDMS-ether - CAS-RN:[112849-27-1] - (1R,3aS,7aR,E)-4-((E)-2-((5R)-3,5-bis(tert-butyldimethylsilyloxy)-2-methylenecyclohexylidene)ethylidene)-1-((2R,5R,E)-5-cyclopropylh ex-3-en-2-yl)-7a-methyl-octahydro-1H-indene
... cholestenones MeSH D04.808.247.222.265.165 --- ecdysteroids MeSH D04.808.247.222.265.165.500 --- ecdysone MeSH D04.808.247.222. ...
Cholestenones / metabolism * Cholesterol / metabolism * Diet * Host-Parasite Interactions* * Plants, Genetically Modified / ...
... cholestenones MeSH D04.808.247.222.265.165 --- ecdysteroids MeSH D04.808.247.222.265.165.500 --- ecdysone MeSH D04.808.247.222. ...
Moore RG, Lange TS, Robinson K, Kim KK, Uzun A, Horan TC, Kawar N, Yano N, Chu SR, Mao Q, Brard L, DePaepe ME, Padbury JF, Arnold LA, Brodsky A, Shen TL, Singh RK. Efficacy of a non-hypercalcemic vitamin-D2 derived anti-cancer agent (MT19c) and inhibition of fatty acid synthesis in an ovarian cancer xenograft model. PLoS One. 2012; 7(4):e34443 ...
Résumé , BibTeX , Étiquettes: Abdomen, Cholestenones, Chromatography, Ecdysone, Epidermis, Fat Body, Grasshoppers, Head, High ... keywords = {Abdomen, Cholestenones, Chromatography, Ecdysone, Epidermis, Fat Body, Grasshoppers, Head, High Pressure Liquid, ...
Cells-Cultured, Cholestenes, Cholestenones, Fetus, Hydroxymethylglutaryl-CoA-Reductases: me, L-Cells: de, me, Liver: de, me, ...
Cholestenones D4.808.247.222.265 D4.210.500.247.222.265 Cholesterol D4.808.247.222.284 D4.210.500.247.222.284 D4.808.247.808. ...
Cholestenones; Coculture Techniques; Colony Stimulating Factor 1; Controlled Study; Enzyme Phosphorylation; Humans; ...
Cholestenones , Cellular Biology , Multiple Sclerosis , Life Sciences , Cuprizone , Myelin Sheath , Oligodendroglia , ... Cholestenones - therapeutic use , Demyelinating Diseases - drug therapy , Disease Models, Animal , Multiple Sclerosis - drug ...
Cholestenones - pharmacology , Cell Proliferation - drug effects , Sphingomyelins - biosynthesis , Spiro Compounds - ... Cholestenones - antagonists & inhibitors , Steroids - pharmacology , Saponins - antagonists & inhibitors , Biological Products ...
Cholestenones - pharmacology , Mice , Protein Kinase Inhibitors - pharmacology , Mutation , Superoxide Dismutase-1 , ... Cholestenones - chemistry , Protein-Serine-Threonine Kinases - antagonists & inhibitors , Indoles - pharmacology , Amyotrophic ...
Animals , Cholestenones , Chemistry , Pharmacokinetics , Pharmacology , Drugs, Chinese Herbal , Chemistry , Pharmacokinetics , ...
Cholestenones , Drugs, Chinese Herbal , Chemistry , Flavonoids , Flavonols , Furans , Lignans , Magnoliopsida , Chemistry , ...
Apigenin , Cholestenones , Flavones , Flavonoids , Glycosides , Hesperidin , Lobelia , Chemistry , Plant Extracts , ...
Alkaloids , Chemistry , Cholestenones , Chemistry , Cynanchum , Chemistry , Glucosides , Chemistry , Isoquinolines , Chemistry ...
Actins , Metabolism , Cadherins , Metabolism , Cell Differentiation , Cell Line , Cholestenones , Pharmacology , Complement C3a ...
... , Chemistry , Animals , Cell Death , Cholestenones , Chemistry , Pharmacology , Cinnamates , Chemistry , Pharmacology ...
Alpinia , Chemistry , Animals , Cell Death , Cholestenones , Chemistry , Pharmacology , Cinnamates , Chemistry , Pharmacology ...
Antiviral Agents/pharmacology , Cholestenones/pharmacology , Enterovirus/drug effects , Receptors, Steroid/metabolism , ...
Cholestenones, Cholesterol, Cholesterol, Chromatin Assembly and Disassembly, Chromatin Assembly and Disassembly, Chromatin ...
Research OutputsResearch Output authored by Analytical study on stress-induced phase transitions in geometrically graded shape memory alloy layers. Part II is tagged with the concept ...
D04.210.500.247.222.265 Cholestenones .. D04.210.500.247.222.265.165 Ecdysteroids .. D04.210.500.247.222.265.165.750 ...
chI, Ch D, Ch B, CH, Online Electronic Medical Dictionary Terminology, Articles, Glossary

No FAQ available that match "cholestenones"