Chlorobium: A genus of phototrophic, obligately anaerobic bacteria in the family Chlorobiaceae. They are found in hydrogen sulfide-containing mud and water environments.Chlorobi: A phylum of anoxygenic, phototrophic bacteria including the family Chlorobiaceae. They occur in aquatic sediments, sulfur springs, and hot springs and utilize reduced sulfur compounds instead of oxygen.Bacteriochlorophylls: Pyrrole containing pigments found in photosynthetic bacteria.Rhodospirillales: An order of photosynthetic bacteria representing a physiological community of predominantly aquatic bacteria.Photosynthetic Reaction Center Complex Proteins: Protein complexes that take part in the process of PHOTOSYNTHESIS. They are located within the THYLAKOID MEMBRANES of plant CHLOROPLASTS and a variety of structures in more primitive organisms. There are two major complexes involved in the photosynthetic process called PHOTOSYSTEM I and PHOTOSYSTEM II.Bacteria: One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.Levulinic Acids: Keto acids that are derivatives of 4-oxopentanoic acids (levulinic acid).Rhodospirillaceae: A family of phototrophic bacteria, in the order Rhodospirillales, isolated from stagnant water and mud.Sulfur: An element that is a member of the chalcogen family. It has an atomic symbol S, atomic number 16, and atomic weight [32.059; 32.076]. It is found in the amino acids cysteine and methionine.ATP Citrate (pro-S)-Lyase: An enzyme that, in the presence of ATP and COENZYME A, catalyzes the cleavage of citrate to yield acetyl CoA, oxaloacetate, ADP, and ORTHOPHOSPHATE. This reaction represents an important step in fatty acid biosynthesis. This enzyme was formerly listed as EC 4.1.3.8.Light-Harvesting Protein Complexes: Complexes containing CHLOROPHYLL and other photosensitive molecules. They serve to capture energy in the form of PHOTONS and are generally found as components of the PHOTOSYSTEM I PROTEIN COMPLEX or the PHOTOSYSTEM II PROTEIN COMPLEX.Thiosulfates: Inorganic salts of thiosulfuric acid possessing the general formula R2S2O3.Bacterial Proteins: Proteins found in any species of bacterium.PhotochemistryPhotosynthesis: The synthesis by organisms of organic chemical compounds, especially carbohydrates, from carbon dioxide using energy obtained from light rather than from the oxidation of chemical compounds. Photosynthesis comprises two separate processes: the light reactions and the dark reactions. In higher plants; GREEN ALGAE; and CYANOBACTERIA; NADPH and ATP formed by the light reactions drive the dark reactions which result in the fixation of carbon dioxide. (from Oxford Dictionary of Biochemistry and Molecular Biology, 2001)Energy Transfer: The transfer of energy of a given form among different scales of motion. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed). It includes the transfer of kinetic energy and the transfer of chemical energy. The transfer of chemical energy from one molecule to another depends on proximity of molecules so it is often used as in techniques to measure distance such as the use of FORSTER RESONANCE ENERGY TRANSFER.Sulfides: Chemical groups containing the covalent sulfur bonds -S-. The sulfur atom can be bound to inorganic or organic moieties.Cytochrome c Group: A group of cytochromes with covalent thioether linkages between either or both of the vinyl side chains of protoheme and the protein. (Enzyme Nomenclature, 1992, p539)Spectrophotometry: The art or process of comparing photometrically the relative intensities of the light in different parts of the spectrum.Genes, Bacterial: The functional hereditary units of BACTERIA.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Spectrum Analysis: The measurement of the amplitude of the components of a complex waveform throughout the frequency range of the waveform. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Proton Pump Inhibitors: Compounds that inhibit H(+)-K(+)-EXCHANGING ATPASE. They are used as ANTI-ULCER AGENTS and sometimes in place of HISTAMINE H2 ANTAGONISTS for GASTROESOPHAGEAL REFLUX.Omeprazole: A 4-methoxy-3,5-dimethylpyridyl, 5-methoxybenzimidazole derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits an H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS.Proton Pumps: Integral membrane proteins that transport protons across a membrane. This transport can be linked to the hydrolysis of ADENOSINE TRIPHOSPHATE. What is referred to as proton pump inhibitors frequently is about POTASSIUM HYDROGEN ATPASE.2-Pyridinylmethylsulfinylbenzimidazoles: Compounds that contain benzimidazole joined to a 2-methylpyridine via a sulfoxide linkage. Several of the compounds in this class are ANTI-ULCER AGENTS that act by inhibiting the POTASSIUM HYDROGEN ATPASE found in the PROTON PUMP of GASTRIC PARIETAL CELLS.Anti-Ulcer Agents: Various agents with different action mechanisms used to treat or ameliorate PEPTIC ULCER or irritation of the gastrointestinal tract. This has included ANTIBIOTICS to treat HELICOBACTER INFECTIONS; HISTAMINE H2 ANTAGONISTS to reduce GASTRIC ACID secretion; and ANTACIDS for symptomatic relief.Lansoprazole: A 2,2,2-trifluoroethoxypyridyl derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS. Lansoprazole is a racemic mixture of (R)- and (S)-isomers.Histamine H2 Antagonists: Drugs that selectively bind to but do not activate histamine H2 receptors, thereby blocking the actions of histamine. Their clinically most important action is the inhibition of acid secretion in the treatment of gastrointestinal ulcers. Smooth muscle may also be affected. Some drugs in this class have strong effects in the central nervous system, but these actions are not well understood.Procollagen-Lysine, 2-Oxoglutarate 5-Dioxygenase: A mixed-function oxygenase that catalyzes the hydroxylation of peptidyllysine, usually in protocollagen, to peptidylhydroxylysine. The enzyme utilizes molecular oxygen with concomitant oxidative decarboxylation of the cosubstrate 2-oxoglutarate to succinate. EC 1.14.11.4.Tin Compounds: Inorganic compounds that contain tin as an integral part of the molecule.Chemical EngineeringDrugs, Chinese Herbal: Chinese herbal or plant extracts which are used as drugs to treat diseases or promote general well-being. The concept does not include synthesized compounds manufactured in China.Stress, Mechanical: A purely physical condition which exists within any material because of strain or deformation by external forces or by non-uniform thermal expansion; expressed quantitatively in units of force per unit area.Hydroxylysine: A hydroxylated derivative of the amino acid LYSINE that is present in certain collagens.GTP Phosphohydrolases: Enzymes that hydrolyze GTP to GDP. EC 3.6.1.-.Glucosephosphate Dehydrogenase Deficiency: A disease-producing enzyme deficiency subject to many variants, some of which cause a deficiency of GLUCOSE-6-PHOSPHATE DEHYDROGENASE activity in erythrocytes, leading to hemolytic anemia.Single-Domain Antibodies: An immunoglobulin fragment composed of one variable domain from an IMMUNOGLOBULIN HEAVY CHAIN or IMMUNOGLOBULIN LIGHT CHAIN.Guanosine Triphosphate: Guanosine 5'-(tetrahydrogen triphosphate). A guanine nucleotide containing three phosphate groups esterified to the sugar moiety.Allosteric Regulation: The modification of the reactivity of ENZYMES by the binding of effectors to sites (ALLOSTERIC SITES) on the enzymes other than the substrate BINDING SITES.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.GTP Phosphohydrolase-Linked Elongation Factors: Factors that utilize energy from the hydrolysis of GTP to GDP for peptide chain elongation. EC 3.6.1.-.Authorship: The profession of writing. Also the identity of the writer as the creator of a literary production.Sinorhizobium: A genus of gram-negative, aerobic, nonsporeforming rods which usually contain granules of poly-beta-hydroxybutyrate. (From Bergey's Manual of Determinative Bacteriology, 9th ed)Terminology as Topic: The terms, expressions, designations, or symbols used in a particular science, discipline, or specialized subject area.Click Chemistry: Organic chemistry methodology that mimics the modular nature of various biosynthetic processes. It uses highly reliable and selective reactions designed to "click" i.e., rapidly join small modular units together in high yield, without offensive byproducts. In combination with COMBINATORIAL CHEMISTRY TECHNIQUES, it is used for the synthesis of new compounds and combinatorial libraries.Students: Individuals enrolled in a school or formal educational program.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Students, Medical: Individuals enrolled in a school of medicine or a formal educational program in medicine.FloridaPhylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Bayes Theorem: A theorem in probability theory named for Thomas Bayes (1702-1761). In epidemiology, it is used to obtain the probability of disease in a group of people with some characteristic on the basis of the overall rate of that disease and of the likelihood of that characteristic in healthy and diseased individuals. The most familiar application is in clinical decision analysis where it is used for estimating the probability of a particular diagnosis given the appearance of some symptoms or test result.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Models, Genetic: Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.

On the energetics of the photosyntheses in green sulfur bacteria. (1/61)

The quantum efficiency of photosynthesis by the green sulfur bacterium, Chlorobium thiosulfatophilum, has been determined in systems in which thiosulfate, tetrathionate, and molecular hydrogen served as electron donors. It was found that about 10 +/- 1 quanta are used for the assimilation of 1 molecule of CO(2), and that the quantum number is independent of the nature of the electron donor. These results are considered as support for the view that also in the bacterial photosyntheses the primary photochemical reaction consists in the photolysis of H(2)O, and that the chemical energy released during the oxidation of the electron donor is not utilized for CO(2) assimilation. Hence the photosynthetic processes of the green sulfur bacteria are thermodynamically less efficient than is green plant photosynthesis.  (+info)

Characterization of Chlorobium tepidum chlorosomes: a calculation of bacteriochlorophyll c per chlorosome and oligomer modeling. (2/61)

The bacteriochlorophyll (Bchl) c content and organization was determined for Chlorobium (Cb.) tepidum chlorosomes, the light-harvesting complexes from green photosynthetic bacteria, using fluorescence correlation spectroscopy and atomic force microscopy. Single-chlorosome fluorescence data was analyzed in terms of the correlation of the fluorescence intensity with time. Using this technique, known as fluorescence correlation spectroscopy, chlorosomes were shown to have a hydrodynamic radius (Rh) of 25 +/- 3.2 nm. This technique was also used to determine the concentration of chlorosomes in a sample, and pigment extraction and quantitation was used to determine the molar concentration of Bchl c present. From these data, a number of approximately 215,000 +/- 80,000 Bchl c per chlorosome was determined. Homogeneity of the sample was further characterized by dynamic light scattering, giving a single population of particles with a hydrodynamic radius of 26.8 +/- 3.7 nm in the sample. Tapping-mode atomic force microscopy (TMAFM) was used to determine the x,y,z dimensions of chlorosomes present in the sample. The results of the TMAFM studies indicated that the average chlorosome dimensions for Cb. tepidum was 174 +/- 8.3 x 91.4 +/- 7.7 x 10.9 +/- 2.71 nm and an overall average volume 90,800 nm(3) for the chlorosomes was determined. The data collected from these experiments as well as a model for Bchl c aggregate dimensions was used to determine possible arrangements of Bchl c oligomers in the chlorosomes. The results obtained in this study have significant implications on chlorosome structure and architecture, and will allow a more thorough investigation of the energetics of photosynthetic light harvesting in green bacteria.  (+info)

Exciton theory for supramolecular chlorosomal aggregates: 1. Aggregate size dependence of the linear spectra. (3/61)

The interior of chlorosomes of green bacteria forms an unusual antenna system organized without proteins. The steady-spectra (absorption, circular dichroism, and linear dichroism) have been modeled using the Frenkel Hamiltonian for the large tubular aggregates of bacteriochlorophylls with geometries corresponding to those proposed for Chloroflexus aurantiacus and Chlorobium tepidum chlorosomes. For the Cf. aurantiacus aggregates we apply a structure used previously (V. I. Prokhorenko., D. B. Steensgaard, and A. R. Holzwarth, Biophys: J. 2000, 79:2105-2120), whereas for the Cb. tepidum aggregates a new extended model of double-tube aggregates, based on recently published solid-state nuclear magnetic resonance studies (B.-J. van Rossum, B. Y. van Duhl, D. B. Steensgaard, T. S. Balaban, A. R. Holzwarth, K. Schaffner, and H. J. M. de Groot, Biochemistry 2001, 40:1587-1595), is developed. We find that the circular dichroism spectra depend strongly on the aggregate length for both types of chlorosomes. Their shape changes from "type-II" (negative at short wavelengths to positive at long wavelengths) to the "mixed-type" (negative-positive-negative) in the nomenclature proposed in K. Griebenow, A. R. Holzwarth, F. van Mourik, and R. van Grondelle, Biochim: Biophys. Acta 1991, 1058:194-202, for an aggregate length of 30-40 bacteriochlorophyll molecules per stack. This "size effect" on the circular dichroism spectra is caused by appearance of macroscopic chirality due to circular distribution of the transition dipole moment of the monomers. We visualize these distributions, and also the corresponding Frenkel excitons, using a novel presentation technique. The observed size effects provide a key to explain many previously puzzling and seemingly contradictory experimental data in the literature on the circular and linear dichroism spectra of seemingly identical types of chlorosomes.  (+info)

Presence of exclusively bacteriochlorophyll-c containing substrain in the culture of green sulfur photosynthetic bacterium Chlorobium vibrioforme strain NCIB 8327 producing bacteriochlorophyll-d. (4/61)

The light-dependent composition change of light harvesting bacteriochlorophyll(BChl)s in the present culture of a green sulfur photosynthetic bacterium Chlorobium (Chl.) vibrioforme f. sp. thiosulfatophilum strain NCIB 8327 was investigated by visible absorption spectroscopy and HPLC analyses. When the culture was repeatedly grown in liquid media under a low light condition, both the Soret and Qy absorption bands of the in vivo spectrum were shifted to longer wavelengths. Analysis of the extracted pigments by HPLC revealed that the ratio of the amount of BChl-c to that of BChl-d molecules gradually increased during repeated cultivation. In contrast, when the culture grown under a low light intensity was transferred to a high light condition and continued to be grown, the absorption bands were shifted to shorter wavelengths and the ratio of BChls-c/d decreased finally to the almost original value. Colonies were prepared on solid agar media from the liquid culture containing both BChls-c and d, which was grown under a low light intensity. Each colony obtained was found to contain either BChl-c or d, but not both of them. Two types of cells isolated in this study were derived from the same clone, judged from their genetic analyses. The variation of pigment composition in our liquid culture observed here could be ascribed to the difference of growth rates between two substrains containing BChl-c and BChl-d, respectively, depending on light conditions.  (+info)

Nine mutants of Chlorobium tepidum each unable to synthesize a different chlorosome protein still assemble functional chlorosomes. (5/61)

Chlorosomes of the green sulfur bacterium Chlorobium tepidum comprise mostly bacteriochlorophyll c (BChl c), small amounts of BChl a, carotenoids, and quinones surrounded by a lipid-protein envelope. These structures contain 10 different protein species (CsmA, CsmB, CsmC, CsmD, CsmE, CsmF, CsmH, CsmI, CsmJ, and CsmX) but contain relatively little total protein compared to other photosynthetic antenna complexes. Except for CsmA, which has been suggested to bind BChl a, the functions of the chlorosome proteins are not known. Nine mutants in which a single csm gene was inactivated were created; these mutants included genes encoding all chlorosome proteins except CsmA. All mutants had BChl c contents similar to that of the wild-type strain and had growth rates indistinguishable from or within approximately 90% (CsmC(-) and CsmJ(-)) of those of the wild-type strain. Chlorosomes isolated from the mutants lacked only the protein whose gene had been inactivated and were generally similar to those from the wild-type strain with respect to size, shape, and BChl c, BChl a, and carotenoid contents. However, chlorosomes from the csmC mutant were about 25% shorter than those from the wild-type strain, and the BChl c absorbance maximum was blue-shifted about 8 nm, indicating that the structure of the BChl c aggregates in these chlorosomes is altered. The results of the present study establish that, except with CsmA, when the known chlorosome proteins are eliminated individually, none of them are essential for the biogenesis, light harvesting, or structural organization of BChl c and BChl a within the chlorosome. These results demonstrate that chlorosomes are remarkably robust structures that can tolerate considerable changes in protein composition.  (+info)

The bchU gene of Chlorobium tepidum encodes the c-20 methyltransferase in bacteriochlorophyll c biosynthesis. (6/61)

Bacteriochlorophylls (BChls) c and d, two of the major light-harvesting pigments in photosynthetic green sulfur bacteria, differ only by the presence of a methyl group at the C-20 methine bridge position in BChl c. A gene potentially encoding the C-20 methyltransferase, bchU, was identified by comparative analysis of the Chlorobium tepidum and Chloroflexus aurantiacus genome sequences. Homologs of this gene were amplified and sequenced from Chlorobium phaeobacteroides strain 1549, Chlorobium vibrioforme strain 8327d, and C. vibrioforme strain 8327c, which produce BChls e, d, and c, respectively. A single nucleotide insertion in the bchU gene of C. vibrioforme strain 8327d was found to cause a premature, in-frame stop codon and thus the formation of a truncated, nonfunctional gene product. The spontaneous mutant of this strain that produces BChl c (strain 8327c) has a second frameshift mutation that restores the correct reading frame in bchU. The bchU gene was inactivated in C. tepidum, a BChl c-producing species, and the resulting mutant produced only BChl d. Growth rate measurements showed that BChl c- and d-producing strains of the same organism (C. tepidum or C. vibrioforme) have similar growth rates at high and intermediate light intensities but that strains producing BChl c grow faster than those with BChl d at low light intensities. Thus, the bchU gene encodes the C-20 methyltransferase for BChl c biosynthesis in Chlorobium species, and methylation at the C-20 position to produce BChl c rather than BChl d confers a significant competitive advantage to green sulfur bacteria living at limiting red and near-infrared light intensities.  (+info)

Evolution of photosystem I - from symmetry through pseudo-symmetry to asymmetry. (7/61)

The evolution of photosystem (PS) I was probably initiated by the formation of a homodimeric reaction center similar to the one currently present in green bacteria. Gene duplication has generated a heterodimeric reaction center that subsequently evolved to the PSI present in cyanobacteria, algae and plant chloroplasts. During the evolution of PSI several attempts to maximize the efficiency of light harvesting took place in the various organisms. In the Chlorobiaceae, chlorosomes and FMO were added to the homodimeric reaction center. In cyanobacteria phycobilisomes and CP43' evolved to cope with the light limitations and stress conditions. The plant PSI utilizes a modular arrangement of membrane light-harvesting proteins (LHCI). We obtained structural information from the two ends of the evolutionary spectrum. Novel features in the structure of Chlorobium tepidum FMO are reported in this communication. Our structure of plant PSI reveals that the addition of subunit G provided the template for LHCI binding, and the addition of subunit H prevented the possibility of trimer formation and provided a binding site for LHCII and the onset of energy spillover from PSII to PSI.  (+info)

The impact of different intensities of green light on the bacteriochlorophyll homologue composition of the Chlorobiaceae Prosthecochloris aestuarii and Chlorobium phaeobacteroides. (8/61)

Members of the Chlorobiaceae and Chloroflexaceae are unique among the phototrophic micro-organisms in having a remarkably rich chlorophyll pigment diversity. The physiological regulation of this diversity and its ecological implications are still enigmatic. The bacteriochlorophyll composition of the chlorobiaceae Prosthecochloris aestuarii strain CE 2404 and Chlorobium phaeobacteroides strain UdG 6030 was therefore studied by both HPLC with photodiode array (PDA) detection and liquid chromatography-mass spectrometry (LC-MS). These strains were grown in liquid cultures under green light (480-615 nm) at different light intensities (0.2-55.7 micromol photons m(-2) s(-1)), simulating the irradiance regime at different depths of the water column of deep lakes. The specific growth rates of Ptc. aestuarii under green light achieved a maximum of 0.06 h(-1) at light intensities exceeding 6 micromol photons m(-2) s(-1), lower than the maximum observed under white light (approx. 0.1 h(-1)). The maximal growth rates of Chl. phaeobacteroides under green light were slightly higher (0.07 h(-1)) than observed for Ptc. aestuarii and were achieved at 3.5 and 4.3 micromol photons m(-2) s(-1). LC-MS/MS analysis of pigment extracts revealed most (>90 %) BChl c homologues of Ptc. aestuarii to be esterified with farnesol. The homologues differed in mass by multiples of 14 Da, reflecting different alkyl subsituents at positions C-8 and C-12 on the tetrapyrrole macrocycle. The relative proportions of the individual homologues varied only slightly among different light intensities. The specific content of BChl c was maximal at 3-5 micromol photons m(-2) s(-1) [400+/-150 nmol BChl c (mg protein)(-1)]. In the case of Chl. phaeobacteroides, the specific content of BChl e was maximal at 4.3 micromol photons m(-2) s(-1) [115 nmol BChl e (mg protein)(-1)], and this species was characterized by high carotenoid (isorenieratene) contents. The major BChl e forms were esterified with a range of isoprenoid and straight-chain alcohols. The major isoprenoid alcohols comprised mainly farnesol and to a lesser extent geranylgeraniol. The straight-chain alcohols included C(15), C(15 : 1), C(16), C(16 : 1) and C(17). Interestingly, the proportion of straight alkyl chains over isoprenoid esterified side chains shifted markedly with increasing light intensity: the isoprenoid side chains dominated at low light intensities, while the straight-chain alkyl substituents dominated at higher light intensities. The authors propose that this phenomenon may be explained as a result of changing availability of reducing power, i.e. the highly reduced straight-chain alcohols have a higher biosynthetic demand for NADPH(2) than the polyunsaturated isoprenoid with the same number of carbon atoms.  (+info)

The Yellowstone National Park Research Coordination Network is a collaboration of scientists and NPS staff to develop a coordinated research network focused on geothermal biology and geochemistry.
The Yellowstone National Park Research Coordination Network is a collaboration of scientists and NPS staff to develop a coordinated research network focused on geothermal biology and geochemistry.
Photophosphorylation in vivo by Chlorobium limicola was inhibited by lipophilic cations and the energy-transfer inhibitors diphenylphosphorylazide, Dio-9, 4-chloro-7-nitrobenzofurazan and chlorhexidene. Membrane-bound ATPase activity was also inhibited by these energy-transfer inhibitors. The formation of a membrane potential was stimulated approximately 1.7-fold on illumination, rising to a value between −110 and −150 mV. The sensitivity of the processes producing this membrane potential to uncouplers, energy-transfer inhibitors and 2-heptyl-4-hydroxyquinoline-N-oxide was measured in the light and the dark.
A Chlorosome is a photosynthetic antenna complex found in green sulfur bacteria (GSB) and some green filamentous anoxygenic phototrophs (FAP) (Chloroflexaceae, Oscillochloridaceae). They differ from other antenna complexes by their large size and lack of protein matrix supporting the photosynthetic pigments. Green sulfur bacteria are a group of organisms that generally live in extremely low-light environments, such as at depths of 100 metres in the Black Sea. The ability to capture light energy and rapidly deliver it to where it needs to go is essential to these bacteria, some of which see only a few photons of light per chlorophyll per day. To achieve this, the bacteria contain chlorosome structures, which contain up to 250,000 chlorophyll molecules. Chlorosomes are ellipsoidal bodies, in GSB their length varies from 100 to 200 nm, width of 50-100 nm and height of 15 - 30 nm, in FAP the chlorosomes are somewhat smaller. Chlorosome shape can vary between species, with some species containing ...
Ras of complex proteins (Roc) is a Ras-like GTP binding domain that always occurs in tandem with the C-terminal of Roc (COR) domain, and is found in bacteria, plants and animals. Recently, it has been shown that Roco proteins belong to the family of G-proteins activated by nucleotide-dependent dimerization (GADs). We investigated the RocCOR tandem from the bacteria Chlorobium tepidum with site-directed spin labeling and pulse EPR distance measurements to follow conformational changes during the Roco G-protein cycle. Our results confirm that the COR domains are a stable dimerization device serving as a scaffold for the Roc domains, that in contrast are structurally heterogeneous and dynamic entities. Contrary to other GAD proteins, we observed only minor structural alterations upon binding and hydrolysis of GTP, indicating significant mechanistic variations within this protein class. Mutations in the most prominent member of the Roco family of proteins, leucine-rich repeat kinase 2 (LRRK2), are ...
1)Washington University in St. Louis. "Taco Shell Protein: Orientation Of Antenna Protein In Photosynthetic Bacteria Described." ScienceDaily 9 April 2009. 12 April 2009 ,http://www.sciencedaily.com¬ /releases/2009/04/090402171438.htm,. ( 2)D.A. Bryant & N.-U. Frigaard (November 2006). "Prokaryotic photosynthesis and phototrophy illuminated". Trends Microbiol. 14 (11): 488. doi:10.1016/j.tim.2006.09.001 (3)Beatty, J.T.; Overmann, J.; Lince, M.T.; Mansket, A.K.; Lang, A.S.; Blankenship, R.E.; Van Dover, C.L.; Martinson, T.A.; Plumley, F.G. " An obligately photosynthetic bacterial anaerobe from a deep-sea hydrothermal vent". PNAS June 28, 2005 vol. 102 no. 26 9306-9310 (4)Li YF, Zhou W, Blankenship RE, Allen JP (1997) Crystal structure of the bacteriochlorophyll a protein from Chlorobium tepidum. J Mol Biol 271:456-471. (5)Olson, J. M. (1978). Bacteriochlorophyll a-proteins from green bacteria. In The Photosynthetic Bacteria (Clayton, R. K. & Sistrom, W. R., eds), pp. 161± 178, Plenum Press, ...
Graphical view by InterProScan indicates a graphical display of the arrangment of the predicted domains by InterProScan.. show/hide icon is a toggle switch to show or hide the graphical display.. PNG icon indicates the link of the PNG file of the graphical display. Table view by InterProScan indicates the summary table of the InterProScan prediction. Each InterPro ID indicates the link to the InterPro entry. [S] links to the list of genes which predicted the InterPro ID (Chlorobium species-wise prediction). [D] links to the list of genes which predicted the InterPro ID (cyanobase dataset-wise prediction). GO terms indicate the link to the GO entry. show/hide icon is a toggle switchto show or hide the table.. TableView icon indicates the link of the table page.. GFF3 icon indicates the link of the GFF file of the InterProScan prediction. Transmembrane regions predicted by SOSUI indicates the SOSUI predicted regions. Go SOSUI bottun link to the SOSUI prediction. ...
Ubiquinone (UQ), also called coenzyme Q, and plastoquinone (PQ) are electron carriers in oxidative phosphorylation and photosynthesis, respectively. The quinoid nucleus of ubiquinone is derived from the shikimate pathway; 4-hydroxybenzoate is directly formed from chorismate in bacteria, while it can be formed from either chorismate or tyrosine in yeast. The following biosynthesis of terpenoid moiety involves reactions of prenylation, decarboxylation, and three hydroxylations alternating with three methylations. The order of these reactions are somewhat different between bacteria and yeast. Phylloquinone (vitamin K1), menaquinone (vitamin K2), and tocopherol (vitamin E) are fat-soluble vitamins. Phylloquinone is a compound present in all photosynthetic plants serving as a cofactor for photosystem I-mediated electron transport. Menaquinone is an obligatory component of the electron-transfer pathway in bacteria ...
Mouse polyclonal antibody raised against a full-length human PSCD3 protein. PSCD3 (NP_004218.1, 1 a.a. ~ 399 a.a) full-length human protein. (H00009265-B01) - Products - Abnova
Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis.
Nuclease that resolves Holliday junction intermediates in genetic recombination. Cleaves the cruciform structure in supercoiled DNA by nicking to strands with the same polarity at sites symmetrically opposed at the junction in the homologous arms and leaves a 5-terminal phosphate and a 3-terminal hydroxyl group.
The green sulfur bacteria are a family of obligately anaerobic photoautotrophic bacteria. Most closely related to the distant Bacteroidetes, they are accordingly assigned their own phylum.[1] Green sulfur bacteria are nonmotile (except Chloroherpeton thalassium, which may glide)[1] and occur in spheres, rods, and spirals.[citation needed] Photosynthesis is achieved using a Type 2[citation needed] Reaction Centre using bacteriochlorophyll (BChl) a and in chlorosomes which employ BChl c, d, or e; in addition chlorophyll a is also present,.[1] They use sulfide ions, hydrogen or ferrous iron as an electron donor and the process is mediated by the type I reaction centre and Fenna-Matthews-Olson complex. Elemental sulfur deposited outside the cell may be further oxidized. By contrast, the photosynthesis in plants uses water as the electron donor and produces oxygen.[1] Chlorobium tepidum has emerged as a model organism for the group; although only 10 genomes have been sequenced, these are quite ...
BrunchClust produces 7 clusters: two complete for ATP-A and ATP-B and one incomplete for ATP-F. ATP-A and ATP-B clusters contain paralogs that are also reported as a result of clustering. There are two paralogs on the ATP-A branch one is of Rhodopirellula baltica and the second is of Methanosarcina acetivorans, and there are three paralogs on the ATP-B branch: two are from the same species as those on the ATP-A branch, i.e. Rhodopirellula baltica and Methanosarcina acetivoran, and the third is from Chlorobium tepidum. List of 30 taxa: 16 Bacteria: Aquifex aeolicus, Bacillus subtilis, Chlorobium tepidum, Corynebacterium glutamicum, Deinococcus radiodurans, Geobacillus kaustophilus, Geobacter sulfurreducens, Gloeobacter violaceus, Nostoc sp., Pseudomonas aeruginosa, Rhodopirellula baltica, Rhodopseudomonas palustris, Streptococcus thermophilus, Streptomyces coelicolor, Thermotoga maritime, Thermus thermophilus, and 14 Archaea: Aeropyrum pernix,Archaeoglobus fulgidus,Haloarcula marismortui, ...
ID B3EM59_CHLPB Unreviewed; 996 AA. AC B3EM59; DT 22-JUL-2008, integrated into UniProtKB/TrEMBL. DT 22-JUL-2008, sequence version 1. DT 20-DEC-2017, entry version 67. DE SubName: Full=FAD-dependent pyridine nucleotide-disulphide oxidoreductase {ECO:0000313,EMBL:ACE03437.1}; GN OrderedLocusNames=Cphamn1_0473 {ECO:0000313,EMBL:ACE03437.1}; OS Chlorobium phaeobacteroides (strain BS1). OC Bacteria; Chlorobi; Chlorobia; Chlorobiales; Chlorobiaceae; OC Chlorobium/Pelodictyon group; Chlorobium. OX NCBI_TaxID=331678 {ECO:0000313,EMBL:ACE03437.1, ECO:0000313,Proteomes:UP000001228}; RN [1] {ECO:0000313,EMBL:ACE03437.1, ECO:0000313,Proteomes:UP000001228} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=BS1 {ECO:0000313,EMBL:ACE03437.1, RC ECO:0000313,Proteomes:UP000001228}; RG US DOE Joint Genome Institute; RA Lucas S., Copeland A., Lapidus A., Glavina del Rio T., Dalin E., RA Tice H., Bruce D., Goodwin L., Pitluck S., Schmutz J., Larimer F., RA Land M., Hauser L., Kyrpides N., Ovchinnikova G., ...
Green photosynthetic bacteria adjust the structure and functionality of the chlorosome - the light absorbing antenna complex - in response to environmental stress factors. The chlorosome is a natural self-assembled aggregate of bacteriochlorophyll (BChl) molecules. In this study we report the regulation of the biogenesis of the Chlorobaculum tepidum chlorosome by carbon assimilation in conjunction with temperature changes. Our studies indicate that the carbon source and thermal stress culture of Cba. tepidum grows slower and incorporates less BChl c in the chlorosome. Compared with the chlorosome from other cultural conditions we investigated, the chlorosome from the carbon source and thermal stress culture displays: (a) smaller cross-sectional radius and overall size; (b) simplified BChl c homologues with smaller side chains; (c) blue-shifted Qy absorption maxima and (d) a sigmoid-shaped circular dichroism (CD) spectra. Using a theoretical model we analyze how the observed spectral ...
This domain of about 175 to 200 amino acids is found, in from one to five copies, in over 50 proteins in Fibrobacter succinogenes S85, an obligate anaerobe of the rumen. Many members of this family have an apparent lipoprotein signal sequence. Conserved cysteine residues, suggestive of disulfide bond formation, are also consistent with an extracytoplasmic location for this domain. This domain can also be found in small numbers of proteins in Chlorobium tepidum and Bacteroides thetaiotaomicron ...
Planning a kids party? Look no further than GigMasters to find and book the best local kids party entertainers and vendors in Green Sulphur Springs, WV. Get started today!
Discover Lifes page about the biology, natural history, ecology, identification and distribution of Colias nastes - Artic Green Sulfur -- Discover Life mobile
Local Green Sulphur Springs West Virginia moving companies offer moving labor service including load and unload help. Hire best movers and helpers after comparing rates and reviews in your area.
Fossilized organic molecules of green sulfur bacteria are helping to u...The fossils were found in sedimentary rock commonly used to make ho...The findings are reported in the May issue of the journal Geology (...Kenig and his colleagues have spent almost 15 years trying to le... It should have been one or the other said Kenig. You cant have...,Seabed,secrets,in,English,clay,biological,biology news articles,biology news today,latest biology news,current biology news,biology newsletters
Technology Networks is an internationally recognised publisher that provides access to the latest scientific news, products, research, videos and posters.
Microtubules (MTs) are filamentous structures found throughout the cytoplasm of eukaryotic cells. They are polymers of tubulin that are involved in maintaining the structural integrity and plasticity of cells as well as the internal structures of cilia and flagella. Microtubules are also essential in several key cellular processes such as cell division and intracellular transport.. Proteins that accumulate at the ends of growing microtubules, known as MT plus end-tracking proteins, play an important role in regulating the dynamics and organization of the organelle. The SLAIN2 gene encodes one such MT plus end-tracking protein. This protein is targeted to microtubule tips by interacting with End-Binding proteins through its C-terminal domain. It is involved in cytoplasmic microtubule organization and nucleation. Through its N-terminal domain, it binds with the polymerase ch-TOG, recruiting it to the microtubule plus ends and thus ensuring microtubule elongation. ...
Niebla limicola is a fruticose lichen that grows on barren mud flats and on sand among salt scrub along the Pacific Coast of the Vizcaíno Desert, of Baja California from San Vicente Canyon to Scammons Lagoon (Guerrero Negro). The epithet, limicola is in reference to the thallus growing on barren (alkali) soil. Niebla limicola is distinguished by a hemispherical thallus lying loose on soil without a central holdfast (terricolous), divided into variously shaped branches, partly narrow in length and prismatic in cross section, and partly flattened and dilated from which short acicular bifurcating branchlets arise, the thallus up to 10 cm high and 15 cm across. The species (N. limicola) also recognized by containing salazinic acid (without triterpenes), and by a relatively thin cortex, (0-)45-75 µm thick, appearing to erode on dilated parts of branches; the thinner cortex evidently related to the contorted appearance of the branches in addition to the medulla being partly hollow (fistulose). The ...
Natural photosynthetic pigments bacteriochlorophyllsc, d and e in green bacteria undergo self-assembly to create an organized antenna system known as the chlorosome, which collects photons and funnels the resulting excitation energy toward the reaction centers. Mimicry of chlorosome function is a central pro
Chappaz-Gillot, Cyril; Marek, Peter L.; Blaive, Bruno J.; Canard, Gabriel; Bürck, Jochen; Garab, Győző; Hahn, Horst; Jávorfi, Tamás; Kelemen, Loránd; Krupke, Ralph; Mössinger, Dennis; Ormos, Pál; Reddy, Chilla Malla; Roussel, Christian; Steinbach, Gábor; Szabó, Milán; Ulrich, Anne S.; Vanthuyne, Nicolas; Vijayaraghavan, Aravind; Zupcanova, Anita; ... mehrBalaban, Teodor Silviu ...
Expression of CYTH3 (ARNO3, cytohesin-3, GRP1, PSCD3) in spleen tissue. Antibody staining with HPA013979 in immunohistochemistry.
Fleming has compared 2-D electronic spectroscopy to the technique used in the early super-heterodyne radios, where an incoming high frequency radio signal was converted by an oscillator to a lower frequency for more controllable amplification and better reception. In the case of 2-D electronic spectroscopy, scientists can track the transfer of energy between molecules that are coupled (connected) through their electronic and vibrational states in any photoactive system, macromolecular assembly or nanostructure.. Fleming and his group first described 2-D electronic spectroscopy in a 2005 Nature paper, when they used the technique to observe electronic couplings in the Fenna-Matthews-Olson (FMO) photosynthetic light-harvesting protein, a molecular complex in green sulphur bacteria. Said Engel, "The 2005 paper was the first biological application of this technique, now we have used 2-D electronic spectroscopy to discover a new phenomenon in photosynthetic systems. While the possibility that ...
Photic zone euxinia (PZE) has proven important for elucidating biogeochemical changes that occur during oceanic anoxic events, including mass extinction and conditions associated with unique fossil preservation. Organic geochemical analyses of a 380 Ma invertebrate fossil, which included well-preserved soft tissues, from the Gogo Formation (Canning Basin, Western Australia) showed biomarkers and stable isotopic values characteristic of PZE and a consortium of sulfate-reducing bacteria, which lead to exceptional fossil and biomarker preservation. The carbonate concretion contained phytoplankton, green sulfur bacteria (Chlorobi), and sulfate-reducing bacteria biomarkers with an increasing concentration toward the nucleus where the fossil is preserved. The spatial distribution of cholestane unequivocally associated with the fossilized tissue and its high relative abundance to the total steranes suggest that the fossil is a crustacean. The presence of an active sulfur cycle in this Devonian system, ...
Download this Research On The Green Bacteria photo now. And search more of the webs best library of royalty-free stock images from iStock.
TY - JOUR. T1 - Anisotropic organization and microscopic manipulation of self-assembling synthetic porphyrin microrods that mimic chlorosomes. T2 - Bacterial light-harvesting systems. AU - Chappaz-Gillot, Cyril. AU - Marek, Peter L.. AU - Blaive, Bruno J.. AU - Canard, Gabriel. AU - Bürck, Jochen. AU - Garab, G.. AU - Hahn, Horst. AU - Jávorfi, Tamás. AU - Kelemen, L.. AU - Krupke, Ralph. AU - Mössinger, Dennis. AU - Ormos, P.. AU - Reddy, Chilla Malla. AU - Roussel, Christian. AU - Steinbach, Gábor. AU - Szabó, Milán. AU - Ulrich, Anne S.. AU - Vanthuyne, Nicolas. AU - Vijayaraghavan, Aravind. AU - Zupcanova, Anita. AU - Balaban, Teodor Silviu. PY - 2012/1/18. Y1 - 2012/1/18. N2 - Being able to control in time and space the positioning, orientation, movement, and sense of rotation of nano- to microscale objects is currently an active research area in nanoscience, having diverse nanotechnological applications. In this paper, we demonstrate unprecedented control and maneuvering of ...
The protein is actually located in chlorosome. Transfer energy was calculated with hetero-atoms. This is solid state NMR model ...
Absorption spectra of BChl a-associated proteins from various C. tepidum strains recovered by Ni2+-affinity purification.Absorption spectra (traces 1-6) of BChl
Free flashcards to help memorize facts about Drugs. Other activities to help include hangman, crossword, word scramble, games, matching, quizes, and tests.
SPR Deficiency is caused by mutations in the SPR gene. The SPR gene provides instructions for making the enzyme sepiapterin reductase. Specifically, sepiapterin reductase is responsible for the last step in the production of tetrahydrobiopterin. Most SPR gene mutations result in an enzyme with little or no function.. A nonfunctional sepiapterin reductase gene leads to a lack of tetrahydrobiopterin which causes a disruption in neurotransmitter metabolism. SPR Deficiency is due to an autosomal recessive inheritance. In this type of inheritance pattern there are two mutated copies of the gene that causes the disorder. A person with SPR deficiency usually has unaffected parents (no symptoms) who each carry a single copy of the mutated gene and are referred to as carriers.. Autosomal recessive disorders are typically not seen in every generation of an affected family. When two people who are carriers of an autosomal recessive condition have a child, there is a 25% (1 in 4) chance that the child will ...
Primary photochemistry in the facultatively aerobic green photosynthetic bacterium Chloroflexus aurantiacus: Photochemical activity was examined in membrane fra
said Pennsylvania State University Professor Donald Bryant, one of the teams leaders. Bryant said green bacteria are a group of organisms that generally live in extremely low-light environments, such as in light-deprived regions of hot springs and at depths of about 325 feet in the Black Sea.. The bacteria contain structures called chlorosomes, which contain up to 250,000 chlorophylls.. ...
Personal Recommendations: A recommendation from someone that just recently worked with a wedding celebration professional photographer is a great start. Who would recognize far better about discover the very best than an individual that employed one.. Google And Other Online search engine:. A quick search on any one of the major internet search engine will certainly produce a mind numbing quantity of options. For example, if you type into Google the search terms "Wedding celebration Digital photographer" it will return millions outcomes. Just undergoing each result would certainly take you years, so as a general rule of thumb, stick with those on page 1 or web page 2. The reason for this is basic: If they are on web page 1 or 2 then they have actually made the effort to make sure that their site is well developed, maximized as well as placed, to guarantee that their products or services are simple to find for possible Couple.. Picking A Professional photographer. As quickly as you have selected ...
SPR antibody [N2C3] (sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)) for ICC/IF, IHC-P, IP, WB. Anti-SPR pAb (GTX113552) is tested in Human, Mouse samples. 100% Ab-Assurance.
Furthermore, the black streak under the eye is also seen on the face of many species that the cheetah preys upon. According to the cheetah section in "Wild Cats of the World" by Mel and Fiona Sunquist, 91% of cheetah kills in the Serengeti are Thomsons gazelle. In Kruger National Park, 68% of kills were the impala, and in other areas such as Botswana, springbok are an important part of the diet as well. 73.9% of the kills made by cheetahs in Nairobi National Park were Thomsons gazelle, Grants gazelle, and impala. As you can see in the pictures below, all of these antelope have that black streak under their eyes, though it is less pronounced in the Grants gazelle and impala than it is in the Thomsons gazelle. One of the biggest reasons for markings on an animal that dont aid in camouflage or sexual selection (i.e. differences between male and female that are used to attract a mate) is to help with species differentiation, so that they dont waste valuable time and resources attempting to ...
My mom has emphysema. I just found her after not seeing her for 5 years, and she is extremely sick. Im worried about her, and I have no idea what to think of her, or what to do. She is about 40 years old, and she weighs about 95 pounds. She is tinier than I am and I weigh 105. She has lung diseases, and liver failure, and kidney failure. Her mom is dying, and Im scared that my mom isnt going to make it to my graduation. It is really important to me for her to be there, and is there any information I can get or advice you can give me on what to do, or whats going to happen??ThanksI discovered this after years of no hope and being in the hospital on a yearly basis. I dont know where you are but surley there must be the same treatment elsewhere. good luckhttp://www.csmc.edu/5868. ...
Grieni Schwäfelbakterie (z. B. Chlorobium) bzw. au Heliobacteriaceae (Heliobacterium) hän e Reakzionszäntrum vum Typ I. Bi dr ...
class Chlorobia from Chlorobium. *phylum Verrucomicrobia vs. class Verrucomicrobiae from Verrucomicrobium (anomalous class name ...
Chlorobium tepidum and proteobacteria): implications regarding the origin of photosynthesis". Molecular Microbiology. 32 (5): ...
Green sulfur bacteria (Chlorobium, Chloroherpeton). *Bacteroides, Flavobacteria and relatives *Bacteroides (Bacteroides, ...
Green sulfur bacteria (Chlorobium, Chloroherpeton). *Bacteroides, Flavobacteria and relatives (later renamed Bacteroidetes * ...
1991; Chlorobium tepidum Wahlund et al. 1996]. *Species C. thiosulfatiphilum Imhoff 2003 ["Chlorobium limicola f. sp. ... Genus Chlorobium Nadson 1906 emend. Imhoff 2003 *Species Chlorobium chlorovibrioides[notes 2](Gorlenko et al. 1974) Imhoff 2003 ... Chlorobium tepidum, a member of green sulfur bacteria was found to be mixotroph due to its ability to use inorganic and organic ... 2006 (epibiont of the phototrophic consortium Chlorochromatium aggregatum) ["Chlorobium chlorochromatii" Meschner 1957] ...
Kim W, Tabita FR (September 2006). "Both subunits of ATP-citrate lyase from Chlorobium tepidum contribute to catalytic activity ...
Kusai, K.; Yamanaka, T. (1973). "The oxidation mechanisms of thiosulphate and sulphide in Chlorobium thiosulphatophilum: roles ...
Fenna RE, Matthews BW (1975). "Chlorophyll arrangement in a bacteriochlorophyll protein from Chlorobium limicola". Nature. 258 ...
Family Chlorobiaceae Genus Chlorobium Genus Ancalochloris Genus Chloroherpeton Genus Clathrochloris Genus Pelodictyon Genus ...
Chlorobium tepidum) enzyme catalyses the final step in the de novo synthesis of tetrahydrobiopterin from GTP. Cho, S.H.; Na, J. ... crystallization and preliminary X-ray analysis of sepiapterin reductase from Chlorobium tepidum". Acta Crystallogr. Sect. F ... "Sepiapterin reductase producing L-threo-dihydrobiopterin from Chlorobium tepidum". Biochem. J. 340: 497-503. doi:10.1042/0264- ...
Examples of phototroph organims: Rhodobacter capsulatus, Chromatium, Chlorobium etc. Originally used with a different meaning, ...
Buchanan and Arnon who were working with the anoxygenic photosynthetic green sulfur bacterium that they called Chlorobium ...
... the dominant species identified were Chlorobium vibrioforme and Chlorobium limicola. Thiocapsa roseopersicina and ... In the anoxic water zone (temperature range of −5 °C (23 °F) to −2.2 °C (28.0 °F)) of the lake, Chlorobium spp. and T. ... The dominance of the species Chlorobium spp. was attributed to "more efficient maintenance metabolism in winter and of their ... Other dominant varieties of bacteria found are Chlorobium vibrioforme and C. limicola. The minor species identified are ...
Chlorobium MeSH B03.440.425.410.290 --- Chromatium MeSH B03.440.425.410.350 --- Desulfovibrio MeSH B03.440.425.410.350.040 --- ...
Chlorobium tepidum TLS and Pelodictyon phaeoclathratiforme BU-1". BMC Research Notes. 8 (565). doi:10.1186/s13104-015-1535-8 . ...
July 2002). "The complete genome sequence of Chlorobium tepidum TLS, a photosynthetic, anaerobic, green-sulfur bacterium". Proc ...
These two gradients promote the growth of different microorganisms such as Clostridium, Desulfovibrio, Chlorobium, Chromatium, ...
... is produced by green sulfur bacteria (Chlorobium) which perform photosynthesis using hydrogen sulfide rather ...
Chlorobium and Rhizobial species). The proteins are of about 480 aas with 12-14 putative TMSs. An open reading frame (ORF) from ...
Some PPases from Anaerostipes caccae, Chlorobium limicola, Clostridium tetani, and Desulfuromonas acetoxidans have been ...
... contains a genome that contains 2.15 Mbp. There are a total of 2,337 genes (of these genes, there are 2,245 ... Chlorobium tepidum is an anaerobic, thermophilic green sulfur bacteria first isolated from New Zealand. Cells are gram-negative ... Frigaard NU, Voigt GD, Bryant DA (June 2002). "Chlorobium tepidum mutant lacking bacteriochlorophyll c made by inactivation of ... July 2002). "The complete genome sequence of Chlorobium tepidum TLS, a photosynthetic, anaerobic, green-sulfur bacterium". ...
... , originally known as Chlorobium aggregatum, is a symbiotic green sulfur bacteria that performs ... "Chlorobium chlorochromatii sp. nov., a symbiotic green sulfur baterium isolated from the phototrophic consortium "Chlorobium ... "Summary of Chlorobium chlorochromatii". Summary of Chlorobium chlorochromatii, Strain CaD3, version 17.5. Chapin, B., ... Chlorobium chlorochromatii prefer environments with low temperature and low sulfur concentrations. Chlorobium chlorochromatii, ...
Chlorobiaceae Chlorobium limicola Chlorobium phaeobacteroides Chlorobium phaeovibrioides Chlorobium vibrioforme Chlorobium ...
2002). "The complete genome sequence of Chlorobium tepidum TLS, a photosynthetic, anaerobic, green-sulfur bacterium". Proc. ...
Of these 65 proteins, 8 are found only in Chlorobium luteolum and Chlorobium phaeovibrioides. These two species form a strongly ... Chlorobium species are thought to have played an important part in mass extinction events on Earth. If the oceans turn anoxic ( ... Chlorobium species exhibit a dark green color; in a Winogradsky column, the green layer often observed is composed of ... Chlorobium (also known as Chlorochromatium) is a genus of green sulfur bacteria. They are photolithotrophic oxidizers of sulfur ...
ABL65204) and Chlorobium parvum (accession no. ACF11246). The amino acids are numbered on the right side. Identical amino acid ... from Lactococcus strain 20-92 and methylmalonyl-CoA epimerases from Chlorobium phaeobacteroides (GenBank/EMBL/DDBJ accession no ...
Cytophaga-Chlorobium, and Planctomycetes, are characterized by three distinct inserts, namely a Sandwich Barrel Hybrid Motif ...
Looking for online definition of chlorofluorocarbons in the Medical Dictionary? chlorofluorocarbons explanation free. What is chlorofluorocarbons? Meaning of chlorofluorocarbons medical term. What does chlorofluorocarbons mean?
Membranes of the green sulfur bacterium, Chlorobium limicola f. thiosulfatophilum, catalyze the reduction of externally added… ...
Chlorobium_limicola_DSM_245′:0.051253,Chlorobium_phaeobacteroides_DSM_266′:0.062034):0.016101):0.038256):0.042465,Chlorobium_ ... Chlorobium_tepidum_TLS:0.032082,Chlorobaculum_parvum_NCIB_8327′:0.032712):0.058237,(((Prosthecochloris_vibrioformis_DSM_265 ... 0.059493,Pelodictyon_luteolum_DSM_273′:0.0478):0.035359,Chlorobium_chlorochromatii_CaD3:0.105899):0.014378,( ...
Chlorobium phaeobacteroides DSM 266, complete genome. DEAD/DEAH box helicase domain protein. 2e-11. 72. ...
Chlorobium limicola Clim_1229 - PFAM: ferredoxin-dependent glutamate synthase; Rieske [2Fe-2S] domain protein; KEGG: jan:Jann_ ... Chlorobium phaeobacteroides BS1 ACE05219.1 - PFAM: ferredoxin-dependent glutamate synthase; Rieske [2Fe-2S] domain protein; ...
chlorobium chlorophyll. *Chlorobium ferrooxidans. *chlorobrightism. *chlorobromide. *chlorobromide paper. *Chlorobromo-Methane ...
Chlo.tepid Chlorobium tepidum TLS [fig,194439.1.rna.54] CTTACAACGGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAACACATG ...
Chlorobium tepidum TLS, complete genome. glucose-inhibited division protein A. 4e-134. 479. ...
Chlorobaculum parvum (strain NCIB 8327) (Chlorobium vibrioforme subspthiosulfatophilum (strain DSM 263 / NCIB 8327)) ... B3QL60 (CINAL_CHLP8) Chlorobaculum parvum (strain NCIB 8327) (Chlorobium vibrioforme subspthiosulfatophilum (strain DSM 263 / ...
Chlorobium]] ,- , Chemoautotrophs , ,- , [[Bacteria]] , [[Thiobacillus]] ,- , , [[Thiosphaera]] , ,- , , [[Thiothrix ...
Electromagnetic study of the chlorosome antenna complex of Chlorobium tepidum.. omeprazole vs nexium vs dexilant generic ...
Ivanovsky RN, Sintov NV, Kondratieva EN: ATP-linked citrate lyase activity in the green sulfur bacterium Chlorobium limicola ...
Chlorobium phaeobacteroides BS1. 1. 1. No Yes Bacteroides xylanisolvens XB1A. 1. 1. ...
B3EDF1 (PANB_CHLL2) Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330). 3-methyl-2-oxobutanoate hydroxymethyltransferase ...
Chlorobium. Chlorobium. Chlorobium. Chloroflexi. Chloroflexi. Chloroflexi. Chloroflexus. Chloroflexus. Chloroflexus. ...
No activity of carboanhydrase was detected in Ectothiorhodospira shaposhnikovii and Chlorobium limicola, probably because Chl. ...
PCC6803 shows similarity in sequence to a lycopene cyclase gene-CruA from Chlorobium tepidum. To test, whether sll0659 encoded ... Bacterial Proteins/genetics , Base Sequence , Cell Division/genetics , Chlorobium/enzymology , Chromatography, High Pressure ...
CIRCULAR DICHROISM AND ABSORPTION SPECTRA OF BACTERIOCHLOROPHYLL PROTEIN AND REACTION CENTER COMPLEXES FROM CHLOROBIUM ...
... the geranylgeranyl group and photosynthetic competence in the CT2256-deleted mutant of the green sulfur bacterium Chlorobium ...
MnmE (Chlorobium tepidum) * MnmE (Nostoc sp.) Copyright © Genesilico - All rights reserved If you have any advice or ...
Amino acid sequence of a ferredoxin from Chlorobium thiosulfatophilum strain Tassajara, a photosynthetic green sulfur bacterium ...
The b-type cytochrome in Chlorobium has an alpha-band maximum at 564 nm and an apparent midpoint oxidation-reduction potential ...
Chlorobium ferredoxin was the only iron-sulfur protein detected in the soluble fraction; no high-potential iron-sulfur protein ... A transcription unit for the Rieske FeS-protein and cytochrome b in Chlorobium limicola. (opens in new tab) ... A possible role for the latter iron-sulfur protein in the primary photochemical reaction in Chlorobium is considered. ... The iron-sulfur proteins of the green photosynthetic bacterium Chlorobium have been characterized by oxidation-reduction ...
  • In the new studies, the researchers explore the possibility of enhancing electricity production in MFCs by examining the function of light-responsive Chlorobium, a photosynthetic green sulfur bacterium. (isssource.com)
  • The iron-sulfur proteins of the green photosynthetic bacterium Chlorobium have been characterized by oxidation-reduction potentiometry in conjunction with low-temperature electron paramagnetic resonance spectroscopy. (meta.org)
  • A light-sensitive green sulfur bacterium Chlorobium can act in tandem with Geobacter, an anode respiring bacterium and the result is a light-responsive form of electricity generation. (isssource.com)
  • The group detected the presence of Chlorobium in the enrichment cultures using pyrosequencing and reasoned the observed negative light responsiveness was either due to photosynthetic Chlorobium directly transferring electrons to the anode during dark phases or instead, transferring these electrons to a non-photosynthetic anode respiring bacterium like Geobacter, through an intermediary reaction. (isssource.com)
  • A possible role for the latter iron-sulfur protein in the primary photochemical reaction in Chlorobium is considered. (meta.org)
  • The experimental results of the co-culture study suggest the following scenario: Chlorobium bacteria gather energy from light in order to fix carbon dioxide and fuel their metabolism. (isssource.com)
  • Using the genetic information available, strains and species assigned to the genera Chlorobium , Pelodictyon and Prosthecochloris are considered, and the following changes are proposed. (microbiologyresearch.org)
  • Chlorobium ferrooxidans, which cannot grow on sulfide but grows on Fe2+, has apparently lost all genes involved in oxidation of sulfur compounds other than sqr. (alpfmedical.info)
  • During periods of darkness, anode respiring Geobacter gains electrons from the acetate produced through Chlorobium metabolism, transferring them to the MPC anode, thereby producing the observed rise in electrical current. (isssource.com)