Chloride-Bicarbonate Antiporters: Electroneutral chloride bicarbonate exchangers that allow the exchange of BICARBONATE IONS exchange for CHLORIDE IONS across the cellular membrane. The action of specific antiporters in this class serve important functions such as allowing the efficient exchange of bicarbonate across red blood cell membranes as they passage through capillaries and the reabsorption of bicarbonate ions by the kidney.Bicarbonates: Inorganic salts that contain the -HCO3 radical. They are an important factor in determining the pH of the blood and the concentration of bicarbonate ions is regulated by the kidney. Levels in the blood are an index of the alkali reserve or buffering capacity.Antiporters: Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.SLC4A Proteins: Bicarbonate transporters that move BICARBONATE IONS in exchange of CHLORIDE IONS or SODIUM IONS across membranes. They regulate acid-base HOMEOSTASIS, cell volume and intracellular pH. Members include CHLORIDE-BICARBONATE ANTIPORTERS (SLC4A1, 2, 3, and 9); SODIUM-COUPLED BICARBONATE TRANSPORTERS (SLC4A4 and 5, 7, 8 and 10); and a sodium borate cotransporter (SLC4A11 protein).Chlorides: Inorganic compounds derived from hydrochloric acid that contain the Cl- ion.Anion Exchange Protein 1, Erythrocyte: A major integral transmembrane protein of the ERYTHROCYTE MEMBRANE. It is the anion exchanger responsible for electroneutral transporting in CHLORIDE IONS in exchange of BICARBONATE IONS allowing CO2 uptake and transport from tissues to lungs by the red blood cells. Genetic mutations that result in a loss of the protein function have been associated with type 4 HEREDITARY SPHEROCYTOSIS.Anion Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of negatively charged molecules (anions) across a biological membrane.Sodium Bicarbonate: A white, crystalline powder that is commonly used as a pH buffering agent, an electrolyte replenisher, systemic alkalizer and in topical cleansing solutions.Potassium-Hydrogen Antiporters: Membrane proteins that allow the exchange of hydrogen ions for potassium ions across the cellular membrane. The action of these antiporters influences intracellular pH and potassium ion homeostasis.Hydrogen-Ion Concentration: The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Sodium-Hydrogen Antiporter: A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.Chloride Channels: Cell membrane glycoproteins that form channels to selectively pass chloride ions. Nonselective blockers include FENAMATES; ETHACRYNIC ACID; and TAMOXIFEN.Sodium Chloride: A ubiquitous sodium salt that is commonly used to season food.Zygosaccharomyces: A genus of ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES.Sodium: A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.Metals, Alkali: Metals that constitute group 1(formerly group Ia) of the periodic table. They are the most strongly electropositive of the metals. Note that HYDROGEN is not considered an alkali metal even though it falls under the group 1 heading in the periodic table.Lithium Chloride: A salt of lithium that has been used experimentally as an immunomodulator.Acid-Base Equilibrium: The balance between acids and bases in the BODY FLUIDS. The pH (HYDROGEN-ION CONCENTRATION) of the arterial BLOOD provides an index for the total body acid-base balance.Lithium: An element in the alkali metals family. It has the atomic symbol Li, atomic number 3, and atomic weight [6.938; 6.997]. Salts of lithium are used in treating BIPOLAR DISORDER.Alkalosis: A pathological condition that removes acid or adds base to the body fluids.Acidosis: A pathologic condition of acid accumulation or depletion of base in the body. The two main types are RESPIRATORY ACIDOSIS and metabolic acidosis, due to metabolic acid build up.Vinyl Chloride: A gas that has been used as an aerosol propellant and is the starting material for polyvinyl resins. Toxicity studies have shown various adverse effects, particularly the occurrence of liver neoplasms.Potassium: An element in the alkali group of metals with an atomic symbol K, atomic number 19, and atomic weight 39.10. It is the chief cation in the intracellular fluid of muscle and other cells. Potassium ion is a strong electrolyte that plays a significant role in the regulation of fluid volume and maintenance of the WATER-ELECTROLYTE BALANCE.Cations, Monovalent: Positively charged atoms, radicals or group of atoms with a valence of plus 1, which travel to the cathode or negative pole during electrolysis.Alkalies: Usually a hydroxide of lithium, sodium, potassium, rubidium or cesium, but also the carbonates of these metals, ammonia, and the amines. (Grant & Hackh's Chemical Dictionary, 5th ed)Ion Transport: The movement of ions across energy-transducing cell membranes. Transport can be active, passive or facilitated. Ions may travel by themselves (uniport), or as a group of two or more ions in the same (symport) or opposite (antiport) directions.Biological Transport: The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.Sodium-Bicarbonate Symporters: Proteins that cotransport sodium ions and bicarbonate ions across cellular membranes.Proton Pumps: Integral membrane proteins that transport protons across a membrane. This transport can be linked to the hydrolysis of ADENOSINE TRIPHOSPHATE. What is referred to as proton pump inhibitors frequently is about POTASSIUM HYDROGEN ATPASE.Salts: Substances produced from the reaction between acids and bases; compounds consisting of a metal (positive) and nonmetal (negative) radical. (Grant & Hackh's Chemical Dictionary, 5th ed)Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Hydrogen: The first chemical element in the periodic table. It has the atomic symbol H, atomic number 1, and atomic weight [1.00784; 1.00811]. It exists, under normal conditions, as a colorless, odorless, tasteless, diatomic gas. Hydrogen ions are PROTONS. Besides the common H1 isotope, hydrogen exists as the stable isotope DEUTERIUM and the unstable, radioactive isotope TRITIUM.Cation Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.Carbon Dioxide: A colorless, odorless gas that can be formed by the body and is necessary for the respiration cycle of plants and animals.Polyvinyl Chloride: A polyvinyl resin used extensively in the manufacture of plastics, including medical devices, tubing, and other packaging. It is also used as a rubber substitute.Yarrowia: A genus of ascomycetous yeast in the family Dipodascaceae, order SACCHAROMYCETALES.Acetazolamide: One of the CARBONIC ANHYDRASE INHIBITORS that is sometimes effective against absence seizures. It is sometimes useful also as an adjunct in the treatment of tonic-clonic, myoclonic, and atonic seizures, particularly in women whose seizures occur or are exacerbated at specific times in the menstrual cycle. However, its usefulness is transient often because of rapid development of tolerance. Its antiepileptic effect may be due to its inhibitory effect on brain carbonic anhydrase, which leads to an increased transneuronal chloride gradient, increased chloride current, and increased inhibition. (From Smith and Reynard, Textbook of Pharmacology, 1991, p337)Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Buffers: A chemical system that functions to control the levels of specific ions in solution. When the level of hydrogen ion in solution is controlled the system is called a pH buffer.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.Cations: Positively charged atoms, radicals or groups of atoms which travel to the cathode or negative pole during electrolysis.Ammonium Chloride: An acidifying agent that has expectorant and diuretic effects. Also used in etching and batteries and as a flux in electroplating.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Protons: Stable elementary particles having the smallest known positive charge, found in the nuclei of all elements. The proton mass is less than that of a neutron. A proton is the nucleus of the light hydrogen atom, i.e., the hydrogen ion.Vacuoles: Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.Carbonic Anhydrases: A family of zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide. They play an important role in the transport of CARBON DIOXIDE from the tissues to the LUNG. EC 4.2.1.1.Absorption: The physical or physiological processes by which substances, tissue, cells, etc. take up or take in other substances or energy.4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid: An inhibitor of anion conductance including band 3-mediated anion transport.Bacterial Proteins: Proteins found in any species of bacterium.Mercuric Chloride: Mercury chloride (HgCl2). A highly toxic compound that volatizes slightly at ordinary temperature and appreciably at 100 degrees C. It is corrosive to mucous membranes and used as a topical antiseptic and disinfectant.Homeostasis: The processes whereby the internal environment of an organism tends to remain balanced and stable.Calcium Chloride: A salt used to replenish calcium levels, as an acid-producing diuretic, and as an antidote for magnesium poisoning.Carbonic Anhydrase Inhibitors: A class of compounds that reduces the secretion of H+ ions by the proximal kidney tubule through inhibition of CARBONIC ANHYDRASES.Ethoxzolamide: A carbonic anhydrase inhibitor used as diuretic and in glaucoma. It may cause hypokalemia.Kinetics: The rate dynamics in chemical or physical systems.Methylene Chloride: A chlorinated hydrocarbon that has been used as an inhalation anesthetic and acts as a narcotic in high concentrations. Its primary use is as a solvent in manufacturing and food technology.Dialysis Solutions: Solutions prepared for exchange across a semipermeable membrane of solutes below a molecular size determined by the cutoff threshold of the membrane material.Potassium Chloride: A white crystal or crystalline powder used in BUFFERS; FERTILIZERS; and EXPLOSIVES. It can be used to replenish ELECTROLYTES and restore WATER-ELECTROLYTE BALANCE in treating HYPOKALEMIA.Acidosis, Respiratory: Respiratory retention of carbon dioxide. It may be chronic or acute.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Proteolipids: Protein-lipid combinations abundant in brain tissue, but also present in a wide variety of animal and plant tissues. In contrast to lipoproteins, they are insoluble in water, but soluble in a chloroform-methanol mixture. The protein moiety has a high content of hydrophobic amino acids. The associated lipids consist of a mixture of GLYCEROPHOSPHATES; CEREBROSIDES; and SULFOGLYCOSPHINGOLIPIDS; while lipoproteins contain PHOSPHOLIPIDS; CHOLESTEROL; and TRIGLYCERIDES.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Electron Transport Complex I: A flavoprotein and iron sulfur-containing oxidoreductase complex that catalyzes the conversion of UBIQUINONE to ubiquinol. In MITOCHONDRIA the complex also couples its reaction to the transport of PROTONS across the internal mitochondrial membrane. The NADH DEHYDROGENASE component of the complex can be isolated and is listed as EC 1.6.99.3.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Kidney Tubules, Distal: The portion of renal tubule that begins from the enlarged segment of the ascending limb of the LOOP OF HENLE. It reenters the KIDNEY CORTEX and forms the convoluted segments of the distal tubule.Acid-Base Imbalance: Disturbances in the ACID-BASE EQUILIBRIUM of the body.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.Secretin: A peptide hormone of about 27 amino acids from the duodenal mucosa that activates pancreatic secretion and lowers the blood sugar level. (USAN and the USP Dictionary of Drug Names, 1994, p597)Bacillus: A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.Anions: Negatively charged atoms, radicals or groups of atoms which travel to the anode or positive pole during electrolysis.Alkalosis, Respiratory: A state due to excess loss of carbon dioxide from the body. (Dorland, 27th ed)Duodenum: The shortest and widest portion of the SMALL INTESTINE adjacent to the PYLORUS of the STOMACH. It is named for having the length equal to about the width of 12 fingers.Benzalkonium Compounds: A mixture of alkylbenzyldimethylammonium compounds. It is a bactericidal quaternary ammonium detergent used topically in medicaments, deodorants, mouthwashes, as a surgical antiseptic, and as a as preservative and emulsifier in drugs and cosmetics.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.Pancreatic Juice: The fluid containing digestive enzymes secreted by the pancreas in response to food in the duodenum.Carbonates: Salts or ions of the theoretical carbonic acid, containing the radical CO2(3-). Carbonates are readily decomposed by acids. The carbonates of the alkali metals are water-soluble; all others are insoluble. (From Grant & Hackh's Chemical Dictionary, 5th ed)Acidosis, Renal Tubular: A group of genetic disorders of the KIDNEY TUBULES characterized by the accumulation of metabolically produced acids with elevated plasma chloride, hyperchloremic metabolic ACIDOSIS. Defective renal acidification of URINE (proximal tubules) or low renal acid excretion (distal tubules) can lead to complications such as HYPOKALEMIA, hypercalcinuria with NEPHROLITHIASIS and NEPHROCALCINOSIS, and RICKETS.Electrolytes: Substances that dissociate into two or more ions, to some extent, in water. Solutions of electrolytes thus conduct an electric current and can be decomposed by it (ELECTROLYSIS). (Grant & Hackh's Chemical Dictionary, 5th ed)Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Potassium Compounds: Inorganic compounds that contain potassium as an integral part of the molecule.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Membrane Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.Perfusion: Treatment process involving the injection of fluid into an organ or tissue.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Kidney Tubules, Proximal: The renal tubule portion that extends from the BOWMAN CAPSULE in the KIDNEY CORTEX into the KIDNEY MEDULLA. The proximal tubule consists of a convoluted proximal segment in the cortex, and a distal straight segment descending into the medulla where it forms the U-shaped LOOP OF HENLE.HEPES: A dipolar ionic buffer.Cystic Fibrosis Transmembrane Conductance Regulator: A chloride channel that regulates secretion in many exocrine tissues. Abnormalities in the CFTR gene have been shown to cause cystic fibrosis. (Hum Genet 1994;93(4):364-8)Carbonic Anhydrase II: A cytosolic carbonic anhydrase isoenzyme found widely distributed in cells of almost all tissues. Deficiencies of carbonic anhydrase II produce a syndrome characterized by OSTEOPETROSIS, renal tubular acidosis (ACIDOSIS, RENAL TUBULAR) and cerebral calcification. EC 4.2.1.-Kidney Tubules: Long convoluted tubules in the nephrons. They collect filtrate from blood passing through the KIDNEY GLOMERULUS and process this filtrate into URINE. Each renal tubule consists of a BOWMAN CAPSULE; PROXIMAL KIDNEY TUBULE; LOOP OF HENLE; DISTAL KIDNEY TUBULE; and KIDNEY COLLECTING DUCT leading to the central cavity of the kidney (KIDNEY PELVIS) that connects to the URETER.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Arabidopsis: A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.Protein Structure, Secondary: The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.Ion Exchange: Reversible chemical reaction between a solid, often one of the ION EXCHANGE RESINS, and a fluid whereby ions may be exchanged from one substance to another. This technique is used in water purification, in research, and in industry.Cadmium Chloride: A cadmium halide in the form of colorless crystals, soluble in water, methanol, and ethanol. It is used in photography, in dyeing, and calico printing, and as a solution to precipitate sulfides. (McGraw-Hill Dictionary of Scientific and Technical Terms, 5th ed)Water-Electrolyte Balance: The balance of fluid in the BODY FLUID COMPARTMENTS; total BODY WATER; BLOOD VOLUME; EXTRACELLULAR SPACE; INTRACELLULAR SPACE, maintained by processes in the body that regulate the intake and excretion of WATER and ELECTROLYTES, particularly SODIUM and POTASSIUM.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Biological Transport, Active: The movement of materials across cell membranes and epithelial layers against an electrochemical gradient, requiring the expenditure of metabolic energy.Hydrochloric Acid: A strong corrosive acid that is commonly used as a laboratory reagent. It is formed by dissolving hydrogen chloride in water. GASTRIC ACID is the hydrochloric acid component of GASTRIC JUICE.4-Acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic Acid: A non-penetrating amino reagent (commonly called SITS) which acts as an inhibitor of anion transport in erythrocytes and other cells.Hemodialysis Solutions: Solutions prepared for hemodialysis. The composition of the pre-dialysis solution may be varied in order to determine the effect of solvated metabolites on anoxia, malnutrition, acid-base balance, etc. Of principal interest are the effect of the choice of buffers (e.g., acetate or carbonate), the addition of cations (Na+, K+, Ca2+), and addition of carbohydrates (glucose).Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Bromides: Salts of hydrobromic acid, HBr, with the bromine atom in the 1- oxidation state. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Recombinant Proteins: Proteins prepared by recombinant DNA technology.Genes, Bacterial: The functional hereditary units of BACTERIA.Osmolar Concentration: The concentration of osmotically active particles in solution expressed in terms of osmoles of solute per liter of solution. Osmolality is expressed in terms of osmoles of solute per kilogram of solvent.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Lactates: Salts or esters of LACTIC ACID containing the general formula CH3CHOHCOOR.Amiloride: A pyrazine compound inhibiting SODIUM reabsorption through SODIUM CHANNELS in renal EPITHELIAL CELLS. This inhibition creates a negative potential in the luminal membranes of principal cells, located in the distal convoluted tubule and collecting duct. Negative potential reduces secretion of potassium and hydrogen ions. Amiloride is used in conjunction with DIURETICS to spare POTASSIUM loss. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p705)Fungal Proteins: Proteins found in any species of fungus.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Isotonic Solutions: Solutions having the same osmotic pressure as blood serum, or another solution with which they are compared. (From Grant & Hackh's Chemical Dictionary, 5th ed & Dorland, 28th ed)Membrane Potentials: The voltage differences across a membrane. For cellular membranes they are computed by subtracting the voltage measured outside the membrane from the voltage measured inside the membrane. They result from differences of inside versus outside concentration of potassium, sodium, chloride, and other ions across cells' or ORGANELLES membranes. For excitable cells, the resting membrane potentials range between -30 and -100 millivolts. Physical, chemical, or electrical stimuli can make a membrane potential more negative (hyperpolarization), or less negative (depolarization).Nitrobenzoates: Benzoic acid or benzoic acid esters substituted with one or more nitro groups.

Topology of the membrane domain of human erythrocyte anion exchange protein, AE1. (1/355)

Anion exchanger 1 (AE1) is the chloride/bicarbonate exchange protein of the erythrocyte membrane. By using a combination of introduced cysteine mutants and sulfhydryl-specific chemistry, we have mapped the topology of the human AE1 membrane domain. Twenty-seven single cysteines were introduced throughout the Leu708-Val911 region of human AE1, and these mutants were expressed by transient transfection of human embryonic kidney cells. On the basis of cysteine accessibility to membrane-permeant biotin maleimide and to membrane-impermeant lucifer yellow iodoacetamide, we have proposed a model for the topology of AE1 membrane domain. In this model, AE1 is composed of 13 typical transmembrane segments, and the Asp807-His834 region is membrane-embedded but does not have the usual alpha-helical conformation. To identify amino acids that are important for anion transport, we analyzed the anion exchange activity for all introduced cysteine mutants, using a whole cell fluorescence assay. We found that mutants G714C, S725C, and S731C have very low transport activity, implying that this region has a structurally and/or catalytically important role. We measured the residual anion transport activity after mutant treatment with the membrane-impermeant, cysteine-directed compound, sodium (2-sulfonatoethyl)methanethiosulfonate) (MTSES). Only two mutants, S852C and A858C, were inhibited by MTSES, indicating that these residues may be located in a pore-lining region.  (+info)

Na+/H+ antiporter activity in hamster embryos is activated during fertilization. (2/355)

This study characterized the activation of the regulatory activity of the Na+/H+ antiporter during fertilization of hamster embryos. Hamster oocytes appeared to lack any mechanism for the regulation of intracellular pH in the acid range. Similarly, no Na+/H+ antiporter activity could be detected in embryos that were collected from the reproductive tract between 1 and 5 h post-egg activation (PEA). Activity of the Na+/H+ antiporter was first detected in embryos collected at 5.5 h PEA and gradually increased to reach maximal activity in embryos collected at 7 h PEA. Parthenogenetically activated one-cell and two-cell embryos demonstrate Na+/H+ antiporter activity, indicating that antiporter activity is maternally derived and initiated by activation of the egg. The inability of cycloheximide, colchicine, or cytochalasin D to affect initiation of antiporter activity indicates that antiporter appearance is not dependent on the synthesis of new protein or recruitment of existing protein to the cell membrane. In contrast, incubation of one-cell embryos with sphingosine did inhibit the appearance of Na+/H+ antiporter activity, showing that inhibition of normal protein kinase C activity is detrimental to antiporter function. Furthermore, incubation of oocytes with a phorbol ester which stimulates protein kinase C activity induced Na+/H+ antiporter activity in oocytes in which the activity was previously absent. Incubation with an intracellular calcium chelator also reduced the appearance of antiporter activity. Taken together, these data indicate that the appearance of Na+/H+ antiporter activity following egg activation may be due, at least in part, to regulation by protein kinase C and intracellular calcium levels.  (+info)

Intracellular pH regulation by HCO3-/Cl- exchange is activated during early mouse zygote development. (3/355)

We report here that at least one major pHi-regulatory mechanism, the HCO3-/Cl- exchanger, is quiescent in unfertilized mouse eggs but becomes fully activated during early development following fertilization. Zygotes (8-12 h postfertilization) exhibited a marked intracellular alkalinization upon external Cl- removal, which is indicative of active HCO3-/Cl- exchangers, in contrast to the very small response observed in eggs. In addition, efflux of Cl- from eggs upon external Cl- removal was much slower than that from zygotes, indicating additional pathways for Cl- to cross the plasma membrane in zygotes. Furthermore, while zygotes quickly recovered from an induced alkalosis, eggs exhibited only a slow, incomplete recovery. Following in vitro fertilization (IVF), increased HCO3-/Cl- exchanger activity was first detectable about 4 h postfertilization and reached the maximal level after about 8 h. The upregulation of HCO3-/Cl- exchanger activity after fertilization appeared to occur by activation of existing, inactive exchangers rather than by synthesis or transport of new exchangers, as the increase in activity following IVF was unaffected by inhibition of protein synthesis or by disruption of the Golgi apparatus or the cytoskeleton. This activation may depend on the Ca2+ transients which follow fertilization, as suppression of these transients, using the Ca2+ chelator BAPTA, reduced subsequent upregulation of HCO3-/Cl- exchanger activity by about 50%. Activation of pHi-regulatory systems may be a widespread feature of the earliest period of embryonic development, not restricted to species such as marine invertebrates as previously believed.  (+info)

Transmembrane folding of the human erythrocyte anion exchanger (AE1, Band 3) determined by scanning and insertional N-glycosylation mutagenesis. (4/355)

The human erythrocyte anion exchanger (AE1, Band 3) contains up to 14 transmembrane segments, with a single site of N-glycosylation at Asn642 in extracellular (EC) loop 4. Scanning and insertional N-glycosylation mutagenesis were used to determine the folding pattern of AE1 in the membrane. Full-length AE1, when expressed in transfected human embryonic kidney (HEK)-293 or COS-7 cells, retained a high-mannose oligosaccharide structure. Scanning N-glycosylation mutagenesis of EC loop 4 showed that N-glycosylation acceptor sites (Asn-Xaa-Ser/Thr) spaced 12 residues from the ends of adjacent transmembrane segments could be N-glycosylated. An acceptor site introduced at position 743 in intracellular (IC) loop 5 that could be N-glycosylated in a cell-free translation system was not N-glycosylated in transfected cells. Mutations designed to disrupt the folding of this loop enhanced the level of N-glycosylation at Asn743 in vitro. The results suggest that this loop might be transiently exposed to the lumen of the endoplasmic reticulum during biosynthesis but normally folds rapidly, precluding N-glycosylation. EC loop 4 insertions into positions 428, 484, 754 and 854 in EC loops 1, 2, 6 and 7 respectively were efficiently N-glycosylated, showing that these regions were extracellular. EC loop 4 insertions into positions 731 or 785 were poorly N-glycosylated, which was inconsistent with an extracellular disposition for these regions of AE1. Insertion of EC loop 4 into positions 599 and 820 in IC loops 3 and 6 respectively were not N-glycosylated in cells, which was consistent with a cytosolic disposition for these loops. Inhibitor-affinity chromatography with 4-acetamido-4'-isothiocyanostilbene-2,2'-disulphonate (SITS)-Affi-Gel was used to assess whether the AE1 mutants were in a native state. Mutants with insertions at positions 428, 484, 599, 731 and 785 showed impaired inhibitor binding, whereas insertions at positions 754, 820 and 854 retained binding. The results indicate that the folding of the C-terminal region of AE1 is more complex than originally proposed and that this region of the transporter might have a dynamic aspect.  (+info)

Transport characteristics of the apical anion exchanger of rabbit cortical collecting duct beta-cells. (5/355)

To functionally characterize transport properties of the apical anion exchanger of rabbit beta-intercalated cells, the mean change in anion exchange activity, dpHi/dt (where pHi is intracellular pH), was measured in response to lumen Cl- replacement with gluconate in perfused cortical collecting ducts (CCDs). beta-Cell apical anion exchange was not affected by 15-min exposure to 0.2 mM lumen DIDS in the presence of 115 mM Cl-. In contrast, apical anion exchange was significantly inhibited by 0.1 mM lumen DIDS in the absence of Cl-. beta-Cell apical anion exchange was unchanged by 15 mM maleic anhydride, 10 mM phenylglyoxal, 0.2 mM niflumic acid, 1 mM edecrin, 1 mM furosemide, 1 mM probenecid, or 0.1 mM diphenylamine-2-carboxylate. However, beta-cell apical anion exchange was inhibited by alpha-cyano-4-hydroxycinnamic acid, with an IC50 of 2.4 mM. Substitution of either sulfate or gluconate for lumen Cl- resulted in a similar rate of alkalinization. Conversely, pHi was unchanged by substitution of sulfate for lumen gluconate, confirming the lack of transport of sulfate on the beta-cell apical anion exchanger. Taken together, the results demonstrate a distinct "fingerprint" of the rabbit CCD beta-cell apical anion exchanger that is unlike that of other known anion exchangers.  (+info)

HLA-DMB expression by thyrocytes: indication of the antigen-processing and possible presenting capability of thyroid cells. (6/355)

Expression of HLA class II molecules on thyrocytes is a characteristic feature of autoimmune thyroid disease and may lead the thyroid cells to present autoantigens to CD4+ T lymphocytes. Since HLA-DM is a critical molecule in class II-restricted antigen processing and presentation, we assessed the expression of HLA-DMB, -invariant chain (Ii), class II transactivator (CIITA) and DRA in an untransformed, pure thyrocyte strain HTV-59A. Here we report that both HLA-DMB mRNA and the protein are expressed in thyrocytes and that CIITA expression is enhanced by interferon-gamma (IFN-gamma) treatment and occurs before DMB, Ii and DRA up-regulation, suggesting CIITA expression is a requirement for antigen processing in thyrocytes. These results indicate that thyrocytes are capable of antigen processing and possibly antigen presentation to T cells.  (+info)

A spliced variant of AE1 gene encodes a truncated form of Band 3 in heart: the predominant anion exchanger in ventricular myocytes. (7/355)

The anion exchangers (AE) are encoded by a multigenic family that comprises at least three genes, AE1, AE2 and AE3, and numerous splicoforms. Besides regulating intracellular pH (pHi) via the Cl-/HCO3- exchange, the AEs exert various cellular functions including generation of a senescent antigen, anchorage of the cytoskeleton to the membrane and regulation of metabolism. Most cells express several AE isoforms. Despite the key role of this family of proteins, little is known about the function of specific AE isoforms in any tissue, including the heart. We therefore chose isolated cardiac cells, in which a tight control of pHi is mandatory for the excitation-contraction coupling process, to thoroughly investigate the expression of the AE genes at both the mRNA and protein levels. RT-PCR revealed the presence of AE1, AE2 and AE3 mRNAs in both neonatal and adult rat cardiomyocytes. AE1 is expressed both as the erythroid form (Band 3 or eAE1) and a novel alternate transcript (nAE1), which was more specifically characterized using a PCR mapping strategy. Two variants of AE2 (AE2a and AE2c) were found at the mRNA level. Cardiac as well as brain AE3 mRNAs were expressed in both neonatal and adult rat cardiomyocytes. Several AE protein isoforms were found, including a truncated form of AE1 and two AE3s, but there was no evidence of AE2 protein in adult rat cardiomyocytes. In cardiomyocytes transfected with an AE3 oligodeoxynucleotide antisense, AE3 immunoreactivity was dramatically decreased but the activity of the Cl-/HCO3- exchange was unchanged. In contrast, intracellular microinjection of blocking anti-AE1 antibodies inhibited the AE activity. Altogether, our findings suggest that a specific and novel AE1 splicoform (nAE1) mediates the cardiac Cl-/HCO3- exchange. The multiple gene and protein expression within the same cell type suggest numerous functions for this protein family.  (+info)

Parietal cells express high levels of Na-K-2Cl cotransporter on migrating into the gastric gland neck. (8/355)

Na-K-2Cl cotransport and Cl/HCO3 exchange are prominent mechanisms for Cl- uptake in Cl--secreting epithelial cells. We used immunofluorescence microscopy to delineate the distributions of Na-K-2Cl cotransporter-1 (NKCC1) and anion exchanger-2 (AE2) proteins in rat gastric mucosa (zymogenic zone). Parietal cells (PCs) above the neck of the gastric gland contained abundant AE2 but little or no NKCC1, whereas those in the neck and base contained high NKCC1 but diminished AE2. Lower levels of NKCC1 were detected in surface mucous cells and in cells comprising the blind ends of all glands. Pulse labeling of proliferating cells with bromodeoxyuridine indicated that new PCs originate in the isthmus with scant NKCC1; the subset of PCs that migrate downward expresses NKCC1 abruptly on entering the neck, within 7 days of cell division. Our results suggest that downwardly migrating PCs replace one mechanism for Cl- entry (Cl/HCO3 exchange) with another (Na-K-2Cl cotransport).  (+info)

*Band 3

Chloride-Bicarbonate Antiporters at the US National Library of Medicine Medical Subject Headings (MeSH) Human SLC4A1 genome ... kAE1 exchanges bicarbonate for chloride on the basolateral surface, essentially returning bicarbonate to the blood. Here it ... into a proton and a bicarbonate ion. The bicarbonate is then excreted (in exchange for a chloride) from the cell by band 3. ... Functional interaction of carbonic anhydrase II and chloride/bicarbonate exchangers". J. Biol. Chem. 276 (51): 47886-94. doi: ...

*List of MeSH codes (D12.776.157)

... chloride-bicarbonate antiporters MeSH D12.776.157.530.450.162.193.500 -- anion exchange protein 1, erythrocyte MeSH D12.776. ... sodium chloride symporters MeSH D12.776.157.530.450.625.437 -- sodium-glucose transport proteins MeSH D12.776.157.530.450.625. ... chloride channels MeSH D12.776.157.530.400.175.125 -- cystic fibrosis transmembrane conductance regulator MeSH D12.776.157.530. ... antiporters MeSH D12.776.157.530.450.162.110 -- anion exchange protein 1, erythrocyte MeSH D12.776.157.530.450.162.193 -- ...

*List of MeSH codes (D12.776.543)

... chloride-bicarbonate antiporters MeSH D12.776.543.550.190.276.500 -- anion exchange protein 1, erythrocyte MeSH D12.776.543.550 ... chloride-bicarbonate antiporters MeSH D12.776.543.585.450.162.193.500 -- anion exchange protein 1, erythrocyte MeSH D12.776. ... potassium-hydrogen antiporters MeSH D12.776.543.550.190.775 -- sodium-hydrogen antiporter MeSH D12.776.543.550.192.610 -- p- ... chloride channels MeSH D12.776.543.550.425.175.125 -- cystic fibrosis transmembrane conductance regulator MeSH D12.776.543.550. ...

*Cotransporter

The AE1 antiporter is essential in the removal of carbon dioxide waste that is converted to bicarbonate inside the erythrocyte ... This cotransporter is an important integral protein in mammalian erythrocytes and moves chloride ion and bicarbonate ion in a ... A Proton gradient moves the ions into the vacuole by proton-sodium antiporter or the proton-calcium antiporter. In plants, ... Antiporters and symporters both transport two or more different types of molecules at the same time in a coupled movement. An ...

*Gastric acid

The pancreas further produces large amounts of bicarbonate and secretes bicarbonate through the pancreatic duct to the duodenum ... potassium chloride (KCl) and sodium chloride (NaCl). The acid plays a key role in digestion of proteins, by activating ... The hydrogen ions leave the cell through H+/K+ ATPase antiporter pumps. At the same time, sodium ions are actively reabsorbed. ... Chloride and sodium ions are secreted actively from the cytoplasm of the parietal cell into the lumen of the canaliculus. This ...

*Transporter Classification Database

Chloride/Bicarbonate Exchanger Family 2.B.21 The ortho-Phenylenediamine-bis-Urea Derivative Anion Transporter (oPDA-U) Family 2 ... H+ Antiporter (NhaA) Family 2.A.34 The NhaB Na+:H+ Antiporter (NhaB) Family 2.A.35 The NhaC Na+:H+ Antiporter (NhaC) Family 2.A ... H+ Antiporter (NhaD) Family 2.A.63 The Monovalent Cation (K+ or Na+):Proton Antiporter-3 (CPA3) Family 2.A.64 Twin Arginine ... Monovalent Cation:Proton Antiporter-1 (CPA1) Family 2.A.37 Monovalent Cation:Proton Antiporter-2 (CPA2) Family 2.A.38 K+ ...

*Renal physiology

... chloride, and bicarbonate). As the kidney is the most important organ in controlling these values, any derangement in these ... antiporter. And ammonia diffuses into renal tubule. A simple means of estimating renal function is to measure pH, blood urea ... 6: Proximal Reabsorption of Bicarbonate. lib.mcg.edu Sect. 7, Ch. 12: Proximal Tubular Reabsorption of Bicarbonate. lib.mcg.edu ... For example, bicarbonate (HCO3−) does not have a transporter, so its reabsorption involves a series of reactions in the tubule ...

*Carbonic anhydrase II

Functional interaction of carbonic anhydrase II and chloride/bicarbonate exchangers". J. Biol. Chem. United States. 276 (51): ... Carbonic anhydrase II has been shown to interact with band 3 and sodium-hydrogen antiporter 1. GRCh38: Ensembl release 89: ... Renal carbonic anhydrase allows the reabsorption of bicarbonate ions in the proximal tubule. ...

*Distal convoluted tubule

... and for Ca to be reclaimed into the blood by the Na/Ca basolateral antiporter. It regulates pH by absorbing bicarbonate and ... Sodium and chloride (salt) reabsorption is also mediated by a group of kinases called WNK kinases. There are 4 different WNK ... On the basolateral surface (peritubular capillary side) there is an ATP-dependent Na/K antiporter pump, a secondary active Na/ ... secreting protons (H+) into the filtrate, or by absorbing protons and secreting bicarbonate into the filtrate. Sodium and ...

*Loop of Henle

... which both push more Na into the cell via the Na-H antiporter. The hydrogen ion for the antiporter comes from the enzyme ... Ascending limb of loop of Henle Sodium (Na+), potassium (K+) and chloride (Cl−) ions are reabsorbed from the urine by secondary ... and bicarbonate. Since water is also reabsorbed the volume of fluid in the loop of Henle is less than the PCT, approximately ... As ions leave the lumen via the Na-K-2Cl symporter and the Na-H antiporter, the concentration becomes more and more hypotonic ...

*V-ATPase

May 1998). "Mutations in the chloride-bicarbonate exchanger gene AE1 cause autosomal dominant but not autosomal recessive ... Ca2+ antiporter system (Ohya, 1991). In synaptic transmission in neuronal cells, V-ATPase acidifies synaptic vesicles. ... In the intercalated cells of the kidney, V-ATPases pump protons into the urine, allowing for bicarbonate reabsorption into the ... October 2003). "Chloride channel ClCN7 mutations are responsible for severe recessive, dominant, and intermediate osteopetrosis ...

*Solute carrier family

Eiden LE, Schafer MK, Weihe E, Schutz B (2004). "The vesicular amine transporter family (SLC18): amine/proton antiporters ... Chen NH, Reith ME, Quick MW (2004). "Synaptic uptake and beyond: the sodium- and chloride-dependent neurotransmitter ... bicarbonate transporter(SLC4A1, SLC4A2, SLC4A3, SLC4A4, SLC4A5, SLC4A6, SLC4A7, SLC4A8, SLC4A9, SLC4A10, SLC4A11) (5) sodium ... and chloride-dependent sodium:neurotransmitter symporters(SLC6A1, SLC6A2, SLC6A3, SLC6A4, SLC6A5, SLC6A6, SLC6A7, SLC6A8, ...
The sodium-driven chloride/bicarbonate exchanger (NDCBE), a member of the SLC4 family of bicarbonate transporters, was recently found to modulate excitatory neurotransmission in hippocampus. et al., 2008). Comparable Na+-driven exchangers have been shown to regulate pH in invertebrate neuronal systems, including molluscan neurons and the squid giant axon (Boron and De Weer, 1976; Thomas, 1977). However, recent work raises the possibility that NDCBE may influence neurotransmission impartial of its effects on pH (Kim and Trussell, 2009). NDCBE and NDCBE-like activity has been detected in multiple brain regions in both rodents and humans (Baxter and Church, 1996; Chen et al., 2008; Damkier et al., 2007; Schwiening and Boron, 1994). The present study reveals a highly selective targeting of NDCBE to axon terminals, where it is closely associated with synaptic vesicles. Because NDCBE is an integral membrane protein, we conclude that this large majority of the vesicle-associated pool must be inserted ...
Signs of Congenital chloride diarrhea including medical signs and symptoms of Congenital chloride diarrhea, symptoms, misdiagnosis, tests, common medical issues, duration, and the correct diagnosis for Congenital chloride diarrhea signs or Congenital chloride diarrhea symptoms.
Chloride is an anion in the human body needed for metabolism (the process of turning food into energy). It also helps keep the bodys acid-base balance. The amount of serum chloride is carefully controlled by the kidneys. Chloride ions have important physiological roles. For instance, in the central nervous system, the inhibitory action of glycine and some of the action of GABA relies on the entry of Cl− into specific neurons. Also, the chloride-bicarbonate exchanger biological transport protein relies on the chloride ion to increase the bloods capacity of carbon dioxide, in the form of the bicarbonate ion; this is the mechanism underpinning the chloride shift occurring as the blood passes through oxygen-consuming capillary beds. The normal blood reference range of chloride for adults in most labs is 96 to 106 milliequivalents (mEq) per liter. The normal range may vary slightly from lab to lab. Normal ranges are usually shown next to results in the lab report. A diagnostic test may use a ...
Cl-/HCO3- exchangers are expressed abundantly in cardiac muscle, suggesting that HCO3- extrusion serves an important function in heart. Mice lacking Anion Exchanger Isoform 3 (AE3), a major cardiac Cl-/HCO3- exchanger, appear healthy, but loss of AE3 causes decompensation in a hypertrophic cardiomyopathy (HCM) model. Using intra-ventricular pressure analysis, in vivo pacing, and molecular studies we identified physiological and biochemical changes caused by loss of AE3 that may contribute to decompensation in HCM. AE3-null mice had normal cardiac contractility under basal conditions and after -adrenergic stimulation, but pacing of hearts revealed that frequency-dependent inotropy was blunted, suggesting that AE3-mediated HCO3- extrusion is required for a robust force-frequency response (FFR) during acute biomechanical stress in vivo. Modest changes in expression of proteins that affect Ca2+-handling were observed, but Ca2+-transient analysis of AE3-null myocytes showed normal twitch-amplitude and Ca2
A collection of disease information resources and questions answered by our Genetic and Rare Diseases Information Specialists for Congenital chloride diarrhea
Worldwide, diarrhea claims several million lives annually, mostly those of infants. Although its incidence is much lower in the more affluent nations, diarrhea remains one of the two most common visits to pediatric emergency rooms and is also common among the institutionalized elderly. Diarrhea is caused by a decrease in net salt and fluid absorption, which can result from either a decrease in salt absorption or an increase in anion secretion, or both. The major pathway for sodium and water absorption in the intestine is thought involve Na+/H+ exchanger type 3 (NHE3) in the brush border membrane of enterocytes where it acts in concert with an anion exchanger to mediate electroneutral NaCl absorption. NHE3 is regulated by many factors, including bacterial toxins, steroids, insulin, cytokines, and osmotic stress. The precise mechanisms underlying the regulation of NHE3 are still under investigation, but emerging themes include transcriptional regulation, changes in phosphorylation of NHE3 ...
4,4-Diisothiocyano-2,2-stilbenedisulfonic acid (DIDS) is an anion exchange inhibitor, blocking reversibly, and later irreversibly, exchangers such as chloride-bicarbonate exchanger. Jessen, Flemming; Sjøholm, C; Hoffmann, EK (1986), "Identification of the anion exchange protein of ehrlich cells: A kinetic analysis of the inhibitory effects of 4,4′-diisothiocyano-2,2′-stilbene-disulfonic acid (DIDS) and labeling of membrane proteins with3H-DIDS", Journal of Membrane Biology, 92 (3): 195, doi:10.1007/BF01869388, PMID 3783658 Lane, Michelle; Baltz, Jay M.; Bavister, Barry D. (1999), "Bicarbonate/Chloride Exchange Regulates Intracellular pH of Embryos but Not Oocytes of the Hamster", Biology of Reproduction, 61 (2): 452-457, doi:10.1095/biolreprod61.2.452, PMID 10411526 ...
Results Forty-three patients (28M/15F) had CCD. Fifteen patients (35%) were diagnosed after one year of age (late referral or misdiagnosis as Bartter syndrome). Premature delivery in 24 cases (55.8%). Polyhydramnios in 26 pregnancies. All patients were distributed among 19 families with 33 children being the outcome of consanguineous marriages. Intractable diarrhea was the presenting symptom in 40patients (93%), Biochemical data revealed: Serum potassium (1.3-4.1, mean 2.4Mmol/l), s. chloride (39-95, mean76.2Mmol/l), s.bicarbonate (22-54) meam-37.6 Mmol/). Fecal chloride (134±21.6, mean±SD)(range 90-205). The fecal chloride over fecal sodium plus potassium ratio was 0.6 (1.1±0.3, mean ± SD)(N.=0.2). Associated disorders were: chronic renal failure 7 (16%), congenital anomalies 8 (19%), mental retardation4 (9.3%) seizures 8 (19%), and brain atrophy 4 (9%). Complications were seen mostly among patients with late referral or poor compliance. At diagnosis, 35 (81.4%) cases were below -2SD for ...
The protein encoded by this gene is a transmembrane glycoprotein that transports chloride ions across the cell membrane in exchange for bicarbonate ions. It is localized to the mucosa of the lower intestinal tract, particularly to the apical membrane of columnar epithelium and some goblet cells. The protein is essential for intestinal chloride absorption, and mutations in this gene have been associated with congenital chloride diarrhea. [provided by RefSeq, Oct 2008 ...
The CLCN5 gene provides instructions for making a protein called ClC-5 that transports charged atoms (ions) across cell membranes. Specifically, ClC-5 exchanges negatively charged atoms of chlorine (chloride ions) for positively charged atoms of hydrogen (protons or hydrogen ions). Based on this function, ClC-5 is known as a H+/Cl- exchanger.. ClC-5 is found primarily in the kidneys, particularly in structures called proximal tubules. These structures help to reabsorb nutrients, water, and other materials that have been filtered from the bloodstream. The kidneys reabsorb needed materials into the blood and excrete everything else into the urine.. Within proximal tubule cells, ClC-5 is embedded in specialized compartments called endosomes. Endosomes are formed at the cell surface to carry proteins and other molecules to their destinations within the cell. ClC-5 transports hydrogen ions into endosomes and chloride ions out, which helps these compartments maintain the proper acidity level (pH). ...
Get an answer for What causes a infant to have congential chloride diarrhea? and find homework help for other Science questions at eNotes
Disease: (OMIM: 126650 214700) Defects in SLC26A3 are the cause of diarrhea type 1 (DIAR1) [MIM:214700]; also known as congenital chloride diarrhea (CLD). DIAR1 is a disease characterized by voluminous watery stools containing an excess of chloride. The children with this disease are often premature ...
Mutations in several SLC26 transporters are linked to human diseases, most of which involve epithelia dysfunction in specific organs. This indicates that SLC26 transporters play a central role in transepithelial fluid and electrolyte transport, including Cl− absorption and HCO3− secretion by the kidney, the GI tract, and secretory glands (Kunzelmann and Mall, 2002; Ko et al., 2004; Melvin et al., 2005; Steward et al., 2005). To understand the function of the SLC26 transporters in epithelial Cl− absorption and HCO3− secretion, it is essential to know their transport mechanism and Cl−/HCO3− transport stoichiometry. Two of the most studied SLC26 transporters are slc26a3 and slc26a6. Both were shown to function as Cl−/HCO3− exchangers (Melvin et al., 1999; Ko et al., 2002; Wang et al., 2002) and as electrogenic transporters (Ko et al., 2002; Xie et al., 2002) with isoform-specific stoichiometry (Ko et al., 2002). However, the electrogenicity of the transporters was called into ...
Congenital Chloride diarrhea (CLD) is an intestinal transport defect of chloride ions. Retention of intestinal chloride causes water retention, which leads to watery diarrhea with an abnormally high chloride concentration. This defect presents in utero, with hydramnion presumably due to intrauterine diarrhea. The gestational period is shortened, and newborn babies have abdominal distension and chronic watery diarrhea. If untreated the condition leads to severe electrolyte changes with a fatal outcome, or to permanent damage of kidneys and brain. Treatment with chloride substitution and control of electrolyte balance is effective and patients can live an almost normal life complicated only by relatively loose stools.
Congenital chloride diarrhea is an autosomal recessive type of chronic diarrhea characterized by voluminous watery stool containing high levels of chloride. It can present in patients of any age from newborns to adults, but onset is most often in the first weeks to months of life. Clinically, congenital chloride diarrhea is similar to Bartter syndrome, except these patients do not have calcium dysregulation ...
1. Na+/H+ antiport activity was measured in peripheral blood polymorphonuclear and mononuclear cells of 12 healthy subjects by using an intracellular pH clamp technique to determine the external Na(+)-dependent H+ efflux rate in cells loaded with a pH-sensitive fluorescent dye, bis(carboxyethyl)carboxyfluorescein. The change in external Na+ concentrations for all pH measurements was similar in both cell types. 2. A significant difference between the two types of cells was found, the polymorphonuclear leucocytes having a higher Na+/H+ antiport activity than the lymphocytes. Cellular intrinsic buffering capacity measured in the absence of HCO3- was also higher in the polymorphonuclear cells than in the lymphocytes. 3. These differences may be associated with a difference in the role of the Na+/H+ exchanger in these two types of cells, although in vivo the presence of HCO3-/Cl- exchangers may also contribute to intracellular pH homoeostasis.
SLC9A1 (NHE1), a member of the Na+/H+ exchanger family, is a ubiquitous membrane protein that regulates intracellular pH and cell volume. Furthermore, SLC9A1 is known to
Book an appointment with Dra. Raquel Ancin Viguiristi. Find verified patient reviews, where to go, insurers, prices, and treatments.
购买SLC35D1兔多克隆抗体(ab106523),SLC35D1抗体经WB验证,可与人,小鼠,大鼠样本反应。产品出库一年都在质保范围内。中国现货速达。
SLC39A10兔多克隆抗体(ab83947)可与小鼠, 大鼠, 人样本反应并经WB, ELISA, ICC实验严格验证。所有产品均提供质保服务,中国75%以上现货。
You need to be signed in to access email alerts. If you have an account log in with your user name and password. If you dont have an account you can just enter your email address in the email box below ...
Rabbit anti Human SLC5A9 antibody recognizes sodium dependent glucose transporter 4 (SGLT4), also known as SLC5A9, a ~76 kDa member o
View Slc34a1/Slc34a1 Slc34a3/Slc34a3 B6.129-Slc34a3 Slc34a1: phenotypes, images, diseases, and references.
Addgene NGS Result CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGC CGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGC CTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAG TGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCG TCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGG CCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAA CAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCT ACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGC TCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATTGATGAGCAATG CTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGTCCCTGCTGGGCAGGGACTACAAC TCTGAGCTGAATAGCCTGGATAACGGCCCTCAGTCCCCATCTGAGAGCTCCTCTAGCATCACATCTGAGA ATGTGCACCCAGCAGGAGAGGCAGGACTGAGCATGATGCAGACCCTGATCCACCTGCTGAAGTGCAATAT CGGAACAGGACTGCTGGGACTGCCACTGGCCATCAAGAACGCAGGACTGCTGGTGGGACCCGTGAGCCTG ...
Browse Sigma-Aldrichs Anion Exchange Media to find products in Amberlite Strong Anion Exchangers, Amberlite® Weak Anion Exchangers, Diaion® Strong Anion Exchanger, Diaion® Weak Anion Exchangers, Dowex® Strong Anion Exchangers, Dowex® Weak Anion Exchangers, Lewatit® Strong Anion Exchanger, Lewatit® Weak Anion Exchanger
Previous studies that have evaluated the Na(+)-H+ antiporter in cells from hypertensive subjects were generally performed under conditions in which HCO3-CO2, the physiological buffer system, was absent from the assay media. The objective of this study was to evaluate the activity of the Na(+)-H+ antiporter and that of the Na(+)-dependent and Na(+)-independent Cl(-)-HCO3- exchangers in cells assayed in the presence of HCO3-CO2 in the media. Lymphocytes from 6- to 8-week-old spontaneously hypertensive rats (SHR) and age-matched Wistar-Kyoto (WKY) rats were obtained from the thymus gland and assayed immediately after isolation. The activity of the Na(+)-H+ antiporter after stimulation by cell acidification (pHi approximately 6.4) was similar in SHR and WKY rats (18.67 +/- 1.03 and 16.12 +/- 0.92 mmol H+/L per minute, respectively). Recovery from cell alkalinization was effected by an Na(+)-independent Cl(-)-HCO3- exchanger, with maximal activity at an alkaline pHi (approximately 7.7). The ...
Mutations of SLC4A1 (AE1) encoding the kidney anion (Cl(-)/HCO(3) (-)) exchanger 1 (kAE1 or band 3) can result in either autosomal dominant (AD) or autosomal recessive (AR) distal renal tubular acidosis (dRTA). The molecular mechanisms associated with SLC4A1 mutations resulting in these different modes of inheritance are now being unveiled using transfected cell systems. The dominant mutants kAE1 R589H, R901X and S613F, which have normal or insignificant changes in anion transport function, exhibit intracellular retention with endoplasmic reticulum (ER) localization in cultured non-polarized and polarized cells, while the dominant mutants kAE1 R901X and G609R are mis-targeted to apical membrane in addition to the basolateral membrane in cultured polarized cells ...
Buy Sylvania / Osram DRA (300W/120V) Lamp features GX6.35 Base, T6 Shape. Review Sylvania / Osram Presentation Lamps & Bulbs, Projector & Presentation Lamps
Request an appointment with Dra. Adriana Geri Nieto. Find verified patient reviews, where to go, insurers, prices, and treatments.
Clone REA368 recognizes the human CD233 antigen, a multi-pass membrane protein also known as anion exchange protein 1 (AE1) or solute carrier family 4 member 1 (SLC4A1). CD233 is a phylogenetically preserved transport protein responsible for mediating the electroneutral anion exchange of chloride for bicarbonate across a plasma membrane. It is the major integral membrane glycoprotein of the erythrocyte membrane and is required for the normal flexibility and stability of the erythrocyte membrane as well as for the normal erythrocyte shape via the interactions of its cytoplasmic domain with cytoskeletal proteins, glycolytic enzymes, and hemoglobin. CD233 mediates the chloride-bicarbonate exchange in the kidney, and is required for the normal acidification of the urine. Additional information: Clone REA368 displays negligible binding to Fc receptors. - Belgique
View mouse Slc4a1 Chr11:102348820-102365281 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
weak anion exchanger, suspension in 20% ethanol and 150 mM NaCl (40-90 µm) Find MSDS or SDS, a COA, data sheets and more information.
Im looking for methods/references regarding the techniques for measuring intracellular pH. Any info would be greatly appreciated. Thanks, Bob McNulty bmcnulty at oavax.csuchico.edu ...
J Mater Sci. DOI 10.1007/s10853-014-8333-x. Adsorption characteristics of noble metals on the strongly basic anion exchanger Purolite A-400TL. A. Wolowicz • Z. Hubicki. Received: 14 March 2014/Accepted: 16 May 2014. © The Author(s) 2014. This article is published with open access at Springerlink.com. Abstract Ion exchange is an alternative process for uptake of noble metals from aqueous solutions. In the present study, the sorption ofPd(II), Pt(IV), and Au(III) ions from aqueous solution was investigated by using Purolite A-400TL (strongly basic anion exchanger, gel, type I) in a batch adsorption system as a function of time (1 min-4 h). Initial Pd(II) concentration (100-1000 mg/L), beads size (0.425-0.85 mm), rate of phases mixing (0-180 rpm), and temperatures (ambient, 313 K) were taken into account during the Pd(II) sorption process. Moreover, the column flow adsorption study was carried out, and the breakthrough curves were obtained for Pd(II) ions. The equilibrium, kinetic, desorption, ...
Tumor hypoxia is associated clinically with therapeutic resistance and poor patient outcomes. One feature of tumor hypoxia is activated expression of carbonic anhydrase IX (CA9), a regulator of pH and tumor growth. In this study, we investigated the hypothesis that impeding the reuptake of bicarbonate produced extracellularly by CA9 could exacerbate the intracellular acidity produced by hypoxic conditions, perhaps compromising cell growth and viability as a result. In 8 of 10 cancer cell lines, we found that hypoxia induced the expression of at least one bicarbonate transporter. The most robust and frequent inductions were of the sodium-driven bicarbonate transporters SLC4A4 and SLC4A9, which rely upon both HIF1α and HIF2α activity for their expression. In cancer cell spheroids, SLC4A4 or SLC4A9 disruption by either genetic or pharmaceutical approaches acidified intracellular pH and reduced cell growth. Furthermore, treatment of spheroids with S0859, a small-molecule inhibitor of sodium-driven
Chronic cerebral hypoperfusion is believed to cause white matter lesions (WMLs), leading to cognitive impairment. Previous studies have shown that inflammation and apoptosis of oligodendrocytes (OLs) are involved in the pathogenesis of WMLs, but effective treatments have not been studied. In this study, 4,4-diisothiocyanostilbene-2,2-disulfonic acid (DIDS), a chloride (Cl−) channel blocker, was injected into chronic cerebral ischemia-hypoxia rat models at different time points. Our results showed that DIDS significantly reduced the elevated mRNA levels and protein expression of chloride channel 2 (ClC-2) in neonatal rats induced by ischemia-hypoxia. Meanwhile, DIDS application significantly decreased the concentrations of reactive oxygen species (ROS); and the mRNA levels of inducible nitric oxide synthase (iNOS) and tumor necrosis factor-alpha TNF-α in neonatal rats with hypoxic-ischemic damage. Myelin staining was weaker in neonatal rats with hypoxic-ischemic damage compared to normal controls
Catalysis of the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: inorganic anion A(out) + inorganic anion B(in) = inorganic anion A(in) + inorganic anion B(out).
Background: Some respiratory diseases may induce alveolar hypoxia thereby hypoxic pulmonary vasoconstriction (HPV). This study was the first to investigate the role of anion exchanger in sustained HPV.. Methods: Experiments were performed in the isolated perfused rabbit lung. In the HCO3- free groups, HEPES were added to the perfusate instead of bicarbonate. In the HEPES1 and HEPES2 groups, the lungs were ventilated with hypoxic gas with or without CO2 respectively.. Results: Ventilation the lungs with hypoxic gas resulted in biphasic HPV. No alteration in both phases of HPV was detected by DIDS (anion exchanger inhibitor,200 microM). However, DIDS (400 microM), extended ascending part of acute HPV until min 24. Both phases of HPV were decreased in the HEPES1 group. But in the HEPES 2 group, HPV tended to increase significantly during rising part of acute phase with no change during sustained phase.. Conclusions: This study is suggesting that anion exchanger may modulate HPV especially during ...
Pendrin is a Cl-/HCO3- exchanger expressed in the apical regions of renal intercalated cells. Following pendrin gene ablation, blood pressure falls, in part, from reduced renal NaCl absorption. We asked if pendrin is expressed in vascular tissue and if the lower blood pressure observed in pendrin null mice is accompanied by reduced vascular reactivity. Thus, the contractile responses to KCl and phenylephrine (PE) were examined in isometrically mounted thoracic aortas from wild-type and pendrin null mice. Although pendrin expression was not detected in the aorta, pendrin gene ablation changed contractile protein abundance and increased the maximal contractile response to PE when normalized to cross sectional area (CSA). However, the contractile sensitivity to this agent was unchanged. The increase in contractile force/cross sectional area observed in pendrin null mice was due to reduced cross sectional area of the aorta and not from increased contractile force per vessel. The pendrin-dependent ...
Human SLC transporter inhibition assay for OATP1B1, OATP1B3, OAT1, OAT3, OCT1, OCT2, MATE1, MATE2-K, OATP1A2, OATP2B1, OAT2, OAT4, OCTN2, PEPT1, PEPT2, NTCP - assay protocol, data and your questions answered.
All of the shorter proteins specific improperly to the mobile area.We even further characterized pH regulation in the AP1 cell line that contains the NHE1 6747-15-5 protein with the MEDChem Express 1009298-09-2 sequence shortened to amino acid 735. In Fig 3C we illustrate the Na+/H+ exchanger activity of the protein that was corrected for the sum of NHE1 protein expressed and focused to the mobile area. The effects demonstrate that the level of action of this protein is nonetheless reduced relative to that of the management.We when compared the intracellular pH of wild type cells with that of the NHE1 protein with the sequence shortened to amino acid 735. Equally the resting intracellular pH, prior to ammonium chloride treatment method, and the degree of acidification induced by ammonium chloride , did not change amongst wild form and 735-NHE1 protein that contains cells. Cells recovering from an acute acid load induced by ammonium chloride, attain a plateau three minutes after recovery ...
The CCDS database identifies a core set of human protein coding regions that are consistently annotated by multiple public resources and pass quality tests.
The CCDS database identifies a core set of human protein coding regions that are consistently annotated by multiple public resources and pass quality tests.
View Notes - Answers for Assignment_9 (Fall 2008) from BBA STAS2126 at Laurentian. STAS2126 Assignment#9 (Fall 2008) Submit to Dropbox not by emailUse your first and last name as the file name Do NOT
We used the pH-sensitive fluorescent dye BCECF to study intracellular pH (pHi) regulation in primary cultures of rat astrocytes and C6 glioma cells. Both cell types contain three pH-regulating transporters: (1) alkalinizing Na+/H+ exchange; (2) alkalinizing Na+ + HCO3 −/Cl−exchange; and (3) acidifying Cl−/HCO3− exchange. Na+/H+ exchange was most evident in the absence of CO2; recovery from acidification was Na+ dependent and amiloride sensitive. Exposure to CO2 caused a cell alkalinization that was inhibited by DIDS, dependent on external Na+, and inhibited 75% in the absence of Cl− (thus mediated by Na+ + HCO3−/Cl− exchange). When pHi was increased above the normal steady-state pHi, a DIDS-inhibitable and Na+ -independent acidifying recovery was evident, indicating the presence of Cl− /HCO3−exchange. Astrocytes, but not C6 cells, contain a fourth pH-regulating transporter, Na+ −HCO3− cotransport; in the presence of CO2, depolarization caused an alkalinization of 0.12 +− 0.01 (n
They administered in excess of 3100 mmol of chloride to their patient (mostly in the form of normal saline) causing the plasma chloride to increase from 90 to 128 mM. They noted a metabolic acidosis (pH, 7.16; HCO3, 13.2 mEq/l; base deficit, 14.5 mEq/l) and attributed this to dilution of the extracellular HCO3 pool by expansion of the extracellular space. This is incorrect. If this was the mechanism involved, then an acidosis should also occur with pure water expansion of the extracellular space such as in SIADH or psychogenic polydipsia. No acidosis is seen in these disorders. The actual mechanism involved is related to chloride-bicarbonate exchange ...
Hi-Tech CADD Services is an industrial supplier of a heat exchanger, and tube heat exchanger, area of a heat exchanger, double pipe heat exchangers, exchanger, exchangers, finned tube, heat exchanger, heat exchanger assembly, heat exchangers.
strong anion exchanger, suspension in 20% ethanol and 150 mM NaCl (40-90 µm) Find MSDS or SDS, a COA, data sheets and more information.
|p| Silia|em||span style=color: rgb(97,169,211)|Prep|/span||/em| Piperazine is a weak anion exchanger that can be used in replacement of SAX and SAX-2 for strong anions to avoid irreversible retention. By using this phase, elution can be done at a low
Gentaur molecular products has all kinds of products like :search , Ato \ Safety Cover for AE_6540_AE_7340 \ 2393718 for more molecular products just contact us
Gentaur molecular products has all kinds of products like :search , Ato \ Safety Cover for AE_6540_AE_7340 \ 2393718 for more molecular products just contact us
Acts as a sodium-independent DIDS-sensitive anion exchanger mediating bicarbonate, chloride, sulfate and oxalate transport. May play a role in the maintenance of the electrolyte and acid-base homeostasis in the kidney, by acting as a distal excretory segment-specific anion exchanger, specifically chloride. Plays a major role in gastric acid secretion.
Enquiry for China 2,2-Bis(O-Chlorophenyl)-4,4,5,5-Tetraphenyl-1,2-Bi (III-Imidazole) 7189-82-4 of Eastar Chemical Corporation , China 2,2-Bis(O-Chlorophenyl)-4,4,5,5-Tetraphenyl-1,2-Bi (III-Imidazole) 7189-82-4 Suppliers & China 2,2-Bis(O-Chlorophenyl)-4,4,5,5-Tetraphenyl-1,2-Bi (III-Imidazole) 7189-82-4 Manufacturers
UCTs Enviro-Clean® anion exchange sorbents provide unmatched activity for the extraction of acidic compounds. The analyst can choose from a wide range of cartridge sizes, sorbent types and quantities tailored to the specific requirements of each analysis.
Human SLC25A38 full-length ORF ( AAH13194.1, 1 a.a. - 304 a.a.) recombinant protein with GST-tag at N-terminal. (H00054977-P01) - Products - Abnova
Human SLC25A4 full-length ORF ( NP_001142.2, 1 a.a. - 298 a.a.) recombinant protein with GST-tag at N-terminal. (H00000291-P01) - Products - Abnova
Centro Hospitalar e Universitário do Porto, Departamento de Doenças Infeciosas, Consulta do Viajante e Doenças Tropicais, Dra. Sandra Xará, Dr. Miguel Abreu, Dra. Maria João ...
Plasmid pDONR221_SLC25A31 from Dr. Giulio Superti-Furgas lab contains the insert SLC25A31. This plasmid is available through Addgene.
Any one elses baby have bronchiltis but worried it was more such as a chest infection?? Ive taken him the Dra twice and each time they say bronchil

sodium carbonate flowsodium carbonate flow

Sodium Chloride - CQ Concepts. MSDS Sheet Sodium chloride, also known as common salt, table salt, or halite, is a States ( ... Sodium bicarbonate NaHCO3 PubChem. Sodium bicarbonate is a white, crystalline powder that is commonly used as a pH buffering ... 201923 ·&enspThe sodiumcalcium exchanger (often denoted Na + /Ca 2+ exchanger, NCX, or exchange protein) is an antiporter ... Sodium bicarbonate NaHCO3 PubChem. Sodium bicarbonate is a white, crystalline powder that is commonly used as a pH buffering ...
more infohttps://growders.eu/sodium_carbonate_flow/29389-24.html

Expression and subcellular localization of aquaporin water channels in the polarized hepatocyte cell line, WIF-B<...Expression and subcellular localization of aquaporin water channels in the polarized hepatocyte cell line, WIF-B<...

... the organic anion transporter Mrp2 and the chloride bicarbonate exchanger AE2. The subcellular localization of the AQPs and the ... the organic anion transporter Mrp2 and the chloride bicarbonate exchanger AE2. The subcellular localization of the AQPs and the ... the organic anion transporter Mrp2 and the chloride bicarbonate exchanger AE2. The subcellular localization of the AQPs and the ... the organic anion transporter Mrp2 and the chloride bicarbonate exchanger AE2. The subcellular localization of the AQPs and the ...
more infohttps://mayoclinic.pure.elsevier.com/en/publications/expression-and-subcellular-localization-of-aquaporin-water-channe

生命薬学 - 研究成果
     - 九州大学生命薬学 - 研究成果 - 九州大学

Chloride-Bicarbonate Antiporters 8 引用 (Scopus) Crystal structure of the enzyme CapF of Staphyloccus aureus reveals a unique ...
more infohttps://kyushu-u.pure.elsevier.com/ja/organisations/pharmaceutical-health-care-and-sciences/publications/?ordering=type&descending=false&page=5

Absence of transepithelial anion exchange by rabbit OMCD: Evidence against reversal of cell polarity<...Absence of transepithelial anion exchange by rabbit OMCD: Evidence against reversal of cell polarity<...

TY - JOUR. T1 - Absence of transepithelial anion exchange by rabbit OMCD. T2 - Evidence against reversal of cell polarity. AU - Hayashi, M.. AU - Schuster, V. L.. AU - Stokes, J. B.. PY - 1988/1/1. Y1 - 1988/1/1. N2 - In the rabbit cortical collecting duct (CCD), Cl tracer crosses the epithelium predominantly via an anion exchange system that operates in either a Cl-Cl or Cl-HCO3 exchange mode. In the present study, we used the 36Cl lumen-to-bath rate coefficient (K(Cl), nm/s), a sensitive measurement of CCD transepithelial anion transport, to investigate the nature of Cl transport in the medullary collecting duct dissected from inner stripe, outer medulla (OMCD). The K(Cl) in OMCD perfused and bathed in HCO3-Ringer solution was low (46.2 ± 8.5 nm/s) and similar to that value observed in the CCD when anion exchange is inhibited and Cl permeates the epithelium by diffusion. Unlike K(Cl) in CCD, K(Cl) in OMCD was not stimulated by adenosine 3,5-cyclic monophosphate (cAMP). OMCD K(Cl) was not ...
more infohttps://einstein.pure.elsevier.com/en/publications/absence-of-transepithelial-anion-exchange-by-rabbit-omcd-evidence-2

坂口光洋記念講座 - 研究成果
     - Keio University坂口光洋記念講座 - 研究成果 - Keio University

Chloride-Bicarbonate Antiporters Bicarbonates Cystic Fibrosis Transmembrane Conductance Regulator 37 引用 (Scopus) ... Bicarbonate-rich fluid secretion predicted by a computational model of guinea-pig pancreatic duct epithelium. Yamaguchi, M., ...
more infohttps://keio.pure.elsevier.com/ja/organisations/15e0-the-sakaguchi-laboratory/publications/

Stakišaitis, D.<...Stakišaitis, D.<...

Chloride-Bicarbonate Antiporters Medicine & Life Sciences Lymphocytes Chemical Compounds Chlorides Medicine & Life Sciences ... Sodium is not required for chloride efflux via chloride/bicarbonate exchanger from rat thymic lymphocytes. Stakišaitis, D., ...
more infohttps://mruni.pure.elsevier.com/en/persons/donatas-stakisaitis

Ductular network formation by rat biliary epithelial cells in the dynamical culture with collagen gel and dimethylsulfoxide...Ductular network formation by rat biliary epithelial cells in the dynamical culture with collagen gel and dimethylsulfoxide...

TY - JOUR. T1 - Ductular network formation by rat biliary epithelial cells in the dynamical culture with collagen gel and dimethylsulfoxide stimulation. AU - Hashimoto, Wataru. AU - Sudo, Ryo. AU - Fukasawa, Kazutomo. AU - Ikeda, Mariko. AU - Mitaka, Toshihiro. AU - Tanishita, Kazuo. PY - 2008/8. Y1 - 2008/8. N2 - Formation of bile ducts in culture is important for reconstructing hepatic organoids with bile drainage systems. However, morphogenic factors of biliary epithelial cells (BECs) have been poorly understood because of the lack of experimental models. Here, we demonstrated that rat BECs formed bile ductular networks in dynamic culture, when culture conditions were sequentially controlled. BEC morphogenesis was achieved through two-dimensional culture on collagen gel, collagen gel sandwich configuration, and 1% dimethylsulfoxide stimulation. In this culture system, BECs developed into large bile duct structures (LBDs) that formed interconnected networks of continuous lumens. LBD luminal ...
more infohttps://waseda.pure.elsevier.com/en/publications/ductular-network-formation-by-rat-biliary-epithelial-cells-in-the

Band 3 - WikipediaBand 3 - Wikipedia

Chloride-Bicarbonate Antiporters at the US National Library of Medicine Medical Subject Headings (MeSH) Human SLC4A1 genome ... kAE1 exchanges bicarbonate for chloride on the basolateral surface, essentially returning bicarbonate to the blood. Here it ... into a proton and a bicarbonate ion. The bicarbonate is then excreted (in exchange for a chloride) from the cell by band 3. ... Functional interaction of carbonic anhydrase II and chloride/bicarbonate exchangers". J. Biol. Chem. 276 (51): 47886-94. doi: ...
more infohttps://en.wikipedia.org/wiki/Band_3

List of MeSH codes (D12.776.157) - WikipediaList of MeSH codes (D12.776.157) - Wikipedia

... chloride-bicarbonate antiporters MeSH D12.776.157.530.450.162.193.500 -- anion exchange protein 1, erythrocyte MeSH D12.776. ... sodium chloride symporters MeSH D12.776.157.530.450.625.437 -- sodium-glucose transport proteins MeSH D12.776.157.530.450.625. ... chloride channels MeSH D12.776.157.530.400.175.125 -- cystic fibrosis transmembrane conductance regulator MeSH D12.776.157.530. ... antiporters MeSH D12.776.157.530.450.162.110 -- anion exchange protein 1, erythrocyte MeSH D12.776.157.530.450.162.193 -- ...
more infohttps://en.wikipedia.org/wiki/List_of_MeSH_codes_(D12.776.157)

Search Articles | University of Toronto LibrariesSearch Articles | University of Toronto Libraries

Chlorides - metabolism , Antiporters - genetics , Bicarbonates - metabolism , Chloride-Bicarbonate Antiporters , Female , Ion ... Chlorides - metabolism , Antiporters - genetics , Chloride-Bicarbonate Antiporters , Ion Transport , Membrane Proteins - ... Chloride-Bicarbonate Antiporters - metabolism , Animals , Biological Transport , Chlorides - metabolism , Antiporters - ... Chloride-Bicarbonate Antiporters - genetics , Gene Expression , Cells, Cultured , Rats , Rats, Inbred WKY , Antiporters - ...
more infohttps://query.library.utoronto.ca/index.php/search/q?kw=SubjectTerms:CL-HCO3%20EXCHANGE

Search Articles | University of Toronto LibrariesSearch Articles | University of Toronto Libraries

Antiporters - genetics , Fluorescent Antibody Technique , Bicarbonates - metabolism , Chloride-Bicarbonate Antiporters , Mice ... Antiporters - genetics , Chloride-Bicarbonate Antiporters , Transcription, Genetic , Gastrins - blood , In Situ Nick-End ... Full Text Immunohistochemical detection of chloride/bicarbonate anion exchangers in human liver ... Full Text Immunohistochemical detection of chloride/bicarbonate anion exchangers in human liver ...
more infohttps://query.library.utoronto.ca/index.php/search/q?kw=Author:Mart%C3%ADnez-Ans%C3%B3,%20Eduardo

Renal Tubular Acidosis (RTA) | Pediatrics Clerkship | The University of ChicagoRenal Tubular Acidosis (RTA) | Pediatrics Clerkship | The University of Chicago

Bicarbonate ion is transported into the blood by the by the chloride-bicarbonate anti-porter AE1 ... This can be done using a BMP (Na+, Cl-, and bicarbonate). * Serum potassium levels can aid in distinguishing RTA types I and IV ... The newly created bicarbonate is passively transported into the blood along with sodium by the co-transporter NBC-1 ... A reduced reabsorption of bicarbonate in the proximal tubule * ​Often secondary to a failure of the renal tubule cells to ...
more infohttps://pedclerk.bsd.uchicago.edu/page/renal-tubular-acidosis-rta

GI VII Flashcards by Jane Schumacher | BrainscapeGI VII Flashcards by Jane Schumacher | Brainscape

This drives the antiporter that exchanges chloride ions for bicarbonate.. H+ is transported into blood by Na+ -H+ exchanger ( ... Two sources for bicarbonate: Some taken across basolateral membrane via symporter NBC-1 (Na-bicarbonate cotransporter type 1). ... As a result, the bicarbonate secretory process is defective - CFTR not functional.. This results in a decrease in pancreatic ... Secretin then stimulates secretion of bicarbonate - results in increase of pH in the intestinal lumen.. This then produces ...
more infohttps://www.brainscape.com/flashcards/gi-vii-4957642/packs/7288446

Balance, Disturbances, and Analysis - The Urinary System | CourseraBalance, Disturbances, and Analysis - The Urinary System | Coursera

bicarbonate. That new bicarbonate then is extruded from the cells using the chloride bicarbonate antiporter. ... The new bicarbonate is then delivered to the blood using our chloride bicarbonate ... also are making bicarbonate. And that bicarbonate then this is new ... anhydrase, we can generate bicarbonate. And this is new bicarbonate. ...
more infohttps://zh.coursera.org/lecture/physiology/balance-disturbances-and-analysis-3NVrS

MicroRNA profiling predicts survival in anti-EGFR treated chemorefractory metastatic colorectal cancer patients with wild-type...MicroRNA profiling predicts survival in anti-EGFR treated chemorefractory metastatic colorectal cancer patients with wild-type...

Chloride-Bicarbonate Antiporters/biosynthesis. *Chloride-Bicarbonate Antiporters/genetics. *Cluster Analysis. *Colorectal ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/23098991?dopt=Abstract

Anion antiport mechanism is involved in transport of lactic acid across intestinal epithelial brush-border membrane.  - PubMed ...Anion antiport mechanism is involved in transport of lactic acid across intestinal epithelial brush-border membrane. - PubMed ...

Chloride-Bicarbonate Antiporters. *Hydrogen-Ion Concentration. *Intestinal Absorption. *Intestinal Mucosa/metabolism*. *Jejunum ... but not by the anion antiporter. The initial uptakes of L-[(14)C]lactic acid which are driven by bicarbonate ion and proton ... lactic acid by BBMVs showed an overshoot phenomenon in the presence of outward-directed bicarbonate and/or inward-directed ... lactic acid uptake revealed the involvement of two saturable processes in the presence of both proton and bicarbonate gradients ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/11018672?dopt=Abstract

Welcome to CDC stacks | Molecular insights into the progression of crystalline silica-induced pulmonary toxicity in rats -...Welcome to CDC stacks | Molecular insights into the progression of crystalline silica-induced pulmonary toxicity in rats -...

Chloride-Bicarbonate Antiporters Disease Progression Gene Expression Gene Expression Regulation Inflammation Male Mucus ...
more infohttps://stacks.cdc.gov/view/cdc/36821

General Concepts and Renal Tubule Function - The Urinary System | CourseraGeneral Concepts and Renal Tubule Function - The Urinary System | Coursera

enter into the blood and chloride enters into the cell.. So we use an antiporter to move the bicarbonate out of the cells and ... This bicarbonate then is now on the inside of the cell.. And this bicarbonate leaves at the basal surface with an anti-porter, ... that the tubules do not have a transporter for bicarbonate.. But that we can convert the bicarbonate and the proton into ... But that the absorption of filtered bicarbonate in the proximal convoluted. tubule takes up the majority of the bicarbonate ...
more infohttps://es.coursera.org/learn/physiology/lecture/83v0d/general-concepts-and-renal-tubule-function

General Concepts and Renal Tubule Function - The Urinary System | CourseraGeneral Concepts and Renal Tubule Function - The Urinary System | Coursera

enter into the blood and chloride enters into the cell. So we use an antiporter to move the bicarbonate out of the cells and ... And this bicarbonate leaves at the basal surface with an anti-porter, ... that the tubules do not have a transporter for bicarbonate. But that we can convert the bicarbonate and the proton into ... But that the absorption of filtered bicarbonate in the proximal convoluted tubule takes up the majority of the bicarbonate ...
more infohttps://zh.coursera.org/lecture/physiology/general-concepts-and-renal-tubule-function-83v0d

General Concepts and Renal Tubule Function - The Urinary System | CourseraGeneral Concepts and Renal Tubule Function - The Urinary System | Coursera

enter into the blood and chloride enters into the cell. So we use an antiporter to move the bicarbonate out of the cells and ... And this bicarbonate leaves at the basal surface with an anti-porter, ... that the tubules do not have a transporter for bicarbonate. But that we can convert the bicarbonate and the proton into ... But that the absorption of filtered bicarbonate in the proximal convoluted tubule takes up the majority of the bicarbonate ...
more infohttps://es.coursera.org/lecture/physiology/general-concepts-and-renal-tubule-function-83v0d

Intracellular cations modulate noradrenaline-stimulated calcium entry into smooth muscle cells of rat portal vein. - Semantic...Intracellular cations modulate noradrenaline-stimulated calcium entry into smooth muscle cells of rat portal vein. - Semantic...

Chloride-Bicarbonate Antiporters. *D-600. *Muscarinic Acetylcholine Receptor. *Dyes. *infliximab. *Plasma membrane ... Calcium-dependence of the calcium-activated chloride current in smooth muscle cells of rat portal vein. *Pierre Pacaud, ...
more infohttps://www.semanticscholar.org/paper/Intracellular-cations-modulate-calcium-entry-into-Pacaud-Loirand/a2b4404b1e9966c30e92c1e40ba6eadde146963c