Electroneutral chloride bicarbonate exchangers that allow the exchange of BICARBONATE IONS exchange for CHLORIDE IONS across the cellular membrane. The action of specific antiporters in this class serve important functions such as allowing the efficient exchange of bicarbonate across red blood cell membranes as they passage through capillaries and the reabsorption of bicarbonate ions by the kidney.
Inorganic salts that contain the -HCO3 radical. They are an important factor in determining the pH of the blood and the concentration of bicarbonate ions is regulated by the kidney. Levels in the blood are an index of the alkali reserve or buffering capacity.
Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.
Bicarbonate transporters that move BICARBONATE IONS in exchange of CHLORIDE IONS or SODIUM IONS across membranes. They regulate acid-base HOMEOSTASIS, cell volume and intracellular pH. Members include CHLORIDE-BICARBONATE ANTIPORTERS (SLC4A1, 2, 3, and 9); SODIUM-COUPLED BICARBONATE TRANSPORTERS (SLC4A4 and 5, 7, 8 and 10); and a sodium borate cotransporter (SLC4A11 protein).
Inorganic compounds derived from hydrochloric acid that contain the Cl- ion.
A major integral transmembrane protein of the ERYTHROCYTE MEMBRANE. It is the anion exchanger responsible for electroneutral transporting in CHLORIDE IONS in exchange of BICARBONATE IONS allowing CO2 uptake and transport from tissues to lungs by the red blood cells. Genetic mutations that result in a loss of the protein function have been associated with type 4 HEREDITARY SPHEROCYTOSIS.
Membrane proteins whose primary function is to facilitate the transport of negatively charged molecules (anions) across a biological membrane.
A white, crystalline powder that is commonly used as a pH buffering agent, an electrolyte replenisher, systemic alkalizer and in topical cleansing solutions.
Membrane proteins that allow the exchange of hydrogen ions for potassium ions across the cellular membrane. The action of these antiporters influences intracellular pH and potassium ion homeostasis.
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.
Cell membrane glycoproteins that form channels to selectively pass chloride ions. Nonselective blockers include FENAMATES; ETHACRYNIC ACID; and TAMOXIFEN.
A ubiquitous sodium salt that is commonly used to season food.
A genus of ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES.
A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.
Metals that constitute group 1(formerly group Ia) of the periodic table. They are the most strongly electropositive of the metals. Note that HYDROGEN is not considered an alkali metal even though it falls under the group 1 heading in the periodic table.
A salt of lithium that has been used experimentally as an immunomodulator.
The balance between acids and bases in the BODY FLUIDS. The pH (HYDROGEN-ION CONCENTRATION) of the arterial BLOOD provides an index for the total body acid-base balance.
An element in the alkali metals family. It has the atomic symbol Li, atomic number 3, and atomic weight [6.938; 6.997]. Salts of lithium are used in treating BIPOLAR DISORDER.
A pathological condition that removes acid or adds base to the body fluids.
A pathologic condition of acid accumulation or depletion of base in the body. The two main types are RESPIRATORY ACIDOSIS and metabolic acidosis, due to metabolic acid build up.
A gas that has been used as an aerosol propellant and is the starting material for polyvinyl resins. Toxicity studies have shown various adverse effects, particularly the occurrence of liver neoplasms.
An element in the alkali group of metals with an atomic symbol K, atomic number 19, and atomic weight 39.10. It is the chief cation in the intracellular fluid of muscle and other cells. Potassium ion is a strong electrolyte that plays a significant role in the regulation of fluid volume and maintenance of the WATER-ELECTROLYTE BALANCE.
Positively charged atoms, radicals or group of atoms with a valence of plus 1, which travel to the cathode or negative pole during electrolysis.
Usually a hydroxide of lithium, sodium, potassium, rubidium or cesium, but also the carbonates of these metals, ammonia, and the amines. (Grant & Hackh's Chemical Dictionary, 5th ed)
The movement of ions across energy-transducing cell membranes. Transport can be active, passive or facilitated. Ions may travel by themselves (uniport), or as a group of two or more ions in the same (symport) or opposite (antiport) directions.
The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.
Proteins that cotransport sodium ions and bicarbonate ions across cellular membranes.
Integral membrane proteins that transport protons across a membrane. This transport can be linked to the hydrolysis of ADENOSINE TRIPHOSPHATE. What is referred to as proton pump inhibitors frequently is about POTASSIUM HYDROGEN ATPASE.
Substances produced from the reaction between acids and bases; compounds consisting of a metal (positive) and nonmetal (negative) radical. (Grant & Hackh's Chemical Dictionary, 5th ed)
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The first chemical element in the periodic table. It has the atomic symbol H, atomic number 1, and atomic weight [1.00784; 1.00811]. It exists, under normal conditions, as a colorless, odorless, tasteless, diatomic gas. Hydrogen ions are PROTONS. Besides the common H1 isotope, hydrogen exists as the stable isotope DEUTERIUM and the unstable, radioactive isotope TRITIUM.
Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.
A colorless, odorless gas that can be formed by the body and is necessary for the respiration cycle of plants and animals.
A polyvinyl resin used extensively in the manufacture of plastics, including medical devices, tubing, and other packaging. It is also used as a rubber substitute.
A genus of ascomycetous yeast in the family Dipodascaceae, order SACCHAROMYCETALES.
One of the CARBONIC ANHYDRASE INHIBITORS that is sometimes effective against absence seizures. It is sometimes useful also as an adjunct in the treatment of tonic-clonic, myoclonic, and atonic seizures, particularly in women whose seizures occur or are exacerbated at specific times in the menstrual cycle. However, its usefulness is transient often because of rapid development of tolerance. Its antiepileptic effect may be due to its inhibitory effect on brain carbonic anhydrase, which leads to an increased transneuronal chloride gradient, increased chloride current, and increased inhibition. (From Smith and Reynard, Textbook of Pharmacology, 1991, p337)
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
A chemical system that functions to control the levels of specific ions in solution. When the level of hydrogen ion in solution is controlled the system is called a pH buffer.
Proteins obtained from ESCHERICHIA COLI.
Positively charged atoms, radicals or groups of atoms which travel to the cathode or negative pole during electrolysis.
An acidifying agent that has expectorant and diuretic effects. Also used in etching and batteries and as a flux in electroplating.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Stable elementary particles having the smallest known positive charge, found in the nuclei of all elements. The proton mass is less than that of a neutron. A proton is the nucleus of the light hydrogen atom, i.e., the hydrogen ion.
Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.
A family of zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide. They play an important role in the transport of CARBON DIOXIDE from the tissues to the LUNG. EC 4.2.1.1.
The physical or physiological processes by which substances, tissue, cells, etc. take up or take in other substances or energy.
An inhibitor of anion conductance including band 3-mediated anion transport.
Proteins found in any species of bacterium.
Mercury chloride (HgCl2). A highly toxic compound that volatizes slightly at ordinary temperature and appreciably at 100 degrees C. It is corrosive to mucous membranes and used as a topical antiseptic and disinfectant.
The processes whereby the internal environment of an organism tends to remain balanced and stable.
A salt used to replenish calcium levels, as an acid-producing diuretic, and as an antidote for magnesium poisoning.
A class of compounds that reduces the secretion of H+ ions by the proximal kidney tubule through inhibition of CARBONIC ANHYDRASES.
A carbonic anhydrase inhibitor used as diuretic and in glaucoma. It may cause hypokalemia.
The rate dynamics in chemical or physical systems.
A chlorinated hydrocarbon that has been used as an inhalation anesthetic and acts as a narcotic in high concentrations. Its primary use is as a solvent in manufacturing and food technology.
Solutions prepared for exchange across a semipermeable membrane of solutes below a molecular size determined by the cutoff threshold of the membrane material.
A white crystal or crystalline powder used in BUFFERS; FERTILIZERS; and EXPLOSIVES. It can be used to replenish ELECTROLYTES and restore WATER-ELECTROLYTE BALANCE in treating HYPOKALEMIA.
Respiratory retention of carbon dioxide. It may be chronic or acute.
Transport proteins that carry specific substances in the blood or across cell membranes.
Protein-lipid combinations abundant in brain tissue, but also present in a wide variety of animal and plant tissues. In contrast to lipoproteins, they are insoluble in water, but soluble in a chloroform-methanol mixture. The protein moiety has a high content of hydrophobic amino acids. The associated lipids consist of a mixture of GLYCEROPHOSPHATES; CEREBROSIDES; and SULFOGLYCOSPHINGOLIPIDS; while lipoproteins contain PHOSPHOLIPIDS; CHOLESTEROL; and TRIGLYCERIDES.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
A flavoprotein and iron sulfur-containing oxidoreductase complex that catalyzes the conversion of UBIQUINONE to ubiquinol. In MITOCHONDRIA the complex also couples its reaction to the transport of PROTONS across the internal mitochondrial membrane. The NADH DEHYDROGENASE component of the complex can be isolated and is listed as EC 1.6.99.3.
The relationships of groups of organisms as reflected by their genetic makeup.
The portion of renal tubule that begins from the enlarged segment of the ascending limb of the LOOP OF HENLE. It reenters the KIDNEY CORTEX and forms the convoluted segments of the distal tubule.
Disturbances in the ACID-BASE EQUILIBRIUM of the body.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
A peptide hormone of about 27 amino acids from the duodenal mucosa that activates pancreatic secretion and lowers the blood sugar level. (USAN and the USP Dictionary of Drug Names, 1994, p597)
A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.
Negatively charged atoms, radicals or groups of atoms which travel to the anode or positive pole during electrolysis.
A state due to excess loss of carbon dioxide from the body. (Dorland, 27th ed)
The shortest and widest portion of the SMALL INTESTINE adjacent to the PYLORUS of the STOMACH. It is named for having the length equal to about the width of 12 fingers.
A mixture of alkylbenzyldimethylammonium compounds. It is a bactericidal quaternary ammonium detergent used topically in medicaments, deodorants, mouthwashes, as a surgical antiseptic, and as a as preservative and emulsifier in drugs and cosmetics.
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
The fluid containing digestive enzymes secreted by the pancreas in response to food in the duodenum.
Salts or ions of the theoretical carbonic acid, containing the radical CO2(3-). Carbonates are readily decomposed by acids. The carbonates of the alkali metals are water-soluble; all others are insoluble. (From Grant & Hackh's Chemical Dictionary, 5th ed)
A group of genetic disorders of the KIDNEY TUBULES characterized by the accumulation of metabolically produced acids with elevated plasma chloride, hyperchloremic metabolic ACIDOSIS. Defective renal acidification of URINE (proximal tubules) or low renal acid excretion (distal tubules) can lead to complications such as HYPOKALEMIA, hypercalcinuria with NEPHROLITHIASIS and NEPHROCALCINOSIS, and RICKETS.
Substances that dissociate into two or more ions, to some extent, in water. Solutions of electrolytes thus conduct an electric current and can be decomposed by it (ELECTROLYSIS). (Grant & Hackh's Chemical Dictionary, 5th ed)
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Inorganic compounds that contain potassium as an integral part of the molecule.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.
Treatment process involving the injection of fluid into an organ or tissue.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
The renal tubule portion that extends from the BOWMAN CAPSULE in the KIDNEY CORTEX into the KIDNEY MEDULLA. The proximal tubule consists of a convoluted proximal segment in the cortex, and a distal straight segment descending into the medulla where it forms the U-shaped LOOP OF HENLE.
A dipolar ionic buffer.
A chloride channel that regulates secretion in many exocrine tissues. Abnormalities in the CFTR gene have been shown to cause cystic fibrosis. (Hum Genet 1994;93(4):364-8)
A cytosolic carbonic anhydrase isoenzyme found widely distributed in cells of almost all tissues. Deficiencies of carbonic anhydrase II produce a syndrome characterized by OSTEOPETROSIS, renal tubular acidosis (ACIDOSIS, RENAL TUBULAR) and cerebral calcification. EC 4.2.1.-
Long convoluted tubules in the nephrons. They collect filtrate from blood passing through the KIDNEY GLOMERULUS and process this filtrate into URINE. Each renal tubule consists of a BOWMAN CAPSULE; PROXIMAL KIDNEY TUBULE; LOOP OF HENLE; DISTAL KIDNEY TUBULE; and KIDNEY COLLECTING DUCT leading to the central cavity of the kidney (KIDNEY PELVIS) that connects to the URETER.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.
The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.
Reversible chemical reaction between a solid, often one of the ION EXCHANGE RESINS, and a fluid whereby ions may be exchanged from one substance to another. This technique is used in water purification, in research, and in industry.
A cadmium halide in the form of colorless crystals, soluble in water, methanol, and ethanol. It is used in photography, in dyeing, and calico printing, and as a solution to precipitate sulfides. (McGraw-Hill Dictionary of Scientific and Technical Terms, 5th ed)
The balance of fluid in the BODY FLUID COMPARTMENTS; total BODY WATER; BLOOD VOLUME; EXTRACELLULAR SPACE; INTRACELLULAR SPACE, maintained by processes in the body that regulate the intake and excretion of WATER and ELECTROLYTES, particularly SODIUM and POTASSIUM.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
The movement of materials across cell membranes and epithelial layers against an electrochemical gradient, requiring the expenditure of metabolic energy.
A strong corrosive acid that is commonly used as a laboratory reagent. It is formed by dissolving hydrogen chloride in water. GASTRIC ACID is the hydrochloric acid component of GASTRIC JUICE.
A non-penetrating amino reagent (commonly called SITS) which acts as an inhibitor of anion transport in erythrocytes and other cells.
Solutions prepared for hemodialysis. The composition of the pre-dialysis solution may be varied in order to determine the effect of solvated metabolites on anoxia, malnutrition, acid-base balance, etc. Of principal interest are the effect of the choice of buffers (e.g., acetate or carbonate), the addition of cations (Na+, K+, Ca2+), and addition of carbohydrates (glucose).
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
Salts of hydrobromic acid, HBr, with the bromine atom in the 1- oxidation state. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Proteins prepared by recombinant DNA technology.
The functional hereditary units of BACTERIA.
The concentration of osmotically active particles in solution expressed in terms of osmoles of solute per liter of solution. Osmolality is expressed in terms of osmoles of solute per kilogram of solvent.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Salts or esters of LACTIC ACID containing the general formula CH3CHOHCOOR.
A pyrazine compound inhibiting SODIUM reabsorption through SODIUM CHANNELS in renal EPITHELIAL CELLS. This inhibition creates a negative potential in the luminal membranes of principal cells, located in the distal convoluted tubule and collecting duct. Negative potential reduces secretion of potassium and hydrogen ions. Amiloride is used in conjunction with DIURETICS to spare POTASSIUM loss. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p705)
Proteins found in any species of fungus.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Solutions having the same osmotic pressure as blood serum, or another solution with which they are compared. (From Grant & Hackh's Chemical Dictionary, 5th ed & Dorland, 28th ed)
The voltage differences across a membrane. For cellular membranes they are computed by subtracting the voltage measured outside the membrane from the voltage measured inside the membrane. They result from differences of inside versus outside concentration of potassium, sodium, chloride, and other ions across cells' or ORGANELLES membranes. For excitable cells, the resting membrane potentials range between -30 and -100 millivolts. Physical, chemical, or electrical stimuli can make a membrane potential more negative (hyperpolarization), or less negative (depolarization).
Benzoic acid or benzoic acid esters substituted with one or more nitro groups.

Topology of the membrane domain of human erythrocyte anion exchange protein, AE1. (1/355)

Anion exchanger 1 (AE1) is the chloride/bicarbonate exchange protein of the erythrocyte membrane. By using a combination of introduced cysteine mutants and sulfhydryl-specific chemistry, we have mapped the topology of the human AE1 membrane domain. Twenty-seven single cysteines were introduced throughout the Leu708-Val911 region of human AE1, and these mutants were expressed by transient transfection of human embryonic kidney cells. On the basis of cysteine accessibility to membrane-permeant biotin maleimide and to membrane-impermeant lucifer yellow iodoacetamide, we have proposed a model for the topology of AE1 membrane domain. In this model, AE1 is composed of 13 typical transmembrane segments, and the Asp807-His834 region is membrane-embedded but does not have the usual alpha-helical conformation. To identify amino acids that are important for anion transport, we analyzed the anion exchange activity for all introduced cysteine mutants, using a whole cell fluorescence assay. We found that mutants G714C, S725C, and S731C have very low transport activity, implying that this region has a structurally and/or catalytically important role. We measured the residual anion transport activity after mutant treatment with the membrane-impermeant, cysteine-directed compound, sodium (2-sulfonatoethyl)methanethiosulfonate) (MTSES). Only two mutants, S852C and A858C, were inhibited by MTSES, indicating that these residues may be located in a pore-lining region.  (+info)

Na+/H+ antiporter activity in hamster embryos is activated during fertilization. (2/355)

This study characterized the activation of the regulatory activity of the Na+/H+ antiporter during fertilization of hamster embryos. Hamster oocytes appeared to lack any mechanism for the regulation of intracellular pH in the acid range. Similarly, no Na+/H+ antiporter activity could be detected in embryos that were collected from the reproductive tract between 1 and 5 h post-egg activation (PEA). Activity of the Na+/H+ antiporter was first detected in embryos collected at 5.5 h PEA and gradually increased to reach maximal activity in embryos collected at 7 h PEA. Parthenogenetically activated one-cell and two-cell embryos demonstrate Na+/H+ antiporter activity, indicating that antiporter activity is maternally derived and initiated by activation of the egg. The inability of cycloheximide, colchicine, or cytochalasin D to affect initiation of antiporter activity indicates that antiporter appearance is not dependent on the synthesis of new protein or recruitment of existing protein to the cell membrane. In contrast, incubation of one-cell embryos with sphingosine did inhibit the appearance of Na+/H+ antiporter activity, showing that inhibition of normal protein kinase C activity is detrimental to antiporter function. Furthermore, incubation of oocytes with a phorbol ester which stimulates protein kinase C activity induced Na+/H+ antiporter activity in oocytes in which the activity was previously absent. Incubation with an intracellular calcium chelator also reduced the appearance of antiporter activity. Taken together, these data indicate that the appearance of Na+/H+ antiporter activity following egg activation may be due, at least in part, to regulation by protein kinase C and intracellular calcium levels.  (+info)

Intracellular pH regulation by HCO3-/Cl- exchange is activated during early mouse zygote development. (3/355)

We report here that at least one major pHi-regulatory mechanism, the HCO3-/Cl- exchanger, is quiescent in unfertilized mouse eggs but becomes fully activated during early development following fertilization. Zygotes (8-12 h postfertilization) exhibited a marked intracellular alkalinization upon external Cl- removal, which is indicative of active HCO3-/Cl- exchangers, in contrast to the very small response observed in eggs. In addition, efflux of Cl- from eggs upon external Cl- removal was much slower than that from zygotes, indicating additional pathways for Cl- to cross the plasma membrane in zygotes. Furthermore, while zygotes quickly recovered from an induced alkalosis, eggs exhibited only a slow, incomplete recovery. Following in vitro fertilization (IVF), increased HCO3-/Cl- exchanger activity was first detectable about 4 h postfertilization and reached the maximal level after about 8 h. The upregulation of HCO3-/Cl- exchanger activity after fertilization appeared to occur by activation of existing, inactive exchangers rather than by synthesis or transport of new exchangers, as the increase in activity following IVF was unaffected by inhibition of protein synthesis or by disruption of the Golgi apparatus or the cytoskeleton. This activation may depend on the Ca2+ transients which follow fertilization, as suppression of these transients, using the Ca2+ chelator BAPTA, reduced subsequent upregulation of HCO3-/Cl- exchanger activity by about 50%. Activation of pHi-regulatory systems may be a widespread feature of the earliest period of embryonic development, not restricted to species such as marine invertebrates as previously believed.  (+info)

Transmembrane folding of the human erythrocyte anion exchanger (AE1, Band 3) determined by scanning and insertional N-glycosylation mutagenesis. (4/355)

The human erythrocyte anion exchanger (AE1, Band 3) contains up to 14 transmembrane segments, with a single site of N-glycosylation at Asn642 in extracellular (EC) loop 4. Scanning and insertional N-glycosylation mutagenesis were used to determine the folding pattern of AE1 in the membrane. Full-length AE1, when expressed in transfected human embryonic kidney (HEK)-293 or COS-7 cells, retained a high-mannose oligosaccharide structure. Scanning N-glycosylation mutagenesis of EC loop 4 showed that N-glycosylation acceptor sites (Asn-Xaa-Ser/Thr) spaced 12 residues from the ends of adjacent transmembrane segments could be N-glycosylated. An acceptor site introduced at position 743 in intracellular (IC) loop 5 that could be N-glycosylated in a cell-free translation system was not N-glycosylated in transfected cells. Mutations designed to disrupt the folding of this loop enhanced the level of N-glycosylation at Asn743 in vitro. The results suggest that this loop might be transiently exposed to the lumen of the endoplasmic reticulum during biosynthesis but normally folds rapidly, precluding N-glycosylation. EC loop 4 insertions into positions 428, 484, 754 and 854 in EC loops 1, 2, 6 and 7 respectively were efficiently N-glycosylated, showing that these regions were extracellular. EC loop 4 insertions into positions 731 or 785 were poorly N-glycosylated, which was inconsistent with an extracellular disposition for these regions of AE1. Insertion of EC loop 4 into positions 599 and 820 in IC loops 3 and 6 respectively were not N-glycosylated in cells, which was consistent with a cytosolic disposition for these loops. Inhibitor-affinity chromatography with 4-acetamido-4'-isothiocyanostilbene-2,2'-disulphonate (SITS)-Affi-Gel was used to assess whether the AE1 mutants were in a native state. Mutants with insertions at positions 428, 484, 599, 731 and 785 showed impaired inhibitor binding, whereas insertions at positions 754, 820 and 854 retained binding. The results indicate that the folding of the C-terminal region of AE1 is more complex than originally proposed and that this region of the transporter might have a dynamic aspect.  (+info)

Transport characteristics of the apical anion exchanger of rabbit cortical collecting duct beta-cells. (5/355)

To functionally characterize transport properties of the apical anion exchanger of rabbit beta-intercalated cells, the mean change in anion exchange activity, dpHi/dt (where pHi is intracellular pH), was measured in response to lumen Cl- replacement with gluconate in perfused cortical collecting ducts (CCDs). beta-Cell apical anion exchange was not affected by 15-min exposure to 0.2 mM lumen DIDS in the presence of 115 mM Cl-. In contrast, apical anion exchange was significantly inhibited by 0.1 mM lumen DIDS in the absence of Cl-. beta-Cell apical anion exchange was unchanged by 15 mM maleic anhydride, 10 mM phenylglyoxal, 0.2 mM niflumic acid, 1 mM edecrin, 1 mM furosemide, 1 mM probenecid, or 0.1 mM diphenylamine-2-carboxylate. However, beta-cell apical anion exchange was inhibited by alpha-cyano-4-hydroxycinnamic acid, with an IC50 of 2.4 mM. Substitution of either sulfate or gluconate for lumen Cl- resulted in a similar rate of alkalinization. Conversely, pHi was unchanged by substitution of sulfate for lumen gluconate, confirming the lack of transport of sulfate on the beta-cell apical anion exchanger. Taken together, the results demonstrate a distinct "fingerprint" of the rabbit CCD beta-cell apical anion exchanger that is unlike that of other known anion exchangers.  (+info)

HLA-DMB expression by thyrocytes: indication of the antigen-processing and possible presenting capability of thyroid cells. (6/355)

Expression of HLA class II molecules on thyrocytes is a characteristic feature of autoimmune thyroid disease and may lead the thyroid cells to present autoantigens to CD4+ T lymphocytes. Since HLA-DM is a critical molecule in class II-restricted antigen processing and presentation, we assessed the expression of HLA-DMB, -invariant chain (Ii), class II transactivator (CIITA) and DRA in an untransformed, pure thyrocyte strain HTV-59A. Here we report that both HLA-DMB mRNA and the protein are expressed in thyrocytes and that CIITA expression is enhanced by interferon-gamma (IFN-gamma) treatment and occurs before DMB, Ii and DRA up-regulation, suggesting CIITA expression is a requirement for antigen processing in thyrocytes. These results indicate that thyrocytes are capable of antigen processing and possibly antigen presentation to T cells.  (+info)

A spliced variant of AE1 gene encodes a truncated form of Band 3 in heart: the predominant anion exchanger in ventricular myocytes. (7/355)

The anion exchangers (AE) are encoded by a multigenic family that comprises at least three genes, AE1, AE2 and AE3, and numerous splicoforms. Besides regulating intracellular pH (pHi) via the Cl-/HCO3- exchange, the AEs exert various cellular functions including generation of a senescent antigen, anchorage of the cytoskeleton to the membrane and regulation of metabolism. Most cells express several AE isoforms. Despite the key role of this family of proteins, little is known about the function of specific AE isoforms in any tissue, including the heart. We therefore chose isolated cardiac cells, in which a tight control of pHi is mandatory for the excitation-contraction coupling process, to thoroughly investigate the expression of the AE genes at both the mRNA and protein levels. RT-PCR revealed the presence of AE1, AE2 and AE3 mRNAs in both neonatal and adult rat cardiomyocytes. AE1 is expressed both as the erythroid form (Band 3 or eAE1) and a novel alternate transcript (nAE1), which was more specifically characterized using a PCR mapping strategy. Two variants of AE2 (AE2a and AE2c) were found at the mRNA level. Cardiac as well as brain AE3 mRNAs were expressed in both neonatal and adult rat cardiomyocytes. Several AE protein isoforms were found, including a truncated form of AE1 and two AE3s, but there was no evidence of AE2 protein in adult rat cardiomyocytes. In cardiomyocytes transfected with an AE3 oligodeoxynucleotide antisense, AE3 immunoreactivity was dramatically decreased but the activity of the Cl-/HCO3- exchange was unchanged. In contrast, intracellular microinjection of blocking anti-AE1 antibodies inhibited the AE activity. Altogether, our findings suggest that a specific and novel AE1 splicoform (nAE1) mediates the cardiac Cl-/HCO3- exchange. The multiple gene and protein expression within the same cell type suggest numerous functions for this protein family.  (+info)

Parietal cells express high levels of Na-K-2Cl cotransporter on migrating into the gastric gland neck. (8/355)

Na-K-2Cl cotransport and Cl/HCO3 exchange are prominent mechanisms for Cl- uptake in Cl--secreting epithelial cells. We used immunofluorescence microscopy to delineate the distributions of Na-K-2Cl cotransporter-1 (NKCC1) and anion exchanger-2 (AE2) proteins in rat gastric mucosa (zymogenic zone). Parietal cells (PCs) above the neck of the gastric gland contained abundant AE2 but little or no NKCC1, whereas those in the neck and base contained high NKCC1 but diminished AE2. Lower levels of NKCC1 were detected in surface mucous cells and in cells comprising the blind ends of all glands. Pulse labeling of proliferating cells with bromodeoxyuridine indicated that new PCs originate in the isthmus with scant NKCC1; the subset of PCs that migrate downward expresses NKCC1 abruptly on entering the neck, within 7 days of cell division. Our results suggest that downwardly migrating PCs replace one mechanism for Cl- entry (Cl/HCO3 exchange) with another (Na-K-2Cl cotransport).  (+info)

The sodium-driven chloride/bicarbonate exchanger (NDCBE), a member of the SLC4 family of bicarbonate transporters, was recently found to modulate excitatory neurotransmission in hippocampus. et al., 2008). Comparable Na+-driven exchangers have been shown to regulate pH in invertebrate neuronal systems, including molluscan neurons and the squid giant axon (Boron and De Weer, 1976; Thomas, 1977). However, recent work raises the possibility that NDCBE may influence neurotransmission impartial of its effects on pH (Kim and Trussell, 2009). NDCBE and NDCBE-like activity has been detected in multiple brain regions in both rodents and humans (Baxter and Church, 1996; Chen et al., 2008; Damkier et al., 2007; Schwiening and Boron, 1994). The present study reveals a highly selective targeting of NDCBE to axon terminals, where it is closely associated with synaptic vesicles. Because NDCBE is an integral membrane protein, we conclude that this large majority of the vesicle-associated pool must be inserted ...
Signs of Congenital chloride diarrhea including medical signs and symptoms of Congenital chloride diarrhea, symptoms, misdiagnosis, tests, common medical issues, duration, and the correct diagnosis for Congenital chloride diarrhea signs or Congenital chloride diarrhea symptoms.
Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by life-long, severe diarrhea with intestinal Cl- malabsorption. It results from a reduced activity of the down regulated in adenoma exchanger (DRA), due to mutations in the solute carrier family 26, member 3 (SLC26A3) gene. Currently available therapies are not able to limit the severity of diarrhea in CLD. Conflicting results have been reported on the therapeutic efficacy of oral butyrate. We investigated the effect of oral butyrate (100 mg/kg/day) in seven CLD children with different SLC26A3 genotypes. Nasal epithelial cells were obtained to assess the effect of butyrate on the expression of the two main Cl- transporters: DRA and putative anion transporter-1 (PAT-1). A variable clinical response to butyrate was observed regarding the stool pattern and fecal ion loss. The best response was observed in subjects with missense and deletion mutations. Variable response to butyrate was also observed on SLC26A3 (DRA) and
Chloride is an anion in the human body needed for metabolism (the process of turning food into energy). It also helps keep the bodys acid-base balance. The amount of serum chloride is carefully controlled by the kidneys. Chloride ions have important physiological roles. For instance, in the central nervous system, the inhibitory action of glycine and some of the action of GABA relies on the entry of Cl− into specific neurons. Also, the chloride-bicarbonate exchanger biological transport protein relies on the chloride ion to increase the bloods capacity of carbon dioxide, in the form of the bicarbonate ion; this is the mechanism underpinning the chloride shift occurring as the blood passes through oxygen-consuming capillary beds. The normal blood reference range of chloride for adults in most labs is 96 to 106 milliequivalents (mEq) per liter. The normal range may vary slightly from lab to lab. Normal ranges are usually shown next to results in the lab report. A diagnostic test may use a ...
Cl-/HCO3- exchangers are expressed abundantly in cardiac muscle, suggesting that HCO3- extrusion serves an important function in heart. Mice lacking Anion Exchanger Isoform 3 (AE3), a major cardiac Cl-/HCO3- exchanger, appear healthy, but loss of AE3 causes decompensation in a hypertrophic cardiomyopathy (HCM) model. Using intra-ventricular pressure analysis, in vivo pacing, and molecular studies we identified physiological and biochemical changes caused by loss of AE3 that may contribute to decompensation in HCM. AE3-null mice had normal cardiac contractility under basal conditions and after -adrenergic stimulation, but pacing of hearts revealed that frequency-dependent inotropy was blunted, suggesting that AE3-mediated HCO3- extrusion is required for a robust force-frequency response (FFR) during acute biomechanical stress in vivo. Modest changes in expression of proteins that affect Ca2+-handling were observed, but Ca2+-transient analysis of AE3-null myocytes showed normal twitch-amplitude and Ca2
Genetic disruption of slc4a10, which encodes the sodium-dependent chloride/bicarbonate exchanger Ncbe, leads to a major decrease in Na+-dependent HCO3− import into choroid plexus epithelial cells in mice and to a marked reduction in brain intraventricular fluid volume. This suggests that Ncbe functionally is a key element in vectorial Na+ transport and thereby for cerebrospinal fluid secretion in the choroid plexus. However, slc4a10 disruption results in severe changes in expression of Na+,K+-ATPase complexes and other major transport proteins, indicating that profound cellular changes accompany the genetic manipulation. A tandem mass tag labeling strategy was chosen for quantitative mass spectrometry. Alterations in the broader patterns of protein expression in the choroid plexus in response to genetic disruption of Ncbe was validated by semi-quantitative immunoblotting, immunohistochemistry and morphometry. The abundance of 601 proteins were found significantly altered in the choroid plexus from
The cellular distributions of the kidney form of the erythrocyte band 3 chloride/bicarbonate exchanger and the kidney vacuolar H+-transporting ATPase were examined in rat kidney collecting duct by immunocytochemical staining of adjacent semithin sections. Polyclonal anti-peptide antibodies directed against two regions of murine erythroid band 3 gave a pattern of basolateral labeling similar to that seen with antibodies directed against the entire protein. In the medullary collecting duct almost all intercalated cells expressed basolateral membrane band 3 and displayed apical membrane H+-ATPase. In the cortical collecting duct and the connecting segment, band 3 labeling was restricted to a subpopulation of intercalcated cells. In the cortical collecting duct 46% of intercalated cells had apical H+-ATPase and basolateral band 3. Cells that had either basolateral or diffuse cytoplasmic staining for H+-ATPase were all band 3-negative and accounted for 53% of the intercalated cells. In addition, occasional
A collection of disease information resources and questions answered by our Genetic and Rare Diseases Information Specialists for Congenital chloride diarrhea
Worldwide, diarrhea claims several million lives annually, mostly those of infants. Although its incidence is much lower in the more affluent nations, diarrhea remains one of the two most common visits to pediatric emergency rooms and is also common among the institutionalized elderly. Diarrhea is caused by a decrease in net salt and fluid absorption, which can result from either a decrease in salt absorption or an increase in anion secretion, or both. The major pathway for sodium and water absorption in the intestine is thought involve Na+/H+ exchanger type 3 (NHE3) in the brush border membrane of enterocytes where it acts in concert with an anion exchanger to mediate electroneutral NaCl absorption. NHE3 is regulated by many factors, including bacterial toxins, steroids, insulin, cytokines, and osmotic stress. The precise mechanisms underlying the regulation of NHE3 are still under investigation, but emerging themes include transcriptional regulation, changes in phosphorylation of NHE3 ...
4,4-Diisothiocyano-2,2-stilbenedisulfonic acid (DIDS) is an anion exchange inhibitor, blocking reversibly, and later irreversibly, exchangers such as chloride-bicarbonate exchanger. Jessen, Flemming; Sjøholm, C; Hoffmann, EK (1986), Identification of the anion exchange protein of ehrlich cells: A kinetic analysis of the inhibitory effects of 4,4′-diisothiocyano-2,2′-stilbene-disulfonic acid (DIDS) and labeling of membrane proteins with3H-DIDS, Journal of Membrane Biology, 92 (3): 195, doi:10.1007/BF01869388, PMID 3783658 Lane, Michelle; Baltz, Jay M.; Bavister, Barry D. (1999), Bicarbonate/Chloride Exchange Regulates Intracellular pH of Embryos but Not Oocytes of the Hamster, Biology of Reproduction, 61 (2): 452-457, doi:10.1095/biolreprod61.2.452, PMID 10411526 ...
Results Forty-three patients (28M/15F) had CCD. Fifteen patients (35%) were diagnosed after one year of age (late referral or misdiagnosis as Bartter syndrome). Premature delivery in 24 cases (55.8%). Polyhydramnios in 26 pregnancies. All patients were distributed among 19 families with 33 children being the outcome of consanguineous marriages. Intractable diarrhea was the presenting symptom in 40patients (93%), Biochemical data revealed: Serum potassium (1.3-4.1, mean 2.4Mmol/l), s. chloride (39-95, mean76.2Mmol/l), s.bicarbonate (22-54) meam-37.6 Mmol/). Fecal chloride (134±21.6, mean±SD)(range 90-205). The fecal chloride over fecal sodium plus potassium ratio was 0.6 (1.1±0.3, mean ± SD)(N.=0.2). Associated disorders were: chronic renal failure 7 (16%), congenital anomalies 8 (19%), mental retardation4 (9.3%) seizures 8 (19%), and brain atrophy 4 (9%). Complications were seen mostly among patients with late referral or poor compliance. At diagnosis, 35 (81.4%) cases were below -2SD for ...
The protein encoded by this gene is a transmembrane glycoprotein that transports chloride ions across the cell membrane in exchange for bicarbonate ions. It is localized to the mucosa of the lower intestinal tract, particularly to the apical membrane of columnar epithelium and some goblet cells. The protein is essential for intestinal chloride absorption, and mutations in this gene have been associated with congenital chloride diarrhea. [provided by RefSeq, Oct 2008 ...
The CLCN5 gene provides instructions for making a protein called ClC-5 that transports charged atoms (ions) across cell membranes. Specifically, ClC-5 exchanges negatively charged atoms of chlorine (chloride ions) for positively charged atoms of hydrogen (protons or hydrogen ions). Based on this function, ClC-5 is known as a H+/Cl- exchanger.. ClC-5 is found primarily in the kidneys, particularly in structures called proximal tubules. These structures help to reabsorb nutrients, water, and other materials that have been filtered from the bloodstream. The kidneys reabsorb needed materials into the blood and excrete everything else into the urine.. Within proximal tubule cells, ClC-5 is embedded in specialized compartments called endosomes. Endosomes are formed at the cell surface to carry proteins and other molecules to their destinations within the cell. ClC-5 transports hydrogen ions into endosomes and chloride ions out, which helps these compartments maintain the proper acidity level (pH). ...
Get an answer for What causes a infant to have congential chloride diarrhea? and find homework help for other Science questions at eNotes
Disease: (OMIM: 126650 214700) Defects in SLC26A3 are the cause of diarrhea type 1 (DIAR1) [MIM:214700]; also known as congenital chloride diarrhea (CLD). DIAR1 is a disease characterized by voluminous watery stools containing an excess of chloride. The children with this disease are often premature ...
Mutations in several SLC26 transporters are linked to human diseases, most of which involve epithelia dysfunction in specific organs. This indicates that SLC26 transporters play a central role in transepithelial fluid and electrolyte transport, including Cl− absorption and HCO3− secretion by the kidney, the GI tract, and secretory glands (Kunzelmann and Mall, 2002; Ko et al., 2004; Melvin et al., 2005; Steward et al., 2005). To understand the function of the SLC26 transporters in epithelial Cl− absorption and HCO3− secretion, it is essential to know their transport mechanism and Cl−/HCO3− transport stoichiometry. Two of the most studied SLC26 transporters are slc26a3 and slc26a6. Both were shown to function as Cl−/HCO3− exchangers (Melvin et al., 1999; Ko et al., 2002; Wang et al., 2002) and as electrogenic transporters (Ko et al., 2002; Xie et al., 2002) with isoform-specific stoichiometry (Ko et al., 2002). However, the electrogenicity of the transporters was called into ...
Why should one think of freezing ones eggs? This text has been written for women between 30 and 40 years of age who are not yet thinking of having children- for whatever.... Read more ...
Ta funkcja została usunięta z jądra MediaWiki w wersji 1.18.0. Proszę zobaczyć alternatywny sposób użycia tej funkcji na Extension:Math. ...
Congenital Chloride diarrhea (CLD) is an intestinal transport defect of chloride ions. Retention of intestinal chloride causes water retention, which leads to watery diarrhea with an abnormally high chloride concentration. This defect presents in utero, with hydramnion presumably due to intrauterine diarrhea. The gestational period is shortened, and newborn babies have abdominal distension and chronic watery diarrhea. If untreated the condition leads to severe electrolyte changes with a fatal outcome, or to permanent damage of kidneys and brain. Treatment with chloride substitution and control of electrolyte balance is effective and patients can live an almost normal life complicated only by relatively loose stools.
Congenital chloride diarrhea is an autosomal recessive type of chronic diarrhea characterized by voluminous watery stool containing high levels of chloride. It can present in patients of any age from newborns to adults, but onset is most often in the first weeks to months of life. Clinically, congenital chloride diarrhea is similar to Bartter syndrome, except these patients do not have calcium dysregulation ...
Considering first the issue of Cl-versusNa+ uptake rates, the apparent discrepancy between in vitro and in vivo observations can be attributed to different concentrations of Cl- and Na+ in seawater. In general,Cl- concentrations exceed Na+ concentrations in seawater by ∼70 mmol l-1, which means that seawater ingestion results in higher gastrointestinal intake of Cl- than Na+. Further,desalinization in the esophagus occurs via both passive and active equimolar Na+ and Cl- absorption(Kirsch and Meister, 1982; Parmelee and Renfro, 1983; Smith, 1930; Wilson et al., 1996). With little or no transport across the gastric mucosa in starved fish, the consequence of the higher concentrations of Cl- than Na+in seawater and equal molar Na+ and Cl- absorption in the esophagus is that fluids entering the intestine contain higher concentrations of Cl- than Na+. However, while intestinal fluid Cl- concentrations remain higher than the corresponding Na+ concentrations as fluids move along the intestine, the ...
Defective regulation of cholangiocyte Cl-/HCO3(-) and Na+/H+ exchanger activities in primary biliary cirrhosis. Defective regulation of cholangiocyte Cl-/HCO3(-) and Na+/H+ exchanger activities in primary biliary cirrhosis
1. Na+/H+ antiport activity was measured in peripheral blood polymorphonuclear and mononuclear cells of 12 healthy subjects by using an intracellular pH clamp technique to determine the external Na(+)-dependent H+ efflux rate in cells loaded with a pH-sensitive fluorescent dye, bis(carboxyethyl)carboxyfluorescein. The change in external Na+ concentrations for all pH measurements was similar in both cell types. 2. A significant difference between the two types of cells was found, the polymorphonuclear leucocytes having a higher Na+/H+ antiport activity than the lymphocytes. Cellular intrinsic buffering capacity measured in the absence of HCO3- was also higher in the polymorphonuclear cells than in the lymphocytes. 3. These differences may be associated with a difference in the role of the Na+/H+ exchanger in these two types of cells, although in vivo the presence of HCO3-/Cl- exchangers may also contribute to intracellular pH homoeostasis.
Use shRNA set against Human SLC35E1(NM_024881.4) for fast, easy, and consistent DNA/RNA Purification, Antibody/Protein Purification, Cell Isolation.
Objective. The anion exchanger gene (AE1) or band 3 encodes a chloride-bicarbonate (Cl−/HCO3−) exchanger expressed in the erythrocyte and in the renal α-intercalated cells involved in urine acidification. The purpose of the present study was to screen for mutations in the AE1 gene in 2 brothers (10 and 15 years of age) with familial distal renal tubular acidosis (dRTA), nephrocalcinosis, and failure to thrive.. Methods. AE1 mutations were screened by single-strand conformation polymorphism, cloning, and sequencing.. Results. A complete form of dRTA was confirmed in the 2 affected brothers and an incomplete form in their father. All 3 were heterozygous for a novel 20-bp deletion in exon 20 of the AE1 gene. This deletion resulted in 1 mutation in codon 888 (Ala-888→Leu) followed by a premature termination codon at position 889, truncating the protein by 23 amino acids. As band 3 deficiency might lead to spherocytic hemolytic anemia or ovalocytosis, erythrocyte abnormalities were also ...
May 2019. By integrating PELDOR measurements and in vitro transport studies with structural modeling and refinement using molecular dynamics simulation, Frankfurt scientists determined the architecture of an important type of membrane-embedded cellular solute carrier and characterized its functional relevance.. The solute carrier family 26 (SLC26) facilitates the transport of a broad variety of organic and inorganic anions in cells. Members of this family of protein complexes are found in all kingdoms of life and operate predominantly as secondary transporters (symporters and exchangers). The relevance of the SLC26 family in maintaining anion equilibria is underlined by the causative role of mammalian SLC26 proteins in diseases such as congenital chloride diarrhea and cytotoxic brain edema.. The SLC26 family shares a 7 + 7 transmembrane segments inverted repeat architecture (7TMIR) with the SLC4 and SLC23 families, but holds a regulatory STAS domain in addition. While the only experimental SLC26 ...
MOVICOL Flavour Free 30 pack Macrogol Plus Electrolytes for constipation. Effective relief from constipation, treatment of chronic constipation and resolution of faecal impaction. MOVICOL is a very effective laxative that works in harmony with your bodys own processes, to gently restore healthy bowel movements. Its suitable for all kinds of constipation and people, easy to prepare and use, and comes in a wide range of flavours. You may have previously used MOVICOL on the advice of a..
Previous studies have shown that the electroneutral Na(+)/HCO(3) (-) cotransporter NBCn2 (SLC4A10) is predominantly expressed in the central nervous system (CNS). The physiological and pathological significances of NBCn2 have been well recognized. However, little is known about the tissue specificity of expression of different NBCn2 variants. Moreover, little is known about the expression of NBCn2 proteins in systems other than CNS. Here, we identified a set of novel Slc4a10 variants differing from the originally described ones by containing a distinct 5 untranslated region encoding a new extreme amino-terminus (Nt). Electrophysiology measurements showed that both NBCn2 variants with alternative Nt contain typical electroneutral Na(+)-coupled HCO(3) (-) transport activity in Xenopus oocytes. Luciferase reporter assay showed that Slc4a10 contains two alternative promoters responsible for expression of the two types of NBCn2 with distinct extreme Nt. Western blotting showed that NBCn2 proteins ...
SLC9A1 (NHE1), a member of the Na+/H+ exchanger family, is a ubiquitous membrane protein that regulates intracellular pH and cell volume. Furthermore, SLC9A1 is known to
Book an appointment with Dra. Raquel Ancin Viguiristi. Find verified patient reviews, where to go, insurers, prices, and treatments.
Below you can read more about our various projects and initiatives in the transition towards even more sustainable transportation.
HOTSHOTS motto är att alla skall finna tillfredställelse både på krogen å´ logen och bröllopet, sångkunnig eller ej! Denna produktion är ett måste att se och begrunda.
购买SLC35D1兔多克隆抗体(ab106523),SLC35D1抗体经WB验证,可与人,小鼠,大鼠样本反应。产品出库一年都在质保范围内。中国现货速达。
SLC12A6兔多克隆抗体(ab92951)可与人样本反应并经WB, ICC/IF实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein enc…
Rabbit anti Human SLC5A9 antibody recognizes sodium dependent glucose transporter 4 (SGLT4), also known as SLC5A9, a ~76 kDa member o
View Slc34a1/Slc34a1 Slc34a3/Slc34a3 B6.129-Slc34a3 Slc34a1: phenotypes, images, diseases, and references.
About Us - AnasmoTek is a registered e-currency exchanger offering the best services in terms of e-currency exchange in the world.
Addgene NGS Result CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGC CGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGC CTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAG TGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCG TCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGG CCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAA CAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCT ACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGC TCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATTGATGAGCAATG CTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGTCCCTGCTGGGCAGGGACTACAAC TCTGAGCTGAATAGCCTGGATAACGGCCCTCAGTCCCCATCTGAGAGCTCCTCTAGCATCACATCTGAGA ATGTGCACCCAGCAGGAGAGGCAGGACTGAGCATGATGCAGACCCTGATCCACCTGCTGAAGTGCAATAT CGGAACAGGACTGCTGGGACTGCCACTGGCCATCAAGAACGCAGGACTGCTGGTGGGACCCGTGAGCCTG ...
Browse Sigma-Aldrichs Anion Exchange Media to find products in Amberlite Strong Anion Exchangers, Amberlite® Weak Anion Exchangers, Diaion® Strong Anion Exchanger, Diaion® Weak Anion Exchangers, Dowex® Strong Anion Exchangers, Dowex® Weak Anion Exchangers, Lewatit® Strong Anion Exchanger, Lewatit® Weak Anion Exchanger
Previous studies that have evaluated the Na(+)-H+ antiporter in cells from hypertensive subjects were generally performed under conditions in which HCO3-CO2, the physiological buffer system, was absent from the assay media. The objective of this study was to evaluate the activity of the Na(+)-H+ antiporter and that of the Na(+)-dependent and Na(+)-independent Cl(-)-HCO3- exchangers in cells assayed in the presence of HCO3-CO2 in the media. Lymphocytes from 6- to 8-week-old spontaneously hypertensive rats (SHR) and age-matched Wistar-Kyoto (WKY) rats were obtained from the thymus gland and assayed immediately after isolation. The activity of the Na(+)-H+ antiporter after stimulation by cell acidification (pHi approximately 6.4) was similar in SHR and WKY rats (18.67 +/- 1.03 and 16.12 +/- 0.92 mmol H+/L per minute, respectively). Recovery from cell alkalinization was effected by an Na(+)-independent Cl(-)-HCO3- exchanger, with maximal activity at an alkaline pHi (approximately 7.7). The ...
Mutations of SLC4A1 (AE1) encoding the kidney anion (Cl(-)/HCO(3) (-)) exchanger 1 (kAE1 or band 3) can result in either autosomal dominant (AD) or autosomal recessive (AR) distal renal tubular acidosis (dRTA). The molecular mechanisms associated with SLC4A1 mutations resulting in these different modes of inheritance are now being unveiled using transfected cell systems. The dominant mutants kAE1 R589H, R901X and S613F, which have normal or insignificant changes in anion transport function, exhibit intracellular retention with endoplasmic reticulum (ER) localization in cultured non-polarized and polarized cells, while the dominant mutants kAE1 R901X and G609R are mis-targeted to apical membrane in addition to the basolateral membrane in cultured polarized cells ...
Latest Exposure If you are a new user to the repository, you may wish to view the exposure for this workspace. An exposure will show the summarized information for the content contained here ...
Buy Sylvania / Osram DRA (300W/120V) Lamp features GX6.35 Base, T6 Shape. Review Sylvania / Osram Presentation Lamps & Bulbs, Projector & Presentation Lamps
Request an appointment with Dra. Adriana Geri Nieto. Find verified patient reviews, where to go, insurers, prices, and treatments.
New electrical equipment shouldnt need PAT Testing providing it has been bought from a reputable supplier and is not a cheap fake
Quuntur magni dolores eos qui ratione voluptatem sequi nesciunt. Neque porro quisquam est, qui dolorem ipsum quiaolor sit amet, consectetur, adipisci velit, sed quia non…. ...
Clone REA368 recognizes the human CD233 antigen, a multi-pass membrane protein also known as anion exchange protein 1 (AE1) or solute carrier family 4 member 1 (SLC4A1). CD233 is a phylogenetically preserved transport protein responsible for mediating the electroneutral anion exchange of chloride for bicarbonate across a plasma membrane. It is the major integral membrane glycoprotein of the erythrocyte membrane and is required for the normal flexibility and stability of the erythrocyte membrane as well as for the normal erythrocyte shape via the interactions of its cytoplasmic domain with cytoskeletal proteins, glycolytic enzymes, and hemoglobin. CD233 mediates the chloride-bicarbonate exchange in the kidney, and is required for the normal acidification of the urine. Additional information: Clone REA368 displays negligible binding to Fc receptors. - Belgique
Potassium, Sodium, Chloride and Bicarbonate are each a type of electrolyte, commonly tested as part of a kidney function test. As they are very sensitive markers, we only offer testing of them for samples collected at the London patient reception, or from a nurse visit within the M25. This is so that your sample can be analysed immediately post-collection, to ensure accurate results can be obtained. If this is a suitable option for you then if you purchase the kidney function test here and select the patient reception, or nurse visit, option at checkout then each of these electrolytes (sodium, potassium, chloride & bicarbonate) will also be included in your results report.
View mouse Slc4a1 Chr11:102348820-102365281 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
weak anion exchanger, suspension in 20% ethanol and 150 mM NaCl (40-90 µm) Find MSDS or SDS, a COA, data sheets and more information.
Wrelat van lreBi eis in gerrßo grSeo negeews, sads sda arsunriovCo ni Binne wie„ lidw mu cish shglnace reüd.w Dhoc se amk azng rs.ndae rPo aTg etefiinrzni chsi in emd afeawekichtsrinsn tatSa tzletzu run enigwe dnDtuez Ms.enench Dei„ Pedmaien war rfü eninB rhes ideägnts.begn cDoh eeilv reakAnirf sndi ni edn enenenagrgv nnoeMta nhoc luhedict elizinsrpridiet eegnswe asl ied oErer,upä tgsa erd lreveK. dUn d,sa owlohb edi hcineeihsgyn neuggdneBni ni med sairnigchfecsznöshpar dnaL mhre sla ifgdürt s.nid aD dsa äecsnndaHwhe iebseerlwihcü na Fsnüsle eias,ttttdnf zeeoridutrp Bnein rdnukharez obemil dshcetaeSHswn-ä für edn eietfhnlcnfö auRm - tim gElrof. oS esi die naimdeeP ribshe an Binne bevori egne.gang tzJet„ nids rdto aber eerdiw lael octSthne cd,tih tsag nva ielBr. iBe nalle eurgbeeVrsnnes in red riise:otnSgbotaalsn ieD uas dme nstWee kemomend igenihklfEutsnwlc rüf aktesriWfa eerwd iwrnehtie gndnrdie tbö.eingt nineB tsi acnh eiw ovr inees der mnesträ rndLeä rde teW.l ...
Im looking for methods/references regarding the techniques for measuring intracellular pH. Any info would be greatly appreciated. Thanks, Bob McNulty bmcnulty at oavax.csuchico.edu ...
Learn how to improve your lung health. Make efforts towards clean air and smokefree living. Find facts about lung diseases, such as lung cancer, COPD, asthma.
Chloride-Bicarbonate+Antiporters at the US National Library of Medicine Medical Subject Headings (MeSH) Human SLC4A1 genome ... kAE1 exchanges bicarbonate for chloride on the basolateral surface, essentially returning bicarbonate to the blood. Here it ... into a proton and a bicarbonate ion. The bicarbonate is then excreted (in exchange for a chloride) from the cell by band 3. ... Functional interaction of carbonic anhydrase II and chloride/bicarbonate exchangers". J. Biol. Chem. 276 (51): 47886-94. doi: ...
... chloride-bicarbonate antiporters MeSH D12.776.157.530.450.162.193.500 - anion exchange protein 1, erythrocyte MeSH D12.776. ... sodium chloride symporters MeSH D12.776.157.530.450.625.437 - sodium-glucose transport proteins MeSH D12.776.157.530.450.625. ... chloride channels MeSH D12.776.157.530.400.175.125 - cystic fibrosis transmembrane conductance regulator MeSH D12.776.157.530. ... antiporters MeSH D12.776.157.530.450.162.110 - anion exchange protein 1, erythrocyte MeSH D12.776.157.530.450.162.193 - ...
... chloride-bicarbonate antiporters MeSH D12.776.543.550.190.276.500 - anion exchange protein 1, erythrocyte MeSH D12.776.543.550. ... chloride-bicarbonate antiporters MeSH D12.776.543.585.450.162.193.500 - anion exchange protein 1, erythrocyte MeSH D12.776. ... 190.442 - potassium-hydrogen antiporters MeSH D12.776.543.550.190.775 - sodium-hydrogen antiporter MeSH D12.776.543.550.192.610 ... potassium-hydrogen antiporters MeSH D12.776.543.585.450.162.442 - sodium-calcium exchanger MeSH D12.776.543.585.450.162.775 - ...
The AE1 antiporter is essential in the removal of carbon dioxide waste that is converted to bicarbonate inside the erythrocyte ... This cotransporter is an important integral protein in mammalian erythrocytes and moves chloride ion and bicarbonate ion in a ... A Proton gradient moves the ions into the vacuole by proton-sodium antiporter or the proton-calcium antiporter. In plants, ... Antiporters and symporters both transport two or more different types of molecules at the same time in a coupled movement. An ...
The pancreas further produces large amounts of bicarbonate and secretes bicarbonate through the pancreatic duct to the duodenum ... Chloride and sodium ions are secreted actively from the cytoplasm of the parietal cell into the lumen of the canaliculus. This ... The hydrogen ions leave the cell through H+/K+ ATPase antiporter pumps. At the same time, sodium ions are actively reabsorbed. ... Chloride and hydrogen ions are secreted separately from the cytoplasm of parietal cells and mixed in the canaliculi. Gastric ...
Chloride/Bicarbonate Exchanger Family 2.B.21 The ortho-Phenylenediamine-bis-Urea Derivative Anion Transporter (oPDA-U) Family 2 ... H+ Antiporter (NhaA) Family 2.A.34 The NhaB Na+:H+ Antiporter (NhaB) Family 2.A.35 The NhaC Na+:H+ Antiporter (NhaC) Family 2.A ... H+ Antiporter (NhaD) Family 2.A.63 The Monovalent Cation (K+ or Na+):Proton Antiporter-3 (CPA3) Family 2.A.64 Twin Arginine ... Monovalent Cation:Proton Antiporter-1 (CPA1) Family 2.A.37 Monovalent Cation:Proton Antiporter-2 (CPA2) Family 2.A.38 K+ ...
... and for Ca to be reclaimed into the blood by the Na/Ca basolateral antiporter. It regulates pH by absorbing bicarbonate and ... Sodium and chloride (salt) reabsorption is also mediated by a group of kinases called WNK kinases. There are 4 different WNK ... On the basolateral surface (peritubular capillary side) there is an ATP-dependent Na/K antiporter pump, a secondary active Na/ ... secreting protons (H+) into the filtrate, or by absorbing protons and secreting bicarbonate into the filtrate. Sodium and ...
Functional interaction of carbonic anhydrase II and chloride/bicarbonate exchangers". J. Biol. Chem. United States. 276 (51): ... Carbonic anhydrase II has been shown to interact with band 3 and sodium-hydrogen antiporter 1. GRCh38: Ensembl release 89: ... Renal carbonic anhydrase allows the reabsorption of bicarbonate ions in the proximal tubule. Loss of carbonic anhydrase ...
... which both push more Na into the cell via the Na-H antiporter. The hydrogen ion for the antiporter comes from the enzyme ... Ascending limb of loop of Henle Sodium (Na+), potassium (K+) and chloride (Cl−) ions are reabsorbed from the urine by secondary ... and bicarbonate. Since water is also reabsorbed the volume of fluid in the loop of Henle is less than the PCT, approximately ... As ions leave the lumen via the Na-K-2Cl symporter and the Na-H antiporter, the concentration becomes more and more hypotonic ...
... chloride, and bicarbonate). As the kidney is the most important organ in controlling these values, any derangement in these ... antiporter, and ammonia diffuses into renal tubule. The kidneys secrete a variety of hormones, including erythropoietin, ... 6: Proximal Reabsorption of Bicarbonate. lib.mcg.edu Sect. 7, Ch. 12: Proximal Tubular Reabsorption of Bicarbonate. lib.mcg.edu ... For example, bicarbonate (HCO3−) does not have a transporter, so its reabsorption involves a series of reactions in the tubule ...
May 1998). "Mutations in the chloride-bicarbonate exchanger gene AE1 cause autosomal dominant but not autosomal recessive ... Ca2+ antiporter system. In synaptic transmission in neuronal cells, V-ATPase acidifies synaptic vesicles. Norepinephrine enters ... In the intercalated cells of the kidney, V-ATPases pump protons into the urine, allowing for bicarbonate reabsorption into the ... Mutations to the chloride channel ClC7 gene also lead to both dominant and recessive osteopetrosis. Approximately 50% of ...
Kirchner K.A., Kotchen T.A., Galla J.H., and Luke R.G.: Importance of chloride for acute inhibition of renin by sodium chloride ... excretion which is coupled to bicarbonate reabsorption. This ultimately results in an increase in blood volume, pressure, and ... increased sodium-hydrogen antiporter activity. tubuloglomerular feedback. increased sensitivity. increase in afferent arteriole ... This sensing mechanism for macula densa-mediated renin secretion appears to have a specific dependency on chloride ions rather ...
Chen NH, Reith ME, Quick MW (February 2004). "Synaptic uptake and beyond: the sodium- and chloride-dependent neurotransmitter ... amine/proton antiporters required for vesicular accumulation and regulated exocytotic secretion of monoamines and acetylcholine ... bicarbonate transporter (SLC4A1, SLC4A2, SLC4A3, SLC4A4, SLC4A5, SLC4A6, SLC4A7, SLC4A8, SLC4A9, SLC4A10, SLC4A11) sodium ... and chloride-dependent sodium:neurotransmitter symporters (SLC6A1, SLC6A2, SLC6A3, SLC6A4, SLC6A5, SLC6A6, SLC6A7, SLC6A8, ...
Fpn does not function as an iron/calcium antiporter. The thermodynamic driving force for Fpn remains unknown. ... sodium- and chloride- dependent sodium:neurotransmitter symporters *SLC6A1. *SLC6A2. *SLC6A3. *SLC6A4. *SLC6A5 ...
Antiporter (exchanger). *Na+/H+. *Na+/Ca2+ *Na+/(Ca2+-K+) - Cl−/HCO−. 3 (Band 3) ... sodium- and chloride- dependent sodium:neurotransmitter symporters *SLC6A1. *SLC6A2. *SLC6A3. *SLC6A4. *SLC6A5 ...
Antiporter (exchanger). *Na+/H+. *Na+/Ca2+ *Na+/(Ca2+-K+) - Cl−/HCO−. 3 (Band 3) ... sodium- and chloride- dependent sodium:neurotransmitter symporters *SLC6A1. *SLC6A2. *SLC6A3. *SLC6A4. *SLC6A5 ...
Antiporter (exchanger). *Na+/H+. *Na+/Ca2+ *Na+/(Ca2+-K+) - Cl−/HCO−. 3 (Band 3) ... sodium- and chloride- dependent sodium:neurotransmitter symporters *SLC6A1. *SLC6A2. *SLC6A3. *SLC6A4. *SLC6A5 ...
Chloride-Bicarbonate Antiporters / analysis * Chloride-Bicarbonate Antiporters / biosynthesis* * Fluorescent Antibody Technique ...
Antiporters * Carrier Proteins * Chloride-Bicarbonate Antiporters * Genetic Markers * Membrane Proteins * Membrane Transport ...
This drives the antiporter that exchanges chloride ions for bicarbonate.. H+ is transported into blood by Na+ -H+ exchanger ( ... Two sources for bicarbonate: Some taken across basolateral membrane via symporter NBC-1 (Na-bicarbonate cotransporter type 1). ... As a result, the bicarbonate secretory process is defective - CFTR not functional.. This results in a decrease in pancreatic ... Secretin then stimulates secretion of bicarbonate - results in increase of pH in the intestinal lumen.. This then produces ...
Chloride-Bicarbonate+Antiporters at the US National Library of Medicine Medical Subject Headings (MeSH) Human SLC4A1 genome ... kAE1 exchanges bicarbonate for chloride on the basolateral surface, essentially returning bicarbonate to the blood. Here it ... into a proton and a bicarbonate ion. The bicarbonate is then excreted (in exchange for a chloride) from the cell by band 3. ... Functional interaction of carbonic anhydrase II and chloride/bicarbonate exchangers". J. Biol. Chem. 276 (51): 47886-94. doi: ...
... chloride-bicarbonate antiporters MeSH D12.776.157.530.450.162.193.500 - anion exchange protein 1, erythrocyte MeSH D12.776. ... sodium chloride symporters MeSH D12.776.157.530.450.625.437 - sodium-glucose transport proteins MeSH D12.776.157.530.450.625. ... chloride channels MeSH D12.776.157.530.400.175.125 - cystic fibrosis transmembrane conductance regulator MeSH D12.776.157.530. ... antiporters MeSH D12.776.157.530.450.162.110 - anion exchange protein 1, erythrocyte MeSH D12.776.157.530.450.162.193 - ...
Chloride-Bicarbonate Antiporters. *Chlorides/metabolism. *Chromosome Mapping. *Cloning, Molecular. *DNA, Complementary/ ...
... the organic anion transporter Mrp2 and the chloride bicarbonate exchanger AE2. The subcellular localization of the AQPs and the ... the organic anion transporter Mrp2 and the chloride bicarbonate exchanger AE2. The subcellular localization of the AQPs and the ... the organic anion transporter Mrp2 and the chloride bicarbonate exchanger AE2. The subcellular localization of the AQPs and the ... the organic anion transporter Mrp2 and the chloride bicarbonate exchanger AE2. The subcellular localization of the AQPs and the ...
Chloride-Bicarbonate Antiporters/genetics*. *Chloride-Bicarbonate Antiporters/metabolism. *Cloning, Molecular. *Humans. *In ...
Chloride-Bicarbonate Antiporters 2000 837 Citations (Scopus) Prestin is the motor protein of cochlear outer hair cells. Zheng, ...
Molecular mechanisms of the electrogenic Na+ Bicarbonate Cotransporter (NBCe1). Romero, M. F. ...
Chloride-Bicarbonate Antiporters [D12.776.157.530.450.162.193]. *Anion Exchange Protein 1, Erythrocyte [D12.776.157.530.450.162 ... Chloride-Bicarbonate Antiporters [D12.776.543.550.190.276]. *Anion Exchange Protein 1, Erythrocyte [D12.776.543.550.190.276.500 ... Chloride-Bicarbonate Antiporters [D12.776.543.585.450.162.193]. *Anion Exchange Protein 1, Erythrocyte [D12.776.543.585.450.162 ... It exists as a dimer and performs the important function of allowing the efficient transport of bicarbonate across erythrocyte ...
Chloride-Bicarbonate Antiporters 8 引用 (Scopus) Crystal structure of the enzyme CapF of Staphyloccus aureus reveals a unique ...
Chloride-Bicarbonate Antiporters Bicarbonates Cystic Fibrosis Transmembrane Conductance Regulator 37 引用 (Scopus) ... Bicarbonate-rich fluid secretion predicted by a computational model of guinea-pig pancreatic duct epithelium. Yamaguchi, M., ...
Chloride-Bicarbonate+Antiporters}} * {{UCSC gene info,SLC4A1}} {{PDB Gallery,geneid=6521}} {{Clusters of differentiation}} {{ ... bicarbonate]] ion. The bicarbonate is then excreted (in exchange for a chloride) from the cell by band 3. * Physical linkage of ... kAE1 exchanges bicarbonate for chloride on the basolateral surface, essentially returning bicarbonate to the blood. Here it ... Functional interaction of carbonic anhydrase II and chloride/bicarbonate exchangers , journal = J. Biol. Chem. , volume = 276 ...
Chloride-Bicarbonate Antiporters 100% * Down-Regulation 11% * Cell Movement 8% * bafilomycin A1 7% ...
anion:anion antiporter activity; bicarbonate transmembrane transporter activity; chloride channel activity; oxalate ...
Antiporters, Chloride-Bicarbonate Bicarbonate Chloride Antiport Bicarbonate-Chloride Antiport Chloride Bicarbonate Antiporters ... Antiport, Bicarbonate-Chloride. Antiporters, Chloride-Bicarbonate. Bicarbonate Chloride Antiport. Bicarbonate-Chloride Antiport ... Chloride Bicarbonate Antiporters. Chloride Bicarbonate Exchanger. Chloride Bicarbonate Exchangers. Chloride-Bicarbonate ... Chloride Bicarbonate Exchanger Chloride Bicarbonate Exchangers Chloride-Bicarbonate Exchanger Chloride-Bicarbonate Exchangers ...
Chloride-Bicarbonate Antiporters Diamines Chelation Dehydration Sulfuric acid dehydration sulfuric acid ethylene ...
Chloride-Bicarbonate Antiporters * Acidification * Sodium-Hydrogen Exchangers * Anions 16 引文 斯高帕斯(Scopus) ...
Huang, C. Y. F., Wu, Y. M., Hsu, C. Y., Lee, W. S., Lai, M. D., Lu, T. J., Huang, C. L., Leu, T. H., Shih, H. M., Fang, H. I., Robinson, D. R., Kungand, H. J. & Yuan, C. J., 2002 Sep 13, In : Journal of Biological Chemistry. 277, 37, p. 34367-34374 8 p.. Research output: Contribution to journal › Article ...
Chloride-Bicarbonate Antiporters * Thermotolerance * Vacuolar Proton-Translocating ATPases * Acclimatization * Proton- ...
Chloride-Bicarbonate Antiporters Medicine & Life Sciences Lymphocytes Chemical Compounds Chlorides Medicine & Life Sciences ... Sodium is not required for chloride efflux via chloride/bicarbonate exchanger from rat thymic lymphocytes. Stakišaitis, D., ...
Chloride-Bicarbonate Antiporters / genetics Actions. * Search in PubMed * Search in MeSH * Add to Search ... Mutations in the chloride channel gene CLCNKB as a cause of classic Bartter syndrome. Konrad M, Vollmer M, Lemmink HH, van den ... Mutations in the chloride channel gene, CLCNKB, cause Bartters syndrome type III. Nat Genet. 1997;17(2):171. - PubMed ... d) Penderin participates in urinary bicarbonate excretion with tubular Cl- reabsorption. (e) CFTR functions as a Cl- channel ...
Chloride-Bicarbonate Antiporters * Sulfate Transporters * Anions * 4,4-Diisothiocyanostilbene-2,2-Disulfonic Acid ... Evidence for Bicarbonate Secretion by Ameloblasts in a Novel Cellular Model. Bori, E., Guo, J., Rácz, R., Burghardt, B., Földes ... Bicarbonate transport by the human pancreatic ductal cell line hpaf. Demeter, I., Hegyesi, O., Nagy, Á. K., Case, M. R., ... Vectorial bicarbonate transport by Par-C10 salivary cells.. Demeter, I., Szucs, A., Hegyesi, O., Foldes, A., Racz, G. Z., ...
Chlorides - metabolism , Antiporters - genetics , Bicarbonates - metabolism , Chloride-Bicarbonate Antiporters , Female , Ion ... Chlorides - metabolism , Antiporters - genetics , Chloride-Bicarbonate Antiporters , Ion Transport , Membrane Proteins - ... Chloride-Bicarbonate Antiporters - metabolism , Animals , Biological Transport , Chlorides - metabolism , Antiporters - ... Chloride-Bicarbonate Antiporters - genetics , Gene Expression , Cells, Cultured , Rats , Rats, Inbred WKY , Antiporters - ...
Antiporters - genetics , Fluorescent Antibody Technique , Bicarbonates - metabolism , Chloride-Bicarbonate Antiporters , Mice ... Antiporters - genetics , Chloride-Bicarbonate Antiporters , Transcription, Genetic , Gastrins - blood , In Situ Nick-End ... Full Text Immunohistochemical detection of chloride/bicarbonate anion exchangers in human liver ... Full Text Immunohistochemical detection of chloride/bicarbonate anion exchangers in human liver ...
... so that we use an anti-porter to move bicarbonate out of the cells and chloride into the cells. The chloride will diffuse ... Bicarbonate is secreted into the blood in exchange for chloride ions. And as the chloride enters, it crosses the cells and then ... And the bicarbonate is shown here. Is extruded from the cells and enters into the blood in exchange for chlorides ... And we get bicarbonate and we get a proton. The proton is going to be extruded from the cells into the lumen by a pump. So this ...
Chloride-Bicarbonate Antiporters/biosynthesis. *Chloride-Bicarbonate Antiporters/genetics. *Cluster Analysis. *Colorectal ...
  • as well as the key solute transporters involved in the generation of canalicular osmotic gradients, i.e., the bile salt export pump Bsep, the organic anion transporter Mrp2 and the chloride bicarbonate exchanger AE2. (elsevier.com)
  • It is the anion exchanger responsible for electroneutral transporting in CHLORIDE IONS in exchange of BICARBONATE IONS allowing CO2 uptake and transport from tissues to lungs by the red blood cells. (childrensmercy.org)
  • Apical membrane chloride-bicarbonate exchanger that mediates luminal chloride absorption and bicarbonate secretion by the small intestinal brush border membrane and contributes to intracellular pH regulation in the duodenal upper villous epithelium during proton-coupled peptide absorption, possibly by providing a bicarbonate import pathway. (monash.edu)
  • The apical membrane chloride-bicarbonate exchanger provides also a major route for fluid and bicarbonate secretion into the proximal tubules of the kidney as well as into the proximal part of the interlobular pancreatic ductal tree, where it mediates electrogenic chloride-bicarbonate exchange with a chloride-bicarbonate stoichiometry of 1:2, and hence will dilute and alkalinize protein-rich acinar secretion. (monash.edu)
  • FUNCTION: Isoform 4: Apical membrane chloride-bicarbonate exchanger. (monash.edu)
  • Acts as a sodium-independent DIDS-sensitive anion exchanger mediating bicarbonate, chloride, sulfate and oxalate transport. (uniprot.org)
  • May play a role in the maintenance of the electrolyte and acid-base homeostasis in the kidney, by acting as a distal excretory segment-specific anion exchanger, specifically chloride. (uniprot.org)
  • Acts as a DIDS-sensitive anion exchanger mediating chloride, sulfate and oxalate transport. (uniprot.org)
  • The bicarbonate leaves the cell and enters plasma in exchange for chloride by the basolateral chloride/bicarbonate exchanger (the energy for which is derived from the sodium/potassium pump on the basolateral side, not shown). (cassadyandselfglassco.com)
  • The Na+-dependent chloride-bicarbonate exchanger SLC4A8 mediates an electroneutral Na+ reabsorption process in the renal cortical collecting ducts of mice. (unil.ch)
  • Anion Exchanger 1 ( AE1 ) or Band 3 is a phylogenetically preserved transport protein responsible for catalysing the electroneutral exchange of chloride (Cl-) for bicarbonate (HCO3-) across a plasma membrane . (bionity.com)
  • The chloride-bicarbonate exchanger in the red cell membrane is not a pump , which would use metabolic energy. (bionity.com)
  • SLC26A3 is a chloride/bicarbonate exchanger that is involved in absorption inside the colon. (thermofisher.com)
  • Acute chloride removal produced a rise in pHi that was Na(+)-dependent and sensitive to 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS) but resistant to ethylisopropylamiloride (EIPA), reflecting the activity of an Na(+)-dependent Cl(-)-HCO3- exchanger. (ahajournals.org)
  • Mediates also intestinal chloride absorption and oxalate secretion, thereby preventing hyperoxaluria and calcium oxalate urolithiasis. (monash.edu)
  • Transepithelial oxalate secretion, chloride-formate, chloride-oxalate and chloride-bicarbonate transport activities in the duodenum are inhibited by PKC activation in a calcium-independent manner. (monash.edu)
  • Chloride ions are exchanged for bicarbonate ions (causing net bicarbonate secretion). (teachmephysiology.com)
  • The most common cause of this type of diarrhea is a cholera toxin that stimulates the secretion of anions, especially chloride ions. (malacards.org)
  • The bicarbonate ions, Na + ions and water then move through the intercalated ducts and end up at the main pancreatic duct ready for secretion into the duodenum upon an appropriate stimulus. (teachmephysiology.com)
  • In initial reports, it was proposed that certain channels from the ClC family of chloride channels may provide compensatory or alternative pathways for epithelial chloride secretion in tissues from cystic fibrosis patients. (jove.com)
  • Band 3 anion transport protein is a phylogenetically-preserved transport protein responsible for mediating the exchange of chloride (Cl−) with bicarbonate (HCO3−) across plasma membranes. (wikipedia.org)
  • The Cl- in the lumen drives the antiporter that exchanges chloride ions for bicarbonate with absorption of Cl- and release of HCO3- into the lumen. (brainscape.com)
  • Previous studies that have evaluated the Na(+)-H+ antiporter in cells from hypertensive subjects were generally performed under conditions in which HCO3-CO2, the physiological buffer system, was absent from the assay media. (ahajournals.org)
  • The objective of this study was to evaluate the activity of the Na(+)-H+ antiporter and that of the Na(+)-dependent and Na(+)-independent Cl(-)-HCO3- exchangers in cells assayed in the presence of HCO3-CO2 in the media. (ahajournals.org)
  • Here it performs two functions: Electroneutral chloride and bicarbonate exchange across the plasma membrane on a one-for-one basis. (wikipedia.org)
  • Electroneutral chloride bicarbonate exchangers that allow the exchange of BICARBONATE IONS exchange for CHLORIDE IONS across the cellular membrane. (bvsalud.org)
  • Electroneutral chloride and bicarbonate exchange across the plasma membrane on a one-for-one basis.This is crucial for CO 2 uptake by the red cell and conversion (by hydration catalysed by carbonic anhydrase ) into a proton and a bicarbonate ion. (bionity.com)
  • Proteins that cotransport sodium ions and bicarbonate ions across cellular membranes. (rush.edu)
  • Both of these are antiporter carrier proteins. (spadesbookings.com)
  • lated to be linked to Na-H transporters and pH, Active transport utilizes a transcellular, energy- specific bicarbonate-linked transporters, and the driven protein pump or channel to facilitate passage concentration gradient across cell membranes. (yudu.com)
  • Tripodal transmembrane transporters for bicarbonate. (tcdb.org)
  • Role of bicarbonate-dependent transporters. (ahajournals.org)
  • diffusion of chloride ions from the plasma into the erythrocytes to compensate for the loss of bicarbonate ions from the cells as a result of carbon dioxide metabolism. (thefreedictionary.com)
  • Alveolar ventilation removes carbon dioxide (CO 2), while the kidneys reclaim filtered bicarbonate (HCO 3 ion) and excrete hydrogen ions produced by the metabolism of dietary protein (or bicarbonate when the diet generates more base than acid). (cassadyandselfglassco.com)
  • The Chloride Channel ClC-4 Co-localizes with Cystic Fibrosis Transmembrane Conductance Regulator and May Mediate Chloride Flux Across the Apical Membrane of Intestinal Epithelia The Journal of Biological Chemistry. (jove.com)
  • Pubmed ID: 11675385 Cystic fibrosis (CF) causing mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) lead to mislocalization of CFTR protein from the brush border membrane of epithelial tissues and/or its dysfunction as a chloride channel. (jove.com)
  • The chloride ions transported by SLC26A3 cross the cell membrane in exchange for biocarbonate ions. (thermofisher.com)
  • Sodium, bicarbonate and chloride absorption by the proximal tubule. (springer.com)
  • In the large intestine, there is a net absorption of sodium ions and chloride ions are actively absorbed. (teachmephysiology.com)
  • Chloride and bicarbonate - the movement of sodium into the plasma produces an electrochemical gradient to allow absorption of chloride. (teachmephysiology.com)
  • Acts as a versatile DIDS-sensitive inorganic and organic anion transporter that mediates the uptake of monovalent anions like chloride, bicarbonate, formate and hydroxyl ion and divalent anions like sulfate and oxalate. (monash.edu)
  • Function in multiple exchange modes involving pairs of these anions, which include chloride-bicarbonate, chloride-oxalate, oxalate-formate, oxalate-sulfate and chloride-formate exchange. (monash.edu)
  • The chloride ions then exit the cell through a chloride transporter which is present on the luminal surface of these cells. (coursera.org)
  • hence maximizes the local concentration of bicarbonate at the transporter site. (monash.edu)
  • On the basolateral surface (blood) there is an ATP-dependent Na/K antiporter pump, a secondary active Na/Ca transporter, and an ATP dependent Ca transporter. (omicsgroup.org)
  • An arginyl residue-modifying agent, phenylglyoxal, inhibited L-[(14)C]lactic acid transport by the proton cotransporter, but not by the anion antiporter. (nih.gov)
  • These observations demonstrate that L-lactic acid is transported across the intestinal brush-border membrane by multiple mechanisms, including an anion antiporter and a previously known proton cotransporter. (nih.gov)
  • It mediates chloride-bicarbonate exchange in the kidney, and is required for normal acidification of the urine. (tcdb.org)
  • kAE1 exchanges bicarbonate for chloride on the basolateral surface, essentially returning bicarbonate to the blood. (wikipedia.org)
  • The basolateral ATP dependent Na/K pump produces the gradient for Na to be absorbed from the apical surface via the Na/Cl symporter , and for Ca to be reclaimed into the blood by the Na/Ca basolateral antiporter. (omicsgroup.org)
  • The effect of luminal sodium and chloride removal on intracellular pH was used to assess the relative rates of Na + /H + and Cl - /base exchange. (elsevier.com)
  • Ammonium Chloride" is a descriptor in the National Library of Medicine's controlled vocabulary thesaurus, MeSH (Medical Subject Headings) . (harvard.edu)
  • This graph shows the total number of publications written about "Ammonium Chloride" by people in Harvard Catalyst Profiles by year, and whether "Ammonium Chloride" was a major or minor topic of these publication. (harvard.edu)
  • Below are the most recent publications written about "Ammonium Chloride" by people in Profiles. (harvard.edu)
  • Influence of ammonium chloride feeding time and light intensity on the cultivation of Spirulina (Arthrospira) platensis. (harvard.edu)
  • Cytosolic alkalinization with ammonium chloride (NH 4 Cl) depolarized photoreceptors and stimulated Ca 2+ release from internal stores, yet paradoxically also evoked dose-dependent, reversible decreases in [Ca 2+ ] i . (physiology.org)
  • Proximal Reabsorption of Bicarbonate Soriano JR. Renal Tubular Acidosis: The Clinical Entity. (uchicago.edu)
  • Carbonic anhydrase ( CA-II ) creates carbonic acid which ionizes to form bicarbonate and a hydrogen ion, in a mechanism similar to that which occurs in the proximal tubule. (uchicago.edu)
  • In both neonatal and adult proximal straight tubules, the rate of Cl - /base exchange was not affected by formate, bicarbonate, or cyanide and acetazolamide, consistent with Cl - /OH - exchange. (elsevier.com)
  • Shah, M , Quigley, R & Baum, M 1998, ' Maturation of rabbit proximal straight tubule chloride/base exchange ', American Journal of Physiology - Renal Physiology , vol. 274, no. 5 43-5, pp. (elsevier.com)
  • May form a molecular complex involved in the regulation of chloride and bicarbonate ions fluxes during sperm capacitation. (uniprot.org)
  • Congenital chloride diarrhea (CLD) is an autosomal recessive disorder with the hallmark of persistent watery Cl(-)-rich diarrhea from birth . (bvsalud.org)
  • Congenital chloride diarrhea is a rare autosomal recessive disorder caused by a defective exchange of chloride and bicarbonate in the ileum and the colon. (bvsalud.org)
  • Diseases associated with SLC26A3 protein dysfunction include congenital chloride diarrhea and congenital secretory chloride diarrhea 1. (thermofisher.com)
  • proton secreted into lumen (urine) combine with bicarbonate to form carbonic acid (H 2 CO 3 ) Potassium is an important nutrient and electrolyte. (cassadyandselfglassco.com)
  • At first, negative chloride ions and sodium ions get secreted actively from the cytoplasm of the parietal cell into the lumen of the canaliculus. (bionity.com)
  • In the canaliculus, secreted hydrogen and chloride ions combine into HCl and are then secreted into the lumen of the oxyntic gland. (bionity.com)
  • An intracellular build up of Cl - is avoided by a chloride channel which allows chloride ions to return to the lumen of the intercalated ducts. (teachmephysiology.com)
  • This is crucial for CO2 uptake by the red blood cell and conversion (by hydration catalysed by carbonic anhydrase) into a proton and a bicarbonate ion. (wikipedia.org)
  • The uptake of L-[(14)C]lactic acid by BBMVs showed an overshoot phenomenon in the presence of outward-directed bicarbonate and/or inward-directed proton gradients. (nih.gov)
  • Kinetic analysis of L-[(14)C]lactic acid uptake revealed the involvement of two saturable processes in the presence of both proton and bicarbonate gradients. (nih.gov)
  • The initial uptakes of L-[(14)C]lactic acid which are driven by bicarbonate ion and proton gradients were inhibited commonly by monocarboxylic acids and selectively by anion exchange inhibitor 4, 4'-diisothiocyanostilbene-2,2'-disulfonic acid and protonophore carbonylcyanide p-trifluoromethoxyphenylhydrazone, respectively. (nih.gov)
  • The last time we said that the parietal cell uses the carbonic anhydrase reaction to convert CO2 and water into bicarbonate and a proton. (coursera.org)
  • The bicarbonate and the proton are then moved to the opposite sides of the parietal cell. (coursera.org)
  • They generate hydrogen ions and bicarbonate ions from carbon dioxide and water - a reaction catalysed by carbonic anhydrase. (wikipedia.org)
  • This is the principal acid secreting cell of the kidney, which generates hydrogen ions and bicarbonate ions from carbon dioxide and water-a reaction catalysed by Carbonic anhydrase . (bionity.com)
  • The action of specific antiporters in this class serve important functions such as allowing the efficient exchange of bicarbonate across red blood cell membranes as they passage through capillaries and the reabsorption of bicarbonate ions by the kidney. (bvsalud.org)
  • It exists as a dimer and performs the important function of allowing the efficient transport of bicarbonate across erythrocyte cell membranes in exchange for chloride ion. (umassmed.edu)
  • Chemically it is an acid solution consisting mainly of hydrochloric acid (HCl), and small quantities of potassium chloride (KCl) and sodium chloride (NaCl). (bionity.com)
  • Many organic compounds contain chlorine, as is indicated by common names such as carbon tetrachloride, methylene chloride, and methyl chloride. (thefreedictionary.com)
  • thus, carbon tetrachloride is tetrachloromethane, methylene chloride is dichloromethane, and methyl chloride is chloromethane. (thefreedictionary.com)
  • Bicarbonate, or hydrogen carbonate, is a simple single carbon molecule that plays surprisingly important roles in diverse biological processes. (hmdb.ca)
  • Bicarbonate ion is an anion that consists of one central carbon atom surrounded by three oxygen atoms in a trigonal planar arrangement, with a hydrogen atom attached to one of the oxygens. (hmdb.ca)
  • Bicarbonate in equilibrium with carbon dioxide constitutes the main physiological buffer. (hmdb.ca)
  • The bicarbonate-carbon dioxide pair stimulates the oxidation, peroxidation and nitration of several biological targets. (hmdb.ca)
  • The carbonate radical has also been proposed to be responsible for the stimulatory effects of the bicarbonate-carbon dioxide pair on oxidations mediated by hydrogen peroxide/transition metal ions. (hmdb.ca)
  • The ultimate precursor of the carbonate radical anion being bicarbonate, carbon dioxide, peroxymonocarbonate or complexes of transition metal ions with bicarbonate-derived species remains a matter of debate. (hmdb.ca)
  • Most chlorides are salts that are formed either by direct union of chlorine with a metal or by reaction of hydrochloric acid (a water solution of hydrogen chloride hydrogen chloride, chemical compound, HCl, a colorless, poisonous gas with an unpleasant, acrid odor. (thefreedictionary.com)
  • The motif LDADD is a binding site for the N-terminal basic region of carbonic ahnydride II (not I), facilitating bicarbonate transport ( Moraes and Reithmeier 2012 ). (tcdb.org)
  • Chloride transport occurs via both active and pas- to one of high concentration (electrochemical gradi- sive processes, and it is the major intestinal anion ent). (yudu.com)
  • The activity of the Na(+)-H+ antiporter after stimulation by cell acidification (pHi approximately 6.4) was similar in SHR and WKY rats (18.67 +/- 1.03 and 16.12 +/- 0.92 mmol H+/L per minute, respectively). (ahajournals.org)
  • H + ions are transported out of the pancreatic ductal cells into the blood in exchange for Na + ions by an H + /Na + antiporter. (teachmephysiology.com)