Chemokines cxc. Medical search

Class of pro-inflammatory cytokines that have the ability to attract and activate leukocytes. They can be divided into at least three structural branches: C; (CHEMOKINES, C); CC; (CHEMOKINES, CC); and CXC; (CHEMOKINES, CXC); according to variations in a shared cysteine motif.

Group of chemokines with paired cysteines separated by a different amino acid. CXC chemokines are chemoattractants for neutrophils but not monocytes.

Group of chemokines with adjacent cysteines that are chemoattractants for lymphocytes, monocytes, eosinophils, basophils but not neutrophils.

Cell surface glycoproteins that bind to chemokines and thus mediate the migration of pro-inflammatory molecules. The receptors are members of the seven-transmembrane G protein-coupled receptor family. Like the CHEMOKINES themselves, the receptors can be divided into at least three structural branches: CR, CCR, and CXCR, according to variations in a shared cysteine motif.

A CXC chemokine with specificity for CXCR2 RECEPTORS. It has growth factor activities and is implicated as a oncogenic factor in several tumor types.

A CXC chemokine that is induced by GAMMA-INTERFERON and is chemotactic for MONOCYTES and T-LYMPHOCYTES. It has specificity for the CXCR3 RECEPTOR.

An INTEFERON-inducible CXC chemokine that is specific for the CXCR3 RECEPTOR.

High-affinity G-protein-coupled receptors for INTERLEUKIN-8 present on NEUTROPHILS; MONOCYTES; and T-LYMPHOCYTES. These receptors also bind several other CXC CHEMOKINES.

A CXC chemokine that is predominantly expressed in EPITHELIAL CELLS. It has specificity for the CXCR2 RECEPTORS and is involved in the recruitment and activation of NEUTROPHILS.

A CC-type chemokine that is a chemoattractant for EOSINOPHILS; MONOCYTES; and LYMPHOCYTES. It is a potent and selective eosinophil chemotaxin that is stored in and released from PLATELETS and activated T-LYMPHOCYTES. Chemokine CCL5 is specific for CCR1 RECEPTORS; CCR3 RECEPTORS; and CCR5 RECEPTORS. The acronym RANTES refers to Regulated on Activation, Normal T Expressed and Secreted.

A CXC chemokine that is induced by GAMMA-INTERFERON. It is a chemotactic factor for activated T-LYMPHOCYTES and has specificity for the CXCR3 RECEPTOR.

A CXC chemokine that is synthesized by activated MONOCYTES and NEUTROPHILS. It has specificity for CXCR2 RECEPTORS.

Group of chemokines without adjacent cysteines that are chemoattractants for lymphocytes only.

Heparin-binding proteins that exhibit a number of inflammatory and immunoregulatory activities. Originally identified as secretory products of MACROPHAGES, these chemokines are produced by a variety of cell types including NEUTROPHILS; FIBROBLASTS; and EPITHELIAL CELLS. They likely play a significant role in respiratory tract defenses.

A chemokine that is a chemoattractant for MONOCYTES and may also cause cellular activation of specific functions related to host defense. It is produced by LEUKOCYTES of both monocyte and lymphocyte lineage and by FIBROBLASTS during tissue injury. It has specificity for CCR2 RECEPTORS.

A CC chemokine with specificity for CCR5 RECEPTORS. It is a chemoattractant for NK CELLS; MONOCYTES and a variety of other immune cells. This chemokine is encoded by multiple genes.

A CC chemokine with specificity for CCR1 RECEPTORS and CCR5 RECEPTORS. It is a chemoattractant for NK CELLS; MONOCYTES; and a variety of other immune cells. This chemokine is encoded by multiple genes.

CXCR receptors that are expressed on the surface of a number of cell types, including T-LYMPHOCYTES; NK CELLS; DENDRITIC CELLS; and a subset of B-LYMPHOCYTES. The receptors are activated by CHEMOKINE CXCL9; CHEMOKINE CXCL10; and CHEMOKINE CXCL11.

A member of the CXC chemokine family that plays a role in the regulation of the acute inflammatory response. It is secreted by variety of cell types and induces CHEMOTAXIS of NEUTROPHILS and other inflammatory cells.

The movement of leukocytes in response to a chemical concentration gradient or to products formed in an immunologic reaction.

High-affinity G-protein-coupled receptors for INTERLEUKIN-8 present on NEUTROPHILS; MONOCYTES; and BASOPHILS.

A monocyte chemoattractant protein that has activity towards a broad variety of immune cell types. Chemokine CCL7 has specificity for CCR1 RECEPTORS; CCR2 RECEPTORS; and CCR5 RECEPTORS.

Non-antibody proteins secreted by inflammatory leukocytes and some non-leukocytic cells, that act as intercellular mediators. They differ from classical hormones in that they are produced by a number of tissue or cell types rather than by specialized glands. They generally act locally in a paracrine or autocrine rather than endocrine manner.

A CXC chemokine that is chemotactic for T-LYMPHOCYTES and MONOCYTES. It has specificity for CXCR4 RECEPTORS. Two isoforms of CXCL12 are produced by alternative mRNA splicing.

Chemokines that are chemoattractants for monocytes. These CC chemokines (cysteines adjacent) number at least three including CHEMOKINE CCL2.

A CXC chemokine that has stimulatory and chemotactic activities towards NEUTROPHILS. It has specificity for CXCR1 RECEPTORS and CXCR2 RECEPTORS.

Group of chemokines with the first two cysteines separated by three amino acids. CX3C chemokines are chemotactic for natural killer cells, monocytes, and activated T-cells.

CXCR receptors with specificity for CXCL12 CHEMOKINE. The receptors may play a role in HEMATOPOIESIS regulation and can also function as coreceptors for the HUMAN IMMUNODEFICIENCY VIRUS.

Soluble mediators of the immune response that are neither antibodies nor complement. They are produced largely, but not exclusively, by monocytes and macrophages.

A blood group consisting mainly of the antigens Fy(a) and Fy(b), determined by allelic genes, the frequency of which varies profoundly in different human groups; amorphic genes are common.

A CC-type chemokine with specificity for CCR7 RECEPTORS. It has activity towards DENDRITIC CELLS and T-LYMPHOCYTES.

A CC-type chemokine with specificity for CCR7 RECEPTORS. It has activity towards T LYMPHOCYTES and B LYMPHOCYTES.

The movement of cells or organisms toward or away from a substance in response to its concentration gradient.

A monocyte chemoattractant protein that attracts MONOCYTES; LYMPHOCYTES; BASOPHILS; and EOSINOPHILS. Chemokine CCL8 has specificity for CCR3 RECEPTORS and CCR5 RECEPTORS.

The diffusion or accumulation of neutrophils in tissues or cells in response to a wide variety of substances released at the sites of inflammatory reactions.

CCR receptors with specificity for CHEMOKINE CCL2 and several other CCL2-related chemokines. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; MACROPHAGES; BASOPHILS; and NK CELLS.

A platelet-specific protein which is released when platelets aggregate. Elevated plasma levels have been reported after deep venous thrombosis, pre-eclampsia, myocardial infarction with mural thrombosis, and myeloproliferative disorders. Measurement of beta-thromboglobulin in biological fluids by radioimmunoassay is used for the diagnosis and assessment of progress of thromboembolic disorders.

A CXC chemokine that is chemotactic for B-LYMPHOCYTES. It has specificity for CXCR5 RECEPTORS.

Regulatory proteins and peptides that are signaling molecules involved in the process of PARACRINE COMMUNICATION. They are generally considered factors that are expressed by one cell and are responded to by receptors on another nearby cell. They are distinguished from HORMONES in that their actions are local rather than distal.

Chemical substances that attract or repel cells. The concept denotes especially those factors released as a result of tissue injury, microbial invasion, or immunologic activity, that attract LEUKOCYTES; MACROPHAGES; or other cells to the site of infection or insult.

Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.

A CC-type chemokine that is found at high levels in the THYMUS and has specificity for CCR4 RECEPTORS. It is synthesized by DENDRITIC CELLS; ENDOTHELIAL CELLS; KERATINOCYTES; and FIBROBLASTS.

CCR receptors with specificity for a broad variety of CC CHEMOKINES. They are expressed at high levels in MONOCYTES; tissue MACROPHAGES; NEUTROPHILS; and EOSINOPHILS.

The movement of cells from one location to another. Distinguish from CYTOKINESIS which is the process of dividing the CYTOPLASM of a cell.

A CC-type chemokine that is specific for CCR3 RECEPTORS. It is a potent chemoattractant for EOSINOPHILS.

A pathological process characterized by injury or destruction of tissues caused by a variety of cytologic and chemical reactions. It is usually manifested by typical signs of pain, heat, redness, swelling, and loss of function.

Granular leukocytes having a nucleus with three to five lobes connected by slender threads of chromatin, and cytoplasm containing fine inconspicuous granules and stainable by neutral dyes.

A CC-type chemokine with specificity for CCR4 RECEPTORS. It has activity towards TH2 CELLS and TC2 CELLS.

CCR receptors with specificity for CHEMOKINE CCL3; CHEMOKINE CCL4; and CHEMOKINE CCL5. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; MACROPHAGES; MAST CELLS; and NK CELLS. The CCR5 receptor is used by the HUMAN IMMUNODEFICIENCY VIRUS to infect cells.

RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.

CCR receptors with specificity for CHEMOKINE CCL11 and a variety of other CC CHEMOKINES. They are expressed at high levels in T-LYMPHOCYTES; EOSINOPHILS; BASOPHILS; and MAST CELLS.

Cell surface proteins that bind cytokines and trigger intracellular changes influencing the behavior of cells.

A CC-type chemokine secreted by activated MONOCYTES and T-LYMPHOCYTES. It has specificity for CCR8 RECEPTORS.

The endogenous compounds that mediate inflammation (AUTACOIDS) and related exogenous compounds including the synthetic prostaglandins (PROSTAGLANDINS, SYNTHETIC).

A CC-type chemokine with specificity for CCR3 RECEPTORS. It is a chemoattractant for EOSINOPHILS.

Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.

The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.

A CXC chemokine that is found in the alpha granules of PLATELETS. The protein has a molecular size of 7800 kDa and can occur as a monomer, a dimer or a tetramer depending upon its concentration in solution. Platelet factor 4 has a high affinity for HEPARIN and is often found complexed with GLYCOPROTEINS such as PROTEIN C.

A CX3C chemokine that is a transmembrane protein found on the surface of cells. The soluble form of chemokine CX3CL1 can be released from cell surface by proteolysis and act as a chemoattractant that may be involved in the extravasation of leukocytes into inflamed tissues. The membrane form of the protein may also play a role in cell adhesion.

White blood cells. These include granular leukocytes (BASOPHILS; EOSINOPHILS; and NEUTROPHILS) as well as non-granular leukocytes (LYMPHOCYTES and MONOCYTES).

Large, phagocytic mononuclear leukocytes produced in the vertebrate BONE MARROW and released into the BLOOD; contain a large, oval or somewhat indented nucleus surrounded by voluminous cytoplasm and numerous organelles.

A CC-type chemokine with specificity for CCR6 RECEPTORS. It has activity towards DENDRITIC CELLS; T-LYMPHOCYTES; and B-LYMPHOCYTES.

The relatively long-lived phagocytic cell of mammalian tissues that are derived from blood MONOCYTES. Main types are PERITONEAL MACROPHAGES; ALVEOLAR MACROPHAGES; HISTIOCYTES; KUPFFER CELLS of the liver; and OSTEOCLASTS. They may further differentiate within chronic inflammatory lesions to EPITHELIOID CELLS or may fuse to form FOREIGN BODY GIANT CELLS or LANGHANS GIANT CELLS. (from The Dictionary of Cell Biology, Lackie and Dow, 3rd ed.)

Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.

Either of the pair of organs occupying the cavity of the thorax that effect the aeration of the blood.

Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.

CCR receptors with specificity for CHEMOKINE CCL27. They may play a specialized role in the cutaneous homing of LYMPHOCYTES.

A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.

CCR receptors with specificity for CHEMOKINE CCL19 and CHEMOKINE CCL21. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; and DENDRITIC CELLS.

CCR receptors with specificity for CHEMOKINE CCL17 and CHEMOKINE CCL22. They are expressed at high levels in T-LYMPHOCYTES; MAST CELLS; DENDRITIC CELLS; and NK CELLS.

Serum glycoprotein produced by activated MACROPHAGES and other mammalian MONONUCLEAR LEUKOCYTES. It has necrotizing activity against tumor cell lines and increases ability to reject tumor transplants. Also known as TNF-alpha, it is only 30% homologous to TNF-beta (LYMPHOTOXIN), but they share TNF RECEPTORS.

A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.

The major interferon produced by mitogenically or antigenically stimulated LYMPHOCYTES. It is structurally different from TYPE I INTERFERON and its major activity is immunoregulation. It has been implicated in the expression of CLASS II HISTOCOMPATIBILITY ANTIGENS in cells that do not normally produce them, leading to AUTOIMMUNE DISEASES.

Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.

An immunoassay utilizing an antibody labeled with an enzyme marker such as horseradish peroxidase. While either the enzyme or the antibody is bound to an immunosorbent substrate, they both retain their biologic activity; the change in enzyme activity as a result of the enzyme-antibody-antigen reaction is proportional to the concentration of the antigen and can be measured spectrophotometrically or with the naked eye. Many variations of the method have been developed.

Phenomenon of cell-mediated immunity measured by in vitro inhibition of the migration or phagocytosis of antigen-stimulated LEUKOCYTES or MACROPHAGES. Specific CELL MIGRATION ASSAYS have been developed to estimate levels of migration inhibitory factors, immune reactivity against tumor-associated antigens, and immunosuppressive effects of infectious microorganisms.

Signal molecules that are involved in the control of cell growth and differentiation.

Established cell cultures that have the potential to propagate indefinitely.

Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.

Technique using an instrument system for making, processing, and displaying one or more measurements on individual cells obtained from a cell suspension. Cells are usually stained with one or more fluorescent dyes specific to cell components of interest, e.g., DNA, and fluorescence of each cell is measured as it rapidly transverses the excitation beam (laser or mercury arc lamp). Fluorescence provides a quantitative measure of various biochemical and biophysical properties of the cell, as well as a basis for cell sorting. Other measurable optical parameters include light absorption and light scattering, the latter being applicable to the measurement of cell size, shape, density, granularity, and stain uptake.

Lipid-containing polysaccharides which are endotoxins and important group-specific antigens. They are often derived from the cell wall of gram-negative bacteria and induce immunoglobulin secretion. The lipopolysaccharide molecule consists of three parts: LIPID A, core polysaccharide, and O-specific chains (O ANTIGENS). When derived from Escherichia coli, lipopolysaccharides serve as polyclonal B-cell mitogens commonly used in laboratory immunology. (From Dorland, 28th ed)

Specialized cells of the hematopoietic system that have branch-like extensions. They are found throughout the lymphatic system, and in non-lymphoid tissues such as SKIN and the epithelia of the intestinal, respiratory, and reproductive tracts. They trap and process ANTIGENS, and present them to T-CELLS, thereby stimulating CELL-MEDIATED IMMUNITY. They are different from the non-hematopoietic FOLLICULAR DENDRITIC CELLS, which have a similar morphology and immune system function, but with respect to humoral immunity (ANTIBODY PRODUCTION).

Cell surface proteins that bind interleukins and trigger intracellular changes influencing the behavior of cells.

The capacity of a normal organism to remain unaffected by microorganisms and their toxins. It results from the presence of naturally occurring ANTI-INFECTIVE AGENTS, constitutional factors such as BODY TEMPERATURE and immediate acting immune cells such as NATURAL KILLER CELLS.

A molecule that binds to another molecule, used especially to refer to a small molecule that binds specifically to a larger molecule, e.g., an antigen binding to an antibody, a hormone or neurotransmitter binding to a receptor, or a substrate or allosteric effector binding to an enzyme. Ligands are also molecules that donate or accept a pair of electrons to form a coordinate covalent bond with the central metal atom of a coordination complex. (From Dorland, 27th ed)

The process in which the neutrophil is stimulated by diverse substances, resulting in degranulation and/or generation of reactive oxygen products, and culminating in the destruction of invading pathogens. The stimulatory substances, including opsonized particles, immune complexes, and chemotactic factors, bind to specific cell-surface receptors on the neutrophil.

The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.

CCR receptors with specificity for CHEMOKINE CCL20. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; and DENDRITIC CELLS.

Washing liquid obtained from irrigation of the lung, including the BRONCHI and the PULMONARY ALVEOLI. It is generally used to assess biochemical, inflammatory, or infection status of the lung.

Cytotaxins liberated from normal or invading cells that specifically attract eosinophils; they may be complement fragments, lymphokines, neutrophil products, histamine or other; the best known is the tetrapeptide ECF-A, released mainly by mast cells.

Granular leukocytes with a nucleus that usually has two lobes connected by a slender thread of chromatin, and cytoplasm containing coarse, round granules that are uniform in size and stainable by eosin.

CCR receptors with specificity for CHEMOKINE CCL1. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; and MACROPHAGES.

Subset of helper-inducer T-lymphocytes which synthesize and secrete the interleukins IL-4, IL-5, IL-6, and IL-10. These cytokines influence B-cell development and antibody production as well as augmenting humoral responses.

Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.

Mature LYMPHOCYTES and MONOCYTES transported by the blood to the body's extravascular space. They are morphologically distinguishable from mature granulocytic leukocytes by their large, non-lobed nuclei and lack of coarse, heavily stained cytoplasmic granules.

Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.

Subset of helper-inducer T-lymphocytes which synthesize and secrete interleukin-2, gamma-interferon, and interleukin-12. Due to their ability to kill antigen-presenting cells and their lymphokine-mediated effector activity, Th1 cells are associated with vigorous delayed-type hypersensitivity reactions.

The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.

The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.

Histochemical localization of immunoreactive substances using labeled antibodies as reagents.

Proteins that specifically inhibit the growth of new blood vessels (ANGIOGENESIS, PHYSIOLOGIC).

Chemokine receptors that are specific for CXC CHEMOKINES.

Highly specialized EPITHELIAL CELLS that line the HEART; BLOOD VESSELS; and lymph vessels, forming the ENDOTHELIUM. They are polygonal in shape and joined together by TIGHT JUNCTIONS. The tight junctions allow for variable permeability to specific macromolecules that are transported across the endothelial layer.

Adherence of cells to surfaces or to other cells.

A pathologic process consisting of the proliferation of blood vessels in abnormal tissues or in abnormal positions.

A cell-surface ligand involved in leukocyte adhesion and inflammation. Its production is induced by gamma-interferon and it is required for neutrophil migration into inflamed tissue.

Proteins prepared by recombinant DNA technology.

Single pavement layer of cells which line the luminal surface of the entire vascular system and regulate the transport of macromolecules and blood components.

CXCR receptors isolated initially from BURKITT LYMPHOMA cells. CXCR5 receptors are expressed on mature, recirculating B-LYMPHOCYTES and are specific for CHEMOKINE CXCL13.

A CC-type chemokine with specificity for CCR10 RECEPTORS. It is constitutively expressed in the skin and may play a role in T-CELL trafficking during cutaneous INFLAMMATION.

A soluble factor produced by MONOCYTES; MACROPHAGES, and other cells which activates T-lymphocytes and potentiates their response to mitogens or antigens. Interleukin-1 is a general term refers to either of the two distinct proteins, INTERLEUKIN-1ALPHA and INTERLEUKIN-1BETA. The biological effects of IL-1 include the ability to replace macrophage requirements for T-cell activation.

A critical subpopulation of T-lymphocytes involved in the induction of most immunological functions. The HIV virus has selective tropism for the T4 cell which expresses the CD4 phenotypic marker, a receptor for HIV. In fact, the key element in the profound immunosuppression seen in HIV infection is the depletion of this subset of T-lymphocytes.

Round, granular, mononuclear phagocytes found in the alveoli of the lungs. They ingest small inhaled particles resulting in degradation and presentation of the antigen to immunocompetent cells.

A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.

Movement of tethered, spherical LEUKOCYTES along the endothelial surface of the microvasculature. The tethering and rolling involves interaction with SELECTINS and other adhesion molecules in both the ENDOTHELIUM and leukocyte. The rolling leukocyte then becomes activated by CHEMOKINES, flattens out, and firmly adheres to the endothelial surface in preparation for transmigration through the interendothelial cell junction. (From Abbas, Cellular and Molecular Immunology, 3rd ed)

Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.

Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.

Morphologic alteration of small B LYMPHOCYTES or T LYMPHOCYTES in culture into large blast-like cells able to synthesize DNA and RNA and to divide mitotically. It is induced by INTERLEUKINS; MITOGENS such as PHYTOHEMAGGLUTININS, and by specific ANTIGENS. It may also occur in vivo as in GRAFT REJECTION.

Ring compounds having atoms other than carbon in their nuclei. (Grant & Hackh's Chemical Dictionary, 5th ed)

Elements of limited time intervals, contributing to particular results or situations.

Cell surface proteins that bind signalling molecules external to the cell with high affinity and convert this extracellular event into one or more intracellular signals that alter the behavior of the target cell (From Alberts, Molecular Biology of the Cell, 2nd ed, pp693-5). Cell surface receptors, unlike enzymes, do not chemically alter their ligands.

Chemokine receptors that are specific for CC CHEMOKINES.

An interleukin-1 subtype that is synthesized as an inactive membrane-bound pro-protein. Proteolytic processing of the precursor form by CASPASE 1 results in release of the active form of interleukin-1beta from the membrane.

A cytokine that stimulates the growth and differentiation of B-LYMPHOCYTES and is also a growth factor for HYBRIDOMAS and plasmacytomas. It is produced by many different cells including T-LYMPHOCYTES; MONOCYTES; and FIBROBLASTS.

Differentiation antigens residing on mammalian leukocytes. CD stands for cluster of differentiation, which refers to groups of monoclonal antibodies that show similar reactivity with certain subpopulations of antigens of a particular lineage or differentiation stage. The subpopulations of antigens are also known by the same CD designation.

Surface ligands, usually glycoproteins, that mediate cell-to-cell adhesion. Their functions include the assembly and interconnection of various vertebrate systems, as well as maintenance of tissue integration, wound healing, morphogenic movements, cellular migrations, and metastasis.

Cellular receptors that bind the human immunodeficiency virus that causes AIDS. Included are CD4 ANTIGENS, found on T4 lymphocytes, and monocytes/macrophages, which bind to the HIV ENVELOPE PROTEIN GP120.

The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.

Connective tissue cells of an organ found in the loose connective tissue. These are most often associated with the uterine mucosa and the ovary as well as the hematopoietic system and elsewhere.

Cell surface receptors for INTERLEUKIN-17. Several subtypes of receptors have been found, each with its own in specificity for interleukin-17 subtype.

The outer covering of the body that protects it from the environment. It is composed of the DERMIS and the EPIDERMIS.

Specialized tissues that are components of the lymphatic system. They provide fixed locations within the body where a variety of LYMPHOCYTES can form, mature and multiply. The lymphoid tissues are connected by a network of LYMPHATIC VESSELS.

Any of several ways in which living cells of an organism communicate with one another, whether by direct contact between cells or by means of chemical signals carried by neurotransmitter substances, hormones, and cyclic AMP.

Culture media containing biologically active components obtained from previously cultured cells or tissues that have released into the media substances affecting certain cell functions (e.g., growth, lysis).

A cell line derived from cultured tumor cells.

Cytokine-induced cell adhesion molecule present on activated endothelial cells, tissue macrophages, dendritic cells, bone marrow fibroblasts, myoblasts, and myotubes. It is important for the recruitment of leukocytes to sites of inflammation. (From Pigott & Power, The Adhesion Molecule FactsBook, 1993, p154)

White blood cells formed in the body's lymphoid tissue. The nucleus is round or ovoid with coarse, irregularly clumped chromatin while the cytoplasm is typically pale blue with azurophilic (if any) granules. Most lymphocytes can be classified as either T or B (with subpopulations of each), or NATURAL KILLER CELLS.

A proinflammatory cytokine produced primarily by T-LYMPHOCYTES or their precursors. Several subtypes of interleukin-17 have been identified, each of which is a product of a unique gene.

They are oval or bean shaped bodies (1 - 30 mm in diameter) located along the lymphatic system.

A large group of structurally diverse cell surface receptors that mediate endocytic uptake of modified LIPOPROTEINS. Scavenger receptors are expressed by MYELOID CELLS and some ENDOTHELIAL CELLS, and were originally characterized based on their ability to bind acetylated LOW-DENSITY LIPOPROTEINS. They can also bind a variety of other polyanionic ligand. Certain scavenger receptors can internalize micro-organisms as well as apoptotic cells.

Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.

The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.

Measurable and quantifiable biological parameters (e.g., specific enzyme concentration, specific hormone concentration, specific gene phenotype distribution in a population, presence of biological substances) which serve as indices for health- and physiology-related assessments, such as disease risk, psychiatric disorders, environmental exposure and its effects, disease diagnosis, metabolic processes, substance abuse, pregnancy, cell line development, epidemiologic studies, etc.

A technique of culturing mixed cell types in vitro to allow their synergistic or antagonistic interactions, such as on CELL DIFFERENTIATION or APOPTOSIS. Coculture can be of different types of cells, tissues, or organs from normal or disease states.

A family of pattern recognition receptors characterized by an extracellular leucine-rich domain and a cytoplasmic domain that share homology with the INTERLEUKIN 1 RECEPTOR and the DROSOPHILA toll protein. Following pathogen recognition, toll-like receptors recruit and activate a variety of SIGNAL TRANSDUCING ADAPTOR PROTEINS.

Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.

Antibodies that inhibit the reaction between ANTIGEN and other antibodies or sensitized T-LYMPHOCYTES (e.g., antibodies of the IMMUNOGLOBULIN G class that compete with IGE antibodies for antigen, thereby blocking an allergic response). Blocking antibodies that bind tumors and prevent destruction of tumor cells by CYTOTOXIC T-LYMPHOCYTES have also been called enhancing antibodies. (Rosen et al., Dictionary of Immunology, 1989)

A critical subpopulation of regulatory T-lymphocytes involved in MHC Class I-restricted interactions. They include both cytotoxic T-lymphocytes (T-LYMPHOCYTES, CYTOTOXIC) and CD8+ suppressor T-lymphocytes.

All of the processes involved in increasing CELL NUMBER including CELL DIVISION.

Infection of the lung often accompanied by inflammation.

The mucous membrane lining the RESPIRATORY TRACT, including the NASAL CAVITY; the LARYNX; the TRACHEA; and the BRONCHI tree. The respiratory mucosa consists of various types of epithelial cells ranging from ciliated columnar to simple squamous, mucous GOBLET CELLS, and glands containing both mucous and serous cells.

A pattern recognition receptor that interacts with LYMPHOCYTE ANTIGEN 96 and LIPOPOLYSACCHARIDES. It mediates cellular responses to GRAM-NEGATIVE BACTERIA.

The third type of glial cell, along with astrocytes and oligodendrocytes (which together form the macroglia). Microglia vary in appearance depending on developmental stage, functional state, and anatomical location; subtype terms include ramified, perivascular, ameboid, resting, and activated. Microglia clearly are capable of phagocytosis and play an important role in a wide spectrum of neuropathologies. They have also been suggested to act in several other roles including in secretion (e.g., of cytokines and neural growth factors), in immunological processing (e.g., antigen presentation), and in central nervous system development and remodeling.

A species of CORONAVIRUS causing pneumonia in newborn rats but a clinically inapparent infection in adults. It is separate but antigenically related to MURINE HEPATITIS VIRUS.

A pattern recognition receptor that forms heterodimers with other TOLL-LIKE RECEPTORS. It interacts with multiple ligands including PEPTIDOGLYCAN, bacterial LIPOPROTEINS, lipoarabinomannan, and a variety of PORINS.

The inner membrane of a joint capsule surrounding a freely movable joint. It is loosely attached to the external fibrous capsule and secretes SYNOVIAL FLUID.

A classification of T-lymphocytes, especially into helper/inducer, suppressor/effector, and cytotoxic subsets, based on structurally or functionally different populations of cells.

The development of new BLOOD VESSELS during the restoration of BLOOD CIRCULATION during the healing process.

Substances that reduce or suppress INFLAMMATION.

INFLAMMATION of the PERITONEUM lining the ABDOMINAL CAVITY as the result of infectious, autoimmune, or chemical processes. Primary peritonitis is due to infection of the PERITONEAL CAVITY via hematogenous or lymphatic spread and without intra-abdominal source. Secondary peritonitis arises from the ABDOMINAL CAVITY itself through RUPTURE or ABSCESS of intra-abdominal organs.

A chronic systemic disease, primarily of the joints, marked by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures. Etiology is unknown, but autoimmune mechanisms have been implicated.

The relationship between the dose of an administered drug and the response of the organism to the drug.

Cells contained in the bone marrow including fat cells (see ADIPOCYTES); STROMAL CELLS; MEGAKARYOCYTES; and the immediate precursors of most blood cells.

A hemeprotein from leukocytes. Deficiency of this enzyme leads to a hereditary disorder coupled with disseminated moniliasis. It catalyzes the conversion of a donor and peroxide to an oxidized donor and water. EC 1.11.1.7.

Bone marrow-derived lymphocytes that possess cytotoxic properties, classically directed against transformed and virus-infected cells. Unlike T CELLS; and B CELLS; NK CELLS are not antigen specific. The cytotoxicity of natural killer cells is determined by the collective signaling of an array of inhibitory and stimulatory CELL SURFACE RECEPTORS. A subset of T-LYMPHOCYTES referred to as NATURAL KILLER T CELLS shares some of the properties of this cell type.

An encapsulated lymphatic organ through which venous blood filters.

A plant genus of the family APIACEAE.

Heteropolysaccharides which contain an N-acetylated hexosamine in a characteristic repeating disaccharide unit. The repeating structure of each disaccharide involves alternate 1,4- and 1,3-linkages consisting of either N-acetylglucosamine or N-acetylgalactosamine.

An albumin obtained from the white of eggs. It is a member of the serpin superfamily.

Soluble factors which stimulate growth-related activities of leukocytes as well as other cell types. They enhance cell proliferation and differentiation, DNA synthesis, secretion of other biologically active molecules and responses to immune and inflammatory stimuli.

Theoretical representations that simulate the behavior or activity of immune system, processes, or phenomena. They include the use of mathematical equations, computers, and other electrical equipment.

The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.

A cytokine produced by a variety of cell types, including T-LYMPHOCYTES; MONOCYTES; DENDRITIC CELLS; and EPITHELIAL CELLS that exerts a variety of effects on immunoregulation and INFLAMMATION. Interleukin-10 combines with itself to form a homodimeric molecule that is the biologically active form of the protein.

A condition characterized by the presence of ENDOTOXINS in the blood. On lysis, the outer cell wall of gram-negative bacteria enters the systemic circulation and initiates a pathophysiologic cascade of pro-inflammatory mediators.

Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.

A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.

Damage to any compartment of the lung caused by physical, chemical, or biological agents which characteristically elicit inflammatory reaction. These inflammatory reactions can either be acute and dominated by NEUTROPHILS, or chronic and dominated by LYMPHOCYTES and MACROPHAGES.

Substances that augment, stimulate, activate, potentiate, or modulate the immune response at either the cellular or humoral level. The classical agents (Freund's adjuvant, BCG, Corynebacterium parvum, et al.) contain bacterial antigens. Some are endogenous (e.g., histamine, interferon, transfer factor, tuftsin, interleukin-1). Their mode of action is either non-specific, resulting in increased immune responsiveness to a wide variety of antigens, or antigen-specific, i.e., affecting a restricted type of immune response to a narrow group of antigens. The therapeutic efficacy of many biological response modifiers is related to their antigen-specific immunoadjuvanticity.

Mice homozygous for the mutant autosomal recessive gene "scid" which is located on the centromeric end of chromosome 16. These mice lack mature, functional lymphocytes and are thus highly susceptible to lethal opportunistic infections if not chronically treated with antibiotics. The lack of B- and T-cell immunity resembles severe combined immunodeficiency (SCID) syndrome in human infants. SCID mice are useful as animal models since they are receptive to implantation of a human immune system producing SCID-human (SCID-hu) hematochimeric mice.

Intercellular signaling peptides and proteins that regulate the proliferation of new blood vessels under normal physiological conditions (ANGIOGENESIS, PHYSIOLOGICAL). Aberrant expression of angiogenic proteins during disease states such as tumorigenesis can also result in PATHOLOGICAL ANGIOGENESIS.

The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.

Devices used in a technique by which cells or tissues are grown in vitro or, by implantation, in vivo within chambers permeable to diffusion of solutes across the chamber walls. The chambers are used for studies of drug effects, osmotic responses, cytogenic and immunologic phenomena, metabolism, etc., and include tissue cages.

Lymphoid cells concerned with humoral immunity. They are short-lived cells resembling bursa-derived lymphocytes of birds in their production of immunoglobulin upon appropriate stimulation.

The process of altering the morphology and functional activity of macrophages so that they become avidly phagocytic. It is initiated by lymphokines, such as the macrophage activation factor (MAF) and the macrophage migration-inhibitory factor (MMIF), immune complexes, C3b, and various peptides, polysaccharides, and immunologic adjuvants.

The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.

Immunoglobulin molecules having a specific amino acid sequence by virtue of which they interact only with the ANTIGEN (or a very similar shape) that induced their synthesis in cells of the lymphoid series (especially PLASMA CELLS).

A soluble factor produced by activated T-LYMPHOCYTES that induces the expression of MHC CLASS II GENES and FC RECEPTORS on B-LYMPHOCYTES and causes their proliferation and differentiation. It also acts on T-lymphocytes, MAST CELLS, and several other hematopoietic lineage cells.

A membrane-bound tumor necrosis family member found primarily on LYMPHOCYTES. It can form a heterotrimer (LYMPHOTOXIN ALPHA1, BETA2 HETEROTRIMER) with the soluble ligand LYMPHOTOXIN-ALPHA and anchor it to the cell surface. The membrane-bound complex is specific for the LYMPHOTOXIN BETA receptor.

Glycoproteins found on the membrane or surface of cells.

The larger air passages of the lungs arising from the terminal bifurcation of the TRACHEA. They include the largest two primary bronchi which branch out into secondary bronchi, and tertiary bronchi which extend into BRONCHIOLES and PULMONARY ALVEOLI.

Epidermal cells which synthesize keratin and undergo characteristic changes as they move upward from the basal layers of the epidermis to the cornified (horny) layer of the skin. Successive stages of differentiation of the keratinocytes forming the epidermal layers are basal cell, spinous or prickle cell, and the granular cell.

Serum that contains antibodies. It is obtained from an animal that has been immunized either by ANTIGEN injection or infection with microorganisms containing the antigen.

Integrin alpha4beta1 is a FIBRONECTIN and VCAM-1 receptor present on LYMPHOCYTES; MONOCYTES; EOSINOPHILS; NK CELLS and thymocytes. It is involved in both cell-cell and cell- EXTRACELLULAR MATRIX adhesion and plays a role in INFLAMMATION, hematopoietic cell homing and immune function, and has been implicated in skeletal MYOGENESIS; NEURAL CREST migration and proliferation, lymphocyte maturation and morphogenesis of the PLACENTA and HEART.

The worsening of a disease over time. This concept is most often used for chronic and incurable diseases where the stage of the disease is an important determinant of therapy and prognosis.

One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.

A heterodimeric cytokine that plays a role in innate and adaptive immune responses. Interleukin-12 is a 70 kDa protein that is composed of covalently linked 40 kDa and 35 kDa subunits. It is produced by DENDRITIC CELLS; MACROPHAGES and a variety of other immune cells and plays a role in the stimulation of INTERFERON-GAMMA production by T-LYMPHOCYTES and NATURAL KILLER CELLS.

A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.

Disease having a short and relatively severe course.

Adverse functional, metabolic, or structural changes in ischemic tissues resulting from the restoration of blood flow to the tissue (REPERFUSION), including swelling; HEMORRHAGE; NECROSIS; and damage from FREE RADICALS. The most common instance is MYOCARDIAL REPERFUSION INJURY.

Forceful administration into the peritoneal cavity of liquid medication, nutrient, or other fluid through a hollow needle piercing the abdominal wall.

Isolation of novel GRO genes and a phylogenetic analysis of the CXC chemokine subfamily in mammals. (1/2535)

Approximately 15 different alpha, or CXC, chemokines have thus far been isolated from 11 species of mammals. Among the best studied chemokines are the 12 human proteins that are encoded by 11 paralogous genes. In order to better understand the evolution and function of this group of genes, we isolated and characterized six novel GRO and GRO-related cDNA sequences from the cow (Bos taurus), the sheep (Ovis aries), the rabbit (Oryctolagus cuniculus), and the guinea pig (Cavia porcellus). The amino acid sequence of the diverged guinea pig GRO or KC gene is only 50%-60% similar to presumed orthologs from other species, while the sheep and cow GRO proteins are 90%-99% similar to each other. The presence of multiple GRO genes in the cow, the rabbit, and the sheep is consistent with what has been observed for humans. Phylogenetic analyses of amino acid sequences from 44 proteins indicate that genes orthologous to many of the 11 known from humans exist in other species. One such gene, interleukin 8, or IL8, has been isolated from nine species, including the rodent guinea pig; however, this gene is absent in the rat and the mouse, indicating a unique gene loss event in the rat/mouse (muroid rodent) lineage. The KC (or MIP2) gene of rodents appears to be orthologous to the GRO gene found in other taxonomic orders. Combined evidence from different sources suggests that IP10 and MIG share sister taxon relationships on the evolutionary tree, while the remaining paralogous genes represent independent lineages, with limited evidence for kinship between them. This observation indicates that these genes originated nearly contemporaneously via a series of gene duplication events. Relative-rate tests for synonymous and nonsynonymous nucleotide substitutions in the KC and IL8 genes did not detect rate heterogeneity; however, there are several notable features regarding the IL8 genes. For example, the IL8 proteins from two Old World monkeys are as similar to one another as they are to the IL8 protein from humans, and all observed nucleotide differences between the IL8 genes of the two monkeys cause amino acid changes; in other words, there are no synonymous differences between them. (+info)

Chemokine and chemokine receptor gene variants and risk of non-Hodgkin's lymphoma in human immunodeficiency virus-1-infected individuals. (2/2535)

Normal B-lymphocyte maturation and proliferation are regulated by chemotactic cytokines (chemokines), and genetic polymorphisms in chemokines and chemokine receptors modify progression of human immunodeficiency virus-1 (HIV-1) infection. Therefore, 746 HIV-1-infected persons were examined for associations of previously described stromal cell-derived factor 1 (SDF-1) chemokine and CCR5 and CCR2 chemokine receptor gene variants with the risk of B-cell non-Hodgkin's lymphoma (NHL). The SDF1-3'A chemokine variant, which is carried by 37% of whites and 11% of blacks, was associated with approximate doubling of the NHL risk in heterozygotes and roughly a fourfold increase in homozygotes. After a median follow-up of 11.7 years, NHL developed in 6 (19%) of 30 SDF1-3'A/3'A homozygotes and 22 (10%) of 202 SDF1-+/3'A heterozygotes, compared with 24 (5%) of 514 wild-type subjects. The acquired immunodeficiency syndrome (AIDS)-protective chemokine receptor variant CCR5-triangle up32 was highly protective against NHL, whereas the AIDS-protective variant CCR2-64I had no significant effect. Racial differences in SDF1-3'A frequency may contribute to the lower risk of HIV-1-associated NHL in blacks compared with whites. SDF-1 genotyping of HIV-1-infected patients may identify subgroups warranting enhanced monitoring and targeted interventions to reduce the risk of NHL. (+info)

Cutting edge: clustered AU-rich elements are the target of IL-10-mediated mRNA destabilization in mouse macrophages. (3/2535)

In the present study we show that IL-10-mediated inhibition of inflammatory gene expression can be mediated by an AU-rich element (ARE) cluster present in the 3' untranslated region (3'UTR) of sensitive genes. A series of chloramphenicol acetyl transferase (CAT) reporter gene constructs were prepared in which different fragments from the IL-10-sensitive KC mRNA 3'UTR were placed downstream of the coding region of the reporter gene CAT. CAT mRNA containing the KC 3'UTR was markedly destabilized as compared with the control CAT mRNA, and the decay rate was further increased in cells stimulated with IL-10. The KC 3'UTR contains an ARE cluster and three isolated ARE motifs. The ARE cluster spanning nucleotides 378-399 appeared to be both necessary and sufficient to mediate sensitivity to IL-10 because a 116-nucleotide fragment that contains the cluster conferred sensitivity, while mutation of the sequence between positions 378 and 399 eliminated sensitivity. The destabilizing effect of IL-10 was relatively selective, as the stability of chimeric CAT mRNAs was not modulated in cells treated with IFN-gamma or IL-4. (+info)

Identification of CXCR4 domains that support coreceptor and chemokine receptor functions. (4/2535)

The interaction of the chemokine stromal cell-derived factor 1 (SDF-1) with its receptor CXCR4 is vital for cell trafficking during development, is capable of inhibiting human immunodeficiency virus type 1 (HIV-1) utilization of CXCR4 as a coreceptor, and has been implicated in delaying disease progression to AIDS in vivo. Because of the importance of this chemokine-chemokine receptor pair to both development and disease, we investigated the molecular basis of the interaction between CXCR4 and its ligands SDF-1 and HIV-1 envelope. Using CXCR4 chimeras and mutants, we determined that SDF-1 requires the CXCR4 amino terminus for binding and activates downstream signaling pathways by interacting with the second extracellular loop of CXCR4. SDF-1-mediated activation of CXCR4 required the Asp-Arg-Tyr motif in the second intracellular loop of CXCR4, was pertussis toxin sensitive, and did not require the distal C-terminal tail of CXCR4. Several CXCR4 mutants that were not capable of binding SDF-1 or signaling still supported HIV-1 infection, indicating that the ability of CXCR4 to function as a coreceptor is independent of its ability to signal. Direct binding studies using the X4 gp120s HXB, BH8, and MN demonstrated the ability of HIV-1 gp120 to bind directly and specifically to the chemokine receptor CXCR4 in a CD4-dependent manner, using a conformationally complex structure on CXCR4. Several CXCR4 variants that did not support binding of soluble gp120 could still function as viral coreceptors, indicating that detectable binding of monomeric gp120 is not always predictive of coreceptor function. (+info)

Expression of specific chemokines and chemokine receptors in the central nervous system of multiple sclerosis patients. (5/2535)

Chemokines direct tissue invasion by specific leukocyte populations. Thus, chemokines may play a role in multiple sclerosis (MS), an idiopathic disorder in which the central nervous system (CNS) inflammatory reaction is largely restricted to mononuclear phagocytes and T cells. We asked whether specific chemokines were expressed in the CNS during acute demyelinating events by analyzing cerebrospinal fluid (CSF), whose composition reflects the CNS extracellular space. During MS attacks, we found elevated CSF levels of three chemokines that act toward T cells and mononuclear phagocytes: interferon-gamma-inducible protein of 10 kDa (IP-10); monokine induced by interferon-gamma (Mig); and regulated on activation, normal T-cell expressed and secreted (RANTES). We then investigated whether specific chemokine receptors were expressed by infiltrating cells in demyelinating MS brain lesions and in CSF. CXCR3, an IP-10/Mig receptor, was expressed on lymphocytic cells in virtually every perivascular inflammatory infiltrate in active MS lesions. CCR5, a RANTES receptor, was detected on lymphocytic cells, macrophages, and microglia in actively demyelinating MS brain lesions. Compared with circulating T cells, CSF T cells were significantly enriched for cells expressing CXCR3 or CCR5. Our results imply pathogenic roles for specific chemokine-chemokine receptor interactions in MS and suggest new molecular targets for therapeutic intervention. (+info)

The T cell-specific CXC chemokines IP-10, Mig, and I-TAC are expressed by activated human bronchial epithelial cells. (6/2535)

Recruitment of activated T cells to mucosal surfaces, such as the airway epithelium, is important in host defense and for the development of inflammatory diseases at these sites. We therefore asked whether the CXC chemokines IFN-induced protein of 10 kDa (IP-10), monokine induced by IFN-gamma (Mig), and IFN-inducible T-cell alpha-chemoattractant (I-TAC), which specifically chemoattract activated T cells by signaling through the chemokine receptor CXCR3, were inducible in respiratory epithelial cells. The effects of proinflammatory cytokines, including IFN-gamma (Th1-type cytokine), Th2-type cytokines (IL-4, IL-10, and IL-13), and dexamethasone were studied in normal human bronchial epithelial cells (NHBEC) and in two human respiratory epithelial cell lines, A549 and BEAS-2B. We found that IFN-gamma, but not TNF-alpha or IL-1 beta, strongly induced IP-10, Mig, and I-TAC mRNA accumulation mainly in NHBEC and that TNF-alpha and IL-1 beta synergized with IFN-gamma induction in all three cell types. High levels of IP-10 protein (> 800 ng/ml) were detected in supernatants of IFN-gamma/TNF-alpha-stimulated NHBEC. Neither dexamethasone nor Th2 cytokines modulated IP-10, Mig, or I-TAC expression. Since IFN-gamma is up-regulated in tuberculosis (TB), using in situ hybridization we studied the expression of IP-10 in the airways of TB patients and found that IP-10 mRNA was expressed in the bronchial epithelium. In addition, IP-10-positive cells obtained by bronchoalveolar lavage were significantly increased in TB patients compared with normal controls. These results show that activated bronchial epithelium is an important source of IP-10, Mig, and I-TAC, which may, in pulmonary diseases such as TB (in which IFN-gamma is highly expressed) play an important role in the recruitment of activated T cells. (+info)

Isolation of the CXC chemokines ENA-78, GRO alpha and GRO gamma from tumor cells and leukocytes reveals NH2-terminal heterogeneity. Functional comparison of different natural isoforms. (7/2535)

Chemokines are a family of chemotactic peptides affecting leukocyte migration during the inflammatory response. Post-translational modification of chemokines has been shown to affect their biological potency. Here, the isolation and identification of natural isoforms of the neutrophil chemoattractants GRO alpha and GRO gamma and the epithelial-cell-derived neutrophil attractant-78 (ENA-78), is reported. Cultured tumor cells produced predominantly intact chemokine forms, whereas peripheral blood monocytes secreted mainly NH2-terminally truncated forms. The order of neutrophil chemotactic potency of these CXC chemokines was GRO alpha > GRO gamma > ENA-78 both for intact and truncated forms. However, truncated GRO alpha (4,5,6-73), GRO gamma (5-73) and ENA-78(8,9-78) were 30-fold, fivefold and threefold more active than the corresponding intact chemokine. As a consequence, truncated GRO alpha (4,5,6-73) was 300-fold more potent than intact ENA-78 indicating that both the type of chemokine and its mode of processing determine the chemotactic potency. Similar observations were made when intact and truncated GRO alpha, GRO gamma and ENA-78 were compared for their capacity to induce an increase in the intracellular calcium concentration in neutrophilic granulocytes, and to desensitize the calcium response towards the CXC chemokine granulocyte chemotactic protein-2 (GCP-2). It must be concluded that physiological proteolytic cleavage of CXC chemokines in general enhances the inflammatory response, whereas for CC chemokines NH2-terminal processing mostly results in reduced chemotactic potency. (+info)

Elevated constitutive IkappaB kinase activity and IkappaB-alpha phosphorylation in Hs294T melanoma cells lead to increased basal MGSA/GRO-alpha transcription. (8/2535)

The basal transcription of the CXC chemokine, melanocyte growth stimulatory activity (MGSA)/growth-regulated protein (GRO)-alpha, is up-regulated in Hs294T melanoma cells compared with the normal retinal pigment epithelial (RPE) cells. Previous studies characterized a cytokine-inducible, functional nuclear factor (NF)-kappaB consensus element in the immediate 5' regulatory region of the MGSA/GRO-alpha gene at -78 bp. Although the cytokine-inducible mechanisms for transcription of this gene are fairly well delineated, the mechanisms involved in its basal up-regulation of transcription in Hs294T melanoma cells are poorly understood. Recently, we demonstrated an increased rate of IkappaB-alpha degradation in Hs294T cells, which leads to an increased nuclear localization of NF-kappaB (R. L. Shattuck-Brandt and A. Richmond. Cancer Res., 57: 3032-3039, 1997). Here we demonstrate that Hs294T melanoma cells have elevated basal IkappaB kinase (IKK) activity relative to RPE cells, causing an increased constitutive IkappaB-alpha phosphorylation and degradation. We also show here that the resultant elevated nuclear NF-kappaB (p50/p65) in these cells is responsible for the increased basal transcription of MGSA/GRO-alpha. Pretreatment of Hs294T or RPE cells with proteasome inhibitors MG115 or MG132 captures the slower migrating, constitutively phosphorylated form of IkappaB-alpha in Hs294T melanoma cells, but not in RPE cells. In addition, a phospho-specific antibody that specifically recognizes the inhibitory form of IkappaB that is phosphorylated at Ser-32 reacted with IkappaB-alpha in Hs294T cell, but not in unstimulated RPE cells. Although the basal level of protein expression of IKK-alpha or IKK-beta are the same in both Hs294T and RPE cells, immunoprecipitation with IKK-alpha antibody combined with activity assay reveal a constitutively active IKK complex in Hs294T melanoma cells. Cotransfection of a 350-bp MGSA/GRO-alpha promoter-luciferase reporter construct with either the dominant negative IKK-alpha or the repressors of NF-kappaB, the IkappaB-alpha wild type or mutants lacking the inducible phosphorylation sites, demonstrates that the increased basal MGSA/GRO-alpha transcription in the Hs294T cells is due to the enhanced nuclear activation of NF-kappaB. (+info)

Maheshwari A, Christensen RD, Calhoun DA (November 2003). "ELR+ CXC chemokines in human milk". Cytokine. 24 (3): 91-102. doi: ... chemokines, and others. Colostrum also contains a number of growth factors, such as insulin-like growth factors I (IGF-1), and ...

https://en.wikipedia.org/wiki/Colostrum

Brandt E, Ludwig A, Petersen F, Flad HD (Oct 2000). "Platelet-derived CXC chemokines: old players in new games". Immunological ... Ahuja SK, Lee JC, Murphy PM (Jan 1996). "CXC chemokines bind to unique sets of selectivity determinants that can function ... Ahuja SK, Murphy PM (Aug 1996). "The CXC chemokines growth-regulated oncogene (GRO) alpha, GRObeta, GROgamma, neutrophil- ... Interleukin 8 receptor, beta is a chemokine receptor. IL8RB is also known as CXCR2, and CXCR2 is now the IUPHAR Committee on ...

https://en.wikipedia.org/wiki/Interleukin_8_receptor,_beta

C-X-C motif chemokine 10 is a small cytokine belonging to the CXC chemokine family. The gene for CXCL10 is located on human ... O'Donovan N, Galvin M, Morgan JG (1999). "Physical mapping of the CXC chemokine locus on human chromosome 4". Cytogenetics and ... Farber JM (March 1997). "Mig and IP-10: CXC chemokines that target lymphocytes". Journal of Leukocyte Biology. 61 (3): 246-57. ... This chemokine elicits its effects by binding to the cell surface chemokine receptor CXCR3. The three-dimensional crystal ...

https://en.wikipedia.org/wiki/CXCL10

... "lnterleukin-8 and related chemotactic cytokines-CXC and CC chemokines". Advances in immunology. 55: 97-179. "Academy of Europe ... It was the first of more than 50 chemokines.{{cite web}}: CS1 maint: url-status (link) Baggiolini, Marco (1998). "Chemokines ... Chemokines act as chemoattractants to guide the migration of cells. Some control cells of the immune system, some promote the ... is a Swiss immunologist and biochemist known for the discovery and the analysis of the first chemokines (or chemotactic ...

https://en.wikipedia.org/wiki/Marco_Baggiolini

CC chemokines act on monocytes (e.g., RANTES), and CXC chemokines are neutrophil granulocyte-specific (e.g., IL-8).[citation ... Chemokines belong to a special class of cytokines; not only do their groups (C, CC, CXC, CX3C chemokines) represent ... Chemokines - chemokine receptors (CCR or CXCR), and Leukotrienes - leukotriene receptors (BLT). However, induction of a wide ... "Combined anti CXC receptors 1 and 2 therapy is a promising anti-inflammatory treatment for respiratory diseases by reducing ...

https://en.wikipedia.org/wiki/Chemotaxis

... chemokines ligand 2, CCL5, CXC-chemokine ligand 1 (CXCL1); as well as macrophage retention factors. Macrophages within the ... The maintenance of foam cells and the subsequent progression of plaque build-up is caused by the secretion of chemokines and ... Foam cells secrete pro-inflammatory cytokines such as interleukins: IL-1, IL-6; tumour necrosis factor (TNF); chemokines: ... chemokines, reactive oxygen species (ROS) and growth factors that stimulate modified lipoprotein uptake and vascular smooth ...

https://en.wikipedia.org/wiki/Foam_cell

The protein is a CXC chemokine receptor. CXCR-4 is an alpha-chemokine receptor specific for stromal-derived-factor-1 (SDF-1 ... Saini V, Marchese A, Majetschak M (May 2010). "CXC chemokine receptor 4 is a cell surface receptor for extracellular ubiquitin ... "MIF is a noncognate ligand of CXC chemokine receptors in inflammatory and atherogenic cell recruitment". Nature Medicine. 13 (5 ... "The promiscuous chemokine binding profile of the Duffy antigen/receptor for chemokines is primarily localized to sequences in ...

https://en.wikipedia.org/wiki/CXCR4

The chemokine (C-X-C motif) ligand 1 (CXCL1) is a small peptide belonging to the CXC chemokine family that acts as a ... Spaks A (April 2017). "Role of CXC group chemokines in lung cancer development and progression". Journal of Thoracic Disease. 9 ... CXCL1 exists as both monomer and dimer and both forms are able to bind chemokine receptor CXCR2. However, CXCL1 chemokine is ... this protein is encoded by the gene Cxcl1 and is located on human chromosome 4 among genes for other CXC chemokines. ...

https://en.wikipedia.org/wiki/CXCL1

... (PF4) is a small cytokine belonging to the CXC chemokine family that is also known as chemokine (C-X-C motif ... O'Donovan N, Galvin M, Morgan JG (1999). "Physical mapping of the CXC chemokine locus on human chromosome 4". Cytogenetics and ... "Entrez Gene: PF4 platelet factor 4 (chemokine (C-X-C motif) ligand 4)". Lasagni L, Francalanci M, Annunziato F, Lazzeri E, ... PF4 is chemotactic for neutrophils, fibroblasts and monocytes, and interacts with a splice variant of the chemokine receptor ...

https://en.wikipedia.org/wiki/Platelet_factor_4

2003). "Chemokine-cytokine cross-talk. The ELR+ CXC chemokine LIX (CXCL5) amplifies a proinflammatory cytokine response via a ... The protein encoded by this gene, CXCL5 is a small cytokine belonging to the CXC chemokine family that is also known as ... The gene for CXCL5 has four exons and is located on human chromosome 4 amongst several other CXC chemokine genes. CXCL5 has ... Walz A, Schmutz P, Mueller C, Schnyder-Candrian S (1997). "Regulation and function of the CXC chemokine ENA-78 in monocytes and ...

https://en.wikipedia.org/wiki/CXCL5

Chemokines are divided into four main subfamilies: C, CC, CXC, and CX3C. Microglial cells are sources of some chemokines and ... The chemokines CCL5/RANTES, CCL3/MIP-1α, CCL4/MIP-1β, all of which bind to CCR5, are inhibitory to HIV-1 replication in ... The chemokine receptor, CX3CR1, is expressed by microglia in the central nervous system. Fractalkine (CX3CL1) is the exclusive ... Chemokines are cytokines that stimulate directional migration of inflammatory cells in vitro and in vivo. ...

https://en.wikipedia.org/wiki/Role_of_microglia_in_disease

October 2007). "Methimazole inhibits CXC chemokine ligand 10 secretion in human thyrocytes". J. Endocrinol. 195 (1): 145-55. ...

https://en.wikipedia.org/wiki/Thiamazole

This protein belongs to the intercrine alpha (chemokine CXC) family. SDF-1 is produced in two forms, SDF-1α/CXCL12a and SDF-1β/ ... The CXCL12 proteins belong to the group of CXC chemokines, whose initial pair of cysteines are separated by one intervening ... The stromal cell-derived factor 1 (SDF-1), also known as C-X-C motif chemokine 12 (CXCL12), is a chemokine protein that in ... Chemokines and chemokine receptors, of which CXCR stands out, regulate multiple processes such as morphogenesis, angiogenesis, ...

https://en.wikipedia.org/wiki/Stromal_cell-derived_factor_1

"A streptococcal protease that degrades CXC chemokines and impairs bacterial clearance from infected tissues". EMBO J. 25 (19): ... "Effect of a bacterial pheromone peptide on host chemokine degradation in group A streptococcal necrotising soft-tissue ...

https://en.wikipedia.org/wiki/Streptococcus_pyogenes

"Cell surface-anchored SR-PSOX/CXC chemokine ligand 16 mediates firm adhesion of CXC chemokine receptor 6-expressing cells". ... Matloubian M, David A, Engel S, Ryan JE, Cyster JG (October 2000). "A transmembrane CXC chemokine is a ligand for HIV- ... CXC, and CX3C chemokines". Journal of Immunology. 166 (8): 5145-54. doi:10.4049/jimmunol.166.8.5145. PMID 11290797. Lee B, ... C-X-C chemokine receptor type 6 is a protein that in humans is encoded by the CXCR6 gene. CXCR6 has also recently been ...

https://en.wikipedia.org/wiki/CXCR6

C-X-C motif chemokine 11 is a small cytokine belonging to the CXC chemokine family that is also called Interferon-inducible T- ... Luo Y, Kim R, Gabuzda D, Mi S, Collins-Racie LA, Lu Z, Jacobs KA, Dorf ME (December 1998). "The CXC-chemokine, H174: expression ... Satish L, Yager D, Wells A (June 2003). "Glu-Leu-Arg-negative CXC chemokine interferon gamma inducible protein-9 as a mediator ... Its gene is located on human chromosome 4 along with many other members of the CXC chemokine family. CXCL9, -10, -11 have ...

https://en.wikipedia.org/wiki/CXCL11

Chemokine (C-X-C motif) ligand 3 (CXCL3) is a small cytokine belonging to the CXC chemokine family that is also known as GRO3 ... O'Donovan N, Galvin M, Morgan JG (1999). "Physical mapping of the CXC chemokine locus on human chromosome 4". Cytogenet. Cell ... Ahuja SK, Murphy PM (August 1996). "The CXC chemokines growth-regulated oncogene (GRO) alpha, GRObeta, GROgamma, neutrophil- ... Cxcl3 is directly regulated transcriptionally by BTG2 The gene for CXCL3 is located on chromosome 4 in a cluster of other CXC ...

https://en.wikipedia.org/wiki/CXCL3

Chemokine (C-X-C motif) ligand 16 (CXCL16) is a small cytokine belonging to the CXC chemokine family. Larger than other ... Matloubian M, David A, Engel S, Ryan J, Cyster J (2000). "A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo". ... chemokines (with 254 amino acids), CXCL16 is composed of a CXC chemokine domain, a mucin-like stalk, a transmembrane domain and ... "The transmembrane CXC-chemokine ligand 16 is induced by IFN-gamma and TNF-alpha and shed by the activity of the disintegrin- ...

https://en.wikipedia.org/wiki/CXCL16

Chemokine (C-X-C motif) ligand 2 (CXCL2) is a small cytokine belonging to the CXC chemokine family that is also called ... The gene for CXCL2 is located on human chromosome 4 in a cluster of other CXC chemokines. CXCL2 mobilizes cells by interacting ... O'Donovan N, Galvin M, Morgan JG (1999). "Physical mapping of the CXC chemokine locus on human chromosome 4". Cytogenetics and ... identical in amino acid sequence as a related chemokine, CXCL1. This chemokine is secreted by monocytes and macrophages and is ...

https://en.wikipedia.org/wiki/CXCL2

This chemokine is also known under the name lungkine. CXCL15 is an ELR+ CXC chemokine (it contains the amino acid sequence E-L- ... Chemokine (C-X-C motif) ligand 15 (CXCL15) is a small cytokine belonging to the CXC chemokine family that has been described in ... Rossi D, Hurst S, Xu Y, Wang W, Menon S, Coffman R, Zlotnik A (1999). "Lungkine, a novel CXC chemokine, specifically expressed ... R immediately before its CXC motif) that recruits neutrophils during inflammation of the lungs. It is highly abundant in ...

https://en.wikipedia.org/wiki/CXCL15

Chemokine (C-X-C motif) ligand 6 (CXCL6) is a small cytokine belonging to the CXC chemokine family that is also known as ... The gene for CXCL6 is located on human chromosome 4 in a cluster with other CXC chemokine genes. GRCh38: Ensembl release 89: ... Modi W, Chen Z (1998). "Localization of the human CXC chemokine subfamily on the long arm of chromosome 4 using radiation ... O'Donovan N, Galvin M, Morgan J (1999). "Physical mapping of the CXC chemokine locus on human chromosome 4". Cytogenet Cell ...

https://en.wikipedia.org/wiki/CXCL6

... is a small chemokine belonging to the CXC chemokine family. As its other names suggest, this chemokine is selectively ... The gene for CXCL13 is located on human chromosome 4 in a cluster of other CXC chemokines. In T lymphocytes, CXCL13 expression ... Chemokine (C-X-C motif) ligand 13 (CXCL13), also known as B lymphocyte chemoattractant (BLC) or B cell-attracting chemokine 1 ( ... a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5". J. Exp. Med. 187 (4): ...

https://en.wikipedia.org/wiki/CXCL13

Chemokine receptor CXCR3 is a Gαi protein-coupled receptor in the CXC chemokine receptor family. Other names for CXCR3 are G ... Chemokine receptors Chemokine Cluster of differentiation GRCh38: Ensembl release 89: ENSG00000186810 - Ensembl, May 2017 GRCm38 ... CXCR3-A binds to the CXC chemokines CXCL9 (MIG), CXCL10 (IP-10), and CXCL11 (I-TAC) whereas CXCR3-B can also bind to CXCL4 in ... "Delayed and deficient dermal maturation in mice lacking the CXCR3 ELR-negative CXC chemokine receptor". The American Journal of ...

https://en.wikipedia.org/wiki/CXCR3

"Rat coronaviruses infect rat alveolar type I epithelial cells and induce expression of CXC chemokines". Virology. 369 (2): 288- ...

https://en.wikipedia.org/wiki/Murine_coronavirus

"CXC chemokines suppress proliferation of myeloid progenitor cells by activation of the CXC chemokine receptor 2". J. Immunol. ...

https://en.wikipedia.org/wiki/Interleukin_3

It may be mediated by interaction through CXCR4 (CD184) the receptor for CXC Chemokines (e.g., SDF1) and α4β1 integrins. ... Burger JA, Spoo A, Dwenger A, Burger M, Behringer D (August 2003). "CXCR4 chemokine receptors (CD184) and alpha4beta1 integrins ...

https://en.wikipedia.org/wiki/Hematopoietic_stem_cell

"Single cells from human primary colorectal tumors exhibit polyfunctional heterogeneity in secretions of ELR+ CXC chemokines". ... paper from the Love lab reported the use of microengraving in evaluating the expression of pro-angiogenic ELR+ CXC chemokines ...

https://en.wikipedia.org/wiki/Enumeral

"Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin ...

https://en.wikipedia.org/wiki/CD278

The encoded protein, Chemokine (C-X-C motif) ligand is a small cytokine belonging to the CXC chemokine family. It is an isoform ... March 2007). "Importance of CXC chemokine receptor 2 in the homing of human peripheral blood endothelial progenitor cells to ... "Entrez Gene: PPBP pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)". Hristov M, Zernecke A, Bidzhekov K, et al. ( ... Chemokine (C-X-C motif) ligand 7 (CXCL7) is a human gene. ...

https://en.wikipedia.org/wiki/CXCL7

Kielian T, Barry B, Hickey WF (April 2001). "CXC chemokine receptor-2 ligands are required for neutrophil-mediated host defense ... Chemokine (C-C motif) ligand 1 (CCL1) is also known as small inducible cytokine A1 and I-309 in humans. CCL1 is a small ... CCL1 is encoded by CCL1 gene which is one of the several chemokine genes clustered on the chromosome 17q11.2-q12 in humans. It ... July 1998). "The chemokine receptor CCR8 is preferentially expressed in Th2 but not Th1 cells". Journal of Immunology. 161 (2 ...

https://en.wikipedia.org/wiki/CCL1

The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is composed of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Six alternatively spliced transcript variants encoding three distinct isoforms have been reported.[5] ...

https://en.wikipedia.org/wiki/Interleukin_5_receptor_alpha_subunit

October 1998). "Peripheral blood-derived CD34+ progenitor cells: CXC chemokine receptor 4 and CC chemokine receptor 5 ... Lataillade JJ, Clay D, Dupuy C, Rigal S, Jasmin C, Bourin P, Le Bousse-Kerdilès MC (February 2000). "Chemokine SDF-1 enhances ... Finally, recent data suggest CD34 may also play a more selective role in chemokine-dependent migration of eosinophils and ...

https://en.wikipedia.org/wiki/CD34

2008). "Macrophage-specific metalloelastase (MMP-12) truncates and inactivates ELR+ CXC chemokines and generates CCL2, -7, -8, ... "Entrez Gene: chemokine (C-C motif) ligand 8". Van Coillie E, Fiten P, Nomiyama H, Sakaki Y, Miura R, Yoshie O, Van Damme J, ... Chemokine (C-C motif) ligand 8 (CCL8), also known as monocyte chemoattractant protein 2 (MCP2), is a protein that in humans is ... The gene for CCL8 is encoded by 3 exons and is located within a large cluster of CC chemokines on chromosome 17q11.2 in humans ...

https://en.wikipedia.org/wiki/CCL8

... which is more typical for the CXC chemokine family members. The speed of immune responses varies depending on the type of the ... Power CA, Clemetson JM, Clemetson KJ, Wells TN (August 1995). "Chemokine and chemokine receptor mRNA expression in human ... Griffith JW, Sokol CL, Luster AD (2014). "Chemokines and chemokine receptors: positioning cells for host defense and immunity ... October 1998). "HIV-1 envelope gp120 inhibits the monocyte response to chemokines through CD4 signal-dependent chemokine ...

https://en.wikipedia.org/wiki/CCL7

... and subsequently trigger an immune response begins with binding of indigestible gliadin fragments to the chemokine CXC motif ...

https://en.wikipedia.org/wiki/Larazotide

2005). "CXC chemokine ligand 12-induced focal adhesion kinase activation and segregation into membrane domains is modulated by ...

https://en.wikipedia.org/wiki/RGS1

... species specificity of the CC chemokine 6Ckine signaling through the CXC chemokine receptor CXCR3: human 6Ckine is not a ligand ... Chemokine (C-C motif) ligand 21 (CCL21) is a small cytokine belonging to the CC chemokine family. This chemokine is also known ... "Macrophage-derived chemokine and EBI1-ligand chemokine attract human thymocytes in different stage of development and are ... identification of a novel chemokine receptor that binds dendritic cell- and T cell-active chemokines including ELC, SLC, and ...

https://en.wikipedia.org/wiki/CCL21

... chemokines, c MeSH D12.776.467.374.200.110 - chemokines, cc MeSH D12.776.467.374.200.120 - chemokines, cxc MeSH D12.776.467.374 ... chemokines, cx3c MeSH D12.776.467.374.200.508 - interleukin-8 MeSH D12.776.467.374.200.600 - macrophage inflammatory proteins ...

https://en.wikipedia.org/wiki/List_of_MeSH_codes_(D12.776)

Ahuja SK, Murphy PM (1996). "The CXC chemokines growth-regulated oncogene (GRO) alpha, GRObeta, GROgamma, neutrophil-activating ... This name and the corresponding gene symbol IL8RA have been replaced by the HGNC approved name C-X-C motif chemokine receptor 1 ... "Chemokine Receptors: CXCR1". IUPHAR Database of Receptors and Ion Channels. International Union of Basic and Clinical ... a new inhibitor of the chemokine receptors CXCR1 and CXCR2". Biochem. Pharmacol. 69 (3): 385-94. doi:10.1016/j.bcp.2004.10.007 ...

https://en.wikipedia.org/wiki/Interleukin_8_receptor,_alpha

Directed migration of neural stem cells to sites of CNS injury by the stromal cell-derived factor 1alpha/CXC chemokine receptor ... "Directed migration of neural stem cells to sites of CNS injury by the stromal cell-derived factor 1α/CXC chemokine receptor 4 ... The role of the chemokines in migration of stem cells was demonstrated in 1997 when it was discovered that bone marrow stem ... Aiuti, A.; Webb, I. J.; Bleul, C.; Springer, T.; Gutierrez-Ramos, J. C. (January 6, 1997). "The chemokine SDF-1 is a ...

https://en.wikipedia.org/wiki/Jaime_Imitola

Chemokine (C-X-C motif) ligand 9 (CXCL9) is a small cytokine belonging to the CXC chemokine family that is also known as ... species specificity of the CC chemokine 6Ckine signaling through the CXC chemokine receptor CXCR3: human 6Ckine is not a ligand ... It is closely related to two other CXC chemokines called CXCL10 and CXCL11, whose genes are located near the gene for CXCL9 on ... O'Donovan N, Galvin M, Morgan JG (1999). "Physical mapping of the CXC chemokine locus on human chromosome 4". Cytogenetics and ...

https://en.wikipedia.org/wiki/CXCL9

... cells in close proximity to the intravascular accumulations of the malignant B-cells fail to express key CXC chemokine receptor ...

https://en.wikipedia.org/wiki/Intravascular_lymphomas

CXC chemokine mRNA in human peripheral blood mononuclear cells, in an IFN-gamma-independent manner". Genes and Immunity. 8 (2 ... chemokines, and other autoimmune‐related components. High levels of IL-29 in serum or disease-specific tissue was observed in ... or enhanced expression of the costimulatory molecules and chemokine receptors on pDC, which are the main producers of IFN-α. IL ...

https://en.wikipedia.org/wiki/Interleukin_29

CXC chemokine receptors InterPro: IPR001053 Chemokine (C-X-C motif) receptor 3 (CXCR3) Chemokine (C-X-C motif) receptor 4 ( ... Chemokine receptor InterPro: IPR000355 Chemokine (C-C motif) receptor 1 (CCR1, CKR1) Chemokine (C-C motif) receptor 2 (CCR2, ... CXCR4, Fusin) Chemokine (C-X-C motif) receptor 5 (CXCR5) Chemokine (C-X-C motif) receptor 6 (CXCR6, BONZO) Chemokine (C-X-C ... Chemokine (C-C motif) receptor 4 (CCR4, CKR4) Chemokine (C-C motif) receptor 5 (CCR5, CKR5) Chemokine (C-C motif) receptor 8 ( ...

https://en.wikipedia.org/wiki/Rhodopsin-like_receptors

Other CXC chemokines that lack the ELR motif, such as CXCL13, tend to be chemoattractant for lymphocytes. CXC chemokines bind ... CXCR that bind CXC chemokines, CCR that bind CC chemokines, CX3CR1 that binds the sole CX3C chemokine (CX3CL1), and XCR1 that ... C4-CC chemokines), but a small number of CC chemokines possess six cysteines (C6-CC chemokines). C6-CC chemokines include CCL1 ... The third group of chemokines is known as the C chemokines (or γ chemokines), and is unlike all other chemokines in that it has ...

https://en.wikipedia.org/wiki/Chemokine

Chemokine (C-X-C motif) ligand 17 (CXCL17) is a small cytokine belonging to the CXC chemokine family that has been identified ... It is also known as VEGF co-regulated chemokine 1 (VCC-1) and dendritic cell- and monocyte-attracting chemokine-like protein ( ... CXCL17 is an orphan chemokine with no known receptor. The receptor for CXCL17 is likely to be a G protein-coupled receptor ( ... DMC). This chemokine is constitutively expressed in the lung. The gene for human CXCL17 is located on chromosome 19. ...

https://en.wikipedia.org/wiki/CXCL17

... s are divided into different families, CXC chemokine receptors, CC chemokine receptors, CX3C chemokine ... CXC chemokine receptors (six members) CC chemokine receptors (ten/eleven members) C chemokine receptors (one member, XCR1) CX3C ... Two types of chemokines that bind to these receptors are inflammatory chemokines and homeostatic chemokines. Inflammatory ... chemokine receptors (one member, CX3CR1) Fifty chemokines have been discovered so far, and most bind onto CXC and CC families. ...

https://en.wikipedia.org/wiki/Chemokine_receptor

Chemokine (C-X-C motif) ligand 14 (CXCL14) is a small cytokine belonging to the CXC chemokine family that is also known as BRAK ... for breast and kidney-expressed chemokine). Mature CXCL14 has many of the conserved features of the CXC chemokine subfamily but ... a novel divergent CXC chemokine preferentially expressed in normal versus malignant cells". Biochemical and Biophysical ... "In vivo expression of the novel CXC chemokine BRAK in normal and cancerous human tissue". The American Journal of Pathology. ...

https://en.wikipedia.org/wiki/CXCL14

... with none in CC chemokines and only one intervening amino acid in CXC chemokines. CX3CL1 is produced as a long protein (with ... Fractalkine, also known as chemokine (C-X3-C motif) ligand 1, is a protein that in humans is encoded by the CX3CL1 gene. ... Its gene is located on human chromosome 16 along with some CC chemokines known as CCL17 and CCL22. Fractalkine is found ... Nomiyama H, Imai T, Kusuda J, Miura R, Callen DF, Yoshie O (1998). "Human chemokines fractalkine (SCYD1), MDC (SCYA22) and TARC ...

https://en.wikipedia.org/wiki/CX3CL1

CXC chemokine receptors are integral membrane proteins that specifically bind and respond to cytokines of the CXC chemokine ... However, CXCR6 is more closely related in structure to CC chemokine receptors than to other CXC chemokine receptors. ACKR3 was ... CXCR1 and CXCR2 are closely related receptors that recognize CXC chemokines that possess an E-L-R amino acid motif immediately ... There are currently six known CXC chemokine receptors in mammals, named CXCR1 through CXCR6. ...

https://en.wikipedia.org/wiki/CXC_chemokine_receptors

NMR Structure of CXC Chemokine CXCL11/ITAC. *PDB DOI: 10.2210/pdb1RJT/pdb ... which indicates a beta-bulge in beta-strand 1 that distorts the dimerization interface used by other CXC chemokines. ... NMR structure of CXCR3 binding chemokine CXCL11 (ITAC).. Booth, V., Clark-Lewis, I., Sykes, B.D.. (2004) Protein Sci 13: 2022- ... Unlike related chemokines such as IP-10 and IL-8, ITAC does not appear to form dimers at millimolar concentrations. The origin ...

https://www.rcsb.org/structure/1RJT

ELR-CXC chemokines are known to bind to CXC chemokine receptor 2 (CXCR2) (with the exception of IL-8, which also binds to CXCR1 ... CXC chemokines have been described as key molecules in the regulation of angiogenesis (30). Whereas ELR-CXC chemokines promote ... Although this chemokine clusters with other ELR-CXC chemokines, none of them can confidently be assigned to be its human ... The role of CXC chemokines in the regulation of angiogenesis in non-small cell lung cancer. J. Leukocyte Biol. 62: 554. ...

https://www.jimmunol.org/node/65893.full.print

Role of PTEN in regulating IR-induced CXC-chemokine signalling and its importance. *Waugh, David (PI) ...

https://pure.qub.ac.uk/en/projects/cruk-c11512a1185

These chemokines were identified initially in IFN-γ-activated macrophages (24, 36). Both are members of the CXC chemokine ... Immunotherapy with Interleukin-10 Depends on the CXC Chemokines Inducible Protein-10 and Monokine Induced by IFN-γ1 Russell ... Two CXC chemokines, Mig and IP-10, are critical to the tumor-inhibitory activity of another cytokine IL-12 (12, 13, 14), and ... Tannenbaum C. S., Tubbs R., Armstrong D., Finke J. H., Bukowski R. M., Hamilton T. A. The CXC chemokines IP-10 and Mig are ...

https://aacrjournals.org/cancerres/article/62/9/2606/509855/Immunotherapy-with-Interleukin-10-Depends-on-the

Our results show that the melanoma cell lines do not express or express in a low degree the chemokine receptors on their cell ... Coexpression of chemokine receptors and their ligands was found in human melanoma cell lines. However, this expression is ... However, as well as in the original cell lines, minute or no expression of the chemokine receptors was observed at the cell ... In melanoma, chemokine receptors have been implicated in organ selective metastasis by regulating processes such as ...

https://bmccancer.biomedcentral.com/articles/10.1186/1471-2407-14-118/tables/4

Mouse CXC-chemokine ligand 16,CXCL16 ELISA Kit ...

https://www.doronscientific.com/product-page/mouse-cxc-chemokine-ligand-16-cxcl16-elisa-kit

CXC motif) ligand 1; CXCL13 = chemokine (CXC motif) ligand 13; CXCR5 = CXC chemokine receptor type 5; CX3CL1 = chemokine CX3C ... and proinflammatory chemokines (e.g., [CC motif] ligand 2, CXC motif chemokine 5)[3,10,11] that directly bind and stimulate G- ... chemokines, and Toll-like receptors that are essential for immune modulation.[19,30-32] Release of cytokines and chemokines ... chemokine (CC motif) ligand 2; CSF1 = colony-stimulating factor 1; CXCL1 = chemokine ( ...

https://www.medscape.com/viewarticle/899763

Chemokine_CXC; 1 of 4 subgroup designations based on the arrangement of the two N-terminal cysteine residues; includes a number ... This antimicrobial gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. Binding of this protein to ... C-X-C motif chemokine ligand 10provided by HGNC. Primary source. HGNC:HGNC:10637 See related. Ensembl:ENSG00000169245 MIM: ... C-X-C motif chemokine 10. Names. 10 kDa interferon gamma-induced protein. gamma IP10. interferon-inducible cytokine IP-10. ...

https://www.ncbi.nlm.nih.gov/gene/3627

Chemokine CXCL9 * Chemokines, CXC / genetics * Cytoskeletal Proteins / genetics * Gene Expression * Humans * Interferon Type I ...

https://pubmed.ncbi.nlm.nih.gov/16736505/?dopt=Abstract

Recombinant TSLP induces IL-6 and CC/CXC chemokines release from HASM cells. To investigate whether TSLP can influence HASM ... IL-8/CXCL8, a CXC family chemokine, is involved in neutrophil recruitment and activation. Increased IL-8/CXCL8 expression has ... Thymic Stromal Lymphopoietin Receptor-Mediated IL-6 and CC/CXC Chemokines Expression in Human Airway Smooth Muscle Cells: Role ... Recombinant TSLP induces IL-6 and CC/CXC chemokines release from HASM cells ...

https://journals.aai.org/jimmunol/article/184/12/7134/84823/Thymic-Stromal-Lymphopoietin-Receptor-Mediated-IL

To confirm the roles of the ELR-CXC chemokines in LPS-driven airway pathology, the authors exposed swine to bacterial LPS and ... tested whether blocking ELR-CXC chemokines would have beneficial effects. Delivery of the ELR-CXC chemokine antagonist CXCL8(3- ... These data implicates the ELR-CXC chemokines in the neutrophilic inflammation observed after airways exposure to bacterial LPS. ... Exposure to such dusts induces expression of ELR-CXC chemokines (e.g., interleukin [IL]-8), prototypical neutrophil ...

http://www2a.cdc.gov/nioshtic-2/BuildQyr.asp?s1=respiratory&f1=%2A&Startyear=&Adv=0&terms=1&EndYear=&Limit=10000&sort=&D1=10&PageNo=350&RecNo=3499&View=f&

Overexpression of CXC chemokine ligand 14exacerbates collagen-induced arthritis[J]. J Immunol, 2010, 184(8):4455-4459.. [16] ... Abstract: Objective: To analyze the expression and its promoter methylation of chemokine CXC ligand 14 (CXCL14) in peripheral ... Expression and its promoter methylation of chemokine CXC ligand 14 in peripheral blood mononuclear cells from patients with ... Expression and its promoter methylation of chemokine CXC ligand 14 in peripheral blood mononuclear cells from patients with ...

http://manu37.magtech.com.cn/Jwk_jsyxkx/cjap/EN/Y2017/V33/I3/197

We show here high levels of expression and secretion of the chemokine CXC ligand 5 (CXCL5) in the macrophage fraction of white ... We show here high levels of expression and secretion of the chemokine CXC ligand 5 (CXCL5) in the macrophage fraction of white ... CXC ligand 5 is an adipose-tissue derived factor that links obesity to insulin resistance Cell Metab. 2009 Apr;9(4):339-49. doi ...

https://pubmed.ncbi.nlm.nih.gov/19356715/

Organization and promoter analysis of the zebrafish (Danio rerio) chemokine gene (CXC-64) promoter. ...

https://ir.sinica.edu.tw/handle/201000000A/30379

Gα-13 induces CXC motif chemokine ligand 5 expression in prostate cancer cells by transactivating NF-κB. Journal of Biological ... This analysis revealed that GNA13 levels affected multiple CXC-family chemokines.. *. Cell Biology ...

https://www.jbc.org/Signal-Transduction?startPage=&KeywordRaw=inflammation

22] Expression of CXC chemokine receptor and its ligand are known to be involved in cancer metastasis. [24] It has been ... Balkwill F. Cancer and the chemokine network. Nat Rev Cancer. 2004 Jul. 4(7):540-50. [QxMD MEDLINE Link]. ... 23] Bone marrow stromal cells provide a niche for MTCs through various interactions mediated by integrins, chemokines, bone ...

https://emedicine.medscape.com/article/1079102-overview

... they may regulate CXC-chemokine production. Blockage of these adhesion molecules may improve survival and remote organ injury ... In contrast, a significant difference in KC and MIP-2 chemokine levels was observed between the wild-type and P/I null mice. ... that often accompanies liver I/R injury, through chemokine regulation. ... From: CXC-chemokine regulation and neutrophil trafficking in hepatic ischemia-reperfusion injury in P-selectin/ICAM-1 deficient ...

https://journal-inflammation.biomedcentral.com/articles/10.1186/1476-9255-4-11/figures/2

CXC chemokines with a glutamate-leucine-arginine (ELR) tripeptide motif (ELR+ CXC chemokines) play an important role in ... N2 - CXC chemokines with a glutamate-leucine-arginine (ELR) tripeptide motif (ELR+ CXC chemokines) play an important role in ... AB - CXC chemokines with a glutamate-leucine-arginine (ELR) tripeptide motif (ELR+ CXC chemokines) play an important role in ... abstract = "CXC chemokines with a glutamate-leucine-arginine (ELR) tripeptide motif (ELR+ CXC chemokines) play an important ...

https://jhu.pure.elsevier.com/en/publications/low-intensity-shear-stress-increases-endothelial-elrsupsup-cxc-ch

The CXC chemokine MIP-2 stimulates neutrophil mobilization in the rat bone marrow within a CD49d-reliant manner. Posted on ... The CXC chemokine MIP-2 stimulates neutrophil mobilization in the rat bone marrow within a CD49d-reliant manner. an revise of ... and may be the receptor for CXC chemokine ligands, cXCL8 [1] especially. CXCR2 mediates a G-protein-coupled receptor (GPCR) ... ELR+ chemokines such as for example CXCL8 activated neutrophil mobilization within a CXCR2-reliant and CXCR1-reliant way [15]. ...

https://fsmr.org/%EF%BB%BFthe-cxc-chemokine-mip-2-stimulates-neutrophil-mobilization-in-the-rat-bone-marrow-within-a-cd49d-reliant-manner/

CXCR5 (C-X-Chemokine Receptor Type 5, CD185) also known as Burkitt lymphoma receptor 1 (BLR1) belongs to the CXC chemokine ... Furthermore, this chemokine receptor plays a critical role in lymphocyte trafficking, in particular T cell migration into the B ... CD185, which is also known as C-X-C chemokine receptor 5 (CXCR5) and Burkitt lymphoma receptor 1 (BLR1), is a seven ... CXCR5 is a G protein-coupled seven transmembrane receptor for chemokine BLC. CXCR5 gene is specifically expressed in Burkitt′s ...

https://www.fishersci.com/shop/products/cd185-cxcr5-mouse-anti-human-pe-clone-mu5ubee-ebioscience-1/501128659?tab=document

Belongs to the intercrine alpha (chemokine CxC) family.. * Post-translational. modifications. Several N-terminal processed ...

https://www.abcam.com/recombinant-human-il-8-protein-active-ab259397.html

Effect of polarized release of CXC-chemokines from wild-type and cystic fibrosis murine airway epithelial cells. Am. J. Respir ... an inflammatory response of the epithelial cells is to produce CXC-chemokines, which act as chemoattractants for P. aeruginosa. ...

https://www.nature.com/articles/s41522-018-0057-2?error=cookies_not_supported&code=0751262c-96b2-43da-8a8b-fe3e2846a114

Design, synthesis, and biological evaluation of scaffold-based tripeptidomimetic antagonists for CXC chemokine receptor 4 ( ...

https://bora.uib.no/bora-xmlui/browse?value=Berg,%20Erik&type=author

High CXC Chemokine Ligand 16 (CXCL16) Expression Promotes Proliferation and Metastasis of Lung Cancer via Regulating the NF-κB ...

https://medscimonit.com/abstract/related/idArt/922659

... chemokines, MHC, and NF-κB), cell cycle regulation (cyclin B2, CDK1, and CKI3), matrix metalloproteinases (MMPs) and cellular ... CXC chemokine K60 TATGCACTGGCATCGGAGTT NM_204305 GGCACTGTCAAGGCTGAGAA chGAPDH TGCATCTGCCCATTTGATGT *The first column indicates ...

https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-11-445/tables/2

... patients with meningoradiculoneuritis had higher levels of B-cell chemoattractants CXC motif chemokine ligand (CXCL) 12 and ...

http://cdc.gov/eid

Chemokine (CXC) receptor 2; CMKAR2;... ... C-X-C chemokine receptor type 2; CD 182; CD182 antigen; CDw128b ...

https://biocheminfo.org/mbs542591-calretinin-positive-control/?setCurrencyId=3

CXC chemokine receptors are integral membrane proteins that specifically bind and respond to cytokines of the CXC chemokine family. (wikipedia.org)
They represent one subfamily of chemokine receptors, a large family of G protein-linked receptors that are known as seven transmembrane (7-TM) proteins, since they span the cell membrane seven times. (wikipedia.org)
There are currently six known CXC chemokine receptors in mammals, named CXCR1 through CXCR6. (wikipedia.org)
CXCR1 and CXCR2 are closely related receptors that recognize CXC chemokines that possess an E-L-R amino acid motif immediately adjacent to their CXC motif. (wikipedia.org)
CXCR6 was formerly called three different names (STRL33, BONZO, and TYMSTR) before being assigned CXCR6 based on its chromosomal location (within the chemokine receptor cluster on human chromosome 3p21) and its similarity to other chemokine receptors in its gene sequence. (wikipedia.org)
However, CXCR6 is more closely related in structure to CC chemokine receptors than to other CXC chemokine receptors. (wikipedia.org)
Several human chemokine receptors have been sons than for those homozygous for the wild classified as such on the basis of similarity of type CCR5 (12,17-19,23). (cdc.gov)
What Are Chemokine Receptors? (cdc.gov)
5] reported that CXCR2-mediated neutrophil recruitment to sites of irritation can be governed by CCRL2, a seven-transmembrane domains receptor that stocks functional and structural similarities with atypical chemokine receptors. (fsmr.org)
Chemokines are a group of cytokines superfamily, which have been classified into 4 subfamilies (CXC, CX3C, CC, and C). Growing evidence suggested that Chemokines and chemokine receptors are crucial regulatory factors in acute lung injury (7). (researchsquare.com)
Qin S, Rottman JB, Myers P, et al: The chemokine receptors CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions. (spandidos-publications.com)
Bonecchi R, Bianchi G, Bordignon PP, et al: Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. (spandidos-publications.com)
In the adult central nervous system (CNS), chemokines and their receptors are involved in developmental, physiological and pathological processes. (frontiersin.org)
These chemokines and their receptors are therefore involved in a range of homeostatic processes including immune surveillance, neuro/gliogenesis and modulation of synaptic transmission. (frontiersin.org)
In addition to these anatomical barriers, the expression of chemokines and chemokine receptors at the BBB and blood-CSF barrier serves as an immunological checkpoint and prevents (during non-inflammatory/homeostatic conditions) or promotes (during neuroinflammation) the infiltration of circulating leukocytes into the deeper CNS parenchyma and ventricular or subarachnoid CSF spaces (Figure 1 ). (frontiersin.org)
Does staining at room temperature or even at 37°C help for checking chemokine receptors expression? (biolegend.com)
Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal. (biolegend.com)
ENA-78 contains the four conserved cysteine residues present in CXC chemokines, and also contains the 'ELR' motif common to CXC chemokines that bind to the CXCR1 and CXCR2 receptors. (peprotech.com)
Certain chemokine receptors predominate on either Th1 or Th2 cells. (ersjournals.com)
Cytokine receptors expressed by Th2 cells include CC chemokine receptor (CCR)4, CCR8 and CXCR4. (ersjournals.com)
It elicits its chemotactic effects by interacting with the chemokine receptors CXCR1 and CXCR2. (creativebiomart.net)
Tumour cell migration and metastasis share many similarities with leukocyte trafficking, which is critically regulated by chemokines and their receptors. (springernature.com)
Here we report that the chemokine receptors CXCR4 and CCR7 are highly expressed in human breast cancer cells, malignant breast tumours and metastases. (springernature.com)
Our findings indicate that chemokines and their receptors have a critical role in determining the metastatic destination of tumour cells. (springernature.com)
CXCR1 is one of more than 20 distinct chemokine receptors expressed in human leukocytes. (guidetoimmunopharmacology.org)
TLR signaling triggers a cascade of events in DCs that includes modified chemokine and cytokine production, altered chemokine receptor expression, and changes in signaling through G protein-coupled receptors (GPCRs). (eurekamag.com)
Chemokine receptors that are specific for CXC CHEMOKINES. (ouhsc.edu)
Cotton rat GRO has been shown to bind and activate both mouse chemokine receptors CXCR1 and CXCR2 (7). (bio-techne.com)
Chemokines are small regulatory proteins that play a crucial role in the coordinated migration of cell populations to the site of infection/inflammation by binding to their cognate receptors. (imrpress.com)
In principle, chemokine receptors, which are serpentine G protein-coupled receptors (GPCRs), mediate the series of downstream intracellular signaling events that occur inside the cells to resolve the pathogenicity. (imrpress.com)
G protein-coupled receptor kinase (GRKs) plays a crucial role in the desensitization and internalization of the chemokine receptors. (imrpress.com)
Extracellular matrix and adhesion molecules, as well as chemokines and their receptors, are important in adult HSC migration. (biomedcentral.com)
We have analyzed by quantitative polymerase chain reaction (qPCR) array the expression pattern of extracellular matrix and adhesion molecules as well as chemokines and chemokine receptors in Lineage - Sca-1 + c-Kit + (LSK) cells at different stages of development, in order to characterize the role played by these molecules in LSK. (biomedcentral.com)
Our results show marked changes in the expression pattern of extracellular matrix, adhesion molecules, chemokines and their receptors with developmental age, particularly in later stages of development. (biomedcentral.com)
This study was undertaken to elucidate the chemokines responsible for the recruitment of B cells in the inflamed synovium, taking into account that the rich chemokine milieu present in the synovial tissue can fine-tune modulate discrete chemokine receptors. (biomedcentral.com)
Expression levels of chemokine receptors from the CC and CXC family, as well as CD27, were assessed by flow cytometry in CD20 + mononuclear cells isolated from the peripheral blood (PB) and synovial fluid (SF) of RA and psoriatic arthritis patients. (biomedcentral.com)
There are currently described more than 50 chemokines and 20 G-protein-coupled chemokine receptors [ 12 ]. (biomedcentral.com)
Upon binding to their ligands, chemokine receptors are rapidly internalized following either a degradative or recycling pathway. (biomedcentral.com)
Griffith J. W., Sokol C. L., Luster A. D. Chemokines and Chemokine Receptors: Positioning Cells for Host Defense and Immunity. (bertin-bioreagent.com)
Contributors to this include a number of chemokine receptors, notably CXC-chemokine receptor 4 (CXCR4), and other members of the G protein-coupled receptor (GPCR) family. (figshare.com)
Although best characterized as mediators of ligand-dependent chemotaxis, some chemokine receptors are also recruited to the synapse and contribute to signaling in the absence of ligation. (figshare.com)
For entry into target cells, HIV-1 requires a primary receptor, CD4, and coreceptors such as chemokine receptors. (amepr.org)
Therefore, compounds which interact with the chemokine receptors may be the ultimate hope for anti-HIV drugs. (amepr.org)

CXCR4 (also known as fusin) is the receptor for a chemokine known as CXCL12 (or SDF-1) and, as with CCR5, is utilized by HIV-1 to gain entry into target cells. (wikipedia.org)
Cxc Chemokine Receptor 4 (CXCR4) / stromal-derived factor-1 (SDF-1), also known as Cxc Chemokine Ligand 1 (CXCL1), chemokine axis was associated with inflammation of injured tissues (8). (researchsquare.com)
CXCL12 reacting with CXC-chemokine receptor type 4 (CXCR4) expressed on HSC. (termedia.pl)
The chemokine SDF1 (stromal derived factor-1) and its receptor CXCR4 regulate trafficking of normal hematopoietic stem cells (HSC) as well as metastasis of solid tumor cells. (intechopen.com)
Blocks binding of stromal cell-derived factor-1-alpha, found on bone marrow stromal cells, to the CXC chemokine receptor 4 (CXCR4). (medscape.com)
Furthermore, we show that the expression of the chemokines Ccl4 , Ccl9 , Il18 and the chemokine receptor Cxcr4 increases in LSK cells during development. (biomedcentral.com)
We observed that, in contrast to observations made in D discoideum , PTEN-null Jurkat T cells exhibited potent chemotactic responses to the chemokine stromal cell-derived factor 1α (SDF-1α), indicating that PTEN was not requisite for CXC chemokine receptor 4 (CXCR4)-mediated chemotaxis of Jurkat cells. (ashpublications.org)
CXC chemokine receptor 4 (CXCR4) is a coreceptor for the entry of T-cell-line-tropic (T-tropic) strains of HIV-1 (15), and the CC chemokine receptor 5 (CCR5) serves as a coreceptor for macrophage tropic (M-tropic) strains of HIV-1 (1, 6, 11, 14). (amepr.org)
Stromal cell-derived aspect-1 (SDF-1) and its own cognate receptor CXC chemokine receptor type 4 (CXCR4) have already been reported to become highly mixed up in reparation and regeneration of varied injured tissue by marketing the migration of stem cells (12,13). (gpr139.info)

CXCL11 (ITAC) is one of three chemokines known to bind the receptor CXCR3, the two others being CXCL9 (Mig) and CXCL10 (IP-10). (rcsb.org)
This antimicrobial gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. (nih.gov)
The chemokine interferon-γ inducible protein 10 kDa (CXCL10) is a member of the CXC chemokine family which binds to the CXCR3 receptor to exert its biological effects. (spandidos-publications.com)
Loetscher M, Loetscher P, Brass N, Meese E and Moser B: Lymphocyte-specific chemokine receptor CXCR3: regulation, chemokine binding and gene localization. (spandidos-publications.com)
Cole KE, Strick CA, Paradis TJ, et al: Interferon-inducible T cell alpha chemoattractant (I-TAC): a novel non-ELR CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. (spandidos-publications.com)
Clark-Lewis I, Mattioli I, Gong JH and Loetscher P: Structure-function relationship between the human chemokine receptor CXCR3 and its ligands. (spandidos-publications.com)
Involvement of Ip Address 10 in iPSC CM efficiency Interferon g inducible protein 10, monokine induced by IFN g and the IFN g inducible T cell chemoattractant are three chemokines that bind to a standard receptor, CXCR3. (camkkinases.com)
For instance, the CXC-chemokine receptor 3 (CXCR3) is necessary for the localization of effector T cells to the skin and for following TRM cell differentiation (10). (secretion.org)

illustrated the amplification stage of neutrophil recruitment within an inflammatory joint disease modal and demonstrated that cytokines such as for example IL-1 and chemokines such as for example CXCL12 released by turned on neutrophils activate synovial cells. (fsmr.org)
Many homeostatic chemokines are expressed on the vasculature of the blood brain barrier (BBB) including CXCL12, CCL19, CCL20, and CCL21. (frontiersin.org)
While endothelial cell expression of these chemokines is known to regulate the entry of leukocytes into the CNS during immunosurveillance, new data indicate that CXCL12 is also involved in diverse cellular activities including adult neurogenesis and neuronal survival, having an opposing role to the homeostatic chemokine, CXCL14, which appears to regulate synaptic inputs to neural precursors. (frontiersin.org)
Neuronal expression of CX 3 CL1, yet another homeostatic chemokine that promotes neuronal survival and communication with microglia, is partly regulated by CXCL12. (frontiersin.org)
For example, chemokine (CXC) ligand 12 (CXCL12) from CAFs promotes the growth and survival of malignant cells. (tocris.com)
The binding of the chemokine [C-X-C motif] ligand 12 (CXCL12 or stromal cell-derived factor 1α [SDF-1α]) constitutively produced by bone marrow stromal cells and osteoblasts, to the CXC receptor (CXCR) 4, a transmembrane chemokine receptor expressed on hematopoietic stem and progenitor cells (HSPCs), has emerged as a key signal for HSPC trafficking to and from the bone marrow. (wustl.edu)

CXCL8 (otherwise known as interleukin-8) and CXCL6 can both bind CXCR1 in humans, while all other ELR-positive chemokines, such as CXCL1 to CXCL7 bind only CXCR2. (wikipedia.org)
Functionally, TSLPR-mediated HASM activation induced a significant increase in CXC (IL-8/CXCL8), CC (eotaxin-1/CCL11) chemokines, and proinflammatory cytokine IL-6 expression. (aai.org)
Delivery of the ELR-CXC chemokine antagonist CXCL8(3-74)K11R/G31P (G31P) blocked reactive oxygen intermediate production and chemotactic responses by IL-8-challenged neutrophils in vitro. (cdc.gov)
CXCR2 is normally portrayed on neutrophils, monocytes, organic killer cells, mast cells, and endothelial cells, and may be the receptor for CXC chemokine ligands, cXCL8 [1] especially. (fsmr.org)
A recent research shows that neutrophil recruitment during irritation proceeds in two stages: an early on stage, mediated by short-lived indicators, accompanied by an amplification stage to lengthen neutrophil activation and recruitment, which is normally mediated by signaling cascades through CXCL8-family members and leukotriene-B4 chemokines [7,8]. (fsmr.org)
Neutrophils respond to CXC chemokines, such as CXCL8, but are usually unresponsive to CC chemokines, such as CCL2. (biomedcentral.com)

For background information on chemokines, see CXCL1 (MIM 155730). (abnova.com)
Receptor for the C-X-C chemokine CXCL9, CXCL1 and CXCL11 and mediates the proliferation, survival and angiogenic activity of mesangial cells through a heterotrimeric G-protein signaling pathway. (biossusa.com)
In today's study, we analyzed the independent jobs of IFN- and TNF- systems in placental malaria by calculating chemokines induced by TNF- (CCL20, CCL18, CXCL1, and CXCL13), IFN- (CXCL9), or both (CCL2). (ranscombehouseglynde.com)

A characteristic feature of neuroinflammation is the activation of glial cells, such as microglia and astrocytes, in the spinal cord and brain, leading to the release of proinflammatory cytokines and chemokines. (medscape.com)
Recent studies suggest that central cytokines and chemokines are powerful neuromodulators and play a sufficient role in inducing hyperalgesia and allodynia after central nervous system administration. (medscape.com)
Sustained increase of cytokines and chemokines in the central nervous system also promotes chronic widespread pain that affects multiple body sites. (medscape.com)
Although cumulative evidence suggests that human airway smooth muscle (HASM) cells can initiate or perpetuate the airway inflammation by secreting a variety of inflammatory cell products such as cytokines and chemokines, the role of TSLP in this pathway is not known. (aai.org)
It has also been reported that numerous cytokines and chemokines accelerate the pathological and physiological progress of ARDS (6), suggesting that inflammatory response is closely related to the pathogenesis of ARDS. (researchsquare.com)

Altogether, our data suggest that the TSLPR-mediated HASM activation induces proinflammatory cytokine and chemokines release that may facilitate inflammatory immune cells recruitment in airways. (aai.org)
Chemokine (C-X-C motif) ligand 10 (CXCL10) or IP-10 is a small cytokine belonging to the CXC chemokine family. (leinco.com)
Interleukin (IL)-18 is a pleiotropic cytokine involved in the activation of Th1 cytokine responses, Fas ligand (Fas-L) expression, and both CC and CXC chemokine induction. (arvojournals.org)
We selected most pathways CXCL11 participated on our site, such as Cytokine-cytokine receptor interaction, Chemokine signaling pathway, Toll-like receptor signaling pathway, which may be useful for your reference. (creativebiomart.net)
Chemokine (C-X-C motif) ligand 6 (CXCL6) is a small cytokine belonging to the CXC chemokine family that is also known as granulocyte chemotactic protein 2 (GCP-2). (creativebiomart.net)
CXCL9 is a small cytokine belonging to the CXC chemokine family that is also known as Monokine induced by gamma interferon (MIG). (bertin-bioreagent.com)
CCL5 is an 8kDa protein classified as a chemotactic cytokine or chemokine . (wikidoc.org)

Kanda N and Watanabe S: Prolactin enhances interferon-gamma induced production of CXC ligand 9 (CXCL9), CXCL10, and CXCL11 in human keratinocytes. (spandidos-publications.com)
Chemokine (C-X-C motif) ligand 9 (CXCL9) and suppression of tumorigenicity 2 (ST2) also were measured on the basis of previously determined associations with GVHD. (umn.edu)
In our genomewide expression profiles of malaria-infected placentas from primigravidae, transcription of chemokines, including CXCL13, CXCL9, and CCL18, was significantly upregulated and was negatively correlated with birth weight (18). (ranscombehouseglynde.com)

Several chemokines of the CXC and CC family are involved in neutrophil chemotaxis. (bmj.com)
Chemokines primarily act to promote leukocyte chemotaxis to sites of inflammation. (guidetoimmunopharmacology.org)
An Fc-fusion protein of 35kDa with a modified human immunoglobulin IgG1 Fc domain is capable of inhibiting CC chemokine-induced calcium flux, chemotaxis, and beta-arrestin recruitment in primary macrophages and transfected cells. (cusabio.com)
For example, phosphoinositide 3-kinase (PI3K) is activated during the initial steps of the chemokine induced signaling cascade to regulate chemotaxis, transcription, and cell survival. (imrpress.com)
Following the binding of a chemokine to its receptor, intracellular signal pathways lead to functional responses such as chemotaxis, secretion and transcriptional activation [ 12 , 13 ]. (biomedcentral.com)

0.05) chemokine ligands intracellularly are shown (ns: not significant expression). (biomedcentral.com)
Thus, US28 accommodates and functionally discriminates amongst highly degenerate chemokine sequences by sensing the steric bulk of the ligands, which distort both receptor extracellular loops and the walls of the ligand binding pocket to varying degrees, rather than requiring sequence-specific bonding chemistries for recognition and signaling. (elifesciences.org)
These results indicate that the level and functional status of RGS proteins in DCs significantly impact their response to GPCR ligands such as chemokines. (eurekamag.com)

strong course="kwd-title" Keywords: CXCR2, CXCR2 antagonist, an infection, irritation, neutrophils Launch Chemokines certainly are a huge category of signaling proteins that DNQX mediate mobile migration, of immune cells especially. (fsmr.org)
Significantly, CXCR2 appearance was significantly low in tumor-associated neutrophils than those in the bone tissue marrow and peripheral bloodstream [13], with endogenous IFN- inhibiting CXCR2-induced neutrophil recruitment by lowering CXCR2 ligand chemokine and appearance gradients. (fsmr.org)
ENA-78 is a CXC chemokine that signals through the CXCR2 receptor. (peprotech.com)
Therapeutically, docetaxel-induced senescence and efficacy were higher in PTEN null tumours when the percentage of tumour-infiltrating CD11b + Gr-1 + myeloid cells was reduced using an antagonist of CXC chemokine receptor 2 (CXCR2). (elsevier.com)

Our data suggest that this new lung-specific chemokine may play a role in neutrophil trafficking during normal and inflammatory conditions. (jimmunol.org)
Exposure to such dusts induces expression of ELR-CXC chemokines (e.g., interleukin [IL]-8), prototypical neutrophil chemoattractants and activators, and neutrophilic pathology. (cdc.gov)
Neutrophil products, such as elastase, chitinase-like proteins and chemokines, have been identified as important risk factors of lung damage and lung function decline and are suggested as biomarkers based on both cross-sectional and longitudinal studies in patients with CF [ 2 - 7 ] and mice with CF-like lung disease [ 8 ]. (hindawi.com)
Chemokines display a central role in mediating the neutrophil migration to inflammatory focus. (biomedcentral.com)
We found that these animals clearly display impaired leukocyte influx into the liver and no release of the neutrophil-specific, LPS-induced CXC chemokine. (ugent.be)
CXCL5, also known as neutrophil activating peptide 78 (ENA‐78), is a CXC chemokine containing ELR motif. (medchemexpress.cn)

The subfamily of the ELR-CXC chemokines is known to induce the migration of neutrophils and, in some cases, T cells, although the latter is controversial ( 12 , 13 ). (jimmunol.org)
In the CC subfamily, which includes beta chemokine, the cysteine residues are adjacent to each other. (abnova.com)
In the CXC subfamily, which includes alpha chemokine, they are separated by an intervening amino acid. (abnova.com)
Cotton rat growth-regulated protein (GRO) is a member of the ELR + CXC subfamily of chemokines (1). (bio-techne.com)

We now demonstrate that treatment of IL-10-tumor-bearing mice with antibodies to either chemokine partially reverses the therapeutic effect of IL-10. (aacrjournals.org)
Functional characteriza-tion of proximal promoter of gene for human BRAK/CXCL14, a tumor-suppressing chemokine[J]. Biomed Res, 2010, 31(2):123-131. (magtech.com.cn)
CAFs and tumor-associated macrophages (TAMs) secrete matrix metalloproteases (MMPs) that degrade ECM proteins, releasing chemokines, as well as angiogenic and growth factors. (tocris.com)
Tumor necrosis factor alpha regulates CXC chemokine receptor expression and function. (uc.edu)
Biopsias líquidas en el tumor cerebral más común en los niños. (vhio.net)
Analysis of publicly available tumor transcriptome profiles showed that the chemokine CCL5 was strongly associated with immune cell infiltration in various human cancers. (biomedcentral.com)

Many recent reports indicate a contribution of endothelial and haematopoietic progenitor cells [ 3 ], attracted via the CXC chemokine ligand 12/CXC chemokine receptor (CXCR)4 axis in the lung [ 4 ], but the role of fibrocytes in PAH is still not clear. (ersjournals.com)

In addition, S100A12 resulted in excessive mucins and the secretion of inflammatory cytokines secretion, and promoted the expression of chemokines and cell adhesion molecules via activating NLRP3 inflammasome pathway in NHBE cells. (researchsquare.com)
DARC binds and mediates the internalization of several inflammatory CC and CXC chemokines. (rndsystems.com)
The TME is regulated by intercellular communication via a diverse network of cytokines , chemokines , growth factors , inflammatory enzymes and matrix remodeling enzymes. (tocris.com)
It is known that chemokine responsiveness in neutrophils can be modulated by some inflammatory conditions, such as sepsis. (biomedcentral.com)

We describe the role of allelic polymorphism in the gene coding for the CCR5 chemokine receptor with regard to susceptibility to and disease course of HIV infection. (cdc.gov)
The present invention relates to the field of medical imaging, and in particular to imaging of disease states associated with the upregulation of the chemokine receptor 5 (CCR5). (freepatentsonline.com)
Maraviroc is a non-peptidic, low molecular weight CC chemokine receptor 5 (CCR5) ligand that has recently been marketed for the treatment of HIV infected individuals. (pasteur.fr)
This review discusses recent molecular modeling studies of CCR5 by homology to CXC chemokine receptor 4, their contribution to the understanding of the allosteric mode of action of the inhibitor and their potential for the development of future drugs with improved efficiency and preservation of CCR5 biological functions. (pasteur.fr)

Because ELR + CXC chemokines are important mediators of endothelial-leukocyte interaction, we compared chemokine expression by microvascular and aortic endothelium to investigate whether differences in chemokine expression by various endothelial types could, at least partially, explain the microvascular localization of endothelial-leukocyte interaction. (elsevier.com)
Both in vitro and in vivo models indicate that ELR + CXC chemokine expression is higher in microvascular endothelium than in aortic endothelial cells. (elsevier.com)
These differences can be explained on the basis of the preferential activation of endothelial chemokine production by low intensity shear stress. (elsevier.com)
Low shear activated endothelial ELR + CXC chemokine production via cell surface heparan sulfates, β 3 -integrins, focal adhesion kinase, the mitogen-activated protein kinase p38β, mitogen- and stress-associated protein kinase-1, and the transcription factor. (elsevier.com)
Duffy Antigen Receptor for Chemokines (DARC), also known as Fy glycoprotein and CD234, is a 7TM non-signaling chemokine receptor that is expressed on venular endothelial cells and erythrocytes. (rndsystems.com)
Many factors within the TME stimulate endothelial cells and neovascularization within cancer, including vascular endothelial growth factors (VEGFs), fibroblast growth factor and chemokines. (tocris.com)
Description: The ELR-negative CXC chemokine CXCL10 (IP-10) has been attributed to several roles, such as chemoattraction for monocytes/macrophages, T cells, NK cells, and dendritic cells, promotion of T cell adhesion to endothelial cells, antitumor activity, and inhibition of bone marrow colony formation and angiogenesis. (thearabidopsisbook.org)

CXCL11 takes on the canonical chemokine fold but exhibits greater conformational flexibility than has been observed for related chemokines under the same sample conditions. (rcsb.org)
Exposure of fibroblasts to Tricin inhibited infectious HCMV production, with concomitant decreases in levels of transcripts of the CXC chemokine IFN-inducible T cell alpha chemoattractant (I-TAC or CXCL11) gene. (chemfaces.com)

We show here high levels of expression and secretion of the chemokine CXC ligand 5 (CXCL5) in the macrophage fraction of white adipose tissue (WAT). (nih.gov)
CXCL5 belongs to the CXC‐type chemokine family with a specific amino acid sequence of glutamic acid-leucine-arginine which is shortly named as ELR motif. (medchemexpress.cn)
CXCL5 inhibits chemokine scavenging in blood in part through binding to erythrocyte DARC [4] . (medchemexpress.cn)

The chemokine receptor CXCR5 is expressed on B cells and CD4+ Tfh cells and is involved in lymphocyte homing and the development of normal lymphoid tissue. (wikipedia.org)
We describe a novel mouse CXC chemokine that is selectively expressed in lung epithelial cells and up-regulated in various lung inflammation models. (jimmunol.org)
The redundancy in chemokine production by resident and/or infiltrating cells in the lung may reflect the need for rapid cell recruitment in response to the large number of Ags that penetrate the lungs. (jimmunol.org)
Lungkine differs from all previously described chemokines because its expression is restricted to lung bronchoepithelial cells and is up-regulated during inflammation. (jimmunol.org)
One major discovery was that members of the chemokine receptor family serve as cofactors for HIV entry into cells. (cdc.gov)
To analyze the expression and its promoter methylation of chemokine CXC ligand 14 (CXCL14) in peripheral blood mononuclear cells (PBMCs) from patients with systemic lupus erythematosus (SLE). (magtech.com.cn)
5] Juremalm M, Nilsson G. Chemokine receptor expression by mast cells[J]. Chem Immunol Allergy, 2005, 87:130-144. (magtech.com.cn)
Furthermore, this chemokine receptor plays a critical role in lymphocyte trafficking, in particular T cell migration into the B cell follicles of germinal centers in response to CXCL13, making CD185 an established marker of follicular helper T cells. (fishersci.com)
The numbers of CCL5+ cells in the submucosa of patients with COPD were 2-15 times higher than any other chemokines. (bmj.com)
Although most lines of investigation focus on their ability to induce the migration of cells, recent studies indicate that chemokines also promote cellular interactions and activate signaling pathways that maintain CNS homeostatic functions. (frontiersin.org)
Moreover, signaling through the chemokine receptor CCR7 is crucial for infiltration of T-ALL cells in the central nervous system. (intechopen.com)
Genetic profiling of dendritic cells exposed to live- or ultraviolet-irradiated Chlamydia muridarum reveals marked differences in CXC chemokine profiles. (harvard.edu)
The chemokine system regulates the trafficking of immune cells to tissues and thus plays a central role in inflammation. (freepatentsonline.com)
Chemokine that acts as chemoattractant for monocytes, macrophages and dendritic cells. (cusabio.com)
Anti-PD-L1 induced the expression of several chemokines that are associated with the recruitment of cytotoxic T cells, with a further increase in expression after combination therapy. (biomedcentral.com)
Transwell experiments were used to study migration of B cells in response to a chemokine or in the presence of multiple chemokines. (biomedcentral.com)
This mechanism, known as desensitization [ 15 ], limits the magnitude and duration of signaling, thus protecting cells from chemokine overstimulation [ 16 ]. (biomedcentral.com)
8,9 The CXCL10 is a chemokine whose production is induced by IFN-g and is highly expressed on primary cells that have been infected by DENV. (microbiologyjournal.org)
The TNF- network involves activated macrophages and B cells, resulting in solid upregulation in the gene appearance of many chemokines, specifically CXCL13 (19). (ranscombehouseglynde.com)
Infected cells undergo apoptosis or necrosis and trigger inﬂammatory responses marked by the activation of proinﬂammatory cytokines or chemokines, which leads to the recruitment of inﬂammatory cells. (bali000.com)
IL-2 and IFN-γ ) that are released by T cells , CCL5 also induces the proliferation and activation of certain natural-killer ( NK ) cells to form CHAK (CC-Chemokine-activated killer) cells. (wikidoc.org)

The genes encoding this and the other ten members of the CXC chemokine family form a cluster in a region mapped to chromosome 4q. (qedbio.com)
Common sequence variants in chemokine-related genes and risk of breast cancer in post-menopausal women. (cdc.gov)
The gene for CXCL6 is located on human chromosome 4 in a cluster with other CXC chemokine genes. (creativebiomart.net)
Combination treatment led to upregulation of immune response genes, including multiple chemokine genes such as CCL5, in macrophages, and downregulation of extracellular matrix genes in fibroblasts. (biomedcentral.com)

Chemokines are basic heparin-binding proteins that, in association with adhesion molecules, play a pivotal role in selectively recruiting certain subsets of leukocytes to specific sites of inflammation and tissue injury ( 1 , 2 , 3 ). (jimmunol.org)
To investigate the expression of neutrophilic chemokines and adhesion molecules in bronchial biopsies from patients with stable COPD of different severity (GOLD stages I-IV) compared with age-matched control subjects, smokers with normal lung function and never smokers. (bmj.com)

CXC chemokines with a glutamate-leucine-arginine (ELR) tripeptide motif (ELR + CXC chemokines) play an important role in leukocyte trafficking into the tissues. (elsevier.com)
A number of chemokines, low molecular weight cytokines, are produced locally in the target sites of leukocyte trafficking and homing [ 10 , 11 ]. (biomedcentral.com)

Chemokine (C-C motif) ligand 5 (also CCL5 ) is a protein which in humans is encoded by the CCL5 gene . (wikidoc.org)

Identification of two distinct subsets of long-term nonprogressors with divergent viral activity by stromal-derived factor 1 chemokine gene polymorphism analysis. (microbiologyresearch.org)
hypothesized that circulating LT-HSC, although chemotactic by 14.5 dpc to the bone marrow recruiting chemokine stromal cell derived factor-1α (SDF-1α), would not colonize the fetal bone marrow until a suitable microenvironment is present [ 8 ]. (biomedcentral.com)

The changes in RGS18 and RGS1 expression are likely important for DC function, because both proteins inhibit G alpha(i)- and G alpha(q)-mediated signaling and can reduce CXC chemokine ligand (CXCL)12-, CC chemokine ligand (CCL)19-, or CCL21-induced cell migration. (eurekamag.com)

Methimazole inhibits CXC chemokine ligand 10 secretion in human thyrocytes. (southernbiotech.com)

Moser B and Loetscher P: Lymphocyte traffic control by chemokines. (spandidos-publications.com)
Regulation of lymphocyte trafficking by CXC chemokine receptor 3 during septic shock. (vanderbilt.edu)

Before the discovery of the role of chemokine disease is expected to increase. (cdc.gov)
Our understanding of the role of chemokine expression in the adult central nervous system (CNS) has shifted away from viewing these molecules primarily as proinflammatory mediators and more towards their ability to exert neuroprotective and reparative functions. (frontiersin.org)

CXC motif chemokine receptor 4 gene polymorphism and cancer risk. (cdc.gov)

Monocyte selectiv-ity and tissue localization suggests a role for breast and kid-ney-expressed chemokine (BRAK) in macrophage develop-ment[J]. J Exp Med, 2001, 194(6):855-861. (magtech.com.cn)

To probe the molecular basis of US28's unique ligand cross-reactivity, we deep-sequenced CX3CL1 chemokine libraries selected on 'molecular casts' of the US28 active-state and find that US28 can engage thousands of distinct chemokine sequences, many of which elicit diverse signaling outcomes. (elifesciences.org)

Our results demonstrate that free airway DNA levels correlate with obstructive lung disease and proinflammatory chemokines in CF patients and CF mice and could serve as therapeutic target and potential biomarker in CF lung disease. (hindawi.com)

We had shown previously that expression of the CXC chemokines Mig (monokine induced by IFN-γ) and IP-10 (inducible protein 10) is observed in IL-10 transduced but not neo-vector control tumors. (aacrjournals.org)
Enhanced TSLP expression has been detected in asthmatic airways that correlated with both the expression of Th2-attracting chemokines and with disease severity. (aai.org)
Loetscher M, Gerber B, Loetscher P, et al: Chemokine receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes. (spandidos-publications.com)
Sallusto F, Lenig D, Mackay CR and Lanzavecchia A: Flexible programs of chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes. (spandidos-publications.com)
Fewer studies have investigated the expression of CC chemokines in COPD. (bmj.com)
Furthermore, evidence has emerged regarding an imbalance between angiogenic and angiostatic chemokine levels, leading to an overall angiogenic pattern of expression in both animal models and tissue specimens from IPF patients. (ersjournals.com)
While the individual effects of different chemokines are well known, the potential consequences of the concomitant expression of chemokines under pathologic conditions in vivo are still a matter of debate [ 26 ]. (biomedcentral.com)
Chemokine receptor specific for IP-10 and Mig: Structure, function and expression in activated T lymphocytes. (bertin-bioreagent.com)

Many chemokines are expressed constitutively and/or during inflammation in the lung as well as in other tissues. (jimmunol.org)
These data implicates the ELR-CXC chemokines in the neutrophilic inflammation observed after airways exposure to bacterial LPS. (cdc.gov)
Chemokines form nanoparticles with DNA and can superinduce TLR-driven immune inflammation. (peprotech.com)
It transports chemokines to the lumenal face of venular endothelium to promote the extravasation of leukocytes to sites of inflammation. (rndsystems.com)

At Site 1, the receptor N-terminal region binds a groove on the globular body of the chemokine. (elifesciences.org)
At Site 2, the chemokine N-terminal peptide binds within a deep pocket formed by the receptor transmembrane helices (TMs) that is believed to function as the receptor activation switch. (elifesciences.org)

Intracellular signaling pathways regulated by the kinase protein sub-families are the center of attention for chemokine derived functional responses. (imrpress.com)

Although this chemokine clusters with other ELR-CXC chemokines, none of them can confidently be assigned to be its human homologue based on sequence identity. (jimmunol.org)
We initially reported human MIP-3α ( 7 , 10 , 11 ), which was recognized as a chemokine that is abundantly produced in several organs ( 7 ). (jimmunol.org)
Human cytomegalovirus has hijacked and evolved a human G-protein-coupled receptor into US28, which functions as a promiscuous chemokine 'sink' to facilitate evasion of host immune responses. (elifesciences.org)
It was subsequently determined to be a CC chemokine and expressed in more than 100 human diseases. (wikidoc.org)

E) Schematic representation of the interaction between monomeric chemokine and GPCR. (imrpress.com)

The chemokine CXCL14(BRAK) stimulates activated NK cell migration:implications for the downregulation of CXCL14 in malignancy[J]. Exp Hematol, 2006, 34(8):1101-1105. (magtech.com.cn)
Chemokine CXCL14/BRAK transgenic mice suppress growth of carcinoma cell transplants. (perkinelmer.com)

CXCR5 (C-X-Chemokine Receptor Type 5, CD185) also known as Burkitt lymphoma receptor 1 (BLR1) belongs to the CXC chemokine receptor family. (fishersci.com)
IL-8 is a member of the CXC chemokine family. (qedbio.com)
The ELR motif of CXC‐type chemokine family plays an important role in angiogenesis. (medchemexpress.cn)
Sequence similarities: Belongs to the intercrine alpha (chemokine CxC) family. (assaygenie.com)
BRAK is a novel member of the CXC chemokine family. (conzort.com)

Thus, SDF-1 might be a necessary chemokine for prenatal viability, B lymphopoiesis, bone marrow myelopoiesis, and cardiac ventricular septal formation (20). (amepr.org)

This protein acts as a CXC chemokine that promotes cell proliferation, migration and invasion. (moleculardepot.com)
Alternatively, LT-HSCs circulating in fetal blood might not possess the appropriate chemokine receptor or adhesion molecule repertoire required for bone marrow homing and migration. (biomedcentral.com)
Together, these two chemokines synergistically increased B-cell migration from PB, but not from SF. (biomedcentral.com)
Most leukocytes express more than one chemokine receptor of varying promiscuity and are, in addition, potentially capable of responding synergistically to concomitant migration signals [ 14 ]. (biomedcentral.com)

The regulation and flow of the signals by the kinases are different for each physiological and pathological event and are tightly regulated by the nature and pairing of chemokine(s) with its receptor(s). (imrpress.com)
The regulation of chemokine receptor is also governed by kinases like protein kinase A (PKA), protein kinase C (PKC), mitogen-activated protein kinases / extracellular signal-regulated kinases (MAPK/ERK), etc . (imrpress.com)

Molecular mechanism of desensitization of the chemokine receptor CCR-5: receptor signaling and internalization are dissociable from its role as an HIV-1 co-receptor. (microbiologyresearch.org)

Anatomy42

Organisms9

Diseases11

Chemicals and Drugs111

Analytical, Diagnostic and Therapeutic Techniques and Equipment18

Phenomena and Processes28

Disciplines and Occupations1

Information Science3

Health Care1

Isolation of novel GRO genes and a phylogenetic analysis of the CXC chemokine subfamily in mammals. (1/2535)

Chemokine and chemokine receptor gene variants and risk of non-Hodgkin's lymphoma in human immunodeficiency virus-1-infected individuals. (2/2535)

Cutting edge: clustered AU-rich elements are the target of IL-10-mediated mRNA destabilization in mouse macrophages. (3/2535)

Identification of CXCR4 domains that support coreceptor and chemokine receptor functions. (4/2535)

Expression of specific chemokines and chemokine receptors in the central nervous system of multiple sclerosis patients. (5/2535)

The T cell-specific CXC chemokines IP-10, Mig, and I-TAC are expressed by activated human bronchial epithelial cells. (6/2535)

Isolation of the CXC chemokines ENA-78, GRO alpha and GRO gamma from tumor cells and leukocytes reveals NH2-terminal heterogeneity. Functional comparison of different natural isoforms. (7/2535)

Elevated constitutive IkappaB kinase activity and IkappaB-alpha phosphorylation in Hs294T melanoma cells lead to increased basal MGSA/GRO-alpha transcription. (8/2535)

Chemokines

Chemokines, CXC

Chemokines, CC

Receptors, Chemokine

Chemokine CXCL1

Chemokine CXCL10

Chemokine CXCL9

Receptors, Interleukin-8B

Chemokine CXCL5

Chemokine CCL5

Chemokine CXCL11

Chemokine CXCL2

Chemokines, C

Macrophage Inflammatory Proteins

Chemokine CCL2

Chemokine CCL4

Chemokine CCL3

Receptors, CXCR3

Interleukin-8

Chemotaxis, Leukocyte

Receptors, Interleukin-8A

Chemokine CCL7

Cytokines

Chemokine CXCL12

Monocyte Chemoattractant Proteins

Chemokine CXCL6

Chemokines, CX3C

Receptors, CXCR4

Monokines

Duffy Blood-Group System

Chemokine CCL21

Chemokine CCL19

Chemotaxis

Chemokine CCL8

Neutrophil Infiltration

Receptors, CCR2

beta-Thromboglobulin

Chemokine CXCL13

Intercellular Signaling Peptides and Proteins

Chemotactic Factors

Mice, Inbred C57BL

Cells, Cultured

Chemokine CCL17

Receptors, CCR1

Cell Movement

Chemokine CCL11

Inflammation

Neutrophils

Chemokine CCL22

Receptors, CCR5

RNA, Messenger

Receptors, CCR3

Receptors, Cytokine

Chemokine CCL1

Inflammation Mediators

Chemokine CCL24

Mice, Knockout

Signal Transduction

Platelet Factor 4

Chemokine CX3CL1

Leukocytes

Monocytes

Mice, Inbred BALB C

Chemokine CCL20

Macrophages

Gene Expression Regulation

Lung

T-Lymphocytes

Receptors, CCR10

Up-Regulation

Receptors, CCR7

Receptors, CCR4

Tumor Necrosis Factor-alpha

Reverse Transcriptase Polymerase Chain Reaction

Interferon-gamma

NF-kappa B

Enzyme-Linked Immunosorbent Assay

Cell Migration Inhibition

Growth Substances

Cell Line