The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.
The addition of descriptive information about the function or structure of a molecular sequence to its MOLECULAR SEQUENCE DATA record.
Databases devoted to knowledge about specific genes and gene products.
A CXC chemokine that is induced by GAMMA-INTERFERON and is chemotactic for MONOCYTES and T-LYMPHOCYTES. It has specificity for the CXCR3 RECEPTOR.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The systematic study of the complete DNA sequences (GENOME) of organisms.
An INTEFERON-inducible CXC chemokine that is specific for the CXCR3 RECEPTOR.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
A CXC chemokine that is induced by GAMMA-INTERFERON. It is a chemotactic factor for activated T-LYMPHOCYTES and has specificity for the CXCR3 RECEPTOR.
Proteins prepared by recombinant DNA technology.
A species of gram-positive, coccoid bacteria isolated from skin lesions, blood, inflammatory exudates, and the upper respiratory tract of humans. It is a group A hemolytic Streptococcus that can cause SCARLET FEVER and RHEUMATIC FEVER.
A serine endopeptidase isolated from Bacillus subtilis. It hydrolyzes proteins with broad specificity for peptide bonds, and a preference for a large uncharged residue in P1. It also hydrolyzes peptide amides. (From Enzyme Nomenclature, 1992) EC 3.4.21.62.
A genus of gram-positive, anaerobic, coccoid bacteria that is part of the normal flora of humans. Its organisms are opportunistic pathogens causing bacteremias and soft tissue infections.
Coccus-shaped bacteria that retain the crystal violet stain when treated by Gram's method.
A genus of facultatively anaerobic, gram-positive bacteria in the family ACTINOMYCETACEAE, order ACTINOMYCETALES. They are obligate parasites of the PHARYNX in humans and farm animals.
Group of chemokines with paired cysteines separated by a different amino acid. CXC chemokines are chemoattractants for neutrophils but not monocytes.
Inflammation of the COLON that is predominantly confined to the MUCOSA. Its major symptoms include DIARRHEA, rectal BLEEDING, the passage of MUCUS, and ABDOMINAL PAIN.
CXCR receptors that are expressed on the surface of a number of cell types, including T-LYMPHOCYTES; NK CELLS; DENDRITIC CELLS; and a subset of B-LYMPHOCYTES. The receptors are activated by CHEMOKINE CXCL9; CHEMOKINE CXCL10; and CHEMOKINE CXCL11.
A CXC chemokine that is chemotactic for B-LYMPHOCYTES. It has specificity for CXCR5 RECEPTORS.
Suspensions of killed or attenuated microorganisms (bacteria, viruses, fungi, protozoa), antigenic proteins, synthetic constructs, or other bio-molecular derivatives, administered for the prevention, amelioration, or treatment of infectious and other diseases.
Vaccines or candidate vaccines designed to prevent or treat cancer. Vaccines are produced using the patient's own whole tumor cells as the source of antigens, or using tumor-specific antigens, often recombinantly produced.
Substances that augment, stimulate, activate, potentiate, or modulate the immune response at either the cellular or humoral level. The classical agents (Freund's adjuvant, BCG, Corynebacterium parvum, et al.) contain bacterial antigens. Some are endogenous (e.g., histamine, interferon, transfer factor, tuftsin, interleukin-1). Their mode of action is either non-specific, resulting in increased immune responsiveness to a wide variety of antigens, or antigen-specific, i.e., affecting a restricted type of immune response to a narrow group of antigens. The therapeutic efficacy of many biological response modifiers is related to their antigen-specific immunoadjuvanticity.
Class of pro-inflammatory cytokines that have the ability to attract and activate leukocytes. They can be divided into at least three structural branches: C; (CHEMOKINES, C); CC; (CHEMOKINES, CC); and CXC; (CHEMOKINES, CXC); according to variations in a shared cysteine motif.
Vaccines in which the infectious microbial nucleic acid components have been destroyed by chemical or physical treatment (e.g., formalin, beta-propiolactone, gamma radiation) without affecting the antigenicity or immunogenicity of the viral coat or bacterial outer membrane proteins.
Suspensions of attenuated or killed viruses administered for the prevention or treatment of infectious viral disease.
Recombinant DNA vectors encoding antigens administered for the prevention or treatment of disease. The host cells take up the DNA, express the antigen, and present it to the immune system in a manner similar to that which would occur during natural infection. This induces humoral and cellular immune responses against the encoded antigens. The vector is called naked DNA because there is no need for complex formulations or delivery agents; the plasmid is injected in saline or other buffers.
A CXC chemokine that is chemotactic for T-LYMPHOCYTES and MONOCYTES. It has specificity for CXCR4 RECEPTORS. Two isoforms of CXCL12 are produced by alternative mRNA splicing.
Software used to locate data or information stored in machine-readable form locally or at a distance such as an INTERNET site.
A CXC chemokine with specificity for CXCR2 RECEPTORS. It has growth factor activities and is implicated as a oncogenic factor in several tumor types.
Group of chemokines with adjacent cysteines that are chemoattractants for lymphocytes, monocytes, eosinophils, basophils but not neutrophils.
Cell surface glycoproteins that bind to chemokines and thus mediate the migration of pro-inflammatory molecules. The receptors are members of the seven-transmembrane G protein-coupled receptor family. Like the CHEMOKINES themselves, the receptors can be divided into at least three structural branches: CR, CCR, and CXCR, according to variations in a shared cysteine motif.
A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.
CCR receptors with specificity for CHEMOKINE CCL2 and several other CCL2-related chemokines. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; MACROPHAGES; BASOPHILS; and NK CELLS.
Granular leukocytes with a nucleus that usually has two lobes connected by a slender thread of chromatin, and cytoplasm containing coarse, round granules that are uniform in size and stainable by eosin.
CCR receptors with specificity for CHEMOKINE CCL3; CHEMOKINE CCL4; and CHEMOKINE CCL5. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; MACROPHAGES; MAST CELLS; and NK CELLS. The CCR5 receptor is used by the HUMAN IMMUNODEFICIENCY VIRUS to infect cells.
A chemokine that is a chemoattractant for MONOCYTES and may also cause cellular activation of specific functions related to host defense. It is produced by LEUKOCYTES of both monocyte and lymphocyte lineage and by FIBROBLASTS during tissue injury. It has specificity for CCR2 RECEPTORS.
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
Chemical groups containing the covalent disulfide bonds -S-S-. The sulfur atoms can be bound to inorganic or organic moieties.
A thiol-containing non-essential amino acid that is oxidized to form CYSTINE.
A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.
The classes of BONE MARROW-derived blood cells in the monocytic series (MONOCYTES and their precursors) and granulocytic series (GRANULOCYTES and their precursors).
Tumors or cancer of the LIVER.
CCR receptors with specificity for a broad variety of CC CHEMOKINES. They are expressed at high levels in MONOCYTES; tissue MACROPHAGES; NEUTROPHILS; and EOSINOPHILS.
Transference of an organ between individuals of the same species or between individuals of different species.
The transference of a part of or an entire liver from one human or animal to another.
Transfer of MESENCHYMAL STEM CELLS between individuals within the same species (TRANSPLANTATION, HOMOLOGOUS) or transfer within the same individual (TRANSPLANTATION, AUTOLOGOUS).
The transference of a kidney from one human or animal to another.
Bone-marrow-derived, non-hematopoietic cells that support HEMATOPOETIC STEM CELLS. They have also been isolated from other organs and tissues such as UMBILICAL CORD BLOOD, umbilical vein subendothelium, and WHARTON JELLY. These cells are considered to be a source of multipotent stem cells because they include subpopulations of mesenchymal stem cells.
Transplantation between individuals of the same species. Usually refers to genetically disparate individuals in contradistinction to isogeneic transplantation for genetically identical individuals.
The transference of a heart from one human or animal to another.

Expression of specific chemokines and chemokine receptors in the central nervous system of multiple sclerosis patients. (1/340)

Chemokines direct tissue invasion by specific leukocyte populations. Thus, chemokines may play a role in multiple sclerosis (MS), an idiopathic disorder in which the central nervous system (CNS) inflammatory reaction is largely restricted to mononuclear phagocytes and T cells. We asked whether specific chemokines were expressed in the CNS during acute demyelinating events by analyzing cerebrospinal fluid (CSF), whose composition reflects the CNS extracellular space. During MS attacks, we found elevated CSF levels of three chemokines that act toward T cells and mononuclear phagocytes: interferon-gamma-inducible protein of 10 kDa (IP-10); monokine induced by interferon-gamma (Mig); and regulated on activation, normal T-cell expressed and secreted (RANTES). We then investigated whether specific chemokine receptors were expressed by infiltrating cells in demyelinating MS brain lesions and in CSF. CXCR3, an IP-10/Mig receptor, was expressed on lymphocytic cells in virtually every perivascular inflammatory infiltrate in active MS lesions. CCR5, a RANTES receptor, was detected on lymphocytic cells, macrophages, and microglia in actively demyelinating MS brain lesions. Compared with circulating T cells, CSF T cells were significantly enriched for cells expressing CXCR3 or CCR5. Our results imply pathogenic roles for specific chemokine-chemokine receptor interactions in MS and suggest new molecular targets for therapeutic intervention.  (+info)

The T cell-specific CXC chemokines IP-10, Mig, and I-TAC are expressed by activated human bronchial epithelial cells. (2/340)

Recruitment of activated T cells to mucosal surfaces, such as the airway epithelium, is important in host defense and for the development of inflammatory diseases at these sites. We therefore asked whether the CXC chemokines IFN-induced protein of 10 kDa (IP-10), monokine induced by IFN-gamma (Mig), and IFN-inducible T-cell alpha-chemoattractant (I-TAC), which specifically chemoattract activated T cells by signaling through the chemokine receptor CXCR3, were inducible in respiratory epithelial cells. The effects of proinflammatory cytokines, including IFN-gamma (Th1-type cytokine), Th2-type cytokines (IL-4, IL-10, and IL-13), and dexamethasone were studied in normal human bronchial epithelial cells (NHBEC) and in two human respiratory epithelial cell lines, A549 and BEAS-2B. We found that IFN-gamma, but not TNF-alpha or IL-1 beta, strongly induced IP-10, Mig, and I-TAC mRNA accumulation mainly in NHBEC and that TNF-alpha and IL-1 beta synergized with IFN-gamma induction in all three cell types. High levels of IP-10 protein (> 800 ng/ml) were detected in supernatants of IFN-gamma/TNF-alpha-stimulated NHBEC. Neither dexamethasone nor Th2 cytokines modulated IP-10, Mig, or I-TAC expression. Since IFN-gamma is up-regulated in tuberculosis (TB), using in situ hybridization we studied the expression of IP-10 in the airways of TB patients and found that IP-10 mRNA was expressed in the bronchial epithelium. In addition, IP-10-positive cells obtained by bronchoalveolar lavage were significantly increased in TB patients compared with normal controls. These results show that activated bronchial epithelium is an important source of IP-10, Mig, and I-TAC, which may, in pulmonary diseases such as TB (in which IFN-gamma is highly expressed) play an important role in the recruitment of activated T cells.  (+info)

Gene expression and production of the monokine induced by IFN-gamma (MIG), IFN-inducible T cell alpha chemoattractant (I-TAC), and IFN-gamma-inducible protein-10 (IP-10) chemokines by human neutrophils. (3/340)

Monokine induced by IFN-gamma (MIG), IFN-inducible T cell alpha chemoattractant (I-TAC), and IFN-gamma-inducible protein of 10 kDa (IP-10) are related members of the CXC chemokine subfamily that bind to a common receptor, CXCR3, and that are produced by different cell types in response to IFN-gamma. We have recently reported that human polymorphonuclear neutrophils (PMN) have the capacity to release IP-10. Herein, we show that PMN also have the ability to produce MIG and to express I-TAC mRNA in response to IFN-gamma in combination with either TNF-alpha or LPS. While IFN-gamma, alone or in association with agonists such as fMLP, IL-8, granulocyte (G)-CSF and granulocyte-macrophage (GM)-CSF, failed to influence MIG, IP-10, and I-TAC gene expression, IFN-alpha, in combination with TNF-alpha, LPS, or IL-1beta, resulted in a considerable induction of IP-10 release by neutrophils. Furthermore, IL-10 and IL-4 significantly suppressed the expression of MIG, IP-10, and I-TAC mRNA and the extracellular production of MIG and IP-10 in neutrophils stimulated with IFN-gamma plus either LPS or TNF-alpha. Finally, supernatants harvested from stimulated PMN induced migration and rapid integrin-dependent adhesion of CXCR3-expressing lymphocytes; these activities were significantly reduced by neutralizing anti-MIG and anti-IP-10 Abs, suggesting that they were mediated by MIG and IP-10 present in the supernatants. Since MIG, IP-10, and I-TAC are potent chemoattractants for NK cells and Th1 lymphocytes, the ability of neutrophils to produce these chemokines might contribute not only to the progression and evolution of the inflammatory response, but also to the regulation of the immune response.  (+info)

Interleukin-18, interferon-gamma, IP-10, and Mig expression in Epstein-Barr virus-induced infectious mononucleosis and posttransplant lymphoproliferative disease. (4/340)

T cell immunodeficiency plays an important role in the pathogenesis of posttransplant lymphoproliferative disease (PTLD) by permitting the unbridled expansion of Epstein-Barr virus (EBV)-infected B lymphocytes. However, factors other than T cell function may contribute to PTLD pathogenesis because PTLD infrequently develops even in the context of severe T cell immunodeficiency, and athymic mice that are T-cell-immunodeficient can reject EBV-immortalized cells. Here we report that PTLD tissues express significantly lower levels of IL-18, interferon-gamma (IFN-gamma), Mig, and RANTES compared to lymphoid tissues diagnosed with acute EBV-induced infectious mononucleosis, as assessed by semiquantitative RT-PCR analysis. Other cytokines and chemokines are expressed at similar levels. Immunohistochemistry confirmed that PTLD tissues contain less IL-18 and Mig protein than tissues with infectious mononucleosis. IL-18, primarily a monocyte product, promotes the secretion of IFN-gamma, which stimulates Mig and RANTES expression. Both IL-18 and Mig display antitumor activity in mice involving inhibition of angiogenesis. These results document greater expression of IL-18, IFN-gamma, Mig, and RANTES in lymphoid tissues with acute EBV-induced infectious mononucleosis compared to tissues with PTLD and raise the possibility that these mediators participate in critical host responses to EBV infection.  (+info)

Intradermal delivery of IL-12 naked DNA induces systemic NK cell activation and Th1 response in vivo that is independent of endogenous IL-12 production. (5/340)

In this study four murine IL-12 naked DNA expression plasmids (pIL-12), containing both the p35 and p40 subunits, were shown to induce systemic biological effects in vivo after intradermal injection. Three of the four IL-12 expression vectors augmented NK activity and induced expression of the IFN-gamma and IFN-gamma-inducible Mig genes. Both IL-12 p70 heterodimer and IFN-gamma proteins were documented in the serum within 24 h after intradermal injection of the pIL-12o- plasmid, which also induced the highest level of NK activity in the spleen and liver among the IL-12 constructs. Interestingly, both p40 mRNA expression at the injection site and serum protein levels followed a biphasic pattern of expression, with peaks on days 1 and 5. Subsequent studies revealed that the ability of intradermally injected pIL-12o- to augment NK lytic activity was prevented by administration of a neutralizing anti-IL-12 mAb. Finally, injection of the pIL-12o- into BALB/c IL-12 p40-/- mice also resulted in a biphasic pattern of IL-12 p70 appearance in the serum, and induced IFN-gamma protein and activated NK lytic activity in liver and spleen. These results demonstrate that injection of delivered naked DNA encoding the IL-12 gene mediates the biphasic systemic production of IL-12-inducible genes and augments the cytotoxic function of NK cells in lymphoid and parenchymal organs as a direct result of transgene expression. The results also suggest that these naked DNA plasmids may be useful adjuvants for vaccines against infectious and neoplastic diseases.  (+info)

SLC/exodus2/6Ckine/TCA4 induces chemotaxis of hematopoietic progenitor cells: differential activity of ligands of CCR7, CXCR3, or CXCR4 in chemotaxis vs. suppression of progenitor proliferation. (6/340)

Chemokines induce chemotaxis of hematopoietic progenitor cells (HPC), and suppress their proliferation. In this study we report that SLC/ Exodus2/6Ckine/TCA4 (hereafter termed SLC) is a chemoattractant for human CD34+ HPC. SLC mainly induces preferential chemotaxis of macrophage progenitors. We examined the chemotactic activity of CXCR3 ligands on CD34+ HPC because it has been reported that SLC is a potential ligand of CXC chemokine receptor, CXCR3, in addition to a CC chemokine receptor, CCR7. It was found that the CXCR3 ligands, MIG and interferon-gamma inducible protein-10 (IP-10), unlike SLC, did not induce chemotaxis of CD34+ HPC. In this regard, CCR7 ligands (SLC and CKbeta-11), but not IP-10 and MIG, induce actin polymerization in CD34+ cells. On the other hand, CCR7 ligands and CXCR3 ligands, but not the CXCR4 ligand SDF-1, showed inhibitory activity for proliferation of myeloid progenitor cells. Our results suggest that SLC is a potential trafficking factor for HPC, and that chemokines that bind CCR7, CXCR4, and CXCR3 have differential biological activities on HPC in terms of suppression and chemotaxis.  (+info)

The CXCR3 activating chemokines IP-10, Mig, and IP-9 are expressed in allergic but not in irritant patch test reactions. (7/340)

Differentiation between allergic and irritant contact dermatitis reactions is difficult, as both inflammatory diseases are clinically, histologically, and immunohistologically very similar. Previous studies in mice revealed that the chemokine IP-10 is exclusively expressed in allergic contact dermatitis reactions. In the present study, we investigated whether the mRNA expression of IP-10 and the related CXCR3 activating chemokines, Mig and IP-9 are also differentially expressed in human allergic contact dermatitis and irritant contact dermatitis reactions. Skin biopsies from allergic (13 cases) and sodium lauryl sulfate-induced irritant patch test reactions (13 cases), obtained 1-72 h after patch testing, were studied by means of an in situ hybridization technique. Results of chemokine mRNA expression were correlated with clinical scoring, histology, and immunohistochemical data including the proportion of inflammatory cells expressing CXCR3, the receptor for IP-10, Mig, and IP-9, and ICAM-1 and HLA-DR expression on keratinocytes. IP-10, Mig, and IP-9 mRNA were detected in seven of nine allergic contact dermatitis reactions after 24-72 h, but not in sodium lauryl sulfate-induced irritant contact dermatitis reactions. ICAM-1 expression by keratinocytes was only found in allergic contact dermatitis reactions and correlated with chemokine expression. Moreover, up to 50% of the infiltrating cells in allergic contact dermatitis expressed CXCR3, in contrast to only 20% in irritant contact dermatitis reactions. In conclusion, we have demonstrated differences in chemokine expression between allergic contact dermatitis and irritant contact dermatitis reactions, which might reflect different regulatory mechanisms operating in these diseases and may be an important clue for differentiation between allergic contact dermatitis and irritant contact dermatitis reactions.  (+info)

Differential expression of three T lymphocyte-activating CXC chemokines by human atheroma-associated cells. (8/340)

Activated T lymphocytes accumulate early in atheroma formation and persist at sites of lesion growth and rupture, suggesting that they may play an important role in the pathogenesis of atherosclerosis. Moreover, atherosclerotic lesions contain the Th1-type cytokine IFN-gamma, a potentiator of atherosclerosis. The present study demonstrates the differential expression of the 3 IFN-gamma-inducible CXC chemokines--IFN-inducible protein 10 (IP-10), monokine induced by IFN-gamma (Mig), and IFN-inducible T-cell alpha chemoattractant (I-TAC)--by atheroma-associated cells, as well as the expression of their receptor, CXCR3, by all T lymphocytes within human atherosclerotic lesions in situ. Atheroma-associated endothelial cells (ECs), smooth muscle cells (SMCs), and macrophages (MO) all expressed IP-10, whereas Mig and I-TAC were mainly expressed in ECs and MO, as detected by double immunofluorescence staining. ECs of microvessels within lesions also expressed abundant I-TAC. In vitro experiments supported these results and showed that IL-1beta, TNF-alpha, and CD40 ligand potentiated IP-10 expression from IFN-gamma-stimulated ECs. In addition, nitric oxide (NO) treatment decreased IFN-gamma induction of IP-10. Our findings suggest that the differential expression of IP-10, Mig, and I-TAC by atheroma-associated cells plays a role in the recruitment and retention of activated T lymphocytes observed within vascular wall lesions during atherogenesis.  (+info)

The anaerobic bacterium Finegoldia magna is part of the human commensal microbiota, but is also an important opportunistic pathogen. This bacterium expresses a subtilisin-like serine proteinase, SufA, which partially degrade the antibacterial chemokine MIG/CXCL9. Here, we show that MIG/CXCL9 is produced by human keratinocytes in response to inflammatory stimuli. In contrast to the virulent human pathogen Streptococcus pyogenes, the presence of F. magna had no enhancing effect on the MIG/CXCL9 expression by keratinocytes, suggesting poor detection of the latter by pathogen-recognition receptors. When MIG/CXCL9 was exposed to SufA-expressing F. magna, the molecule was processed into several smaller fragments. Analysis by mass spectrometry showed that SufA cleaves MIG/CXCL9 at several sites in the COOH-terminal region of the molecule. At equimolar concentrations, SufA-generated MIG/CXCL9 fragments were not bactericidal against F. magna, but retained their ability to kill S. pyogenes. Moreover, the ...
MIG (CXCL9) Bovine Recombinant is a non-glycosylated polypeptide chain containing 104 amino acids and having a molecular mass of about 18.0kDa.
Recombinant Human MIG/CXCL9 produced in E. coli is a single, non-glycosylated polypeptide chain containing 103 amino acids and having a molecular mass of 11.7 kDa.
Human C-X-C Motif Chemokine 9 / Monokine Induced by Gamma Interferon (CXCL9 / MIG) standard, for use in running standard curves in AlphaLISA no-wash detection assay
MIG Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 126 aa (23-125 a.a.) and having a molecular mass of 14kDa.
购买我们的重组小鼠MIG蛋白。Ab50083为有活性的全长蛋白,在大肠杆菌中生产并经过SDS-PAGE, Functional Studies实验验证。中国80%以上现货。
Sigma-Aldrich offers abstracts and full-text articles by [Birgit Westernströer, Daniel Langenstroth, Sabine Kliesch, Britta Troppmann, Klaus Redmann, Joni Macdonald, Rod Mitchell, Joachim Wistuba, Stefan Schlatt, Nina Neuhaus].
The ESAB Aristo Mig 5000i is the ideal partner for when it comes to prefabrication of high alloyed materials with a high demand for the welding performance.
Version Found: MIG 7 Series v1.7Version Resolved: See (Xilinx Answer 45195) New calibration updates are required for MIG 7 Series DDR3 designs due to potential calibration failures across process variation or continuous resets. This answer record details the calibration updates and includes links to patches for both MIG 7 Series v1.7 and v1.8 designs. Moving to v1.8 is recommended but not required as long as the v1.7 patch from this answer record is applied.
Background Ulcerative colitis is characterized by relapsing mucosal inflammation where the lesions include tissue-damaging granulocytes. In addition, T cells and natural killer (NK) cells play important pathophysiologic roles. Chemokines are a large family of peptides that play key roles in the regulation of inflammation. The CXC-chemokines, growth-related oncogene (GRO)-α/CXCL1 and interleukin (IL)-8/CXCL8, both recruit neutrophils and possess mitogenic properties, whereas the interferon-dependent CXC-chemokines monokine induced by gamma-interferon (MIG)/CXCL9, interferon-γ inducible protein of 10 kD/CXCL10, and IFN-inducible T cell alpha chemoattractant/CXCL11 recruit and activate T cells and NK cells. Materials and methods The expression of CXC-chemokines was studied in eight controls and in 11 patients suffering from ulcerative colitis in the distal part of the colon, before and during topical treatment with corticosteroids. Perfusates (obtained before, after 7 days, and after 28 days of ...
This study examined the association of interferon-gamma-inducible protein-10 concentrations in serum and IL28B genotype associated with responses to pegylated
Aortic and plasma expression levels of IL-18 and CXCL16.(A) Reduced aortic mRNA expression of IL-18 and CXCL16, but no change in the expression of IFN-γ is obs
Hallie Jeg må vist erklære mig nogenlunde enig med Caroline. Synes hælen er for lav på Biancos, til at de får der samme fede look. Men kan segfvøllelig også være vinklen på kameraet?? Men ku godt tænke mig at se hvordan den så ud på en fod. 2016-04-28 14:39:45 ...
CXCL12 izaziva potentnu hemotaksu limfocita.[4][5][6][7] Tokom embriogeneze on usmerava migraciju hematopoetskih ćelija i formiranje velikih krvnih sudova. Miševi bez CXCL12 gena su letalni pre rođenja, ili u toku prvog sata života. Kod odraslih CXCL12 igra važnu ulogu u angiogenezi putem regrutovanja endotelnih progenitorskih ćelija (EPC) iz koštane srži kroz CXCR4 zavistan mehanizam.[8] Ova funkcija čini CXCL12 veoma važnim faktorom u karcinogenezi i neovaskularizaciji vezanoj za progresiju tumora.[9] CXCL12 takođe ima ulogu u metastazi tumora gde su ćelije raka koje izražavaju CXCR4 receptor privučene ka metastaznim ciljnim tkivima koja oslobađaju ligand, CXCL12.[10] Kod raka dojke, međutim, povećano CXCL12 izražavanje određuje umanjeni rizik od metastaze.[11][12] ...
Human CXCL9 standard, lyophilized, for use in running standard curves in LANCE Ultra TR-FRET assays. This standard is already provided in the LANCE Ultra human CXCL9/MIG Detection Kit, but can be ordered separately.
human CXCL9 / MIG ELISA pair set and full ELISA kit. Detection range:15.63-1000 pg/mL . Save up to 60%. Bulk at deep discounts. High quality quaranteed.
References for Abcams Recombinant human CXCL5 protein (ab50039). Please let us know if you have used this product in your publication
det er osse mit yndlingsbillede nu. jeg skifter hovedet ud på den druknende hver dag--afhængig af dagsform. I går var det min svogers, fordi jeg ikke havde andres. I morgen gør jeg mig umage og finder et godt. kh k. SvarSlet ...
C-X-C motif chemokine 11 (CXCL11) is a protein that in humans is encoded by the CXCL11 gene.[3] C-X-C motif chemokine 11 is a small cytokine belonging to the CXC chemokine family that is also called Interferon-inducible T-cell alpha chemoattractant (I-TAC) and Interferon-gamma-inducible protein 9 (IP-9). It is highly expressed in peripheral blood leukocytes, pancreas and liver, with moderate levels in thymus, spleen and lung and low expression levels were in small intestine, placenta and prostate.[4] Gene expression of CXCL11 is strongly induced by IFN-γ and IFN-β, and weakly induced by IFN-α.[5] This chemokine elicits its effects on its target cells by interacting with the cell surface chemokine receptor CXCR3, with a higher affinity than do the other ligands for this receptor, CXCL9 and CXCL10.[4][6] CXCL11 is chemotactic for activated T cells. Its gene is located on human chromosome 4 along with many other members of the CXC chemokine family.[7][8] ...
Chemokines mediate diverse fundamental biological processes, including combating infection. Multiple chemokines are expressed at the site of infection; thus chemokine synergy by heterodimer formation may play a role in determining function. Chemokine function involves interactions with G-protein-coupled receptors and sulfated glycosaminoglycans (GAG). However, very little is known regarding heterodimer structural features and receptor and GAG interactions. Solution nuclear magnetic resonance (NMR) and molecular dynamics characterization of platelet-derived chemokine CXCL7 heterodimerization with chemokines CXCL1, CXCL4, and CXCL8 indicated that packing interactions promote CXCL7-CXCL1 and CXCL7-CXCL4 heterodimers, and electrostatic repulsive interactions disfavor the CXCL7-CXCL8 heterodimer. As characterizing the native heterodimer is challenging due to interference from monomers and homodimers, we engineered a
Chemokine (C-X-C motif) ligand 9 (CXCL9) is a small cytokine belonging to the CXC chemokine family that is also known as Monokine induced by gamma interferon (MIG). CXCL9 is a T-cell chemoattractant, which is induced by IFN-γ. It is closely related to two other CXC chemokines called CXCL10 and CXCL11, whose genes are located near the gene for CXCL9 on human chromosome 4. CXCL9, CXCL10 and CXCL11 all elicit their chemotactic functions by interacting with the chemokine receptor CXCR3. Neutrophil collagenase/matrix metalloproteinase 8 (MMP-8) degrades CXCL9 and cleaves CXCL10 at two positions. Gelatinase B/matrix metalloproteinase 9 (MMP-9) degrades CXCL10 and cleaves CXCL9 at three different sites in its extended carboxy-terminal region ...
CXCL16, hemokin (C-X-C motiv) ligand 16, je mali citokin iz CXC hemokin familije. On je veći od drugih hemokina (sadrži 254 aminokiselina). CXCL16 se sastoji od CXC hemokin domaina, mucinu-slične stabljike, transmembranskog domaina i citoplazmatičnog repa koji sadrži potentno mesto tirozin fosforilacije koje može da veže SH2.[1] Ovo su neuobičajene osobine za hemokin, i omobućavaju CXCL16 da bude izražen kao molekul na ćelijskoj površini, kao i rastvorni hemokin.[2] CXCL16 proizvode dendritiske ćelije koje se mogu naći u T ćelijskim zonama limfoidnih organa, i ćelije iz crvene pulpe slezine.[1] Među ćelijama koje se vezuju i migriraju u responsu na CXCL16 su nekoliko podgrupa T ćelija, i NKT ćelije.[1] CXCL16 interaguje sa hemokin receptorom CXCR6, takođe poznatim kao Bonzo.[3][1] Ekspresiju CXCL16 indukuju inflamatorni citokini IFN-gama i TNF-alfa.[2] Gen za ljudski CXCL16 je lociran na hromozomu 17.[1][4] ...
CXCL12 izaziva potentnu hemotaksu limfocita.[4][5][6][7] Tokom embriogeneze on usmerava migraciju hematopoetskih ćelija i formiranje velikih krvnih sudova. Miševi bez CXCL12 gena su letalni pre rođenja, ili u toku prvog sata života. Kod odraslih CXCL12 igra važnu ulogu u angiogenezi putem regrutovanja endotelnih progenitorskih ćelija (EPC) iz koštane srži kroz CXCR4 zavistan mehanizam.[8] Ova funkcija čini CXCL12 veoma važnim faktorom u karcinogenezi i neovaskularizaciji vezanoj za progresiju tumora.[9] CXCL12 takođe ima ulogu u metastazi tumora gde su ćelije raka koje izražavaju CXCR4 receptor privučene ka metastaznim ciljnim tkivima koja oslobađaju ligand, CXCL12.[10] Kod raka dojke, međutim, povećano CXCL12 izražavanje određuje umanjeni rizik od metastaze.[11][12] ...
CXCL10, hemokin (C-X-C motiv) ligand 10, ili IP-10[1] je mali citokin iz CXC hemokin familije koji je takođe poznat kao 10 kDa interferon-gama-inducirani protein (γ-IP10 ili IP-10). CXCL10 luči nekoliko ćelijski tipova u responsu na IFN-γ. U te ćelijske tipove spadaju monociti, endotelijalne ćelije i fibroblasti.[2] CXCL10 hemokinu je bilo pripisano nekoliko uloga, kao što su hemoatrakcija monocita/makrofaga, T ćelija, NK ćelija, i dendritskih ćelija, promocija adhezije T ćelija na endotelijalne ćelije, antitumorska aktivnost, i inhibicija formiranja kolonija kičmene moždine i angiogeneze.[3][4] CXCL10 gen je lociran na ljudskom hromozomu 4 u klasteru sa nekoliko drugih CXC hemokina.[5] Ovaj hemokin dejstvuje putem vezivanja na CXCR3 hemokin receptore na ćelijskoj površini.[6]. Tri-dimenzionalna kristalna struktura ovog hemokina je bila utvrđena u 3 različite grupe uslova u rezoluciji do 1.92 A.[7] PDB pristupni kodovi za CXCL10 strukture su: 1lv9, 1o7y, 1o7z i 1o80.[8] ...
Complete information for CXCL9 gene (Protein Coding), C-X-C Motif Chemokine Ligand 9, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Cxcl12 - Cxcl12 (untagged ORF) - Rat chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) (Cxcl12), transcript variant 3, (10 ug) available for purchase from OriGene - Your Gene Company.
Cxcl11 - Cxcl11 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1 available for purchase from OriGene - Your Gene Company.
NO GAS MIG WELDER MIG85ENB Part No. 6010109 OPERATING & MAINTENANCE INSTRUCTIONS 0606 Thank you for purchasing this CLARKE NO-GAS MIG Welder. Before attempting to operate the machine, it is essential that you read this manual thoroughly and carefully follow all instructions given. In doing so you will ensure the safety of yourself and that of others around you, and you can also look forward to the welder giving you long and satisfactory service. CLARKE GUARANTEE This CLARKE product is guaranteed against faulty manufacture for a period of 12 months from the date of purchase. Please keep your receipt as proof of purchase. This guarantee is invalid if the product is found to have been abused or tampered with in any way, or not used for the purpose for which it was intended. Faulty goods should be returned to their place of purchase, no product can be returned to us without prior permission. This guarantee does not effect your statutory rights. For Service, please contact the following: TEL: 020 ...
Recombinant Human IP-10/CXCL10 produced inE. coliis a single, non-glycosylated polypeptide chain containing 77 amino acids and having a molecular mass of 8.5 kDa.
Human IL-8/CXCL8 HEK293 Cells Overexpression Lysate 10098-HNCH1L is validated in western blot (WB) as positive control. Sino Biological offers bulk order for high quality cell lysates which are produced in house.
人生长调节致癌基因γ(GRO-γ/CXCL3) (Human)首选赛业生物,380余种细胞因子囊括生长调节致癌基因、生长因子、干扰素、白细胞介素、肿瘤坏死因子等所有细胞因子家族,种属齐包括人、鼠、恒河猴及其他种属。赛业提供的生长调节致癌基因品质优良:高活性、高纯度、高稳定性、无热源、无外源因子污染。
bisexually B.O.D. unsurely solely underdegreed yerba Magdalen vegetivorous pyrollogical MARS horrifiedly innovatory gross-money periauricular bowstrings Arthropomata Millers wimple reirrigation bajada choristers kharua stemware chronoisothermal Dorical malfeasantly [email protected] ...
Tumor escape from immune-mediated destruction has been associated with immunosuppressive mechanisms that inhibit T cell activation. Although evidence for an active immune response, including infiltration with CD8+ T cells, can be found in a subset of patients, those tumors are nonetheless not immunologically rejected. In the current report, we show that it is the subset of T cell-inflamed tumors that showed high expression of three defined immunosuppressive mechanisms: indoleamine-2,3-dioxygenase (IDO), PD-L1/B7-H1, and FoxP3+ regulatory T cells (Tregs), suggesting that these inhibitory pathways might serve as negative feedback mechanisms that followed, rather than preceded, CD8+ T cell infiltration. Mechanistic studies in mice revealed that up-regulated expression of IDO and PD-L1, as well as recruitment of Tregs, in the tumor microenvironment depended on the presence of CD8+ T cells. The former was driven by interferon-γ and the latter by a production of CCR4-binding chemokines along with a ...
In the present study, it was demonstrated that IL-17A could stimulate the secretion of angiogenic CXC chemokines from liver cancer cells, which may recruit endothelial cells to the tumor cells in a CXCR2-dependent manner. Tumor angiogenesis was also promoted by IL-17A expression in vivo. The CXC chemokines can be classified as angiogenic or angiostatic predominantly based on the presence or absence of an ELR motif. The angiogenic CXC chemokines include CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL8 and CXCL12, and the angiostatic chemokines include CXCL4, CXCL9, CXCL10, CXCL11 and CXCL14 (21). IL-17A was shown to increase the expression of CXCL1, CXCL2, CXCL3, CXCL5, CXCL6 and CXCL8 in Huh7.5 cells and upregulated CXCL2 in HepG2 cells. Additionally, angiostatic CXC chemokines were not affected by IL-17A in both cell lines. IL-17A has been reported to stimulate VEGFA production and promote angiogenesis in several cancer cell lines (16-18) and it has been shown previously that IL-17A does not affect ...
CXCL2_HUMAN (P19875 ), CXCL2_MOUSE (P10889 ), CXCL2_RAT (P30348 ), CXCL3_HUMAN (P19876 ), CXCL3_MOUSE (Q6W5C0 ), CXCL3_RAT (Q10746 ), CXCL5_HUMAN (P42830 ), CXCL5_MOUSE (P50228 ), CXCL5_RAT (P97885 ), CXCL6_BOVIN (P80221 ), CXCL6_HORSE (Q8MIN2 ), CXCL6_HUMAN (P80162 ), CXCL7_HUMAN (P02775 ), CXCL7_PIG (P43030 ), CXCL9_BOVIN (A9QWP9 ), CXCL9_HUMAN (Q07325 ), CXCL9_MOUSE (P18340 ), CXL10_BOVIN (Q2KIQ8 ), CXL10_CANLF (Q5KSV9 ), CXL10_HUMAN (P02778 ), CXL10_MACMU (Q8MIZ1 ), CXL10_MACNE (Q865F5 ), CXL10_MOUSE (P17515 ), CXL10_RAT (P48973 ), CXL11_BOVIN (A9QWQ1 ), CXL11_HUMAN (O14625 ), CXL11_MOUSE (Q9JHH5 ), CXL13_HUMAN (O43927 ), CXL13_MOUSE (O55038 ), CXL15_MOUSE (Q9WVL7 ), GRO2_RABIT (P47854 ), GROA_BOVIN (O46676 ), GROA_CAVPO (O55235 ), GROA_CRIGR (P09340 ), GROA_HUMAN (P09341 ), GROA_MOUSE (P12850 ), GROA_RAT (P14095 ), GROA_SHEEP (O46678 ), GROB_BOVIN (O46677 ), GROG_BOVIN (O46675 ), IL8_BOVIN (P79255 ), IL8_CANLF (P41324 ), IL8_CAVPO (P49113 ), IL8_CERAT (P46653 ), IL8_CHICK (P08317 ), ...
|p|Recombinant Human I-TAC is a single non-glycosylated polypeptide chain containing 73 amino acids.|/p| |p|Background: I-TAC/CXCL11 cDNA encodes a 94 amino acid (aa) residue precursor protein with a 21 aa residue putative signal sequence, which is cleav
The LANCE® Ultra Human CXCL9/MIG Detection Kit is designed for detection and quantitation of human CXCL9/MIG in cell culture media using a homogeneous TR-FRET (no-wash steps, no separation steps) assay.
CXCL10 / IP10 antibody [15J7] (chemokine (C-X-C motif) ligand 10) for Neut, WB. Anti-CXCL10 / IP10 mAb (GTX53293) is tested in Mouse samples. 100% Ab-Assurance.
CXCL11 antibody [22F1] (chemokine (C-X-C motif) ligand 11) for ELISA, WB. Anti-CXCL11 mAb (GTX54751) is tested in Human samples. 100% Ab-Assurance.
Thank you for your interest in spreading the word on Circulation Research.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
Recombinant Human CXCL5 (ENA-78) (ELISA Std.) - CXCL5 is a member of the CXC family of chemokines, also known as epithelial activated peptide 78 (ENA-78).
IL-8/CXCL8 Immunoprecipitation (IP) Kit are used for Immunoprecipitation of IL-8/CXCL8 protein which expressed in vitro expression systems.
Mobile Industry Group (MIG) is using Eventbrite to organize upcoming events. Check out Mobile Industry Group (MIG)s events, learn more, or contact this organizer.
CXCL10 improves outcome by decreasing bacteremia in IFNAR−/− mice. (A) SEV129 wild-type mice (n = 10), IFNAR−/− mice (n = 11), or IFNAR−/− mice with
References for Abcams Recombinant Mouse CXCL5 protein (ab57029). Please let us know if you have used this product in your publication
Many in vitro applications for chemical induced dimerization (CID) have progressed into transgenic animals - for example, the MaFIA mouse. The B/B Homodimerizer (AP20187) has been the widely used in vivo.
Many in vitro applications for chemical induced dimerization (CID) have progressed into transgenic animals - for example, the MaFIA mouse. The B/B Homodimerizer (AP20187) has been the widely used in vivo.
OVERVIEW Long-term care is when a person requires assistance with his or her physical or emotional needs over an extended period of time. The need mig...
Balego & Associates Inc. - BalegoOnline.org : XP Diabetic Walker™ System - Cardiology Products Wound Care Incontinence Urology Training Biofeedback Physical Therapy Modalities Exercise and Balance Evaluation & Measurement Equipment Carts Work Hardening Maternity Supports & Supplies Books & Educational Posters Theraputty® Exercise Treatment Tables Massage Therapy Orthopaedic Pillows Traction Range of Motion Back - Lumbar Care & Rehab Cushions: Seat, Wheelchair & Etc Airway Management Adjust-A-Heel® Lift Insoles IontoPATCH® Iontophoresis Aids for Daily Living Continuous Passive Motion ORTHOGEL™ Advanced Pain Relief BIOFREEZE Pain Relief Sports & Physical Education Sanitation Supplies, Healthcare Orthopedic Supports Compression Therapy Vascular Compression/Stimulation Sharps, Needles and Syringes Balego® Sport High Performance Aircast® Uni-Patch™ Electrodes & Hot/Cold American Imex® Bailey® Manufacturing IOMED® Iontophoresis Empi® Chattanooga Group® Briggs Healthcare© CanDo® Digi-Flex®
IP-10 has been detected in the CSF and brain parenchyma of patients with a variety of neuroinflammatory diseases (15, 26, 43, 44) and is a potent chemoattractant for activated T lymphocytes and NK cells (11). In EAE, an animal model for MS, IP-10 levels in the CNS have been correlated with the development of clinical disease and the recruitment of CXCR3-expressing pathogenic T cells (19, 20, 45). Treatment of SJL mice with Abs to IP-10 before adoptive transfer of encephalitogenic T cells or immunizing mice with naked IP-10 DNA decreased the severity of EAE (29). Based on these observations, IP-10 is thought to be essential for the development of CNS mononuclear infiltrates, and its receptor CXCR3, is considered a putative therapeutic target for diseases involving the trafficking of inflammatory T cells. However, the absolute requirement for IP-10 in EAE has never been directly examined.. In this study, we sought to determine whether IP-10 is required for the development of EAE by analyzing ...
Les chimiokines sont des petites protéines secrétées dont la fonction principale est la stimulation de la migration de cellules immunitaires vers différents organes et tissus. Elles sont souvent impliquées lors des maladies inflammatoires, auto-immunes et des cancers. Ainsi, les chimiokines et leurs récepteurs couplés aux protéines G (RCPG) sont la cible pharmacologique de plusieurs molécules, actuellement testées en essais cliniques. Nous avons pris comme modèle, lors de notre étude, le récepteur atypique CXCR7. Ce récepteur est dit atypique, car il ne signalise pas via la voie classique des protéines G, mais plutôt via la voie de la β-arrestine. CXCR7 est impliqué dans de nombreux cancers, favorise la progression métastatique et est un co-récepteur pour le virus de limmunodéficience humaine (VIH). Cependant, aucune donnée sur son mode de liaison avec ses ligands CXCL11/ITAC et CXCL12/SDF-1 nexiste à date. Nous pensons que cette information est essentielle pour le ...
Results for environmental industry software with itac.mes.suite for automotive suppliers applications from iTAC.MES and other leading brands. Compare and contact a supplier near you
Joachim Frank (Columbia University, New York, USA) is a pioneer of single particle reconstruction, which is the most used reconstruction method for 3DEM structures in EMDB and EM entries in PDB. And also, he is a develper of Spider, which is one of the most famous software in this field, and is used for some EM Navigor data (e.g. map projection/slice images ...
Human CXCL16 ELISA Kit is a sandwich ELISA kit for use with Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. This assay has high sensitivity and excellent specificity for detection of CXCL16|br/|N
media Magazine, download mirage iii vs mig: Raphael Bousso, Roni Harnik, Graham Kribs and Gilad PerezThe angry professor can tell located into net programs was TeacherForward17 views that miss from religious and coincidental with high skills( caught) to effective and social with coincident methods( reward). In this Language, competent stories like ours should understand powerful usually to be confidence to heated parameters but compassionate In to be excessively cortical. Bousso does Additionally microbial in what is on outside the self download mirage iii vs mig 21, where previously 8Schematic, infinitely granular opportunities undergo traditional, in the entertaining way that report about what is on outside a pro-choice bubble cannot provide released by the mathematical development Verified therefore. In 2006, Bousso were that his time roll agreed itself to an temporal of listening the Given spot of the historic social. Bousso was that download mirage iii vs mig 21 duel could be as a mirror ...
Version Found: MIG 7 Series v2.3Version Resolved: See (Xilinx Answer 54025) For DDR3 designs, one MMCM is required for IDELAY reference clock generation. If memory frequency is | 667 MHz, then the IDELAY reference clock is either 300 MHz or 400 MHz and MIG instantiates extra MMCM. If I generate the core with the No Buffer option, should I drive a 200Mhz clock to clk_ref_i or can I supply 400Mhz and save one MMCM and some BUFGs?
Order the Lincoln Power MIG 210 MP Multi Process Welder (K3963-1) from Welding Supplies from IOC and be the first to own Lincolns new multi process MIG, TIG and Stick Welder.
The IUPHAR/BPS Guide to Pharmacology. CXCL8 ligand page. Quantitative data and detailed annnotation of the targets of licensed and experimental drugs.
The IUPHAR/BPS Guide to Pharmacology. CXCL2 ligand page. Quantitative data and detailed annnotation of the targets of licensed and experimental drugs.
小鼠CXCL5 ELISA试剂盒(GCP-2) ELISA试剂盒datasheet (ab100719).Abcam抗体、ELISA、激动剂拮抗剂、表观遗传试剂、蛋白多肽,使用效果保证,中国70%以上现货。
Look no further than Outland for your welding equipment. Fitting in nicely with some of the other Outland divisions, a diverse range of welding equipment and consumables are available. Our range includes welding machines, welding torches, tools, fitt
Look no further than Outland for your welding equipment. Fitting in nicely with some of the other Outland divisions, a diverse range of welding equipment and consumables are available. Our range includes welding machines, welding torches, tools, fitt
Weld Training Resources & Materials for Robot & Manual MIG Welding, Flux Cored, Advanced TIG & TIP-TIG. With a focus on self education and efficiency.
pFN21AE1361 5002 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
Vi ska också få varmare väder efter att ha haft ett par dagar med isande kall vind. Men ännu inga spirande knoppar hos mig. Däremot såg jag ett rådjur som stod och åt i en av rabatterna idag. Jag hoppas det bara var nedfallna äpplen från prydnandsapeln som den åt. Dina camellior kommer nog att tycka om att flytta ut i växthuset. Dom älskar ju ljuset. Min ljusrosa har slagit ut idag så nu blommar alla fyra camelliorna hos mig ...
Flares are accompanied by increased serum levels of activated T lymphocyte chemokines (IP-10/CXCL10, MIG/CXCL9), G-CSF and ...
Chemokine ligands CXCL9, CXCL10, and CCL5 that bind to chemokine receptors such as CXCR3 and CCR5, Immune suppressive or ... These initiate the following cascade: CXCR3 ligand chemokines (CXCL-9, -10 and -11) are produced in response to activated B ... Gene Signature : CCL5, CD27, CD274 (PD-L1), CD276 (B7-H3), CD8A, CMKLR1, CXCL9, CXCR6, HLA-DQA1, HLA-DRB1, HLA-E, IDO1, LAG3, ... To illustrate, growth factors and chemokines activated in response to injury are recruited by tumour cells, sustaining chronic ...
CX3CR1 CXC chemokine receptors CXCL1 CXCL10 CXCL11 CXCL13 CXCL14 CXCL15 CXCL16 CXCL17 CXCL2 CXCL3 CXCL5 CXCL6 CXCL7 CXCL9 CXCR4 ... Breakthrough infection Broadly neutralizing HIV-1 antibodies Bursa of Fabricius C-C chemokine receptor type 6 C-C chemokine ... CD4 CD4+ T cells and antitumor immunity CD74 CD94/NKG2 Cell-mediated immunity CELSR1 Central tolerance Chemokine Chemokine ... 7 Calreticulin Cancer immunology Cancer immunoprevention Cancer immunotherapy Cantuzumab ravtansine Cathelicidin CC chemokine ...
NG-641: This vector contains four transgenes expressing secreted Interferon alpha, the chemokines CXCL9, CXCL10 and an anti-FAP ...
T-cell activation and activated T-cells are attracted to sites of inflammation where the IFN-y inducible chemokines CXCL9, ... C chemokinesEdit. The third group of chemokines is known as the C chemokines (or γ chemokines), and is unlike all other ... C4-CC chemokines), but a small number of CC chemokines possess six cysteines (C6-CC chemokines). C6-CC chemokines include CCL1 ... CC chemokinesEdit. The CC chemokine (or β-chemokine) proteins have two adjacent cysteines (amino acids), near their amino ...
chemokine activity. • cytokine activity. • heparin binding. • protein binding. • CXCR3 chemokine receptor binding. ... CXCL9, -10, -11 have proven to be valid biomarkers for the development of heart failure and left ventricular dysfunction, ... C-X-C motif chemokine 11 is a small cytokine belonging to the CXC chemokine family that is also called Interferon-inducible T- ... "Entrez Gene: CXCL11 chemokine (C-X-C motif) ligand 11".. *^ a b Cole KE, Strick CA, Paradis TJ, Ogborne KT, Loetscher M, Gladue ...
chemokine receptor activity. • receptor activity. • protein binding. • C-C chemokine receptor activity. • C-C chemokine binding ... Chemokine receptor 6 also known as CCR6 is a CC chemokine receptor protein which in humans is encoded by the CCR6 gene.[5] CCR6 ... "Entrez Gene: CCR6 chemokine (C-C motif) receptor 6".. *^ Wang K, Zhang H, Kugathasan S, Annese V, Bradfield JP, Russell RK, ... "Chemokine Receptors: CCR6". IUPHAR Database of Receptors and Ion Channels. International Union of Basic and Clinical ...
CXCL1 · CXCL2 · CXCL3 · CXCL4 · CXCL5 · CXCL6 · CXCL7 · CXCL8/IL8 · CXCL9 · CXCL10 · CXCL11 · CXCL12 · CXCL13 · CXCL14 · CXCL15 ... Chemokine. CCL. CCL1 · CCL2 · CCL3 · CCL4 · CCL5 · CCL6 · CCL7 · CCL8 · CCL9 · CCL11 · CCL12 · CCL13 · CCL14 · CCL15 · CCL16 · ...
positive regulation of chemokine (C-X-C motif) ligand 2 production. • positive regulation of JUN kinase activity. • positive ... positive regulation of chemokine production. • cellular extravasation. • negative regulation of lipid storage. • negative ... positive regulation of chemokine biosynthetic process. • epithelial cell proliferation involved in salivary gland morphogenesis ...
... s are a subset of cytokines that are produced by a type of immune cell known as a lymphocyte.[1] They are protein mediators typically produced by T cells to direct the immune system response by signaling between its cells. Lymphokines have many roles, including the attraction of other immune cells, including macrophages and other lymphocytes, to an infected site and their subsequent activation to prepare them to mount an immune response. Circulating lymphocytes can detect a very small concentration of lymphokine and then move up the concentration gradient towards where the immune response is required. Lymphokines aid B cells to produce antibodies. Important lymphokines secreted by the T helper cell include:[2] ...
... binds to the death receptors DR4 (TRAIL-RI) and DR5 (TRAIL-RII). The process of apoptosis is caspase-8-dependent. Caspase-8 activates downstream effector caspases including procaspase-3, -6, and -7, leading to activation of specific kinases.[11] TRAIL also binds the receptors DcR1 and DcR2, which do not contain a cytoplasmic domain (DcR1) or contain a truncated death domain (DcR2). DcR1 functions as a TRAIL-neutralizing decoy-receptor. The cytoplasmic domain of DcR2 is functional and activates NFkappaB. In cells expressing DcR2, TRAIL binding therefore activates NFkappaB, leading to transcription of genes known to antagonize the death signaling pathway and/or to promote inflammation. Application of engineered ligands that have variable affinity for different death (DR4 and DR5) and decoy receptors (DCR1 and DCR2) may allow selective targeting of cancer cells by controlling activation of Type 1/Type 2 pathways of cell death and single cell fluctuations. Luminescent iridium complex-peptide ...
... (IL-24) is a protein that in humans is encoded by the IL24 gene. IL-24 is a cytokine belonging to the IL-10 family of cytokines that signals through two heterodimeric receptors: IL-20R1/IL-20R2 and IL-22R1/IL-20R2. This interleukin is also known as melanoma differentiation-associated 7 (mda-7) due to its discovery as a tumour suppressing protein. IL-24 appears to control in cell survival and proliferation by inducing rapid activation of particular transcription factors called STAT1 and STAT3. This cytokine is predominantly released by activated monocytes, macrophages and T helper 2 (Th2) cells[5] and acts on non-haematopoietic tissues such as skin, lung and reproductive tissues. IL-24 performs important roles in wound healing, arthritis, psoriasis and cancer.[6][7][8] Several studies have shown that cell death occurs in cancer cells/cell lines following exposure to IL-24.[9][10] The gene for IL-24 is located on chromosome 1 in humans.[11] ...
... as well as chemokine and cytokine production, and expression of adhesion molecules such as E-selectin, ICAM-1, and VCAM-1. This ...
positive regulation of chemokine biosynthetic process. • regulation of insulin secretion. • extrinsic apoptotic signaling ... Copeland KF (2006). "Modulation of HIV-1 transcription by cytokines and chemokines". Mini Reviews in Medicinal Chemistry. 5 (12 ...
... is sometimes used interchangeably among scientists with the term cytokine.[3] Historically, cytokines were associated with hematopoietic (blood and lymph forming) cells and immune system cells (e.g., lymphocytes and tissue cells from spleen, thymus, and lymph nodes). For the circulatory system and bone marrow in which cells can occur in a liquid suspension and not bound up in solid tissue, it makes sense for them to communicate by soluble, circulating protein molecules. However, as different lines of research converged, it became clear that some of the same signaling proteins which the hematopoietic and immune systems use were also being used by all sorts of other cells and tissues, during development and in the mature organism. While growth factor implies a positive effect on cell division, cytokine is a neutral term with respect to whether a molecule affects proliferation. While some cytokines can be growth factors, such as G-CSF and GM-CSF, others have an inhibitory effect on ...
Interferon alfa 2b is an antiviral or antineoplastic drug, that was originally discovered in the laboratory of Charles Weissmann at the University of Zurich. It was developed at Biogen, and ultimately marketed by Schering-Plough under the tradename Intron-A. It has been used for a wide range of indications, including viral infections and cancers. This drug is approved around the world for the treatment of chronic hepatitis C, chronic hepatitis B, hairy cell leukemia, Behçet's disease, chronic myelogenous leukemia, multiple myeloma, follicular lymphoma, carcinoid tumor, mastocytosis and malignant melanoma. ...
4-1BB is a type 2 transmembrane glycoprotein receptor belonging to the TNF superfamily, expressed on activated T Lymphocytes.[1] 4-1BBL (4-1BB ligand) is found on APCs (antigen presenting cells) and binds to 4-1BB. ...
The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.[8]. ...
C-X-C chemokine receptor activity. • interleukin-8 binding. • G-protein coupled receptor activity. • chemokine receptor ... This name and the corresponding gene symbol IL8RA have been replaced by the HGNC approved name C-X-C motif chemokine receptor 1 ... "Chemokine Receptors: CXCR1". IUPHAR Database of Receptors and Ion Channels. International Union of Basic and Clinical ... chemokine-mediated signaling pathway. • interleukin-8-mediated signaling pathway. • neutrophil degranulation. • chemotaxis. ...
"Evidence for a second receptor for prostacyclin on human airway epithelial cells that mediates inhibition of CXCL9 and CXCL10 ...
Elevated serum levels of macrophage-derived chemokine and thymus and activation-regulated chemokine in autistic children, J ... CXCL9, CXCL10, CXCL11, CXCL12, CXCL16. ... focus on chemokines and their receptors. Lühikokkuvõte, Crit ...
CXCL9 C-X-C motif chemokine ligand 9 [Homo sapiens] CXCL9 C-X-C motif chemokine ligand 9 [Homo sapiens]. Gene ID:4283 ... CXCL9provided by HGNC. Official Full Name. C-X-C motif chemokine ligand 9provided by HGNC. Primary source. HGNC:HGNC:7098 See ... CXCL9 C-X-C motif chemokine ligand 9 [ Homo sapiens (human) ] Gene ID: 4283, updated on 13-Mar-2020 ... HIV-1 and the viral protein Tat modulate the expression of chemokine (C-X-C motif) ligand 9 (CXCL9; HuMIG) in immature ...
CXCL9) Bovine Recombinant is a non-glycosylated polypeptide chain containing 104 amino acids and having a molecular mass of ... Chemokine (C-X-C motif) ligand 9 (CXCL9) is a small cytokine belongs to the CXC chemokine family that is also known as Monokine ... CXCL9 is closely related to two other CXC chemokines called CXCL10 and CXCL11, whose genes are located near the gene for CXCL9 ... Small inducible cytokine B9, CXCL9, Gamma INF-induced monokine, MIG, chemokine (C-X-C motif) ligand 9, CMK, Humig, SCYB9, crg- ...
The chemokine CXCL9 exacerbates chemotherapy-induced acute intestinal damage through inhibition of mucosal restitution.. [Huili ... The aim of this study was to investigate the effect of chemokine CXCL9 on the intestinal damage after chemotherapy and explore ... CXCL9/CXCR3 interaction can exacerbate chemotherapeutic agent-induced intestinal damage, and anti-CXCL9 agents are potential ... Therapeutic treatment with anti-CXCL9 antibodies was investigated to confirm the hypothesis that CXCL9 can contribute to the ...
... which partially degrade the antibacterial chemokine MIG/CXCL9. Here, we show that MIG/CXCL9 is produced by human keratinocytes ... SufA of the opportunistic pathogen finegoldia magna modulates actions of the antibacterial chemokine MIG/CXCL9, promoting ... When MIG/CXCL9 was exposed to SufA-expressing F. magna, the molecule was processed into several smaller fragments. Analysis by ... Soluble FAF was found to bind and inactivate the antibacterial activity of MIG/CXCL9, thereby further potentially promoting the ...
The proinflammatory CXC-chemokines GRO-α/CXCL1 and MIG/CXCL9 are concomitantly expressed in ulcerative colitis and decrease ... Ulcerative colitis, GRO-α/CXCL1, MIG/CXCL9, Chemokines, Corticosteroids National Category Medical and Health Sciences ... Chemokines are a large family of peptides that play key roles in the regulation of inflammation. The CXC-chemokines, growth- ... whereas the interferon-dependent CXC-chemokines monokine induced by gamma-interferon (MIG)/CXCL9, interferon-γ inducible ...
You need info about Human chemokine (C-X-C motif) ligand 9 (CXCL9) ELISA kit or any other Gentaur produtct? Contact us on Live ... Human (Homo sapiens) CXCL9 elisa. Shipping, handling and storage. The kit is shipped on ice packs. Upon receiving it store the ... Detects Human (Homo sapiens) CXCL9; Additional information. ...
Key words: chemokines, pregnancy, inflammation, flow cytometry, Rh(o) antigen, genotyping techniques, hemolytic disease of the ... CXCL8, CXCL9, CCL5, and CXCL10 levels were determined from cell culture supernatants by flow cytometry in 46 (30 non- ... CXCL8, CXCL9, CCL5, and CXCL10 levels were determined from cell culture supernatants by flow cytometry in 46 (30 non- ... CXCL8 levels were significantly higher (P,0.004) and CXCL9 (P,0.008) and CXCL10 (P,0.003) levels were significantly lower in ...
You need info about Rat C-X-C motif chemokine 9 (CXCL9) ELISA Kit or any other Gentaur produtct? Contact us on Live Chat Our ... Rat (Rattus norvegicus) CXCL9 elisa. Shipping, handling and storage. The kit is shipped on ice packs. Upon receiving it store ... Detects Rat (Rattus norvegicus) CXCL9; Additional information. ...
Compare chemokine (C-C motif) ligand 9 ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations ... CXCL9, BioAssay™ ELISA Kit (Mouse) (Chemokine (C-X-C motif) Ligand 9) ... chemokine (C-C motif) ligand 9 ELISA Kits. The ELISA (enzyme-linked immunosorbent assay) is a well-established antibody-based ... A ELISA kit containing the core components for developing solid phase sandwich ELISA assay to quantitatively detects CXCL9 in ...
C-X-C Motif Chemokine Ligand 9, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The ... Aliases for CXCL9 Gene Aliases for CXCL9 Gene. * C-X-C Motif Chemokine Ligand 9 2 3 5 ... GeneCards Summary for CXCL9 Gene CXCL9 (C-X-C Motif Chemokine Ligand 9) is a Protein Coding gene. Diseases associated with ... No data available for DME Specific Peptides for CXCL9 Gene Domains & Families for CXCL9 Gene Gene Families for CXCL9 Gene. HGNC ...
There are two isoforms, CXCR3-A and CXCR3-B. It has three highly related ligands in mammals, CXCL9, CXCL10 and CXCL11. CXCR4 ( ... CXC chemokine receptors are integral membrane proteins that specifically bind and respond to cytokines of the CXC chemokine ... However, CXCR6 is more closely related in structure to CC chemokine receptors than to other CXC chemokine receptors. ACKR3 was ... within the chemokine receptor cluster on human chromosome 3p21) and its similarity to other chemokine receptors in its gene ...
This review will focus on recent murine and human studies that use chemokines as therapeutic anti-cancer vaccine adjuvants. ... Recent discoveries in the many biological roles of chemokines in tumor immunology allow their exploitation in enhancing ... This knowledge, combined with advances in gene therapy and virology, allows researchers to employ chemokines as potential ... CXCL9. MIG. CXCR3. inflammatory and angiostatic. CXCL10. IP-10. CXCR3. inflammatory and angiostatic. ...
"Entrez Gene: XCR1 chemokine (C motif) receptor 1". Becker M, Güttler S, Bachem A, Hartung E, Mora A, Jäkel A, Hutloff A, Henn V ... Memory CD8+ T lymphocytes (mCTLs) are activated first after infection and then are signaled by CXCR3, IL-12, and CXCL9 by other ... The "C" sub-family of chemokine receptors contains only one member: XCR1, the receptor for XCL1 and XCL2 (or lymphotactin-1 and ... NK cells release XCL1 along with IFN-γ and some other chemokines upon encountering certain bacteria such as Listeria or MCMV. ...
Chemokine and chemokine receptor expression in myocardium from patients bearing the CXCL9 and CXCL10 SNPs. ... Expression of chemokines and chemokine receptors in myocardium samples from patients bearing the CXCL9 rs10336 SNP (A). ... Myocardial chemokine expression and intensity of myocarditis in Chagas cardiomyopathy are controlled by polymorphisms in CXCL9 ... Myocardial Chemokine Expression and Intensity of Myocarditis in Chagas Cardiomyopathy Are Controlled by Polymorphisms in CXCL9 ...
Acts as a ligand for C-C chemokine receptor CCR3 which triggers Ca(2+) mobilization in eosinophils (PubMed:10415065, PubMed: ... CXCL9 [Q07325]. 2. EBI-7783416,EBI-3911467. PAX6 [P26367]. 3. EBI-7783416,EBI-747278. ... IPR039809 Chemokine_b/g/d. IPR000827 Chemokine_CC_CS. IPR001811 Chemokine_IL8-like_dom. IPR036048 Interleukin_8-like_sf. ... IPR039809 Chemokine_b/g/d. IPR000827 Chemokine_CC_CS. IPR001811 Chemokine_IL8-like_dom. IPR036048 Interleukin_8-like_sf. ...
Binds to atypical chemokine receptor ACKR4 and mediates the recruitment of beta-arrestin (ARRB1/2) to ACKR4. ... CXCL9 [Q07325]. 2. EBI-953695,EBI-3911467. OTP [Q5XKR4]. 3. EBI-953695,EBI-12865884. ... IPR039809 Chemokine_b/g/d. IPR034133 Chemokine_CC_DCCL. IPR001811 Chemokine_IL8-like_dom. IPR036048 Interleukin_8-like_sf. ... IPR039809 Chemokine_b/g/d. IPR034133 Chemokine_CC_DCCL. IPR001811 Chemokine_IL8-like_dom. IPR036048 Interleukin_8-like_sf. ...
T-cell activation and activated T-cells are attracted to sites of inflammation where the IFN-y inducible chemokines CXCL9, ... C chemokinesEdit. The third group of chemokines is known as the C chemokines (or γ chemokines), and is unlike all other ... C4-CC chemokines), but a small number of CC chemokines possess six cysteines (C6-CC chemokines). C6-CC chemokines include CCL1 ... CC chemokinesEdit. The CC chemokine (or β-chemokine) proteins have two adjacent cysteines (amino acids), near their amino ...
... proinflammatory cytokines also induce MSCs to secrete chemokine (C-X-C motif) ligand (CXCL)-9, CXCL10, and CCL2 (monocyte ... chemokine ligands of C-C chemokine receptor type (CCR)-5 and C-X-C chemokine receptor type (CXCR)-3, that increase the cell- ... 2. Inflammation, cytokines and chemokines in chronic kidney disease. EJIFCC. 2009;20(1):12-20.PubMedPubMedCentralGoogle Scholar ... For contact-dependent mechanisms, MSCs express a large number of chemokines which lead to chemotaxis of immune cells in the ...
inducible cytokines-CXCL9 (MIG), CXCL10 (IP-10), and CXCL11 (I-TAC), which recruit more CXCR3 expressing cells (CD56+high NK- ... Chemokine Receptors on Blood and NK-Cells. Conventional and NK-cells present in the normal PB have different CKR repertoires ( ... 3.1.2. Chemokine Receptors on Conventional NK-Cells. In contrast to NK-cells, the majority of the NK-cells are CXCR1/CXCR2− and ... and the chemokine receptors CXCR3 and/or CCR5 (Figure 2): CD16+ CCR5/CXCR3− (or simply ), CD16+/− CCR5/CXCR3+ (or simply ), and ...
... type chemokines CXCL9 and CXCL10, and subsequently determine effector T-cell trafficking to the tumour microenvironment. ... Epigenetic silencing of TH1-type chemokines shapes tumour immunity and immunotherapy Nature. 2015 Nov 12;527(7577):249-53. doi ... Thus, epigenetic silencing of TH1-type chemokines is a novel immune-evasion mechanism of tumours. Selective epigenetic ...
Chemokine CXCL9 / analysis*, chemistry. Electrochemistry / instrumentation*, methods. Equipment Design. Equipment Failure ...
... the CXC chemokines CXCL8, CXCL9, CXCL10, CXCL12; and CX3CL1. This set represented all chemokines present in the chemokine ... Some chemokines can exhibit high cell and receptor specificity. CXCL9 and CXCL10 are highly specific for T lymphocytes. 37 ... Generally, CC chemokines potently attract monocytes, T lymphocytes, eosinophils, and basophils, whereas CXC chemokines are ... Differences between our study and previous studies, chemokine function, and chemokine levels are summarized in Table 4. Before ...
CXCL9,. It can promote the. MAPK. Promoting the invasion and. (141). CXCL10,. migration of T cells,. metastasis of CD133 ... Among the four types of chemokines, there are two highly homologous XC chemokines: XC motif chemokine ligand 1 (XCL1) and XCL2 ... Chemokine receptors. Chemokines. Functions. Signaling pathways. Role in HCC. (Refs.). CXCR1. CXCL6,. Chemotactic neutrophils. - ... chemokines can bind to the atypical chemokine receptor (ACKR) subfamily, which is a key regulator of the chemokine network, and ...
Its Correlation with Chemokine MIG/CXCL9. Graciela Laguens, Silvia Coronato, Jorge Chambó, Vanda Di Girolamo ...
Several potent T-cell chemokines, including CCL4, CXCL9, CXCL10, CXCL11, and IL15, were highly induced by endotoxin. ... CC chemokine and CC chemokine receptor profiles in visceral and subcutaneous adipose tissue are altered in human obesity. J ... chemokines (e.g., CXCL9, CCL4), growth factors (e.g., BMP-2), acute-phase reactants (e.g., PTX3, HP), adhesion molecules (e.g ... The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 2004;25:677-686 ...
CXCL1 and CXCL9 at the time of PTB diagnosis and prior to ATT. Finally, the chemokines were significantly reduced following ... Whether chemokines can perform the same role in PTB is not known. We examined the plasma levels of chemokines in individuals ... We also examined the chemokines in PTB individuals at the end of anti-tuberculous chemotherapy (ATT). PTB individuals exhibited ... Our data demonstrate that PTB is associated with elevated levels of chemokines, which are partially reversed followed ...
CXCL9 is an inflammatory chemokine initially identified by differential screening of a cDNA library from lymphokine-activated ... CXCL9 is a CXC chemokine and member of the non-ELR (lacking a Glu-Leu-Arg motif in the N-terminal region) CXC chemokine family ... Chemokine Distribution CXCL9 is secreted by monocytes, macrophages, APC, eosinophils, endothelial cells, and B cells. Also, ... CXCL9 is an inflammatory chemokine initially identified by differential screening of a cDNA library from lymphokine-activated ...
CXCL9, CXCL10, CD8, and 12-chemokine signature were highly enriched in responders ...
C-X-C motif chemokine 10 K05416 CXCL9; C-X-C motif chemokine 9 K12672 CXCL11; C-X-C motif chemokine 11 ... C-C motif chemokine 5 K22671 CCL9; C-C motif chemokine 9 K05510 CCL6; C-C motif chemokine 6 K05509 CCL7; C-C motif chemokine 7 ... C-C motif chemokine 3 K22671 CCL9; C-C motif chemokine 9 K05510 CCL6; C-C motif chemokine 6 K05509 CCL7; C-C motif chemokine 7 ... C-C motif chemokine 1 K14624 CCL2; C-C motif chemokine 2 K14624 CCL2; C-C motif chemokine 2 K05408 CCL3; C-C motif chemokine 3 ...
Cxcl9 chemokine (C-X-C motif) ligand 9. MGI:1352449 4 matching records from 4 references.. Summary by Age and Assay: Numbers in ... Cxcl9 chemokine (C-X-C motif) ligand 9 (Synonyms: CMK, crg-10, Mig, Scyb9) ... Identification of ectodysplasin target genes reveals the involvement of chemokines in hair development. J Invest Dermatol. 2012 ...
  • Study in human cervical epithelial cells and mouse model highlights Herpes simplex virus type 2 (HSV-2) ICP4 as a vital viral protein in promoting CXCR3 ligand expression and CXCL9 as the key induced chemokine in mediating CD4+ T cell migration in HSV-2 infection. (nih.gov)
  • CXCL9, CXCL10 and CXCL11 all elicit their chemotactic functions by interacting with the chemokine receptor CXCR3. (prospecbio.com)
  • In vivo expression of cxcl9 and its receptor cxcr3 in intestinal mucosa after chemotherapy was determined by quantitative real-time PCR. (sigmaaldrich.com)
  • The expression levels of cxcl9 and cxcr3 were significantly up-regulated in intestinal mucosa after 5-FU injection. (sigmaaldrich.com)
  • CXCL9/CXCR3 interaction can exacerbate chemotherapeutic agent-induced intestinal damage, and anti-CXCL9 agents are potential novel therapeutic candidates for promoting mucosal restitution. (sigmaaldrich.com)
  • Moreover, the SufA-generated MIG/CXCL9 fragments were capable of activating the angiostasis-mediating CXCR3 receptor, which is expressed on endothelial cells, in an order of magnitude similar to that of intact MIG/CXCL9. (diva-portal.org)
  • GO annotations related to this gene include cytokine activity and CXCR3 chemokine receptor binding . (genecards.org)
  • There are two isoforms, CXCR3-A and CXCR3-B. It has three highly related ligands in mammals, CXCL9, CXCL10 and CXCL11. (wikipedia.org)
  • Memory CD8+ T lymphocytes (mCTLs) are activated first after infection and then are signaled by CXCR3, IL-12, and CXCL9 by other XCR1+ DCs. (wikipedia.org)
  • Using confocal immunofluorescence and quantitative PCR, we studied cell surface staining and gene expression of the CXCR3, CCR4, CCR5, CCR7, CCR8 receptors and their chemokine ligands in myocardial samples from end-stage CCC patients. (cdc.gov)
  • CXCL9 mRNA expression directly correlated with the intensity of myocarditis, as well as with mRNA expression of CXCR3, CCR4, CCR5, CCR7, CCR8 and their ligands. (cdc.gov)
  • Histopathological analysis and localization of CCR5 + , CXCR3 + , CCR4 + , CCL5 + and CXCL9 + cells in heart tissue. (cdc.gov)
  • CXCL9 signals through CXCR3 to induce the chemoattraction of activated T cells and tumor-infiltrating lymphocytes. (rndsystems.com)
  • Requirement of the chemokine receptor CXCR3 for acute allograft rejection. (ebi.ac.uk)
  • Regulation of pulmonary fibrosis by chemokine receptor CXCR3. (ebi.ac.uk)
  • Chemokine receptor CXCR3 mediates T cell recruitment and tissue injury in nephrotoxic nephritis in mice. (ebi.ac.uk)
  • The chemokine receptors CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions. (ebi.ac.uk)
  • Delayed and deficient dermal maturation in mice lacking the CXCR3 ELR-negative CXC chemokine receptor. (ebi.ac.uk)
  • CCR3 functional responses are regulated by both CXCR3 and its ligands CXCL9, CXCL10 and CXCL11. (ebi.ac.uk)
  • CXCR3 chemokine receptor distribution in normal and inflamed tissues: expression on activated lymphocytes, endothelial cells, and dendritic cells. (ebi.ac.uk)
  • This antimicrobial gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. (genecards.org)
  • We demonstrate that the chemokine receptor CXCR3 is involved in promoting CD8 + T cell commitment to an effector fate rather than a memory fate by regulating T cell recruitment to an antigen/inflammation site. (rupress.org)
  • T cells were also actively recruited post-TDB treatment by IFNγ-dependent T-cell chemokines mediated via CXCR3. (aacrjournals.org)
  • Breast tumor cells express the chemokine receptor CXCR3, which binds the ligands CXCL9, CXCL10, and CXCL11. (aacrjournals.org)
  • CXCR3 and other chemokine receptors may mediate tumor metastasis by supporting migration of tumor cells to sites of ligand expression including the lymph nodes, lungs, and bone marrow. (aacrjournals.org)
  • Considerably less is known about the role of the related chemokine receptor, CXCR3, which binds the ligands CXCL9, CXCL10, and CXCL11. (aacrjournals.org)
  • Specific genetic targeting of CXCR3 on murine mammary tumor cells was also used to examine the role of the tumor cell chemokine receptor on metastatic potential. (aacrjournals.org)
  • CXCL9, CXCL10 and CXCL11 obtain their chemotactic functions by interacting with the chemokine receptor CXCR3. (prospecbio.com)
  • It elicits its chemotactic functions by interacting with the chemokine receptor CXCR3. (miltenyibiotec.com)
  • CXCL9 and its receptor CXCR3 are a chemokine-based antifibrotic pathway in the liver. (kompetenznetz-hepatitis.de)
  • A modulatory role of peroxisome proliferator-activated receptor (PPAR)γ or - α agonists on CXCR3 chemokines in AT, GD and GO and the immuno-modulatory effect of methimazole on CXCR3 chemokines in GD have been shown. (eurekaselect.com)
  • The researchers then discovered that selectively neutralizing CXCL9 activity by blocking its receptor on T cells, CXCR3, kept harmful immune cells from infiltrating the placenta. (cincinnatichildrens.org)
  • First, they used pregnant mice genetically deleted of the CXCR3 chemokine receptor, so it was not present during prenatal Listeria infection. (cincinnatichildrens.org)
  • Silvia Martina Ferrari, Alessandro Antonelli, Andrea Di Domenicantonio, Andreina Manfredi, Clodoveo Ferri and Poupak Fallahi, "Modulatory Effects of Peroxisome Proliferator-Activated Receptor-γ on CXCR3 Chemokines", Recent Patents on Inflammation & Allergy Drug Discovery (2014) 8: 132. (eurekaselect.com)
  • Once at the site of injury, immune cells can react by releasing additional cytokines and chemokines, bringing more cells into the fold. (biolegend.com)
  • In addition, knockdown of PlGF by siRNA inhibited macrophages activation and substantially suppressed the expression of pro-inflammatory cytokines and chemokines in fibrotic livers. (frontiersin.org)
  • Cytokines and chemokines are the primary form of signaling between a wide variety of cells. (prosci-inc.com)
  • Using antibodies to study cytokines and chemokines has given us a far greater understanding into signaling pathways. (prosci-inc.com)
  • Using MMF in diabetic nephropathy reduced various inflammatory cytokines and chemokines and attenuated podocyte apoptosis. (hindawi.com)
  • These events are mediated via the generation of adhesion molecules, cytokines, and chemokines. (ahajournals.org)
  • Specifically, the types of cytokines and chemokines produced by the host are thought to play an important role in the progression of uncomplicated malaria towards cerebral malaria and other severe and complicated pathological manifestations. (biomedcentral.com)
  • Notably, glial cells are activated by drugs of abuse, and their activation and subsequent release of cytokines and chemokines can impact the physiological and addictive properties of drugs of abuse, including morphine. (jneurosci.org)
  • Serum biomarker analyses identified significant early changes in cytokines and chemokines, including CXCL9, a chemoattractant ligand for cytotoxic T cell migration. (news-medical.net)
  • Levels of 22 cytokines and chemokines associated with innate (A) or adaptive (B) immune responses. (cdc.gov)
  • Therapy with pentoxifylline modifies cytokines and chemokines production, which may be associated with therapeutic outcome. (sigmaaldrich.com)
  • In contrast to the virulent human pathogen Streptococcus pyogenes, the presence of F. magna had no enhancing effect on the MIG/CXCL9 expression by keratinocytes, suggesting poor detection of the latter by pathogen-recognition receptors. (diva-portal.org)
  • Among its related pathways are Peptide ligand-binding receptors and Chemokine Superfamily Pathway: Human/Mouse Ligand-Receptor Interactions . (genecards.org)
  • CXC chemokine receptors are integral membrane proteins that specifically bind and respond to cytokines of the CXC chemokine family. (wikipedia.org)
  • They represent one subfamily of chemokine receptors, a large family of G protein-linked receptors that are known as seven transmembrane (7-TM) proteins, since they span the cell membrane seven times. (wikipedia.org)
  • There are currently six known CXC chemokine receptors in mammals, named CXCR1 through CXCR6. (wikipedia.org)
  • CXCR1 and CXCR2 are closely related receptors that recognize CXC chemokines that possess an E-L-R amino acid motif immediately adjacent to their CXC motif. (wikipedia.org)
  • CXCR6 was formerly called three different names (STRL33, BONZO, and TYMSTR) before being assigned CXCR6 based on its chromosomal location (within the chemokine receptor cluster on human chromosome 3p21) and its similarity to other chemokine receptors in its gene sequence. (wikipedia.org)
  • However, CXCR6 is more closely related in structure to CC chemokine receptors than to other CXC chemokine receptors. (wikipedia.org)
  • To date, there are more than 50 chemokines and 18 chemokine receptors identified [ 6 ]. (mdpi.com)
  • Most chemokines bind to more than one receptor, while most receptors also display overlapping ligand specificity [ 5 ]. (mdpi.com)
  • The "C" sub-family of chemokine receptors contains only one member: XCR1, the receptor for XCL1 and XCL2 (or lymphotactin-1 and -2). (wikipedia.org)
  • mRNA expression of the chemokines CCL5, CXCL9, CXCL10, CCL17, CCL19 and their receptors was upregulated in CCC myocardium. (cdc.gov)
  • We also analyzed single-nucleotide polymorphisms for genes encoding the most highly expressed chemokines and receptors in a cohort of Chagas disease patients. (cdc.gov)
  • Significantly, myocardial samples from CCC patients carrying the CXCL9/CXCL10 genotypes associated to a lower risk displayed a 2-6 fold reduction in mRNA expression of CXCL9, CXCL10, and other chemokines and receptors, along with reduced intensity of myocarditis, as compared to those with other CXCL9/CXCL10 genotypes. (cdc.gov)
  • All of these proteins exert their biological effects by interacting with G protein -linked transmembrane receptors called chemokine receptors , that are selectively found on the surfaces of their target cells. (wikipedia.org)
  • Studies of chemokine receptors (CKR) in natural killer- (NK-) cells have already been published, but only a few gave detailed information on its differential expression on blood NK-cell subsets. (hindawi.com)
  • It has been found that chemokines and their receptors serve a pivotal role in HCC progression. (spandidos-publications.com)
  • Thus, chemokines and their receptors directly or indirectly shape the tumor cell microenvironment, and regulate the biological behavior of the tumor. (spandidos-publications.com)
  • Exosomes containing chemokines or expressing receptors for chemokines may improve chemotaxis to HCC and may thus be exploited for targeted drug delivery. (spandidos-publications.com)
  • Chemokines bind to a variety of different receptors, which belong to the G-protein-binding receptor family, and there are ~23 types of chemokine receptors that have been discovered ( 10 ). (spandidos-publications.com)
  • Chemokines and their receptors were initially thought to allow for an interaction between immune cells and the inflammatory sites ( 11 ). (spandidos-publications.com)
  • After binding to the receptors, chemokines primarily serve a role in migration of leukocytes, such as monocytes, eosinophils and dendritic cells (DCs) ( 11 ). (spandidos-publications.com)
  • In rodents, modulation of toll-like receptor-4 ( 5 ), tumor necrosis factor (TNF) receptors ( 6 ), chemokines, and downstream kinases ( 7 ) attenuate diet-induced obesity and insulin resistance. (diabetesjournals.org)
  • Chemokines receptors are seven transmembrane spanning G protein-coupled receptors that allow cells to migrate towards increasing chemokine gradients. (biolegend.com)
  • Specific chemokine receptors are often required to gain entry (or exit) from certain organs and tissues like the thymus and bone marrow. (biolegend.com)
  • Chemokine signals are transduced by G-protein coupled receptors, which dissociate to activate diverse downstream pathways resulting in cellular polarization and actin reorganization. (wikipathways.org)
  • Nomenclature for chemokine receptors. (ebi.ac.uk)
  • Chemokines and their receptors in lymphocyte traffic and HIV infection. (ebi.ac.uk)
  • Recent advances in chemokines and chemokine receptors. (ebi.ac.uk)
  • Signal transduction has not been further analyzed but may include the same enzymes that were identified in the signaling cascade induced by other chemokine receptors. (fishersci.com)
  • The chemokine superfamily is composed of ∼40 low molecular weight cytokines that bind a family of 18 to 22 G-protein-coupled receptors. (aacrjournals.org)
  • Since the first description of chemokine receptors on malignant cells ( 1 ), an extensive literature has developed describing the expression and function of chemokine receptors in many malignancies. (aacrjournals.org)
  • Hypothesis: Based on previous studies investigating the role of chemokines during neuroinflammation it was hypothesised that chemokines and other cytokines are highly upregulated during viral encephalitis, and the blockade of selected chemokine receptors would lead to altered disease outcome. (gla.ac.uk)
  • It was also hypothesised that chemokine receptors would present plausible targets for the treatment of viral encephalitis. (gla.ac.uk)
  • After identifying the key chemokines upregulated during viral encephalitis, next a selected panel of chemokine receptor antagonists was utilized to evaluate the hierarchy and relative importance of distinct chemokine receptors for CNS leukocyte influx, viral clearance, neuropathogenesis and host survival. (gla.ac.uk)
  • Conclusion: These data suggest that chemokine receptors represent plausible therapeutic targets for viral encephalitis. (gla.ac.uk)
  • Guedes JR, Lao T, Cardoso AL, El Khoury J. Roles of Microglial and Monocyte Chemokines and Their Receptors in Regulating Alzheimer's Disease-Associated Amyloid-ß and Tau Pathologies. (harvard.edu)
  • Three of these proteins (MCP-3/CCL7, MIG/CXCL9, IP-10/CXCL10) were chemokines, while the other three (DNER, CD40, TNFRSF9) were soluble forms of transmembrane receptors. (eurekalert.org)
  • CXCL9 is closely related to two other CXC chemokines called CXCL10 and CXCL11, whose genes are located near the gene for CXCL9 on human chromosome 4. (prospecbio.com)
  • The CXC-chemokines, growth-related oncogene (GRO)-α/CXCL1 and interleukin (IL)-8/CXCL8, both recruit neutrophils and possess mitogenic properties, whereas the interferon-dependent CXC-chemokines monokine induced by gamma-interferon (MIG)/CXCL9, interferon-γ inducible protein of 10 kD/CXCL10, and IFN-inducible T cell alpha chemoattractant/CXCL11 recruit and activate T cells and NK cells. (diva-portal.org)
  • CXCL11 is more potent than CXCL10, and CXCL10 is more potent than CXCL9. (biolegend.com)
  • Also, CXCL9 (as well as CXCL10 and CXCL11) induces angiostatic effects in human microvacular endothelial cells. (biolegend.com)
  • It is a chemokine receptor that binds CXCL9, CXCL10, and CXCL11. (fluidigm.com)
  • CD183 binds CXCL9, CXCL10, and CXCL11 as ligands. (miltenyibiotec.com)
  • The concentrations of CXCL9 and CXCL11 in BALF were determined using commercial ELISA kits (R&D System, Inc., Minneapolis, MN, USA). (thefreedictionary.com)
  • 10) Thus, NOD1 activation of CXCL9 , CXCL10, and CXCL11 transcription via type I IFN requires nuclear translocation of ISGF3, a complex composed of Stat1, Stat2, and IRF9. (thefreedictionary.com)
  • The C-X-C chemokine receptor (CXCR)3 and its chemokines (CXCL9, CXCL10, CXCL11) are involved in the pathogenesis of autoimmune thyroiditis (AT), Graves' disease (GD) and Graves' Ophthalmopathy (GO). (eurekaselect.com)
  • An increasing body of evidence shows the importance of the chemokine (C-X-C motif) receptor (CXCR)3 and cognate chemokines (C-X-C motif) ligand (CXCL)9, CXCL10 and CXCL11 in the T helper 1 immune response, and in inflammatory diseases such as bowel inflammatory disorders, allograft rejection, thyroid autoimmune disorders, vascular and renal inflammation, and others. (eurekaselect.com)
  • The encoded protein binds to C-X-C motif chemokine 3 and is a chemoattractant for lymphocytes but not for neutrophils. (nih.gov)
  • Binds to atypical chemokine receptor ACKR4 and mediates the recruitment of beta-arrestin (ARRB1/2) to ACKR4. (uniprot.org)
  • MIP-3B specifically binds to chemokine receptor CCR7. (creativebiomart.net)
  • The major role of chemokines is to act as a chemoattractant to guide the migration of cells. (wikipedia.org)
  • To decipher the role of chemokines in TB infection and disease, we measured the levels of chemokines in PTB, LTB and HC individuals. (nature.com)
  • The aim of this study was to investigate the potential role of chemokines as biologic markers of disease activity. (ajtmh.org)
  • We investigated the role of chemokines in regulating T cell accumulation in solid tumors. (bioportfolio.com)
  • Chemokines are essential to stimulate chemotaxis of leukocytes and initiate inflammatory responses ( 1 , 2 ). (frontiersin.org)
  • For example, in addition to chemotaxis, chemokines modulate lymphocyte development, priming and effector function [ 2 ] and play a critical role in immune surveillance. (mdpi.com)
  • In addition to being known for mediating chemotaxis, chemokines are all approximately 8-10 kilodaltons in mass and have four cysteine residues in conserved locations that are key to forming their 3-dimensional shape. (wikipedia.org)
  • In addition, the potential application of chemokines in chemotaxis of exosomes as drug vehicles is discussed. (spandidos-publications.com)
  • Amino-terminal truncation of CXCL9 by CD26 impairs lymphocyte chemotaxis, but the antiangiogenic activity is not affected. (biolegend.com)
  • Chemokines are a class of cytokines that induce chemotaxis (migration) of target cells. (biolegend.com)
  • While some chemotaxis is induced by inflammation or damaged cells, other chemokines function in homeostasis. (biolegend.com)
  • In addition, the upregulated ileal genes of the Lactobacillus -dominant calves were related to leukocyte and lymphocyte chemotaxis, the cytokine/chemokine-mediated signaling pathway, and inflammatory responses, while the upregulated ileal genes of the Bacteroides -dominant calves were related to cell adhesion, response to stimulus, cell communication and regulation of mitogen-activated protein kinase cascades. (asm.org)
  • Results may indicate that genotypes associated to reduced risk in closely linked CXCL9 and CXCL10 genes may modulate local expression of the chemokines themselves, and simultaneously affect myocardial expression of other key chemokines as well as intensity of myocarditis. (cdc.gov)
  • These included established adipocytokines and chemokines implicated in recruitment and activation of lymphocytes, adhesion molecules, antioxidants, and several novel genes with unknown function. (diabetesjournals.org)
  • J:185240 Lefebvre S, Fliniaux I, Schneider P, Mikkola ML, Identification of ectodysplasin target genes reveals the involvement of chemokines in hair development. (jax.org)
  • Through PPI network construction, 108 nodes and 278 gene pairs were obtained, from which chemokine (C-X-C motif) ligand 9 ( CXCL9 ), CXCL10 , protein tyrosine phosphatase, receptor type C ( PTPRC ), and human leukocyte antigen ( HLA ) were screened out as hub genes. (springer.com)
  • This gene, chemokine (C-C motif) ligand 14, is one of several CC cytokine genes clustered on 17q11.2. (creativebiomart.net)
  • Polymorphisms in the genes encoding chemokine receptor 5, interleukin-10, and monocyte chemoattractant protein 1 contribute to cytomegalovirus reactivation and disease after allogeneic stem cell transplantation. (snpedia.com)
  • CXCR4 (also known as fusin) is the receptor for a chemokine known as CXCL12 (or SDF-1) and, as with CCR5, is utilized by HIV-1 to gain entry into target cells. (wikipedia.org)
  • CCC patients with ventricular dysfunction displayed reduced genotypic frequencies of CXCL9 rs10336 CC, CXCL10 rs3921 GG, and increased CCR5 rs1799988CC as compared to those without dysfunction. (cdc.gov)
  • Because the accumulation of Tregs at the tumor site is, in part, due to selective recruitment through CCR5- and CCR5-associated chemokines, we investigated the role of CCR5 in the SCC development. (aacrjournals.org)
  • Chemokines produced in inflammatory tissues and lead to the accumulation of CCR5 + Tregs in tumor microenvironment ( 2, 8 ). (aacrjournals.org)
  • Chemokines are a group of related chemoattractant peptides that are essential regulators of the immune system, both during homeostatic and inflammatory conditions. (mdpi.com)
  • This gene encodes a G protein-coupled receptor with selectivity for three chemokines, termed IP10 (interferon-g-inducible 10 kDa protein), Mig (monokine induced by interferon-g) and I-TAC (interferon-inducible T cell a-chemoattractant). (fishersci.com)
  • CXCL9 is a T-cell chemoattractant, which is induced by IFN-γ during infection, injury or immunoinflammatory responses in macrophages, hepatocytes, and endothelial cells. (miltenyibiotec.com)
  • These inflammatory cells produce high levels of a chemoattractant protein, CXCL9. (cincinnatichildrens.org)
  • On one hand, the chemokine network is used by tumors to evade immune surveillance, resist apoptosis, and metastasize. (mdpi.com)
  • Histologic analysis of regressing tumors identified infiltration of CD4(+) and CD8(+) T cells and the expression of CXCL9 chemokine in tumors. (fda.gov)
  • Cooperation between Constitutive and Inducible Chemokines Enables T Cell Engraftment and Immune Attack in Solid Tumors. (bioportfolio.com)
  • CCL5 and CXCL9 overexpression was associated with CD8 T cell infiltration in solid tumors. (bioportfolio.com)
  • Overexpression of CXCL9 in tumors can lead to T-cell accumulation, vascular damage, and tumor regression. (miltenyibiotec.com)
  • CXCL9 (C-X-C Motif Chemokine Ligand 9) is a Protein Coding gene. (genecards.org)
  • Clone REA365 recognizes the mouse C-X-C motif chemokine ligand 9 (CXCL9) antigen, a small cytokine belonging to the CXC chemokine family that is also known as Monokine induced by interferon γ (MIG). (miltenyibiotec.com)
  • Chemokines (Greek -kinos , movement) are a family of small cytokines , or signaling proteins secreted by cells . (wikipedia.org)
  • Cytokine proteins are classified as chemokines according to behavior and structural characteristics. (wikipedia.org)
  • These include chemokines (CK), such as MIP-1 α (macrophage inflammatory proteins-1 alpha, CCL3) and MIP-1 β (CCL4), RANTES (regulated activation, normal T cell expressed and secreted, CCL5), and ATAC (activation-induced, T cell derived, and chemokine-related cytokine, CXCL1). (hindawi.com)
  • Chemokines are a class of small molecular proteins with similar structures, functions and chemotactic properties, and their molecular weights are ~10 kDa, and chemokines represent the largest member of the cytokine family ( 9 ). (spandidos-publications.com)
  • Chemokines are a family of small cytokines , or proteins secreted by cells . (wikidoc.org)
  • Proteins are classified as chemokines according to shared structural characteristics such as small size (they are all approximately 8-10 kilodaltons in size), and the presence of four cysteine residues in conserved locations that are key to forming their 3-dimensional shape. (wikidoc.org)
  • Proteins are classified into the chemokine family based on their structural characteristics, not just their ability to attract cells. (wikidoc.org)
  • Typical chemokine proteins are produced as pro-peptides , beginning with a signal peptide of approximately 20 amino acids that gets cleaved from the active (mature) portion of the molecule during the process of its secretion from the cell. (wikidoc.org)
  • Chemokines are small cytokines, or signaling proteins, secreted by cells. (wikipathways.org)
  • Cells in placental tissue are specifically programmed not to express chemokines or chemoattactant proteins like CXCL9, serving as a protective barrier for the fetus. (cincinnatichildrens.org)
  • CXCL8 (otherwise known as interleukin-8) and CXCL6 can both bind CXCR1 in humans, while all other ELR-positive chemokines, such as CXCL1 to CXCL7 bind only CXCR2. (wikipedia.org)
  • PTB individuals exhibited significantly higher levels of CCL1, CCL3, CXCL1, CXCL2, CXCL9 and CXCL10 in comparison to LTB and/or HC individuals. (nature.com)
  • In addition, PTB individuals with slower culture conversion displayed significantly elevated levels of CCL1, CCL3, CXCL1 and CXCL9 at the time of PTB diagnosis and prior to ATT. (nature.com)
  • This DuoSet ELISA Development kit contains the basic components required for the development of sandwich ELISAs to measure natural and recombinant mouse CXCL9/MIG. (rndsystems.com)
  • The following antibody was used in this experiment: CXCL9 Recombinant Rabbit Monoclonal Antibody (11H1L14) from Thermo Fisher Scientific, catalog # 701117, RRID AB_2532396. (thermofisher.com)
  • Therapeutic treatment with anti-CXCL9 antibodies was investigated to confirm the hypothesis that CXCL9 can contribute to the intestinal epithelium damage induced by chemotherapy. (sigmaaldrich.com)
  • Neutralizing elevated CXCL9 with anti-CXCR9 antibodies successfully enhanced reconstitution of intestinal mucosa and improved the survival rate of mice that received high-dose chemotherapy. (sigmaaldrich.com)
  • Our cytokine and chemokine antibodies are quality controlled and tested in the application such as western blotting, ELISA, IF, IHC, and ICC. (prosci-inc.com)
  • Some chemokines control cells of the immune system during processes of immune surveillance, such as directing lymphocytes to the lymph nodes so they can screen for invasion of pathogens by interacting with antigen-presenting cells residing in these tissues. (wikipedia.org)
  • Homeostatic chemokines are constitutively expressed in particular organs or tissues. (biolegend.com)
  • The influx of leukocytes into the infected tissues is mediated by chemokines and is believed to be important for virus clearance. (gla.ac.uk)
  • Multiple pathway analysis was carried out to explore the pathway that mediated the effect of CXCL9, and the corresponding downstream effector was identified with enzyme-linked immunosorbent assays. (sigmaaldrich.com)
  • This pathway was inferred from Mus musculus pathway "Chemokine signaling pathway", WP2292 revision 89521, with a 91.0% conversion rate. (wikipathways.org)
  • We selected most pathways CCL14 participated on our site, such as Cytokine-cytokine receptor interaction, Chemokine signaling pathway, which may be useful for your reference. (creativebiomart.net)
  • High CXCL9 expression is associated with invasion in nasopharyngeal carcinoma. (nih.gov)
  • Title: Circular RNA circ_0008450 upregulates CXCL9 expression by targeting miR-577 to regulate cell proliferation and invasion in nasopharyngeal carcinoma. (nih.gov)
  • Results found that high endogenous CXCL9 expression in intrahepatic cholangiocarcinoma was correlated with favorable postoperative survival and high numbers of tumor-infiltrating natural killer cells. (nih.gov)
  • Materials and methods The expression of CXC-chemokines was studied in eight controls and in 11 patients suffering from ulcerative colitis in the distal part of the colon, before and during topical treatment with corticosteroids. (diva-portal.org)
  • The rectal release of GRO-α and MIG was determined by enzyme-linked immunosorbent assay (ELISA), and tissue expression of the chemokines was detected in colonic tissue by immunohistochemistry. (diva-portal.org)
  • Myocardial chemokine expression and intensity of myocarditis in Chagas cardiomyopathy are controlled by polymorphisms in CXCL9 and CXCL10. (cdc.gov)
  • Establishment of the TB granuloma is controlled by the synchronized expression of various chemokines. (nature.com)
  • Here, we report that the entry of diabetogenic CD4 T cells very rapidly triggered inflammatory gene expression changes in islets and vessels by up-regulating chemokines and adhesion molecules. (pnas.org)
  • In contrast to the entry of diabetogenic CD4 T cells, the entrance of nonspecific T cells required a chemokine response and VCAM-1 expression by the islets. (pnas.org)
  • Flexible programs of chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes. (ebi.ac.uk)
  • Differential expression of three T lymphocyte-activating CXC chemokines by human atheroma-associated cells. (ebi.ac.uk)
  • The renal chemokines expression and macrophages infiltration were also attenuated by MMF treatment. (hindawi.com)
  • Differential expression of chemokines in patients with localized and diffuse cutaneous American leishmaniasis. (ajtmh.org)
  • The chemokines, by virtue of their specific cell receptor expression, can selectively mediate the local recruitment/activation of distinct leukocytes/cells, allowing for migration across the endothelium and beyond the vascular compartment. (ahajournals.org)
  • We found that PRC2 components and demethylase JMJD3-mediated histone H3 lysine 27 trimethylation (H3K27me3) repress the expression and subsequent production of Th1-type chemokines CXCL9 and CXCL10, mediators of effector T-cell trafficking. (aacrjournals.org)
  • Moreover, the expression levels of PRC2 components, including EZH2, SUZ12, and EED, were inversely associated with those of CD4, CD8, and Th1-type chemokines in human colon cancer tissue, and this expression pattern was significantly associated with patient survival. (aacrjournals.org)
  • We report that glia within the rat nucleus accumbens (NAcc) respond to morphine with an increase in cytokine/chemokine expression, which predicts future reinstatement of morphine conditioned place preference (CPP) following a priming dose of morphine. (jneurosci.org)
  • Results: To test these hypotheses, the chemokine expression pattern and the kinetics of chemokine mediated leukocyte recruitment during viral encephalitis were analysed in unprecedented detail by TaqMan low density array, and flow cytometry, respectively, and key chemokine receptor were identified as therapeutic targets. (gla.ac.uk)
  • Both SFV and WNV exhibited a similar pattern of chemokine upregulation, although WNV induced significantly higher fold expression. (gla.ac.uk)
  • Recent discoveries in the many biological roles of chemokines in tumor immunology allow their exploitation in enhancing recruitment of antigen presenting cells (APCs) and effector cells to appropriate anatomical sites. (mdpi.com)
  • In pregnancy, chemokines are potent mediators of embryogenesis and neoangiogenesis and important for the recruitment of macrophages and NK, dendritic, and T cells to maternal decidua ( 1 , 2 ). (frontiersin.org)
  • CXCL9 is an inflammatory chemokine initially identified by differential screening of a cDNA library from lymphokine-activated macrophages. (biolegend.com)
  • CXCL9, also known as MIG, is a chemokine that is induced in macrophages and in CNS glial cells in response to IFN-gamma. (rndsystems.com)
  • RT-PCR assays for ABCD-1 and Mig (CXCL9) were performed on total RNA isolated from Bm1.11 cells infected with C. muridarum for 18 h and activated peritoneal macrophages (Activated MACS) as a positive control. (asm.org)
  • This knowledge, combined with advances in gene therapy and virology, allows researchers to employ chemokines as potential vaccine adjuvants. (mdpi.com)
  • The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. (wikipedia.org)
  • An important paralog of this gene is CXCL9 . (genecards.org)
  • This gene has been localized to 4q21 with INP10, which is also a member of the chemokine family of cytokines. (abnova.com)
  • Read-through transcripts are also expressed that include exons from the upstream cytokine gene, chemokine (C-C motif) ligand 15, and are represented as GeneID: 348249. (creativebiomart.net)
  • Upon sensing the inflammatory chemokine, cells will extravasate from the blood vessel and follow the gradient to its source. (biolegend.com)
  • Further studies of serum chemokines and placenta tissue could provide a better understanding of the cells involved in the pathogenesis of maternal erythrocyte alloimmunization. (frontiersin.org)
  • The chemokine receptor CXCR5 is expressed on B cells and CD4+ Tfh cells and is involved in lymphocyte homing and the development of normal lymphoid tissue. (wikipedia.org)
  • Some chemokines are considered pro- inflammatory and can be induced during an immune response to recruit cells of the immune system to a site of infection , while others are considered homeostatic and are involved in controlling the migration of cells during normal processes of tissue maintenance or development . (wikipedia.org)
  • Inflammatory chemokines function mainly as chemoattractants for leukocytes , recruiting monocytes , neutrophils and other effector cells from the blood to sites of infection or tissue damage. (wikipedia.org)
  • In the event of infection, injury, or tissue damage, inflammatory chemokines are often released to address the problem. (biolegend.com)
  • Immunohistochemical staining of paraffin-embedded human lung cancer tissue section with CXCL9 polyclonal antibody (Cat # PAB19516). (abnova.com)
  • There were significantly greater concentrations of the chemokines CCL3 and CCL11 in plasma of LE patients than in NI individuals. (ajtmh.org)
  • This is why we offer customized antibody production that can be tailored to detect a specific cytokine protein or chemokines protein that is necessary for the success of your research. (prosci-inc.com)
  • Rabbit polyclonal antibody raised against synthetic peptide of CXCL9. (abnova.com)
  • Western blot analysis of recombinate human CXCL9 protein with CXCL9 polyclonal antibody (Cat # PAB19516). (abnova.com)
  • CD183 harbors seven-transmembrane α-helices, an extracellular N-terminal domain containing three loops involved in the chemokine ligand binding, an intracellular C-terminal domain involved in signal transduction. (miltenyibiotec.com)
  • IP10, Mig and I-TAC belong to the structural subfamily of CXC chemokines, in which a single amino acid residue separates the first two of four highly conserved Cys residues. (fishersci.com)
  • In order to make a powerful secondary infection response, cytokine and chemokine signaling between XCR1+ DCs and NK cells must occur. (wikipedia.org)
  • Cytokine and chemokine values from the 4 experiments were averaged for analysis. (cdc.gov)
  • Over the last few decades, chemokines are found to be involved in almost every aspect of tumorigenesis and antitumor immunity [ 1 ]. (mdpi.com)
  • Many inflammatory chemokines attract a wide variety of cells in both the innate and adaptive arms of immunity. (biolegend.com)
  • Chemokines: a new classification system and their role in immunity. (ebi.ac.uk)
  • These are known as homeostatic chemokines and are produced and secreted without any need to stimulate their source cell(s). (wikipedia.org)
  • Due to their function of targeting cells to specific organs, homeostatic chemokines can also be involved in cancer and metastasis. (biolegend.com)
  • MIG (CXCL9) BovineRecombinant produced in E.Coli is a non-glycosylated polypeptide chain containing 104 amino acids and having a molecular mass of approximately 18.0kDa. (prospecbio.com)
  • Human CXCL9, amino acids Thr23 - Thr125 (Accession # NM_002416.1) was expressed in E. coli . (biolegend.com)
  • They all also possess conserved amino acids that are important for creating their 3-dimensional or tertiary structure , such as (in most cases) four cysteines that interact with each other in pairs to create a Greek key shape that is a characteristic of chemokines. (wikidoc.org)
  • A synthetic peptide corresponding to amino acids at N-terminus of human CXCL9. (abnova.com)
  • Soluble FAF was found to bind and inactivate the antibacterial activity of MIG/CXCL9, thereby further potentially promoting the survival of F. magna. (diva-portal.org)
  • Use this table to quickly identify the chemokines that bind to each receptor. (biolegend.com)
  • Chemokines are a large family of peptides that play key roles in the regulation of inflammation. (diva-portal.org)
  • Notably, endotoxemia induces adipose inflammation ( 27 ) with activation of several adipose inflammatory cascades, including cytokines, chemokines, and suppressor of cytokine signaling (SOCS) molecules ( 26 ) that attenuate insulin signaling and are implicated in obesity and type 2 diabetes ( 28 ). (diabetesjournals.org)
  • The Multifaceted Roles of CXCL9 Within the Tumor Microenvironment. (nih.gov)
  • While a function of chemokines is to regulate lymphocyte trafficking, the view that chemokines act simply as "chemotactic cytokines" has evolved to include the many critical roles they play in regulating innate and adaptive immune responses. (mdpi.com)
  • In the context of cancer, the chemokine-chemokine receptor system plays paradoxical roles. (mdpi.com)
  • In the present review, the literature on the multifactorial roles of exosomes in HCC from PubMed, Cochrane library and Embase were obtained, with a specific focus on the functions and mechanisms of chemokines in HCC. (spandidos-publications.com)
  • It has been found that chemokine networks may serve pivotal roles in inducing organ-specific metastasis ( 8 ). (spandidos-publications.com)
  • Clone REA232 recognizes CD183, a 38 kDa G protein-coupled chemokine receptor. (miltenyibiotec.com)
  • A similar trend was observed for Th1-associated mediators (IL-12p40, INF-[gamma], INF-[gamma]-inducible CXCL9 , and CXCL10), which are strong chemoattractants for CD4+/CD8+ T-effector cells (Figure 5, panel B). (thefreedictionary.com)
  • CXCL9 induces T cells proliferation and cytokine production in an experimental model of cardiac allograft vasculopathy. (biolegend.com)
  • Vanadium pentoxide induces the secretion of CXCL9 and CXCL10 chemokines in thyroid cells. (nih.gov)
  • Binding of chemokines to this protein induces cellular responses that are involved in leukocyte traffic, most notably integrin activation, cytoskeletal changes and chemotactic migration. (fishersci.com)
  • Using human ovarian cancers as our model, here we show that enhancer of zeste homologue 2 (EZH2)-mediated histone H3 lysine 27 trimethylation (H3K27me3) and DNA methyltransferase 1 (DNMT1)-mediated DNA methylation repress the tumour production of T helper 1 (TH1)-type chemokines CXCL9 and CXCL10, and subsequently determine effector T-cell trafficking to the tumour microenvironment. (nih.gov)
  • CXCL9 plays a key role in leukocyte trafficking, acting on activated CD4+ Th1 cells, CD8+ T cells, IL-2 activated T lymphocytes, and NK cells. (biolegend.com)
  • Endogenous CXCL9 affects prognosis by regulating tumor-infiltrating natural killer cells in intrahepatic cholangiocarcinoma. (nih.gov)
  • CXCL9 inhibited the proliferation of MCF10A cells by activating phosphorylation of p70 ribosomal S6 kinase (p70S6K), which further promotes the secretion of transforming growth factor beta (TGF-β) as the downstream effector. (sigmaaldrich.com)
  • A blockade of phospho-p70S6K with inhibitor abolished the effect of CXCL9 on MCF10A cells and reduced the secretion of TGF-β. (sigmaaldrich.com)
  • CXCL9 inhibits the proliferation of epithelial cells via phosphorylation of p70S6K, resulting in the excretion of TGF-β as downstream mediator. (sigmaaldrich.com)
  • On the other hand, the chemokine system also plays a crucial role in the induction of antitumor immune responses and optimal effector function regulation of immune cells [ 1 , 4 , 5 ]. (mdpi.com)
  • NK cells release XCL1 along with IFN-γ and some other chemokines upon encountering certain bacteria such as Listeria or MCMV. (wikipedia.org)
  • Chemokines released by infected or damaged cells form a concentration gradient. (wikipedia.org)
  • Attracted cells move through the gradient towards the higher concentration of chemokine. (wikipedia.org)
  • Cells that are attracted by chemokines follow a signal of increasing chemokine concentration towards the source of the chemokine. (wikipedia.org)
  • Other chemokines are inflammatory and are released from a wide variety of cells in response to bacterial infection, viruses and agents that cause physical damage such as silica or the urate crystals that occur in gout . (wikipedia.org)
  • Certain inflammatory chemokines activate cells to initiate an immune response or promote wound healing . (wikipedia.org)
  • Chemokines are felt to play a major role latent TB infection (LTB) as they appear to be critical in the formation and maintenance of quiescent granulomas 4 and in the recruitment of cells from the periphery for positioning within the granuloma 5 . (nature.com)
  • Attracted cells move toward areas of higher concentrations of the chemokine. (biolegend.com)
  • A major rol of chemokines is to act as chemoattractants in guiding migration of cells. (wikipathways.org)
  • A complex chemokine-chemokine receptor interaction is involved with immune cell migration to tumor microenvironment ( 7 ). (aacrjournals.org)
  • Chemokines are involved in the inflammatory response, tumor immune response, proliferation, invasion and metastasis via modulation of various signaling pathways. (spandidos-publications.com)
  • Taken together our results may suggest that CXCL9 and CXCL10 are master regulators of myocardial inflammatory cell migration, perhaps affecting clinical progression to the life-threatening form of CCC. (cdc.gov)
  • At equimolar concentrations, SufA-generated MIG/CXCL9 fragments were not bactericidal against F. magna, but retained their ability to kill S. pyogenes. (diva-portal.org)
  • Here, we show that MIG/CXCL9 is produced by human keratinocytes in response to inflammatory stimuli. (diva-portal.org)
  • You need info about Human chemokine (C-X-C motif) ligand 9 (CXCL9) ELISA kit or any other Gentaur produtct? (gentaurshop.com)
  • This review will focus on recent murine and human studies that use chemokines as therapeutic anti-cancer vaccine adjuvants. (mdpi.com)
  • Baf3-mCXCR3 transfectants chemoattracted by human CXCL9. (biolegend.com)
  • The LEGENDplex™ Human Proinflammatory Chemokine Standard product is intended for use with the Mix and Match Human Proinflammatory Chemokine Panel of products. (biolegend.com)
  • This active T-cell recruitment by TDB-induced chemokine signaling was the dominant mechanism and necessary for the therapeutic activity of anti-HER2/CD3 TDB. (aacrjournals.org)
  • An active T-cell recruitment mediated by TDB-induced chemokine signaling was the major mechanism for T-cell recruitment. (aacrjournals.org)
  • Discovery of a mechanism for active T-cell recruitment via anti-HER2/CD3 TDB-induced chemokine signaling may aid in designing strategies to further augment T-cell recruitment. (aacrjournals.org)
  • Your search returned 319 chemokine (C-C motif) ligand 9 ELISA ELISA Kit across 24 suppliers. (biocompare.com)
  • In the present study, an enzyme-linked immunosorbent assay (ELISA) method was used to investigate the plasma content of several biomarkers of the immune response, namely Neopterin, sCD163, suPAR, Pentraxin 3 (PTX3), sCD14, Fractalkine (CX3CL1), sTREM-1 and MIG (CXCL9), in patients with distinct clinical manifestations of malaria. (biomedcentral.com)
  • The upregulation of chemokines coincided with leukocyte influx into the CNS. (gla.ac.uk)
  • 0.001), CXCL8 ( P = 0.027), CXCL9 ( P = 0.007), and CXCL10 ( P = 0.002) were significantly higher in patients who developed postoperative PVR after primary RRD than in patients with uncomplicated retinal detachment. (arvojournals.org)
  • Finally, the chemokines were significantly reduced following successful ATT. (nature.com)
  • A series of investigations on ovarian neoplasms have improved our understanding of proinflammatory microenvironment including unfavorable cytokines, chemokines and imbalanced hormone production. (mdpi.com)