A CXC chemokine that is chemotactic for T-LYMPHOCYTES and MONOCYTES. It has specificity for CXCR4 RECEPTORS. Two isoforms of CXCL12 are produced by alternative mRNA splicing.
A CXC chemokine that is chemotactic for B-LYMPHOCYTES. It has specificity for CXCR5 RECEPTORS.
A CXC chemokine that is induced by GAMMA-INTERFERON and is chemotactic for MONOCYTES and T-LYMPHOCYTES. It has specificity for the CXCR3 RECEPTOR.
A CXC chemokine that has stimulatory and chemotactic activities towards NEUTROPHILS. It has specificity for CXCR1 RECEPTORS and CXCR2 RECEPTORS.
A CXC chemokine that is induced by GAMMA-INTERFERON. It is a chemotactic factor for activated T-LYMPHOCYTES and has specificity for the CXCR3 RECEPTOR.
A CXC chemokine with specificity for CXCR2 RECEPTORS. It has growth factor activities and is implicated as a oncogenic factor in several tumor types.
An INTEFERON-inducible CXC chemokine that is specific for the CXCR3 RECEPTOR.
Group of chemokines with paired cysteines separated by a different amino acid. CXC chemokines are chemoattractants for neutrophils but not monocytes.
Cell surface glycoproteins that bind to chemokines and thus mediate the migration of pro-inflammatory molecules. The receptors are members of the seven-transmembrane G protein-coupled receptor family. Like the CHEMOKINES themselves, the receptors can be divided into at least three structural branches: CR, CCR, and CXCR, according to variations in a shared cysteine motif.
Chemokine receptors that are specific for CXC CHEMOKINES.
A CXC chemokine that is predominantly expressed in EPITHELIAL CELLS. It has specificity for the CXCR2 RECEPTORS and is involved in the recruitment and activation of NEUTROPHILS.
CXCR receptors with specificity for CXCL12 CHEMOKINE. The receptors may play a role in HEMATOPOIESIS regulation and can also function as coreceptors for the HUMAN IMMUNODEFICIENCY VIRUS.
CXCR receptors that are expressed on the surface of a number of cell types, including T-LYMPHOCYTES; NK CELLS; DENDRITIC CELLS; and a subset of B-LYMPHOCYTES. The receptors are activated by CHEMOKINE CXCL9; CHEMOKINE CXCL10; and CHEMOKINE CXCL11.
Class of pro-inflammatory cytokines that have the ability to attract and activate leukocytes. They can be divided into at least three structural branches: C; (CHEMOKINES, C); CC; (CHEMOKINES, CC); and CXC; (CHEMOKINES, CXC); according to variations in a shared cysteine motif.
A CC-type chemokine that is a chemoattractant for EOSINOPHILS; MONOCYTES; and LYMPHOCYTES. It is a potent and selective eosinophil chemotaxin that is stored in and released from PLATELETS and activated T-LYMPHOCYTES. Chemokine CCL5 is specific for CCR1 RECEPTORS; CCR3 RECEPTORS; and CCR5 RECEPTORS. The acronym RANTES refers to Regulated on Activation, Normal T Expressed and Secreted.
CXCR receptors isolated initially from BURKITT LYMPHOMA cells. CXCR5 receptors are expressed on mature, recirculating B-LYMPHOCYTES and are specific for CHEMOKINE CXCL13.
High-affinity G-protein-coupled receptors for INTERLEUKIN-8 present on NEUTROPHILS; MONOCYTES; and T-LYMPHOCYTES. These receptors also bind several other CXC CHEMOKINES.
A chemokine that is a chemoattractant for MONOCYTES and may also cause cellular activation of specific functions related to host defense. It is produced by LEUKOCYTES of both monocyte and lymphocyte lineage and by FIBROBLASTS during tissue injury. It has specificity for CCR2 RECEPTORS.
A CXC chemokine that is synthesized by activated MONOCYTES and NEUTROPHILS. It has specificity for CXCR2 RECEPTORS.
A CC-type chemokine with specificity for CCR7 RECEPTORS. It has activity towards DENDRITIC CELLS and T-LYMPHOCYTES.
The movement of leukocytes in response to a chemical concentration gradient or to products formed in an immunologic reaction.
A CC chemokine with specificity for CCR5 RECEPTORS. It is a chemoattractant for NK CELLS; MONOCYTES and a variety of other immune cells. This chemokine is encoded by multiple genes.
The movement of cells from one location to another. Distinguish from CYTOKINESIS which is the process of dividing the CYTOPLASM of a cell.
A CC-type chemokine with specificity for CCR4 RECEPTORS. It has activity towards TH2 CELLS and TC2 CELLS.
A CC chemokine with specificity for CCR1 RECEPTORS and CCR5 RECEPTORS. It is a chemoattractant for NK CELLS; MONOCYTES; and a variety of other immune cells. This chemokine is encoded by multiple genes.
A CC-type chemokine that is found at high levels in the THYMUS and has specificity for CCR4 RECEPTORS. It is synthesized by DENDRITIC CELLS; ENDOTHELIAL CELLS; KERATINOCYTES; and FIBROBLASTS.
A large group of structurally diverse cell surface receptors that mediate endocytic uptake of modified LIPOPROTEINS. Scavenger receptors are expressed by MYELOID CELLS and some ENDOTHELIAL CELLS, and were originally characterized based on their ability to bind acetylated LOW-DENSITY LIPOPROTEINS. They can also bind a variety of other polyanionic ligand. Certain scavenger receptors can internalize micro-organisms as well as apoptotic cells.
A CC-type chemokine with specificity for CCR7 RECEPTORS. It has activity towards T LYMPHOCYTES and B LYMPHOCYTES.
A CX3C chemokine that is a transmembrane protein found on the surface of cells. The soluble form of chemokine CX3CL1 can be released from cell surface by proteolysis and act as a chemoattractant that may be involved in the extravasation of leukocytes into inflamed tissues. The membrane form of the protein may also play a role in cell adhesion.
Group of chemokines with adjacent cysteines that are chemoattractants for lymphocytes, monocytes, eosinophils, basophils but not neutrophils.
A member of the CXC chemokine family that plays a role in the regulation of the acute inflammatory response. It is secreted by variety of cell types and induces CHEMOTAXIS of NEUTROPHILS and other inflammatory cells.
Ring compounds having atoms other than carbon in their nuclei. (Grant & Hackh's Chemical Dictionary, 5th ed)
The movement of cells or organisms toward or away from a substance in response to its concentration gradient.
A CXC chemokine that is found in the alpha granules of PLATELETS. The protein has a molecular size of 7800 kDa and can occur as a monomer, a dimer or a tetramer depending upon its concentration in solution. Platelet factor 4 has a high affinity for HEPARIN and is often found complexed with GLYCOPROTEINS such as PROTEIN C.
A monocyte chemoattractant protein that has activity towards a broad variety of immune cell types. Chemokine CCL7 has specificity for CCR1 RECEPTORS; CCR2 RECEPTORS; and CCR5 RECEPTORS.
A CC-type chemokine with specificity for CCR6 RECEPTORS. It has activity towards DENDRITIC CELLS; T-LYMPHOCYTES; and B-LYMPHOCYTES.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
A CC-type chemokine that is specific for CCR3 RECEPTORS. It is a potent chemoattractant for EOSINOPHILS.
A CC-type chemokine secreted by activated MONOCYTES and T-LYMPHOCYTES. It has specificity for CCR8 RECEPTORS.
The diffusion or accumulation of neutrophils in tissues or cells in response to a wide variety of substances released at the sites of inflammatory reactions.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
A CC-type chemokine with specificity for CCR10 RECEPTORS. It is constitutively expressed in the skin and may play a role in T-CELL trafficking during cutaneous INFLAMMATION.
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Technique using an instrument system for making, processing, and displaying one or more measurements on individual cells obtained from a cell suspension. Cells are usually stained with one or more fluorescent dyes specific to cell components of interest, e.g., DNA, and fluorescence of each cell is measured as it rapidly transverses the excitation beam (laser or mercury arc lamp). Fluorescence provides a quantitative measure of various biochemical and biophysical properties of the cell, as well as a basis for cell sorting. Other measurable optical parameters include light absorption and light scattering, the latter being applicable to the measurement of cell size, shape, density, granularity, and stain uptake.
CCR receptors with specificity for CHEMOKINE CCL2 and several other CCL2-related chemokines. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; MACROPHAGES; BASOPHILS; and NK CELLS.
CCR receptors with specificity for a broad variety of CC CHEMOKINES. They are expressed at high levels in MONOCYTES; tissue MACROPHAGES; NEUTROPHILS; and EOSINOPHILS.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
CCR receptors with specificity for CHEMOKINE CCL3; CHEMOKINE CCL4; and CHEMOKINE CCL5. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; MACROPHAGES; MAST CELLS; and NK CELLS. The CCR5 receptor is used by the HUMAN IMMUNODEFICIENCY VIRUS to infect cells.
A monocyte chemoattractant protein that attracts MONOCYTES; LYMPHOCYTES; BASOPHILS; and EOSINOPHILS. Chemokine CCL8 has specificity for CCR3 RECEPTORS and CCR5 RECEPTORS.
Non-antibody proteins secreted by inflammatory leukocytes and some non-leukocytic cells, that act as intercellular mediators. They differ from classical hormones in that they are produced by a number of tissue or cell types rather than by specialized glands. They generally act locally in a paracrine or autocrine rather than endocrine manner.
A pathological process characterized by injury or destruction of tissues caused by a variety of cytologic and chemical reactions. It is usually manifested by typical signs of pain, heat, redness, swelling, and loss of function.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
Heparin-binding proteins that exhibit a number of inflammatory and immunoregulatory activities. Originally identified as secretory products of MACROPHAGES, these chemokines are produced by a variety of cell types including NEUTROPHILS; FIBROBLASTS; and EPITHELIAL CELLS. They likely play a significant role in respiratory tract defenses.
A cell line derived from cultured tumor cells.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
An immunoassay utilizing an antibody labeled with an enzyme marker such as horseradish peroxidase. While either the enzyme or the antibody is bound to an immunosorbent substrate, they both retain their biologic activity; the change in enzyme activity as a result of the enzyme-antibody-antigen reaction is proportional to the concentration of the antigen and can be measured spectrophotometrically or with the naked eye. Many variations of the method have been developed.
CCR receptors with specificity for CHEMOKINE CCL17 and CHEMOKINE CCL22. They are expressed at high levels in T-LYMPHOCYTES; MAST CELLS; DENDRITIC CELLS; and NK CELLS.
High-affinity G-protein-coupled receptors for INTERLEUKIN-8 present on NEUTROPHILS; MONOCYTES; and BASOPHILS.
Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.
CCR receptors with specificity for CHEMOKINE CCL11 and a variety of other CC CHEMOKINES. They are expressed at high levels in T-LYMPHOCYTES; EOSINOPHILS; BASOPHILS; and MAST CELLS.
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
Adherence of cells to surfaces or to other cells.
The relatively long-lived phagocytic cell of mammalian tissues that are derived from blood MONOCYTES. Main types are PERITONEAL MACROPHAGES; ALVEOLAR MACROPHAGES; HISTIOCYTES; KUPFFER CELLS of the liver; and OSTEOCLASTS. They may further differentiate within chronic inflammatory lesions to EPITHELIOID CELLS or may fuse to form FOREIGN BODY GIANT CELLS or LANGHANS GIANT CELLS. (from The Dictionary of Cell Biology, Lackie and Dow, 3rd ed.)
Highly specialized EPITHELIAL CELLS that line the HEART; BLOOD VESSELS; and lymph vessels, forming the ENDOTHELIUM. They are polygonal in shape and joined together by TIGHT JUNCTIONS. The tight junctions allow for variable permeability to specific macromolecules that are transported across the endothelial layer.
CCR receptors with specificity for CHEMOKINE CCL19 and CHEMOKINE CCL21. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; and DENDRITIC CELLS.
Established cell cultures that have the potential to propagate indefinitely.
Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.
CCR receptors with specificity for CHEMOKINE CCL27. They may play a specialized role in the cutaneous homing of LYMPHOCYTES.
Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.
CCR receptors with specificity for CHEMOKINE CCL1. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; and MACROPHAGES.
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
The major interferon produced by mitogenically or antigenically stimulated LYMPHOCYTES. It is structurally different from TYPE I INTERFERON and its major activity is immunoregulation. It has been implicated in the expression of CLASS II HISTOCOMPATIBILITY ANTIGENS in cells that do not normally produce them, leading to AUTOIMMUNE DISEASES.
A CC-type chemokine with specificity for CCR3 RECEPTORS. It is a chemoattractant for EOSINOPHILS.
A critical subpopulation of T-lymphocytes involved in the induction of most immunological functions. The HIV virus has selective tropism for the T4 cell which expresses the CD4 phenotypic marker, a receptor for HIV. In fact, the key element in the profound immunosuppression seen in HIV infection is the depletion of this subset of T-lymphocytes.
Cell surface proteins that bind cytokines and trigger intracellular changes influencing the behavior of cells.
Chemokines that are chemoattractants for monocytes. These CC chemokines (cysteines adjacent) number at least three including CHEMOKINE CCL2.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Chemokine receptors that are specific for CC CHEMOKINES.
Cells contained in the bone marrow including fat cells (see ADIPOCYTES); STROMAL CELLS; MEGAKARYOCYTES; and the immediate precursors of most blood cells.
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
Group of chemokines with the first two cysteines separated by three amino acids. CX3C chemokines are chemotactic for natural killer cells, monocytes, and activated T-cells.
Chemical substances that attract or repel cells. The concept denotes especially those factors released as a result of tissue injury, microbial invasion, or immunologic activity, that attract LEUKOCYTES; MACROPHAGES; or other cells to the site of infection or insult.
CCR receptors with specificity for CHEMOKINE CCL20. They are expressed at high levels in T-LYMPHOCYTES; B-LYMPHOCYTES; and DENDRITIC CELLS.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Elements of limited time intervals, contributing to particular results or situations.
Soluble mediators of the immune response that are neither antibodies nor complement. They are produced largely, but not exclusively, by monocytes and macrophages.
Large, phagocytic mononuclear leukocytes produced in the vertebrate BONE MARROW and released into the BLOOD; contain a large, oval or somewhat indented nucleus surrounded by voluminous cytoplasm and numerous organelles.
Granular leukocytes having a nucleus with three to five lobes connected by slender threads of chromatin, and cytoplasm containing fine inconspicuous granules and stainable by neutral dyes.
A molecule that binds to another molecule, used especially to refer to a small molecule that binds specifically to a larger molecule, e.g., an antigen binding to an antibody, a hormone or neurotransmitter binding to a receptor, or a substrate or allosteric effector binding to an enzyme. Ligands are also molecules that donate or accept a pair of electrons to form a coordinate covalent bond with the central metal atom of a coordination complex. (From Dorland, 27th ed)
Cellular receptors that bind the human immunodeficiency virus that causes AIDS. Included are CD4 ANTIGENS, found on T4 lymphocytes, and monocytes/macrophages, which bind to the HIV ENVELOPE PROTEIN GP120.
A blood group consisting mainly of the antigens Fy(a) and Fy(b), determined by allelic genes, the frequency of which varies profoundly in different human groups; amorphic genes are common.
Specialized cells of the hematopoietic system that have branch-like extensions. They are found throughout the lymphatic system, and in non-lymphoid tissues such as SKIN and the epithelia of the intestinal, respiratory, and reproductive tracts. They trap and process ANTIGENS, and present them to T-CELLS, thereby stimulating CELL-MEDIATED IMMUNITY. They are different from the non-hematopoietic FOLLICULAR DENDRITIC CELLS, which have a similar morphology and immune system function, but with respect to humoral immunity (ANTIBODY PRODUCTION).
Phenomenon of cell-mediated immunity measured by in vitro inhibition of the migration or phagocytosis of antigen-stimulated LEUKOCYTES or MACROPHAGES. Specific CELL MIGRATION ASSAYS have been developed to estimate levels of migration inhibitory factors, immune reactivity against tumor-associated antigens, and immunosuppressive effects of infectious microorganisms.
Regulatory proteins and peptides that are signaling molecules involved in the process of PARACRINE COMMUNICATION. They are generally considered factors that are expressed by one cell and are responded to by receptors on another nearby cell. They are distinguished from HORMONES in that their actions are local rather than distal.
The endogenous compounds that mediate inflammation (AUTACOIDS) and related exogenous compounds including the synthetic prostaglandins (PROSTAGLANDINS, SYNTHETIC).
Serum glycoprotein produced by activated MACROPHAGES and other mammalian MONONUCLEAR LEUKOCYTES. It has necrotizing activity against tumor cell lines and increases ability to reject tumor transplants. Also known as TNF-alpha, it is only 30% homologous to TNF-beta (LYMPHOTOXIN), but they share TNF RECEPTORS.
Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.
Either of the pair of organs occupying the cavity of the thorax that effect the aeration of the blood.
Cytotaxins liberated from normal or invading cells that specifically attract eosinophils; they may be complement fragments, lymphokines, neutrophil products, histamine or other; the best known is the tetrapeptide ECF-A, released mainly by mast cells.
White blood cells. These include granular leukocytes (BASOPHILS; EOSINOPHILS; and NEUTROPHILS) as well as non-granular leukocytes (LYMPHOCYTES and MONOCYTES).
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.
Connective tissue cells of an organ found in the loose connective tissue. These are most often associated with the uterine mucosa and the ovary as well as the hematopoietic system and elsewhere.
A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Lipid-containing polysaccharides which are endotoxins and important group-specific antigens. They are often derived from the cell wall of gram-negative bacteria and induce immunoglobulin secretion. The lipopolysaccharide molecule consists of three parts: LIPID A, core polysaccharide, and O-specific chains (O ANTIGENS). When derived from Escherichia coli, lipopolysaccharides serve as polyclonal B-cell mitogens commonly used in laboratory immunology. (From Dorland, 28th ed)
Subset of helper-inducer T-lymphocytes which synthesize and secrete the interleukins IL-4, IL-5, IL-6, and IL-10. These cytokines influence B-cell development and antibody production as well as augmenting humoral responses.
Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Proteins prepared by recombinant DNA technology.
They are oval or bean shaped bodies (1 - 30 mm in diameter) located along the lymphatic system.
Mature LYMPHOCYTES and MONOCYTES transported by the blood to the body's extravascular space. They are morphologically distinguishable from mature granulocytic leukocytes by their large, non-lobed nuclei and lack of coarse, heavily stained cytoplasmic granules.
Subset of helper-inducer T-lymphocytes which synthesize and secrete interleukin-2, gamma-interferon, and interleukin-12. Due to their ability to kill antigen-presenting cells and their lymphokine-mediated effector activity, Th1 cells are associated with vigorous delayed-type hypersensitivity reactions.
Proteins that specifically inhibit the growth of new blood vessels (ANGIOGENESIS, PHYSIOLOGIC).
Morphologic alteration of small B LYMPHOCYTES or T LYMPHOCYTES in culture into large blast-like cells able to synthesize DNA and RNA and to divide mitotically. It is induced by INTERLEUKINS; MITOGENS such as PHYTOHEMAGGLUTININS, and by specific ANTIGENS. It may also occur in vivo as in GRAFT REJECTION.
Granular leukocytes with a nucleus that usually has two lobes connected by a slender thread of chromatin, and cytoplasm containing coarse, round granules that are uniform in size and stainable by eosin.
The capacity of a normal organism to remain unaffected by microorganisms and their toxins. It results from the presence of naturally occurring ANTI-INFECTIVE AGENTS, constitutional factors such as BODY TEMPERATURE and immediate acting immune cells such as NATURAL KILLER CELLS.
Specialized tissues that are components of the lymphatic system. They provide fixed locations within the body where a variety of LYMPHOCYTES can form, mature and multiply. The lymphoid tissues are connected by a network of LYMPHATIC VESSELS.
A classification of T-lymphocytes, especially into helper/inducer, suppressor/effector, and cytotoxic subsets, based on structurally or functionally different populations of cells.
A critical subpopulation of regulatory T-lymphocytes involved in MHC Class I-restricted interactions. They include both cytotoxic T-lymphocytes (T-LYMPHOCYTES, CYTOTOXIC) and CD8+ suppressor T-lymphocytes.
A technique of culturing mixed cell types in vitro to allow their synergistic or antagonistic interactions, such as on CELL DIFFERENTIATION or APOPTOSIS. Coculture can be of different types of cells, tissues, or organs from normal or disease states.
The passage of cells across the layer of ENDOTHELIAL CELLS, i.e., the ENDOTHELIUM; or across the layer of EPITHELIAL CELLS, i.e. the EPITHELIUM.

Expression of specific chemokines and chemokine receptors in the central nervous system of multiple sclerosis patients. (1/1046)

Chemokines direct tissue invasion by specific leukocyte populations. Thus, chemokines may play a role in multiple sclerosis (MS), an idiopathic disorder in which the central nervous system (CNS) inflammatory reaction is largely restricted to mononuclear phagocytes and T cells. We asked whether specific chemokines were expressed in the CNS during acute demyelinating events by analyzing cerebrospinal fluid (CSF), whose composition reflects the CNS extracellular space. During MS attacks, we found elevated CSF levels of three chemokines that act toward T cells and mononuclear phagocytes: interferon-gamma-inducible protein of 10 kDa (IP-10); monokine induced by interferon-gamma (Mig); and regulated on activation, normal T-cell expressed and secreted (RANTES). We then investigated whether specific chemokine receptors were expressed by infiltrating cells in demyelinating MS brain lesions and in CSF. CXCR3, an IP-10/Mig receptor, was expressed on lymphocytic cells in virtually every perivascular inflammatory infiltrate in active MS lesions. CCR5, a RANTES receptor, was detected on lymphocytic cells, macrophages, and microglia in actively demyelinating MS brain lesions. Compared with circulating T cells, CSF T cells were significantly enriched for cells expressing CXCR3 or CCR5. Our results imply pathogenic roles for specific chemokine-chemokine receptor interactions in MS and suggest new molecular targets for therapeutic intervention.  (+info)

The T cell-specific CXC chemokines IP-10, Mig, and I-TAC are expressed by activated human bronchial epithelial cells. (2/1046)

Recruitment of activated T cells to mucosal surfaces, such as the airway epithelium, is important in host defense and for the development of inflammatory diseases at these sites. We therefore asked whether the CXC chemokines IFN-induced protein of 10 kDa (IP-10), monokine induced by IFN-gamma (Mig), and IFN-inducible T-cell alpha-chemoattractant (I-TAC), which specifically chemoattract activated T cells by signaling through the chemokine receptor CXCR3, were inducible in respiratory epithelial cells. The effects of proinflammatory cytokines, including IFN-gamma (Th1-type cytokine), Th2-type cytokines (IL-4, IL-10, and IL-13), and dexamethasone were studied in normal human bronchial epithelial cells (NHBEC) and in two human respiratory epithelial cell lines, A549 and BEAS-2B. We found that IFN-gamma, but not TNF-alpha or IL-1 beta, strongly induced IP-10, Mig, and I-TAC mRNA accumulation mainly in NHBEC and that TNF-alpha and IL-1 beta synergized with IFN-gamma induction in all three cell types. High levels of IP-10 protein (> 800 ng/ml) were detected in supernatants of IFN-gamma/TNF-alpha-stimulated NHBEC. Neither dexamethasone nor Th2 cytokines modulated IP-10, Mig, or I-TAC expression. Since IFN-gamma is up-regulated in tuberculosis (TB), using in situ hybridization we studied the expression of IP-10 in the airways of TB patients and found that IP-10 mRNA was expressed in the bronchial epithelium. In addition, IP-10-positive cells obtained by bronchoalveolar lavage were significantly increased in TB patients compared with normal controls. These results show that activated bronchial epithelium is an important source of IP-10, Mig, and I-TAC, which may, in pulmonary diseases such as TB (in which IFN-gamma is highly expressed) play an important role in the recruitment of activated T cells.  (+info)

CD40 ligand-CD40 interaction induces chemokines in cervical carcinoma cells in synergism with IFN-gamma. (3/1046)

Cellular immunity plays a major role in controlling human papilloma virus infection and development of cervical carcinoma. Mononuclear cell infiltration possibly due to the action of chemokines becomes prominent in the tumor tissue. In fact, the macrophage chemoattractant protein-1, MCP-1, was detected in cervical squamous cell carcinoma in situ, whereas absent in cultured cells. From this, unknown environmental factors were postulated regulating chemokine expression in vivo. In this study, we show high CD40 expression on cervical carcinoma cells and CD40 ligand (CD40L) staining on attracted T cells in tumor tissue, suggesting a paracrine stimulation mechanism via CD40L-CD40 interactions. We therefore investigated chemokine synthesis in nonmalignant and malignant human papilloma virus-positive cell lines after CD40L exposure. Constitutive expression of MCP-1, MCP-3, RANTES, and IFN-gamma-inducible protein-10 was almost undetectable in all cell lines tested. CD40L was able to induce MCP-1 production; however, despite much higher CD40 expression in malignant cells, MCP-1 induction was significantly lower compared with nontumorigenic cells. After sensitization with IFN-gamma, another T cell-derived cytokine showing minimal effects on CD40 expression levels, CD40 ligation led to a more than 20-fold MCP-1 induction in carcinoma cell lines. An even stronger effect was observed for IFN-gamma-inducible protein-10. Our study highlights the synergism of T cell-derived mediators such as CD40L and IFN-gamma for chemokine responses in cervical carcinoma cells, helping to understand the chemokine expression patterns observed in vivo.  (+info)

Gene expression and production of the monokine induced by IFN-gamma (MIG), IFN-inducible T cell alpha chemoattractant (I-TAC), and IFN-gamma-inducible protein-10 (IP-10) chemokines by human neutrophils. (4/1046)

Monokine induced by IFN-gamma (MIG), IFN-inducible T cell alpha chemoattractant (I-TAC), and IFN-gamma-inducible protein of 10 kDa (IP-10) are related members of the CXC chemokine subfamily that bind to a common receptor, CXCR3, and that are produced by different cell types in response to IFN-gamma. We have recently reported that human polymorphonuclear neutrophils (PMN) have the capacity to release IP-10. Herein, we show that PMN also have the ability to produce MIG and to express I-TAC mRNA in response to IFN-gamma in combination with either TNF-alpha or LPS. While IFN-gamma, alone or in association with agonists such as fMLP, IL-8, granulocyte (G)-CSF and granulocyte-macrophage (GM)-CSF, failed to influence MIG, IP-10, and I-TAC gene expression, IFN-alpha, in combination with TNF-alpha, LPS, or IL-1beta, resulted in a considerable induction of IP-10 release by neutrophils. Furthermore, IL-10 and IL-4 significantly suppressed the expression of MIG, IP-10, and I-TAC mRNA and the extracellular production of MIG and IP-10 in neutrophils stimulated with IFN-gamma plus either LPS or TNF-alpha. Finally, supernatants harvested from stimulated PMN induced migration and rapid integrin-dependent adhesion of CXCR3-expressing lymphocytes; these activities were significantly reduced by neutralizing anti-MIG and anti-IP-10 Abs, suggesting that they were mediated by MIG and IP-10 present in the supernatants. Since MIG, IP-10, and I-TAC are potent chemoattractants for NK cells and Th1 lymphocytes, the ability of neutrophils to produce these chemokines might contribute not only to the progression and evolution of the inflammatory response, but also to the regulation of the immune response.  (+info)

Differential induction of adhesion molecule and chemokine expression by LTalpha3 and LTalphabeta in inflammation elucidates potential mechanisms of mesenteric and peripheral lymph node development. (5/1046)

Lymphotoxin (LT) is a member of the proinflammatory TNF family of cytokines that plays a critical role in the development of lymphoid tissue. It has previously been reported that the presence of the LTalpha transgene under the control of the rat insulin promoter results in inflammation at the sites of transgene expression. LTalpha transgene expression results in expression of the adhesion molecules VCAM, ICAM, peripheral node addressin (a marker of peripheral lymph nodes), and mucosal addressin cellular adhesion molecule (a marker of mucosal lymphoid tissue, including mesenteric lymph nodes). In this study to determine the mechanisms by which LT promotes inflammation and lymphoid tissue organization, we analyzed the regulation of expression of adhesion molecules and chemokines in LT transgenic mice. The results demonstrate that LTalpha3 induces expression of the adhesion molecules VCAM, ICAM, and mucosal addressin cellular adhesion molecule as well as the chemokines RANTES, IFN-inducible protein-10, and monocyte chemotactic protein-1, while LTalphabeta is required for the induction of peripheral node addressin that may contribute to the recruitment of L-selectinhigh CD44low naive T cells. These data provide candidate mediators of LT-induced inflammation as well as potential mechanisms by which LTalpha and LTalphabeta may differentially promote the development of mesenteric and peripheral lymph nodes.  (+info)

Early gene expression of NK cell-activating chemokines in mice resistant to Leishmania major. (6/1046)

Susceptibility of mice to Leishmania major is associated with an insufficient NK cell-mediated innate immune response. We analyzed the expression of NK cell-activating chemokines in vivo during the first days of infection in resistant and susceptible mice. The mRNA expression of gamma interferon-inducible protein 10 (IP-10), monocyte chemoattractant protein 1 (MCP-1), and lymphotactin was upregulated 1 day after infection in the draining lymph nodes of resistant C57BL/6 mice but not in those of susceptible BALB/c mice. In vivo local treatment of BALB/c mice with recombinant IP-10 shortly after infection resulted in an enhanced NK cell activity in the draining lymph node. The data suggest that although the recruitment of NK cells is normal in susceptible mice, the lack of NK cell-activating chemokines is a factor resulting in a suboptimal NK cell-mediated defense.  (+info)

Acquisition of selectin binding and peripheral homing properties by CD4(+) and CD8(+) T cells. (7/1046)

Different T cell subsets exhibit distinct capacities to migrate into peripheral sites of inflammation, and this may in part reflect differential expression of homing receptors and chemokine receptors. Using an adoptive transfer approach, we examined the ability of functionally distinct subsets of T cells to home to a peripheral inflammatory site. The data directly demonstrate the inability of naive T cells and the ability of effector cells to home to inflamed peritoneum. Furthermore, interleukin (IL)-12 directs the differentiation of either CD4(+) or CD8(+) T cells into effector populations that expresses functional E- and P-selectin ligand and that are preferentially recruited into the inflamed peritoneum compared with T cells differentiated in the presence of IL-4. Recruitment can be blocked by anti-E- and -P-selectin antibodies. The presence of antigen in the peritoneum promotes local proliferation of recruited T cells, and significantly amplifies the Th1 polarization of the lymphocytic infiltrate. Preferential recruitment of Th1 cells into the peritoneum is also seen when cytokine response gene 2 (CRG-2)/interferon gamma-inducible protein 10 (IP-10) is used as the sole inflammatory stimulus. We have also found that P-selectin binds only to antigen-specific T cells in draining lymph nodes after immunization, implying that both antigen- and cytokine-mediated signals are required for expression of functional selectin-ligand.  (+info)

CCR5(+) and CXCR3(+) T cells are increased in multiple sclerosis and their ligands MIP-1alpha and IP-10 are expressed in demyelinating brain lesions. (8/1046)

Multiple sclerosis (MS) is a T cell-dependent chronic inflammatory disease of the central nervous system. The role of chemokines in MS and its different stages is uncertain. Recent data suggest a bias in expression of chemokine receptors by Th1 vs. Th2 cells; human Th1 clones express CXCR3 and CCR5 and Th2 clones express CCR3 and CCR4. Chemokine receptors expressed by Th1 cells may be important in MS, as increased interferon-gamma (IFN-gamma) precedes clinical attacks, and IFN-gamma injection induces disease exacerbations. We found CXCR3(+) T cells increased in blood of relapsing-remitting MS, and both CCR5(+) and CXCR3(+) T cells increased in progressive MS compared with controls. Furthermore, peripheral blood CCR5(+) T cells secreted high levels of IFN-gamma. In the brain, the CCR5 ligand, MIP-1alpha, was strongly associated with microglia/macrophages, and the CXCR3 ligand, IP-10, was expressed by astrocytes in MS lesions but not unaffected white matter of control or MS subjects. Areas of plaque formation were infiltrated by CCR5-expressing and, to a lesser extent, CXCR3-expressing cells; Interleukin (IL)-18 and IFN-gamma were expressed in demyelinating lesions. No leukocyte expression of CCR3, CCR4, or six other chemokines, or anti-inflammatory cytokines IL-5, IL-10, IL-13, and transforming growth factor-beta was observed. Thus, chemokine receptor expression may be used for immunologic staging of MS and potentially for other chronic autoimmune/inflammatory processes such as rheumatoid arthritis, autoimmune diabetes, or chronic transplant rejection. Furthermore, these results provide a rationale for the use of agents that block CCR5 and/or CXCR3 as a therapeutic approach in the treatment of MS.  (+info)

This study examined the association of interferon-gamma-inducible protein-10 concentrations in serum and IL28B genotype associated with responses to pegylated
TY - JOUR. T1 - Cytokine-responsive gene-2/IFN-inducible protein-10 expression in multiple models of liver and bile duct injury suggests a role in tissue regeneration. AU - Koniaris, L. G.. AU - Zimmers-Koniaris, T.. AU - Hsiao, E. C.. AU - Chavin, K.. AU - Sitzmann, J. V.. AU - Farber, J. M.. PY - 2001/7/1. Y1 - 2001/7/1. N2 - IFN-inducible protein-10 (IP-10/CXCL10) is a CXC chemokine that targets both T cells and NK cells. Elevation of IP-1O expression has been demonstrated in a number of human diseases, including chronic cirrhosis and biliary atresia. Cytokine-responsive gene-2 (Crg-2), the murine ortholog of IP-10, was induced following CCl4 treatment of the hepatocyte-like cell line AML-12. Crg-2 expression was noted in vivo in multiple models of hepatic and bile duct injury, including bile duct ligation and CCl4, D-galactosamine, and methylene dianiline toxic liver injuries. Induction of Crg-2 was also examined following two-thirds hepatectomy, a model that minimally injures the remaining ...
Inflammasomes sense diverse classes of foreign molecules in the cytoplasm and induce caspase-1 activation and IL-1β maturation. Whether such a sensing mechanism exists in the nucleus is not known. Nuclear replicating herpesvirus KSHV is associated with Kaposi Sarcoma (KS) that is characterized by a microenvironment of inflammatory cytokines including IL-1β. How the caspase-1 inflammasome, which is required for IL-1β maturation is induced during KSHV infection is not known. Here we demonstrate that during de novo KSHV infection of endothelial cells, interferon gamma-inducible protein 16 (IFI16) interacts with ASC and procaspase-1 to form a functional inflammasome. This complex was initially detected in the nucleus and subsequently in the peri-nuclear area. Caspase-1 activation by KSHV was reduced by IFI16 and ASC silencing but not by AIM2 knockdown. Our studies reveal a new function of IFI16 as a nuclear danger sensor and demonstrate that the inflammasomes danger sensing functions extend into ...
GILT antibody (interferon, gamma-inducible protein 30) for IHC-P, WB. Anti-GILT pAb (GTX103967) is tested in Human samples. 100% Ab-Assurance.
Recombinant protein of human interferon, gamma-inducible protein 16 (IFI16), 20 ug available for purchase from OriGene - Your Gene Company.
C-X-C Motif Chemokine 2/CXCL2/MIP-2 product information; C-X-C Motif Chemokine 2/CXCL2/MIP-2 is available 1 time from supplier EnoGene at Gentaur.com shop
CXCL12 izaziva potentnu hemotaksu limfocita.[4][5][6][7] Tokom embriogeneze on usmerava migraciju hematopoetskih ćelija i formiranje velikih krvnih sudova. Miševi bez CXCL12 gena su letalni pre rođenja, ili u toku prvog sata života. Kod odraslih CXCL12 igra važnu ulogu u angiogenezi putem regrutovanja endotelnih progenitorskih ćelija (EPC) iz koštane srži kroz CXCR4 zavistan mehanizam.[8] Ova funkcija čini CXCL12 veoma važnim faktorom u karcinogenezi i neovaskularizaciji vezanoj za progresiju tumora.[9] CXCL12 takođe ima ulogu u metastazi tumora gde su ćelije raka koje izražavaju CXCR4 receptor privučene ka metastaznim ciljnim tkivima koja oslobađaju ligand, CXCL12.[10] Kod raka dojke, međutim, povećano CXCL12 izražavanje određuje umanjeni rizik od metastaze.[11][12] ...
CXCL10 / IP10 antibody [15J7] (chemokine (C-X-C motif) ligand 10) for Neut, WB. Anti-CXCL10 / IP10 mAb (GTX53293) is tested in Mouse samples. 100% Ab-Assurance.
Complete information for CXCL9 gene (Protein Coding), C-X-C Motif Chemokine Ligand 9, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Many in vitro applications for chemical induced dimerization (CID) have progressed into transgenic animals - for example, the MaFIA mouse. The B/B Homodimerizer (AP20187) has been the widely used in vivo.
Many in vitro applications for chemical induced dimerization (CID) have progressed into transgenic animals - for example, the MaFIA mouse. The B/B Homodimerizer (AP20187) has been the widely used in vivo.
Aortic and plasma expression levels of IL-18 and CXCL16.(A) Reduced aortic mRNA expression of IL-18 and CXCL16, but no change in the expression of IFN-γ is obs
References for Abcams Recombinant human CXCL5 protein (ab50039). Please let us know if you have used this product in your publication
Bachem offers H-4606 Interferon-Inducible T Cell α-Chemoattractant (human) for your research. Find all specific details here. Find product specific information including available pack sizes, CAS, detailed description and references here.
C-X-C motif chemokine 11 (CXCL11) is a protein that in humans is encoded by the CXCL11 gene.[3] C-X-C motif chemokine 11 is a small cytokine belonging to the CXC chemokine family that is also called Interferon-inducible T-cell alpha chemoattractant (I-TAC) and Interferon-gamma-inducible protein 9 (IP-9). It is highly expressed in peripheral blood leukocytes, pancreas and liver, with moderate levels in thymus, spleen and lung and low expression levels were in small intestine, placenta and prostate.[4] Gene expression of CXCL11 is strongly induced by IFN-γ and IFN-β, and weakly induced by IFN-α.[5] This chemokine elicits its effects on its target cells by interacting with the cell surface chemokine receptor CXCR3, with a higher affinity than do the other ligands for this receptor, CXCL9 and CXCL10.[4][6] CXCL11 is chemotactic for activated T cells. Its gene is located on human chromosome 4 along with many other members of the CXC chemokine family.[7][8] ...
1. ButcherBA, GreeneRI, HenrySC, AnnecharicoKL, WeinbergJB, et al. (2005) p47 GTPases regulate Toxoplasma gondii survival in activated macrophages. Infect Immun 73: 3278-3286.. 2. CollazoCM, YapGS, SempowskiGD, LusbyKC, TessarolloL, et al. (2001) Inactivation of LRG-47 and IRG-47 reveals a family of interferon gamma-inducible genes with essential, pathogen-specific roles in resistance to infection. J Exp Med 194: 181-188.. 3. LingYM, ShawMH, AyalaC, CoppensI, TaylorGA, et al. (2006) Vacuolar and plasma membrane stripping and autophagic elimination of Toxoplasma gondii in primed effector macrophages. J Exp Med 203: 2063-2071.. 4. MartensS, ParvanovaI, ZerrahnJ, GriffithsG, SchellG, et al. (2005) Disruption of Toxoplasma gondii parasitophorous vacuoles by the mouse p47-resistance GTPases. PLoS Pathog 1: e24.. 5. TaylorGA, CollazoCM, YapGS, NguyenK, GregorioTA, et al. (2000) Pathogen-specific loss of host resistance in mice lacking the IFN-gamma-inducible gene IGTP. Proc Natl Acad Sci U S A 97: ...
Fatal human respiratory disease associated with influenza A subtype H5N1 has been documented in Hong Kong, and more recently in Vietnam, Thailand and Cambodia. We previously demonstrated that patients with H5N1 disease had unusually high serum levels of IP-10 (interferon-gamma-inducible protein-10). Furthermore, when compared with human influenza virus subtype H1N1, the H5N1 viruses in 1997 (A/Hong Kong/483/97) (H5N1/97) were more potent inducers of pro-inflammatory cytokines (e.g. tumor necrosis factor-a) and chemokines (e.g. IP-10) from primary human macrophages in vitro, which suggests that cytokines dysregulation may play a role in pathogenesis of H5N1 disease. Since respiratory epithelial cells are the primary target cell for replication of influenza viruses, it is pertinent to investigate the cytokine induction profile of H5N1 viruses in these cells. We used quantitative RT-PCR and ELISA to compare the profile of cytokine and chemokine gene expression induced by H5N1 viruses A/HK/483/97 (H5N1/97),
SAM domain and HD domain-containing protein 1 is a protein that in humans is encoded by the SAMHD1 gene. SAMHD1 is a cellular enzyme, responsible for blocking replication of HIV in dendritic cells, macrophages and monocytes. It is an enzyme that exhibits phosphohydrolase activity, converting deoxynucleoside triphosphates (dNTPs) to inorganic phosphate (iPPP) and a 2-deoxynucleoside (i.e. deoxynucleosides without a phosphate group). In doing so, SAMHD1 depletes the pool of dNTPs available to a reverse transcriptase for viral cDNA synthesis and thus prevents viral replication. SAMHD1 has also shown nuclease activity. Although a ribonuclease activity was described to be required for HIV-1 restriction, recent data confirmed that SAMHD1-mediated HIV-1 restriction in cells does not involve ribonuclease activity. The SAMHD1 protein is also known as: AGS5: Aicardi- Goutières syndrome type 5 DCIP: Dendritic cell-derived IFNG-induced protein2 Mg11: Interferon-gamma-inducible protein HDDC1: HD domain ...
Chemokines mediate diverse fundamental biological processes, including combating infection. Multiple chemokines are expressed at the site of infection; thus chemokine synergy by heterodimer formation may play a role in determining function. Chemokine function involves interactions with G-protein-coupled receptors and sulfated glycosaminoglycans (GAG). However, very little is known regarding heterodimer structural features and receptor and GAG interactions. Solution nuclear magnetic resonance (NMR) and molecular dynamics characterization of platelet-derived chemokine CXCL7 heterodimerization with chemokines CXCL1, CXCL4, and CXCL8 indicated that packing interactions promote CXCL7-CXCL1 and CXCL7-CXCL4 heterodimers, and electrostatic repulsive interactions disfavor the CXCL7-CXCL8 heterodimer. As characterizing the native heterodimer is challenging due to interference from monomers and homodimers, we engineered a
CXCL12 izaziva potentnu hemotaksu limfocita.[4][5][6][7] Tokom embriogeneze on usmerava migraciju hematopoetskih ćelija i formiranje velikih krvnih sudova. Miševi bez CXCL12 gena su letalni pre rođenja, ili u toku prvog sata života. Kod odraslih CXCL12 igra važnu ulogu u angiogenezi putem regrutovanja endotelnih progenitorskih ćelija (EPC) iz koštane srži kroz CXCR4 zavistan mehanizam.[8] Ova funkcija čini CXCL12 veoma važnim faktorom u karcinogenezi i neovaskularizaciji vezanoj za progresiju tumora.[9] CXCL12 takođe ima ulogu u metastazi tumora gde su ćelije raka koje izražavaju CXCR4 receptor privučene ka metastaznim ciljnim tkivima koja oslobađaju ligand, CXCL12.[10] Kod raka dojke, međutim, povećano CXCL12 izražavanje određuje umanjeni rizik od metastaze.[11][12] ...
CXCL2, hemokin (C-X-C motiv) ligand 2, je mali citokin koji pripada CXC hemokin familiji. Os se takođe zove makrofagni inflamatorni protein 2-alfa (MIP2-alfa), rast-regulisani protein beta (Gro-beta) i Gro onkogen-2 (Gro-2). CXCL2 is 90% identičan u aminokiselinskoj sekvenci sa hemokinom, CXCL1. Ovaj hemokin izlučuju monociti i makrofage i on izaziva hemotaksu polimorfonuclearnih leukocita i hematopoetskih stem ćelija.[1][2][3] Gen za CXCL2 je lociran na ljudskom hromozomu 4 u klasteru sa drugim CXC hemokinima.[4] CXCL2 mobiliše ćelije putem interakcije sa hemokin receptorom na ćelijskoj površini koji se zove CXCR2.[3][5] ...
CXCL10 (chemokine (C-X-C motif) ligand 10), Authors: Frank Antonicelli, Philippe Bernard. Published in: Atlas Genet Cytogenet Oncol Haematol.
MIG (CXCL9) Bovine Recombinant is a non-glycosylated polypeptide chain containing 104 amino acids and having a molecular mass of about 18.0kDa.
Human C-X-C Motif Chemokine 9 / Monokine Induced by Gamma Interferon (CXCL9 / MIG) standard, for use in running standard curves in AlphaLISA no-wash detection assay
Recombinant Human MIG/CXCL9 produced in E. coli is a single, non-glycosylated polypeptide chain containing 103 amino acids and having a molecular mass of 11.7 kDa.
IL-8/CXCL8 Immunoprecipitation (IP) Kit are used for Immunoprecipitation of IL-8/CXCL8 protein which expressed in vitro expression systems.
Chicken polyclonal CXCL16 antibody validated for WB and tested in Human. With 1 independent review. Immunogen corresponding to recombinant fragment
Recombinant Human IP-10/CXCL10 produced inE. coliis a single, non-glycosylated polypeptide chain containing 77 amino acids and having a molecular mass of 8.5 kDa.
Human IL-8/CXCL8 HEK293 Cells Overexpression Lysate 10098-HNCH1L is validated in western blot (WB) as positive control. Sino Biological offers bulk order for high quality cell lysates which are produced in house.
pFN21AE1361 5002 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
购买我们的重组小鼠MIG蛋白。Ab50083为有活性的全长蛋白,在大肠杆菌中生产并经过SDS-PAGE, Functional Studies实验验证。中国80%以上现货。
The purpose of this study is to investigate T-cell mediated immune responses to HIV-1 and HCV and determine how these responses are affected by HCV treatment and correlates to response. Furthermore, to study Interferon-inducible protein-10 (IP-10) dynamics during HCV treatment, and correlate this to treatment outcome ...
The purpose of this study is to investigate T-cell mediated immune responses to HIV-1 and HCV and determine how these responses are affected by HCV treatment and correlates to response. Furthermore, to study Interferon-inducible protein-10 (IP-10) dynamics during HCV treatment, and correlate this to treatment outcome ...
Chemokine (C-X-C motif) ligand 9 (CXCL9) is a small cytokine belonging to the CXC chemokine family that is also known as Monokine induced by gamma interferon (MIG). CXCL9 is a T-cell chemoattractant, which is induced by IFN-γ. It is closely related to two other CXC chemokines called CXCL10 and CXCL11, whose genes are located near the gene for CXCL9 on human chromosome 4. CXCL9, CXCL10 and CXCL11 all elicit their chemotactic functions by interacting with the chemokine receptor CXCR3. Neutrophil collagenase/matrix metalloproteinase 8 (MMP-8) degrades CXCL9 and cleaves CXCL10 at two positions. Gelatinase B/matrix metalloproteinase 9 (MMP-9) degrades CXCL10 and cleaves CXCL9 at three different sites in its extended carboxy-terminal region ...
IP-10 has been detected in the CSF and brain parenchyma of patients with a variety of neuroinflammatory diseases (15, 26, 43, 44) and is a potent chemoattractant for activated T lymphocytes and NK cells (11). In EAE, an animal model for MS, IP-10 levels in the CNS have been correlated with the development of clinical disease and the recruitment of CXCR3-expressing pathogenic T cells (19, 20, 45). Treatment of SJL mice with Abs to IP-10 before adoptive transfer of encephalitogenic T cells or immunizing mice with naked IP-10 DNA decreased the severity of EAE (29). Based on these observations, IP-10 is thought to be essential for the development of CNS mononuclear infiltrates, and its receptor CXCR3, is considered a putative therapeutic target for diseases involving the trafficking of inflammatory T cells. However, the absolute requirement for IP-10 in EAE has never been directly examined.. In this study, we sought to determine whether IP-10 is required for the development of EAE by analyzing ...
CXCL16, hemokin (C-X-C motiv) ligand 16, je mali citokin iz CXC hemokin familije. On je veći od drugih hemokina (sadrži 254 aminokiselina). CXCL16 se sastoji od CXC hemokin domaina, mucinu-slične stabljike, transmembranskog domaina i citoplazmatičnog repa koji sadrži potentno mesto tirozin fosforilacije koje može da veže SH2.[1] Ovo su neuobičajene osobine za hemokin, i omobućavaju CXCL16 da bude izražen kao molekul na ćelijskoj površini, kao i rastvorni hemokin.[2] CXCL16 proizvode dendritiske ćelije koje se mogu naći u T ćelijskim zonama limfoidnih organa, i ćelije iz crvene pulpe slezine.[1] Među ćelijama koje se vezuju i migriraju u responsu na CXCL16 su nekoliko podgrupa T ćelija, i NKT ćelije.[1] CXCL16 interaguje sa hemokin receptorom CXCR6, takođe poznatim kao Bonzo.[3][1] Ekspresiju CXCL16 indukuju inflamatorni citokini IFN-gama i TNF-alfa.[2] Gen za ljudski CXCL16 je lociran na hromozomu 17.[1][4] ...
CXCL2_HUMAN (P19875 ), CXCL2_MOUSE (P10889 ), CXCL2_RAT (P30348 ), CXCL3_HUMAN (P19876 ), CXCL3_MOUSE (Q6W5C0 ), CXCL3_RAT (Q10746 ), CXCL5_HUMAN (P42830 ), CXCL5_MOUSE (P50228 ), CXCL5_RAT (P97885 ), CXCL6_BOVIN (P80221 ), CXCL6_HORSE (Q8MIN2 ), CXCL6_HUMAN (P80162 ), CXCL7_HUMAN (P02775 ), CXCL7_PIG (P43030 ), CXCL9_BOVIN (A9QWP9 ), CXCL9_HUMAN (Q07325 ), CXCL9_MOUSE (P18340 ), CXL10_BOVIN (Q2KIQ8 ), CXL10_CANLF (Q5KSV9 ), CXL10_HUMAN (P02778 ), CXL10_MACMU (Q8MIZ1 ), CXL10_MACNE (Q865F5 ), CXL10_MOUSE (P17515 ), CXL10_RAT (P48973 ), CXL11_BOVIN (A9QWQ1 ), CXL11_HUMAN (O14625 ), CXL11_MOUSE (Q9JHH5 ), CXL13_HUMAN (O43927 ), CXL13_MOUSE (O55038 ), CXL15_MOUSE (Q9WVL7 ), GRO2_RABIT (P47854 ), GROA_BOVIN (O46676 ), GROA_CAVPO (O55235 ), GROA_CRIGR (P09340 ), GROA_HUMAN (P09341 ), GROA_MOUSE (P12850 ), GROA_RAT (P14095 ), GROA_SHEEP (O46678 ), GROB_BOVIN (O46677 ), GROG_BOVIN (O46675 ), IL8_BOVIN (P79255 ), IL8_CANLF (P41324 ), IL8_CAVPO (P49113 ), IL8_CERAT (P46653 ), IL8_CHICK (P08317 ), ...
This antimicrobial gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. Binding of this protein to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. This gene may also be a key regulator of the cytokine storm immune response to SARS-CoV-2 infection. [provided by RefSeq, Sep 2020 ...
Cxcl11 - Cxcl11 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1 available for purchase from OriGene - Your Gene Company.
Thank you for your interest in spreading the word on Circulation Research.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
Interferon gamma-induced protein 10 (IP-10), or CXCL10, is a chemokine secreted by monocytes, endothelial cells and fibroblasts in response to interferon gamma (IFN-ɣ).
CXCL10 is a 10 kDa protein and is also known as Interferon γ-induced protein 10 (IP-10) or small-inducible cytokine B10. This cytokine is implicated in the cell migration of leukocytes and its expression is dependent on interferon γ (IFN γ) in numerous cell types (neutrophils, monocytes, T lymphocytes, endothelial cells, fibroblast, keratinocytes, and thyrocytes among others)(Antonelli et al., 2014).
PIG11 protein may play an important role by interaction with other biological molecules in the regulation of apoptosis and provided us a novel angel of view to explore the possible function of PIG11 in vivo ...
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
CXCL12/SDF-1 alpha ELISA Kits for quantification of target antigens. Browse our CXCL12/SDF-1 alpha ELISA Kits backed by our 100% Guarantee.
CXCL10 improves outcome by decreasing bacteremia in IFNAR−/− mice. (A) SEV129 wild-type mice (n = 10), IFNAR−/− mice (n = 11), or IFNAR−/− mice with
小鼠CXCL5 ELISA试剂盒(GCP-2) ELISA试剂盒datasheet (ab100719).Abcam抗体、ELISA、激动剂拮抗剂、表观遗传试剂、蛋白多肽,使用效果保证,中国70%以上现货。
Gentaur molecular products has all kinds of products like :search , Prospecbio \ Recombinant Mouse CXCL16 \ CHM-363 for more molecular products just contact us
人生长调节致癌基因γ(GRO-γ/CXCL3) (Human)首选赛业生物,380余种细胞因子囊括生长调节致癌基因、生长因子、干扰素、白细胞介素、肿瘤坏死因子等所有细胞因子家族,种属齐包括人、鼠、恒河猴及其他种属。赛业提供的生长调节致癌基因品质优良:高活性、高纯度、高稳定性、无热源、无外源因子污染。
Chemokines are a family of cytokines involved in the extravasation of leukocytes to the site of inflammation. 4 CCL2/monocyte chemoattractant protein-1 (MCP-1), which is chemotactic for monocytes, 5 and CXCL8/IL-8, which chemoattracts neutrophils, 6 have been reported to be elevated in the bronchoalveolar lavage fluid (BALF) or serum of patients with active pulmonary sarcoidosis. 7 8 9 10 CCL3/macrophage inflammatory protein-1α (MIP-1α), CCL4/MIP-1β, and CCL5/regulated on activation normal T-cell expressed and secreted (RANTES) also have been shown to be elevated in the BALF of patients with pulmonary sarcoidosis. 11 12 13 As a result of the findings that CCL3 and CCL5 share the same CC chemokine receptor (CCR5) that is expressed abundantly on Th1-type cells and that CCR5 mRNA expression is upregulated in BALF of patients with pulmonary sarcoidosis, these chemokines have been suggested to be involved in the recruitment of Th1 cells 14 from the circulation to the granulomas in pulmonary ...
In the present study, it was demonstrated that IL-17A could stimulate the secretion of angiogenic CXC chemokines from liver cancer cells, which may recruit endothelial cells to the tumor cells in a CXCR2-dependent manner. Tumor angiogenesis was also promoted by IL-17A expression in vivo. The CXC chemokines can be classified as angiogenic or angiostatic predominantly based on the presence or absence of an ELR motif. The angiogenic CXC chemokines include CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL8 and CXCL12, and the angiostatic chemokines include CXCL4, CXCL9, CXCL10, CXCL11 and CXCL14 (21). IL-17A was shown to increase the expression of CXCL1, CXCL2, CXCL3, CXCL5, CXCL6 and CXCL8 in Huh7.5 cells and upregulated CXCL2 in HepG2 cells. Additionally, angiostatic CXC chemokines were not affected by IL-17A in both cell lines. IL-17A has been reported to stimulate VEGFA production and promote angiogenesis in several cancer cell lines (16-18) and it has been shown previously that IL-17A does not affect ...
Among CXC chemokines, CXCL10 has been identified to play an important role in several endocrine eautoimmune diseases such as Hashimotos thyroiditis, Graves disease and Type 1 diabetes mellitus. The chemokine IP-10 (interferon-inducible protein of 10 kDa, CXCL10) is a chemoattractant for CXCR3+ T cells, binds to the G protein-coupled receptor CXCR3, which is found mainly on activated T cells and NK cells, and plays an important role in Th1-type inflammatory diseases. IP-10 also binds to glycosaminoglycans (GAGs), an interaction thought to be important for its sequestration on endothelial and other cells. Recombinant Mouse IP-10 produced in E. coli is a single non-glycosylated polypeptide chain containing 77 amino acids with a MW of 8,701 Da ...
Interferons play a critical role in regulating both the innate and adaptive immune responses. Previous reports have shown increased levels of IFN-γ, IFN-γ-inducing IL-12 and IFN-γ-inducible chemokine IP-10 in patients with chronic obstructive pulmonary disease (COPD). The present study focuses on the regulation of the IP-10 secretion in co-cultures of lung epithelial cells and peripheral blood mononuclear cells (PBMCs). No IP-10 secretion was detected in cells cultured alone, whereas a significant increase in IP-10 levels was observed in epithelial cell/PBMC co-cultures. Furthermore, the results show that interactions between lung epithelial cells, lymphocytes and monocytes are needed for basal IP-10 secretion. Interestingly, we have also shown that incubation with IL-12 can induce an IFN-γ independent increase in IP-10 levels in co-cultures. Furthermore, inhibition studies supported the suggestion that different intracellular pathways are responsible of IFN-γ and IL-12 mediated IP-10 secretion.
Sigma-Aldrich offers abstracts and full-text articles by [Birgit Westernströer, Daniel Langenstroth, Sabine Kliesch, Britta Troppmann, Klaus Redmann, Joni Macdonald, Rod Mitchell, Joachim Wistuba, Stefan Schlatt, Nina Neuhaus].
Detecting pathogenic DNA by intracellular receptors termed sensors is critical toward galvanizing host immune responses and eliminating microbial infections. Emerging evidence has challenged the dogma that sensing of viral DNA occurs exclusively in sub-cellular compartments normally devoid of cellular DNA. The interferon-inducible protein IFI16 was shown to bind nuclear viral DNA and initiate immune signaling, culminating in antiviral cytokine secretion. Here, we review the newly characterized nucleus-originating immune signaling pathways, their links to other crucial host defenses, and unique mechanisms by which viruses suppress their functions. We frame these findings in the context of human pathologies associated with nuclear replicating DNA viruses. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.. ...
These reference sequences exist independently of genome builds. Explain. These reference sequences are curated independently of the genome annotation cycle, so their versions may not match the RefSeq versions in the current genome build. Identify version mismatches by comparing the version of the RefSeq in this section to the one reported in Genomic regions, transcripts, and products above. ...
Human CXCL16 ELISA Kit is a sandwich ELISA kit for use with Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. This assay has high sensitivity and excellent specificity for detection of CXCL16|br/|N
Recombinant Human CXCL5 (ENA-78) (ELISA Std.) - CXCL5 is a member of the CXC family of chemokines, also known as epithelial activated peptide 78 (ENA-78).
IP-10 (CXCL10) regulates innate and adaptive immunity by regulating T cells, natural killer cells, dendritic cells, macrophages, and B cells.
Gentaur molecular products has all kinds of products like :search , Cell Sciences \ Recombinant Mouse CXCL2 \ CSI11487C for more molecular products just contact us
The ESAB Aristo Mig 5000i is the ideal partner for when it comes to prefabrication of high alloyed materials with a high demand for the welding performance.
It is closely related to two other CXC chemokines called CXCL10 and CXCL11, whose genes are located near the gene for CXCL9 on ... Chemokine (C-X-C motif) ligand 9 (CXCL9) is a small cytokine belonging to the CXC chemokine family that is also known as ... Campbell JD, Stinson MJ, Simons FE, Rector ES, HayGlass KT (July 2001). "In vivo stability of human chemokine and chemokine ... Shields PL, Morland CM, Salmon M, Qin S, Hubscher SG, Adams DH (December 1999). "Chemokine and chemokine receptor interactions ...
2005). "Identification of genes differentially expressed in T cells following stimulation with the chemokines CXCL12 and CXCL10 ...
... host-derived pro-inflammatory chemokines (e.g. CXCL8, CCL2, CCL3, CCL4, CCL5, CCL11, CXCL10), platelet-activating factor, and ... stimulates their expression the chemokine receptor, CCR5, to inhibit chemokine signaling, enhances their phagocyte activity, ... CMKLR1 (chemokine receptor-like 1), also termed the ChemR23 or E series resolvin receptor (ERV), is expressed on inflammation- ...
Flares are accompanied by increased serum levels of activated T lymphocyte chemokines (IP-10/CXCL10, MIG/CXCL9), G-CSF and ... Activated CD4(+)/CD25(+) T-lymphocyte counts correlated negatively with serum concentrations of IP-10/CXCL10, whereas CD4(+)/ ... IP-10/CXCL10) genes. T cell associated genes (CD3, CD8B) are down regulated. ...
It does this by increasing production of interferon gamma, which in turn increases the production of a chemokine called ... inducible protein-10 (IP-10 or CXCL10). IP-10 then mediates this anti-angiogenic effect. Because of its ability to induce ...
... as well as promoting the production of chemokines CXCL10, CXCL9 and CXCL11. These chemokines play an important role in ... The recruitment of more immune cells also occurs and is mediated by the chemokines produced during the inflammatory process. In ...
Chemokines such as CXCR3 and CCR5, ligand chemokines (CXCL9, CXCL10, and CCL5) and other chemokines (CX3CL1 and CCL2) Adhesion ...
... -A binds to the CXC chemokines CXCL9 (MIG), CXCL10 (IP-10), and CXCL11 (I-TAC) whereas CXCR3-B can also bind to CXCL4 in ... Chemokine receptor CXCR3 is a Gαi protein-coupled receptor in the CXC chemokine receptor family. Other names for CXCR3 are G ... Chemokine receptors Chemokine Cluster of differentiation GRCh38: Ensembl release 89: ENSG00000186810 - Ensembl, May 2017 GRCm38 ... "Expression of specific chemokines and chemokine receptors in the central nervous system of multiple sclerosis patients". The ...
... particularly chemokines such as CXCL10 and CCL2 which attract leukocytes to the site of pathogen invasion.[citation needed] A ... Keratinocytes also modulate the immune system: apart from the above-mentioned antimicrobial peptides and chemokines they are ...
"Anti-CXCL10 Therapeutic Antibody (eldelumab) - Creative Biolabs". www.creativebiolabs.net. Retrieved 2017-03-24. Sandborn, ... Eldelumab (alternative identifier BMS-936557) is a fully human monoclonal antibody (type IgG1 kappa) that targets chemokine (C- ... X-C motif) ligand 10 (CXCL10)/Interferon-γ-inducible protein-10 (IP-10) designed for the treatment of Crohn's disease and ...
C-X-C motif chemokine 11 (CXCL11) is a protein that in humans is encoded by the CXCL11 gene. C-X-C motif chemokine 11 is a ... CXCL9 and CXCL10. CXCL11 is chemotactic for activated T cells. Its gene is located on human chromosome 4 along with many other ... This chemokine elicits its effects on its target cells by interacting with the cell surface chemokine receptor CXCR3, with a ... Luo Y, Kim R, Gabuzda D, Mi S, Collins-Racie LA, Lu Z, Jacobs KA, Dorf ME (December 1998). "The CXC-chemokine, H174: expression ...
Over the past three decades, Luster has been intimately associated with the birth, growth and development of the chemokine ... of this important family of immunoregulatory chemotactic cytokines in health and diseases since his initial discovery of CXCL10 ... His laboratory is interested in defining the roles of chemokines and lipid chemoattractant molecules in autoimmune, allergic, ... According to Google Scholar, Luster's most cited paper, the review "Chemokines-chemotactic cytokines that mediate inflammation ...
CroFab Cross-presentation Cross-reactivity Cryptic self epitopes Cryptotope CX3CL1 CX3CR1 CXC chemokine receptors CXCL1 CXCL10 ... C-C chemokine receptor type 6 C-C chemokine receptor type 7 Calreticulin Cancer immunology Cancer immunoprevention Cancer ... CD4 CD4+ T cells and antitumor immunity CD74 CD94/NKG2 Cell-mediated immunity CELSR1 Central tolerance Chemokine Chemokine ... immunotherapy Cantuzumab ravtansine Cathelicidin CC chemokine receptors CCBP2 CCL1 CCL11 CCL12 CCL13 CCL14 CCL15 CCL16 CCL17 ...
Examples are: CXCL-8, CCL2, CCL3, CCL4, CCL5, CCL11, CXCL10. The main function of chemokines is to manage the migration of ... C4-CC chemokines), but a small number of CC chemokines possess six cysteines (C6-CC chemokines). C6-CC chemokines include CCL1 ... The third group of chemokines is known as the C chemokines (or γ chemokines), and is unlike all other chemokines in that it has ... CCL1 for the ligand 1 of the CC-family of chemokines, and CCR1 for its respective receptor. The CC chemokine (or β-chemokine) ...
The gene for CXCL10 is located on human chromosome 4 in a cluster among several other CXC chemokines. CXCL10 is secreted by ... C-X-C motif chemokine 10 (CXCL10) also known as Interferon gamma-induced protein 10 (IP-10) or small-inducible cytokine B10 is ... Booth V, Keizer DW, Kamphuis MB, Clark-Lewis I, Sykes BD (August 2002). "The CXCR3 binding chemokine IP-10/CXCL10: structure ... Human CXCL10 genome location and CXCL10 gene details page in the UCSC Genome Browser. Farber JM (March 1997). "Mig and IP-10: ...
The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions. Biochemistry 41: 10418-10425, 2002. Legler D.F ... CXC chemokine receptors are integral membrane proteins that specifically bind and respond to cytokines of the CXC chemokine ... However, CXCR6 is more closely related in structure to CC chemokine receptors than to other CXC chemokine receptors. CXCR7 was ... within the chemokine receptor cluster on human chromosome 3p21) and its similarity to other chemokine receptors in its gene ...
1999). "The assignment of chemokine-chemokine receptor pairs: TARC and MIP-1 beta are not ligands for human CC-chemokine ... CXCL10 release by TNF-alpha and IFN-gamma in HaCaT cell line". Cytokine. 20 (1): 1-6. doi:10.1006/cyto.2002.1965. PMID 12441140 ... Chemokine (C-C motif) ligand 17 (CCL17) (also known as TARC) is a small cytokine belonging to the CC chemokine family is also ... This chemokine specifically binds and induces chemotaxis in T cells and elicits its effects by interacting with the chemokine ...
"Human osteoblasts express functional CXC chemokine receptors 3 and 5: activation by their ligands, CXCL10 and CXCL13, ... is a G protein-coupled seven transmembrane receptor for chemokine CXCL13 (also known as BLC) and belongs to the CXC chemokine ... C-X-C chemokine receptor type 5 (CXC-R5) also known as CD185 (cluster of differentiation 185) or Burkitt lymphoma receptor 1 ( ... Förster R, Mattis AE, Kremmer E, Wolf E, Brem G, Lipp M (December 1996). "A putative chemokine receptor, BLR1, directs B cell ...
... chemokine (C-X-C motif) ligand 9, scyb9 CXCL10: chemokine (C-X-C motif) ligand 10, scyb10 CXCL11: chemokine (C-X-C motif) ... chemokine (C-X-C motif) ligand 1, scyb1 CXCL2: chemokine (C-X-C motif) ligand 2, scyb2 CXCL3: chemokine (C-X-C motif) ligand 3 ... chemokine (C-X-C motif) ligand 5, scyb5 CXCL6: chemokine (C-X-C motif) ligand 6, scyb6 CXCL7: chemokine (C-X-C motif) ligand 7 ... scyb3 CXCL4: chemokine (C-X-C motif) ligand 4, Platelet factor-4, PF-4, scyb4 CXCL5: ...
It acts at CXCL10. "DrugBank: Methimazole (DB00763)". drugbank.ca. Retrieved 21 July 2015. Nakamura H, Noh JY, Itoh K, Fukata S ... October 2007). "Methimazole inhibits CXC chemokine ligand 10 secretion in human thyrocytes". J. Endocrinol. 195 (1): 145-55. ...
Human osteoblasts express functional CXC chemokine receptors 3 and 5: activation by their ligands, CXCL10 and CXCL13, ... Chan C.C., Shen D., Hackett J.J., Buggage R.R., Tuaillon N. Expression of chemokine receptors, CXCR4 and CXCR5, and chemokines ... CXCR5, BLR1, CD185, MDR15, C-X-C motif chemokine receptor 5, C-X-C chemokine receptor type 5. ... Gunn M.D., Ngo V.N., Ansel K.M., Ekland E.H., Cyster J.G., Williams L.T. A B-cell-homing chemokine made in lymphoid follicles ...
chemokine receptor activity. • receptor activity. • protein binding. • C-C chemokine receptor activity. • C-C chemokine binding ... Chemokine receptor 6 also known as CCR6 is a CC chemokine receptor protein which in humans is encoded by the CCR6 gene.[5] CCR6 ... "Entrez Gene: CCR6 chemokine (C-C motif) receptor 6".. *^ Wang K, Zhang H, Kugathasan S, Annese V, Bradfield JP, Russell RK, ... "Chemokine Receptors: CCR6". IUPHAR Database of Receptors and Ion Channels. International Union of Basic and Clinical ...
CXCL10 - chemokine (C-X-C motif) ligand 10". Архивирано из оригинала на датум 20. 04. 2010. Приступљено 17. 07. 2010.. ... Swaminathan (2003). „Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine.". Structure. 11: 521-32. PMID ... Booth (2002). „The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions.". Biochemistry. 41. PMID 12173928 ... CXCL10, hemokin (C-X-C motiv) ligand 10, ili IP-10[1] je mali citokin iz CXC hemokin familije koji je takođe poznat kao 10 kDa ...
CXCL10 and CXCL11 are secreted.[6] ... CC chemokinesEdit. The CC chemokine (or β-chemokine) proteins ... C chemokinesEdit. The third group of chemokines is known as the C chemokines (or γ chemokines), and is unlike all other ... C4-CC chemokines), but a small number of CC chemokines possess six cysteines (C6-CC chemokines). C6-CC chemokines include CCL1 ... CXC chemokinesEdit. The two N-terminal cysteines of CXC chemokines (or α-chemokines) are separated by one amino acid, ...
C-X-C chemokine receptor activity. • interleukin-8 binding. • G-protein coupled receptor activity. • chemokine receptor ... This name and the corresponding gene symbol IL8RA have been replaced by the HGNC approved name C-X-C motif chemokine receptor 1 ... "Chemokine Receptors: CXCR1". IUPHAR Database of Receptors and Ion Channels. International Union of Basic and Clinical ... chemokine-mediated signaling pathway. • interleukin-8-mediated signaling pathway. • neutrophil degranulation. • chemotaxis. ...
CXCL1 · CXCL2 · CXCL3 · CXCL4 · CXCL5 · CXCL6 · CXCL7 · CXCL8/IL8 · CXCL9 · CXCL10 · CXCL11 · CXCL12 · CXCL13 · CXCL14 · CXCL15 ... Chemokine. CCL. CCL1 · CCL2 · CCL3 · CCL4 · CCL5 · CCL6 · CCL7 · CCL8 · CCL9 · CCL11 · CCL12 · CCL13 · CCL14 · CCL15 · CCL16 · ...
positive regulation of chemokine (C-X-C motif) ligand 2 production. • positive regulation of JUN kinase activity. • positive ... positive regulation of chemokine production. • cellular extravasation. • negative regulation of lipid storage. • negative ... positive regulation of chemokine biosynthetic process. • epithelial cell proliferation involved in salivary gland morphogenesis ...
... s are a subset of cytokines that are produced by a type of immune cell known as a lymphocyte.[1] They are protein mediators typically produced by T cells to direct the immune system response by signaling between its cells. Lymphokines have many roles, including the attraction of other immune cells, including macrophages and other lymphocytes, to an infected site and their subsequent activation to prepare them to mount an immune response. Circulating lymphocytes can detect a very small concentration of lymphokine and then move up the concentration gradient towards where the immune response is required. Lymphokines aid B cells to produce antibodies. Important lymphokines secreted by the T helper cell include:[2] ...
... binds to the death receptors DR4 (TRAIL-RI) and DR5 (TRAIL-RII). The process of apoptosis is caspase-8-dependent. Caspase-8 activates downstream effector caspases including procaspase-3, -6, and -7, leading to activation of specific kinases.[11] TRAIL also binds the receptors DcR1 and DcR2, which do not contain a cytoplasmic domain (DcR1) or contain a truncated death domain (DcR2). DcR1 functions as a TRAIL-neutralizing decoy-receptor. The cytoplasmic domain of DcR2 is functional and activates NFkappaB. In cells expressing DcR2, TRAIL binding therefore activates NFkappaB, leading to transcription of genes known to antagonize the death signaling pathway and/or to promote inflammation. Application of engineered ligands that have variable affinity for different death (DR4 and DR5) and decoy receptors (DCR1 and DCR2) may allow selective targeting of cancer cells by controlling activation of Type 1/Type 2 pathways of cell death and single cell fluctuations. Luminescent iridium complex-peptide ...
IFN-α, -β and -γ, CXCL10, IL-4, -12 and -18. inhibit cell migration of endothelial cells, downregulate bFGF. ... Bifidobacteria and Salmonella by adding the genes for anti-angiogenic factors such as endostatin or IP10 chemokine and removing ...
"Evidence for a second receptor for prostacyclin on human airway epithelial cells that mediates inhibition of CXCL9 and CXCL10 ...
... (IL-24) is a protein that in humans is encoded by the IL24 gene. IL-24 is a cytokine belonging to the IL-10 family of cytokines that signals through two heterodimeric receptors: IL-20R1/IL-20R2 and IL-22R1/IL-20R2. This interleukin is also known as melanoma differentiation-associated 7 (mda-7) due to its discovery as a tumour suppressing protein. IL-24 appears to control in cell survival and proliferation by inducing rapid activation of particular transcription factors called STAT1 and STAT3. This cytokine is predominantly released by activated monocytes, macrophages and T helper 2 (Th2) cells[5] and acts on non-haematopoietic tissues such as skin, lung and reproductive tissues. IL-24 performs important roles in wound healing, arthritis, psoriasis and cancer.[6][7][8] Several studies have shown that cell death occurs in cancer cells/cell lines following exposure to IL-24.[9][10] The gene for IL-24 is located on chromosome 1 in humans.[11] ...
... as well as chemokine and cytokine production, and expression of adhesion molecules such as E-selectin, ICAM-1, and VCAM-1. This ...
Elevated serum levels of macrophage-derived chemokine and thymus and activation-regulated chemokine in autistic children, J ... CXCL10, CXCL11, CXCL12, CXCL16. ... focus on chemokines and their receptors. Lühikokkuvõte, Crit ...
positive regulation of chemokine biosynthetic process. • regulation of insulin secretion. • extrinsic apoptotic signaling ... Copeland KF (2006). "Modulation of HIV-1 transcription by cytokines and chemokines". Mini Reviews in Medicinal Chemistry. 5 (12 ...
... is sometimes used interchangeably among scientists with the term cytokine.[3] Historically, cytokines were associated with hematopoietic (blood and lymph forming) cells and immune system cells (e.g., lymphocytes and tissue cells from spleen, thymus, and lymph nodes). For the circulatory system and bone marrow in which cells can occur in a liquid suspension and not bound up in solid tissue, it makes sense for them to communicate by soluble, circulating protein molecules. However, as different lines of research converged, it became clear that some of the same signaling proteins which the hematopoietic and immune systems use were also being used by all sorts of other cells and tissues, during development and in the mature organism. While growth factor implies a positive effect on cell division, cytokine is a neutral term with respect to whether a molecule affects proliferation. While some cytokines can be growth factors, such as G-CSF and GM-CSF, others have an inhibitory effect on ...
The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.[8]. ...
Katsete põhjal kutsuvad viiruseosakesed nakatunud makrofaagides esile interleukiin-12, IFN-γ ja kemokiinide IP-10/CXCL-10, MCP- ... replication of Middle East respiratory syndrome coronavirus and aberrant induction of inflammatory cytokines and chemokines in ...
Interferon alfa 2b is an antiviral or antineoplastic drug, that was originally discovered in the laboratory of Charles Weissmann at the University of Zurich. It was developed at Biogen, and ultimately marketed by Schering-Plough under the tradename Intron-A. It has been used for a wide range of indications, including viral infections and cancers. This drug is approved around the world for the treatment of chronic hepatitis C, chronic hepatitis B, hairy cell leukemia, Behçet's disease, chronic myelogenous leukemia, multiple myeloma, follicular lymphoma, carcinoid tumor, mastocytosis and malignant melanoma. ...
4-1BB is a type 2 transmembrane glycoprotein receptor belonging to the TNF superfamily, expressed on activated T Lymphocytes.[1] 4-1BBL (4-1BB ligand) is found on APCs (antigen presenting cells) and binds to 4-1BB. ...
... chemokine (C-X-C motif) ligand 10) for Neut, WB. Anti-CXCL10 / IP10 mAb (GTX53293) is tested in Mouse samples. 100% Ab- ... chemokine (C-X-C motif) ligand 10. Synonyms. INP10 Antibody , CRG-2 Antibody , gIP-10 Antibody , Scyb10 Antibody , IP10 ... Antibody , C7 Antibody , IP-10 Antibody , chemokine (C-X-C motif) ligand 10 Antibody , Cxcl10 Antibody , mob-1 Antibody , Ifi10 ... Specifications: CXCL10 / IP10 antibody [15J7]. Full Name. ... CXCL10 / IP10 antibody [15J7]. *Host / ClonalityRat Monoclonal ...
C-X-C Motif Chemokine Ligand 9, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The ... CXCL9 CXCL10 CXCL11 NAAA GC04P076101 GH04G076029. 0.8. FANTOM5 46.9. -22.0. -21968. 0.2. CTCF KLF1 ARID4B RBBP5 ZNF335 ZNF316 ... HuMig: a new human member of the chemokine family of cytokines. (PMID: 8476424) Farber J.M. (Biochem. Biophys. Res. Commun. ... CXCL9 CXCL10 CXCL11 SDAD1 ART3 NAAA GC04M075923 RPL36P8 GH04G076059. 1.1. FANTOM5 ENCODE 29.6. -52.5. -52453. 1.2. ATF1 NR2F1 ...
CXC Chemokines Exhibit Bactericidal Activity against Multidrug-Resistant Gram-Negative Pathogens Matthew A. Crawford, Debra J. ...
CXCL10 C-X-C motif chemokine ligand 10 [Homo sapiens] CXCL10 C-X-C motif chemokine ligand 10 [Homo sapiens]. Gene ID:3627 ... CXCL10 an important chemokine associated with cytokine storm in COVID-19 infected patients. Title: CXCL10 an important ... CXCL10provided by HGNC. Official Full Name. C-X-C motif chemokine ligand 10provided by HGNC. Primary source. HGNC:HGNC:10637 ... CXCL10 an important chemokine associated with cytokine storm in COVID-19 infected patients. Zhang N, et al. Eur Rev Med ...
Atorvastatin reduces plasma levels of chemokine (CXCL10) in patients with Crohns disease.. Grip O1, Janciauskiene S. ... We investigated plasma levels of chemokines (CCL2, CCL4, CCL11, CCL13, CCL17, CCL22, CCL26, CXCL8, CXCL10) and endothelial ... Atorvastatin Reduces Plasma Levels of Chemokine (CXCL10) in Patients with Crohns Disease ... CXCL10 is a ligand for the CXCR3 receptor, the activation of which results in the recruitment of T lymphocytes and the ...
Here we describe a pathogen-mediated mechanism of evading CXCL10, a chemokine with diverse antimicrobial functions, including T ... Crucially, CXCL10 cleavage impaired T cell chemotaxis in vitro, indicating that cleaved CXCL10 cannot signal through CXCR3. ... Crucially, CXCL10 cleavage impaired T cell chemotaxis in vitro, indicating that cleaved CXCL10 cannot signal through CXCR3. ... but not distantly related chemokines, such as CXCL8 and CCL22. Further characterization demonstrated that CXCL10 cleavage ...
... chemokine (C-X-C motif) ligand 10), Authors: Frank Antonicelli, Philippe Bernard. Published in: Atlas Genet Cytogenet Oncol ... CXCL10 Mutations. ICGC Data Portal. CXCL10 TCGA Data Portal. CXCL10 Broad Tumor Portal. CXCL10. OASIS Portal. CXCL10 [ Somatic ... CXCL10 [ NCBI-GEO ] CXCL10 [ EBI - ARRAY_EXPRESS ] CXCL10 [ SEEK ] CXCL10 [ MEM ] Gene Expression Viewer (FireBrowse). CXCL10 ... Chemokine_CXC Chemokine_CXC_CS Chemokine_IL8-like_dom CXC_Chemokine_domain Interleukin_8-like_sf ...
Background and aims: CXC chemokine ligand 10 (CXCL10) also known as chemokine interferon γ inducible protein (IP-10) is a CXCR3 ... were genotyped for the CXCL10_89 and for the CXCL10_90 (AD: n=183; GD: n=82) polymorphism within the CXCL10 gene. Additionally ... Chemokine CXCL10 gene polymorphisms in Addisons disease. Dilek Sadet1, Marissa Penna-Martinez1, Alina Kurylowicz3, Jane ... No differences were observed in the genotype-frequencies for CXCL10_90 and CXCL10_89 polymorphisms in Graves disease. ...
CXCL10 is a 10 kDa protein and is also known as Interferon γ-induced protein 10 (IP-10) or small-inducible cytokine B10. This ... The CXCR3 receptor also binds the IFN γ inducible chemokines CXCL9 and CXCL11 and the platelet-derived chemokines CXCL4 and ... CXCL10 is a 10 kDa protein and is also known as Interferon γ-induced protein 10 (IP-10) or small-inducible cytokine B10. This ... CXCL10 assay is a solid phase enzyme linked immunoassay which has been validated in the laboratory for measurement in human ...
The CXCL10/CXCR3 Chemokine Pathway is Required for the Generation and Protective Function of Tissue-Resident Memory CD103+CD8+ ... The CXCL10/CXCR3 Chemokine Pathway is Required for the Generation and Protective Function of Tissue-Resident Memory CD103+CD8+ ... Lbachir BenMohamed, Anthony B. Nesburn, Ruchi Srivastava; The CXCL10/CXCR3 Chemokine Pathway is Required for the Generation and ... chemokine specifically in TG and COR rescued the number and promoted the protective function of CD103+CD8+ TRM cells in CXCL10 ...
The extracellular domain of human CXCL10 (AAH10954.1)(Val22-Pro98) is fused to the N-terminus of the Fc region of human IgG1 ... CXCL10-4341D. Recombinant Dolphin CXCL10 Protein. +Inquiry. CXCL10-01H. Recombinant Human CXCL10 Protein, Myc/DDK-tagged. + ... CXCL10. Synonyms :. CXCL10; chemokine (C-X-C motif) ligand 10; INP10, SCYB10, small inducible cytokine subfamily B (Cys X Cys ... Recombinant Human Chemokine (C-X-C Motif) Ligand 10, HIgG1 Fc-tagged. CXCL10 Related Products By Species ...
Targeting the Chemokine Receptor CXCR3 and Its Ligand CXCL10 in the Central Nervous System: Potential Therapy for Inflammatory ... Title: Targeting the Chemokine Receptor CXCR3 and Its Ligand CXCL10 in the Central Nervous System: Potential Therapy for ... Torben Lykke Sørensen, " Targeting the Chemokine Receptor CXCR3 and Its Ligand CXCL10 in the Central Nervous System: Potential ... Keywords:chemokines, chemokine receptors, multiple sclerosis. Abstract: Multiple sclerosis is an inflammatory disease of the ...
Chemokine CXCL10 Equivalent Terms Chemokine, CXCL10 , Chemokine (C-X-C Motif) Ligand 10 , Chemokine IP-10, CXC , CXC Chemokine ... ChemokinesChemokines, CXC ← Chemokine CXCL10 2.. Chemicals ← Biological Factors ← Inflammation MediatorsChemokines ← ... IP 10 , CXC Chemokine IP-10 , CXCL10 Chemokine , CXCL10, Chemokine , Cytokine IP 10 Protein , Cytokine IP-10 Protein , gammaIP ... Chemokine CXCL10 3.. Chemicals ← Biological Factors ← Intercellular Signaling Peptides and ProteinsCytokinesChemokines ← ...
Key words: chemokines, pregnancy, inflammation, flow cytometry, Rh(o) antigen, genotyping techniques, hemolytic disease of the ... CXCL8 levels were significantly higher (P,0.004) and CXCL9 (P,0.008) and CXCL10 (P,0.003) levels were significantly lower in ... Further studies of serum chemokines and placenta tissue could provide a better understanding of the cells involved in the ... CXCL8, CXCL9, CCL5, and CXCL10 levels were determined from cell culture supernatants by flow cytometry in 46 (30 non- ...
... chemokines often bind more than one chemokine receptor, and chemokine receptors typically bind more than one class of chemokine ... To detect these chemokines or chemokine receptors, Western blotting was performed using rabbit anti-murine chemokine Abs ( ... CXCL10 and CCL7 mediate O3-induced neutrophilic inflammation. To evaluate the role of the six chemokines up-regulated by O3 in ... This group of chemokines includes CXCL10 (10.6-fold increase, p ≤ 0.01), CCL3 (3.9-fold increase, p ≤ 0.05), and CCL7 (13.1- ...
C-X-C Motif Chemokine Ligand 10, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The ... Genes that share phenotypes with CXCL10: view Animal Models for CXCL10 Gene. MGI Knock Outs for CXCL10:. * Cxcl10 Cxcl10,tm1Adl ... Aliases for CXCL10 Gene Aliases for CXCL10 Gene. * C-X-C Motif Chemokine Ligand 10 2 3 5 ... Summaries for CXCL10 Gene Entrez Gene Summary for CXCL10 Gene. * This antimicrobial gene encodes a chemokine of the CXC ...
Compare C-C motif chemokine ligand 2 ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, ... Chemokine CC-1, Chemokine CC-3, Small Inducible Cytokine Subfamily A (Cys-Cys) Member 14) ... Chemokine CC-1, Chemokine CC-3, Small Inducible Cytokine Subfamily A (Cys-Cys) Member 14) ... C-C motif chemokine ligand 2 ELISA Kits. The ELISA (enzyme-linked immunosorbent assay) is a well-established antibody-based ...
Compare X-C motif chemokine ligand 2 ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, ... X-C motif chemokine ligand 2 ELISA Kits. The ELISA (enzyme-linked immunosorbent assay) is a well-established antibody-based ... Your search returned 394 X-C motif chemokine ligand 2 ELISA Kit across 24 suppliers. ... CXCL10 / IP-10 / CRG-2. *. Detection Range: 7.8 - 500 pg/mL. *. Reactivity: Mouse ...
The Chemokine CXCL10 and the T Cell Connection. CXCL10 or IP-10 (IFN-γ-induced protein of 10 kDa) is a T cell chemokine and ... Chemokine CXCL10 promotes atherogenesis by modulating the local balance of effector and regulatory T cells. Circulation. 2006; ... Differential Chemokine Receptor Usage by Distinct Monocyte Subsets. *The Transmembrane Chemokine CX3CL1 and its Receptor CX3CR1 ... Differential Chemokine Receptor Usage by Distinct Monocyte Subsets. *The Transmembrane Chemokine CX3CL1 and its Receptor CX3CR1 ...
This review will focus on recent murine and human studies that use chemokines as therapeutic anti-cancer vaccine adjuvants. ... Recent discoveries in the many biological roles of chemokines in tumor immunology allow their exploitation in enhancing ... This knowledge, combined with advances in gene therapy and virology, allows researchers to employ chemokines as potential ... was genetically fused to chemokines CCL7, CXCL10 [54] and CCL20 [53]. Immunization with chemokine-sFv protein elicited a T-cell ...
CXCL10 is a small proinflammatory, proangiogenic, interferon γ- (IFN-γ-) inducible chemokine that has been implicated in the ... 5. C Chemokines. The C chemokines are XCL1 (lymphotactin-α) and XCL2 (lymphotactin-β). The single receptor to which these ... In contrast to its upregulatory action on CXCL10 gene expression, tetrac in the case of other chemokines reviewed here serves ... T. L. Sørensen, F. Sellebjerg, C. V. Jensen, R. M. Strieter, and R. M. Ransohoff, "Chemokines CXCL10 and CCL2: differential ...
Examples are: CXCL-8, CCL2, CCL3, CCL4, CCL5, CCL11, CXCL10. The main function of chemokines is to manage the migration of ... C4-CC chemokines), but a small number of CC chemokines possess six cysteines (C6-CC chemokines). C6-CC chemokines include CCL1 ... The third group of chemokines is known as the C chemokines (or γ chemokines), and is unlike all other chemokines in that it has ... CCL1 for the ligand 1 of the CC-family of chemokines, and CCR1 for its respective receptor. The CC chemokine (or β-chemokine) ...
Chemokine CXCL10 * Chemokines, CXC / antagonists & inhibitors * Chemokines, CXC / biosynthesis * Chemokines, CXC / physiology ... We conclude that CXCL10 plays a critical role in recruitment of T lymphocytes to sites of spinal cord injury, and that a ... Here, we show that the T-lymphocyte chemoattractant CXCL10 is upregulated after dorsal hemisection injury to the adult ... mammalian spinal cord of C57/BL6 mice, and that antibody neutralization of CXCL10 beginning 1 day prior to injury dramatically ...
Chemokine CCL2 * Chemokine CXCL10 * Cxcl10 protein, mouse * DNA Primers * Receptors, LDL * Receptors, Prostaglandin E, EP4 ... Aim: prostaglandin E(2), by ligation of its receptor EP4, suppresses the production of inflammatory cytokines and chemokines in ...
The gene for CXCL10 is located on human chromosome 4 in a cluster among several other CXC chemokines. CXCL10 is secreted by ... C-X-C motif chemokine 10 (CXCL10) also known as Interferon gamma-induced protein 10 (IP-10) or small-inducible cytokine B10 is ... Booth V, Keizer DW, Kamphuis MB, Clark-Lewis I, Sykes BD (August 2002). "The CXCR3 binding chemokine IP-10/CXCL10: structure ... Human CXCL10 genome location and CXCL10 gene details page in the UCSC Genome Browser. Farber JM (March 1997). "Mig and IP-10: ...
C-X-C motif chemokine 10 (CXCL10), IL-6, TNFα and interleukin 12 p70 subunit (IL12p70) [17]. The induction of pro-inflammatory ...
Higher circulating levels of chemokines CXCL10, CCL20 and CCL22 in patients with ischemic heart disease.. Safa A1, Rashidinejad ... These results showed that the higher levels of CXCL10, CCL20 and CCL22 were associated with IHD. The serum levels of chemokines ... The frequency of the GG genotype at SNP rs4508917 in CXCL10 gene was higher, whereas the frequency of the AA genotype at SNP ... The mean serum concentrations of CXCL10, CCL20 and CCL22 in AMI patients (395.97±21.20Pg/mL, 108.38±10.31Pg/mL and 1852.58± ...
IP-10/CXCL10, I-TAC/CXCL11, LIF, LIGHT/TNFSF14, Lymphotactin/XCL1, MCP-2/CCL8, MCP-3/CCL7, MCP-4/CCL13, MDC/CCL22, MIF, MIP-3,i ... which allows the simultaneous determination of 40 chemokines per sample. The sets consist of the following chemokines: 6Ckine/ ... i,Results.,/i, We showed possible implication of 4 chemokines, that is, HCC-4, I-TAC, MIP-3,i,α,/i,, and TARC in women with ... i,Conclusion.,/i, On the basis of our findings, it seems that the chemokines may play role in the pathogenesis of preterm labor ...
Chemokine and chemokine receptor genes such as CXCL10, CCL5, CCL2 and CCR2 constitute a prominent group in the immune signature ... TNF-α and TLR3 ligands are potent inducers of the survival-associated chemokines CXCL10, CCL5 and CCL2. These chemokines ... The three chemokine genes were transcribed in both tumor cells and TIL (FIG. 10, A). Furthermore, when CXCL10 and CCL5 ... These chemokines (CXCL10, CCL5 and CCL2) could recruit immune cells, which display anti-tumor activity reflected by enhanced ...
Humans , Chemokine CXCL10/blood , Zika Virus Infection/complications , Gene Expression , Chemokines/immunology , Zika Virus ... Full text: Available Index: LILACS (Americas) Main subject: Chemokine CXCL10 / Zika Virus Infection Limits: Humans Language: ... Full text: Available Index: LILACS (Americas) Main subject: Chemokine CXCL10 / Zika Virus Infection Limits: Humans Language: ... High-dimensional data analysis further identified CXCL10, a chemokine involved in foetal neuron apoptosis and Guillain-Barré ...
Evidence shows that chemokines CXCL10, CXCL11 and their receptor CXCR3 are involved in severity of dengue, but their genetic ... Common variants of chemokine receptor gene CXCR3 and its ligands CXCL10 and CXCL11 associated with vascular permeability of ... rs4859584 and rs8878 (CXCL10) were significantly associated with vascular permeability of dengue infection (P,0.05); while ... of gene CXCL10 and "AGTTTAC" of CXCL11 were found to be significantly associated with vascular leakage (P=0.0154 and 0.0366 ...
Abstract 2048CXCL10, also known as interferon gamma inducible protein 10, is a chemokine secreted by several cell types ... CXCL10, also known as interferon gamma inducible protein 10, is a chemokine secreted by several cell types including monocytes ... The Association of a Single Nucleotide Polymorphism in the Chemokine CXCL10 Gene with Transplant Outcomes After HLA-Matched ... The Association of a Single Nucleotide Polymorphism in the Chemokine CXCL10 Gene with Transplant Outcomes After HLA-Matched ...
  • Inflammatory stimuli, such as TNFα, have also been shown to induce CXCL10 expression (Nestle et al. (atlasgeneticsoncology.org)
  • Then determination of the balance between the agonists and the antagonist forms is of interest in monitoring the role of CXCL10 in cancer and inflammatory diseases (Casrouge et al. (atlasgeneticsoncology.org)
  • CXCL10 have been found to be implicated in several diseases, from solid and hematopoietic tumors to inflammatory or neurodegenerative disorders (Van Raemdonck et al. (bioclinica.com)
  • Chemokines -chemoattractant cytokines - regulate the inflammatory composite of the MS lesion. (eurekaselect.com)
  • Thus, this study aimed to evaluate levels of inflammatory chemokines in RhD − pregnant women with erythrocyte alloimmunization. (frontiersin.org)
  • Chemokines are essential to stimulate chemotaxis of leukocytes and initiate inflammatory responses ( 1 , 2 ). (frontiersin.org)
  • Thus, analysis of inflammatory chemokines could provide a better understanding of the pathogenesis of maternal erythrocyte alloimmunization. (frontiersin.org)
  • The 0.8 ppm O 3 up-regulated lung mRNA of CXCL1,2,3 (mouse growth-related oncogene-α and macrophage-inflammatory protein-2), CXCL10 (IFN-γ-inducible protein-10), CCL3 (macrophage-inflammatory protein-1α), CCL7 (monocyte chemoattractant protein-3), and CCL11 (eotaxin) at 0 h postexposure, and expression of CXCL10, CCL3, and CCL7 mRNA was sustained 18 h postexposure. (jimmunol.org)
  • Chemokines can be located in different vascular cell types, eg, endothelial cells (ECs) but also inflammatory cells and can be detected within atherosclerotic lesions, where they function as messengers to direct leukocytes to sites of inflammation but may also control homeostasis and other activities of emigrated cells. (ahajournals.org)
  • Chemokines are a group of related chemoattractant peptides that are essential regulators of the immune system, both during homeostatic and inflammatory conditions. (mdpi.com)
  • Some inflammatory chemokines have proven essential in memory T cell generation [ 3 ]. (mdpi.com)
  • Fractalkine (CX3CL1) is a chemokine relevant to inflammatory processes in the CNS that are microglia-dependent but also important to normal brain development. (hindawi.com)
  • The chemokine products of these genes are important to vascularity of the brain, particularly of the choroid plexus, to inflammatory processes in the CNS and, in certain cases, to neuroprotection. (hindawi.com)
  • We propose that actions of thyroid hormone and hormone analogues on chemokine gene expression contribute to regulation of inflammatory processes in brain and of brain blood vessel formation and maintenance. (hindawi.com)
  • prostaglandin E(2), by ligation of its receptor EP4, suppresses the production of inflammatory cytokines and chemokines in macrophages in vitro. (nih.gov)
  • Some chemokines are considered pro- inflammatory and can be induced during an immune response to recruit cells of the immune system to a site of infection , while others are considered homeostatic and are involved in controlling the migration of cells during normal processes of tissue maintenance or development . (wikipedia.org)
  • Other chemokines are inflammatory and are released from a wide variety of cells in response to bacterial infection, viruses and agents that cause physical damage such as silica or the urate crystals that occur in gout . (wikipedia.org)
  • Inflammatory chemokines function mainly as chemoattractants for leukocytes , recruiting monocytes , neutrophils and other effector cells from the blood to sites of infection or tissue damage. (wikipedia.org)
  • Certain inflammatory chemokines activate cells to initiate an immune response or promote wound healing . (wikipedia.org)
  • Functionally distinct subsets of leukocytes express different chemokine receptors: thus, recently activated, effector and memory T cells express high levels of the receptors that bind inflammatory chemokines, thought to facilitate their accumulation at inflammatory sites, compared to naïve cells. (biomedcentral.com)
  • Finally, an inflammatory component of reperfusion injury was evaluated by means of enzyme-linked immunosorbent assay analysis of candidate chemokines (IP-10, I-TAC, and Mig) and cytokines (IL-6, IL-1beta, and IL-10). (biomedsearch.com)
  • Chemokines are involved in the inflammatory response, tumor immune response, proliferation, invasion and metastasis via modulation of various signaling pathways. (spandidos-publications.com)
  • Chemokines and their receptors were initially thought to allow for an interaction between immune cells and the inflammatory sites ( 11 ). (spandidos-publications.com)
  • These mutant mice may be useful in studies of Th1-type inflammatory disease, chemokine biology, and T cell priming, proliferation, and trafficking. (jax.org)
  • 1997). "CCR6, a CC chemokine receptor that interacts with macrophage inflammatory protein 3alpha and is highly expressed in human dendritic cells" . (wikipedia.org)
  • These chemokines also have a more diverse range of functions compared to inflammatory chemokines. (biolegend.com)
  • In the event of infection, injury, or tissue damage, inflammatory chemokines are often released to address the problem. (biolegend.com)
  • Many inflammatory chemokines attract a wide variety of cells in both the innate and adaptive arms of immunity. (biolegend.com)
  • Upon sensing the inflammatory chemokine, cells will extravasate from the blood vessel and follow the gradient to its source. (biolegend.com)
  • In addition, the upregulated ileal genes of the Lactobacillus -dominant calves were related to leukocyte and lymphocyte chemotaxis, the cytokine/chemokine-mediated signaling pathway, and inflammatory responses, while the upregulated ileal genes of the Bacteroides -dominant calves were related to cell adhesion, response to stimulus, cell communication and regulation of mitogen-activated protein kinase cascades. (asm.org)
  • The Human Inflammatory Protein-10 (Hu IP-10/CXCL10) ELISA quantitates Hu IP-10/CXCL10 in human serum, plasma, saliva, buffered solution, or cell culture medium. (thermofisher.com)
  • CXCL10 is a pro-inflammatory chemoattractant cytokine that attracts activated T lymphocytes. (thermofisher.com)
  • CXCL10 exhibits an angiostatic and an antitumor role that is also involved in Th1 inflammatory diseases, Hashimoto's thyroiditis, Graves' disease and Type 1 diabetes mellitus. (thermofisher.com)
  • for example, CCL20 can act also as pro-inflammatory chemokine. (wikipedia.org)
  • The main function of chemokines is to manage the migration of leukocytes (homing) in the respective anatomical locations in inflammatory and homeostatic processes. (wikipedia.org)
  • Inflammatory: inflammatory chemokines are produced in high concentrations during infection or injury and determine the migration of inflammatory leukocytes into the damaged area. (wikipedia.org)
  • Conclusion This study highlights important inflammatory chemokines involved in regulating neutrophil migration, which may have potential value as therapeutic targets for the treatment of ARDS. (bmj.com)
  • Chemokines produced in inflammatory tissues and lead to the accumulation of CCR5 + Tregs in tumor microenvironment ( 2, 8 ). (aacrjournals.org)
  • Haplotype blocks were constructed for genes CXCL10 and CXCL11 (5 and 7 common variants respectively). (cdc.gov)
  • Haplotype association tests performed revealed that, "CCCCA" of gene CXCL10 and "AGTTTAC" of CXCL11 were found to be significantly associated with vascular leakage (P=0.0154 and 0.0366 respectively). (cdc.gov)
  • In summary, our association study further strengthens the evidence of the involvement of CXCL10 and CXCL11 in the pathogenesis of dengue infection. (cdc.gov)
  • PTB individuals with bilateral or cavitary disease displayed significantly elevated levels of CCL1, CCL3, CXCL1, CXCL10 and CXCL11 compared to those with unilateral or non-cavitary disease and also exhibited a significant positive relationship with bacterial burdens. (nature.com)
  • It is a chemokine receptor that binds CXCL9, CXCL10, and CXCL11. (fluidigm.com)
  • Once at the site of injury, immune cells can react by releasing additional cytokines and chemokines, bringing more cells into the fold. (biolegend.com)
  • Mϕ play a crucial role in human host defense by secreting cytokines and chemokines, presenting antigen to T lymphocytes and clearing infectious agents. (pnas.org)
  • Cytokines and chemokines are the primary form of signaling between a wide variety of cells. (prosci-inc.com)
  • Using antibodies to study cytokines and chemokines has given us a far greater understanding into signaling pathways. (prosci-inc.com)
  • A panel of cytokines and chemokines was accessed by enzime-linked immunosorbent assay (ELISA) test in the serum of a subgroup of patients with and without leprosy reactions. (scielo.br)
  • All together our data points that the tested TLR markers may have a regulatory role in the immunity against Mycobacterium leprae, by driving the host's production of key cytokines and chemokines involved in the pathogenesis of this disease. (scielo.br)
  • These events are mediated via the generation of adhesion molecules, cytokines, and chemokines. (ahajournals.org)
  • CXCL8, CXCL9, CCL5, and CXCL10 levels were determined from cell culture supernatants by flow cytometry in 46 (30 non-alloimmunized RhD − and 16 previously alloimmunized RhD − ) pregnant women. (frontiersin.org)
  • The role of the CC chemokine ligand-5 (CCL5/RANTES) and its receptors CCR1 and CCR5 in atherosclerosis have been addressed in a number of studies. (ahajournals.org)
  • This study focuses upon three chemokines, namely CCL5, CXCL10 and CCL3, which are potential novel therapeutic targets in arthritis. (biomedcentral.com)
  • All three of these chemokines are highly expressed at the level of mRNA, with the most significant increase in mRNA levels being demonstrated for CCL5 when compared with matched peripheral blood samples and controls. (biomedcentral.com)
  • Levels of mRNAs for CCL2, CCL3L1, CCL4, CXCL10, CCR1 and CCR5 were significantly increased in at least one time point following infection in two experiments and CCL5, CCR9 and CXCR4 mRNA were significantly increased in one of the experiments. (beds.ac.uk)
  • T helper 1 (Th1) clones, established from the CSF of individuals with IND and from a healthy subject, similarly migrated to CXCL10, CXCL12, and CCL5. (prohealth.com)
  • Biochemical Analysis of C-X-C Motif Chemokine Ligand 10 (CXCL10) as a Biomarker in Patients with Rheumatoid Arthritis. (nih.gov)
  • CXCL10 (C-X-C Motif Chemokine Ligand 10) is a Protein Coding gene. (genecards.org)
  • CXCL10 , hemokin (C-X-C motiv) ligand 10 , ili IP-10 [1] je mali citokin iz CXC hemokin familije koji je takođe poznat kao 10 kDa interferon-gama-inducirani protein (γ-IP10 ili IP-10). (wikipedia.org)
  • CXCL10 gene, localized on the chromosome 4 at band q21, was originally described in 1985 by Luster (Luster et al. (atlasgeneticsoncology.org)
  • 2006). Multiple alignment sequences of pig, human, mouse, goat and sheep of CXCL10 gene product shows 86, 74, 72, 82 and 83% of homology respectively (Yang et al. (atlasgeneticsoncology.org)
  • Therefore, we investigated the role of CXCL10 gene polymorphisms in patients with Addison s disease (AD) and in patients with Graves disease (GD). (endocrine-abstracts.org)
  • n =82) polymorphism within the CXCL10 gene. (endocrine-abstracts.org)
  • Conclusion: CXCL10_89 gene polymorphism was significantly associated with Addison s disease in the German population but not with Graves disease. (endocrine-abstracts.org)
  • Our results point out that CXCL10 could be a candidate gene in the pathogenesis of Addison s disease. (endocrine-abstracts.org)
  • Gene Ontology (GO) annotations related to this gene include signaling receptor binding and chemokine activity . (genecards.org)
  • This knowledge, combined with advances in gene therapy and virology, allows researchers to employ chemokines as potential vaccine adjuvants. (mdpi.com)
  • The single nucleotide polymorphism (SNP) rs3921 located in the 3'-untranslated region of the CXCL10 gene has been reportedly associated with acute GVHD and with invasive aspergillosis after allogenic stem-cell transplantation. (ashpublications.org)
  • Together, these results provide insight into chemokine-induced gene activation and identify potentially novel functions for known genes in chemokine biology. (biomedcentral.com)
  • Chemokine receptor 6 also known as CCR6 is a CC chemokine receptor protein which in humans is encoded by the CCR6 gene . (wikipedia.org)
  • CXCR6 was formerly called three different names (STRL33, BONZO, and TYMSTR) before being assigned CXCR6 based on its chromosomal location (within the chemokine receptor cluster on human chromosome 3p21) and its similarity to other chemokine receptors in its gene sequence. (wikipedia.org)
  • This gene encodes a G protein-coupled receptor with selectivity for three chemokines, termed IP10 (interferon-g-inducible 10 kDa protein), Mig (monokine induced by interferon-g) and I-TAC (interferon-inducible T cell a-chemoattractant). (fishersci.com)
  • The results showed that greatest fold increases in mRNAs for CXCL10 and CCL2 were observed following infection of pigs. (beds.ac.uk)
  • CoMTsAg, but not control conditioned medium, stimulated astrocyte CCL2/MCP-1 (161.5 ± 16 ng/ml), CXCL8/IL-8 (416 ± 6.2 ng/ml), and CXCL10/IFN-γ-inducible protein (9.07 ± 0.6 ng/ml) secretion after 24 h, whereas direct astrocyte or neutrophil stimulation with TsAg had no effect. (jimmunol.org)
  • ASA treatment also reduced the MDSC-attracting chemokine CCL2 (C-C motif ligand 2) in the TME along with numbers of CD11b + Ly6G hi Ly6C lo granulocytic MDSCs in both the bone marrow and the TME. (aacrjournals.org)
  • In addition, evaluating the association between different genotypes of the TLR1, 2 and 4 markers and cytokine/chemokine serological levels, IL-17 appears as an immunological marker regulated by the polymorphism of the three TLR genes evaluated, whereas different TLR1 genotypes were associated with differential production of IL-12p40 and MCP-1(CCL2). (scielo.br)
  • PTB individuals exhibited significantly higher levels of CCL1, CCL3, CXCL1, CXCL2, CXCL9 and CXCL10 in comparison to LTB and/or HC individuals. (nature.com)
  • The aim of this study was to evaluate the CXCL10, CCL20 and CCL22 levels and the single nucleotide polymorphisms (SNPs) rs4508917, rs6749704 and rs4359426 in chemokine genes in patients with IHD to clarify any association. (cdc.gov)
  • These chemokine-modulated genes were further verified using quantitative RT-PCR and Western blot analysis. (biomedcentral.com)
  • Following removal of redundant and non-informative clones, seventeen mRNAs were found to be differentially expressed post treatment with either chemokine ligand with several representing known genes with established functions. (biomedcentral.com)
  • Twenty-one genes were upregulated in these transfected Jurkat cells following both CXCL12 and CXCL10, four genes displayed a discordant response and seven genes were downregulated upon treatment with either chemokine. (biomedcentral.com)
  • Upregulation of genes for interferon (IFN)-γ and CXC chemokine receptor (CXCR)3 expression, two crucial molecules in sarcoid inflammation and granuloma formation, is directly controlled by the T-helper (Th)1 transcription factor T-bet (T-box, expressed in T-cells). (ersjournals.com)
  • In Crohn's disease high tissue expression and serum levels of chemokines and their receptors are known to correlate with disease activity. (nih.gov)
  • In patients with Hashimoto s thyroiditis, type 1 diabetes mellitus and Graves disease high levels of CXCL10 ligand in serum have been found. (endocrine-abstracts.org)
  • CXCL10 assay is a solid phase enzyme linked immunoassay which has been validated in the laboratory for measurement in human serum. (bioclinica.com)
  • Further studies of serum chemokines and placenta tissue could provide a better understanding of the cells involved in the pathogenesis of maternal erythrocyte alloimmunization. (frontiersin.org)
  • To assess the concentration of chemokines in the blood serum, we used a multiplex method, which allows the simultaneous determination of 40 chemokines per sample. (hindawi.com)
  • Serum samples from all participants were tested for the CXCL10, CCL20 and CCL22 levels by using ELISA. (cdc.gov)
  • CXCL10 protein was also detected in serum from pigs infected with the high virulence Benin 97/1 isolate. (beds.ac.uk)
  • IP-10 (CXCL10) in vitro SimpleStep ELISA (Enzyme-Linked Immunosorbent Assay) kit is designed for the quantitative measurement of IP-10 protein in mouse serum, plasma and cell culture supernatants. (abcam.com)
  • 2015. Peripheral blood cells from patients with autoimmune Addison's disease poorly respond to interferons in vitro, despite elevated serum levels of interferon-inducible chemokines. (uib.no)
  • Since the role of chemokines in atherosclerotic vascular disease has been reviewed in this journal, significant progress has been accomplished in defining the regulation of chemokine expression and function in atherosclerosis. (ahajournals.org)
  • The considerable leap in insight over recent years leads us to anticipate further advances in comprehending the role of chemokines in atherosclerosis, allowing targeted interventions for its prevention and therapy. (ahajournals.org)
  • The major role of chemokines is to act as a chemoattractant to guide the migration of cells. (wikipedia.org)
  • To decipher the role of chemokines in TB infection and disease, we measured the levels of chemokines in PTB, LTB and HC individuals. (nature.com)
  • CXCL10 is also named 10kDa interferon γ-induced protein (IP-10), as its secretion by CD4+, CD8+, NK and NK-T cells is dependent on IFN-γ , which is itself mediated by the IL-12 cytokine family. (atlasgeneticsoncology.org)
  • Transcription CXCL10, also named IP-10 for Interferon-g-inducible protein 10, is induced by a large range of innate and adaptive immune stimuli that induce the production of IFN type-1 and tye-2. (atlasgeneticsoncology.org)
  • 2003). The CXCL10 promoter includes response element for Interferon Regulatory Factor (IRF)1 and for many other transcription factor such as NF-κB , STAT-1 , AP-1, FoxA2a, FoxF2 , FHXA/FHXB-1, FHXA/FHXB-2 and CEBP (Lu et al. (atlasgeneticsoncology.org)
  • CXCL10 is a 10 kDa protein and is also known as Interferon γ-induced protein 10 (IP-10) or small-inducible cytokine B10. (bioclinica.com)
  • A CXC chemokine that is induced by GAMMA-INTERFERON and is chemotactic for MONOCYTES and T-LYMPHOCYTES. (ctdbase.org)
  • CXCL10, also known as interferon gamma inducible protein 10, is a chemokine secreted by several cell types including monocytes, endothelial cells and fibroblasts that plays important roles in the stimulation and migration of natural killer cells and T cells. (ashpublications.org)
  • C-X-C motif chemokine 10 (CXCL10 or IP-10) is a small 10.8kD protein that is secreted by several cell types in response to interferon-gamma (IFNg). (abcam.com)
  • The immunobiology of interferon-gamma inducible protein 10 kD (IP-10): a novel, pleiotropic member of the C-X-C chemokine superfamily. (wikipedia.org)
  • A key role in granuloma formation is played by interferon (IFN)-γ [ 3 ] and T-helper (Th) type-1 cells accumulating in the sarcoid lungs, which express chemokine receptor CXC chemokine receptor (CXCR)3 [ 4 ]. (ersjournals.com)
  • Chemokine receptors can be subdivided into specific families based on their specificity for C, CC, CXC, or CX3C chemokine ligands. (biomedcentral.com)
  • The chemokine SDF-1/CXCL12 binds to and signals through the orphan receptor RDC1 in T lymphocytes, J Biol Chem, 2005, 280:35760-35766. (wikipedia.org)
  • However, very little is known about chemokines that orchestrate oxidative stress-induced neutrophilic airway inflammation in vivo. (jimmunol.org)
  • These findings indicate that CCL7 and CXCL10, two chemokines not previously reported to orchestrate neutrophilic inflammation, play a critical role in mediating oxidative stress-induced neutrophilic airway inflammation. (jimmunol.org)
  • Recruitment of leukocytes is one of the earliest events in the pathogenesis of ischemic heart disease (IHD) and chemokines play an important role in the migration of these cells into the inflammation sites. (cdc.gov)
  • Urinary biomarker CXCL10, identifying site specific allograft inflammation in renal transplantation. (amedeo.com)
  • Urinary CXCL10 chemokine is associated with alloimmune and virus compartment-specific renal allograft inflammation. (amedeo.com)
  • CXCR4 (also known as fusin) is the receptor for a chemokine known as CXCL12 (or SDF-1) and, as with CCR5, is utilized by HIV-1 to gain entry into target cells. (wikipedia.org)
  • Because the accumulation of Tregs at the tumor site is, in part, due to selective recruitment through CCR5- and CCR5-associated chemokines, we investigated the role of CCR5 in the SCC development. (aacrjournals.org)
  • CXCL10 belongs to the CXC subfamily chemokine containing a single and variable amino acid between the two first of four highly conserved cysteine residues. (atlasgeneticsoncology.org)
  • They represent one subfamily of chemokine receptors, a large family of G protein-linked receptors that are known as seven transmembrane (7-TM) proteins, since they span the cell membrane seven times. (wikipedia.org)
  • Our cytokine and chemokine antibodies are quality controlled and tested in the application such as western blotting, ELISA, IF, IHC, and ICC. (prosci-inc.com)
  • Your search returned 1131 C-C motif chemokine ligand 2 ELISA ELISA Kit across 31 suppliers. (biocompare.com)
  • Your search returned 394 X-C motif chemokine ligand 2 ELISA Kit across 24 suppliers. (biocompare.com)
  • The contribution of the transmembrane chemokines CX 3 CL1 and CXCL16 with their respective receptors CX 3 CR1 and CXCR6 in the recruitment of T cell and monocyte subsets and shear-mediated plaque modulation will be discussed. (ahajournals.org)
  • All of these proteins exert their biological effects by interacting with G protein -linked transmembrane receptors called chemokine receptors , that are selectively found on the surfaces of their target cells. (wikipedia.org)
  • Chemokines receptors are seven transmembrane spanning G protein-coupled receptors that allow cells to migrate towards increasing chemokine gradients. (biolegend.com)
  • There were no significant differences between men and women or between patients who treated with statin, aspirin, β-blockers or angiotensin converting enzyme (ACE) inhibitors and patients without mentioned treatment regarding the levels of chemokines. (cdc.gov)
  • Most chemokines bind to more than one receptor, while most receptors also display overlapping ligand specificity [ 5 ]. (mdpi.com)
  • Chemokines bind to a variety of different receptors, which belong to the G-protein-binding receptor family, and there are ~23 types of chemokine receptors that have been discovered ( 10 ). (spandidos-publications.com)
  • Use this table to quickly identify the chemokines that bind to each receptor. (biolegend.com)
  • CXC chemokine receptors are integral membrane proteins that specifically bind and respond to cytokines of the CXC chemokine family. (wikipedia.org)
  • Proteases, growth factors, chemokines, lipid-binding proteins, and pathogen proteins are among the numerous proteins that bind heparin ( Table ). (ahajournals.org)
  • Thus, migration of T cells under a chemokine gradient into an inflamed site such as the joint in JIA may itself lead to further T cell activation. (biomedcentral.com)
  • After binding to the receptors, chemokines primarily serve a role in migration of leukocytes, such as monocytes, eosinophils and dendritic cells (DCs) ( 11 ). (spandidos-publications.com)
  • A major rol of chemokines is to act as chemoattractants in guiding migration of cells. (wikipathways.org)
  • Chemokines are functionally divided into two groups: Homeostatic: are constitutively produced in certain tissues and are responsible for basal leukocyte migration. (wikipedia.org)
  • Binding of chemokines to this protein induces cellular responses that are involved in leukocyte traffic, most notably integrin activation, cytoskeletal changes and chemotactic migration. (fishersci.com)
  • The chemokines, by virtue of their specific cell receptor expression, can selectively mediate the local recruitment/activation of distinct leukocytes/cells, allowing for migration across the endothelium and beyond the vascular compartment. (ahajournals.org)
  • A complex chemokine-chemokine receptor interaction is involved with immune cell migration to tumor microenvironment ( 7 ). (aacrjournals.org)
  • Chemokines belong to a large group of structurally related and secretable, largely basic, chemotactic cytokines, which can be divided into 4 families (CC, CXC, CX 3 C, XC) based on the position of the first 2 cysteine residues. (ahajournals.org)
  • To date, >50 chemokines have been found, which can be divided into four families: CXC, CX3C, CC and XC, according to the different positions of the conserved N‑terminal cysteine residues. (spandidos-publications.com)
  • 50 chemokines have been identified, which can be divided into four families: CXC, CX3C, CC and XC, based on the different positions of the conserved N-terminal cysteine residues ( 9 ). (spandidos-publications.com)
  • Proteins are classified as chemokines according to shared structural characteristics such as small size (they are all approximately 8-10 kilodaltons in size), and the presence of four cysteine residues in conserved locations that are key to forming their 3-dimensional shape. (wikidoc.org)
  • All chemokines share a typical Greek key structure that is stabilised by disulphide bonds between conserved cysteine residues. (wikidoc.org)
  • Intramolecular disulphide bonds typically join the first to third, and the second to fourth cysteine residues, numbered as they appear in the protein sequence of the chemokine. (wikidoc.org)
  • This pathway was inferred from Mus musculus pathway "Chemokine signaling pathway", WP2292 revision 89521, with a 91.0% conversion rate. (wikipathways.org)
  • Finally, Cxcl10 -deficient mice exhibited reduced CTL infiltration of tumors, establishing that CXCL10 limited this pathway of immunosuppression. (aacrjournals.org)
  • However, it is unknown whether the COX-2 pathway affects chemokine expression profiles that are responsible for MDSC accumulation in the TME. (aacrjournals.org)
  • Our findings in this study implicate significance of the COX-2 pathway in gliomagenesis through chemokine-mediated immune cell infiltration in the TME. (aacrjournals.org)
  • Taken together, our results imply that blocking the PD-1 pathway can increase IFN-γ at the tumor site, thereby increasing chemokine-dependent trafficking of immune cells into malignant disease sites. (aacrjournals.org)
  • We selected most pathways Ccl21c participated on our site, such as Cytokine-cytokine receptor interaction, Chemokine signaling pathway, NF-kappa B signaling pathway, which may be useful for your reference. (creativebiomart.net)
  • We examined the plasma levels of chemokines in individuals with PTB, latent TB (LTB) or healthy controls (HC) and their association with disease severity and mycobacterial burdens in PTB. (nature.com)
  • CXCL10 is a secreted protein present in body fluids and in tissues. (atlasgeneticsoncology.org)
  • Homeostatic chemokines are constitutively expressed in particular organs or tissues. (biolegend.com)
  • Specific chemokine receptors are often required to gain entry (or exit) from certain organs and tissues like the thymus and bone marrow. (biolegend.com)
  • Basal: homeostatic chemokines are basal produced in the thymus and lymphoid tissues. (wikipedia.org)
  • CXCL10, CXCL12, and CCL19 were increased in the CSF of individuals with neuroinflammation. (prohealth.com)
  • Here, the use of the C-C motif chemokine ligand 25 (CCL)25 in comparison to differentiation factors such as transforming growth factor (TGF)β3, bone morphogenetic protein (BMP)2, BMP7, BMP12, and BMP14 (all in concentrations of 10, 50 and 100 ng/mL) was tested in an in vitro micro mass pellet model with isolated and cultivated human AF-cells ( n = 3) to induce and enhance AF-matrix formation. (mdpi.com)
  • Chemokines (Greek -kinos , movement) are a family of small cytokines , or signaling proteins secreted by cells . (wikipedia.org)
  • Cytokine proteins are classified as chemokines according to behavior and structural characteristics. (wikipedia.org)
  • Chemokines are a class of small molecular proteins with similar structures, functions and chemotactic properties, and their molecular weights are ~10 kDa, and chemokines represent the largest member of the cytokine family ( 9 ). (spandidos-publications.com)
  • Chemokines are a family of small cytokines , or proteins secreted by cells . (wikidoc.org)
  • Proteins are classified into the chemokine family based on their structural characteristics, not just their ability to attract cells. (wikidoc.org)
  • Typical chemokine proteins are produced as pro-peptides , beginning with a signal peptide of approximately 20 amino acids that gets cleaved from the active (mature) portion of the molecule during the process of its secretion from the cell. (wikidoc.org)
  • Chemokines are small cytokines, or signaling proteins, secreted by cells. (wikipathways.org)
  • Recent discoveries in the many biological roles of chemokines in tumor immunology allow their exploitation in enhancing recruitment of antigen presenting cells (APCs) and effector cells to appropriate anatomical sites. (mdpi.com)
  • Thus, chemokines and their receptors directly or indirectly shape the tumor cell microenvironment, and regulate the biological behavior of the tumor. (spandidos-publications.com)
  • Lung metastases deplete certain kinds of chemokines from their local environment, which means the signal that should attract beneficial white blood cells to fight the tumor is gone," said Anvay Ukidve, another researcher involved in the study. (medgadget.com)
  • We hypothesized that providing that chemokine signal at the tumor site could help restore the body's normal immune response and enable it to attack the tumors. (medgadget.com)
  • While anti-PD-1 did not reduce the number of immunosuppressive regulatory T cells and myeloid-derived suppressor cells present in tumor-bearing mice, we found that it increased expression of IFN-γ and CXCL10 at the tumor site. (aacrjournals.org)
  • Because statins can reduce chemokine expression in patients with coronary diseases, we wanted to test whether this can be achieved in patients with Crohn's disease. (nih.gov)
  • The aim of the study was to analyse the expression and production of these three chemokines within the joints of children with juvenile idiopathic arthritis (JIA) of the oligoarticular and polyarticular subtypes. (biomedcentral.com)
  • Modulation of the expression of chemokines and chemokine receptors in whole blood was compared following infection of pigs with high and low virulence isolates of African swine fever virus. (beds.ac.uk)
  • Differential expression of three T lymphocyte-activating CXC chemokines by human atheroma-associated cells. (ebi.ac.uk)
  • Establishment of the TB granuloma is controlled by the synchronized expression of various chemokines. (nature.com)
  • CXCL10 is constitutively expressed at low levels in lymph organs, and the expression is highly induced by IFN- gamma and to some extent by IL12. (thermofisher.com)
  • Chemokine receptor expression on neutrophils from blood or BAL fluid of patients with ARDS was analysed by flow cytometry. (bmj.com)
  • Furthermore, neutrophils isolated from the blood or BAL fluid differentially regulated the cell surface expression of chemokine (C-X-C motif) receptor 1 and C-C chemokine receptor type 2 during ARDS. (bmj.com)
  • The expression of activation markers and of chemokine receptors on T cells homing to the nervous system (NS) may help define their functional state. (prohealth.com)
  • O 3 increased lung protein levels of CXCL10, CCL7, and CCR3 (CCL7R). (jimmunol.org)
  • Increased levels of CXCL10 may either contribute to the activation of lymphocyte priming toward the Th1 phenotype or induction of T lymphocyte apoptosis. (beds.ac.uk)
  • Of the 13 substances investigated, only CXCL10 was found to be significantly reduced (by 34%, p = 0.026) in all of the treated patients. (nih.gov)
  • The donor CXCL10 genotypes did not significantly influence the transplant outcomes. (ashpublications.org)
  • Finally, the chemokines were significantly reduced following successful ATT. (nature.com)
  • The first two cysteines, in a chemokine, are situated close together near the N-terminal end of the mature protein, with the third cysteine residing in the centre of the molecule and the fourth close to the C-terminal end . (wikidoc.org)
  • This review focuses on the present data regarding CXCL10 (previously known as IP-10) and CXRC3 in multiple sclerosis, since consistent data has suggested that this chemokine/chemokine receptor pair has a pivotal role in leukocyte recruitment into the central nervous system (CNS) in multiple sclerosis. (eurekaselect.com)
  • Chemokines are involved in many biological activities ranging from leukocyte differentiation to neuronal morphogenesis. (biomedcentral.com)
  • Chemokines are small secreted chemo-attractant molecules involved in such leukocyte trafficking, as well as playing important roles in lymphoid homeostasis and development [ 6 - 8 ]. (biomedcentral.com)
  • Identification of CXCR4 and CXCL10 as Potential Predictive Biomarkers in Triple Negative Breast Cancer (TNBC). (nih.gov)
  • Higher circulating levels of chemokines CXCL10, CCL20 and CCL22 in patients with ischemic heart disease. (cdc.gov)
  • Infection with L. major in a human monocyte cell line induced robust CXCL10 transcription without increasing extracellular CXCL10 protein concentrations. (frontiersin.org)
  • A family of molecules called chemokines coordinate recruitment of the immune cells required to eliminate infection. (frontiersin.org)
  • employ to suppress host chemokines: a Leishmania- encoded protease cleaves chemokines known to recruit T cells that fight off infection. (frontiersin.org)
  • The increase of the chemokines concentration could be associated not only with infection but also with the mechanism of labor [ 12 ]. (hindawi.com)
  • Chemokines and their receptors in lymphocyte traffic and HIV infection. (ebi.ac.uk)
  • Chemokines are felt to play a major role latent TB infection (LTB) as they appear to be critical in the formation and maintenance of quiescent granulomas 4 and in the recruitment of cells from the periphery for positioning within the granuloma 5 . (nature.com)
  • While a function of chemokines is to regulate lymphocyte trafficking, the view that chemokines act simply as "chemotactic cytokines" has evolved to include the many critical roles they play in regulating innate and adaptive immune responses. (mdpi.com)
  • The chemokine receptor CXCR5 is expressed on B cells and CD4+ Tfh cells and is involved in lymphocyte homing and the development of normal lymphoid tissue. (wikipedia.org)
  • These are known as homeostatic chemokines and are produced and secreted without any need to stimulate their source cell(s). (wikipedia.org)
  • Due to their function of targeting cells to specific organs, homeostatic chemokines can also be involved in cancer and metastasis. (biolegend.com)
  • The fundamental importance of chemokines for atherogenesis, progression, and destabilization of atherosclerotic plaques is now widely appreciated, but the degree of complexity, specificity, and cooperativity harnessed by these signal molecules to govern atherogenic cell recruitment and homeostasis is still being refined. (ahajournals.org)
  • Chemokines are a family of small molecular weight cytokines, which are involved in leukocytes stimulation and chemotactic gradient determining. (hindawi.com)
  • Despite numerous reports describing chemokine function, little is known about the molecular changes induced by cytokines. (biomedcentral.com)
  • All chemokines are small, with a molecular mass of between 8 and 10 kDa . (wikidoc.org)
  • Specifically, GP63 cleaves CXCL10 after amino acid A81 at the base of a C-terminal alpha-helix. (frontiersin.org)
  • They all also possess conserved amino acids that are important for creating their 3-dimensional or tertiary structure , such as (in most cases) four cysteines that interact with each other in pairs to create a Greek key shape that is a characteristic of chemokines. (wikidoc.org)
  • CXCR1 and CXCR2 are closely related receptors that recognize CXC chemokines that possess an E-L-R amino acid motif immediately adjacent to their CXC motif. (wikipedia.org)
  • The ELR + CXC chemokines are potent promoter of angiogenesis, whereas the ELR - chemokine, such as CXCL10, display angiostatic properties (Belperio et al. (atlasgeneticsoncology.org)
  • In addition, CXCL10 has antitumor activity through the inhibition of bone marrow colony formation and angiogenesis. (abcam.com)
  • 1,2 By signaling through G protein-coupled chemokine receptors, chemokines govern a variety of cell responses including cell activation and transmigration in leukocytes, as well as in nonhematopoietic cells. (ahajournals.org)
  • Chemokine signals are transduced by G-protein coupled receptors, which dissociate to activate diverse downstream pathways resulting in cellular polarization and actin reorganization. (wikipathways.org)