AnatomyChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsTechnology, Industry, AgricultureInformation ScienceHealth CareGeographicals
Cellular StructuresCellsElectron Microscope TomographyMicroscopyMicroscopy, FluorescenceOrganellesMicroscopy, Fluorescence, MultiphotonCell Physiological PhenomenaCytoskeletonMicroscopy, ConfocalImaging, Three-DimensionalMicrotubulesActinsMicroscopy, ElectronStaining and LabelingNanotechnologyModels, BiologicalActin CytoskeletonLuminescent ProteinsMicroscopy, Electron, ScanningFluorescent DyesMicrotubule-Associated ProteinsMicrofilament ProteinsGreen Fluorescent ProteinsTubulinCell CompartmentationCell MembraneCell LineImage Processing, Computer-AssistedProteinsCytoplasmMolecular Sequence DataProteomicsCell NucleusCells, CulturedProtein TransportAmino Acid SequenceHeLa CellsFluorescent Antibody TechniqueMembrane ProteinsProtein BindingRecombinant Fusion ProteinsNuclear ProteinsMitochondriaSignal TransductionImmunohistochemistryMutationKineticsCell Line, TumorTime FactorsPakistanInternetAcademies and InstitutesAutophagy
Cellular Structures
Components of a cell.
Cells
The fundamental, structural, and functional units or subunits of living organisms. They are composed of CYTOPLASM containing various ORGANELLES and a CELL MEMBRANE boundary.
Electron Microscope Tomography
A tomographic technique for obtaining 3-dimensional images with transmission electron microscopy.
Microscopy
The use of instrumentation and techniques for visualizing material and details that cannot be seen by the unaided eye. It is usually done by enlarging images, transmitted by light or electron beams, with optical or magnetic lenses that magnify the entire image field. With scanning microscopy, images are generated by collecting output from the specimen in a point-by-point fashion, on a magnified scale, as it is scanned by a narrow beam of light or electrons, a laser, a conductive probe, or a topographical probe.
Microscopy, Fluorescence
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
Organelles
Specific particles of membrane-bound organized living substances present in eukaryotic cells, such as the MITOCHONDRIA; the GOLGI APPARATUS; ENDOPLASMIC RETICULUM; LYSOSOMES; PLASTIDS; and VACUOLES.
Microscopy, Fluorescence, Multiphoton
Fluorescence microscopy utilizing multiple low-energy photons to produce the excitation event of the fluorophore. Multiphoton microscopes have a simplified optical path in the emission side due to the lack of an emission pinhole, which is necessary with normal confocal microscopes. Ultimately this allows spatial isolation of the excitation event, enabling deeper imaging into optically thick tissue, while restricting photobleaching and phototoxicity to the area being imaged.
Cell Physiological Phenomena
Cellular processes, properties, and characteristics.
Cytoskeleton
The network of filaments, tubules, and interconnecting filamentous bridges which give shape, structure, and organization to the cytoplasm.
Microscopy, Confocal
A light microscopic technique in which only a small spot is illuminated and observed at a time. An image is constructed through point-by-point scanning of the field in this manner. Light sources may be conventional or laser, and fluorescence or transmitted observations are possible.
Imaging, Three-Dimensional
The process of generating three-dimensional images by electronic, photographic, or other methods. For example, three-dimensional images can be generated by assembling multiple tomographic images with the aid of a computer, while photographic 3-D images (HOLOGRAPHY) can be made by exposing film to the interference pattern created when two laser light sources shine on an object.
Microtubules
Slender, cylindrical filaments found in the cytoskeleton of plant and animal cells. They are composed of the protein TUBULIN and are influenced by TUBULIN MODULATORS.
Actins
Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.
Microscopy, Electron
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
Staining and Labeling
The marking of biological material with a dye or other reagent for the purpose of identifying and quantitating components of tissues, cells or their extracts.
Nanotechnology
The development and use of techniques to study physical phenomena and construct structures in the nanoscale size range or smaller.
Models, Biological
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
Actin Cytoskeleton
Fibers composed of MICROFILAMENT PROTEINS, which are predominately ACTIN. They are the smallest of the cytoskeletal filaments.
Luminescent Proteins
Proteins which are involved in the phenomenon of light emission in living systems. Included are the "enzymatic" and "non-enzymatic" types of system with or without the presence of oxygen or co-factors.
Microscopy, Electron, Scanning
Microscopy in which the object is examined directly by an electron beam scanning the specimen point-by-point. The image is constructed by detecting the products of specimen interactions that are projected above the plane of the sample, such as backscattered electrons. Although SCANNING TRANSMISSION ELECTRON MICROSCOPY also scans the specimen point by point with the electron beam, the image is constructed by detecting the electrons, or their interaction products that are transmitted through the sample plane, so that is a form of TRANSMISSION ELECTRON MICROSCOPY.
Fluorescent Dyes
Agents that emit light after excitation by light. The wave length of the emitted light is usually longer than that of the incident light. Fluorochromes are substances that cause fluorescence in other substances, i.e., dyes used to mark or label other compounds with fluorescent tags.
Microtubule-Associated Proteins
High molecular weight proteins found in the MICROTUBULES of the cytoskeletal system. Under certain conditions they are required for TUBULIN assembly into the microtubules and stabilize the assembled microtubules.
Microfilament Proteins
Monomeric subunits of primarily globular ACTIN and found in the cytoplasmic matrix of almost all cells. They are often associated with microtubules and may play a role in cytoskeletal function and/or mediate movement of the cell or the organelles within the cell.
Green Fluorescent Proteins
Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.
Tubulin
A microtubule subunit protein found in large quantities in mammalian brain. It has also been isolated from SPERM FLAGELLUM; CILIA; and other sources. Structurally, the protein is a dimer with a molecular weight of approximately 120,000 and a sedimentation coefficient of 5.8S. It binds to COLCHICINE; VINCRISTINE; and VINBLASTINE.
Cell Compartmentation
A partitioning within cells due to the selectively permeable membranes which enclose each of the separate parts, e.g., mitochondria, lysosomes, etc.
Cell Membrane
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
Cell Line
Established cell cultures that have the potential to propagate indefinitely.
Image Processing, Computer-Assisted
A technique of inputting two-dimensional images into a computer and then enhancing or analyzing the imagery into a form that is more useful to the human observer.
Proteins
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
Cytoplasm
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
Molecular Sequence Data
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Proteomics
The systematic study of the complete complement of proteins (PROTEOME) of organisms.
Cell Nucleus
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Cells, Cultured
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Protein Transport
The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.
Amino Acid Sequence
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
HeLa Cells
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Fluorescent Antibody Technique
Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.
Membrane Proteins
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
Protein Binding
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Recombinant Fusion Proteins
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Nuclear Proteins
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Mitochondria
Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)
Signal Transduction
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Immunohistochemistry
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
Mutation
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Kinetics
The rate dynamics in chemical or physical systems.
Cell Line, Tumor
A cell line derived from cultured tumor cells.
Time Factors
Elements of limited time intervals, contributing to particular results or situations.
Pakistan
Internet
A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.
Academies and Institutes
Organizations representing specialized fields which are accepted as authoritative; may be non-governmental, university or an independent research organization, e.g., National Academy of Sciences, Brookings Institution, etc.
Autophagy
The segregation and degradation of damaged or unwanted cytoplasmic constituents by autophagic vacuoles (cytolysosomes) composed of LYSOSOMES containing cellular components in the process of digestion; it plays an important role in BIOLOGICAL METAMORPHOSIS of amphibians, in the removal of bone by osteoclasts, and in the degradation of normal cell components in nutritional deficiency states.

Preliminary findings in germinal vesicle transplantation of immature human oocytes. (1/139)

Transplanting a germinal vesicle (GV) from an aged woman's oocyte into a younger ooplasm has been proposed as a possible way to reduce the incidence of oocyte aneuploidy which is considered to be responsible for age-related infertility. In this study, we have assessed the efficiency of each step involved in nuclear transplantation-specifically cell survival, nuclear-cytoplasmic reconstitution, and the capacity of the reconstituted oocytes for in-vitro maturation. In addition, we have evaluated the fertilizability and karyotypic status of the manipulated oocytes by intracytoplasmic sperm injection (ICSI) and fluorescent in-situ hybridization technique respectively. Nuclear transplantation was accomplished with an overall efficiency of 73%. Due to the limited availability of materials, most nuclear transplantation procedures were performed between sibling oocytes. The maturation rate of 62% following reconstitution was comparable with that of control oocytes, as was the incidence of aneuploidy among the reconstituted oocytes. The ICSI results of the reconstituted oocytes yielded a survival rate of 77%, a fertilization rate of 52%, and a satisfactory early embryonic cleavage. Furthermore, in a limited number of observations where the nucleus of an aged oocyte was transferred into a younger ooplasm, there was an appropriate chromosomal segregation. These findings demonstrate that human oocytes reconstituted with GV nuclei are able to undergo maturation, fertilization, and early embryo cleavage, and maintain a normal ploidy. Although in-vitro maturation seems to be a limiting step, this technique would allow us to investigate further the nuclear-ooplasmic relationship during meiotic maturation.  (+info)

Inferring sub-cellular localization through automated lexical analysis. (2/139)

MOTIVATION: The SWISS-PROT sequence database contains keywords of functional annotations for many proteins. In contrast, information about the sub-cellular localization is available for only a few proteins. Experts can often infer localization from keywords describing protein function. We developed LOCkey, a fully automated method for lexical analysis of SWISS-PROT keywords that assigns sub-cellular localization. With the rapid growth in sequence data, the biochemical characterisation of sequences has been falling behind. Our method may be a useful tool for supplementing functional information already automatically available. RESULTS: The method reached a level of more than 82% accuracy in a full cross-validation test. Due to a lack of functional annotations, we could infer localization for fewer than half of all proteins in SWISS-PROT. We applied LOCkey to annotate five entirely sequenced proteomes, namely Saccharomyces cerevisiae (yeast), Caenorhabditis elegans (worm), Drosophila melanogaster (fly), Arabidopsis thaliana (plant) and a subset of all human proteins. LOCkey found about 8000 new annotations of sub-cellular localization for these eukaryotes.  (+info)

Prediction of protein subcellular locations by support vector machines using compositions of amino acids and amino acid pairs. (3/139)

MOTIVATION: The subcellular location of a protein is closely correlated to its function. Thus, computational prediction of subcellular locations from the amino acid sequence information would help annotation and functional prediction of protein coding genes in complete genomes. We have developed a method based on support vector machines (SVMs). RESULTS: We considered 12 subcellular locations in eukaryotic cells: chloroplast, cytoplasm, cytoskeleton, endoplasmic reticulum, extracellular medium, Golgi apparatus, lysosome, mitochondrion, nucleus, peroxisome, plasma membrane, and vacuole. We constructed a data set of proteins with known locations from the SWISS-PROT database. A set of SVMs was trained to predict the subcellular location of a given protein based on its amino acid, amino acid pair, and gapped amino acid pair compositions. The predictors based on these different compositions were then combined using a voting scheme. Results obtained through 5-fold cross-validation tests showed an improvement in prediction accuracy over the algorithm based on the amino acid composition only. This prediction method is available via the Internet.  (+info)

In vivo noninvasive identification of cell composition of intimal lesions: a combined approach with ultrasonography and immunocytochemistry. (4/139)

PURPOSE: We investigated whether differences in cellular composition of the shoulder region of carotid plaque, a cell-rich, debris-free area, can be revealed with computer-driven analysis of ultrasound scans. METHODS: In 26 patients referred for carotid endarterectomy, the shoulder region of plaque eligible for surgical removal was identified with ultrasound scanning. Digital images were obtained and evaluated with a specially developed computer-driven system (Medical Image Processing [MIP]). The gray level distribution of the region of interest (ROI), along with some statistical parameters exploring the spatial distribution of pixels, such as entropy and second angular moment, were analyzed. In the specimen retrieved at surgery, the area corresponding to the ROI was selected. Cryosections were tested at immunocytochemistry with monoclonal antibodies specific to smooth muscle cells (SMCs), macrophages), and lymphocytes. Computerized image analysis was performed to quantify each cellular component of the lesion. RESULTS: Mean gray levels were related positively to the content of SMCs (r = 0.576, P =.002) and negatively to the content of macrophages (r = -0.555, P =.003). Lymphocytes did not show any correlation. Prevalence of SMCs, expressed as the ratio SMC/(SMC + macrophages), was related positively with entropy (r = 0.517, P =.007) and negatively with the second angular moment (r = -0.422, P =.032). The quartiles of gray level were useful for detecting significant differences in terms of cellular composition. CONCLUSIONS: Some cellular features of the shoulder region of plaque are associated with specific videodensitometric patterns evaluated with MIP. This approach enables in vivo noninvasive prediction and monitoring of cell composition of the shoulder region, and could be extended to study of the thickened intima.  (+info)

Prediction of protein subcellular locations using fuzzy k-NN method. (5/139)

MOTIVATION: Protein localization data are a valuable information resource helpful in elucidating protein functions. It is highly desirable to predict a protein's subcellular locations automatically from its sequence. RESULTS: In this paper, fuzzy k-nearest neighbors (k-NN) algorithm has been introduced to predict proteins' subcellular locations from their dipeptide composition. The prediction is performed with a new data set derived from version 41.0 SWISS-PROT databank, the overall predictive accuracy about 80% has been achieved in a jackknife test. The result demonstrates the applicability of this relative simple method and possible improvement of prediction accuracy for the protein subcellular locations. We also applied this method to annotate six entirely sequenced proteomes, namely Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, Oryza sativa, Arabidopsis thaliana and a subset of all human proteins. AVAILABILITY: Supplementary information and subcellular location annotations for eukaryotes are available at http://166.111.30.65/hying/fuzzy_loc.htm  (+info)

Translational polymorphism as a potential source of plant proteins variety in Arabidopsis thaliana. (6/139)

MOTIVATION: According to scanning model, 40S ribosomal subunits can either initiate translation at start AUG codon in suboptimal context or miss it and initiate translation at downstream AUG(s), thereby producing several proteins. Functional significance of such a protein translational polymorphism is still unknown. RESULTS: We compared predicted subcellular localizations of annotated Arabidopsis thaliana proteins and their potential N-terminally truncated forms started from the nearest downstream in-frame AUG codons. It was found that localizations of full and N-truncated proteins differ in many cases: 12.2% of N-truncated proteins acquired sorting signals de novo and 5.7% changed their predicted subcellular locations (mitochodria, chloroplast or secretory pathway). It is likely that the in-frame downstream AUGs may be frequently utilized to synthesize proteins possessing new functional properties and such a translational polymorphism may serve as an important source of cellular and organelle proteomes.  (+info)

Predicting subcellular localization of proteins using machine-learned classifiers. (7/139)

MOTIVATION: Identifying the destination or localization of proteins is key to understanding their function and facilitating their purification. A number of existing computational prediction methods are based on sequence analysis. However, these methods are limited in scope, accuracy and most particularly breadth of coverage. Rather than using sequence information alone, we have explored the use of database text annotations from homologs and machine learning to substantially improve the prediction of subcellular location. RESULTS: We have constructed five machine-learning classifiers for predicting subcellular localization of proteins from animals, plants, fungi, Gram-negative bacteria and Gram-positive bacteria, which are 81% accurate for fungi and 92-94% accurate for the other four categories. These are the most accurate subcellular predictors across the widest set of organisms ever published. Our predictors are part of the Proteome Analyst web-service.  (+info)

Morphological and physiological changes induced by high hydrostatic pressure in exponential- and stationary-phase cells of Escherichia coli: relationship with cell death. (8/139)

The relationship between a loss of viability and several morphological and physiological changes was examined with Escherichia coli strain J1 subjected to high-pressure treatment. The pressure resistance of stationary-phase cells was much higher than that of exponential-phase cells, but in both types of cell, aggregation of cytoplasmic proteins and condensation of the nucleoid occurred after treatment at 200 MPa for 8 min. Although gross changes were detected in these cellular structures, they were not related to cell death, at least for stationary-phase cells. In addition to these events, exponential-phase cells showed changes in their cell envelopes that were not seen for stationary-phase cells, namely physical perturbations of the cell envelope structure, a loss of osmotic responsiveness, and a loss of protein and RNA to the extracellular medium. Based on these observations, we propose that exponential-phase cells are inactivated under high pressure by irreversible damage to the cell membrane. In contrast, stationary-phase cells have a cytoplasmic membrane that is robust enough to withstand pressurization up to very intense treatments. The retention of an intact membrane appears to allow the stationary-phase cell to repair gross changes in other cellular structures and to remain viable at pressures that are lethal to exponential-phase cells.  (+info)

Correlative live-cell and superresolution microscopy reveals cargo transport dynamics at microtubule intersections. - The...Correlative live-cell and superresolution microscopy reveals cargo transport dynamics at microtubule intersections. - The...
Intracellular transport plays an essential role in maintaining the organization of polarized cells. Motor proteins tether and move cargos along microtubules during long-range transport to deliver them to their proper location of function. To reach their destination, cargo-bound motors must overcome barriers to their forward motion such as intersection points between microtubules. The ability to visualize how motors navigate these barriers can give important information about the mechanisms that lead to efficient transport. Here, we first develop an all-optical correlative imaging method based on single-particle tracking and superresolution microscopy to map the transport trajectories of cargos to individual microtubules with high spatiotemporal resolution. We then use this method to study the behavior of lysosomes at microtubule-microtubule intersections. Our results show that the intersection poses a significant hindrance that leads to long pauses in transport only when the separation distance of the
https://www.kennedy.ox.ac.uk/publications/685030
Noninvasive Identification of Ventricular Tachycardia-Related Anatomical Isthmuses in Repaired Tetralogy of Fallot | JACC:...Noninvasive Identification of Ventricular Tachycardia-Related Anatomical Isthmuses in Repaired Tetralogy of Fallot | JACC:...
Preselection of pace-mapping sites is usually based on the 12-lead VT ECG. Limited information is available concerning the 12-lead VT ECG in rTOF and its relation to AIs. In a series of 11 rTOF patients with 15 AI-related VT, 2 RBBB, and 13 LBBB VTs with a RV critical isthmus site were induced. The QRS precordial transition tended to be at V3 or later in AI1-related VTs and earlier in AI3- or AI4-related VTs (5).. Notably, a RBBB VT morphology was observed in 25% of VTs in our series, which is usually considered to indicate a left ventricular site of origin. Despite the RBBB morphology, 71% of VTs were approachable from the RV. A positive concordant 12-lead VT ECG was typical for AI3 dependent VT with clockwise activation of AI3. Of interest, RBBB VTs with V2 transition break was consistent with a left-sided exit within the coronary cusp or subaortic left ventricular outflow tract.. The unexpected high prevalence of RBBB VTs arising from the RVOT may be explained by the anterocephalic deviation ...
https://electrophysiology.onlinejacc.org/content/4/10/1308
The noninvasive identification of left main and three-vessel coronary artery disease by myocardial stress perfusion...The noninvasive identification of left main and three-vessel coronary artery disease by myocardial stress perfusion...
Thank you for your interest in spreading the word on Circulation.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
http://circ.ahajournals.org/content/60/2/276
Addgene: pCAG-ChR2-mRuby2-STAddgene: pCAG-ChR2-mRuby2-ST
Plasmid pCAG-ChR2-mRuby2-ST from Dr. Hillel Adesniks lab contains the insert ChR2-mRuby2-ST and is published in Nat Neurosci. 2018 Apr 30. pii: 10.1038/s41593-018-0139-8. doi: 10.1038/s41593-018-0139-8. This plasmid is available through Addgene.
http://www.addgene.org/109125/
Addgene: pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA SequencesAddgene: pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA Sequences
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA sequence 6756 bps ctgcagagggccctgcgtatgagtgcaagtgggttttaggaccaggatgaggcggggtgggggtgcctac ctgacgaccgaccccgacccactggacaagcacccaacccccattccccaaattgcgcatcccctatcag agagggggaggggaaacaggatgcggcgaggcgcgtgcgcactgccagcttcagcaccgcggacagtgcc ttcgcccccgcctggcggcgcgcgccaccgccgcctcagcactgaaggcgcgctgacgtcactcgccggt cccccgcaaactccccttcccggccaccttggtcgcgtccgcgccgccgccggcccagccggaccgcacc acgcgaggcgcgagataggggggcacgggcgcgaccatctgcgctgcggcgccggcgactcagcgctgcc tcagtctgcggtgggcagcggaggagtcgtgtcgtgcctgagagcgcagtcgaattcaagctgctagcaa ggatccacccgccacctaccggtcctagggccaccatggtgtctaagggcgaagagctgatcaaggaaaa tatgcgtatgaaggtggtcatggaaggttcggtcaacggccaccaattcaaatgcacaggtgaaggagaa ggcaatccgtacatgggaactcaaaccatgaggatcaaagtcatcgagggaggacccctgccatttgcct ttgacattcttgccacgtcgttcatgtatggcagccgtacttttatcaagtacccgaaaggcattcctga tttctttaaacagtcctttcctgagggttttacttgggaaagagttacgagatacgaagatggtggagtc gtcaccgtcatgcaggacaccagccttgaggatggctgtctcgtttaccacgtccaagtcagaggggtaa ...
https://www.addgene.org/51473/sequences/
Biological fingerprints improve diagnosis of dementiaBiological fingerprints improve diagnosis of dementia
Conventional light microscopes cannot distinguish structures when they are separated by a distance smaller than, roughly, the wavelength of light. Superresolution microscopy, developed since the 1980s, lifts this limitation, using fluorescent moieties. Scientists at the Max Planck Institute for Polymer Research have now discovered that graphene nano-molecules can be used to improve this microscopy technique. These graphene nano-molecules offer a number of substantial advantages over the materials previously used, making superresolution microscopy even more versatile. ...
https://www.innovations-report.com/html/reports/life-sciences/biological-fingerprints-improve-diagnosis-dementia-183185.html
Inspiratory Capacity | Harvard Catalyst Profiles | Harvard CatalystInspiratory Capacity | Harvard Catalyst Profiles | Harvard Catalyst
Pamidi S, Redline S, Rapoport D, Ayappa I, Palombini L, Farre R, Kirkness J, Pépin JL, Polo O, Wellman A, Kimoff RJ. An Official American Thoracic Society Workshop Report: Noninvasive Identification of Inspiratory Flow Limitation in Sleep Studies. Ann Am Thorac Soc. 2017 Jul; 14(7):1076-1085 ...
https://connects.catalyst.harvard.edu/Profiles/display/Concept/Inspiratory%20Capacity
Comprehensive genomic meta-analysis identifies intra-tumoural stroma as a predictor of survival in patients with gastric cancer...Comprehensive genomic meta-analysis identifies intra-tumoural stroma as a predictor of survival in patients with gastric cancer...
Results The authors identified 178 gene expression programmes (modules) expressed in primary GCs, which were associated with distinct biological processes, chromosomal location patterns, cis-regulatory motifs and clinicopathological parameters. Expression of a transforming growth factor β (TGF-β) signalling associated super-module of stroma-related genes consistently predicted patient survival in multiple GC validation cohorts. The proportion of intra-tumoural stroma, quantified by morphometry in tissue sections from gastrectomy specimens, was also significantly associated with stromal super-module expression and GC patient survival. ...
http://gut.bmj.com/content/early/2012/06/25/gutjnl-2011-301373
Active Motif » Fluorescent Cell and Organelle Stains for the study of subcellular structures and the identification of stem...Active Motif » Fluorescent Cell and Organelle Stains for the study of subcellular structures and the identification of stem...
Active Motifs Cell and Organelle Stains are fluorescent dyes for staining subcellular structures in live and in fixed cells, simplifying the study of cellular structures or the identification of stem cells using fluorescence microscopy
http://www.activemotif.com/catalog/618/cell-and-organelle-stains
PALM Imaging: Practical AspectsPALM Imaging: Practical Aspects
Get an overview of PALM practical aspects and continue to learn superresolution microscopy. Know how to analyze fluorescent samples and to use the appropriate software.
https://www.zeiss.com/microscopy/int/solutions/reference/superresolution/practical-aspects-of-palm-imaging.html
Block-Based MAP Superresolution Using Feature-Driven Prior ModelBlock-Based MAP Superresolution Using Feature-Driven Prior Model
In the field of image superresolution reconstruction (SRR), the prior can be employed to solve the ill-posed problem. However, the prior model is selected empirically and characterizes the entire image so that the local feature of image cannot be represented accurately. This paper proposes a feature-driven prior model relying on feature of the image and introduces a block-based maximum a posteriori (MAP) framework under which the image is split into several blocks to perform SRR. Therefore, the local feature of image can be characterized more accurately, which results in a better SRR. In process of recombining superresolution blocks, we still design a border-expansion strategy to remove a byproduct, namely, cross artifacts. Experimental results show that the proposed method is effective.
https://www.hindawi.com/journals/mpe/2014/508357/
Structures in Human Cells. Cellular OrganizationStructures in Human Cells. Cellular Organization
Structures in Human Cells. Cellular Organization. The Plasma Membrane. Fluid-mosaic model of the plasma membrane. The Nucleus. Ribosomes. Structures in Human Cells in pictures
http://encyclopedia.lubopitko-bg.com/Cellular_Organization.html
What is cellular organization? | Reference.comWhat is cellular organization? | Reference.com
Cellular organization refers to the components of a cell and how these individual parts are arranged within the cell. Cells are the smallest organizational levels of living...
https://www.reference.com/science/cellular-organization-6ee9bc7bc9c7d192
PPT - Cell Structure and Function PowerPoint Presentation - ID:4234570PPT - Cell Structure and Function PowerPoint Presentation - ID:4234570
Cell Structure and Function. Cell Theory. All living organisms are made of cells . Cells are small aqueous solution (cytoplasm) organelles ( subcellular structures)
https://www.slideserve.com/maisie/cell-structure-and-function
microscopy fluorescence multiphoton Protocols and Video...microscopy fluorescence multiphoton Protocols and Video...
Video articles in JoVE about microscopy fluorescence multiphoton include Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins.
https://www.jove.com/keyword/microscopy+fluorescence+multiphoton
OmniVision and Almalence Add SuperResolution to Worlds Smallest Camera Module for Endoscopic Medical Imaging | Business WireOmniVision and Almalence Add SuperResolution to Worlds Smallest Camera Module for Endoscopic Medical Imaging | Business Wire
OmniVision Technologies, Inc., a leading developer of advanced digital imaging solutions, and Almalence Inc., one of the worlds leaders in computatio
https://www.businesswire.com/news/home/20201116005500/en/OmniVision-and-Almalence-Add-SuperResolution-to-World%E2%80%99s-Smallest-Camera-Module-for-Endoscopic-Medical-Imaging
Theories - Origin of Life - Page 44 - Biology-OnlineTheories - Origin of Life - Page 44 - Biology-Online
I havent cared to read all 44 pages of replys and Im fairly certain youve enough material for your paper at this point though I feel certain things oughtnt be left out of your paper. With evidence provided by the Miller-Urey experiments it is known the general composition of our early atmosphere was capable of producing something that we today might identify as lifelike- presumably a protobiont with a primitive lipid membrane and some means of reproduction- presumably RNA. under proper circumstances these RNA molecules could multiply, though it is doubtful any kind of orderly cellular structure developed for millions of years, a simple strip of RNA may as well be classified as a living thing due to its ability to reproduce ...
https://www.biology-online.org/biology-forum/viewtopic.php?t=14351&p=140884&hilit=Transposons
Theories - Origin of Life - Page 44 - Biology-OnlineTheories - Origin of Life - Page 44 - Biology-Online
I havent cared to read all 44 pages of replys and Im fairly certain youve enough material for your paper at this point though I feel certain things oughtnt be left out of your paper. With evidence provided by the Miller-Urey experiments it is known the general composition of our early atmosphere was capable of producing something that we today might identify as lifelike- presumably a protobiont with a primitive lipid membrane and some means of reproduction- presumably RNA. under proper circumstances these RNA molecules could multiply, though it is doubtful any kind of orderly cellular structure developed for millions of years, a simple strip of RNA may as well be classified as a living thing due to its ability to reproduce ...
https://www.biology-online.org/biology-forum/viewtopic.php?t=14351&p=140884&hilit=Lead+sequence
What hypothesis could you form to explain what would happen to the cell or organism if at least two cell structures were...What hypothesis could you form to explain what would happen to the cell or organism if at least two cell structures were...
Get an answer for What hypothesis could you form to explain what would happen to the cell or organism if at least two cell structures were damaged or destroyed? and find homework help for other Science questions at eNotes
https://www.enotes.com/homework-help/what-hypothesis-could-you-form-explain-what-would-447028
Noninvasive Identification of Ventricular Tachycardia-Related Conducting Channels Using Contrast-Enhanced Magnetic Resonance...Noninvasive Identification of Ventricular Tachycardia-Related Conducting Channels Using Contrast-Enhanced Magnetic Resonance...
Figure 5 Maps of Anterior Infarct, Relation of Voltage and SI Mapping, and Morphology of Induced VT. (Top panel) Endocardial voltage (A) and subendocardial signal intensity (B) maps of an anterior infarct showing the similarity of scar from the patient shown in Figure 3A. (A) The voltage map shows the extension of the scar when the voltage scar definition was set ,1.5 mV. (B) The signal intensity map is consistent with the magnetic resonance imaging short-axis view shown in Figure 3A. The channel that runs parallel to the mitral annulus between segments 2 and 3 (black arrows) coincides with the heterogeneous tissue channel in frames 5 and 6 in Figure 3A. The second channel, perpendicular to the mitral annulus is in segment 3 (white arrow), this channel corresponds with the heterogeneous tissue channel in frames 1 and 2. The continuity of the signal-intensity channel is interrupted when the heterogeneous tissue channel (frame 3) moves to the epicardium. Then it moves back to the endocardium and ...
http://www.onlinejacc.org/content/57/2/184
Motion pictures from living cells: Research team from Jena and Bielefeld improves superresolution microscopyMotion pictures from living cells: Research team from Jena and Bielefeld improves superresolution microscopy
This makes it possible to measure samples quickly and adapt test conditions immediately during an experiment instead of evaluating them afterwards, says Rainer Heintzmann, describing the practical benefits of the new technology.. The scientists tested the method on biological cells and recorded the movements of mitochondria, the energy centres of the cells that are about one micrometer in size. We were able to produce about 60 frames per second - a higher frame rate than those of motion pictures. The time between measurement and image is less than 250 milliseconds, which is why the technology allows real-time recordings, says Andreas Markwirth.. So far, superresolution images have often been combined with conventional methods: A conventional fast microscope is used to first find structures. These structures can then be examined in detail using a superresolution microscope. However, some structures are so small that they cannot be found with conventional microscopes, for example special pores ...
https://www.innovations-report.com/html/reports/medical-technology/motion-pictures-from-living-cells-research-team-from-jena-and-bielefeld-improves-superresolution-microscopy.html
Regulation of Subcellular Organization in Skeletal Muscle - Evelyn RalstonRegulation of Subcellular Organization in Skeletal Muscle - Evelyn Ralston
Our main project deals with understanding the organization of the unique grid-like network of skeletal muscle fiber microtubules. Results obtained in previous y...
http://grantome.com/grant/NIH/ZIA-AR041132-12
Elyra P.1 3-D Superresolution Microscopy | Carl Zeiss Spectroscopy GmbH | Feb 2014 | BioPhotonicsElyra P.1 3-D Superresolution Microscopy | Carl Zeiss Spectroscopy GmbH | Feb 2014 | BioPhotonics
Zeiss has added the Elyra P.1 module to its 3-D microscopy portfolio. The system enables superresolution photoactivated localization microscopy (PALM)
https://www.photonics.com/Products/Elyra_P1_3-D_Superresolution_Microscopy/pr55341
ZEISS Introduces New Technology for 3D Superresolution Microscopy | SelectScienceZEISS Introduces New Technology for 3D Superresolution Microscopy | SelectScience
Expanding its 3D microcopy portfolio, ZEISS introduced superresolution photoactivated localization microscopy (PALM) in 3D at the Society for Neuroscience Annual Meeting in San Diego, California.
http://www.selectscience.net/product-news/carl-zeiss-microscopy/zeiss-introduces-new-technology-for-3d-superresolution-microscopy/?artID=30925
Superresolution Microscopy: An Imaging Revolution | Features | Spring 2017 | EuroPhotonicsSuperresolution Microscopy: An Imaging Revolution | Features | Spring 2017 | EuroPhotonics
Superresolution optical microscopy, for which the Nobel Prize was awarded to Eric Betzig, Stefan Hell, and William Moerner in 2014, has been one of th
https://www.photonics.com/Articles/Superresolution_Microscopy_An_Imaging_Revolution/p2/vo143/i920/a61599
Motion pictures from living cells: Research team from Jena and Bielefeld improves superresolution microscopyMotion pictures from living cells: Research team from Jena and Bielefeld improves superresolution microscopy
This graphics card normally helps computer gamers to have a great gaming experience. The researchers, however, use it to observe the smallest cell components in action - in real time and with a very high frame rate. „The image data can be reconstructed about twenty times faster than it would take on a PC, explains Rainer Heintzmann of the Leibniz Institute of Photonic Technology (Leibniz IPHT), who laid the foundations for the process of structured illumination in high-resolution microscopy back in 1998. Together with him, the Bielefeld research team led by Prof. Thomas Huser further expanded the technology of Super-Resolved Structured Illumination Microscopy (SR-SIM). In the fluorescence microscopic method SR-SIM, objects are irradiated with laser light using a special pattern. It excites special fluorescent molecules in the sample so that they emit light at a different wavelength. The microscopic image then shows this emitted light. It is first recorded in several individual images and then ...
https://nachrichten.idw-online.de/2019/09/20/motion-pictures-from-living-cells-research-team-from-jena-and-bielefeld-improves-superresolution-microscopy/
Dr. Ulrike Boehm - Superresolution Microscopy, Single-Molecule Imaging & Gene ExpressionDr. Ulrike Boehm - Superresolution Microscopy, Single-Molecule Imaging & Gene Expression
Welcome to the website of Ulrike Boehm - physicist, entrepreneur & science communicator. Here you can learn more about my research & various other projects.
http://ulrikeboehm.org
Publications - Institute for Bioengineering of Catalonia (IBEC)Publications - Institute for Bioengineering of Catalonia (IBEC)
New techniques for automatic invasive and noninvasive identification of inspiratory flow limitation (IFL) are presented. Data were collected from 11 patients with full nocturnal polysomnography and gold-standard esophageal pressure (Pes) measurement. A total of 38,782 breaths were extracted and automatically analyzed. An exponential model is proposed to reproduce the relationship between Pes and airflow of an inspiration and achieve an objective assessment of changes in upper airway obstruction. The characterization performance of the model is appraised with three evaluation parameters: mean-squared error when estimating resistance at peak pressure, coefficient of determination, and assessment of IFL episodes. The models results are compared to the two best-performing models in the literature. The obtained gold-standard IFL annotations were then employed to train, test, and validate a new noninvasive automatic IFL classification system. Discriminant analysis, support vector machines, and ...
http://www.ibecbarcelona.eu/for-researchers/publications/Upper+airway+obstruction/
3D Echocardiography to Evaluate Right Atrial Pressure in Acutely Decompensated Heart Failure | JACC: Cardiovascular Imaging3D Echocardiography to Evaluate Right Atrial Pressure in Acutely Decompensated Heart Failure | JACC: Cardiovascular Imaging
This is the first study to examine the utility of 3DE for noninvasive identification of elevated RAP, testing the concept that enlarged 3DE-derived RA volume may be useful for identifying elevated RAP. Although qualitative and 2DE measures of RA size did not correlate with RAP, 3DE RA volume was correlated with RAP in this population of advanced heart failure patients. Compared with the combination of dilated IVC and reduced IVC collapse, the addition of 3DE maximal RA volume to IVC diameter resulted in improved sensitivity for identification of RAP ,10 mm Hg. The combination of 3D-RAVi ≥35 ml/m2 and IVC ≥2 cm, compared with the presence of a dilated IVC alone, also trended toward improved specificity for RAP ,10 mm Hg without compromising accuracy or sensitivity.. Whereas RA size is determined by qualitative assessment in many laboratories, the results of the current study indicate only a modest correlation between qualitative assessment of RA size and 3DE RA volume. In addition, whereas ...
http://imaging.onlinejacc.org/content/4/9/938
Simvastatin Attenuates Plaque Inflammation | JACC: Journal of the American College of CardiologySimvastatin Attenuates Plaque Inflammation | JACC: Journal of the American College of Cardiology
Recently, 18FDG-PET has emerged as a promising imaging modality for visualizing plaque inflammation. Our prospective, controlled, randomized trial has shown here for the first time by the use of 18FDG-PET co-registered with enhanced CT that 3-month simvastatin treatment attenuates plaque inflammation. Although simvastatin decreased LDL-C and increased HDL-C, only the increase in HDL-C was correlated with the decrease in 18FDG uptake. Thus, the antiinflammatory effect of simvastatin on atherosclerotic plaques may be one of the pleiotropic effects independent of LDL-C-lowering.. Noninvasive identification of inflammatory plaque has been challenging. With the recent advance in imaging technologies, we can get the morphology of plaques and some information about plaque stability (12,13) but cannot see the inflammation directly. Because 18FDG-PET can visualize tissue glucose metabolism with high sensitivity and we can quantify 18FDG uptake in the region of interest, we used this metabolic imaging ...
http://www.onlinejacc.org/content/48/9/1825?ijkey=09ed7a4a0ad158273ad95c02fb06d87d945863db&keytype2=tf_ipsecsha
Predicting Amyloid Pathology in Mild Cognitive Impairment Using Radiomics Analysis of Magnetic Resonance Imaging - IOS PressPredicting Amyloid Pathology in Mild Cognitive Impairment Using Radiomics Analysis of Magnetic Resonance Imaging - IOS Press
Background: Noninvasive identification of amyloid-β (Aβ) is important for better clinical management of mild cognitive impairment (MCI) patients. Objective: To investigate whether radiomics features in the hippocampus in MCI improve the prediction of
https://content.iospress.com/articles/journal-of-alzheimers-disease/jad200734
News | Department of CELL BIOLOGYNews | Department of CELL BIOLOGY
Organisms across the evolutionary spectrum have evolved mechanisms to maintain the integrity of the cellular proteome. Among these mechanisms are spatial protein quality control pathways in which damaged and misfolded cellular proteins are actively sequestered at unique subcellular structures in response to acute stress. This mitigates the deleterious effects of these aberrant protein species, which can include advanced cellular aging and cytotoxicity leading to cell death. Despite the universal importance of such spatial control of the proteome, there is considerable mechanistic diversity throughout the evolutionary scale regarding how this control is achieved. In a recent publication in Cell Reports (Egan and McClintock et al., PMID 25865884) the Reck-Peterson Lab expanded on the known evolutionary diversity of spatial quality control mechanisms by examining the subcellular organization of heat-induced protein aggregates in filamentous fungi, which are of substantial health and economic ...
http://cellbio.med.harvard.edu/news?page=5
e2e] Discrete IP - retakee2e] Discrete IP - retake
yes - the ballonist assumes youd have electricity i dont. lifetime of opportunistic net made out of cell phones running our modified twitter client to tell people where you are and send hashtag data with sensor net is about 7 days... coverage? depends on mobility patterns of scavenger missions and landscape/territory - given the way people surivve in clusters (see for example googles mapping of haiti earthquake damage), it can be very good, in fact, if you design your manet/dtn routing with the actual human movement/location patterns in mind.... something mon golfier frere hasnt being able to hand the disaster teams 72 hours later with a map of who is where and what resources are still working would be good i nteh book i cited, not knowing this led to susequent followup diasters (like shooting people who were sharing water thinking they were looters) In missive ,[email protected][10.0.1.3],, John Day typed: ,,You seem to be assuming you have electricity. Which seems like a big ...
http://www.postel.org/pipermail/end2end-interest/2012-September/008511.html
Molecular MicrobiologyMolecular Microbiology
Studies that include genetic, biochemical, biophysical, bioinformatic and structural analyses leading to a deeper understanding of the molecular principals underlying basic physiological processes or mechanisms are considered as potentially suitable for publication in the Journal. Topics that are considered appropriate include gene expression and regulation, pathogenicity and virulence, physiology and metabolism, synthesis of macromolecules (proteins, nucleic acids, lipids, polysaccharides, etc), cell biology and subcellular organization, membrane biogenesis and function, traffic and transport, cell-cell communication and signalling pathways, evolution and gene transfer ...
http://acsm.healthjobsplus.com/site/catalog/journals/414.jsp
Modular transient nanoclustering of activated β2-adrenergic receptors revealed by single-molecule tracking of conformation...Modular transient nanoclustering of activated β2-adrenergic receptors revealed by single-molecule tracking of conformation...
None of the current superresolution microscopy techniques can reliably image the changes in endogenous protein nanoclustering dynamics associated with specific conformations in live cells. Single-domain nanobodies have been invaluable tools to isolate defined conformational states of proteins, and we reasoned that expressing these nanobodies coupled to single-molecule imaging-amenable tags could allow superresolution analysis of endogenous proteins in discrete conformational states. Here, we used anti-GFP nanobodies tagged with photoconvertible mEos expressed as intrabodies, as a proof-of-concept to perform single-particle tracking on a range of GFP proteins expressed in live cells, neurons, and small organisms. We next expressed highly specialized nanobodies that target conformation-specific endogenous β2-adrenoreceptor (β2-AR) in neurosecretory cells, unveiling real-time mobility behaviors of activated and inactivated endogenous conformers during agonist treatment in living cells. We showed ...
https://www.pnas.org/content/117/48/30476
Microbial transformation of hydrocarbons. II. Growth constants and cell composition of microbial cells derived from <em>n</em>...Microbial transformation of hydrocarbons. II. Growth constants and cell composition of microbial cells derived from <em>n</em>...
Microbial transformation of hydrocarbons. II. Growth constants and cell composition of microbial cells derived from |em|n|/em|-alkanes | F. Wagner; Th. Kleemann; W. Zahn | download | BookSC. Download books for free. Find books
http://th.booksc.org/book/700007/45b4ad
Lattice light-sheet microscopy gets an AO upgradeLattice light-sheet microscopy gets an AO upgrade
In late 2014, just a month after learning he had won that years Nobel Prize in Chemistry for superresolution microscopy, Eric Betzig and colleagues described a technique that has taken the microscopy world by storm.. Lattice light-sheet microscopy (LLSM) projects ultrathin, low-intensity planes of light into a biological sample, boosting image clarity while reducing phototoxicity and photobleaching, thus allowing researchers to image live cells at high resolution for extended periods. Still in development at Zeiss, and sublicensed to 3i, which has released a commercial version of its own, LLSM has been a hit with the microscopy community, says Betzig, a group leader at the Howard Hughes Medical Institutes Janelia Research Campus. Besides the systems sold by 3i itself, Betzig estimates his team has guided 70 or so groups in setting up their own versions of the system, and another 40 have gotten time on the system in Janelias Advanced Imaging Center in Ashburn, Virginia.. But for all that, the ...
https://blogs.nature.com/naturejobs/2018/05/07/lattice-light-sheet-microscopy-gets-an-ao-upgrade/
testo SuperResolution - Upgrade for Testo thermal imagers | Thermal imager | Temperature | Parameters | Testo SAtesto SuperResolution - Upgrade for Testo thermal imagers | Thermal imager | Temperature | Parameters | Testo SA
With the patent-pending SuperResolution upgrade, you can capture extremely high-resolution infrared images (up to megapixel quality) with your Testo thermal imager. The SuperResolution upgrade improves the usable geometric resolution of the thermal image by a factor of 1.6 - with four times as many measuring values.
https://www.testo.com/en-ZA/testo-superresolution/p/0554-7806
Superresolution imaging using single-molecule localizationSuperresolution imaging using single-molecule localization
Superresolution imaging is a rapidly emerging new field of microscopy that dramatically improves the spatial resolution of light microscopy by over an order of magnitude (approximately 10-20-nm resolution), allowing biological processes to be described at the molecular scale. Here, we discuss a form …
https://pubmed.ncbi.nlm.nih.gov/20055680/?dopt=Abstract
Visualizing Cell Structure and Function With Point-Localization Superresolution Imaging - PubMedVisualizing Cell Structure and Function With Point-Localization Superresolution Imaging - PubMed
Fundamental to the success of cell and developmental biology is the ability to tease apart molecular organization in cells and tissues by localizing specific proteins with respect to one another in a native cellular context. However, many key cellular structures (from mitochondrial cristae to nuclea …
https://pubmed.ncbi.nlm.nih.gov/23237943/
Cellular structures - Mindmap in A Level and IB BiologyCellular structures - Mindmap in A Level and IB Biology
Copyright Get Revising 2018 all rights reserved. Get Revising is one of the trading names of The Student Room Group Ltd. Register Number: 04666380 (England and Wales), VAT No. 806 8067 22 Registered office: International House, Queens Road, Brighton, BN1 3XE ...
https://getrevising.co.uk/diagrams/cellular_structures_2
Fluorophores for SuperresolutionFluorophores for Superresolution
Lastek is the exclusive distributor in Australia and New Zealand for more than fifty leading international laser, optic, detection, spectroscopy and imaging manufacturers.
http://www.lastek.com.au/microscopy/superresolution-microscopy/fluorophores-for-superresolution
Chapter 4 Cell Structure and Function - Chapter 4 Cell Structure and Function An Overview I Pastures of the Seas A Vast...Chapter 4 Cell Structure and Function - Chapter 4 Cell Structure and Function An Overview I Pastures of the Seas A Vast...
View Notes - Chapter 4 Cell Structure and Function from BSC BSC1005 at Broward College. Chapter 4 Cell Structure and Function: An Overview I. Pastures of the Seas A. Vast populations of single-celled
https://www.coursehero.com/file/6675907/Chapter-4-Cell-Structure-and-Function/
Multi-protein assemblies - Proteopedia, life in 3DMulti-protein assemblies - Proteopedia, life in 3D
proteopedia link. Many PDB files contain complexes in which a particular protein is interacting with a different protein in what are called multi-protein assemblies or multi-protein complexes. These interactions, if biologically relevant, can be immensely insightful in shedding light on cellular and extracellular processes. ...
http://proteopedia.org/wiki/index.php/Multi-protein_assemblies
Recent Articles | Midbody | The Scientist Magazine®Recent Articles | Midbody | The Scientist Magazine®
Cellular structures known as midbodies, formed during cell division, appear to accumulate in stem cells and cancer cells, hinting at a potential function for these once-disregarded organelles.. 9 Comments. ...
https://www.the-scientist.com/?articles.list/categoryNo/2625/category/The-Scientist/tagNo/1028/tags/midbody/
TumorsTumors
Benign lung tumor is an extensive group of diseases, which includes tumors of different origin and cellular structure. Benign tumors of the lungs are found only in 7-10% of cases, read more... ...
https://cancer.vsebolezni.com/opuxoli
Helium raises resolution of whole cell imagingHelium raises resolution of whole cell imaging
The ability to obtain an accurate three-dimensional image of an intact cell is critical for unraveling the mysteries of cellular structure and function. However, for many years, tiny structures buried deep inside cells have ...
https://phys.org/news/2011-10-helium-resolution-cell-imaging.html
pH AnalysispH Analysis
pH (potential of hydrogen) is the measurement of resistance and indicates the speed at which energy is moving through the body.pH is key in digestion.The pH reading tells us if we are getting the right amount of the right kind of minerals and if the energy from our food is being put on our frequency so it can be used to build and maintain cellular structures. An acidic pH (5.0 6.2) shows there is too little resistance or in this case digestion is going too fast and not assimilating any minerals.An alkaline pH (6.6 7.0) shows there is too much resistance or digestion is going to slow and food basically starts to rot in our digestive track.As in an acidic body, an alkaline body has minimal assimilation of minerals ...
https://www.healthylifestyleswellnesscenter.com/index.php?p=404978
Click to printClick to print
Two articles in one, with strong scientific details showing the evolutionary claim to be invalid: From: ICR Many supporters of evolutionary theory have claimed that nylon-eating bacteria strongly demonstrate the kind of evolution that can create new cellular structures, new cells, and new organisms.1 However, examining only the apparent, visible beneficial trait can be misleading. Recent…
https://releasingthetruth.wordpress.com/2013/04/12/neb/
NEET (NTA-National Eligibility cum Medical Entrance Test) Biology Cell Structure and Function Questions 299 to 307 -...NEET (NTA-National Eligibility cum Medical Entrance Test) Biology Cell Structure and Function Questions 299 to 307 -...
Cell Structure and Function: Questions 299-307 of 413. Get to the point NEET (NTA-National Eligibility cum Medical Entrance Test) Biology questions for your exams.
https://www.doorsteptutor.com/Exams/NEET/Biology/Questions/Topic-Cell-Structure-and-Function-2/Part-41.html
NEET (National Eligibility cum Medical Entrance Test) Biology Cell Structure and Function Questions 26 to 32 - DoorstepTutorNEET (National Eligibility cum Medical Entrance Test) Biology Cell Structure and Function Questions 26 to 32 - DoorstepTutor
Cell Structure and Function: Questions 26-32 of 413. Get to the point NEET (National Eligibility cum Medical Entrance Test) Biology questions for your exams.
https://www.doorsteptutor.com/Exams/NEET/Biology/Questions/Topic-Cell-Structure-and-Function-2/Part-5.html
Learn: Cell Structure and Function (by poliyera) - Memorize.com - Remember and UnderstandLearn: Cell Structure and Function (by poliyera) - Memorize.com - Remember and Understand
Learn Cell Structure and Function facts using a simple interactive process (flashcard, matching, or multiple choice). Finally a format that helps you memorize and understand. Browse or search in thousands of pages or create your own page using a simple wizard. No signup required!
http://memorize.com/cell-structure-and-function/poliyera
BIO 101 Chapter 4 Cell Structure Flashcards - Cram.comBIO 101 Chapter 4 Cell Structure Flashcards - Cram.com
Study Flashcards On BIO 101 Chapter 4 Cell Structure at Cram.com. Quickly memorize the terms, phrases and much more. Cram.com makes it easy to get the grade you want!
http://www.cram.com/flashcards/bio-101-chapter-4-cell-structure-301704

No data available that match "cellular structures"


Cellular organizational structure - WikipediaCellular organizational structure - Wikipedia
A non-biological entity with a cellular organizational structure (also known as a cellular organization, cellular system, nodal ... efficient use of cellular organizational planning. A cellular business structure is partly related, philosophically speaking, ... Tony Hsieh, the CEO of Zappos, has remarked that his business considers cellular-type self-management groups to be a key to its ... This structure, as applied in areas such as business management, exists in direct contrast to traditional hierarchical ...
https://en.wikipedia.org/wiki/Cellular_organizational_structure
BICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures. - PubMed - NCBIBICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures. - PubMed - NCBI
BICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures.. Splinter D1, Razafsky DS, ... BICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures ... BICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures ... BICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures ...
https://www.ncbi.nlm.nih.gov/pubmed?term=BICD2%2C%20dynactin%20and%20LIS1%20cooperate%20in%20regulating%20dynein%20recruitment%20to%20cellular%20structures
DNA polymerase family X: function, structure, and cellular roles. - PubMed - NCBIDNA polymerase family X: function, structure, and cellular roles. - PubMed - NCBI
A. Chemical structure of an 8oxoG base in the anti configuration base paired with a dC. Adapted from []. B. Chemical structure ... DNA polymerase family X: function, structure, and cellular roles.. Yamtich J1, Sweasy JB. ... Remarkably, although these enzymes have similar three-dimensional structures, their biochemical properties and cellular ... The mispaired crystal structure was aligned with crystal structures of the binary and correctly paired ternary complexes of pol ...
https://www.ncbi.nlm.nih.gov/pubmed/19631767
Archive ouverte HAL - Homology of Cellular Structures Allowing Multi-incidenceArchive ouverte HAL - Homology of Cellular Structures Allowing Multi-incidence
Our work aims at providing a way to compute homologies directly on a cellular structure. This is done through the computation ... cellular structures that allow multi-incidence between cells. We deal here with combinatorial maps, more precisely chains of ... Homology computation on such structures is usually achieved by computing simplicial homology on a simplicial analog. But such ... expensive because it requires computing this simplicial analog and performing the homology computation on a structure ...
https://hal.archives-ouvertes.fr/hal-01189215v1
Cellular organelles and structure (article) | Khan AcademyCellular organelles and structure (article) | Khan Academy
If youre seeing this message, it means were having trouble loading external resources on our website.. If youre behind a web filter, please make sure that the domains *.kastatic.org and *.kasandbox.org are unblocked. ...
https://www.khanacademy.org/test-prep/mcat/cells/eukaryotic-cells/a/organelles-article
Adaptive Cellular Robots with a Tetrahedral Structure (Arts)Adaptive Cellular Robots with a Tetrahedral Structure (Arts)
The invention consits of a modular, self-reconfigurable cellular robot system with a plurality of interconnected individual ...
http://www.innovations-report.com/html/reports/technology-offerings/adaptive-cellular-robots-with-a-tetrahedral-structure-arts-1.html
Cellular Structured T-Shirt - Polos & T-Shirts | Porsche DesignCellular Structured T-Shirt - Polos & T-Shirts | Porsche Design
Cellular Structured T-Shirt. Article number: 4046901695354 Cellular Structured T-Shirt. Article number: 4046901695354 ... The fascinating structure of mitochondria translated to an exclusive jacquard knit: the Porsche Design Cellular Structured Tee ... is accentuated by bold color-blocking for an exciting contrast with the organic cellular pattern of the T-shirt. The exclusive ...
https://www.porsche-design.com/gb/en/porsche-design-shop/shop/fashion-sport/fashion/polos-t-shirts/p1110-m-cellular-structed-tee/?variationCode=4046901695422&sf=size
TSRI scientists map out protein structure involved in cellular function, nervous system developmentTSRI scientists map out protein structure involved in cellular function, nervous system development
... have mapped out the structure of an important protein involved in cellular function and nervous system development. ... The new structure provides crucial information for understanding how the protein binds to cellular components. Its also the ... TSRI scientists map out protein structure involved in cellular function, nervous system development. *Download PDF Copy ... Cellular Highways. While previous research had shown that TTLL7 modifies microtubules (hollow tubes that transport cellular ...
https://www.news-medical.net/news/20150512/TSRI-scientists-map-out-protein-structure-involved-in-cellular-function-nervous-system-development.aspx
International Conference on Cell Biology, Structures and Cellular Processes in April 2022 in JerusalemInternational Conference on Cell Biology, Structures and Cellular Processes in April 2022 in Jerusalem
Structures and Cellular Processes scheduled on April 29-30, 2022 in April 2022 in Jerusalem is for the researchers, scientists ... Structures and Cellular Processes. ICCBSCP 2022: 16. International Conference on Cell Biology, Structures and Cellular ... Structures and functions of the cell. Internal cellular structures. Chemical and molecular environment. Organelles. Processes. ... ICCBSCP 2022 has teamed up with the Special Journal Issue on Cell Biology, Structures and Cellular Processes. A number of ...
https://waset.org/cell-biology-structures-and-cellular-processes-conference-in-april-2022-in-jerusalem
Imaging cellular structure and function beyond the diffraction limit | Research groups | Imperial College LondonImaging cellular structure and function beyond the diffraction limit | Research groups | Imperial College London
Imaging cellular structure and function beyond the diffraction limit. Funded by the MRC Next Generation Optical Microscopy ... Imaging cellular structure and function beyond the diffraction limit. *High content analysis of 3-D cell cultures with ... Imaging cellular structure and function beyond the diffraction limit. *High content analysis of 3-D cell cultures with ... In this proposal, we will develop and apply these new imaging techniques to visualise biological structures and processes that ...
https://www.imperial.ac.uk/photonics/research/biophotonics/research/current-research/imaging-cellular-structure-and-function-beyond-the-diffraction-limit/
RCSB PDB - 1XHN: The crystal structure of Cellular Repressor of E1A-stimulated Genes (CREG)RCSB PDB - 1XHN: The crystal structure of Cellular Repressor of E1A-stimulated Genes (CREG)
Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These ... The crystal structure of CREG, a secreted glycoprotein involved in cellular growth and differentiation. Sacher, M., Di Bacco, A ... The crystal structure of Cellular Repressor of E1A-stimulated Genes (CREG). *DOI: 10.2210/pdb1XHN/pdb ... To better understand CREG function in cellular growth and differentiation, we solved the 3D crystal structure of this protein ...
https://www.rcsb.org/structure/1XHN
Probing Native Protein Structures by Chemical Cross-linking, Mass Spectrometry, and Bioinformatics | Molecular & Cellular...Probing Native Protein Structures by Chemical Cross-linking, Mass Spectrometry, and Bioinformatics | Molecular & Cellular...
Molecular & Cellular Proteomics August 1, 2010, First published on March 31, 2010, 9 (8) 1634-1649; DOI: 10.1074/mcp.R000001- ... Molecular & Cellular Proteomics August 1, 2010, First published on March 31, 2010, 9 (8) 1634-1649; DOI: 10.1074/mcp.R000001- ... Structures of most commonly used amine-reactive cross-linking reagents: DSS, BS3, DSG, and bis(sulfosuccinimidyl) glutarate (BS ... Your Name) has sent you a message from Molecular & Cellular Proteomics Message Body (Your Name) thought you would like to see ...
https://www.mcponline.org/content/9/8/1634
Molecular Details Underlying Dynamic Structures and Regulation of the Human 26S Proteasome | Molecular & Cellular ProteomicsMolecular Details Underlying Dynamic Structures and Regulation of the Human 26S Proteasome | Molecular & Cellular Proteomics
Molecular & Cellular Proteomics May 1, 2017, First published on March 14, 2017, 16 (5) 840-854; DOI: 10.1074/mcp.M116.065326 ... Molecular & Cellular Proteomics May 1, 2017, First published on March 14, 2017, 16 (5) 840-854; DOI: 10.1074/mcp.M116.065326 ... Your Name) has sent you a message from Molecular & Cellular Proteomics Message Body (Your Name) thought you would like to see ... Molecular Details Underlying Dynamic Structures and Regulation of the Human 26S Proteasome. Xiaorong Wang, Peter Cimermancic, ...
https://www.mcponline.org/content/16/5/840.abstract
7.1 life is cellular 7.2 Cell Structure7.1 life is cellular 7.2 Cell Structure
large membrane enclosed structure that contains genetic material in the form of DNA and controls many of the cells activities . ... gives cell membranes a flexible structure that forms a strong barrier between the cell and its surroundings. ... 7.1 life is cellular 7.2 Cell Structure. Loyola Cell structure vocabulary . 1. 2. 3. ...
https://www.armoredpenguin.com/crossword/Data/2012.09/1415/14153548.447.html
Frontiers | Structure, function, and plasticity of GABA transporters | Frontiers in Cellular NeuroscienceFrontiers | Structure, function, and plasticity of GABA transporters | Frontiers in Cellular Neuroscience
The Cellular and Sub-Cellular Distribution of GABA Transporters. One of the most interesting features of GAT1 and GAT3 is their ... Figure 4. The cellular and sub-cellular distribution of GABA transporters. (A) Schematized morphology of cortical pyramidal ... This reasoning obviously holds only if considering GABA transport in cellular or sub-cellular compartments where the reversal ... Figure 2. Secondary structure and surface representation of LeuTAa. (A) Topology of Aquifex aeolicus LeuTAa. The transporter is ...
https://www.frontiersin.org/articles/10.3389/fncel.2014.00161/full
Multicompartmentalized polymeric systems: towards biomimetic cellular structure and function - Archive ouverte HALMulticompartmentalized polymeric systems: towards biomimetic cellular structure and function - Archive ouverte HAL
The first step consists in mimicking the structure of the cell: its inner compartments, the organelles, with a ... from cell structure mimics towards a controlled biofunctionality. Such a biomimetic approach in material design and the future ... multicompartmentalized structure, and the rest, i.e. the cytoplasm minus the organelles (mainly cytoskeleton/ cytosol) with ... Multicompartmentalized polymeric systems: towards biomimetic cellular structure and function Maïté Marguet 1 Colin Bonduelle 1 ...
https://hal.archives-ouvertes.fr/hal-00926540
Medical Physiology/Cellular Physiology/Cell structure and Function - Wikibooks, open books for an open worldMedical Physiology/Cellular Physiology/Cell structure and Function - Wikibooks, open books for an open world
Medical Physiology/Cellular Physiology/Cell structure and Function. From Wikibooks, open books for an open world ... They are complex structures made up of ribosomal RNA and proteins. The are composed of a large and a small subunit which clamp ... It is a polarized structure with a cis and a trans side. The cis side faces the endoplasmic reticulum and the trans side the ... Structure. Characteristics. Function. Microvilli (not shown). Extensive folding of the cell membrane found in certain cells ...
https://en.wikibooks.org/wiki/Medical_Physiology/Cellular_Physiology/Cell_structure_and_Function
talks.cam : Some assembly required: In vitro reconstitution of cellular structurestalks.cam : Some assembly required: In vitro reconstitution of cellular structures
Some assembly required: In vitro reconstitution of cellular structures. Add to your list(s) Download to your calendar using ... University of Cambridge , Talks.cam , Foster Talks , Some assembly required: In vitro reconstitution of cellular structures ... Progress towards reconstitution of micron-scale cellular structures and processes has been limited by the challenges of ... Understanding the molecular basis of cellular behavior is a central goal in biology and a critical guide for medical research. ...
http://talks.cam.ac.uk/talk/index/40188
Cellular and Supramolecular Structure and Function | National Institute of Biomedical Imaging and BioengineeringCellular and Supramolecular Structure and Function | National Institute of Biomedical Imaging and Bioengineering
Cellular Imaging and Macromolecular Biophysics (LCIMB) * Cellular and Supramolecular Structure and Function ... The Cellular and Supramolecular Structure and Function (CSSF) Section of LCIMB is located in Building 13, Room 3E63. ... The Cellular and Supramolecular Structure and Function (CSSF) Section develops new methods based on electron microscopy and ... Nuclear mapping of nanodrug delivery systems in dynamic cellular environments.. Bhirde AAKapoor ALiu GIglesias-Bartolome RJin A ...
https://www.nibib.nih.gov/labs-at-nibib/laboratory-cellular-imaging-and-macromolecular-biophysics-lcimb/cellular-and-supramolecular-structure-and-function
Cell Cycle: 3d-printable jewelry design app inspired by microscopic cellular structuresCell Cycle: 3d-printable jewelry design app inspired by microscopic cellular structures
Generate your own 3d-printed jewelry with this physics-based tool inspired by microscopic cellular structures. ...
https://n-e-r-v-o-u-s.com/cellCycle/
Significance of C4 Leaf Structure at the Tissue and Cellular Levels | SpringerLinkSignificance of C4 Leaf Structure at the Tissue and Cellular Levels | SpringerLink
Taniguchi M., Cousins A.B. (2018) Significance of C4 Leaf Structure at the Tissue and Cellular Levels. In: Adams III W., ... Significance of C4 Leaf Structure at the Tissue and Cellular Levels. ... Here we discuss key leaf anatomical traits at the tissue, cellular, and sub-cellular level that influence the efficiency and ... Dengler NG, Nelson T (1999) Leaf structure and development in C4 plants. In: Sage RF, Monson RK (eds) C4 plant biology. ...
https://link.springer.com/chapter/10.1007%2F978-3-319-93594-2_9?error=cookies_not_supported&code=03cc6017-5778-493a-9ba8-2d3a31f5266b
Modeling 3D Printed Cellular Structures: Approaches - PADT, Inc. - The BlogModeling 3D Printed Cellular Structures: Approaches - PADT, Inc. - The Blog
... representing the effective property of the cellular structure without regard to the cellular geometry itself. This approach has ... This is the second in a two-part post on the modeling aspects of 3D printed cellular structures. If you havent already, please ... The literature on the 3D printing of cellular structures is vast, and growing. While the majority of the focus in this field is ... However, the assumption that the connecting struts/walls in a cellular structure behave the same way the bulk material does can ...
http://www.padtinc.com/blog/modeling-3d-printed-cellular-structures-approaches/
Modeling 3D Printed Cellular Structures: Challenges - PADT, Inc. - The BlogModeling 3D Printed Cellular Structures: Challenges - PADT, Inc. - The Blog
Modeling cellular structures has the above mentioned challenges - most have practical implications in determining what is the ... In this post, I discuss six challenges that make the modeling of 3D printed cellular structures (such as honeycombs and ... I state the most well-appreciated challenge with cellular structures first: they are NOT fully-dense solid materials that have ... It is common in the field of cellular structure modeling to extract an "effective" property - a property that represents a ...
http://www.padtinc.com/blog/the-focus/modeling-3d-printed-cellular-structures-challenges
Optimum Design of Structures for Earthquake Loading by a Cellular Evolutionary Algorithm and Neural Networks: Environment &...Optimum Design of Structures for Earthquake Loading by a Cellular Evolutionary Algorithm and Neural Networks: Environment &...
The present chapter deals with optimum design of structures for earthquake induced loads by taking into account nonlinear time ... Optimum Design of Structures for Earthquake Loading by a Cellular Evolutionary Algorithm and Neural Networks: 10.4018/978-1- ... "Optimum Design of Structures for Earthquake Loading by a Cellular Evolutionary Algorithm and Neural Networks." In Structural ... "Optimum Design of Structures for Earthquake Loading by a Cellular Evolutionary Algorithm and Neural Networks." Structural ...
https://www.igi-global.com/chapter/optimum-design-structures-earthquake-loading/66751
Cellular uptake studies of two hexanuclear, carboxylate bridged, zinc ring structures using fluorescence microscopy - Chemical...Cellular uptake studies of two hexanuclear, carboxylate bridged, zinc ring structures using fluorescence microscopy - Chemical...
Cellular uptake revealed a non-specific process, resulting in accumulation within the cell cytoplasm. ... Cellular uptake studies of two hexanuclear, carboxylate bridged, zinc ring structures using fluorescence microscopy C. Redshaw ... Cellular uptake studies of two hexanuclear, carboxylate bridged, zinc ring structures using fluorescence microscopy† ... Cellular uptake revealed a non-specific process, resulting in accumulation within the cell cytoplasm. ...
https://pubs.rsc.org/en/Content/ArticleLanding/2012/CC/c2cc32060f
Cellular Structure and Function ( Lesson Plans ) | Biology | CK-12 FoundationCellular Structure and Function ( Lesson Plans ) | Biology | CK-12 Foundation
This lesson explores the relationship between structure and function in a cell. It contains links to images, videos and an ... This lesson explores the relationship between structure and function in a cell. It contains links to images, videos and an ... Describes the four common structures of cells: plasma membranes, cytoplasms, ribosomes, and DNA.. ...
https://www.ck12.org/biology/parts-of-the-cell/lessonplanx/cellular-structure-and-function/
Cellular Structures | Profiles RNSCellular Structures | Profiles RNS
"Cellular Structures" by people in this website by year, and whether "Cellular Structures" was a major or minor topic of these ... "Cellular Structures" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical ... Below are the most recent publications written about "Cellular Structures" by people in Profiles. ... Below are MeSH descriptors whose meaning is more general than "Cellular Structures". ...
https://profiles.umassmed.edu/display/123801
Fluorescent Cell Stains for Organelles & Cellular Structures | BiotiumFluorescent Cell Stains for Organelles & Cellular Structures | Biotium
... cell structures, including membrane dyes, nuclear stains, & cytoskeleton stains. ... Biotium offers a variety of stains for different organelles and cellular structures. Scroll down or select an organelle below ... See the Cellular Stains Brochure for more information.. Biotin Derivatives. Biocytin (e-biotinoyl-L-lysine) is a cellular ... General structure of SynaptoGreenâ„¢ and SynaptoRedâ„¢ dyes.. General structure of AM fixable nerve terminal dyes.. ...
https://biotium.com/technology/cellular-stains/
JCI - CD2AP in mouse and human podocytes controls a proteolytic program that regulates cytoskeletal...JCI - CD2AP in mouse and human podocytes controls a proteolytic program that regulates cytoskeletal...
CD2AP in mouse and human podocytes controls a proteolytic program that regulates cytoskeletal structure and cellular survival. ... CD2AP in mouse and human podocytes controls a proteolytic program that regulates cytoskeletal structure and cellular survival. ... CD2AP in mouse and human podocytes controls a proteolytic program that regulates cytoskeletal structure and cellular survival. ...
https://www.jci.org/articles/view/62812
Journal Club Theme of December 2009: Impact Behaviour of Materials with Cellular Structures | iMechanicaJournal Club Theme of December 2009: Impact Behaviour of Materials with Cellular Structures | iMechanica
1. Cellular materials for impact protection. 1.1 Natural and man-made cellular structures. 1.2 Kelvin problem. 1.3 Constitutive ... Cellular solids: structure and properties, 2nd edn. , Cambridge University Press, 1997. M.F. Ashby, A.G. Evans, N.A. Fleck, L.J ... 2) Natural cellular materials Kongdong discussed the negative Poissons ratio of the sunflower honeycomb structure. The impact ... shock front structure of a cellular material. Permalink Submitted by Henry Tan on Fri, 2009-12-25 08:54. ...
https://imechanica.org/comment/13300
AutomatonAutomataMetabolic StructureGuided meditationAntennasHollowSystemAbstractAtmosphereBandsCentreCoveringWirelessMainServicesSearchShareTelephoneSpaceSingleOptionRuleDoubleMobileDamageBasicTypeLightMadeShownAppleHigh
Automaton6
  • The fact that 1D cellular automata can be universal was discussed by Alvy Ray Smith in 1970-who set up an 18-color nearest-neighbor cellular automaton rule capable of emulating Marvin Minsky 's 7-state 4-color universal Turing machine (see page 706 ). (wolframscience.com)
  • Roger Banks also mentioned in 1970 a 17-color cellular automaton that he believed was universal. (wolframscience.com)
  • In 1989 Kristian Lindgren and Mats Nordahl constructed a 7-color nearest-neighbor cellular automaton that could emulate Minsky's 7,4 universal Turing machine, and showed that in general a rule with s + k + 2 colors could emulate an s -state k -color Turing machine (compare page 658 ). (wolframscience.com)
  • I was reading on Complex Systems journal and found a paper where the author states that a cellular automaton can be viewed as a computer. (stackexchange.com)
  • is it always a given Cellular Automaton is a computer? (stackexchange.com)
  • But in a system like a cellular automaton the typical reason for it is just that in the end effects never spread beyond a limited region, as in the examples shown in the first set of pictures below. (wolframscience.com)
Automata11
  • Additionally, some cellular automata exhibit local nested structures on one side. (rutgers.edu)
  • But without any particular reason to think it would be interesting, almost nothing was done on finding simpler universal 1D cellular automata. (wolframscience.com)
  • In 1984 I suggested that cellular automata showing what I called class 4 behavior should be universal-and I identified some simple rules (such as k = 2 , r = 2 totalistic code 20) as explicit candidates. (wolframscience.com)
  • A piece published in Scientific American in 1985 describing my interest in finding simple 1D universal cellular automata led me to receive a large number of proofs of the fact (already well known to me) that 1D cellular automata can in principle emulate Turing machines. (wolframscience.com)
  • Following my ideas about class 4 cellular automata I had come by 1985 to suspect that rule 110 must be universal. (wolframscience.com)
  • Are Cellular Automata always computers? (stackexchange.com)
  • Cellular automata can be viewed as either computers or logical universes where computers may be embbed. (stackexchange.com)
  • Universal Computation in Simple One-Dimensional Cellular Automata. (stackexchange.com)
  • This program utilizes a flocking cellular automata system. (antoinettebumatay.com)
  • Examples of behavior in mobile automata and cellular automata that remains localized to a limited region and thus always eventually repeats. (wolframscience.com)
  • Cellular automata in which a repetitive pattern in both space and time is generated by evolution from a simple seed. (wolframscience.com)
Metabolic Structure1
  • Global self-organization of the cellular metabolic structure. (uniba.sk)
Guided meditation1
  • Set to beautiful music this guided meditation leads you deep into your own cellular structure to release distorted patterns and then anchor in soul patterns for health and happiness. (energiesofcreation.com)
Antennas3
  • In this particular report we cover Apple's latest cellular MacBook invention relating to specialized antennas along with Apple's overview of the Mac Pro's internal architecture. (patentlyapple.com)
  • Apple's newly granted patent covers their invention relating to electronic devices and, more particularly, to wireless electronic devices with antennas which includes cellular. (patentlyapple.com)
  • The ROHN Pole Wall Mount is designed to support most Satellite, PCS, Cellular, and Microwave antennas. (rohnnet.com)
Hollow2
  • the cellular structure of alpaca is hollow, with microscopic air pockets creating a high thermal capacity and insulation value. (planetfurniture.com.au)
  • What type of sections were used (e.g. hollow, cellular, I beams etc) and why? (saisc.co.za)
System5
  • I insisted, however, that he keep on trying, and over the next several years he developed a systematic computer-aided design system for working with structures in rule 110. (wolframscience.com)
  • These genes form a secretion system which injects CagA protein into cells where it causes disorganised cellular structure due to "growth factor like" effects. (helico.com)
  • I do think the sun is, as described in the above Wikki quote, a cellular structure that forms around the most massive (and/or chargeable )body in our part of the galaxy, becoming our solar system. (thunderbolts.info)
  • In some cases the basic structure of a system may allow only a limited number of possible states. (wolframscience.com)
  • The BUILDINGS Cellular system is especially suitable for use as a main and distribution centre. (pok.fi)
Abstract1
Atmosphere1
  • Only then can a conducive social atmosphere - based on a more egalitarian economic structure - prevail. (theseoultimes.com)
Bands1
  • For example, electronic device 10 may contain wireless communications circuitry that operates in long-range communications bands such as cellular telephone bands and wireless circuitry that operates in short-range communications bands such as the 2.4 GHz Bluetooth band and the 2.4 GHz and 5 GHz WiFi wireless local area network bands (sometimes referred to as IEEE 802.11 bands or wireless local area network communications bands). (patentlyapple.com)
Centre2
  • You are the centre of this light structure. (kamadonacademy.com)
  • The modular structure enables an almost unlimited number of different centre sizes. (pok.fi)
Covering2
  • This invention is supported by other related patents covering cellular MacBooks which could be reviewed in our special archives . (patentlyapple.com)
  • Additional damage will be dealt if Cellular Re-Structure, Poisoned Thorns, Frost Blades, Magma Covering, or Self Illumination are running on the target. (aoitems.com)
Wireless4
  • Also, when looking to densify your cellular network by constructing cellular towers, small cells or co-locate wireless equipment on CSX owned or third party structures, CSX has a streamlined process to accommodate your needs. (csx.com)
  • Utility, Wireless Infrastructure Installations & Rights of Entry: Construct and/or maintain utilities, new tower builds, small cells and co-location of both third party and CSX owned structures. (csx.com)
  • WirelessAdvisor.com is not associated by ownership or membership with any cellular, PCS or wireless service provider companies and is not meant to be an endorsement of any company or service. (wirelessadvisor.com)
  • Enhanced Cellular Reception for In-Building Wireless - Why You Need It? (teleco.com)
Main3
  • Here is everything an engineer or manager needs to know in order to build and operate a fully functional PCS (Personal Communications Systems) network -- the main competitor to cellular technology for the multi-billion-dollar mobile telecommunications market. (textbookx.com)
  • The main contractor and ecostrut worked together to make this project a success in all aspect from manufature to the complete erection of the structure. (saisc.co.za)
  • Next visualise the Orionis 5th dimensional vibration Kamadon Temple from above and below encapsulating and surrounding this structure of light with the 3 Metatronic sacred super powerballs being the main central chamber of the Temple. (kamadonacademy.com)
Services1
  • Founded in 1981, TELECO offers TELECO'S Perfect Viewâ„¢ Video Surveillance, Building Access Control, Unified Communications as a Service, Business Phone Systems, Structured Cabling, Managed IT Services, Cellular & Public Safety Distributed Antenna Systems and Photoluminescent Products. (teleco.com)
Search1
  • Connect and share knowledge within a single location that is structured and easy to search. (stackexchange.com)
Share1
  • Please note that Illinois Valley Cellular does not occupy this antenna structure, nor does Illinois Valley Cellular share tower space with Cingular/AT&T. (wirelessadvisor.com)
Telephone2
  • This issue started when, without warning, a cellular telephone equipment structure installation started at the Cabin John Volunteer Fire House on Falls Road. (wmcca.org)
  • No notice was given, no special exception was sought, and one day, Mr. North, who lives next door to the property, heard heavy machinery running and, on inquiring, was told that an equipment structure for a new cellular telephone network was being installed. (wmcca.org)
Space2
  • but its defining embedding into a Cartesian space equips its boundary with its cellular decomposition into faces , generalizing the way that the triangle has three edges (which are 1-simplices) as faces , and three points (which are vertices or 0-simplices) as corners. (ncatlab.org)
  • The limmited space and using mildsteel members to for the eaves detail made it possible to erect the structure in cost effective and timely why. (saisc.co.za)
Single1
  • the 2-color nearest-neighbor rule numbers 60, 90, 105, 150 all generate global nested structures when begun from a single black cell. (rutgers.edu)
Option1
  • Just bought my daughter a preloved Apple watch 5 that included a cellular option. (fido.ca)
Rule2
  • In general, rules with local nested structure are characterized by positional bijectivity in one of the rule components. (rutgers.edu)
  • We will prove a general theorem accounting for nested structure in a right bijective, k-color rule, and we will explore a new class of integer sequences suggested by these investigations. (rutgers.edu)
Double1
  • Cellular nature: While double layers are relatively thin, they will spread over the entire cross surface of a laboratory container. (thunderbolts.info)
Mobile1
  • Innovation is going on in a short time within the cellular advertising enviornment, and far of it is driven by the short innovation occurring in mobile hardware. (wikidot.com)
Damage1
  • Rust Oleum Epoxyshield Basement Floor Coating Water issues in the home of yours can be extremely demanding since they are able to damage the building of the structure and they can in addition affect your overall health. (oiww.org)
Basic1
  • The cellular simplex is one of the basic geometric shapes for higher structures . (ncatlab.org)
Type2
  • The statistical structure of EEG-signals has been traced by us during research on the time parameters of an EEG of a man normally and at rest on a modernized analyzer of the type AI-100-1 [1]. (cheniere.org)
  • The bridge structure supporting the decks is cellular, box type. (suhkrupatt.ee)
Light2
  • Bathe in this powerful light and love for as long as you wish, emanating your balanced structured water encoding. (kamadonacademy.com)
  • Multiwall is a light weight sheet with a cellular structure. (arlaplast.com)
Made2
  • the eaves sprockets needed to be mildsteel and by using h-beams to support the sprockets that is made out of ipe steel beams was used to speed up the process of getting the structure up and to do sheeting before the walls for the beam fill was did. (saisc.co.za)
  • The structure was made in successive overhangs, in 3. (suhkrupatt.ee)
Shown1
  • In this work it has been shown that clipped EEG-signals in their statistical structure are sharply distinguished from all known random processes and are in all probability a complex information function. (cheniere.org)
Apple1
  • Only the well heeled Bell/Rogers/Telus clan can take advantage of cellular service with the Apple watch. (fido.ca)
High1
  • Use SMS for your cellular advertising in case you need a platform with a low value, a really high open price, and a platform that's very versatile. (wikidot.com)
Three-dimensional preservation of cellular and subcellular structures suggests 1.6 billion-year-old crown-group red algae
Three-dimensional preservation of cellular and subcellular structures suggests 1.6 billion-year-old crown-group red algae (journals.plos.org)
Bacteria - Wikipedia
Bacteria - Wikipedia (en.wikipedia.org)
Atomic Force Microscopy | SpringerLink
Atomic Force Microscopy | SpringerLink (link.springer.com)
Energies | Free Full-Text | Burning Behaviour of High-Pressure CH4-H2-Air Mixtures | HTML
Energies | Free Full-Text | Burning Behaviour of High-Pressure CH4-H2-Air Mixtures | HTML (mdpi.com)
Scientists discover enzyme that supports brain tumor growth
Scientists discover enzyme that supports brain tumor growth (medicalnewstoday.com)
Essay on Mt203 Unit 2 Assignment - 754 Words | Bartleby
Essay on Mt203 Unit 2 Assignment - 754 Words | Bartleby (bartleby.com)
Archive ouverte HAL - Homology of Cellular Structures Allowing Multi-incidence
Archive ouverte HAL - Homology of Cellular Structures Allowing Multi-incidence (hal.archives-ouvertes.fr)
Mini tractor beams help arrange artificial cells into tissue structures | Imperial News | Imperial College London
Mini tractor beams help arrange artificial cells into tissue structures | Imperial News | Imperial College London (imperial.ac.uk)
Cellular protein signal can be manipulated to favor bone building
Cellular protein signal can be manipulated to favor bone building (news-medical.net)
NIOSHTIC-2 Publications Search - 20040090 - Three cases of hairy cell leukemia in coal miners - letter to editor.
NIOSHTIC-2 Publications Search - 20040090 - Three cases of hairy cell leukemia in coal miners - letter to editor. (cdc.gov)
New polymer ink expands possibilities of 3D printing - Materials Today
New polymer ink expands possibilities of 3D printing - Materials Today (materialstoday.com)
Management.com.ua] Every Institution is a Living System
Management.com.ua] Every Institution is a Living System (management.com.ua)
Help with Cell Wall Structure - GRE Subject Test: Biochemistry, Cell, and Molecular Biology
Help with Cell Wall Structure - GRE Subject Test: Biochemistry, Cell, and Molecular Biology (varsitytutors.com)
Thescelosaurus - Wikipedia
Thescelosaurus - Wikipedia (en.wikipedia.org)
Precambrian Sponges with Cellular Structures | Science
Precambrian Sponges with Cellular Structures | Science (science.sciencemag.org)
Poly(lactic acid): Synthesis, Structures, Properties, Processing, and Applications | Polymer Science & Technology General |...
Poly(lactic acid): Synthesis, Structures, Properties, Processing, and Applications | Polymer Science & Technology General |... (wiley.com)
Imaging Calcium Entry Sites and Ribbon Structures in Two Presynaptic Cells | Journal of Neuroscience
Imaging Calcium Entry Sites and Ribbon Structures in Two Presynaptic Cells | Journal of Neuroscience (jneurosci.org)
Frontiers | A Critical Reappraisal of Neutrophil Extracellular Traps and NETosis Mimics Based on Differential Requirements for...
Frontiers | A Critical Reappraisal of Neutrophil Extracellular Traps and NETosis Mimics Based on Differential Requirements for... (frontiersin.org)
3D Printing Student Projects at PADT: Visit our Open House to Learn More (Thursday, March 2, 5pm) - PADT, Inc. - The Blog
3D Printing Student Projects at PADT: Visit our Open House to Learn More (Thursday, March 2, 5pm) - PADT, Inc. - The Blog (padtinc.com)
Modeling 3D Printed Cellular Structures: Approaches - PADT, Inc. - The Blog
Modeling 3D Printed Cellular Structures: Approaches - PADT, Inc. - The Blog (padtinc.com)
Actin | SpringerLink
Actin | SpringerLink (link.springer.com)
Modeling 3D Printed Cellular Structures: Challenges - PADT, Inc. - The Blog
Modeling 3D Printed Cellular Structures: Challenges - PADT, Inc. - The Blog (padtinc.com)
Search | eLife
Search | eLife (elifesciences.org)
Biomedical Applications of Biophotonics
Biomedical Applications of Biophotonics (news-medical.net)
Defects in Mitochondrial Dynamics and Metabolomic Signatures of Evolving Energetic Stress in Mouse Models of Familial Alzheimer...
Defects in Mitochondrial Dynamics and Metabolomic Signatures of Evolving Energetic Stress in Mouse Models of Familial Alzheimer... (journals.plos.org)
FtsEX-mediated regulation of the final stages of cell division reveals morphogenetic plasticity in Caulobacter crescentus
FtsEX-mediated regulation of the final stages of cell division reveals morphogenetic plasticity in Caulobacter crescentus (journals.plos.org)
People - Biomedical Engineering - Purdue University
People - Biomedical Engineering - Purdue University (engineering.purdue.edu)
Cellular uptake studies of two hexanuclear, carboxylate bridged, zinc ring structures using fluorescence microscopy - Chemical...
Cellular uptake studies of two hexanuclear, carboxylate bridged, zinc ring structures using fluorescence microscopy - Chemical... (pubs.rsc.org)
Maximum Entropy and Bayesian Methods | Ali Mohammad-Djafari | Springer
Maximum Entropy and Bayesian Methods | Ali Mohammad-Djafari | Springer (springer.com)
RCSB PDB - 1XHN: The crystal structure of Cellular Repressor of E1A-stimulated Genes (CREG)
RCSB PDB - 1XHN: The crystal structure of Cellular Repressor of E1A-stimulated Genes (CREG) (rcsb.org)
Activation of the cGMP Pathway in Dopaminergic Structures Reduces Cocaine-Induced EGR-1 Expression and Locomotor Activity |...
Activation of the cGMP Pathway in Dopaminergic Structures Reduces Cocaine-Induced EGR-1 Expression and Locomotor Activity |... (jneurosci.org)
A DNA nanorobot functions as a cancer therapeutic in response to a molecular trigger in vivo | Nature Biotechnology
A DNA nanorobot functions as a cancer therapeutic in response to a molecular trigger in vivo | Nature Biotechnology (nature.com)