Components of a cell.
The fundamental, structural, and functional units or subunits of living organisms. They are composed of CYTOPLASM containing various ORGANELLES and a CELL MEMBRANE boundary.
A tomographic technique for obtaining 3-dimensional images with transmission electron microscopy.
The use of instrumentation and techniques for visualizing material and details that cannot be seen by the unaided eye. It is usually done by enlarging images, transmitted by light or electron beams, with optical or magnetic lenses that magnify the entire image field. With scanning microscopy, images are generated by collecting output from the specimen in a point-by-point fashion, on a magnified scale, as it is scanned by a narrow beam of light or electrons, a laser, a conductive probe, or a topographical probe.
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
Specific particles of membrane-bound organized living substances present in eukaryotic cells, such as the MITOCHONDRIA; the GOLGI APPARATUS; ENDOPLASMIC RETICULUM; LYSOSOMES; PLASTIDS; and VACUOLES.
Fluorescence microscopy utilizing multiple low-energy photons to produce the excitation event of the fluorophore. Multiphoton microscopes have a simplified optical path in the emission side due to the lack of an emission pinhole, which is necessary with normal confocal microscopes. Ultimately this allows spatial isolation of the excitation event, enabling deeper imaging into optically thick tissue, while restricting photobleaching and phototoxicity to the area being imaged.
Cellular processes, properties, and characteristics.
The network of filaments, tubules, and interconnecting filamentous bridges which give shape, structure, and organization to the cytoplasm.
A light microscopic technique in which only a small spot is illuminated and observed at a time. An image is constructed through point-by-point scanning of the field in this manner. Light sources may be conventional or laser, and fluorescence or transmitted observations are possible.
The process of generating three-dimensional images by electronic, photographic, or other methods. For example, three-dimensional images can be generated by assembling multiple tomographic images with the aid of a computer, while photographic 3-D images (HOLOGRAPHY) can be made by exposing film to the interference pattern created when two laser light sources shine on an object.
Slender, cylindrical filaments found in the cytoskeleton of plant and animal cells. They are composed of the protein TUBULIN and are influenced by TUBULIN MODULATORS.
Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
The marking of biological material with a dye or other reagent for the purpose of identifying and quantitating components of tissues, cells or their extracts.
The development and use of techniques to study physical phenomena and construct structures in the nanoscale size range or smaller.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
Fibers composed of MICROFILAMENT PROTEINS, which are predominately ACTIN. They are the smallest of the cytoskeletal filaments.
Proteins which are involved in the phenomenon of light emission in living systems. Included are the "enzymatic" and "non-enzymatic" types of system with or without the presence of oxygen or co-factors.
Microscopy in which the object is examined directly by an electron beam scanning the specimen point-by-point. The image is constructed by detecting the products of specimen interactions that are projected above the plane of the sample, such as backscattered electrons. Although SCANNING TRANSMISSION ELECTRON MICROSCOPY also scans the specimen point by point with the electron beam, the image is constructed by detecting the electrons, or their interaction products that are transmitted through the sample plane, so that is a form of TRANSMISSION ELECTRON MICROSCOPY.
Agents that emit light after excitation by light. The wave length of the emitted light is usually longer than that of the incident light. Fluorochromes are substances that cause fluorescence in other substances, i.e., dyes used to mark or label other compounds with fluorescent tags.
High molecular weight proteins found in the MICROTUBULES of the cytoskeletal system. Under certain conditions they are required for TUBULIN assembly into the microtubules and stabilize the assembled microtubules.
Monomeric subunits of primarily globular ACTIN and found in the cytoplasmic matrix of almost all cells. They are often associated with microtubules and may play a role in cytoskeletal function and/or mediate movement of the cell or the organelles within the cell.
Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.
A microtubule subunit protein found in large quantities in mammalian brain. It has also been isolated from SPERM FLAGELLUM; CILIA; and other sources. Structurally, the protein is a dimer with a molecular weight of approximately 120,000 and a sedimentation coefficient of 5.8S. It binds to COLCHICINE; VINCRISTINE; and VINBLASTINE.
A partitioning within cells due to the selectively permeable membranes which enclose each of the separate parts, e.g., mitochondria, lysosomes, etc.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
Established cell cultures that have the potential to propagate indefinitely.
A technique of inputting two-dimensional images into a computer and then enhancing or analyzing the imagery into a form that is more useful to the human observer.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The systematic study of the complete complement of proteins (PROTEOME) of organisms.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The rate dynamics in chemical or physical systems.
A cell line derived from cultured tumor cells.
Elements of limited time intervals, contributing to particular results or situations.
A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.
Organizations representing specialized fields which are accepted as authoritative; may be non-governmental, university or an independent research organization, e.g., National Academy of Sciences, Brookings Institution, etc.
The segregation and degradation of damaged or unwanted cytoplasmic constituents by autophagic vacuoles (cytolysosomes) composed of LYSOSOMES containing cellular components in the process of digestion; it plays an important role in BIOLOGICAL METAMORPHOSIS of amphibians, in the removal of bone by osteoclasts, and in the degradation of normal cell components in nutritional deficiency states.

Preliminary findings in germinal vesicle transplantation of immature human oocytes. (1/139)

Transplanting a germinal vesicle (GV) from an aged woman's oocyte into a younger ooplasm has been proposed as a possible way to reduce the incidence of oocyte aneuploidy which is considered to be responsible for age-related infertility. In this study, we have assessed the efficiency of each step involved in nuclear transplantation-specifically cell survival, nuclear-cytoplasmic reconstitution, and the capacity of the reconstituted oocytes for in-vitro maturation. In addition, we have evaluated the fertilizability and karyotypic status of the manipulated oocytes by intracytoplasmic sperm injection (ICSI) and fluorescent in-situ hybridization technique respectively. Nuclear transplantation was accomplished with an overall efficiency of 73%. Due to the limited availability of materials, most nuclear transplantation procedures were performed between sibling oocytes. The maturation rate of 62% following reconstitution was comparable with that of control oocytes, as was the incidence of aneuploidy among the reconstituted oocytes. The ICSI results of the reconstituted oocytes yielded a survival rate of 77%, a fertilization rate of 52%, and a satisfactory early embryonic cleavage. Furthermore, in a limited number of observations where the nucleus of an aged oocyte was transferred into a younger ooplasm, there was an appropriate chromosomal segregation. These findings demonstrate that human oocytes reconstituted with GV nuclei are able to undergo maturation, fertilization, and early embryo cleavage, and maintain a normal ploidy. Although in-vitro maturation seems to be a limiting step, this technique would allow us to investigate further the nuclear-ooplasmic relationship during meiotic maturation.  (+info)

Inferring sub-cellular localization through automated lexical analysis. (2/139)

MOTIVATION: The SWISS-PROT sequence database contains keywords of functional annotations for many proteins. In contrast, information about the sub-cellular localization is available for only a few proteins. Experts can often infer localization from keywords describing protein function. We developed LOCkey, a fully automated method for lexical analysis of SWISS-PROT keywords that assigns sub-cellular localization. With the rapid growth in sequence data, the biochemical characterisation of sequences has been falling behind. Our method may be a useful tool for supplementing functional information already automatically available. RESULTS: The method reached a level of more than 82% accuracy in a full cross-validation test. Due to a lack of functional annotations, we could infer localization for fewer than half of all proteins in SWISS-PROT. We applied LOCkey to annotate five entirely sequenced proteomes, namely Saccharomyces cerevisiae (yeast), Caenorhabditis elegans (worm), Drosophila melanogaster (fly), Arabidopsis thaliana (plant) and a subset of all human proteins. LOCkey found about 8000 new annotations of sub-cellular localization for these eukaryotes.  (+info)

Prediction of protein subcellular locations by support vector machines using compositions of amino acids and amino acid pairs. (3/139)

MOTIVATION: The subcellular location of a protein is closely correlated to its function. Thus, computational prediction of subcellular locations from the amino acid sequence information would help annotation and functional prediction of protein coding genes in complete genomes. We have developed a method based on support vector machines (SVMs). RESULTS: We considered 12 subcellular locations in eukaryotic cells: chloroplast, cytoplasm, cytoskeleton, endoplasmic reticulum, extracellular medium, Golgi apparatus, lysosome, mitochondrion, nucleus, peroxisome, plasma membrane, and vacuole. We constructed a data set of proteins with known locations from the SWISS-PROT database. A set of SVMs was trained to predict the subcellular location of a given protein based on its amino acid, amino acid pair, and gapped amino acid pair compositions. The predictors based on these different compositions were then combined using a voting scheme. Results obtained through 5-fold cross-validation tests showed an improvement in prediction accuracy over the algorithm based on the amino acid composition only. This prediction method is available via the Internet.  (+info)

In vivo noninvasive identification of cell composition of intimal lesions: a combined approach with ultrasonography and immunocytochemistry. (4/139)

PURPOSE: We investigated whether differences in cellular composition of the shoulder region of carotid plaque, a cell-rich, debris-free area, can be revealed with computer-driven analysis of ultrasound scans. METHODS: In 26 patients referred for carotid endarterectomy, the shoulder region of plaque eligible for surgical removal was identified with ultrasound scanning. Digital images were obtained and evaluated with a specially developed computer-driven system (Medical Image Processing [MIP]). The gray level distribution of the region of interest (ROI), along with some statistical parameters exploring the spatial distribution of pixels, such as entropy and second angular moment, were analyzed. In the specimen retrieved at surgery, the area corresponding to the ROI was selected. Cryosections were tested at immunocytochemistry with monoclonal antibodies specific to smooth muscle cells (SMCs), macrophages), and lymphocytes. Computerized image analysis was performed to quantify each cellular component of the lesion. RESULTS: Mean gray levels were related positively to the content of SMCs (r = 0.576, P =.002) and negatively to the content of macrophages (r = -0.555, P =.003). Lymphocytes did not show any correlation. Prevalence of SMCs, expressed as the ratio SMC/(SMC + macrophages), was related positively with entropy (r = 0.517, P =.007) and negatively with the second angular moment (r = -0.422, P =.032). The quartiles of gray level were useful for detecting significant differences in terms of cellular composition. CONCLUSIONS: Some cellular features of the shoulder region of plaque are associated with specific videodensitometric patterns evaluated with MIP. This approach enables in vivo noninvasive prediction and monitoring of cell composition of the shoulder region, and could be extended to study of the thickened intima.  (+info)

Prediction of protein subcellular locations using fuzzy k-NN method. (5/139)

MOTIVATION: Protein localization data are a valuable information resource helpful in elucidating protein functions. It is highly desirable to predict a protein's subcellular locations automatically from its sequence. RESULTS: In this paper, fuzzy k-nearest neighbors (k-NN) algorithm has been introduced to predict proteins' subcellular locations from their dipeptide composition. The prediction is performed with a new data set derived from version 41.0 SWISS-PROT databank, the overall predictive accuracy about 80% has been achieved in a jackknife test. The result demonstrates the applicability of this relative simple method and possible improvement of prediction accuracy for the protein subcellular locations. We also applied this method to annotate six entirely sequenced proteomes, namely Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, Oryza sativa, Arabidopsis thaliana and a subset of all human proteins. AVAILABILITY: Supplementary information and subcellular location annotations for eukaryotes are available at http://166.111.30.65/hying/fuzzy_loc.htm  (+info)

Translational polymorphism as a potential source of plant proteins variety in Arabidopsis thaliana. (6/139)

MOTIVATION: According to scanning model, 40S ribosomal subunits can either initiate translation at start AUG codon in suboptimal context or miss it and initiate translation at downstream AUG(s), thereby producing several proteins. Functional significance of such a protein translational polymorphism is still unknown. RESULTS: We compared predicted subcellular localizations of annotated Arabidopsis thaliana proteins and their potential N-terminally truncated forms started from the nearest downstream in-frame AUG codons. It was found that localizations of full and N-truncated proteins differ in many cases: 12.2% of N-truncated proteins acquired sorting signals de novo and 5.7% changed their predicted subcellular locations (mitochodria, chloroplast or secretory pathway). It is likely that the in-frame downstream AUGs may be frequently utilized to synthesize proteins possessing new functional properties and such a translational polymorphism may serve as an important source of cellular and organelle proteomes.  (+info)

Predicting subcellular localization of proteins using machine-learned classifiers. (7/139)

MOTIVATION: Identifying the destination or localization of proteins is key to understanding their function and facilitating their purification. A number of existing computational prediction methods are based on sequence analysis. However, these methods are limited in scope, accuracy and most particularly breadth of coverage. Rather than using sequence information alone, we have explored the use of database text annotations from homologs and machine learning to substantially improve the prediction of subcellular location. RESULTS: We have constructed five machine-learning classifiers for predicting subcellular localization of proteins from animals, plants, fungi, Gram-negative bacteria and Gram-positive bacteria, which are 81% accurate for fungi and 92-94% accurate for the other four categories. These are the most accurate subcellular predictors across the widest set of organisms ever published. Our predictors are part of the Proteome Analyst web-service.  (+info)

Morphological and physiological changes induced by high hydrostatic pressure in exponential- and stationary-phase cells of Escherichia coli: relationship with cell death. (8/139)

The relationship between a loss of viability and several morphological and physiological changes was examined with Escherichia coli strain J1 subjected to high-pressure treatment. The pressure resistance of stationary-phase cells was much higher than that of exponential-phase cells, but in both types of cell, aggregation of cytoplasmic proteins and condensation of the nucleoid occurred after treatment at 200 MPa for 8 min. Although gross changes were detected in these cellular structures, they were not related to cell death, at least for stationary-phase cells. In addition to these events, exponential-phase cells showed changes in their cell envelopes that were not seen for stationary-phase cells, namely physical perturbations of the cell envelope structure, a loss of osmotic responsiveness, and a loss of protein and RNA to the extracellular medium. Based on these observations, we propose that exponential-phase cells are inactivated under high pressure by irreversible damage to the cell membrane. In contrast, stationary-phase cells have a cytoplasmic membrane that is robust enough to withstand pressurization up to very intense treatments. The retention of an intact membrane appears to allow the stationary-phase cell to repair gross changes in other cellular structures and to remain viable at pressures that are lethal to exponential-phase cells.  (+info)

Intracellular transport plays an essential role in maintaining the organization of polarized cells. Motor proteins tether and move cargos along microtubules during long-range transport to deliver them to their proper location of function. To reach their destination, cargo-bound motors must overcome barriers to their forward motion such as intersection points between microtubules. The ability to visualize how motors navigate these barriers can give important information about the mechanisms that lead to efficient transport. Here, we first develop an all-optical correlative imaging method based on single-particle tracking and superresolution microscopy to map the transport trajectories of cargos to individual microtubules with high spatiotemporal resolution. We then use this method to study the behavior of lysosomes at microtubule-microtubule intersections. Our results show that the intersection poses a significant hindrance that leads to long pauses in transport only when the separation distance of the
Preselection of pace-mapping sites is usually based on the 12-lead VT ECG. Limited information is available concerning the 12-lead VT ECG in rTOF and its relation to AIs. In a series of 11 rTOF patients with 15 AI-related VT, 2 RBBB, and 13 LBBB VTs with a RV critical isthmus site were induced. The QRS precordial transition tended to be at V3 or later in AI1-related VTs and earlier in AI3- or AI4-related VTs (5).. Notably, a RBBB VT morphology was observed in 25% of VTs in our series, which is usually considered to indicate a left ventricular site of origin. Despite the RBBB morphology, 71% of VTs were approachable from the RV. A positive concordant 12-lead VT ECG was typical for AI3 dependent VT with clockwise activation of AI3. Of interest, RBBB VTs with V2 transition break was consistent with a left-sided exit within the coronary cusp or subaortic left ventricular outflow tract.. The unexpected high prevalence of RBBB VTs arising from the RVOT may be explained by the anterocephalic deviation ...
Thank you for your interest in spreading the word on Circulation.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
Plasmid pCAG-ChR2-mRuby2-ST from Dr. Hillel Adesniks lab contains the insert ChR2-mRuby2-ST and is published in Nat Neurosci. 2018 Apr 30. pii: 10.1038/s41593-018-0139-8. doi: 10.1038/s41593-018-0139-8. This plasmid is available through Addgene.
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA sequence 6756 bps ctgcagagggccctgcgtatgagtgcaagtgggttttaggaccaggatgaggcggggtgggggtgcctac ctgacgaccgaccccgacccactggacaagcacccaacccccattccccaaattgcgcatcccctatcag agagggggaggggaaacaggatgcggcgaggcgcgtgcgcactgccagcttcagcaccgcggacagtgcc ttcgcccccgcctggcggcgcgcgccaccgccgcctcagcactgaaggcgcgctgacgtcactcgccggt cccccgcaaactccccttcccggccaccttggtcgcgtccgcgccgccgccggcccagccggaccgcacc acgcgaggcgcgagataggggggcacgggcgcgaccatctgcgctgcggcgccggcgactcagcgctgcc tcagtctgcggtgggcagcggaggagtcgtgtcgtgcctgagagcgcagtcgaattcaagctgctagcaa ggatccacccgccacctaccggtcctagggccaccatggtgtctaagggcgaagagctgatcaaggaaaa tatgcgtatgaaggtggtcatggaaggttcggtcaacggccaccaattcaaatgcacaggtgaaggagaa ggcaatccgtacatgggaactcaaaccatgaggatcaaagtcatcgagggaggacccctgccatttgcct ttgacattcttgccacgtcgttcatgtatggcagccgtacttttatcaagtacccgaaaggcattcctga tttctttaaacagtcctttcctgagggttttacttgggaaagagttacgagatacgaagatggtggagtc gtcaccgtcatgcaggacaccagccttgaggatggctgtctcgtttaccacgtccaagtcagaggggtaa ...
Conventional light microscopes cannot distinguish structures when they are separated by a distance smaller than, roughly, the wavelength of light. Superresolution microscopy, developed since the 1980s, lifts this limitation, using fluorescent moieties. Scientists at the Max Planck Institute for Polymer Research have now discovered that graphene nano-molecules can be used to improve this microscopy technique. These graphene nano-molecules offer a number of substantial advantages over the materials previously used, making superresolution microscopy even more versatile. ...
Pamidi S, Redline S, Rapoport D, Ayappa I, Palombini L, Farre R, Kirkness J, Pépin JL, Polo O, Wellman A, Kimoff RJ. An Official American Thoracic Society Workshop Report: Noninvasive Identification of Inspiratory Flow Limitation in Sleep Studies. Ann Am Thorac Soc. 2017 Jul; 14(7):1076-1085 ...
Results The authors identified 178 gene expression programmes (modules) expressed in primary GCs, which were associated with distinct biological processes, chromosomal location patterns, cis-regulatory motifs and clinicopathological parameters. Expression of a transforming growth factor β (TGF-β) signalling associated super-module of stroma-related genes consistently predicted patient survival in multiple GC validation cohorts. The proportion of intra-tumoural stroma, quantified by morphometry in tissue sections from gastrectomy specimens, was also significantly associated with stromal super-module expression and GC patient survival. ...
Active Motifs Cell and Organelle Stains are fluorescent dyes for staining subcellular structures in live and in fixed cells, simplifying the study of cellular structures or the identification of stem cells using fluorescence microscopy
Get an overview of PALM practical aspects and continue to learn superresolution microscopy. Know how to analyze fluorescent samples and to use the appropriate software.
In the field of image superresolution reconstruction (SRR), the prior can be employed to solve the ill-posed problem. However, the prior model is selected empirically and characterizes the entire image so that the local feature of image cannot be represented accurately. This paper proposes a feature-driven prior model relying on feature of the image and introduces a block-based maximum a posteriori (MAP) framework under which the image is split into several blocks to perform SRR. Therefore, the local feature of image can be characterized more accurately, which results in a better SRR. In process of recombining superresolution blocks, we still design a border-expansion strategy to remove a byproduct, namely, cross artifacts. Experimental results show that the proposed method is effective.
Structures in Human Cells. Cellular Organization. The Plasma Membrane. Fluid-mosaic model of the plasma membrane. The Nucleus. Ribosomes. Structures in Human Cells in pictures
Cellular organization refers to the components of a cell and how these individual parts are arranged within the cell. Cells are the smallest organizational levels of living...
Cell Structure and Function. Cell Theory. All living organisms are made of cells . Cells are small aqueous solution (cytoplasm) organelles ( subcellular structures)
Video articles in JoVE about microscopy fluorescence multiphoton include Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins.
OmniVision Technologies, Inc., a leading developer of advanced digital imaging solutions, and Almalence Inc., one of the worlds leaders in computatio
I havent cared to read all 44 pages of replys and Im fairly certain youve enough material for your paper at this point though I feel certain things oughtnt be left out of your paper. With evidence provided by the Miller-Urey experiments it is known the general composition of our early atmosphere was capable of producing something that we today might identify as lifelike- presumably a protobiont with a primitive lipid membrane and some means of reproduction- presumably RNA. under proper circumstances these RNA molecules could multiply, though it is doubtful any kind of orderly cellular structure developed for millions of years, a simple strip of RNA may as well be classified as a living thing due to its ability to reproduce ...
I havent cared to read all 44 pages of replys and Im fairly certain youve enough material for your paper at this point though I feel certain things oughtnt be left out of your paper. With evidence provided by the Miller-Urey experiments it is known the general composition of our early atmosphere was capable of producing something that we today might identify as lifelike- presumably a protobiont with a primitive lipid membrane and some means of reproduction- presumably RNA. under proper circumstances these RNA molecules could multiply, though it is doubtful any kind of orderly cellular structure developed for millions of years, a simple strip of RNA may as well be classified as a living thing due to its ability to reproduce ...
Get an answer for What hypothesis could you form to explain what would happen to the cell or organism if at least two cell structures were damaged or destroyed? and find homework help for other Science questions at eNotes
Figure 5 Maps of Anterior Infarct, Relation of Voltage and SI Mapping, and Morphology of Induced VT. (Top panel) Endocardial voltage (A) and subendocardial signal intensity (B) maps of an anterior infarct showing the similarity of scar from the patient shown in Figure 3A. (A) The voltage map shows the extension of the scar when the voltage scar definition was set ,1.5 mV. (B) The signal intensity map is consistent with the magnetic resonance imaging short-axis view shown in Figure 3A. The channel that runs parallel to the mitral annulus between segments 2 and 3 (black arrows) coincides with the heterogeneous tissue channel in frames 5 and 6 in Figure 3A. The second channel, perpendicular to the mitral annulus is in segment 3 (white arrow), this channel corresponds with the heterogeneous tissue channel in frames 1 and 2. The continuity of the signal-intensity channel is interrupted when the heterogeneous tissue channel (frame 3) moves to the epicardium. Then it moves back to the endocardium and ...
This makes it possible to measure samples quickly and adapt test conditions immediately during an experiment instead of evaluating them afterwards, says Rainer Heintzmann, describing the practical benefits of the new technology.. The scientists tested the method on biological cells and recorded the movements of mitochondria, the energy centres of the cells that are about one micrometer in size. We were able to produce about 60 frames per second - a higher frame rate than those of motion pictures. The time between measurement and image is less than 250 milliseconds, which is why the technology allows real-time recordings, says Andreas Markwirth.. So far, superresolution images have often been combined with conventional methods: A conventional fast microscope is used to first find structures. These structures can then be examined in detail using a superresolution microscope. However, some structures are so small that they cannot be found with conventional microscopes, for example special pores ...
Our main project deals with understanding the organization of the unique grid-like network of skeletal muscle fiber microtubules. Results obtained in previous y...
Expanding its 3D microcopy portfolio, ZEISS introduced superresolution photoactivated localization microscopy (PALM) in 3D at the Society for Neuroscience Annual Meeting in San Diego, California.
Superresolution optical microscopy, for which the Nobel Prize was awarded to Eric Betzig, Stefan Hell, and William Moerner in 2014, has been one of th
Welcome to the website of Ulrike Boehm - physicist, entrepreneur & science communicator. Here you can learn more about my research & various other projects.
A company spun out from Harvard University aims to provide life sciences researchers with a way to achieve subdiffraction imaging resolution using sta
New techniques for automatic invasive and noninvasive identification of inspiratory flow limitation (IFL) are presented. Data were collected from 11 patients with full nocturnal polysomnography and gold-standard esophageal pressure (Pes) measurement. A total of 38,782 breaths were extracted and automatically analyzed. An exponential model is proposed to reproduce the relationship between Pes and airflow of an inspiration and achieve an objective assessment of changes in upper airway obstruction. The characterization performance of the model is appraised with three evaluation parameters: mean-squared error when estimating resistance at peak pressure, coefficient of determination, and assessment of IFL episodes. The models results are compared to the two best-performing models in the literature. The obtained gold-standard IFL annotations were then employed to train, test, and validate a new noninvasive automatic IFL classification system. Discriminant analysis, support vector machines, and ...
This is the first study to examine the utility of 3DE for noninvasive identification of elevated RAP, testing the concept that enlarged 3DE-derived RA volume may be useful for identifying elevated RAP. Although qualitative and 2DE measures of RA size did not correlate with RAP, 3DE RA volume was correlated with RAP in this population of advanced heart failure patients. Compared with the combination of dilated IVC and reduced IVC collapse, the addition of 3DE maximal RA volume to IVC diameter resulted in improved sensitivity for identification of RAP ,10 mm Hg. The combination of 3D-RAVi ≥35 ml/m2 and IVC ≥2 cm, compared with the presence of a dilated IVC alone, also trended toward improved specificity for RAP ,10 mm Hg without compromising accuracy or sensitivity.. Whereas RA size is determined by qualitative assessment in many laboratories, the results of the current study indicate only a modest correlation between qualitative assessment of RA size and 3DE RA volume. In addition, whereas ...
Recently, 18FDG-PET has emerged as a promising imaging modality for visualizing plaque inflammation. Our prospective, controlled, randomized trial has shown here for the first time by the use of 18FDG-PET co-registered with enhanced CT that 3-month simvastatin treatment attenuates plaque inflammation. Although simvastatin decreased LDL-C and increased HDL-C, only the increase in HDL-C was correlated with the decrease in 18FDG uptake. Thus, the antiinflammatory effect of simvastatin on atherosclerotic plaques may be one of the pleiotropic effects independent of LDL-C-lowering.. Noninvasive identification of inflammatory plaque has been challenging. With the recent advance in imaging technologies, we can get the morphology of plaques and some information about plaque stability (12,13) but cannot see the inflammation directly. Because 18FDG-PET can visualize tissue glucose metabolism with high sensitivity and we can quantify 18FDG uptake in the region of interest, we used this metabolic imaging ...
Organisms across the evolutionary spectrum have evolved mechanisms to maintain the integrity of the cellular proteome. Among these mechanisms are spatial protein quality control pathways in which damaged and misfolded cellular proteins are actively sequestered at unique subcellular structures in response to acute stress. This mitigates the deleterious effects of these aberrant protein species, which can include advanced cellular aging and cytotoxicity leading to cell death. Despite the universal importance of such spatial control of the proteome, there is considerable mechanistic diversity throughout the evolutionary scale regarding how this control is achieved. In a recent publication in Cell Reports (Egan and McClintock et al., PMID 25865884) the Reck-Peterson Lab expanded on the known evolutionary diversity of spatial quality control mechanisms by examining the subcellular organization of heat-induced protein aggregates in filamentous fungi, which are of substantial health and economic ...
yes - the ballonist assumes youd have electricity i dont. lifetime of opportunistic net made out of cell phones running our modified twitter client to tell people where you are and send hashtag data with sensor net is about 7 days... coverage? depends on mobility patterns of scavenger missions and landscape/territory - given the way people surivve in clusters (see for example googles mapping of haiti earthquake damage), it can be very good, in fact, if you design your manet/dtn routing with the actual human movement/location patterns in mind.... something mon golfier frere hasnt being able to hand the disaster teams 72 hours later with a map of who is where and what resources are still working would be good i nteh book i cited, not knowing this led to susequent followup diasters (like shooting people who were sharing water thinking they were looters) In missive ,[email protected][10.0.1.3],, John Day typed: ,,You seem to be assuming you have electricity. Which seems like a big ...
Studies that include genetic, biochemical, biophysical, bioinformatic and structural analyses leading to a deeper understanding of the molecular principals underlying basic physiological processes or mechanisms are considered as potentially suitable for publication in the Journal. Topics that are considered appropriate include gene expression and regulation, pathogenicity and virulence, physiology and metabolism, synthesis of macromolecules (proteins, nucleic acids, lipids, polysaccharides, etc), cell biology and subcellular organization, membrane biogenesis and function, traffic and transport, cell-cell communication and signalling pathways, evolution and gene transfer ...
None of the current superresolution microscopy techniques can reliably image the changes in endogenous protein nanoclustering dynamics associated with specific conformations in live cells. Single-domain nanobodies have been invaluable tools to isolate defined conformational states of proteins, and we reasoned that expressing these nanobodies coupled to single-molecule imaging-amenable tags could allow superresolution analysis of endogenous proteins in discrete conformational states. Here, we used anti-GFP nanobodies tagged with photoconvertible mEos expressed as intrabodies, as a proof-of-concept to perform single-particle tracking on a range of GFP proteins expressed in live cells, neurons, and small organisms. We next expressed highly specialized nanobodies that target conformation-specific endogenous β2-adrenoreceptor (β2-AR) in neurosecretory cells, unveiling real-time mobility behaviors of activated and inactivated endogenous conformers during agonist treatment in living cells. We showed ...
Microbial transformation of hydrocarbons. II. Growth constants and cell composition of microbial cells derived from |em|n|/em|-alkanes | F. Wagner; Th. Kleemann; W. Zahn | download | BookSC. Download books for free. Find books
In late 2014, just a month after learning he had won that years Nobel Prize in Chemistry for superresolution microscopy, Eric Betzig and colleagues described a technique that has taken the microscopy world by storm.. Lattice light-sheet microscopy (LLSM) projects ultrathin, low-intensity planes of light into a biological sample, boosting image clarity while reducing phototoxicity and photobleaching, thus allowing researchers to image live cells at high resolution for extended periods. Still in development at Zeiss, and sublicensed to 3i, which has released a commercial version of its own, LLSM has been a hit with the microscopy community, says Betzig, a group leader at the Howard Hughes Medical Institutes Janelia Research Campus. Besides the systems sold by 3i itself, Betzig estimates his team has guided 70 or so groups in setting up their own versions of the system, and another 40 have gotten time on the system in Janelias Advanced Imaging Center in Ashburn, Virginia.. But for all that, the ...
With the patent-pending SuperResolution upgrade, you can capture extremely high-resolution infrared images (up to megapixel quality) with your Testo thermal imager. The SuperResolution upgrade improves the usable geometric resolution of the thermal image by a factor of 1.6 - with four times as many measuring values.
Superresolution imaging is a rapidly emerging new field of microscopy that dramatically improves the spatial resolution of light microscopy by over an order of magnitude (approximately 10-20-nm resolution), allowing biological processes to be described at the molecular scale. Here, we discuss a form …
Fundamental to the success of cell and developmental biology is the ability to tease apart molecular organization in cells and tissues by localizing specific proteins with respect to one another in a native cellular context. However, many key cellular structures (from mitochondrial cristae to nuclea …
Copyright Get Revising 2018 all rights reserved. Get Revising is one of the trading names of The Student Room Group Ltd. Register Number: 04666380 (England and Wales), VAT No. 806 8067 22 Registered office: International House, Queens Road, Brighton, BN1 3XE ...
Lastek is the exclusive distributor in Australia and New Zealand for more than fifty leading international laser, optic, detection, spectroscopy and imaging manufacturers.
View Notes - Chapter 4 Cell Structure and Function from BSC BSC1005 at Broward College. Chapter 4 Cell Structure and Function: An Overview I. Pastures of the Seas A. Vast populations of single-celled
proteopedia link. Many PDB files contain complexes in which a particular protein is interacting with a different protein in what are called multi-protein assemblies or multi-protein complexes. These interactions, if biologically relevant, can be immensely insightful in shedding light on cellular and extracellular processes. ...
Cellular structures known as midbodies, formed during cell division, appear to accumulate in stem cells and cancer cells, hinting at a potential function for these once-disregarded organelles.. 9 Comments. ...
The ability to obtain an accurate three-dimensional image of an intact cell is critical for unraveling the mysteries of cellular structure and function. However, for many years, tiny structures buried deep inside cells have ...
pH (potential of hydrogen) is the measurement of resistance and indicates the speed at which energy is moving through the body.pH is key in digestion.The pH reading tells us if we are getting the right amount of the right kind of minerals and if the energy from our food is being put on our frequency so it can be used to build and maintain cellular structures. An acidic pH (5.0 6.2) shows there is too little resistance or in this case digestion is going too fast and not assimilating any minerals.An alkaline pH (6.6 7.0) shows there is too much resistance or digestion is going to slow and food basically starts to rot in our digestive track.As in an acidic body, an alkaline body has minimal assimilation of minerals ...
Two articles in one, with strong scientific details showing the evolutionary claim to be invalid: From: ICR Many supporters of evolutionary theory have claimed that nylon-eating bacteria strongly demonstrate the kind of evolution that can create new cellular structures, new cells, and new organisms.1 However, examining only the apparent, visible beneficial trait can be misleading. Recent…
Cell Structure and Function: Questions 26-32 of 413. Get to the point NEET (National Eligibility cum Medical Entrance Test) Biology questions for your exams.
Cell Structure and Function: Questions 299-307 of 413. Get to the point NEET (NTA-National Eligibility cum Medical Entrance Test) Biology questions for your exams.
Learn Cell Structure and Function facts using a simple interactive process (flashcard, matching, or multiple choice). Finally a format that helps you memorize and understand. Browse or search in thousands of pages or create your own page using a simple wizard. No signup required!
Study Flashcards On BIO 101 Chapter 4 Cell Structure at Cram.com. Quickly memorize the terms, phrases and much more. Cram.com makes it easy to get the grade you want!
Printz RL, Osawa H, Ardehali H, Koch S, Granner DK (Feb 1997). "Hexokinase II gene: structure, regulation and promoter ... Its inducible expression indicates its adaptive role in metabolic responses to changes in the cellular environment. HK2 is ... Printz RL, Osawa H, Ardehali H, Koch S, Granner DK (Feb 1997). "Hexokinase II gene: structure, regulation and promoter ... Schindler A, Foley E (Dec 2013). "Hexokinase 1 blocks apoptotic signals at the mitochondria". Cellular Signalling. 25 (12): ...
VEGF-A binds to VEGFR-1 (Flt-1) and VEGFR-2 (KDR/Flk-1). VEGFR-2 appears to mediate almost all of the known cellular responses ... Stuttfeld E, Ballmer-Hofer K (September 2009). "Structure and function of VEGF receptors". IUBMB Life. 61 (9): 915-22. doi: ... All members of the VEGF family stimulate cellular responses by binding to tyrosine kinase receptors (the VEGFRs) on the cell ... Holmes K, Roberts OL, Thomas AM, Cross MJ (October 2007). "Vascular endothelial growth factor receptor-2: structure, function, ...
Miller DJ, Jerga A, Rock CO, White SW (July 2008). "Analysis of the Staphylococcus aureus DgkB structure reveals a common ... As both lipids are thought to function as bioactive lipid signaling molecules with distinct cellular targets, DGK therefore ... van Blitterswijk WJ, Houssa B (October 2000). "Properties and functions of diacylglycerol kinases". Cellular Signalling. 12 (9- ... catalytic mechanism for the soluble diacylglycerol kinases". Structure. 16 (7): 1036-46. doi:10.1016/j.str.2008.03.019. PMC ...
Vaughn J, Wolford JK, Prochazka M, Permana PA (Aug 2000). "Genomic structure and expression of human KCNJ9 (Kir3.3/GIRK3)". ... Cellular Signalling. 11 (12): 871-83. doi:10.1016/S0898-6568(99)00059-5. PMID 10659995. ...
The presence of intra-cellular proteins is common ground, and it is agreed that proteins such as the Scaffold, or Matrix ... In contrast to the cytoskeleton, however, the nuclear matrix has been proposed to be a dynamic structure. Along with the ... Evidence for such a structure was recognised as long ago as 1948 (Zbarskii and Debov), and consequently many proteins ... Rynearson AL, Sussman CR (June 2011). "Nuclear structure, organization, and oncogenesis". Journal of Gastrointestinal Cancer. ...
The first structure to be solved by this method was that of sperm whale myoglobin by Sir John Cowdery Kendrew. In this ... On the other hand, a protein may interact briefly and in a reversible manner with other proteins in only certain cellular ... The crystal structures of complexes, obtained at high resolution from different but homologous proteins, have shown that some ... The molecular structures of many protein complexes have been unlocked by the technique of X-ray crystallography. ...
... secondary structure has not been explicitly determined, but predictions based on the PRR36 mRNA give some possibilities. ... Cellular Proteomics. 7 (9): 1598-608. doi:10.1074/mcp.M700574-MCP200. PMC 2528073. PMID 18463090. Blom N, Sicheritz-Pontén T, ... "SOSUI". Classification and Secondary Structure Prediction of Membrane Proteins. Mitaku Group. Xue Y, Ren J, Gao X, Jin C, Wen L ... Alpha-helixes, beta sheets, and other structure characteristics fail to be conserved across PRP36 orthologs with the exception ...
These filamentous structures are also present during multivesicular body formation and function as a ring-like fence that plugs ... The ESCRT machinery plays a vital role in a number of cellular processes including multivesicular body (MVB) biogenesis, ... The formation of this spiral-like structure deforms the membrane and the AAA-ATPase spastin is brought in by Did2 and Ist1 to ... Samson, RY; Dobro, MJ; Jensen, GJ; Bell, SD (2017). "The Structure, Function and Roles of the Archaeal ESCRT Apparatus". Sub- ...
"Polymorphism" refers to formation of diverse structures such as three-dimensional tubes, rods, and structures with cubic ... Cellular Lipidomics. The EMBO Journal (2005) 24, 3159-3165, doi:10.1038/sj.emboj.7600798. Published online 1 September 2005 " ... The Structure of Biological Membranes. 2nd. ed. CRC Press, (2005). 173-194. Digging Deeper the Surfactant; Accessed: February 2 ... The phospholipid bilayer is a two-layer structure mainly composed of phospholipids, which are amphiphilic molecules that have ...
Unlike traditionally structured programming languages, APL code is typically structured as chains of monadic or dyadic ... GCA - Global Cellular Automation. Inherently massively parallel. 'APL has been chosen because of the ability to express matrix ... More recent implementations of APL generally include comprehensive control structures, so that data structure and program ... Early APL implementations (circa 1970 or so) had no programming loop-flow control structures, such as do or while loops, and if ...
Shuman S (2000). "Structure, mechanism, and evolution of the mRNA capping apparatus". Progress in Nucleic Acid Research and ... Molecular and Cellular Biology. 18 (9): 5189-98. doi:10.1128/MCB.18.9.5189. PMC 109104. PMID 9710603. ... As of late 2007, 5 structures have been solved for this class of enzymes, with PDB accession codes 1D8H, 1D8I, 1I9S, 1I9T, and ... Lima CD, Wang LK, Shuman S (November 1999). "Structure and mechanism of yeast RNA triphosphatase: an essential component of the ...
Luboshits G, Benayahu D (2005). "MS-KIF18A, new kinesin; structure and cellular expression". Gene. 351: 19-28. doi:10.1016/j. ... PDBe-KB provides an overview of all the structure information available in the PDB for Human Kinesin-like protein KIF18A v t e ...
Shoyab M, Plowman GD, McDonald VL, Bradley JG, Todaro GJ (February 1989). "Structure and function of human amphiregulin: a ... Molecular and Cellular Biology. 11 (5): 2547-57. doi:10.1128/MCB.11.5.2547. PMC 360024. PMID 2017164. Kimura H, Fischer WH, ... "Structure and function of human amphiregulin: a member of the epidermal growth factor family". Science. 243 (4894 Pt 1): 1074-6 ... Amphiregulin is part of cellular response type 2. It was found that the cell source of amphiregulin is innate lymphoid cells 2 ...
A DNA unwinding element (DUE or DNAUE) is the initiation site for the opening of the double helix structure of the DNA at the ... Bell SD (2012). "Archaeal orc1/cdc6 proteins". Sub-Cellular Biochemistry. Subcellular Biochemistry. 62: 59-69. doi:10.1007/978- ... In eukaryotes, nucleosome structures can complicate replication initiation. They can block access of DUE-B's to the DUE, thus ... Kemp M, Bae B, Yu JP, Ghosh M, Leffak M, Nair SK (April 2007). "Structure and function of the c-myc DNA-unwinding element- ...
The phosphoacceptors often reside within loops in the protein structure suitably termed 'activation loops'. The structures of ... It will therefore be inaccessible to cellular substrates. In response to DNA damage, the kinase domain of one monomer ... Mol CD, Lim KB, Sridhar V, Zou H, Chien EY, Sang BC, Nowakowski J, Kassel DB, Cronin CN, McRee DE (Aug 2003). "Structure of a c ... The known structures include: Tyr phosphorylation sites in juxtamembrane regions: human cKIT, Tyr568 (PDB: 1PKG) human CSF1R, ...
As an allosteric structure regulated by Ca2+ in the troponin complex, it binds and stabilizes the position of tropomyosin in ... Perry SV (Jan 1999). "Troponin I: inhibitor or facilitator". Molecular and Cellular Biochemistry. 190 (1-2): 9-32. doi:10.1023/ ... PDB: 1J1E 1J1E​; Takeda S, Yamashita A, Maeda K, Maéda Y (Jul 2003). "Structure of the core domain of human cardiac troponin in ... Vassylyev DG, Takeda S, Wakatsuki S, Maeda K, Maéda Y (Apr 1998). "Crystal structure of troponin C in complex with troponin I ...
Vincent JP (October 1995). "Neurotensin receptors: binding properties, transduction pathways, and structure". Cellular and ...
Journal of Cellular Biochemistry. 71(3): 400-415. Fleming H. 1999 Structure and function of cultured endometrial epithelial ... These structures can divide symmetrically by an amitotic nuclear fission process, forming new "bells". Or they can fission ... It does not involve these paired structures being pulled in opposite directions by a mitotic spindle to form daughter cells. ... forming structures (mitonucleons) that become elevated as a result of vacuole formation during the initial 6 hours of ...
The structure was reported in a letter titled "MOLECULAR STRUCTURE OF NUCLEIC ACIDS A Structure for Deoxyribose Nucleic Acid", ... The latter was thought to be a tetramer, with the function of buffering cellular pH. In 1937, William Astbury produced the ... For this purpose it has to fold into a structure. It has been shown that to allow to create all possible structures at least ... These flat four-base units then stack on top of each other to form a stable G-quadruplex structure. These structures are ...
Its three-dimensional structure is also the first example of any human steroid-converting enzyme. This enzyme contains a short- ... Molecular and Cellular Endocrinology. 248 (1-2): 38-46. doi:10.1016/j.mce.2005.11.035. PMID 16480815. S2CID 19087697. Peltoketo ... Luu-The V, Labrie C, Simard J, Lachance Y, Zhao HF, Couët J, Leblanc G, Labrie F (Feb 1990). "Structure of two in tandem human ... Ghosh D, Pletnev VZ, Zhu DW, Wawrzak Z, Duax WL, Pangborn W, Labrie F, Lin SX (May 1995). "Structure of human estrogenic 17 ...
Crystallographic structure of fsTnI in troponin complex from chicken fast skeletal muscle showed an overall structure similar ... As AMPK is a key regulator of cellular energetics, phosphorylation of this site may provide an adaptive mechanism during energy ... Takeda S, Yamashita A, Maeda K, Maéda Y (Jul 2003). "Structure of the core domain of human cardiac troponin in the Ca(2+)- ... The overlapping of enhancer elements of the TnT gene promoter with the upstream TnI gene structure may be a critical factor in ...
Rubin CI, Atweh GF (October 2004). "The role of stathmin in the regulation of the cell cycle". Journal of Cellular Biochemistry ... They are highly dynamic structures that continuously alternate between assembly and disassembly. Stathmin performs an important ... Changes in the cytoskeleton are important because the cytoskeleton is a scaffold required for many cellular processes, such as ... Steinmetz MO (May 2007). "Structure and thermodynamics of the tubulin-stathmin interaction". Journal of Structural Biology. 158 ...
Nakao M, Nomiyama H, Shimada K (Jul 1990). "Structures of human genes coding for cytokine LD78 and their expression". Molecular ... and Cellular Biology. 10 (7): 3646-58. doi:10.1128/MCB.10.7.3646. PMC 360801. PMID 1694014. Irving SG, Zipfel PF, Balke J, ...
In its active form, the protein forms a ring structure consisting of three PNPase molecules. Each PNPase molecule consists of ... Molecular and Cellular Biology. 21 (16): 5408-16. doi:10.1128/MCB.21.16.5408-5416.2001. PMC 87263. PMID 11463823. Grunberg- ... Structure. 8 (11): 1215-26. doi:10.1016/S0969-2126(00)00521-9. PMID 11080643. Yehudai-Resheff S, Hirsh M, Schuster G (August ...
Pease, D. C. (1947). "The structure of trichocysts revealed by the electron microscope". Journal of Cellular Physiology. 29 (1 ... It is also a structure in the cortex of certain ciliate and flagellate protozoans consisting of a cavity and long, thin threads ...
Rademacher M, Zimmerman AW, Rüterjans H, Veerkamp JH, Lücke C (Oct 2002). "Solution structure of fatty acid-binding protein ... Molecular and Cellular Biology. 23 (6): 2213-24. doi:10.1128/MCB.23.6.2213-2224.2003. PMC 149461. PMID 12612091. Sánchez-Font ... Gene Structure and Expression. 1354 (1): 24-8. doi:10.1016/S0167-4781(97)00115-2. PMID 9375786. Godbout R, Bisgrove DA, Shkolny ... "Crystal structure and thermodynamic analysis of human brain fatty acid-binding protein". The Journal of Biological Chemistry. ...
The secondary structure of C8orf34 is predicted to consist mostly of free random coils with alpha helices being the dominant ... At the cellular level, several pieces of evidence support the conclusion that C8orf34 plays a role in gene expression ... "[email protected] : SOPMA secondary structure prediction". npsa-prabi.ibcp.fr. Retrieved 2019-05-06. Walter P, Roberts K, Raff M, Lewis J, ... The structure prediction and analysis application Phyre2 reported that a portion of C8orf34 has close structural similarity ...
Ford HL, Silver DL, Kachar B, Sellers JR, Zain SB (Dec 1997). "Effect of Mts1 on the structure and activity of nonmuscle myosin ... Molecular and Cellular Biology. 20 (18): 6731-40. doi:10.1128/MCB.20.18.6731-6740.2000. PMC 86192. PMID 10958671. Wei Q, ... It appears that NM-IIB plays an essential role in maintaining normal adherens junction integrity and structure. A cardiac ... These data indicate that NM-IIB functions in ensuring the proper maintenance of intercalated disc structures. Single nucleotide ...
... a highly organized and dynamic structure". Journal of Cellular Biochemistry. 96 (3): 506-21. doi:10.1002/jcb.20519. PMID ... Understanding the structure and function of cells is fundamental to all of the biological sciences. The similarities and ... The theme of "structure to function" is central to biology. Physiological studies have traditionally been divided into plant ... The Structure of Evolutionary Theory. The Belknap Press of Harvard University Press: Cambridge, 2002. ISBN 0-674-00613-5. p. ...
Katamine S, Notario V, Rao CD, Miki T, Cheah MS, Tronick SR, Robbins KC (Jan 1988). "Primary structure of the human fgr proto- ... Molecular and Cellular Biology. 5 (4): 831-8. doi:10.1128/MCB.5.4.831. PMC 366788. PMID 2581127. Brickell PM, Patel M (Dec 1988 ... Patel M, Leevers SJ, Brickell PM (Feb 1990). "Structure of the complete human c-fgr proto-oncogene and identification of ... Nishizawa M, Semba K, Yoshida MC, Yamamoto T, Sasaki M, Toyoshima K (Feb 1986). "Structure, expression, and chromosomal ...
Wu, Samuel Miao-sin; Johnston, Daniel (1995). Foundations of cellular neurophysiology. Cambridge, Mass: MIT Press. ISBN 0-262- ... structure, physiology and cognitive abilities of the nervous system.[1][2][3][4] ... others argue that uncovering structural functional relations depends on including as much neuronal and network structure as ...
Geyer M, Fackler OT, Peterlin BM (2001). "Structure--function relationships in HIV-1 Nef". EMBO Rep. 2 (7): 580-5. doi:10.1093/ ... N-myristoyltransferase 2 Molecular and Cellular Biology portal. ...
One of the earliest commercial applications of turbo coding was the CDMA2000 1x (TIA IS-2000) digital cellular technology ... "Digital Video Broadcast (DVB); Frame structure, channel coding and modulation for a second generation digital terrestrial ... "Digital Video Broadcast (DVB); Second generation framing structure, channel coding and modulation systems for Broadcasting, ... more advanced decoding algorithms can take advantage of the error structure and achieve more reliable communication than a ...
how community structure, function and stability is determined.[36][37]. Ecological pyramids[edit]. See also: Ecological pyramid ... extra-cellular polymers, nectar, root exudates and leachates, dissolved organic matter, extra-cellular matrix, mucilage). The ... Pyramid structure can vary across ecosystems and across time. In some instances biomass pyramids can be inverted. This pattern ... At different levels in the hierarchy of life, such as the stability of a food web, "the same overall structure is maintained in ...
... s play roles in cellular organization and polarity long before the development and incorporation of Wnt signaling ... Cell-cell adhesion complexes are required for simple epithelia in higher organisms to maintain structure, function and polarity ... it is nonetheless an important player in cellular organization, function and growth. α-catenin participates in the formation ... although β-catenin substitutes for plakoglobin at many cellular junctions. Keratinocytes engineered to not express alpha- ...
The movement of substances across the membrane can be either passive, occurring without the input of cellular energy, or active ... StructureEdit. The phospholipid bilayer. The membrane is made up of a thin layer called the 'phospholipid bilayer'. This has ...
Fox KM، Dias JA، Van Roey P (2001). "Three-dimensional structure of human follicle-stimulating hormone". Mol. Endocrinol. 15 (3 ... Cellular component. • extracellular exosome. • سيتوبلازم. • منطقة خارج الخلية. • extracellular space. Biological process. • ...
Cellular component. • cellular component. Biological process. • multicellular organism development. • intramembranous ...
Rosenbloom J (1984). «Elastin: relation of protein and gene structure to disease». Lab. Invest. 51 (6): 605-23. PMID 6150137. ... Bertram C, Hass R (2009). «Cellular senescence of human mammary epithelial cells (HMEC) is associated with an altered MMP-7/HB- ... EGF signaling and increased formation of elastin-like structures». Mech. Ageing Dev. 130 (10): 657-69. PMID 19682489. doi: ... use of recombinantly expressed human elastin polypeptides as a model for investigations of structure and self-assembly of ...
... a necessary component for cellular division.[13] The vinca alkaloids thus prevent microtubule polymerization, as opposed to the ... and Key Analogues and Development of Inspired Methodology Suitable for the Systematic Study of Their Structure-Function ...
... and flattened leaf stems called phyllodes which differ from leaves both in their structure and origin.[4][7] Some structures of ... or metabolized by cellular respiration to provide chemical energy to run cellular processes. The leaves draw water from the ... Rudall, Paula J. (2007). Anatomy of flowering plants: an introduction to structure and development (3rd ed.). Cambridge: ... On the other hand, I-beam leaves such as Banksia marginata involve specialized structures to stiffen them. These I-beams are ...
This processing appears to allow the virus to bind to cellular proteins enabling it to fuse with internal cellular membranes ... which reduces the availability of specific integrins responsible for cell adhesion to the intercellular structure and causes ... Klenk, Hans-Dieter; Feldmann, Heinz (2004). Ebola and Marburg viruses: molecular and cellular biology (Limited preview). ... Virions bud off from the cell, gaining their envelopes from the cellular membrane from which they bud. The mature progeny ...
Structure and function[edit]. Yeast OST is composed of eight different membrane-spanning proteins in three subcomplexes (one of ... Lizak C, Gerber S, Numao S, Aebi M, Locher KP (June 2011). "X-ray structure of a bacterial oligosaccharyltransferase". Nature. ... Pfeffer S, Dudek J, Gogala M, Schorr S, Linxweiler J, Lang S, Becker T, Beckmann R, Zimmermann R, Förster F (2014). "Structure ... Wild R, Kowal J, Eyring J, Ngwa EM, Aebi M, Locher KP (2018). "Structure of the yeast oligosaccharyltransferase complex gives ...
The structure contains a core network within a larger network of interconnected nuclei that function to maintain respiratory ... The Cellular Building Blocks of Breathing. Comprehensive Physiology 2012;2(4):2683-2731. doi:10.1002/cphy.c110033. Guyenet, PG ... the pre-Bötzinger complex needs to rearrange the activity of its neurons and requires the assistance of other brain structures ...
"Fc-structure". Archived from the original on 2007-11-10. Retrieved 2007-12-03.. ... The Fc portion of rituximab mediates antibody-dependent cellular cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC ... Rituximab mechanisms of action; the three major independent mechanisms are (1) antibody dependent cellular cytotoxicity (ADCC ... antibody-dependent cellular cytotoxicity).[55] This strategy for enhancing a monoclonal antibody's ability to induce ADCC takes ...
Toyoshima C. et al (2000). "Crystal structure of the calcium pump of sarcoplasmic reticulum at 2.6 A resolution". Nature 405 ( ... Endoplasmic reticulum (ER) is a cellular organelle. It is the transport network for molecules going to specific places, as ...
SP amplifies or excites most cellular processes.[15][16]. Substance P is a key first responder to most noxious/extreme stimuli ... given that NK1Rs are unprotected by a blood brain barrier in the area postrema just adjacent to neuronal structures in the ... Editorial: impact of substance p on cellular immunity. 22, 93-98 (2008). ... Journal of Cellular Physiology. 201 (2): 167-80. doi:10.1002/jcp.20061. PMID 15334652.. ...
Cellular component. • high-density lipoprotein particle. • extracellular region. • very-low-density lipoprotein particle. ... It is expressed in the liver and has a predicted protein structure characteristic of the other genes in this family. Apo C4 is ...
Mann, T. (2012). Spermatophores: Development, Structure, Biochemical Attributes and Role in the Transfer of Spermatozoa. ... The blood vessels consist of arteries, capillaries and veins and are lined with a cellular endothelium which is quite unlike ... Both the structures and editing sites are conserved in the coleoid genome and the mutation rates for the sites are severely ... They are similar in structure to those of a fish and are enclosed in a cartilaginous capsule fused to the cranium. The cornea ...
... is a member of a group of bacteria that possess the stalk structure, a tubular extension from the cell ... The rate of progression of the cell cycle is further adjusted by additional signals arising from cellular sensors that monitor ... The other daughter, called the "stalked" cell, has a tubular stalk structure protruding from one pole that has an adhesive ... and cellular differentiation. Caulobacter daughter cells have two very different forms. One daughter is a mobile "swarmer" cell ...
See retina for information on the retinal layer structure. *^ Provencio, I.; et al. (2000-01-15). "A human opsin in the inner ... This article is about cellular photoreceptors. For other types of photoreceptors, see Photoreceptor (disambiguation). ... Rod and cone photoreceptors are found on the outermost layer of the retina; they both have the same basic structure. Closest to ... and stimulation by light causes its structure to change to all-trans-retinal. This structural change causes it to activate a ...
During embryonic development mesenchymal cells will form cellular structures known as 'condensations.' These cellular units ... Chondrocytes are only present in cartilage where they will produce cartilaginous matrix to maintain the structure. Sox9, L-Sox5 ... Osteoprogenitor cells can be identified by their associations with existing bone or cartilage structures, or their placement in ... Depending on the different effects, the cellular condensations may differentiate into osteogenic or chondrocytic condensations ...
Anatomy is the study of the physical structure of organisms. In contrast to macroscopic or gross anatomy, cytology and ... Subspecialties include transfusion medicine, cellular pathology, clinical chemistry, hematology, clinical microbiology and ... Biomechanics is the study of the structure and function of biological systems by means of the methods of Mechanics. ... Histology is the study of the structures of biological tissues by light microscopy, electron microscopy and ...
"Molecular and Cellular Biology. 21 (2): 524-33. doi:10.1128/MCB.21.2.524-533.2001. PMC 86614. PMID 11134340.. ... anatomical structure morphogenesis. • metanephric epithelium development. • mesenchymal to epithelial transition involved in ... Cellular component. • nucleoplasm. • cell nucleus. Biological process. • regulation of apoptotic process. • pronephros ... "Molecular and Cellular Biology. 13 (10): 6024-35. doi:10.1128/mcb.13.10.6024. PMC 364662. PMID 8413205.. ...
Molecular and Cellular Probes. 31: 22-27. doi:10.1016/j.mcp.2016.08.003. PMID 27523487. Archived (PDF) from the original on 20 ... 2010). "Chapter 6, Structure, Function and Biogenesis of the Borrelia Cell Envelope". Borrelia: Molecular Biology, Host ... Auwaerter PG, Aucott J, Dumler JS (January 2004). "Lyme borreliosis (Lyme disease): molecular and cellular pathobiology and ...
The skull bone structure can also be subject to a neoplasm that by its very nature reduces the volume of the intracranial ... and release and recruitment of cellular mediators (e.g., cytokines) that disrupt normal parenchymal function. ... Anaplastic cells have lost total control of their normal functions and many have deteriorated cell structures. Anaplastic cells ... the dedifferentiation causes the cells to lose all of their normal structure/function), or cancer stem cells can increase their ...
"review). Molecular and Cellular Endocrinology. 389 (1-2): 71-83. doi:10.1016/j.mce.2014.02.002. PMC 4040308. PMID 24530924.. ... or prevention of disease and/or articles intended to affect the structure or any function of the human body."[33][34] ...
Unstained biological structures appear mostly transparent under Bright-field microscopy as most cellular structures do not ... This effect is called photoelasticity, and can be used to reveal stresses in structures. The birefringent material is placed ... Nevertheless, the variation in the materials that constitutes these structures also corresponds to a variation in the ... "On the structure of doubly refracting crystals". Philosophical Magazine. 45 (202): 126. doi:10.1080/14786441508638398 ...
Radhey Lal Singhal; John A. Thomas (1 January 1976). Cellular Mechanisms Modulating Gonadal Action. University Park Press. p. ... Singh SM, Gauthier S, Labrie F (2000). "Androgen receptor antagonists (antiandrogens): structure-activity relationships". Curr ... Singh SM, Gauthier S, Labrie F (February 2000). "Androgen receptor antagonists (antiandrogens): structure-activity ... based on chemical structure: steroidal and nonsteroidal.[57][58][65] Steroidal AR antagonists are structurally related to ...
Few species have multi-cellular glands. Hairs consist of one cell and occur in many forms: from simple to forked, star-, tree- ... "Secondary Structure Analyses of the Nuclear rRNA Internal Transcribed Spacers and Assessment of Its Phylogenetic Utility ...
BICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures.. Splinter D1, Razafsky DS, ... BICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures ... BICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures ... BICD2, dynactin, and LIS1 cooperate in regulating dynein recruitment to cellular structures ...
A. Chemical structure of an 8oxoG base in the anti configuration base paired with a dC. Adapted from []. B. Chemical structure ... DNA polymerase family X: function, structure, and cellular roles.. Yamtich J1, Sweasy JB. ... Remarkably, although these enzymes have similar three-dimensional structures, their biochemical properties and cellular ... The mispaired crystal structure was aligned with crystal structures of the binary and correctly paired ternary complexes of pol ...
Our work aims at providing a way to compute homologies directly on a cellular structure. This is done through the computation ... cellular structures that allow multi-incidence between cells. We deal here with combinatorial maps, more precisely chains of ... Homology computation on such structures is usually achieved by computing simplicial homology on a simplicial analog. But such ... expensive because it requires computing this simplicial analog and performing the homology computation on a structure ...
If youre seeing this message, it means were having trouble loading external resources on our website.. If youre behind a web filter, please make sure that the domains *.kastatic.org and *.kasandbox.org are unblocked. ...
The invention consits of a modular, self-reconfigurable cellular robot system with a plurality of interconnected individual ...
A non-biological entity with a cellular organizational structure (also known as a cellular organization, cellular system, nodal ... efficient use of cellular organizational planning. A cellular business structure is partly related, philosophically speaking, ... Tony Hsieh, the CEO of Zappos, has remarked that his business considers cellular-type self-management groups to be a key to its ... This structure, as applied in areas such as business management, exists in direct contrast to traditional hierarchical ...
Cellular Structures in Instabilities. Proceedings of the Meeting "Structures cellulaires dans les instabilités - périodicité, ... Profil Structures boundary element method chaos convection dynamical system dynamical systems equilibrium geometry laminar flow ... Defects and interactions with the structures in ehd convection in nematic liquid crystals ... Electro-hydro-dynamical convective structures and transitions to chaos in a liquid crystal ...
... have mapped out the structure of an important protein involved in cellular function and nervous system development. ... The new structure provides crucial information for understanding how the protein binds to cellular components. Its also the ... TSRI scientists map out protein structure involved in cellular function, nervous system development. *Download PDF Copy ... Cellular Highways. While previous research had shown that TTLL7 modifies microtubules (hollow tubes that transport cellular ...
Structures and Cellular Processes scheduled on April 29-30, 2022 in April 2022 in Jerusalem is for the researchers, scientists ... Structures and Cellular Processes. ICCBSCP 2022: 16. International Conference on Cell Biology, Structures and Cellular ... Structures and functions of the cell. Internal cellular structures. Chemical and molecular environment. Organelles. Processes. ... ICCBSCP 2022 has teamed up with the Special Journal Issue on Cell Biology, Structures and Cellular Processes. A number of ...
Imaging cellular structure and function beyond the diffraction limit. Funded by the MRC Next Generation Optical Microscopy ... Imaging cellular structure and function beyond the diffraction limit. *High content analysis of 3-D cell cultures with ... Imaging cellular structure and function beyond the diffraction limit. *High content analysis of 3-D cell cultures with ... In this proposal, we will develop and apply these new imaging techniques to visualise biological structures and processes that ...
Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These ... The crystal structure of CREG, a secreted glycoprotein involved in cellular growth and differentiation. Sacher, M., Di Bacco, A ... The crystal structure of Cellular Repressor of E1A-stimulated Genes (CREG). *DOI: 10.2210/pdb1XHN/pdb ... To better understand CREG function in cellular growth and differentiation, we solved the 3D crystal structure of this protein ...
Molecular & Cellular Proteomics August 1, 2010, First published on March 31, 2010, 9 (8) 1634-1649; DOI: 10.1074/mcp.R000001- ... Molecular & Cellular Proteomics August 1, 2010, First published on March 31, 2010, 9 (8) 1634-1649; DOI: 10.1074/mcp.R000001- ... Structures of most commonly used amine-reactive cross-linking reagents: DSS, BS3, DSG, and bis(sulfosuccinimidyl) glutarate (BS ... Your Name) has sent you a message from Molecular & Cellular Proteomics Message Body (Your Name) thought you would like to see ...
Molecular & Cellular Proteomics May 1, 2017, First published on March 14, 2017, 16 (5) 840-854; DOI: 10.1074/mcp.M116.065326 ... Molecular & Cellular Proteomics May 1, 2017, First published on March 14, 2017, 16 (5) 840-854; DOI: 10.1074/mcp.M116.065326 ... Your Name) has sent you a message from Molecular & Cellular Proteomics Message Body (Your Name) thought you would like to see ... Molecular Details Underlying Dynamic Structures and Regulation of the Human 26S Proteasome. Xiaorong Wang, Peter Cimermancic, ...
large membrane enclosed structure that contains genetic material in the form of DNA and controls many of the cells activities . ... gives cell membranes a flexible structure that forms a strong barrier between the cell and its surroundings. ... 7.1 life is cellular 7.2 Cell Structure. Loyola Cell structure vocabulary . 1. 2. 3. ...
The Cellular and Sub-Cellular Distribution of GABA Transporters. One of the most interesting features of GAT1 and GAT3 is their ... Figure 4. The cellular and sub-cellular distribution of GABA transporters. (A) Schematized morphology of cortical pyramidal ... This reasoning obviously holds only if considering GABA transport in cellular or sub-cellular compartments where the reversal ... Figure 2. Secondary structure and surface representation of LeuTAa. (A) Topology of Aquifex aeolicus LeuTAa. The transporter is ...
The first step consists in mimicking the structure of the cell: its inner compartments, the organelles, with a ... from cell structure mimics towards a controlled biofunctionality. Such a biomimetic approach in material design and the future ... multicompartmentalized structure, and the rest, i.e. the cytoplasm minus the organelles (mainly cytoskeleton/ cytosol) with ... Multicompartmentalized polymeric systems: towards biomimetic cellular structure and function Maïté Marguet 1 Colin Bonduelle 1 ...
Medical Physiology/Cellular Physiology/Cell structure and Function. From Wikibooks, open books for an open world ... They are complex structures made up of ribosomal RNA and proteins. The are composed of a large and a small subunit which clamp ... It is a polarized structure with a cis and a trans side. The cis side faces the endoplasmic reticulum and the trans side the ... Structure. Characteristics. Function. Microvilli (not shown). Extensive folding of the cell membrane found in certain cells ...
Some assembly required: In vitro reconstitution of cellular structures. Add to your list(s) Download to your calendar using ... University of Cambridge , Talks.cam , Foster Talks , Some assembly required: In vitro reconstitution of cellular structures ... Progress towards reconstitution of micron-scale cellular structures and processes has been limited by the challenges of ... Understanding the molecular basis of cellular behavior is a central goal in biology and a critical guide for medical research. ...
Cellular Imaging and Macromolecular Biophysics (LCIMB) * Cellular and Supramolecular Structure and Function ... The Cellular and Supramolecular Structure and Function (CSSF) Section of LCIMB is located in Building 13, Room 3E63. ... The Cellular and Supramolecular Structure and Function (CSSF) Section develops new methods based on electron microscopy and ... Nuclear mapping of nanodrug delivery systems in dynamic cellular environments.. Bhirde AAKapoor ALiu GIglesias-Bartolome RJin A ...
Generate your own 3d-printed jewelry with this physics-based tool inspired by microscopic cellular structures. ...
Phys.org)-A team of researches affiliated with several institutions in Japan has conducted research into the cellular structure ... Phys.org)-A team of researches affiliated with several institutions in Japan has conducted research into the cellular structure ... Researchers gain better understanding of cellular intestinal barrier structure. by Bob Yirka , Phys.org ... Here we present the structure of mammalian claudin-19 in complex with C-CPE at 3.7 Å resolution. The structure shows that C-CPE ...
Taniguchi M., Cousins A.B. (2018) Significance of C4 Leaf Structure at the Tissue and Cellular Levels. In: Adams III W., ... Significance of C4 Leaf Structure at the Tissue and Cellular Levels. ... Here we discuss key leaf anatomical traits at the tissue, cellular, and sub-cellular level that influence the efficiency and ... Dengler NG, Nelson T (1999) Leaf structure and development in C4 plants. In: Sage RF, Monson RK (eds) C4 plant biology. ...
... representing the effective property of the cellular structure without regard to the cellular geometry itself. This approach has ... This is the second in a two-part post on the modeling aspects of 3D printed cellular structures. If you havent already, please ... The literature on the 3D printing of cellular structures is vast, and growing. While the majority of the focus in this field is ... However, the assumption that the connecting struts/walls in a cellular structure behave the same way the bulk material does can ...
Modeling cellular structures has the above mentioned challenges - most have practical implications in determining what is the ... In this post, I discuss six challenges that make the modeling of 3D printed cellular structures (such as honeycombs and ... I state the most well-appreciated challenge with cellular structures first: they are NOT fully-dense solid materials that have ... It is common in the field of cellular structure modeling to extract an "effective" property - a property that represents a ...
The present chapter deals with optimum design of structures for earthquake induced loads by taking into account nonlinear time ... Optimum Design of Structures for Earthquake Loading by a Cellular Evolutionary Algorithm and Neural Networks: 10.4018/978-1- ... "Optimum Design of Structures for Earthquake Loading by a Cellular Evolutionary Algorithm and Neural Networks." In Structural ... "Optimum Design of Structures for Earthquake Loading by a Cellular Evolutionary Algorithm and Neural Networks." Structural ...
Cellular uptake revealed a non-specific process, resulting in accumulation within the cell cytoplasm. ... Cellular uptake studies of two hexanuclear, carboxylate bridged, zinc ring structures using fluorescence microscopy C. Redshaw ... Cellular uptake studies of two hexanuclear, carboxylate bridged, zinc ring structures using fluorescence microscopy† ... Cellular uptake revealed a non-specific process, resulting in accumulation within the cell cytoplasm. ...
This lesson explores the relationship between structure and function in a cell. It contains links to images, videos and an ... This lesson explores the relationship between structure and function in a cell. It contains links to images, videos and an ... Describes the four common structures of cells: plasma membranes, cytoplasms, ribosomes, and DNA.. ...
"Cellular Structures" by people in this website by year, and whether "Cellular Structures" was a major or minor topic of these ... "Cellular Structures" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical ... Below are the most recent publications written about "Cellular Structures" by people in Profiles. ... Below are MeSH descriptors whose meaning is more general than "Cellular Structures". ...
Discover the new insight into the Cellular Structure. Discribed in Anatomy Trains 3rd Edition, the sheets of the endoplasmic ... New Insight into Cellular Structure: Totally tubular, dude. Posted November 2, 2016. by Tom Myers ... Home / Anatomy Trains Blog / News / New Insight into Cellular Structure: Totally tubular, dude ...
... cell structures, including membrane dyes, nuclear stains, & cytoskeleton stains. ... Biotium offers a variety of stains for different organelles and cellular structures. Scroll down or select an organelle below ... See the Cellular Stains Brochure for more information.. Biotin Derivatives. Biocytin (e-biotinoyl-L-lysine) is a cellular ... General structure of SynaptoGreen™ and SynaptoRed™ dyes.. General structure of AM fixable nerve terminal dyes.. ...
  • If you haven't already, please read the first part here , where I detail the challenges associated with modeling 3D printed cellular structures. (padtinc.com)
  • In an article published online February 12 by Science Express , Hoelz and his colleagues describe the structure of a significant portion of the NPC, which is made up of many copies of about 34 different proteins, perhaps 1,000 proteins in all and a total of 10 million atoms. (caltech.edu)
  • In this new effort the researchers learned more about the crystal structure of claudin-19, one of the major proteins that exist in the barrier, by watching how it was impacted by a bacterial toxin known as CPE-prior research has shown that it breaks down material in the tight junctions allowing entry into the bloodstream and causing food borne illnesses . (phys.org)
  • Hydroxyl radical footprinting (HRF) has been successfully used to study the structure of both nucleic acids and proteins. (rsc.org)
  • This dissertation explores the effects of non-steroidal anti-inflammatory drugs (NSAIDs) on human colorectal cancer (CRC) cell proteins related to cellular structure and adhesion. (tennessee.edu)
  • USP7 is a cellular protein that binds and stabilizes many proteins involved in multiple pathways that regulate oncogenesis and as such is recognized as a potential target for cancer therapy. (prolekare.cz)
  • We then used this information to identify two cellular proteins, GMPS and UHRF1, that also bind USP7 through this binding site. (prolekare.cz)
  • Therefore we have identified a new mechanism by which both viral and cellular proteins can target USP7. (prolekare.cz)
  • Ubiquitin specific protease 7 (USP7) catalyzes the deubiquitination of many cellular proteins involved in tumor suppression, neural stem cell maintenance, DNA damage and immune responses [ 1 - 8 ]. (prolekare.cz)
  • Several proteins from herpesviruses target USP7 predominantly to undermine cellular defense mechanisms [ 9 , 25 - 27 ]. (prolekare.cz)
  • Moreover, abundant cellular structural proteins similar to mammalian muscle tissues were also identified. (biomedcentral.com)
  • Structural proteins are involved in maintenance of cellular structures and are crucial in cell polarity, cell to cell communication, movement and migration, cell division and other functions requiring cell malleability. (epigentek.com)
  • Motor proteins, such as myosin, kinesins, and dyneins facilitate the movement of organelles along the cells cytoskeletal structure. (epigentek.com)
  • These cellular building blocks (DNA, RNA, proteins, lipids etc.) interact with one another to form a hierarchy of dynamic, information-rich, macromolecular assemblies that drive a plethora of intriguing biological processes. (dicp.ac.cn)
  • Upon infection, coronaviruses extensively rearrange cellular membranes into organelle-like replicative structures that consist of double-membrane vesicles and convoluted membranes to which the nonstructural proteins involved in RNA synthesis localize. (mdpi.com)
  • This review will summarize the current knowledge on the biogenesis of the replicative structures, the membrane anchoring of the replication-transcription complexes, and the location of viral RNA synthesis, with particular focus on the dynamics of the coronavirus replicative structures and individual replication-associated proteins. (mdpi.com)
  • According to the hypothesis explored in this paper, native aggregation is genetically controlled (programmed) reversible aggregation that occurs when interacting proteins form new temporary structures through highly specific interactions. (vladimirmatveev.ru)
  • When the cell is activated, secondary structures appear in natively unfolded proteins (including unfolded regions in other proteins), and globular proteins begin to melt and their secondary structures become available for interaction with the secondary structures of other proteins. (vladimirmatveev.ru)
  • These temporary secondary structures provide a means for highly specific interactions between proteins. (vladimirmatveev.ru)
  • Research in this region is centered on how best to make proteins more stable to raise knowledge about protein structure and organization. (pr-gateway.de)
  • According to the paper's abstract, the printed and sintered alumina foam honeycomb structures have a relative density of just ~6%, making them incredibly lightweight. (ceramics.org)
  • One example of a cellular structure is the honeycomb, a morphological structure made by bees that is based on the bee's round bottom shape and size, which mainly functions to either store honey or larvae. (wordpress.com)
  • Typical cellular confinement systems are geosynthetics made with ultrasonically welded high-density polyethylene (HDPE) strips or novel polymeric alloy (NPA)-and expanded on-site to form a honeycomb-like structure-and filled with sand, soil, rock, gravel or concrete. (wikipedia.org)
  • Current research includes development of techniques for (1) determining the tertiary and quaternary structures of macromolecular assemblies, (2) visualizing 3D ultrastructure, (3) mapping the elemental composition of subcellular compartments quantitatively, and (4) studying bionanoparticles and their interactions with cells. (nih.gov)
  • We are also developing techniques for determining subcellular structure based on axial bright-field STEM tomography by recording images from micrometer-thick sections of cells over a range of tilt angles. (nih.gov)
  • In this research, we are developing techniques to map chemical elements contained in subcellular structures using (1) energy-filtered transmission electron microscopy (EFTEM), and (2) STEM coupled with electron energy loss spectroscopy (EELS). (nih.gov)
  • The concluding discussion compares cellular and subcellular hard-X-ray microradiology with other techniques and evaluates its potential impact on biomedical research. (epfl.ch)
  • The applications range widely from morphostructural analyses of cellular structures, to the investigation of subcellular structures, to functional investigations, and reveal a powerful new way of looking at biological samples. (springer.com)
  • This paper focuses on homology computation over 'cellular' structures that allow multi-incidence between cells. (archives-ouvertes.fr)
  • But such an approach is computationally expensive because it requires computing this simplicial analog and performing the homology computation on a structure containing many more cells (simplices) than the initial one. (archives-ouvertes.fr)
  • A non-biological entity with a cellular organizational structure (also known as a cellular organization, cellular system, nodal organization, nodal structure, et cetera) is set up in such a way that it mimics how natural systems within biology work, with individual 'cells' or 'nodes' working somewhat independently to establish goals and tasks, administer those things, and troubleshoot difficulties. (wikipedia.org)
  • Cellular organization" is the defining property in living organisms.These cells exist in a broader network in which they frequently communicate with each other, exchanging information, in a more or less even organizational playing field. (wikipedia.org)
  • It allows researchers to visualise biological structure and function on almost the molecular scale in live cells and organisms. (imperial.ac.uk)
  • The cellular repressor of E1A-stimulated genes (CREG) is a secreted glycoprotein that inhibits proliferation and enhances differentiation of human embryonal carcinoma cells. (rcsb.org)
  • Progress towards reconstitution of micron-scale cellular structures and processes has been limited by the challenges of generating in vitro systems that capture the spatial organization, physical constraints, and dynamics of living cells. (cam.ac.uk)
  • Of particular current interest is to determine the structure of postsynaptic densities in hippocampal neurons, as well as ribbon synapses in rod bipolar cells of retina. (nih.gov)
  • Finally, the homogenization of these cells can lose insight into how structures behave in the transition region between different volume fractions, even if each cell type is calibrated at a range of volume fractions - this is likely to be exacerbated for failure modeling. (padtinc.com)
  • Firefly luciferase gene: structure and expression in mammalian cells. (asm.org)
  • Our experimental results demonstrate that full-field hard-X-ray microscopy is finally able to investigate the internal structure of cells in tissues. (epfl.ch)
  • The beta-carotene in basil is even more powerful than straight Vitamin A because it protects the cells that line many body structures, including your blood vessels. (bioelectricshield.com)
  • When using fluorescence microscope techniques to study cells, it is essential that the cell structure and contents are preserved after preparation of the samples, and that the preparation method employed does not create artefacts that can be perceived as cellular structure/components. (lu.se)
  • In addition, the C terminal region of γ-tubulin (green fluorescence protein tagged [GFP]-γ-tubulin 334--449 ) forms cytosolic GFP-labeled structures, which can easily be imaged in live cells but are not preserved in fixed cells [1,3]. (lu.se)
  • This protocol describes a method that preserves γ-tubulin-containing structures in fixed cells. (lu.se)
  • forms cytosolic GFP-labeled structures, which can easily be imaged in live cells but are not preserved in fixed cells [1,3]. (lu.se)
  • In the cellular automata simulation, the object under consideration is divided into small cells and the simulation is performed according to the local rule which is defined as the local relationship among cells. (edu.au)
  • First, truss elements are considered as the cells of the cellular automata and the local rule is derived from the optimization problem. (edu.au)
  • Human CRC cells treated with the NSAID sulindac sulfide (SS) showed dramatic morphological changes under differential interference contrast and fluorescent microscopy, as well as weakened cellular adhesion and loss of membrane permeability as measured by micro-impedance. (tennessee.edu)
  • To elucidate a molecular mechanisms involved, two independent microarray analysis were performed using HCT-116 cells, and the gene Nesprin-2 was selected for further study based on its novelty in relation to cancer and its role in cell organization and structure (Chapter 2). (tennessee.edu)
  • Further micro-impedance experiments on cells with reduced Nesprin-2 expression showed a proportional decrease in cellular adhesion. (tennessee.edu)
  • this structure was identified as the AG and is formed by a homogeneous mass of cells characterized by a small size (7 μm), a cytoplasm with discrete cell boundaries, and an oval nucleus (4 μm). (brillonline.com)
  • An international group of researchers led by Professor Christoph Hess from the Department of Biomedicine at the University of Basel and University Hospital Basel have now found a structure that accounts for the rapid immunologic memory of particular immune cells (CD8 + memory T cells): these important memory cells form multiple connections between mitochondria - the powerhouses of cells - and the endoplasmic reticulum, the site of protein production. (myscience.org)
  • Cells are highly complex biological structures… This completely affects the biological functions at many size scales. (wordpress.com)
  • Our interest is focused in the self-organizing processes of cells, their formation and the resultant structures produced by genetic info ration in nature. (wordpress.com)
  • Structures in Human Cells. (lubopitko-bg.com)
  • The nucleus is a prominent structure in human cells. (lubopitko-bg.com)
  • These micro-tools can be used both to control the shape and adhesive pattern of individual cells and to highlight the laws governing the formation of intracellular structures. (cea.fr)
  • Although cultured cells show what appear to be random cell division orientation axes, in fact, the laws governing cell structure are actually hidden by the situational variability. (cea.fr)
  • The team say that by altering artificial cell membranes they can now get the cells to stick together like 'stickle bricks' - allowing them to be arranged into whole new structures. (imperial.ac.uk)
  • Now, researchers from Imperial College London and Loughborough University have demonstrated a new level of complexity with artificial cells by arranging them into basic tissue structures with different types of connectivity. (imperial.ac.uk)
  • These structures could be used to perform functions like initiating chemical reactions or moving chemicals around networks of artificial and biological cells. (imperial.ac.uk)
  • What structures do human epithelial cells have in common with elodea cells? (reference.com)
  • Human epithelial cells, which are animal cells, and elodea cells, which are plant cells, share many structures because both are eukaryotic cells, or cells with a membrane-bound nucleus. (reference.com)
  • Plant cells have several structures not present in animal cells, such as a rigid cell wall made of cellulose, chloroplasts for photosynthesis and a large central vacuole for the transportation of water. (reference.com)
  • Animal cells contain several structures not common to plants as well, including lysosomes, or sacs of enzymes that digest cellular material. (reference.com)
  • Animal and plant cells' common structures include a nucleus containing DNA bound by a membrane, along with many other structures. (reference.com)
  • Programming the cells to express cell adhesion molecules and other regulatory molecules enabled spontaneous formation of multilayered structures, like those that form during embryonic development. (sciencemag.org)
  • Cells deal with the problem of cellular water balance in different ways. (hawaii.edu)
  • Many bacteria contain other extracellular structures such as flagella , fimbriae, and pili, which are used respectively for motility (movement), attachment, and conjugation (transmission of DNA between bacterial cells by contact other than fusion). (newworldencyclopedia.org)
  • In experiments in rats and human cells, Johns Hopkins Medicine researchers say they have added to evidence that a cellular protein signal that drives both bone and fat formation in selected stem cells can be manipulated to favor bone building. (news-medical.net)
  • The X-ray diffraction data used for structure determination was collected at the General Medical Sciences and National Cancer Institutes Structural Biology Beamline at the Argonne National Laboratory. (caltech.edu)
  • ICCBSCP 2022 has teamed up with the Special Journal Issue on Cell Biology, Structures and Cellular Processes . (waset.org)
  • Understanding the molecular basis of cellular behavior is a central goal in biology and a critical guide for medical research. (cam.ac.uk)
  • Thank you for sharing this Molecular and Cellular Biology article. (asm.org)
  • Message Body (Your Name) thought you would be interested in this article in Molecular and Cellular Biology. (asm.org)
  • Cellular and Molecular Biology of the Kidney: International Symposium on Cell Biology of Nephron Heterogeneity: Fine Structure and Functions, Shizuoka, July 1990. (foyles.co.uk)
  • Taken together, they provide a comprehensive update on the progress of research for all those interested in the cellular and molecular biology of the kidney. (foyles.co.uk)
  • Solid State Biology, Cellular Water Structure, and Ion Complexing with Application to Navy Medicine. (dtic.mil)
  • Unfortunately, despite their central role in cell biology, the requisite structure-functional studies of endogenous multi-subunit macromolecular assemblies still prove to extraordinarily challenging-partially due to their low cellular abundance , dynamic nature, and heterogeneity of these native assemblies. (dicp.ac.cn)
  • Our research interests in the area of Cellular and Molecular Structure and Function range from computational protein folding to stem cell biology. (utoronto.ca)
  • 1 Department of Cellular and Molecular Pharmacology, Howard Hughes Medical Institute, and Center for Systems and Synthetic Biology, University of California, San Francisco, CA 94158, USA. (sciencemag.org)
  • Cellular Biology: Organelles, Structure and Function covers the basics of biology on a cellular level, specialized in text for emergent readers. (nation2.com)
  • The chapter ends with notes on critical and emergency Cellular Biology : Organelles, Structure, Function download PDF cases. (nation2.com)
  • How can the mechanical behavior of cellular structures (honeycombs, foams and lattices) be modeled? (padtinc.com)
  • 1. Cellular materials, such as metal foams, are used as impact energy absorbers in crash and blast protection due to their unique constitutive behaviour. (imechanica.org)
  • So in a process that resembles whipping egg whites into a meringue , the researchers have devised a procedure for fabricating ceramic foams that can be used to 3-D print cellular materials that combine both microscale and macroscale porosity. (ceramics.org)
  • What do you think-what are some other potential applications of 3-D printed cellular ceramic foams? (ceramics.org)
  • Part 1 of our third week in the form-finding experiment evaluated how biological cell structures are created, the science behind a foam structure, the types of foams that were uncovered, and what our experience with creating the plaster molds was like. (wordpress.com)
  • The first step consists in mimicking the structure of the cell: its inner compartments, the organelles, with a multicompartmentalized structure, and the rest, i.e. the cytoplasm minus the organelles (mainly cytoskeleton/ cytosol) with gels or particular solutions (highly concentrated for example) in one compartment, and finally the combination of both. (archives-ouvertes.fr)
  • Biotium offers a variety of stains for different organelles and cellular structures. (biotium.com)
  • Organelles are small, usually membranous structures that are best seen with an electron microscope. (lubopitko-bg.com)
  • Because organelles are composed of membrane, we can say that membrane compartmentalizes the cell, keeping the various cellular activities separated from one another. (lubopitko-bg.com)
  • Just as the rooms in your house have particular pieces of furniture that serve a particular purpose, organelles have a structure that suits their function. (lubopitko-bg.com)
  • As prokaryotes , all bacteria have a relatively simple cell structure lacking either a cell nucleus or membrane-bound organelles such as mitochondria and chloroplasts . (newworldencyclopedia.org)
  • These latter may include intracellular membranes, nutrient storage structures, gas vesicles, and magnetosomes (membranous organelles that contain magnetite crystals to orient magnetotactic bacteria in geomagnetic fields). (newworldencyclopedia.org)
  • Creating cellular organizations fundamentally involves mimicking processes that occur in natural processes. (wikipedia.org)
  • Professors Brent B. Allred, Raymond E. Miles, and Charles C. Snow have cited instances of cellular organization in terms of the telecommunications industry in Australia, specifically referring to the firm Technical Computing and Graphics (TCG) as an example due to how its processes have created successful work for partners such as Hitachi and Telstra. (wikipedia.org)
  • In this proposal, we will develop and apply these new imaging techniques to visualise biological structures and processes that are simply too small or inaccessible for conventional microscopes. (imperial.ac.uk)
  • This talk will describe on-going efforts to create functional reconstitutions of cytoskeletal and membrane processes involved in cellular protrusions and shape change. (cam.ac.uk)
  • However, the assumption that the connecting struts/walls in a cellular structure behave the same way the bulk material does can particularly be erroneous for AM processes that can introduce significant size specific behavior and large anisotropy. (padtinc.com)
  • The level of error introduced by a continuum assumption is likely to vary by process: processes like Fused Deposition Modeling (FDM) are already strongly anisotropic with highly geometry-specific meso-structures and an assumption like this will generate large errors as shown in Figure 1. (padtinc.com)
  • However, using a new technique developed at MedUni Vienna, so-called Line Field OCT, MedUni Vienna researchers from the Center for Medical Physics and Biomedical Technology have now managed to simplify looking into the cellular processes in the eye to allow even more accurate diagnosis. (healthcanal.com)
  • Pathology is the study of processes of disease at all levels from the whole organism down to the cellular, sub-cellular and molecular levels. (bristol.ac.uk)
  • Abstract One of the most important goals of the postgenomic era is understanding the metabolic dynamic processes and the functional structures generated by them. (duhnnae.com)
  • Acetyl coenzyme A (CoA), generated via glucose and acetate uptake, is a key carbon source for important cellular processes such as histone acetylation and gene expression," says Zhimin Lu, Ph.D., professor of neuro-oncology and lead researcher of the study. (medicalnewstoday.com)
  • A three-dimensional cellular system that may be made to exhibit some very unusual but highly useful mechanical properties, including negative Poisson's ratio (auxetic), zero Poisson's ratio, negative linear and negative area compressibility, is proposed and discussed. (royalsocietypublishing.org)
  • DNA polymerase family X: function, structure, and cellular roles. (nih.gov)
  • Remarkably, although these enzymes have similar three-dimensional structures, their biochemical properties and cellular functions differ in important ways that impact cellular function. (nih.gov)
  • Scientists from The Scripps Research Institute (TSRI), working closely with researchers at the National Institutes of Health (NIH), have mapped out the structure of an important protein involved in cellular function and nervous system development. (news-medical.net)
  • To better understand CREG function in cellular growth and differentiation, we solved the 3D crystal structure of this protein to 1.9-A resolution. (rcsb.org)
  • The Cellular and Supramolecular Structure and Function (CSSF) Section develops new methods based on electron microscopy and related techniques. (nih.gov)
  • Optimum design of structures is a process of selecting the design variables such that an objective function is minimized while all of the design constraints are satisfied. (igi-global.com)
  • This lesson explores the relationship between structure and function in a cell. (ck12.org)
  • A general biological principle states that cellular function results from the combined interactions of sub-cellular structures in space and time. (biomedcentral.com)
  • Specifically, these scientists used a battery of structural, biophysical, biochemical, and genetic experiments to decipher and understand the structure and function of the UvrA-UvrB DNA damage sensor. (harvard.edu)
  • Heterozygous cellular glutathione peroxidase deficiency in the mouse: abnormalities in vascular and cardiac function and structure. (semanticscholar.org)
  • Genome stability through successive cell divisions is central to the maintenance of normal cellular function. (utoronto.ca)
  • For a more detailed look at the work ongoing in the Cellular and Molecular Structure and Function research field please read the full Field Spotlight. (utoronto.ca)
  • As a reconfigurer of centromeric and flanking nucleosomes, RSC complex is required both for proper kinetochore function in chromosome segregation and, via a PKC1-dependent signaling pathway, for organization of the cellular cytoskeleton. (uniprot.org)
  • Cell function is considered as a transition between two states (two states model), the resting state and state of activity (this applies to the cell as a whole and to its individual structures). (vladimirmatveev.ru)
  • This approach does away with the need for any cellular level characterization and in so doing, we do not have to worry about size or contact effects described in the previous post that are artifacts of having to characterize behavior at the cellular level. (padtinc.com)
  • Member modeling approach: represent cellular structure as a collection of members, use beam theory for example, to describe the member's behavior through analytical equations. (padtinc.com)
  • It is common in the field of cellular structure modeling to extract an "effective" property - a property that represents a homogenized behavior without explicitly modeling the cellular detail. (padtinc.com)
  • Although multiple combinations of materials and proportions have been used for several applications, it is still unclear the relationship between good printability of hydrogels and better medical/clinical behavior of bioprinted structures. (frontiersin.org)
  • Furthermore, a comparison of mechanical and cellular behavior of those bioprinted structures is presented. (frontiersin.org)
  • Synthesis, bioprinting, and cross-linking of bioinks have a great impact on the generation of biological structures and especially on its mechanical and cellular behavior. (frontiersin.org)
  • The ability to program the manufacture of biological structures may yield new biomaterials or synthetic tissues and organs. (sciencemag.org)
  • Understanding the molecular mechanisms responsible for the metabolic dissipative structures is crucial for unraveling the dynamics of cellular life. (duhnnae.com)
  • Cellular uptake revealed a non-specific process, resulting in accumulation within the cell cytoplasm. (rsc.org)
  • A distinctive common feature of +RNA viruses is the replication of their genomes in the cytoplasm of the host cell in association with rearranged cellular membranes that are remodeled into organelle-like membranous structures to which the viral replication-transcription complexes (RTCs) localize. (mdpi.com)
  • The cytoskeletal structure of the cell or cytoskeleton is composed of three types of filaments, microfilaments, intermediate filaments and microtubules. (epigentek.com)
  • Some cellular components found a 'system' such as the endomembrane system or the cytoskeleton. (lumenlearning.com)
  • Recent advances in instrumentation, cross-linking protocols, and analysis software have led to a renewed interest in this technique, which promises to provide important information about native protein structure and the topology of protein complexes. (mcponline.org)
  • The study of protein structure and protein interactions represents another theme among members of the group. (utoronto.ca)
  • Topics include DNA and protein databases, DNA and protein sequence alignment, protein structure prediction, drug discovery and molecular modelling. (westminster.ac.uk)
  • The researchers were able to solve the structure of TTLL7 by combining x-ray crystallography and electron microscopy (EM). (news-medical.net)
  • The first SRM technique would be structured illumination microscopy (SIM) that entails illuminating samples with patterns of light and observing the interference patterns between these patterns and the structure of the sample. (imperial.ac.uk)
  • The nanometer scale of biological electron microscopy lies between the realms of live-cell optical microscopy and atomic-scale structural tools that require extraction and purification of cellular components. (nih.gov)
  • Therefore, we analyzed the complete structure of the AG and cellular cord associated with the reproductive system of Litopenaeus setiferus, L. occidentalis, L. stylirostris, and Rimapenaeus byrdi at the stereoscopic microscopy and histological level. (brillonline.com)
  • Our specialist cellular pathology modules are supported by the online use of interactive digital microscopy, for example in pathology case studies, to illustrate the applications of a range of visualisation methods in cellular pathology. (westminster.ac.uk)
  • Phys.org)-A team of researches affiliated with several institutions in Japan has conducted research into the cellular structure of tight junctions in the small intestine, and has made progress in better understanding their construction, possibly helping to pave the way towards creating drugs that would be better equipped to make their way into the bloodstream. (phys.org)
  • We focus on biochemical mechanisms, structural variation, fidelity and lesion bypass mechanisms, and cellular roles. (nih.gov)
  • Cellular mechanisms for regulating water and sodium levels ( ENaCs ) are found in all layers of the epidermis. (wikipedia.org)
  • Understanding the cellular and molecular mechanisms underlying this process is essential for proper diagnosis and prediction of outcome for cancer patients, and for developing new ways of preventing and treating cancer. (bristol.ac.uk)
  • Researchers are naturally eager to find commonalities in the mechanisms of cellular regulation. (vladimirmatveev.ru)
  • I would like to propose a substantial approach to problems of cell physiology the structural ground that produces signals and underlies the diversity of cellular mechanisms. (vladimirmatveev.ru)
  • DNA-protein interaction sites and information on the secondary and tertiary structure of RNA has been characterized. (rsc.org)
  • It is assumed that Anfinsen's dogma may be extended to protein aggregation: composition and amino acid sequence determine not only the secondary and tertiary structure of single protein, but also the structure of protein aggregates (associates). (vladimirmatveev.ru)
  • Also see our Cellular Stains Comparison Guides to browse targets, applications, fixability, and stains for different organisms at a glance. (biotium.com)
  • What is the cell structure of organisms in the Monera kingdom? (reference.com)
  • The content and activities in this topic will work towards building an understanding of how certain structures and functions define living organisms. (hawaii.edu)
  • Recent analyses performed with dissipative metabolic networks have shown that unicellular organisms display a singular global enzymatic structure common to all living cellular organisms, which seems to be an intrinsic property of the functional metabolism as a whole. (duhnnae.com)
  • Cellular GPx (GPx-1) is the principal intracellular isoform of GPx. (semanticscholar.org)
  • Bacteria contain relatively few intracellular structures compared to eukaryotes , but do contain a tightly supercoiled chromosome , ribosomes , and several other species-specific structures. (newworldencyclopedia.org)
  • While previous research had shown that TTLL7 modifies microtubules (hollow tubes that transport cellular components and act as highways and scaffolding in the cell) by adding one or more molecules of the amino acid glutamate, exactly how has remained a mystery. (news-medical.net)
  • Microtubules are hollow cylinders formed from alpha-tubulin and beta-tubulin subunits, and they participate in cellular activities requiring motion, such as organelle transport and chromosome segregation during cell division. (epigentek.com)
  • Despite their simplicity, these minimal intercellular programs were sufficient to yield assemblies with hallmarks of natural developmental systems: robust self-organization into multidomain structures, well-choreographed sequential assembly, cell type divergence, symmetry breaking, and the capacity for regeneration upon injury. (sciencemag.org)
  • To better understand the structure and regulation of the human 26S proteasome, we have established new DSSO-based in vivo and in vitro XL-MS workflows by coupling with HB-tag based affinity purification to comprehensively examine protein-protein interactions within the 26S proteasome. (mcponline.org)
  • Dense arrays of carbon nanofibers are being used as membranes that are integrated within fluidic structures. (nsti.org)
  • The biologically inspired design of VACNF structures will be useful for performing chemical separations and for mimicking the properties of natural membranes. (nsti.org)
  • The interdisciplinarity is also evident in the thematic breadth of our biophysics books: they are dedicated to cell structure, neuronal signal transmission, biological membranes, evolution, immunology and much more. (springer.com)
  • Finally, after achieving control over these prerequisites, scientists are able to combine them and push the frontiers of biomimicry further: from cell structure mimics towards a controlled biofunctionality. (archives-ouvertes.fr)
  • The most common approach in the literature is the use of homogenization - representing the effective property of the cellular structure without regard to the cellular geometry itself. (padtinc.com)
  • Here I limit myself to size effects that are purely a mathematical artifact of the cellular geometry itself, independent of the manufacturing process used to make them - in other words this effect would persist even if the material in the cellular structure was a mathematically precise, homogeneous and isotropic material. (padtinc.com)
  • Primary structure of the Saccharomyces cerevisiae GAL4 gene. (asm.org)
  • The OvHVIL-10 gene is unique amongst virus captured genes in that it has precisely retained the original cellular exon structure, having five exons of similar sizes to the cellular counterparts. (uzh.ch)
  • This is the first example of a captured herpesvirus gene retaining the full cellular gene structure. (uzh.ch)
  • By analyzing cellular functional transcripts, we found high expression of some venom related genes and gland-specific genes, such as calglandulin EF-hand protein gene and protein disulfide isomerase gene. (biomedcentral.com)
  • The deduced primary structure of chicken brain p190 revealed that this 1,830-amino acid (aa) 212,509-D) protein is a member of a novel structural class of unconventional myosins that includes the gene products encoded by the dilute locus of mouse and the MYO2 gene of Saccharomyces cerevisiae. (rupress.org)
  • While direct molecular interactions crucially depend on spatial proximity, other interactions typically result in spatial correlations between the interacting structures. (biomedcentral.com)
  • We establish a connection between co-localization and spatial interaction of sub-cellular structures by formulating the object-based interaction analysis problem in a spatial statistics framework based on nearest-neighbor distance distributions. (biomedcentral.com)
  • Interactions typically manifest themselves through statistical dependencies in the spatial distributions of the involved structures. (biomedcentral.com)
  • This approach is based on the paradigm that spatial proximity (or co-localization ) is a hallmark of many types of physical and chemical interactions between sub-cellular structures. (biomedcentral.com)
  • If two or more structures interact, their spatial distributions hence appear correlated. (biomedcentral.com)
  • The researchers also showed that some spatial configurations of the cellular microenvironment generate asymmetrical spindle orientation axes. (cea.fr)
  • The ability of these networks to drive complex structure formation illustrates the power of interlinking cell signaling with cell sorting: Signal-induced spatial reorganization alters the local signals received by each cell, resulting in iterative cycles of cell fate branching. (sciencemag.org)
  • The amount of information that is needed to direct the action of the cellular assembly pathways could be minimal because cellular morphogenesis is a self-organizing process. (wordpress.com)
  • These laws can be revealed through a high-precision examination of cellular microenvironment geometry and the reproducibility of cell behaviour under these conditions. (cea.fr)
  • The structures which compose a Eukaryotic cell are determined by the specific functions carried out by the cell. (pr-gateway.de)
  • Nowadays, it is assumed that the denaturation is the destruction of the tertiary and secondary structure of a protein. (vladimirmatveev.ru)
  • The US Army Corps of Engineers in Vicksburg, Mississippi (1981) experimented with a number of confining systems, from plastic pipe mats, to slotted aluminum sheets to prefabricated polymeric systems called sand grids and then, cellular confinement systems. (wikipedia.org)
  • Component of the chromatin structure-remodeling complex (RSC), which is involved in transcription regulation and nucleosome positioning. (uniprot.org)
  • None of these enzymes possesses a proofreading subdomain, and their intrinsic fidelity of DNA synthesis is much lower than that of a polymerase that functions in cellular DNA replication. (nih.gov)
  • Here we present the structure of mammalian claudin-19 in complex with C-CPE at 3.7 Å resolution. (phys.org)
  • In this post, I discuss six challenges that make the modeling of 3D printed cellular structures (such as honeycombs and lattices) a non-trivial matter. (padtinc.com)
  • The ACSS2 enzyme allows lysosomes, which are cellular structures that are known to contribute to tumor development, to be produced. (medicalnewstoday.com)
  • To examine extensively the transcripts expressed in the venom gland of Deinagkistrodon acutus and unveil the potential of its products on cellular structure and functional aspects, we generated 8696 expressed sequence tags (ESTs) from a non-normalized cDNA library. (biomedcentral.com)
  • For 1D analysis, Reid and Peng (1997) firstly treated cellular materials subject to uniaxial compression using a simplified rigid, perfectly-plastic, locking (RPPL) model. (imechanica.org)
  • However, as shown in Figure 1 , such is not the case for cellular structures, where local stress and strain distributions are non-uniform. (padtinc.com)
  • aims to bring together leading academic scientists, researchers and research scholars to exchange and share their experiences and research results on all aspects of Internal Cellular Structures. (waset.org)
  • Also, high quality research contributions describing original and unpublished results of conceptual, constructive, empirical, experimental, or theoretical work in all areas of Internal Cellular Structures are cordially invited for presentation at the conference. (waset.org)
  • In this research work, isolated microspore culture was studied in order to induce multi-cellular structures in different rose cultivars. (ishs.org)
  • This four-year degree is similar to BSc Cellular and Molecular Medicine but will give you the opportunity to gain valuable experience of cellular and molecular medicine in commercial or government research as an employee during your third year. (bristol.ac.uk)
  • Research to date suggests that some purposely made nanomaterials will present hazards based on their structure-as well as their chemistry-thus challenging many conventional approaches to risk assessment and management. (psu.edu)
  • In addition, the core modules in cellular pathology are designed to deliver a comprehensive overview of contemporary technical practice in the context of service delivery to the pathologist for diagnostic practice, or for the scientist engaged in cell and tissue-based research. (westminster.ac.uk)
  • Research and development of cellular confinement systems (CCS) began with the U.S. Army Corps of Engineers in 1975 to devise a method for building tactical roads over soft ground. (wikipedia.org)
  • Early research (Bathurst and Jarrett, 1988) found that cellular confinement reinforced gravel bases are "equivalent to about twice the thickness of unreinforced gravel bases" and that geocells performed better than single sheet reinforcement schemes (geotextiles and geogrids) and were more effective in reducing lateral spreading of infill under loading than conventional reinforced bases. (wikipedia.org)
  • Dr. Katja Fälber and Professor Oliver Daumke, structural biologists at the Max Delbrück Center for Molecular Medicine (MDC) Berlin-Buch, together with researchers from Freie Universität (FU) Berlin, have determined the molecular structure of dynamin, a ℠wire-puller´ that mediates nutrient uptake into the cell. (redorbit.com)
  • Here we discuss key leaf anatomical traits at the tissue, cellular, and sub-cellular level that influence the efficiency and effectiveness of C 4 photosynthesis. (springer.com)
  • L. stylirostris and L. occidentalis also show a cellular structure at the same location, identified as white adipose tissue. (brillonline.com)
  • In this sense, bioprinting allows the generation of complex structures mimicking biological cues, which increases the possibilities of tissue creation by supporting and improving other traditional techniques of tissue engineering ( Moldovan, 2019 ). (frontiersin.org)
  • The module will encourage you to evaluate disease pathogenesis at the molecular, cellular and tissue levels with particular reference to the diagnosis of disease in the cellular pathology laboratory. (westminster.ac.uk)
  • Microfilaments are composed of actin polymers that form thin, long fibers, and they contribute to muscular cell contraction and cellular locomotion. (epigentek.com)
  • Now that we have an idea of how the dynamin molecule is structured, we can understand at the atomic level how the molecular motor dynamin functions," said Professor Daumke. (redorbit.com)
  • In this structure the C-terminus of one module is situated very close to the N-terminus of the adjacent module around the five fold axis ( Figure 71 ) suggesting that more than one repeat in a single receptor molecule might attach simultaneously. (esrf.eu)
  • And that means that the researchers can specifically adjust the structures' mechanical properties, too, varying their mode of deformation and specific stiffness by varying the individual levels of porosity. (ceramics.org)
  • Researchers at our institute are developing new strategies in order to study​ the laws governing internal cell structure. (cea.fr)
  • The employed optimization algorithm is a modified cellular genetic algorithm which reduces the required generation numbers compared with the standard genetic algorithm. (igi-global.com)
  • We can now make multifunctional materials, in which many different material properties, including mechanical, thermal, and transport characteristics, can be optimized within a structure that is printed in a single step," Muth adds in the release. (ceramics.org)
  • With the addition of more compacted water balloons the open cell structure created a more organic look. (wordpress.com)
  • The new structure provides crucial information for understanding how the protein binds to cellular components. (news-medical.net)
  • A. Chemical structure of an 8oxoG base in the anti configuration base paired with a dC. (nih.gov)
  • The structure shows that C-CPE forms extensive hydrophobic and hydrophilic interactions with the two extracellular segments of claudin-19. (phys.org)
  • However, high-resolution structures of virus-receptor complexes are required in order to identify the critical interactions that determine the receptor recognition specificity. (esrf.eu)
  • Over the last decades, advances in fluorescent markers have enabled probing interactions of sub-cellular structures in the microscope, either directly or indirectly. (biomedcentral.com)
  • The key statement for the rationale of the present paper is that the specificity of interactions of polypeptide chains with each other (at the intra- and inter-molecular levels) can be provided only by their secondary structures, primarily α -helices and β -sheets. (vladimirmatveev.ru)