CDC28 Protein Kinase, S cerevisiae: A protein kinase encoded by the Saccharomyces cerevisiae CDC28 gene and required for progression from the G1 PHASE to the S PHASE in the CELL CYCLE.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Protein Kinase C: An serine-threonine protein kinase that requires the presence of physiological concentrations of CALCIUM and membrane PHOSPHOLIPIDS. The additional presence of DIACYLGLYCEROLS markedly increases its sensitivity to both calcium and phospholipids. The sensitivity of the enzyme can also be increased by PHORBOL ESTERS and it is believed that protein kinase C is the receptor protein of tumor-promoting phorbol esters.Protein Kinases: A family of enzymes that catalyze the conversion of ATP and a protein to ADP and a phosphoprotein.Saccharomyces cerevisiae Proteins: Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.Cyclic AMP-Dependent Protein Kinases: A group of enzymes that are dependent on CYCLIC AMP and catalyze the phosphorylation of SERINE or THREONINE residues on proteins. Included under this category are two cyclic-AMP-dependent protein kinase subtypes, each of which is defined by its subunit composition.Protein-Serine-Threonine Kinases: A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.CDC2 Protein Kinase: Phosphoprotein with protein kinase activity that functions in the G2/M phase transition of the CELL CYCLE. It is the catalytic subunit of the MATURATION-PROMOTING FACTOR and complexes with both CYCLIN A and CYCLIN B in mammalian cells. The maximal activity of cyclin-dependent kinase 1 is achieved when it is fully dephosphorylated.Calcium-Calmodulin-Dependent Protein Kinases: A CALMODULIN-dependent enzyme that catalyzes the phosphorylation of proteins. This enzyme is also sometimes dependent on CALCIUM. A wide range of proteins can act as acceptor, including VIMENTIN; SYNAPSINS; GLYCOGEN SYNTHASE; MYOSIN LIGHT CHAINS; and the MICROTUBULE-ASSOCIATED PROTEINS. (From Enzyme Nomenclature, 1992, p277)Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.Mitogen-Activated Protein Kinases: A superfamily of PROTEIN-SERINE-THREONINE KINASES that are activated by diverse stimuli via protein kinase cascades. They are the final components of the cascades, activated by phosphorylation by MITOGEN-ACTIVATED PROTEIN KINASE KINASES, which in turn are activated by mitogen-activated protein kinase kinase kinases (MAP KINASE KINASE KINASES).Protein Kinase Inhibitors: Agents that inhibit PROTEIN KINASES.MAP Kinase Signaling System: An intracellular signaling system involving the MAP kinase cascades (three-membered protein kinase cascades). Various upstream activators, which act in response to extracellular stimuli, trigger the cascades by activating the first member of a cascade, MAP KINASE KINASE KINASES; (MAPKKKs). Activated MAPKKKs phosphorylate MITOGEN-ACTIVATED PROTEIN KINASE KINASES which in turn phosphorylate the MITOGEN-ACTIVATED PROTEIN KINASES; (MAPKs). The MAPKs then act on various downstream targets to affect gene expression. In mammals, there are several distinct MAP kinase pathways including the ERK (extracellular signal-regulated kinase) pathway, the SAPK/JNK (stress-activated protein kinase/c-jun kinase) pathway, and the p38 kinase pathway. There is some sharing of components among the pathways depending on which stimulus originates activation of the cascade.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Phosphatidylinositol 3-Kinases: Phosphotransferases that catalyzes the conversion of 1-phosphatidylinositol to 1-phosphatidylinositol 3-phosphate. Many members of this enzyme class are involved in RECEPTOR MEDIATED SIGNAL TRANSDUCTION and regulation of vesicular transport with the cell. Phosphatidylinositol 3-Kinases have been classified both according to their substrate specificity and their mode of action within the cell.p38 Mitogen-Activated Protein Kinases: A mitogen-activated protein kinase subfamily that regulates a variety of cellular processes including CELL GROWTH PROCESSES; CELL DIFFERENTIATION; APOPTOSIS; and cellular responses to INFLAMMATION. The P38 MAP kinases are regulated by CYTOKINE RECEPTORS and can be activated in response to bacterial pathogens.cdc25 Phosphatases: A subclass of dual specificity phosphatases that play a role in the progression of the CELL CYCLE. They dephosphorylate and activate CYCLIN-DEPENDENT KINASES.Fungal Proteins: Proteins found in any species of fungus.cdc42 GTP-Binding Protein: A member of the Rho family of MONOMERIC GTP-BINDING PROTEINS. It is associated with a diverse array of cellular functions including cytoskeletal changes, filopodia formation and transport through the GOLGI APPARATUS. This enzyme was formerly listed as EC 3.6.1.47.Enzyme Activation: Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Mitogen-Activated Protein Kinase 1: A proline-directed serine/threonine protein kinase which mediates signal transduction from the cell surface to the nucleus. Activation of the enzyme by phosphorylation leads to its translocation into the nucleus where it acts upon specific transcription factors. p40 MAPK and p41 MAPK are isoforms.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Mitogen-Activated Protein Kinase Kinases: A serine-threonine protein kinase family whose members are components in protein kinase cascades activated by diverse stimuli. These MAPK kinases phosphorylate MITOGEN-ACTIVATED PROTEIN KINASES and are themselves phosphorylated by MAP KINASE KINASE KINASES. JNK kinases (also known as SAPK kinases) are a subfamily.Protein Kinase C-alpha: A cytoplasmic serine threonine kinase involved in regulating CELL DIFFERENTIATION and CELLULAR PROLIFERATION. Overexpression of this enzyme has been shown to promote PHOSPHORYLATION of BCL-2 PROTO-ONCOGENE PROTEINS and chemoresistance in human acute leukemia cells.Gene Expression Regulation, Fungal: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in fungi.Protein Kinase C-delta: A ubiquitously expressed protein kinase that is involved in a variety of cellular SIGNAL PATHWAYS. Its activity is regulated by a variety of signaling protein tyrosine kinase.Mitogen-Activated Protein Kinase 3: A 44-kDa extracellular signal-regulated MAP kinase that may play a role the initiation and regulation of MEIOSIS; MITOSIS; and postmitotic functions in differentiated cells. It phosphorylates a number of TRANSCRIPTION FACTORS; and MICROTUBULE-ASSOCIATED PROTEINS.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.JNK Mitogen-Activated Protein Kinases: A subgroup of mitogen-activated protein kinases that activate TRANSCRIPTION FACTOR AP-1 via the phosphorylation of C-JUN PROTEINS. They are components of intracellular signaling pathways that regulate CELL PROLIFERATION; APOPTOSIS; and CELL DIFFERENTIATION.AMP-Activated Protein Kinases: Intracellular signaling protein kinases that play a signaling role in the regulation of cellular energy metabolism. Their activity largely depends upon the concentration of cellular AMP which is increased under conditions of low energy or metabolic stress. AMP-activated protein kinases modify enzymes involved in LIPID METABOLISM, which in turn provide substrates needed to convert AMP into ATP.Cdc20 Proteins: Highly conserved proteins that specifically bind to and activate the anaphase-promoting complex-cyclosome, promoting ubiquitination and proteolysis of cell-cycle-regulatory proteins. Cdc20 is essential for anaphase-promoting complex activity, initiation of anaphase, and cyclin proteolysis during mitosis.Isoenzymes: Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.Kinetics: The rate dynamics in chemical or physical systems.Protein Kinase C-epsilon: A protein kinase C subtype that was originally characterized as a CALCIUM-independent, serine-threonine kinase that is activated by PHORBOL ESTERS and DIACYLGLYCEROLS. It is targeted to specific cellular compartments in response to extracellular signals that activate G-PROTEIN-COUPLED RECEPTORS; TYROSINE KINASE RECEPTORS; and intracellular protein tyrosine kinase.Cell Cycle Proteins: Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.Protein Kinase C beta: PKC beta encodes two proteins (PKCB1 and PKCBII) generated by alternative splicing of C-terminal exons. It is widely distributed with wide-ranging roles in processes such as B-cell receptor regulation, oxidative stress-induced apoptosis, androgen receptor-dependent transcriptional regulation, insulin signaling, and endothelial cell proliferation.src-Family Kinases: A PROTEIN-TYROSINE KINASE family that was originally identified by homology to the Rous sarcoma virus ONCOGENE PROTEIN PP60(V-SRC). They interact with a variety of cell-surface receptors and participate in intracellular signal transduction pathways. Oncogenic forms of src-family kinases can occur through altered regulation or expression of the endogenous protein and by virally encoded src (v-src) genes.Protein-Tyrosine Kinases: Protein kinases that catalyze the PHOSPHORYLATION of TYROSINE residues in proteins with ATP or other nucleotides as phosphate donors.Tetradecanoylphorbol Acetate: A phorbol ester found in CROTON OIL with very effective tumor promoting activity. It stimulates the synthesis of both DNA and RNA.Cyclic GMP-Dependent Protein Kinases: A group of cyclic GMP-dependent enzymes that catalyze the phosphorylation of SERINE or THREONINE residues of proteins.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Enzyme Inhibitors: Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Cyclic AMP: An adenine nucleotide containing one phosphate group which is esterified to both the 3'- and 5'-positions of the sugar moiety. It is a second messenger and a key intracellular regulator, functioning as a mediator of activity for a number of hormones, including epinephrine, glucagon, and ACTH.Cell Line: Established cell cultures that have the potential to propagate indefinitely.MAP Kinase Kinase Kinases: Mitogen-activated protein kinase kinase kinases (MAPKKKs) are serine-threonine protein kinases that initiate protein kinase signaling cascades. They phosphorylate MITOGEN-ACTIVATED PROTEIN KINASE KINASES; (MAPKKs) which in turn phosphorylate MITOGEN-ACTIVATED PROTEIN KINASES; (MAPKs).Casein Kinase II: A ubiquitous casein kinase that is comprised of two distinct catalytic subunits and dimeric regulatory subunit. Casein kinase II has been shown to phosphorylate a large number of substrates, many of which are proteins involved in the regulation of gene expression.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.p21-Activated Kinases: A family of serine-threonine kinases that bind to and are activated by MONOMERIC GTP-BINDING PROTEINS such as RAC GTP-BINDING PROTEINS and CDC42 GTP-BINDING PROTEIN. They are intracellular signaling kinases that play a role the regulation of cytoskeletal organization.Calcium-Calmodulin-Dependent Protein Kinase Type 2: A multifunctional calcium-calmodulin-dependent protein kinase subtype that occurs as an oligomeric protein comprised of twelve subunits. It differs from other enzyme subtypes in that it lacks a phosphorylatable activation domain that can respond to CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE KINASE.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Recombinant Proteins: Proteins prepared by recombinant DNA technology.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Cyclin-Dependent Kinases: Protein kinases that control cell cycle progression in all eukaryotes and require physical association with CYCLINS to achieve full enzymatic activity. Cyclin-dependent kinases are regulated by phosphorylation and dephosphorylation events.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Serine: A non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE. It is involved in the biosynthesis of PURINES; PYRIMIDINES; and other amino acids.eIF-2 Kinase: A dsRNA-activated cAMP-independent protein serine/threonine kinase that is induced by interferon. In the presence of dsRNA and ATP, the kinase autophosphorylates on several serine and threonine residues. The phosphorylated enzyme catalyzes the phosphorylation of the alpha subunit of EUKARYOTIC INITIATION FACTOR-2, leading to the inhibition of protein synthesis.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.CDC2-CDC28 Kinases: A family of cell cycle-dependent kinases that are related in structure to CDC28 PROTEIN KINASE; S CEREVISIAE; and the CDC2 PROTEIN KINASE found in mammalian species.Cell Cycle: The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Intracellular Signaling Peptides and Proteins: Proteins and peptides that are involved in SIGNAL TRANSDUCTION within the cell. Included here are peptides and proteins that regulate the activity of TRANSCRIPTION FACTORS and cellular processes in response to signals from CELL SURFACE RECEPTORS. Intracellular signaling peptide and proteins may be part of an enzymatic signaling cascade or act through binding to and modifying the action of other signaling factors.MAP Kinase Kinase 1: An abundant 43-kDa mitogen-activated protein kinase kinase subtype with specificity for MITOGEN-ACTIVATED PROTEIN KINASE 1 and MITOGEN-ACTIVATED PROTEIN KINASE 3.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.PhosphoproteinsProtein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Calcium: A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.RNA, Fungal: Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.Extracellular Signal-Regulated MAP Kinases: A mitogen-activated protein kinase subfamily that is widely expressed and plays a role in regulation of MEIOSIS; MITOSIS; and post mitotic functions in differentiated cells. The extracellular signal regulated MAP kinases are regulated by a broad variety of CELL SURFACE RECEPTORS and can be activated by certain CARCINOGENS.Ribosomal Protein S6 Kinases: A family of protein serine/threonine kinases which act as intracellular signalling intermediates. Ribosomal protein S6 kinases are activated through phosphorylation in response to a variety of HORMONES and INTERCELLULAR SIGNALING PEPTIDES AND PROTEINS. Phosphorylation of RIBOSOMAL PROTEIN S6 by enzymes in this class results in increased expression of 5' top MRNAs. Although specific for RIBOSOMAL PROTEIN S6 members of this class of kinases can act on a number of substrates within the cell. The immunosuppressant SIROLIMUS inhibits the activation of ribosomal protein S6 kinases.Casein Kinases: A group of protein-serine-threonine kinases that was originally identified as being responsible for the PHOSPHORYLATION of CASEINS. They are ubiquitous enzymes that have a preference for acidic proteins. Casein kinases play a role in SIGNAL TRANSDUCTION by phosphorylating a variety of regulatory cytoplasmic and regulatory nuclear proteins.Proto-Oncogene Proteins: Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.Proto-Oncogene Proteins c-akt: A protein-serine-threonine kinase that is activated by PHOSPHORYLATION in response to GROWTH FACTORS or INSULIN. It plays a major role in cell metabolism, growth, and survival as a core component of SIGNAL TRANSDUCTION. Three isoforms have been described in mammalian cells.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Mitosis: A type of CELL NUCLEUS division by means of which the two daughter nuclei normally receive identical complements of the number of CHROMOSOMES of the somatic cells of the species.MAP Kinase Kinase 4: A mitogen-activated protein kinase kinase with specificity for JNK MITOGEN-ACTIVATED PROTEIN KINASES; P38 MITOGEN-ACTIVATED PROTEIN KINASES and the RETINOID X RECEPTORS. It takes part in a SIGNAL TRANSDUCTION pathway that is activated in response to cellular stress.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Phosphotransferases (Alcohol Group Acceptor): A group of enzymes that transfers a phosphate group onto an alcohol group acceptor. EC 2.7.1.DiglyceridesPhosphoprotein Phosphatases: A group of enzymes removing the SERINE- or THREONINE-bound phosphate groups from a wide range of phosphoproteins, including a number of enzymes which have been phosphorylated under the action of a kinase. (Enzyme Nomenclature, 1992)Phorbol 12,13-Dibutyrate: A phorbol ester found in CROTON OIL which, in addition to being a potent skin tumor promoter, is also an effective activator of calcium-activated, phospholipid-dependent protein kinase (protein kinase C). Due to its activation of this enzyme, phorbol 12,13-dibutyrate profoundly affects many different biological systems.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.Cell Division: The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.Gene Deletion: A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Staurosporine: An indolocarbazole that is a potent PROTEIN KINASE C inhibitor which enhances cAMP-mediated responses in human neuroblastoma cells. (Biochem Biophys Res Commun 1995;214(3):1114-20)Gene Expression Regulation, Enzymologic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.Schizosaccharomyces: A genus of ascomycetous fungi of the family Schizosaccharomycetaceae, order Schizosaccharomycetales.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Isoquinolines: A group of compounds with the heterocyclic ring structure of benzo(c)pyridine. The ring structure is characteristic of the group of opium alkaloids such as papaverine. (From Stedman, 25th ed)Cell Nucleus: Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine: A specific protein kinase C inhibitor, which inhibits superoxide release from human neutrophils (PMN) stimulated with phorbol myristate acetate or synthetic diacylglycerol.Phorbol Esters: Tumor-promoting compounds obtained from CROTON OIL (Croton tiglium). Some of these are used in cell biological experiments as activators of protein kinase C.MaleimidesThreonine: An essential amino acid occurring naturally in the L-form, which is the active form. It is found in eggs, milk, gelatin, and other proteins.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Immunoblotting: Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.Indoles: Benzopyrroles with the nitrogen at the number one carbon adjacent to the benzyl portion, in contrast to ISOINDOLES which have the nitrogen away from the six-membered ring.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Glycogen Synthase Kinase 3: A glycogen synthase kinase that was originally described as a key enzyme involved in glycogen metabolism. It regulates a diverse array of functions such as CELL DIVISION, microtubule function and APOPTOSIS.Apoptosis: One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.Creatine Kinase: A transferase that catalyzes formation of PHOSPHOCREATINE from ATP + CREATINE. The reaction stores ATP energy as phosphocreatine. Three cytoplasmic ISOENZYMES have been identified in human tissues: the MM type from SKELETAL MUSCLE, the MB type from myocardial tissue and the BB type from nervous tissue as well as a mitochondrial isoenzyme. Macro-creatine kinase refers to creatine kinase complexed with other serum proteins.DNA-Activated Protein Kinase: A serine-threonine protein kinase that, when activated by DNA, phosphorylates several DNA-binding protein substrates including the TUMOR SUPPRESSOR PROTEIN P53 and a variety of TRANSCRIPTION FACTORS.Chromosomes, Fungal: Structures within the nucleus of fungal cells consisting of or containing DNA, which carry genetic information essential to the cell.Precipitin Tests: Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.Tyrosine: A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.Pyruvate Kinase: ATP:pyruvate 2-O-phosphotransferase. A phosphotransferase that catalyzes reversibly the phosphorylation of pyruvate to phosphoenolpyruvate in the presence of ATP. It has four isozymes (L, R, M1, and M2). Deficiency of the enzyme results in hemolytic anemia. EC 2.7.1.40.Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.cdc42 GTP-Binding Protein, Saccharomyces cerevisiae: A member of the Rho family of MONOMERIC GTP-BINDING PROTEINS from SACCHAROMYCES CEREVISIAE. It is involved in morphological events related to the cell cycle. This enzyme was formerly listed as EC 3.6.1.47.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.3-Phosphoinositide-Dependent Protein Kinases: Highly conserved protein-serine threonine kinases that phosphorylate and activate a group of AGC protein kinases, especially in response to the production of the SECOND MESSENGERS, phosphatidylinositol 3,4,-biphosphate (PtdIns(3,4)P2) and phosphatidylinositol 3,4,5-triphosphate (PtdIns(3,4,5)P3).Tumor Cells, Cultured: Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.Cyclic AMP-Dependent Protein Kinase Type II: A cyclic AMP-dependent protein kinase subtype primarily found in particulate subcellular fractions. They are tetrameric proteins that contain two catalytic subunits and two type II-specific regulatory subunits.Genome, Fungal: The complete gene complement contained in a set of chromosomes in a fungus.Flavonoids: A group of phenyl benzopyrans named for having structures like FLAVONES.Dose-Response Relationship, Drug: The relationship between the dose of an administered drug and the response of the organism to the drug.Adenosine Triphosphate: An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.Glucose: A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement.Protein Transport: The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.Receptor Protein-Tyrosine Kinases: A class of cellular receptors that have an intrinsic PROTEIN-TYROSINE KINASE activity.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.rho-Associated Kinases: A group of intracellular-signaling serine threonine kinases that bind to RHO GTP-BINDING PROTEINS. They were originally found to mediate the effects of rhoA GTP-BINDING PROTEIN on the formation of STRESS FIBERS and FOCAL ADHESIONS. Rho-associated kinases have specificity for a variety of substrates including MYOSIN-LIGHT-CHAIN PHOSPHATASE and LIM KINASES.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.Cytosol: Intracellular fluid from the cytoplasm after removal of ORGANELLES and other insoluble cytoplasmic components.Cell Line, Tumor: A cell line derived from cultured tumor cells.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Phosphoserine: The phosphoric acid ester of serine.1-Phosphatidylinositol 4-Kinase: An enzyme that catalyzes the conversion of phosphatidylinositol (PHOSPHATIDYLINOSITOLS) to phosphatidylinositol 4-phosphate, the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate.Molecular Weight: The sum of the weight of all the atoms in a molecule.Androstadienes: Derivatives of the steroid androstane having two double bonds at any site in any of the rings.3T3 Cells: Cell lines whose original growing procedure consisted being transferred (T) every 3 days and plated at 300,000 cells per plate (J Cell Biol 17:299-313, 1963). Lines have been developed using several different strains of mice. Tissues are usually fibroblasts derived from mouse embryos but other types and sources have been developed as well. The 3T3 lines are valuable in vitro host systems for oncogenic virus transformation studies, since 3T3 cells possess a high sensitivity to CONTACT INHIBITION.Schizosaccharomyces pombe Proteins: Proteins obtained from the species Schizosaccharomyces pombe. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.Mitogen-Activated Protein Kinase 8: A c-jun amino-terminal kinase that is activated by environmental stress and pro-inflammatory cytokines. Several isoforms of the protein with molecular sizes of 43 and 48 KD exist due to multiple ALTERNATIVE SPLICING.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Saccharomyces: A genus of ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES.Alkaloids: Organic nitrogenous bases. Many alkaloids of medical importance occur in the animal and vegetable kingdoms, and some have been synthesized. (Grant & Hackh's Chemical Dictionary, 5th ed)Suppression, Genetic: Mutation process that restores the wild-type PHENOTYPE in an organism possessing a mutationally altered GENOTYPE. The second "suppressor" mutation may be on a different gene, on the same gene but located at a distance from the site of the primary mutation, or in extrachromosomal genes (EXTRACHROMOSOMAL INHERITANCE).Aurora Kinases: A family of highly conserved serine-threonine kinases that are involved in the regulation of MITOSIS. They are involved in many aspects of cell division, including centrosome duplication, SPINDLE APPARATUS formation, chromosome alignment, attachment to the spindle, checkpoint activation, and CYTOKINESIS.I-kappa B Kinase: A protein serine-threonine kinase that catalyzes the PHOSPHORYLATION of I KAPPA B PROTEINS. This enzyme also activates the transcription factor NF-KAPPA B and is composed of alpha and beta catalytic subunits, which are protein kinases and gamma, a regulatory subunit.Peptides: Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.Multienzyme Complexes: Systems of enzymes which function sequentially by catalyzing consecutive reactions linked by common metabolic intermediates. They may involve simply a transfer of water molecules or hydrogen atoms and may be associated with large supramolecular structures such as MITOCHONDRIA or RIBOSOMES.Rats, Sprague-Dawley: A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.Adaptor Proteins, Signal Transducing: A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymesBiological Transport: The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.Thymidine Kinase: An enzyme that catalyzes the conversion of ATP and thymidine to ADP and thymidine 5'-phosphate. Deoxyuridine can also act as an acceptor and dGTP as a donor. (From Enzyme Nomenclature, 1992) EC 2.7.1.21.Carbazoles: Benzo-indoles similar to CARBOLINES which are pyrido-indoles. In plants, carbazoles are derived from indole and form some of the INDOLE ALKALOIDS.Ribosomal Protein S6 Kinases, 90-kDa: A family of ribosomal protein S6 kinases that are structurally distinguished from RIBOSOMAL PROTEIN S6 KINASES, 70-KDA by their apparent molecular size and the fact they contain two functional kinase domains. Although considered RIBOSOMAL PROTEIN S6 KINASES, members of this family are activated via the MAP KINASE SIGNALING SYSTEM and have been shown to act on a diverse array of substrates that are involved in cellular regulation such as RIBOSOMAL PROTEIN S6 and CAMP RESPONSE ELEMENT-BINDING PROTEIN.Pyridines: Compounds with a six membered aromatic ring containing NITROGEN. The saturated version is PIPERIDINES.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Down-Regulation: A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.Protein Processing, Post-Translational: Any of various enzymatically catalyzed post-translational modifications of PEPTIDES or PROTEINS in the cell of origin. These modifications include carboxylation; HYDROXYLATION; ACETYLATION; PHOSPHORYLATION; METHYLATION; GLYCOSYLATION; ubiquitination; oxidation; proteolysis; and crosslinking and result in changes in molecular weight and electrophoretic motility.MAP Kinase Kinase Kinase 1: A 195-kDa MAP kinase kinase kinase with broad specificity for MAP KINASE KINASES. It is found localized in the CYTOSKELETON and can activate a variety of MAP kinase-dependent pathways.Peptide Mapping: Analysis of PEPTIDES that are generated from the digestion or fragmentation of a protein or mixture of PROTEINS, by ELECTROPHORESIS; CHROMATOGRAPHY; or MASS SPECTROMETRY. The resulting peptide fingerprints are analyzed for a variety of purposes including the identification of the proteins in a sample, GENETIC POLYMORPHISMS, patterns of gene expression, and patterns diagnostic for diseases.Two-Hybrid System Techniques: Screening techniques first developed in yeast to identify genes encoding interacting proteins. Variations are used to evaluate interplay between proteins and other molecules. Two-hybrid techniques refer to analysis for protein-protein interactions, one-hybrid for DNA-protein interactions, three-hybrid interactions for RNA-protein interactions or ligand-based interactions. Reverse n-hybrid techniques refer to analysis for mutations or other small molecules that dissociate known interactions.ChromonesDNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).MAP Kinase Kinase 2: A 44 kDa mitogen-activated protein kinase kinase with specificity for MITOGEN-ACTIVATED PROTEIN KINASE 1 and MITOGEN-ACTIVATED PROTEIN KINASE 3.Diacylglycerol Kinase: An enzyme of the transferase class that uses ATP to catalyze the phosphorylation of diacylglycerol to a phosphatidate. EC 2.7.1.107.Cattle: Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.MorpholinesDNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Imidazoles: Compounds containing 1,3-diazole, a five membered aromatic ring containing two nitrogen atoms separated by one of the carbons. Chemically reduced ones include IMIDAZOLINES and IMIDAZOLIDINES. Distinguish from 1,2-diazole (PYRAZOLES).Myosin-Light-Chain Kinase: An enzyme that phosphorylates myosin light chains in the presence of ATP to yield myosin-light chain phosphate and ADP, and requires calcium and CALMODULIN. The 20-kDa light chain is phosphorylated more rapidly than any other acceptor, but light chains from other myosins and myosin itself can act as acceptors. The enzyme plays a central role in the regulation of smooth muscle contraction.Meiosis: A type of CELL NUCLEUS division, occurring during maturation of the GERM CELLS. Two successive cell nucleus divisions following a single chromosome duplication (S PHASE) result in daughter cells with half the number of CHROMOSOMES as the parent cells.Actins: Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.Cytoplasm: The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)Microscopy, Fluorescence: Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.Catalytic Domain: The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.Cyclin B: A cyclin subtype that is transported into the CELL NUCLEUS at the end of the G2 PHASE. It stimulates the G2/M phase transition by activating CDC2 PROTEIN KINASE.Death-Associated Protein Kinases: A family of calcium/calmodulin-dependent PROETIN-SERINE-THREONINE KINASES. They are ubiquitously expressed in adult and embryonic mammalian tissues, and their functions are tightly related to the early stages of eukaryotic programmed cell death.Cell Survival: The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.Subcellular Fractions: Components of a cell produced by various separation techniques which, though they disrupt the delicate anatomy of a cell, preserve the structure and physiology of its functioning constituents for biochemical and ultrastructural analysis. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p163)Cyclic GMP-Dependent Protein Kinase Type I: A cyclic GMP-dependent protein kinase subtype that is expressed in SMOOTH MUSCLE tissues and plays a role in regulation of smooth muscle contraction. Two isoforms, PKGIalpha and PKGIbeta, of the type I protein kinase exist due to alternative splicing of its mRNA.Mitochondria: Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)Benzophenanthridines: Compounds of four rings containing a nitrogen. They are biosynthesized from reticuline via rearrangement of scoulerine. They are similar to BENZYLISOQUINOLINES. Members include chelerythrine and sanguinarine.Calmodulin: A heat-stable, low-molecular-weight activator protein found mainly in the brain and heart. The binding of calcium ions to this protein allows this protein to bind to cyclic nucleotide phosphodiesterases and to adenyl cyclase with subsequent activation. Thereby this protein modulates cyclic AMP and cyclic GMP levels.Calcium-Calmodulin-Dependent Protein Kinase Kinase: A regulatory calcium-calmodulin-dependent protein kinase that specifically phosphorylates CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE TYPE 1; CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE TYPE 2; CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE TYPE 4; and PROTEIN KINASE B. It is a monomeric enzyme that is encoded by at least two different genes.Genes, Suppressor: Genes that have a suppressor allele or suppressor mutation (SUPPRESSION, GENETIC) which cancels the effect of a previous mutation, enabling the wild-type phenotype to be maintained or partially restored. For example, amber suppressors cancel the effect of an AMBER NONSENSE MUTATION.Focal Adhesion Kinase 1: A non-receptor protein tyrosine kinase that is localized to FOCAL ADHESIONS and is a central component of integrin-mediated SIGNAL TRANSDUCTION PATHWAYS. Focal adhesion kinase 1 interacts with PAXILLIN and undergoes PHOSPHORYLATION in response to adhesion of cell surface integrins to the EXTRACELLULAR MATRIX. Phosphorylated p125FAK protein binds to a variety of SH2 DOMAIN and SH3 DOMAIN containing proteins and helps regulate CELL ADHESION and CELL MIGRATION.Protein Phosphatase 1: A eukayrotic protein serine-threonine phosphatase subtype that dephosphorylates a wide variety of cellular proteins. The enzyme is comprised of a catalytic subunit and regulatory subunit. Several isoforms of the protein phosphatase catalytic subunit exist due to the presence of multiple genes and the alternative splicing of their mRNAs. A large number of proteins have been shown to act as regulatory subunits for this enzyme. Many of the regulatory subunits have additional cellular functions.DNA Replication: The process by which a DNA molecule is duplicated.Phosphothreonine: The phosphoric acid ester of threonine. Used as an identifier in the analysis of peptides, proteins, and enzymes.MAP Kinase Kinase 6: A mitogen-activated protein kinase kinase with specificity for P38 MITOGEN-ACTIVATED PROTEIN KINASES.Cyclins: A large family of regulatory proteins that function as accessory subunits to a variety of CYCLIN-DEPENDENT KINASES. They generally function as ENZYME ACTIVATORS that drive the CELL CYCLE through transitions between phases. A subset of cyclins may also function as transcriptional regulators.A Kinase Anchor Proteins: A structurally-diverse family of intracellular-signaling adaptor proteins that selectively tether specific protein kinase A subtypes to distinct subcellular sites. They play a role in focusing the PROTEIN KINASE A activity toward relevant substrates. Over fifty members of this family exist, most of which bind specifically to regulatory subunits of CYCLIC AMP-DEPENDENT PROTEIN KINASE TYPE II such as CAMP PROTEIN KINASE RIIALPHA or CAMP PROTEIN KINASE RIIBETA.MAP Kinase Kinase 3: A mitogen-activated protein kinase kinase with specificity for a subset of P38 MITOGEN-ACTIVATED PROTEIN KINASES that includes MITOGEN-ACTIVATED PROTEIN KINASE 12; MITOGEN-ACTIVATED PROTEIN KINASE 13; and MITOGEN-ACTIVATED PROTEIN KINASE 14.Butadienes: Four carbon unsaturated hydrocarbons containing two double bonds.RNA, Small Interfering: Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.

Inhibitory phosphorylation of the APC regulator Hct1 is controlled by the kinase Cdc28 and the phosphatase Cdc14. (1/285)

BACKGROUND: Exit from mitosis requires inactivation of mitotic cyclin-dependent kinases (CDKs). A key mechanism of CDK inactivation is ubiquitin-mediated cyclin proteolysis, which is triggered by the late mitotic activation of a ubiquitin ligase known as the anaphase-promoting complex (APC). Activation of the APC requires its association with substoichiometric activating subunits termed Cdc20 and Hct1 (also known as Cdh1). Here, we explore the molecular function and regulation of the APC regulatory subunit Hct1 in Saccharomyces cerevisiae. RESULTS: Recombinant Hct1 activated the cyclin-ubiquitin ligase activity of APC isolated from multiple cell cycle stages. APC isolated from cells arrested in G1, or in late mitosis due to the cdc14-1 mutation, was more responsive to Hct1 than APC isolated from other stages. We found that Hct1 was phosphorylated in vivo at multiple CDK consensus sites during cell cycle stages when activity of the cyclin-dependent kinase Cdc28 is high and APC activity is low. Purified Hct1 was phosphorylated in vitro at these sites by purified Cdc28-cyclin complexes, and phosphorylation abolished the ability of Hct1 to activate the APC in vitro. The phosphatase Cdc14, which is known to be required for APC activation in vivo, was able to reverse the effects of Cdc28 by catalyzing Hct1 dephosphorylation and activation. CONCLUSIONS: We conclude that Hct1 phosphorylation is a key regulatory mechanism in the control of cyclin destruction. Phosphorylation of Hct1 provides a mechanism by which Cdc28 blocks its own inactivation during S phase and early mitosis. Following anaphase, dephosphorylation of Hct1 by Cdc14 may help initiate cyclin destruction.  (+info)

NDD1, a high-dosage suppressor of cdc28-1N, is essential for expression of a subset of late-S-phase-specific genes in Saccharomyces cerevisiae. (2/285)

cdc28-1N mutants progress through the G1 and S phases normally at the restrictive temperature but fail to undergo nuclear division. We have isolated a gene, NDD1, which at a high dosage suppresses the nuclear-division defect of cdc28-1N. NDD1 (nuclear division defective) is an essential gene. Its expression during the cell cycle is tightly regulated such that NDD1 RNA is most abundant during the S phase. Cells lacking the NDD1 gene arrest with an elongated bud, a short mitotic spindle, 2N DNA content, and an undivided nucleus, suggesting that its function is required for some aspect of nuclear division. We show that overexpression of Ndd1 results in the upregulation of both CLB1 and CLB2 transcription, suggesting that the suppression of cdc28-1N by NDD1 may be due to an accumulation of these cyclins. Overproduction of Ndd1 also enhances the expression of SWI5, whose transcription, like that of CLB1 and CLB2, is activated in the late S phase. Ndd1 is essential for the expression of CLB1, CLB2, and SWI5, since none of these genes are transcribed in its absence. Both CLB2 expression and its upregulation by NDD1 are mediated by a 240-bp promoter sequence that contains four MCM1-binding sites. However, Ndd1 does not appear to be a component of any of the protein complexes assembled on this DNA fragment, as indicated by gel mobility shift assays. Instead, overexpression of NDD1 prevents the formation of one of the complexes whose appearance correlates with the termination of CLB2 expression in G1. The inability of GAL1 promoter-driven CLB2 to suppress the lethality of NDD1 null mutant suggests that, in addition to CLB1 and CLB2, NDD1 may also be required for the transcription of other genes whose functions are necessary for G2/M transition.  (+info)

Cyclin-dependent kinase and Cks/Suc1 interact with the proteasome in yeast to control proteolysis of M-phase targets. (3/285)

Cell cycle-specific proteolysis is critical for proper execution of mitosis in all eukaryotes. Ubiquitination and subsequent proteolysis of the mitotic regulators Clb2 and Pds1 depend on the cyclosome/APC and the 26S proteasome. We report here that components of the cell cycle machinery in yeast, specifically the cell cycle regulatory cyclin-dependent kinase Cdc28 and a conserved associated protein Cks1/Suc1, interact genetically, physically, and functionally with components of the 26S proteasome. A mutation in Cdc28 (cdc28-1N) that interferes with Cks1 binding, or inactivation of Cks1 itself, confers stabilization of Clb2, the principal mitotic B-type cyclin in budding yeast. Surprisingly, Clb2-ubiquitination in vivo and in vitro is not affected by mutations in cks1, indicating that Cks1 is not essential for cyclosome/APC activity. However, mutant Cks1 proteins no longer physically interact with the proteasome, suggesting that Cks1 is required for some aspect of proteasome function during M-phase-specific proteolysis. We further provide evidence that Cks1 function is required for degradation of the anaphase inhibitor Pds1. Stabilization of Pds1 is partially responsible for the metaphase arrest phenotype of cks1 mutants because deletion of PDS1 partially relieves the metaphase block in these mutants.  (+info)

Regulation of transcription at the Saccharomyces cerevisiae start transition by Stb1, a Swi6-binding protein. (4/285)

In Saccharomyces cerevisiae, gene expression in the late G(1) phase is activated by two transcription factors, SBF and MBF. SBF contains the Swi4 and Swi6 proteins and activates the transcription of G(1) cyclin genes, cell wall biosynthesis genes, and the HO gene. MBF is composed of Mbp1 and Swi6 and activates the transcription of genes required for DNA synthesis. Mbp1 and Swi4 are the DNA binding subunits for MBF and SBF, while the common subunit, Swi6, is presumed to play a regulatory role in both complexes. We show that Stb1, a protein first identified in a two-hybrid screen with the transcriptional repressor Sin3, binds Swi6 in vitro. The STB1 transcript was cell cycle periodic and peaked in late G(1) phase. In vivo accumulation of Stb1 phosphoforms was dependent on CLN1, CLN2, and CLN3, which encode G(1)-specific cyclins for the cyclin-dependent kinase Cdc28, and Stb1 was phosphorylated by Cln-Cdc28 kinases in vitro. Deletion of STB1 caused an exacerbated delay in G(1) progression and the onset of Start transcription in a cln3Delta strain. Our results suggest a role for STB1 in controlling the timing of Start transcription that is revealed in the absence of the G(1) regulator CLN3, and they implicate Stb1 as an in vivo target of G(1)-specific cyclin-dependent kinases.  (+info)

Phosphorylation-independent inhibition of Cdc28p by the tyrosine kinase Swe1p in the morphogenesis checkpoint. (5/285)

The morphogenesis checkpoint in budding yeast delays cell cycle progression in G(2) when the actin cytoskeleton is perturbed, providing time for cells to complete bud formation prior to mitosis. Checkpoint-induced G(2) arrest involves the inhibition of the master cell cycle regulatory cyclin-dependent kinase, Cdc28p, by the Wee1 family kinase Swe1p. Results of experiments using a nonphosphorylatable CDC28(Y19F) allele suggested that the checkpoint stimulated two inhibitory pathways, one that promoted phosphorylation at tyrosine 19 (Y19) and a poorly characterized second pathway that did not require Cdc28p Y19 phosphorylation. We present the results from a genetic screen for checkpoint-defective mutants that led to the repeated isolation of the dominant CDC28(E12K) allele that is resistant to Swe1p-mediated inhibition. Comparison of this allele with the nonphosphorylatable CDC28(Y19F) allele suggested that Swe1p is still able to inhibit CDC28(Y19F) in a phosphorylation-independent manner and that both the Y19 phosphorylation-dependent and -independent checkpoint pathways in fact reflect Swe1p inhibition of Cdc28p. Remarkably, we found that a Swe1p mutant lacking catalytic activity could significantly delay the cell cycle in vivo during a physiological checkpoint response, even when expressed at single copy. The finding that a Wee1 family kinase expressed at physiological levels can inhibit a nonphosphorylatable cyclin-dependent kinase has broad implications for many checkpoint studies using such mutants in other organisms.  (+info)

A role for the Cdc7 kinase regulatory subunit Dbf4p in the formation of initiation-competent origins of replication. (6/285)

Using a reconstituted DNA replication assay from yeast, we demonstrate that two kinase complexes are essential for the promotion of replication in vitro. An active Clb/Cdc28 kinase complex, or its vertebrate equivalent, is required in trans to stimulate initiation in G(1)-phase nuclei, whereas the Dbf4/Cdc7 kinase complex must be provided by the template nuclei themselves. The regulatory subunit of Cdc7p, Dbf4p, accumulates during late G(1) phase, becomes chromatin associated prior to Clb/Cdc28 activation, and assumes a punctate pattern of localization that is similar to, and dependent on, the origin recognition complex (ORC). The association of Dbf4p with a detergent-insoluble chromatin fraction in G(1)-phase nuclei requires ORC but not Cdc6p or Clb/Cdc28 kinase activity, and correlates with competence for initiation. We propose a model in which Dbf4p targets Cdc7p to the prereplication complex prior to the G(1)/S transition, by a pathway parallel to, but independent of, the Cdc6p-dependent recruitment of MCMs.  (+info)

The role of actin in spindle orientation changes during the Saccharomyces cerevisiae cell cycle. (7/285)

In the budding yeast Saccharomyces cerevisiae, the mitotic spindle must align along the mother-bud axis to accurately partition the sister chromatids into daughter cells. Previous studies showed that spindle orientation required both astral microtubules and the actin cytoskeleton. We now report that maintenance of correct spindle orientation does not depend on F-actin during G2/M phase of the cell cycle. Depolymerization of F-actin using Latrunculin-A did not perturb spindle orientation after this stage. Even an early step in spindle orientation, the migration of the spindle pole body (SPB), became actin-independent if it was delayed until late in the cell cycle. Early in the cell cycle, both SPB migration and spindle orientation were very sensitive to perturbation of F-actin. Selective disruption of actin cables using a conditional tropomyosin double-mutant also led to defects in spindle orientation, even though cortical actin patches were still polarized. This suggests that actin cables are important for either guiding astral microtubules into the bud or anchoring them in the bud. In addition, F-actin was required early in the cell cycle for the development of the actin-independent spindle orientation capability later in the cell cycle. Finally, neither SPB migration nor the switch from actin-dependent to actin-independent spindle behavior required B-type cyclins.  (+info)

Hsl7 localizes to a septin ring and serves as an adapter in a regulatory pathway that relieves tyrosine phosphorylation of Cdc28 protein kinase in Saccharomyces cerevisiae. (8/285)

Successful mitosis requires faithful DNA replication, spindle assembly, chromosome segregation, and cell division. In the budding yeast Saccharomyces cerevisiae, the G(2)-to-M transition requires activation of Clb-bound forms of the protein kinase, Cdc28. These complexes are held in an inactive state via phosphorylation of Tyr19 in the ATP-binding loop of Cdc28 by the Swe1 protein kinase. The HSL1 and HSL7 gene products act as negative regulators of Swe1. Hsl1 is a large (1,518-residue) protein kinase with an N-terminal catalytic domain and a very long C-terminal extension. Hsl1 localizes to the incipient site of cytokinesis in the bud neck in a septin-dependent manner; however, the function of Hsl7 was not previously known. Using both indirect immunofluorescence with anti-Hsl7 antibodies and a fusion of Hsl7 to green fluorescent protein, we found that Hsl7 also localizes to the bud neck, congruent with the septin ring that faces the daughter cell. Both Swe1 and a segment of the C terminus of Hsl1 (which has no sequence counterpart in two Hsl1-related protein kinases, Gin4 and Kcc4) were identified as gene products that interact with Hsl7 in a two-hybrid screen of a random S. cerevisiae cDNA library. Hsl7 plus Swe1 and Hsl7 plus Hsl1 can be coimmunoprecipitated from extracts of cells overexpressing these proteins, confirming that Hsl7 physically associates with both partners. Also consistent with the two-hybrid results, Hsl7 coimmunoprecipitates with full-length Hsl1 less efficiently than with a C-terminal fragment of Hsl1. Moreover, Hsl7 does not localize to the bud neck in an hsl1Delta mutant, whereas Hsl1 is localized normally in an hsl7Delta mutant. Phosphorylation and ubiquitinylation of Swe1, preludes to its destruction, are severely reduced in cells lacking either Hsl1 or Hsl7 (or both), as judged by an electrophoretic mobility shift assay. Collectively, these data suggest that formation of the septin rings provides sites for docking Hsl1, exposing its C terminus and thereby permitting recruitment of Hsl7. Hsl7, in turn, presents its cargo of bound Swe1, allowing phosphorylation by Hsl1. Thus, Hsl1 and Hsl7 promote proper timing of cell cycle progression by coupling septin ring assembly to alleviation of Swe1-dependent inhibition of Cdc28. Furthermore, like septins and Hsl1, homologs of Hsl7 are found in fission yeast, flies, worms, and humans, suggesting that its function in this control mechanism may be conserved in all eukaryotes.  (+info)

*List of MeSH codes (D12.776)

... cdc2 protein kinase MeSH D12.776.167.200.067.500 - cdc28 protein kinase, s cerevisiae MeSH D12.776.167.200.067.875 - cyclin- ... dependent kinase 5 MeSH D12.776.167.200.067.900 - cyclin-dependent kinase 9 MeSH D12.776.167.200.580.500 - cdc2 protein kinase ... RNA-binding protein EWS MeSH D12.776.624.664.700.250 - lymphocyte specific protein tyrosine kinase p56(lck) MeSH D12.776. ... wnt1 protein MeSH D12.776.624.664.700.978 - wnt2 protein MeSH D12.776.624.776.355.100 - cyclin-dependent kinase inhibitor p15 ...

*CKS1B

"Entrez Gene: CKS1B CDC28 protein kinase regulatory subunit 1B". Harper, J.W. 2001. Protein destruction: Adapting roles for Cks ... "Human cDNAs encoding homologs of the small p34Cdc28/Cdc2-associated protein of Saccharomyces cerevisiae and Schizosaccharomyces ... Cyclin-dependent kinases regulatory subunit 1 is a protein that in humans is encoded by the CKS1B gene. The CKS1B protein binds ... 1996). "Crystal structure and mutational analysis of the human CDK2 kinase complex with cell cycle-regulatory protein CksHs1". ...

*Angelika Amon

As a student under Nasmyth, Amon demonstrated that CDC28 protein kinase is not required for the metaphase to anaphase ... The Amon lab primarily investigates yeast (Saccharomyces cerevisiae) as a model for understanding the controls that govern cell ... "Destruction of the CDC28/CLB mitotic kinase is not required for the metaphase to anaphase transition in budding yeast". The ... Amon's team demonstrated that CDC20 is the target protein in the spindle checkpoint during mitosis. Amon's more recent work has ...

*APC/C activator protein CDH1

Cdh1 contains multiple phosphorylation sites for the kinase cdc28. When cdh1 is hyperphosphorytaled, the association of cdh1 to ... The following structural informations are based on the cdh1 protein of Saccharomyces cerevisiae also named Hct1. Cdh1 is a ... In the cdh1 protein amino acid modifications can be found at residue 156 being a phosphoserine and at residue 157 being a ... Li M, Shin YH, Hou L, Huang X, Wei Z, Klann E, Zhang P (2008). "The adaptor protein of the anaphase promoting complex Cdh1 is ...

*List of MeSH codes (D08)

... cdc2 protein kinase MeSH D08.811.913.696.620.682.700.200.067.500 --- cdc28 protein kinase, s cerevisiae MeSH D08.811.913.696. ... map kinase kinase kinases MeSH D08.811.913.696.620.682.700.559.100 --- map kinase kinase kinase 1 MeSH D08.811.913.696.620.682. ... map kinase kinase kinase 2 MeSH D08.811.913.696.620.682.700.559.300 --- map kinase kinase kinase 3 MeSH D08.811.913.696.620.682 ... map kinase kinase kinase 4 MeSH D08.811.913.696.620.682.700.559.500 --- map kinase kinase kinase 5 MeSH D08.811.913.696.620.682 ...

*List of MeSH codes (D12.644)

... cdc2 protein kinase MeSH D12.644.360.250.067.500 --- cdc28 protein kinase, s cerevisiae MeSH D12.644.360.250.067.875 --- cyclin ... map kinase kinase kinase 1 MeSH D12.644.360.400.200 --- map kinase kinase kinase 2 MeSH D12.644.360.400.300 --- map kinase ... kinase kinase 3 MeSH D12.644.360.400.400 --- map kinase kinase kinase 4 MeSH D12.644.360.400.500 --- map kinase kinase kinase 5 ... map kinase kinase 6 MeSH D12.644.360.440.700 --- map kinase kinase 7 MeSH D12.644.360.450 --- mitogen-activated protein kinases ...

*CKS2

"Entrez Gene: CKS2 CDC28 protein kinase regulatory subunit 2". Human CKS2 genome location and CKS2 gene details page in the UCSC ... "Human cDNAs encoding homologs of the small p34Cdc28/Cdc2-associated protein of Saccharomyces cerevisiae and Schizosaccharomyces ... Cyclin-dependent kinases regulatory subunit 2 is a protein that in humans is encoded by the CKS2 gene. CKS2 protein binds to ... 2005). "A human protein-protein interaction network: a resource for annotating the proteome". Cell. 122 (6): 957-68. doi: ...

*Cyclin-dependent kinase 4

... cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 ... The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene ... Cyclin-dependent kinase 4 also known as cell division protein kinase 4 is an enzyme that in humans is encoded by the CDK4 gene ... 1995). "Identification of human cyclin-dependent kinase 8, a putative protein kinase partner for cyclin C". Proc. Natl. Acad. ...

*Cyclin-dependent kinase 3

Cell division protein kinase 3 is an enzyme that in humans is encoded by the CDK3 gene. CDK3 complements cdc28 mutants of ... Saccharomyces cerevisiae suggesting that it may be involved in cell cycle control. CDK3 can phosphorylate histone H1 and ... 1995). "Chromosomal mapping of members of the cdc2 family of protein kinases, cdk3, cdk6, PISSLRE, and PITALRE, and a cdk ... Meikrantz W, Schlegel R (1996). "Suppression of apoptosis by dominant negative mutants of cyclin-dependent protein kinases". J ...

*Cyclin-dependent kinase 2

This protein kinase is highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, also known as Cdk1 in ... The protein encoded by this gene is a member of the cyclin-dependent kinase family of Ser/Thr protein kinases. ... Cyclin-dependent kinase 2, also known as cell division protein kinase 2, is an enzyme that in humans is encoded by the CDK2 ... Cheng A, Kaldis P, Solomon MJ (November 2000). "Dephosphorylation of human cyclin-dependent kinases by protein phosphatase type ...

*Cyclin-dependent kinase 7

CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe ... Cell division protein kinase 7 is an enzyme that in humans is encoded by the CDK7 gene. The protein encoded by this gene is a ... This protein forms a trimeric complex with cyclin H and MAT1, which functions as a Cdk-activating kinase (CAK). It is an ... Drapkin R, Le Roy G, Cho H, Akoulitchev S, Reinberg D (Jun 1996). "Human cyclin-dependent kinase-activating kinase exists in ...

*Cyclin-dependent kinase 10

... cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to ... Cell division protein kinase 10 is an enzyme that in humans is encoded by the CDK10 gene. The protein encoded by this gene ... "Entrez Gene: CDK10 cyclin-dependent kinase (CDC2-like) 10". Kasten M, Giordano A (Apr 2001). "Cdk10, a Cdc2-related kinase, ... "Chromosomal mapping of members of the cdc2 family of protein kinases, cdk3, cdk6, PISSLRE, and PITALRE, and a cdk inhibitor, ...

*Wee1

... cerevisiae homologue Swe1 In S. cerevisiae, cyclin-dependent kinase Cdc28 (Cdk1 homologue) is phosphorylated by Swe1 (Wee1 ... Wee1-like protein kinase Cell cycle β-transducin repeat-containing protein 1/2 (β-TrCP1/2) F-box protein-containing SKP1/Cul1/F ... The S. cerevisiae protein Swe1 is also regulated by degradation. Swe1 is hyperphosphorylated by Clb2-Cdc28 and Cdc5 which may ... The corresponding proteins are Wee1-like protein kinase and Wee1-like protein kinase 2 which act on the human Cdk1 homologue ...

*Cyclin-dependent kinase 9

... cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of ... Cyclin-dependent kinase 9 or CDK9 is a cyclin-dependent kinase associated with P-TEFb. The protein encoded by this gene is a ... HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein ... CDK9 cyclin-dependent kinase 9 (CDC2-related kinase)". MacLachlan TK, Sang N, De Luca A, Puri PL, Levrero M, Giordano A (1998 ...

*Cyclin-dependent kinase 6

CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe ... This kinase is a catalytic subunit of the protein kinase complex, important for the G1 phase progression and G1/S transition of ... Cell division protein kinase 6 (CDK6) is an enzyme encoded by the CDK6 gene. It is regulated by cyclins, more specifically by ... CDK6 is a protein kinase activating cell proliferation, it is involved in an important point of restriction in the cell cycle. ...

*Cln3

Tyers, M; Tokiwa, G; Nash, R; Futcher, B (May 1992). "The Cln3-Cdc28 kinase complex of S. cerevisiae is regulated by ... It is a 65 kD, unstable protein; like other cyclins, it functions by binding and activating cyclin-dependent kinase (CDK). Cln3 ... Cln/Cdc28 kinases activate bound transcription factor SBF (Swi4/Swi6) at start, whereas Clb/Cdc28 kinases displace it from the ... "Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae". The EMBO Journal. 14 (19 ...

*Cyclin-dependent kinase 1

ISBN 0-19-920610-4. Nasmyth K (April 1993). "Control of the yeast cell cycle by the Cdc28 protein kinase". Curr. Opin. Cell ... Cdk1 activity is best understood in S. cerevisiae, so Cdk1 S. cerevisiae activity is described here. In the budding yeast, ... Cdk1 is comprised mostly by the bare protein kinase motif, which other protein kinases share. Cdk1, like other kinases, ... Cyclin-dependent kinase 1 also known as CDK1 or cell division cycle protein 2 homolog is a highly conserved protein that ...

*Origin recognition complex

Cell cycle-regulated phosphorylation of Orc2, Orc6, Cdc6, and MCM by the cyclin-dependent protein kinase Cdc28 regulates ... "Yeast two-hybrid analysis of the origin recognition complex of Saccharomyces cerevisiae: interaction between subunits and ... Weinreich M, Liang C, Chen HH, Stillman B (September 2001). "Binding of cyclin-dependent kinases to ORC and Cdc6p regulates the ... Nguyen VQ, Co C, Li JJ (June 2001). "Cyclin-dependent kinases prevent DNA re-replication through multiple mechanisms". Nature. ...

*List of MeSH codes (D12.776.476)

... cdc2 protein kinase MeSH D12.776.476.250.067.500 -- cdc28 protein kinase, s cerevisiae MeSH D12.776.476.250.067.875 -- cyclin- ... mitogen-activated protein kinase 1 MeSH D12.776.476.450.169.750 -- mitogen-activated protein kinase 3 MeSH D12.776.476.450. ... 169.875 -- mitogen-activated protein kinase 6 MeSH D12.776.476.450.169.937 -- mitogen-activated protein kinase 7 MeSH D12.776. ... mitogen-activated protein kinase 8 MeSH D12.776.476.450.340.750 -- mitogen-activated protein kinase 9 MeSH D12.776.476.450. ...

*Cyclin-dependent kinase

Most knowledge of CDK structure and function is based on CDKs of S. pombe (Cdc2), S. cerevisiae (CDC28), and vertebrates (CDC2 ... A cyclin-dependent kinase inhibitor (CKI) is a protein that interacts with a cyclin-CDK complex to block kinase activity, ... By definition, a CDK binds a regulatory protein called a cyclin. Without cyclin, CDK has little kinase activity; only the ... One of the kinases that place the tyrosine phosphate is Wee1, a kinase conserved in all eukaryotes. Fission yeast also contains ...

*Cdc6

... , or cell division cycle 6, is a protein in eukaryotic cells that is studied in the budding yeast Saccharomyces cerevisiae ... Furthermore, Cdc6 indirectly inhibits activation of the p34cdc2/CDC28 M phase kinase, thus nuclear division is suppressed. ... From studies with E. coli γ clamp loading complex, it was suggested that domain III mediates protein-protein interactions with ... Cdc6p is an ATP binding protein and a member of the pre-replicative complex (pre-RC) together with the origin recognition ...

*Non-homologous end joining

This regulation is accomplished by the cyclin-dependent kinase Cdk1 (Cdc28 in yeast), which is turned off in G1 and expressed ... DeFazio LG, Stansel RM, Griffith JD, Chu G (June 2002). "Synapsis of DNA ends by DNA-dependent protein kinase". The EMBO ... Palmbos PL, Wu D, Daley JM, Wilson TE (December 2008). "Recruitment of Saccharomyces cerevisiae Dnl4-Lif1 complex to a double- ... Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D ...

*Cyclin-dependent kinase complex

In S. cerevisiae, the association of Cdc28 with cyclins, Cln1, Cln2, or Cln3, results in the transition from G1 phase to S ... is a protein complex formed by the association of an inactive catalytic subunit of a protein kinase, cyclin-dependent kinase ( ... Once in the S phase, Cln1 and Cln2 dissociates with Cdc28 and complexes between Cdc28 and Clb5 or Clb6 are formed. In G2 phase ... Cyclin Cyclin-dependent kinase Malumbres M, Barbacid M. Mammalian cyclin-dependent kinases. Trends Biochem. Sci. 2005 Nov;30(11 ...

*Sic1

The stress-activated protein kinase (SAPK) Hog1 phosphorylates Sic1 at a single residue at the carboxyl terminus. This leads to ... In the G1 phase of the cell cycle, Sic1 binds tightly to the Cdc28-Clb complex and inhibits it. Low Cdc28-Clb activity leads to ... cerevisiae". Cell. 79 (2): 233-44. doi:10.1016/0092-8674(94)90193-7. PMID 7954792. Morgan DO (1997). The Cell Cycle: Principles ... 2). Sic1 can also be phosphorylated by other kinases, such as Pho85-Pc11 , a kinase which becomes essential when Cln1 and Cln2 ...

*Eukaryotic DNA replication

S phase-specific cyclin-dependent protein kinase (CDK) and Cdc7/Dbf4 kinase (DDK) transform the pre-RC into an active ... In S. cerevisiae, nuclear export is promoted by cyclin-dependent kinase (CDK) activity. Mcm proteins that are associated with ... Binding of Cdc45 to chromatin depends on Clb-Cdc28 kinase activity as well as functional Cdc6 and Mcm2, which suggests that ... One kinase is the Cdc7-Dbf4 kinase called Dbf4-dependent kinase (DDK) and the other is cyclin-dependent kinase (CDK). Chromatin ...

*Kim Nasmyth

... cloned the CDC28 gene from the budding yeast Saccharomyces cerevisiae. As a group leader in Cambridge Nasmyth became interested ... Schwob, E; Böhm, T; Mendenhall, M. D.; Nasmyth, K (1994). "The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S ... "Yeast cohesin complex requires a conserved protein, Eco1p(Ctf7), to establish cohesion between sister chromatids during DNA ... Together with Kelly Tatchell he cloned the S. cerevisiae mating-type locus and found, surprisingly, that 'silent' copies of the ...
In this study, we used a functional-genomics approach to explore the biological basis of the complex phenotype caused by deletion of the multifunctional Pho85 Cdk. Pho85 function is mediated through 10 Pho85 cyclins or Pcls, but both the complexity of Pho85 function and the genetic redundancy of the cyclins have hampered efforts to use traditional genetic approaches to discover functions and substrates for individual Pcl-Pho85 complexes (45). Using a combination of SGA analysis (64), expression profiling, and phenotypic tests, we have uncovered important roles for Pho85 in cell integrity and the response to adverse growth conditions. First, our work highlights a cell integrity function for the Pcl1,2 subfamily of Pho85 Cdks that is independent of the role of Pho80-Pho85 in the response to stress. Second, we uncovered a key function for Pho80-Pho85-mediated regulation of Pho4 in vacuolar function and stress response, in addition to its well-established role in phosphate regulation. The ...
Article Autophosphorylation-induced degradation of the Pho85 cyclin Pcl5 is essential for response to amino acid limitation. Pho85 cyclins (Pcls), activators of the yeast cyclin-dependent kinase (CDK) Pho85, belong together with the p35 activator of ...
Definition of cdc28 protein kinase, s cerevisiae in the Definitions.net dictionary. Meaning of cdc28 protein kinase, s cerevisiae. What does cdc28 protein kinase, s cerevisiae mean? Information and translations of cdc28 protein kinase, s cerevisiae in the most comprehensive dictionary definitions resource on the web.
S cerevisiae NOP58 protein: involved in pre-rRNA processing, 18S rRNA synthesis, and snoRNA synthesis; a component of the small subunit processome complex
S cerevisiae Air1 protein: Air - arginine methyltransferase-interacting RING finger protein; inhibits methylation of Npl3 by Hmt1
cdna:novel chromosome:VEGA66:4:137321762:137357699:-1 gene:OTTMUSG00000009829 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:Cdc42 description:cell division cycle 42 homolog (S cerevisiae ...
Four of the mutants examined (tpm1Δ, sac6Δ, pfy1-111, and myo2-66) displayed a clear reduction in viability when the morphogenesis checkpoint was crippled by elimination of Swe1p (Fig. 2 B). This strongly suggests that the actin perturbations caused by the mutants triggered the checkpoint response, as confirmed below.. Intriguingly, the degree of growth benefit provided by Swe1p varied depending on the growth temperature, in a mutant-specific manner. The difference between the growth of different mutants in combination with swe1Δ was most extreme at the temperatures shown in Fig. 2 B but was often reduced at other (7°C higher or lower) temperatures. In the most dramatic example, growth of myo2-66 swe1Δ cells was impaired relative to myo2-66 cells at 29°C, but not at 28°C (Fig. 2 B). This was unexpected because the strain grows slowly and has impaired actin organization at both temperatures. One problem in interpreting growth assays for very sick strains is the accumulation of suppressor ...
... is a member of the CDC25 family of phosphatases. CDC25A is required for progression from G1 to the S phase of the cell cycle. It activates the cyclin-dependent kinase CDC2 by removing two phosphate groups. CDC25A is specifically degraded in response to DNA damage, which prevents cells with chromosomal abnormalities from progressing through cell division. CDC25A is an oncogene, although its exact role in oncogenesis has not been demonstrated. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008 ...
Elastografia SWE wątroby - wybrane artykuły z piśmiennictwa naukowego poświęcone nowoczesnym metodom oceny włóknienia wątroby.| Elastograf.pl
Addgene NGS Result GTCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATAT GGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTG ACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGT ATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGT CAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAG TACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCA TCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGC GGGGGGGGGGGGGGGGCGCGGGGCGGGGCGGGGCGGGGCGGRGRGGGGCGGCGGCRGCCAATCAGAGCGG CGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGG CGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCC GGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTA GCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGC CCTTTGTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCT ...
EMMX proudly develops novel molecules and reagents to drug discovery and cancer research. We are scientists driven by a devotion to discovery and innovation, and we work hard every day to find new ways to streamline life science research.. ...
Principal Investigator:ANDO Shoji, Project Period (FY):1996 - 1997, Research Category:Grant-in-Aid for Scientific Research (C), Section:一般, Research Field:Bioorganic chemistry
No Worm CLN is a medicine available in a number of countries worldwide. A list of US medications equivalent to No Worm CLN is available on the Drugs.com website.
Gentaur molecular products has all kinds of products like :search , SibEm \ Sbf I \ E101 for more molecular products just contact us
TY - JOUR. T1 - Alterations in cyclin-dependent protein kinase 5 (CDK5) protein levels, activity and immunocytochemistry in canine motor neuron disease. AU - Green, Sherril L.. AU - Vulliet, Philip R. AU - Pinter, Martin J.. AU - Cork, Linda C.. PY - 1998/11. Y1 - 1998/11. N2 - Hereditary canine spinal muscular atrophy (HCSMA) is a dominantly inherited motor neuron disease in Brittany spaniels that is clinically characterized by progressive muscle weakness leading to paralysis. Histopathologically, degeneration is confined to motor neurons with accumulation of phosphorylated neurofilaments in axonal internodes. Cyclin- dependent kinase 5 (CDK5), a kinase related to the cell cycle kinase cdc2, phosphorylates neurofilaments and regulates neurofilament dynamics. We examined CDK5 activity, protein levels, and cellular immunoreactivity in nervous tissue from dogs with HCSMA, from closely age-matched controls and from dogs with other neurological diseases. On immunoblot analysis, CDK5 protein levels ...
Overexpression of mitotic cyclin CLB2 results in premature spindle elongation in swe1Δ mutants.A. Overexpression of CLB2 is toxic to swe1Δ mutants. WT and swe
I logged on to this site after following a link from CDC. I was curious about CD and considering a change from LL. After reading the ridiculous opinions of...
Are you looking to buy Ammonia printing service online in bulk? Find the best Ammonia printing service , Ammonia printing service manufacturer, supplier, Ammonia printing service exporter & wholesaler in India.
More than 70 mutations in the CLN6 gene have been found to cause CLN6 disease. This condition impairs motor and mental development, typically starting in early to late childhood, causing gradually worsening problems with movement and a decline in intellectual function. In some cases, signs and symptoms of CLN6 disease do not appear until adulthood.. Most CLN6 gene mutations result in the production of an abnormal CLN6 protein that is quickly broken down (degraded). As a result, there is a severe reduction in the amount of functional CLN6 protein in cells. While it is not known how the loss of this protein causes the signs and symptoms of CLN6 disease, it is likely that the proteins quick degradation contributes to the childhood onset of CLN6 disease.. In the cases in which CLN6 disease develops in adulthood, CLN6 gene mutations often change single protein building blocks (amino acids), resulting in a CLN6 protein with reduced function. Research suggests that these CLN6 gene mutations allow ...
多种适用的CDC25CELISA试剂盒,如人等。在antibodies-online.cn对比CDC25CELISA试剂盒,以便找到您需要的产品。
Cardiomyocytes cease to divide shortly after birth and an irreversible cell cycle arrest is evident accompanied by the downregulation of cyclin-dependent kinase activities. To get a better understanding of the cardiac cell cycle and its regulation, the effect of functional recovery of the mitosis-promoting factor (MPF) consisting of cyclin B1 and the cyclin-dependent kinase Cdc2 was assessed in primary cultures of postmitotic ventricular adult rat cardiomyocytes ( ARC). Gene transfer into ARC was achieved using the adenovirus-enhanced transferrinfection system that was characterized by the absence of cytotoxic events. Simultaneous ectopic expression of wild-type versions of cyclin B1 and Cdc2 was sufficient to induce MPF activity. Reestablished MPF resulted in a mitotic phenotype, marked by an abnormal condensation of the nuclei, histone H3 phosphorylation and variable degree of decay of the contractile apparatus. Although a complete cell division was not observed, the results provided ...
Complete information for CLN3 gene (Protein Coding), CLN3, Battenin, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
多种适用的CDC25BELISA试剂盒,如人, 小鼠, 大鼠等。在antibodies-online.cn对比CDC25BELISA试剂盒,以便找到您需要的产品。
a class="explain" href="http://www.cdc.gov/emailupdates/",What's this?,/a, ,label,,span class="tp-sr-only",Submit Button,/span, ,input class="button submit" name="commit" type="submit" value="Submit" /,,/label ...
Poznaj swe mapy przy grach internetowego, iz grasz. Uchwycenie teren jest niezwykle wazne zwyciestwo. Gdzie sa najlepsze miejsca, z jakiego sie ukryc oraz zasadzki przeciwników? Dokad wolno zrobic skróty do odwiedzenia daja lepsze sytuacje strategiczna? Ten typ madrosci przynosi wazna przewage strategiczna. Nie doceniac taktyke tlumienia plomienia bedac przez internet shooter. Jezeli grasz na zestawy, posiadajac poszczególnego zawodnika tylko zawierajace obszar z zywym ogniem jego koledzy z ekipy daje wielka okazje podkrasc sie do odwiedzenia nieprzyjaciela albo przynajmniej lepiej sytuacje strategiczna. Pracujac razem, w jaki sposób jest to naprawde byc moze podwyzszyc swe wygrane. Jezeli grasz przy rozrywki sportowe, natomiast nie masz jakiegokolwiek badz doswiadczenia z zanim, ustawic pulap klopoty dzieki debiutanta. To pomoze Tobie wyjsc na unikalnych cech zabawy oraz wyuczyc sie przemieszczac przy polu. Jesli zostanie zestawiona wyzej niz, iz jest prawdopodobne, by draznic oraz nie ...
Poznaj swe mapy przy grach internetowego, iz grasz. Uchwycenie teren jest niezwykle wazne zwyciestwo. Gdzie sa najlepsze miejsca, z jakiego sie ukryc oraz zasadzki przeciwników? Dokad wolno zrobic skróty do odwiedzenia daja lepsze sytuacje strategiczna? Ten typ madrosci przynosi wazna przewage strategiczna. Nie doceniac taktyke tlumienia plomienia bedac przez internet shooter. Jezeli grasz na zestawy, posiadajac poszczególnego zawodnika tylko zawierajace obszar z zywym ogniem jego koledzy z ekipy daje wielka okazje podkrasc sie do odwiedzenia nieprzyjaciela albo przynajmniej lepiej sytuacje strategiczna. Pracujac razem, w jaki sposób jest to naprawde byc moze podwyzszyc swe wygrane. Jezeli grasz przy rozrywki sportowe, natomiast nie masz jakiegokolwiek badz doswiadczenia z zanim, ustawic pulap klopoty dzieki debiutanta. To pomoze Tobie wyjsc na unikalnych cech zabawy oraz wyuczyc sie przemieszczac przy polu. Jesli zostanie zestawiona wyzej niz, iz jest prawdopodobne, by draznic oraz nie ...

Mitotic role for the Cdc28 protein kinase of Saccharomyces cerevisiae. | PNASMitotic role for the Cdc28 protein kinase of Saccharomyces cerevisiae. | PNAS

The dual role of the Cdc28 protein kinase in the S. cerevisiae cell cycle thus parallels that demonstrated for the cdc2 protein ... Mitotic role for the Cdc28 protein kinase of Saccharomyces cerevisiae. Message Subject (Your Name) has sent you a message from ... Mitotic role for the Cdc28 protein kinase of Saccharomyces cerevisiae.. S I Reed and C Wittenberg ... The Cdc28 protein kinase functions in the G1 to S phase transition of the cell cycle of the budding yeast Saccharomyces ...
more infohttps://www.pnas.org/content/87/15/5697?ijkey=6b2c0b6ec93cc0284e032bd0377e49b43923a66a&keytype2=tf_ipsecsha

What does cdc28 protein kinase, s cerevisiae mean?What does cdc28 protein kinase, s cerevisiae mean?

... Information and translations of cdc28 protein kinase, s cerevisiae in the ... s cerevisiae in the Definitions.net dictionary. Meaning of cdc28 protein kinase, s cerevisiae. ... What does cdc28 protein kinase, s cerevisiae mean?. Definitions for cdc28 protein kinase, s cerevisiae. Here are all the ... CDC28 Protein Kinase, S cerevisiae. A protein kinase encoded by the Saccharomyces cerevisiae CDC28 gene and required for ...
more infohttp://www.definitions.net/definition/cdc28%20protein%20kinase%2C%20s%20cerevisiae

The role of phosphorylation and the CDC28 protein kinase in cell cycle-regulated nuclear import of the S. cerevisiae...The role of phosphorylation and the CDC28 protein kinase in cell cycle-regulated nuclear import of the S. cerevisiae...

As all three serines are phosphorylated by purified CDC28-dependent H1 kinase activity in vitro, we propose a model in which ... The protein is nuclear in G1 cells but cytoplasmic in S, G2, and M phase cells. We have identified SWI5s nuclear localization ... the CDC28 kinase acts directly to control nuclear entry of SWI5. ... cell cycle-dependent nuclear entry to a heterologous protein. ... cerevisiae transcription factor SWI5 is cell cycle dependent. ... The role of phosphorylation and the CDC28 protein kinase in ...
more infohttps://www.neuroscience.ox.ac.uk/publications/98408

Control of Cell Proliferation, Organ Growth, and DNA Damage Response Operate Independently of Dephosphorylation of the...Control of Cell Proliferation, Organ Growth, and DNA Damage Response Operate Independently of Dephosphorylation of the...

Hadwiger, J.A., and Reed, S.I. (1988). Invariant phosphorylation of the Saccharomyces cerevisiae Cdc28 protein kinase. Mol. ... In kinase assays from protein extracts of flower buds, the activity of VF was the same as that of the wild-type CDKA;1 (Figure ... Gonzalez, N., Gevaudant, F., Hernould, M., Chevalier, C., and Mouras, A. (2007). The cell cycle-associated protein kinase WEE1 ... Imajuku, Y., Hirayama, T., Endoh, H., and Oka, A. (1992). Exon-intron organization of the Arabidopsis thaliana protein kinase ...
more infohttp://www.plantcell.org/content/21/11/3641?ijkey=57c689ec81f21a507a0baa5afd910c062acb8381&keytype2=tf_ipsecsha

Yeast TAF(II)145 required for transcription of G1/S cyclin genes and r by Scott S. Walker, Wu-Cheng Shen et al."Yeast TAF(II)145 required for transcription of G1/S cyclin genes and r" by Scott S. Walker, Wu-Cheng Shen et al.

TFIID comprises the TATA box-binding protein and a set of highly conserved associated factors (TAF(II)s). yTAF(II)145, the core ... CDC28 Protein Kinase, S cerevisiae; *Cyclin B; Cyclins; DNA-Binding Proteins; Fungal Proteins; G1 Phase; Gene Expression ... Saccharomyces cerevisiae Proteins; *TATA-Binding Protein Associated Factors; *Transcription Factor TFIID; Transcription Factors ... TFIID comprises the TATA box-binding protein and a set of highly conserved associated factors (TAF(II)s). yTAF(II)145, the core ...
more infohttps://escholarship.umassmed.edu/gsbs_sp/1325/

The mcm5-bob1 Bypass of Cdc7p/Dbf4p in DNA Replication Depends on Both Cdk1-Independent and Cdk1-Dependent Steps in...The mcm5-bob1 Bypass of Cdc7p/Dbf4p in DNA Replication Depends on Both Cdk1-Independent and Cdk1-Dependent Steps in...

1991 A cyclin B homolog in S. cerevisiae: chronic activation of the Cdc28 protein kinase by cyclin prevents exit from mitosis. ... two protein kinases, cyclin-dependent kinase (Cdk)1p (also known as Cdc28p) and Cdc7p, must be activated. These kinases both ... 1993 Cell cycle regulation of the yeast Cdc7 protein kinase by association with the Dbf4 protein. Mol. Cell. Biol. 13: 2899- ... 1994 The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S phase transition in Saccharomyces cerevisiae. Mol. Cell. ...
more infohttp://www.genetics.org/content/161/1/47

Gendoo - Relevant featuresGendoo - Relevant features

Elongation Factor 2 Kinase CaMキナーゼ3 CDC28 Protein Kinase, S cerevisiae cdc28蛋白質キナーゼ ... JNK Mitogen-Activated Protein Kinases JNK Mitogen-Activated Protein Kinases Calcium-Calmodulin-Dependent Protein Kinases カルシウム- ... protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform. Disease : Chemicals : Biological Phenomena : Anatomy ... Tumor Suppressor Protein p53 腫瘍抑制蛋白質p53 ... Protein Kinase C プロテインキナーゼC Mitogen-Activated
more infohttp://gendoo.dbcls.jp/cgi-bin/gendoo.cgi?geneid=5494&taxonomy=human

Characterization of the Aspergillus nidulans Septin (asp) Gene Family | GeneticsCharacterization of the Aspergillus nidulans Septin (asp) Gene Family | Genetics

... an adapter in a regulatory pathway that relieves tyrosine phosphorylation of Cdc28 protein kinase in Saccharomyces cerevisiae. ... Except for the S. cerevisiae protein Spr28, the septins from within a single fungal species were dispersed among the classes. ... Two mitosis-specific kinases from S. cerevisiae, Gin4p and Kcc4p, regulate cell cycle progression and localize to the bud neck ... cerevisiae (Figure 2). Each class contained one of the prototypical S. cerevisiae septins, Cdc3, Cdc10, Cdc11, or Cdc12. The ...
more infohttps://www.genetics.org/node/330135.full.print

Daniel J. Lew - Searle Scholars ProgramDaniel J. Lew - Searle Scholars Program

In the budding yeast S. cerevisiae, cell cycle progression is controlled by the Cdc28 protein kinase and cyclins. In particular ... encoding a kinase capable of phosphorylating Cdc28 on tyrosine 19, thus inhibiting its kinase activity. During the checkpoint- ... mitosis is triggered by activation of Cdc28 by Clb cyclins. In cells that cannot polarize the actin cytoskeleton or form a bud ... both of these contribute to lowering Cdc28 activity. However, we have found that both of these transcriptional responses are ...
more infohttps://www.searlescholars.net/people/daniel-j-lew

CKS2 CDC28 protein kinase regulatory subunit 2 [Homo sapiens (human)] - Gene - NCBICKS2 CDC28 protein kinase regulatory subunit 2 [Homo sapiens (human)] - Gene - NCBI

cyclin-dependent kinases regulatory subunit 2. Names. CDC28 protein kinase 2. CKS-2. CKS1(S. cerevisiae Cdc28/Cdc2 kinase ... CKS2 CDC28 protein kinase regulatory subunit 2 [Homo sapiens] CKS2 CDC28 protein kinase regulatory subunit 2 [Homo sapiens]. ... CDC28 protein kinase regulatory subunit 2provided by HGNC. Primary source. HGNC:HGNC:2000 See related. Ensembl:ENSG00000123975 ... CKS2 CDC28 protein kinase regulatory subunit 2 [ Homo sapiens (human) ] Gene ID: 1164, updated on 4-Mar-2018 ...
more infohttps://www.ncbi.nlm.nih.gov/gene?Db=gene&Cmd=ShowDetailView&TermToSearch=1164

List of MeSH codes (D12.776) - WikipediaList of MeSH codes (D12.776) - Wikipedia

... cdc2 protein kinase MeSH D12.776.167.200.067.500 - cdc28 protein kinase, s cerevisiae MeSH D12.776.167.200.067.875 - cyclin- ... dependent kinase 5 MeSH D12.776.167.200.067.900 - cyclin-dependent kinase 9 MeSH D12.776.167.200.580.500 - cdc2 protein kinase ... RNA-binding protein EWS MeSH D12.776.624.664.700.250 - lymphocyte specific protein tyrosine kinase p56(lck) MeSH D12.776. ... wnt1 protein MeSH D12.776.624.664.700.978 - wnt2 protein MeSH D12.776.624.776.355.100 - cyclin-dependent kinase inhibitor p15 ...
more infohttps://en.wikipedia.org/wiki/List_of_MeSH_codes_(D12.776)

A Single-Transformation Gene Function Test in DiploidCandida albicans | Journal of BacteriologyA Single-Transformation Gene Function Test in DiploidCandida albicans | Journal of Bacteriology

Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae. ... CDC28 specifies a cyclin-dependent protein kinase, and activity of such kinases is vital for cell cycle progression in all ... Novel sensing mechanisms and targets for the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae.Mol. Microbiol ... including key residues required forSNF1 and CDC28 protein kinase activity. The deletion of CDC25 removes the GDP-GTP exchange ...
more infohttps://jb.asm.org/content/182/20/5730

Multiple Regulatory Mechanisms to Inhibit Untimely Initiation of DNA Replication Are Important for Stable Genome Maintenance |...Multiple Regulatory Mechanisms to Inhibit Untimely Initiation of DNA Replication Are Important for Stable Genome Maintenance |...

The role of phosphorylation and the CDC28 protein kinase in cell cycle-regulated nuclear import of the S. cerevisiae ... CDK and DDK (Dbf4-dependent kinase, which consists of Cdc7 and Dbf4) are conserved protein kinases and are required for ... NguyenVQCoCIrieKLiJJ 2000 Clb/Cdc28 kinases promote nuclear export of the replication initiator proteins Mcm2-7. Curr Biol 10 ... To address this possibility, we have monitored the phosphorylation of Rad53, an essential protein kinase required for cell ...
more infohttps://www.prolekare.cz/casopisy/plos-genetics/2011-6/multiple-regulatory-mechanisms-to-inhibit-untimely-initiation-of-dna-replication-are-important-for-stable-genome-maintenance-45351

Dissection of a Complex Phenotype by Functional Genomics Reveals Roles for the Yeast Cyclin-Dependent Protein Kinase Pho85 in...Dissection of a Complex Phenotype by Functional Genomics Reveals Roles for the Yeast Cyclin-Dependent Protein Kinase Pho85 in...

Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae. ... The protein kinase Pho85 is required for asymmetric accumulation of the Ash1 protein in Saccharomyces cerevisiae. Mol. ... Novel sensing mechanisms and targets for the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol. ... Mutation of the SPS1-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during ...
more infohttps://mcb.asm.org/content/22/14/5076

Mol Cell Biol 9(5), 2034-2041, 1989 Publication Passport - StrainInfoMol Cell Biol 9(5), 2034-2041, 1989 Publication Passport - StrainInfo

S.cerevisiae protein kinase (CKS1) gene, complete cds. 1989/11/23. 729. ... encodes a subunit of the Cdc28 protein kinase complex. ... Saccharomyces cerevisiae genes for Cks1 protein, Esr1 protein, ... The Saccharomyces cerevisiae CKS1 gene, a homolog of the Schizosaccharomyces pombe suc1+ gene, ... hypothetical protein, partial and complete cds. 1994/07/27. 8700. M26033. ...
more infohttp://www.straininfo.net/publications/86406

Negative regulation of G1 and G2 by S-phase cyclins of Sacchar...Negative regulation of G1 and G2 by S-phase cyclins of Sacchar...

Cell cycle progression in the budding yeast Saccharomyces cerevisiae is contro ... Negative regulation of G1 and G2 by S-phase cyclins of Saccharomyces cerevisiae.: ... Cell cycle progression in the budding yeast Saccharomyces cerevisiae is controlled by the Cdc28 protein kinase, which is ... Nevertheless, both Clb5 and Clb6 were shown to be responsible for down-regulation of the protein kinase activities associated ...
more infohttps://www.mysciencework.com/publication/show/negative-regulation-of-g1-and-g2-by-s-phase-cyclins-of-saccharomyces-cerevisiae

ASMscience | Fungal Cell Cycle: A Unicellular versus Multicellular ComparisonASMscience | Fungal Cell Cycle: A Unicellular versus Multicellular Comparison

Here we describe the cell cycles of the unicellular budding yeast Saccharomyces cerevisiae and the multicellular filamentous ... an adapter in a regulatory pathway that relieves tyrosine phosphorylation of Cdc28 protein kinase in Saccharomyces cerevisiae. ... Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae. EMBO J 14:4803-4813. [ ... Summary of the morphogenesis checkpoint in Saccharomyces cerevisiae. In the nucleus the kinase Swe1 inhibits Cdc28 via ...
more infohttp://www.asmscience.org/content/journal/microbiolspec/10.1128/microbiolspec.FUNK-0025-2016

Cell cycle control of septin ring dynamics in the budding yeast | Microbiology SocietyCell cycle control of septin ring dynamics in the budding yeast | Microbiology Society

... splitting of the ring into two independent structures depends on the function of the mitotic exit network in which the protein ... cell cycle arrests and deregulation of cell cycle controls we show that septin assembly is dependent on G1 cyclin/Cdc28- ... In Saccharomyces cerevisiae, the Cdc3, Cdc10, Cdc11, Cdc12 and Shs1/Sep7 septins assemble as a ring that marks the cytokinetic ... adapter in a regulatory pathway that relieves tyrosine phosphorylation of the Cdc28 protein kinase in Saccharomyces cerevisiae ...
more infohttps://www.microbiologyresearch.org/content/journal/micro/10.1099/00221287-147-6-1437

The saccharomyces-cerevisiae cks1 gene, a homolog of the schizosaccharomyces-pombe suc1+ gene, encodes a subunit of the cdc28...The saccharomyces-cerevisiae cks1 gene, a homolog of the schizosaccharomyces-pombe suc1+ gene, encodes a subunit of the cdc28...

The Saccharomyces cerevisiae gene CDC28 encodes a protein kinase required for cell cycle initiation. In an attempt to identify ... Furthermore, the Cks1 protein was shown to be physically associated with active forms of the Cdc28 protein kinase. These data ... encodes a subunit of the cdc28 protein-kinase complex Academic Article ... genes encoding proteins that interact with the Cdc28 protein kinase, high-copy plasmid suppressors of a temperature-sensitive ...
more infohttps://vivo.scripps.edu/display/endnote2130

The Cdk-activating kinase (CAK) from budding yeast.  - PubMed - NCBIThe Cdk-activating kinase (CAK) from budding yeast. - PubMed - NCBI

Saccharomyces cerevisiae Proteins. *Protein-Serine-Threonine Kinases. *CDC2-CDC28 Kinases. *CDC28 Protein Kinase, S cerevisiae ... A temperature-sensitive mutation in CAK1 confers a G2 delay accompanied by low Cdc28p protein kinase activity and shows genetic ... the Cdk-activating kinase. We have purified and cloned CAK from S. cerevisiae. Unlike CAKs from other organisms, Cak1p is ... The Cdk-activating kinase (CAK) from budding yeast.. Kaldis P1, Sutton A, Solomon MJ. ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/8752210?dopt=Abstract

Far1 and Fus3 Link the Mating Pheromone Signal-Transduction Pathway to 3 G1-Phase Cdc28 Kinase Complexes  - CSHL Scientific...Far1 and Fus3 Link the Mating Pheromone Signal-Transduction Pathway to 3 G1-Phase Cdc28 Kinase Complexes - CSHL Scientific...

In the yeast Saccharomyces cerevisiae, the Cdc28 protein kinase controls commitment to cell division at Start, but no ... and Cln3 kinase complexes. This induced interaction depends upon the Fus3 protein kinase, a mitogen-activated protein kinase ... CELL-CYCLE CONTROL SACCHAROMYCES-CEREVISIAE PROTEIN-KINASE RESPONSE PATHWAY YEAST GENE ARREST DIVISION CLN2 PHOSPHORYLATION. ... Thus, we trace a path through which a mitogen-activated protein kinase regulates a Cdc2 kinase. ...
more infohttp://repository.cshl.edu/32564/

A novel multiple affinity purification tag and its use in identification of proteins associated with a cyclin-CDK complex  -...A novel multiple affinity purification tag and its use in identification of proteins associated with a cyclin-CDK complex -...

Western CDC28 Protein Kinase, S cerevisiae/chemistry/genetics/isolation & purification/ metabolism Calmodulin/metabolism ... Active Clb2-Cdc28 kinase complex was purified from yeast cells after inserting the CHH tag into Clb2. Associated proteins were ... metabolism Saccharomyces cerevisiae/genetics/metabolism Saccharomyces cerevisiae Proteins. Subjects:. bioinformatics , genomics ... These included the known associated proteins Cdc28, Sic1 and Cks1. Several other proteins were found including the 70 kDa ...
more infohttp://repository.cshl.edu/29254/

Is START a switch? - InfoscienceIs START a switch? - Infoscience

A model of START regulation involves activation of CDC28 kinase by any CLN protein, leading to activation of CLN1 and CLN2 ... They probably act by activating the CDC28 protein kinase. Expression of CLN1 or CLN3 under the control of an inducible promoter ... The cell cycle in Saccharomyces cerevisiae is controlled by regulation of START in late G1. The CLN1, CLN2 and CLN3 family of ... The cell cycle in Saccharomyces cerevisiae is controlled by regulation of START in late G1. The CLN1, CLN2 and CLN3 family of ...
more infohttps://infoscience.epfl.ch/record/153334

Experts and Doctors on saccharomyces cerevisiae in Connecticut, United StatesExperts and Doctors on saccharomyces cerevisiae in Connecticut, United States

Research Topics about Experts and Doctors on saccharomyces cerevisiae in Connecticut, United States ... s cerevisiae cdc28 protein kinase*genetic crossing over*gtp binding protein alpha subunits*genetic suppression*myosin type v* ... The sequence of the MEK1 gene predicts a 56.8-kD protein with homology to serine-threonine protein kinases. The MEK1 gene maps ... Du L, Novick P. Pag1p, a novel protein associated with protein kinase Cbk1p, is required for cell morphogenesis and ...
more infohttp://www.labome.org/locale/united/experts-and-doctors-on-saccharomyces-cerevisiae-in-connecticut--united-states-21159.html

Phosphorylation of phosphatidate phosphatase regulates its membrane association and physiological functions in Saccharomyces...Phosphorylation of phosphatidate phosphatase regulates its membrane association and physiological functions in Saccharomyces...

... as the sites phosphorylated by the CDC28 (CDK1)-encoded cyclin-dependent kinase. Compared with the dephosphorylation mimic of ... PAP is phosphorylated at multiple Ser and Thr residues and is dephosphorylated for in vivo function by the Nem1p-Spo7p protein ... The Saccharomyces cerevisiae PAH1-encoded phosphatidate phosphatase (PAP) catalyzes the penultimate step in the synthesis of ... Lipid metabolism and transport define longevity of the yeast Saccharomyces cerevisiae.. *Darya Mitrofanova, Paméla Dakik, ...
more infohttps://www.semanticscholar.org/paper/Phosphorylation-of-phosphatidate-phosphatase-its-in-Choi-Su/c0fbee79b57aceaca34a4f7a99d8818789bd231b
  • our data highlight a cell integrity function for the Pcl1,2 subgroup of Pho85 Cdks that is independent of a role for the Pho80-Pho85 kinase in the response to stress. (asm.org)
  • Four human protein kinases (underlined) representing the four major families in the CMGC group (CDKs, MAPKs, GSK3, and CDK-like) were included in the alignment to anchor the position of these families in the tree. (asmscience.org)
  • This is in contrast with observations of the homologous protein kinase from a variety of metazoans, where activity and function are associated with the G2 to M phase transition. (pnas.org)
  • A model of START regulation involves activation of CDC28 kinase by any CLN protein, leading to activation of CLN1 and CLN2 transcription in a positive feedback loop and passage through START. (epfl.ch)
  • Discovering the physiological substrates of protein kinases is a major challenge, and we have pursued a number of genomics approaches to reveal the processes regulated by Pho85 and to understand the root cause of reduced cellular fitness in pho85 Δ mutant strains. (asm.org)
  • During the checkpoint-induced G2 delay, CLB transcription is repressed, while SWE1 transcription is induced: both of these contribute to lowering Cdc28 activity. (searlescholars.net)
  • Previous studies have suggested that the Pch2 protein acts in a checkpoint pathway that monitors chromosome synapsis. (labome.org)
  • Active Clb2-Cdc28 kinase complex was purified from yeast cells after inserting the CHH tag into Clb2. (cshl.edu)
  • In Start, yeast cells decide whether or not to initiate a new cell cycle depending on external (nutrient availability, presence of pheromones) and internal (protein synthesis/cell size, DNA integrity) cues [ 14 ]. (biomedcentral.com)
  • The contrast between C. albicans and S. cerevisiae can provide unique insight into regulatory mechanisms, interpathway relationships, and general aspects of eukaryotic biology. (asm.org)
  • In phylogenetic analysis most fungal septins could be grouped with one of the prototypical S. cerevisiae septins, Cdc3, Cdc10, Cdc11, and Cdc12. (genetics.org)
  • The origins are bound throughout the cell cycle by a six-member protein complex known as the origin-recognition complex (ORC). (genetics.org)
  • Several lines of evidence point to the Mcm complex as the substrate of Cdc7p kinase. (genetics.org)
  • In the first reaction, known as licensing, a specific protein-origin DNA complex, called the pre-replicative complex (pre-RC), is assembled at origins during the G1 phase of the cell cycle by the loading of an inactive form of the Mcm2-7 helicase complex. (prolekare.cz)
  • Dong H, Roeder G. Organization of the yeast Zip1 protein within the central region of the synaptonemal complex. (labome.org)
  • We show, in addition, that the protein kinase is highly active during this phase of the cell cycle. (pnas.org)
  • The protein is nuclear in G1 cells but cytoplasmic in S, G2, and M phase cells. (ox.ac.uk)
  • Molecular experiments revealed that the mcm5-bob1 mutation allows for constitutive loading of Cdc45p at early origins in arrested G1 phase cells when both kinases are inactive. (genetics.org)
  • Cdc7 protein may be required for error-prone DNA repair or for translesion error-prone DNA replication and not for the checkpoints in G1 phase. (naver.com)
  • The intracellular localization of the S. cerevisiae transcription factor SWI5 is cell cycle dependent. (ox.ac.uk)
  • We have identified SWI5's nuclear localization signal (NLS) and show that it can confer cell cycle-dependent nuclear entry to a heterologous protein. (ox.ac.uk)
  • As all three serines are phosphorylated by purified CDC28-dependent H1 kinase activity in vitro, we propose a model in which the CDC28 kinase acts directly to control nuclear entry of SWI5. (ox.ac.uk)
  • The fact that the strain in which all six CLB genes are deleted is viable if Clb1p is overexpressed indicates that this specificity can be subverted by overexpression of a single Clb protein ( H aase and R eed 1999 ). (genetics.org)
  • A model is proposed in which the Mcm5-bob1 protein assumes a unique molecular conformation without prior action by either kinase. (genetics.org)
  • Bartkiewicz M, Houghton A, Baron R. Leucine zipper-mediated homodimerization of the adaptor protein c-Cbl. (labome.org)
  • The figure depicts only the CMGC branch of a larger tree constructed (by J. Packer, Abbott Laboratories) from a Hidden Markov Model-derived alignment of all protein kinases in the P. falciparum genome. (asmscience.org)