A protein kinase encoded by the Saccharomyces cerevisiae CDC28 gene and required for progression from the G1 PHASE to the S PHASE in the CELL CYCLE.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
An serine-threonine protein kinase that requires the presence of physiological concentrations of CALCIUM and membrane PHOSPHOLIPIDS. The additional presence of DIACYLGLYCEROLS markedly increases its sensitivity to both calcium and phospholipids. The sensitivity of the enzyme can also be increased by PHORBOL ESTERS and it is believed that protein kinase C is the receptor protein of tumor-promoting phorbol esters.
A family of enzymes that catalyze the conversion of ATP and a protein to ADP and a phosphoprotein.
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
A group of enzymes that are dependent on CYCLIC AMP and catalyze the phosphorylation of SERINE or THREONINE residues on proteins. Included under this category are two cyclic-AMP-dependent protein kinase subtypes, each of which is defined by its subunit composition.
A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.
Phosphoprotein with protein kinase activity that functions in the G2/M phase transition of the CELL CYCLE. It is the catalytic subunit of the MATURATION-PROMOTING FACTOR and complexes with both CYCLIN A and CYCLIN B in mammalian cells. The maximal activity of cyclin-dependent kinase 1 is achieved when it is fully dephosphorylated.
A CALMODULIN-dependent enzyme that catalyzes the phosphorylation of proteins. This enzyme is also sometimes dependent on CALCIUM. A wide range of proteins can act as acceptor, including VIMENTIN; SYNAPSINS; GLYCOGEN SYNTHASE; MYOSIN LIGHT CHAINS; and the MICROTUBULE-ASSOCIATED PROTEINS. (From Enzyme Nomenclature, 1992, p277)
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
A superfamily of PROTEIN-SERINE-THREONINE KINASES that are activated by diverse stimuli via protein kinase cascades. They are the final components of the cascades, activated by phosphorylation by MITOGEN-ACTIVATED PROTEIN KINASE KINASES, which in turn are activated by mitogen-activated protein kinase kinase kinases (MAP KINASE KINASE KINASES).
Agents that inhibit PROTEIN KINASES.
An intracellular signaling system involving the MAP kinase cascades (three-membered protein kinase cascades). Various upstream activators, which act in response to extracellular stimuli, trigger the cascades by activating the first member of a cascade, MAP KINASE KINASE KINASES; (MAPKKKs). Activated MAPKKKs phosphorylate MITOGEN-ACTIVATED PROTEIN KINASE KINASES which in turn phosphorylate the MITOGEN-ACTIVATED PROTEIN KINASES; (MAPKs). The MAPKs then act on various downstream targets to affect gene expression. In mammals, there are several distinct MAP kinase pathways including the ERK (extracellular signal-regulated kinase) pathway, the SAPK/JNK (stress-activated protein kinase/c-jun kinase) pathway, and the p38 kinase pathway. There is some sharing of components among the pathways depending on which stimulus originates activation of the cascade.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Phosphotransferases that catalyzes the conversion of 1-phosphatidylinositol to 1-phosphatidylinositol 3-phosphate. Many members of this enzyme class are involved in RECEPTOR MEDIATED SIGNAL TRANSDUCTION and regulation of vesicular transport with the cell. Phosphatidylinositol 3-Kinases have been classified both according to their substrate specificity and their mode of action within the cell.
A mitogen-activated protein kinase subfamily that regulates a variety of cellular processes including CELL GROWTH PROCESSES; CELL DIFFERENTIATION; APOPTOSIS; and cellular responses to INFLAMMATION. The P38 MAP kinases are regulated by CYTOKINE RECEPTORS and can be activated in response to bacterial pathogens.
A subclass of dual specificity phosphatases that play a role in the progression of the CELL CYCLE. They dephosphorylate and activate CYCLIN-DEPENDENT KINASES.
Proteins found in any species of fungus.
A member of the Rho family of MONOMERIC GTP-BINDING PROTEINS. It is associated with a diverse array of cellular functions including cytoskeletal changes, filopodia formation and transport through the GOLGI APPARATUS. This enzyme was formerly listed as EC 3.6.1.47.
Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A proline-directed serine/threonine protein kinase which mediates signal transduction from the cell surface to the nucleus. Activation of the enzyme by phosphorylation leads to its translocation into the nucleus where it acts upon specific transcription factors. p40 MAPK and p41 MAPK are isoforms.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
A serine-threonine protein kinase family whose members are components in protein kinase cascades activated by diverse stimuli. These MAPK kinases phosphorylate MITOGEN-ACTIVATED PROTEIN KINASES and are themselves phosphorylated by MAP KINASE KINASE KINASES. JNK kinases (also known as SAPK kinases) are a subfamily.
A cytoplasmic serine threonine kinase involved in regulating CELL DIFFERENTIATION and CELLULAR PROLIFERATION. Overexpression of this enzyme has been shown to promote PHOSPHORYLATION of BCL-2 PROTO-ONCOGENE PROTEINS and chemoresistance in human acute leukemia cells.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in fungi.
A ubiquitously expressed protein kinase that is involved in a variety of cellular SIGNAL PATHWAYS. Its activity is regulated by a variety of signaling protein tyrosine kinase.
A 44-kDa extracellular signal-regulated MAP kinase that may play a role the initiation and regulation of MEIOSIS; MITOSIS; and postmitotic functions in differentiated cells. It phosphorylates a number of TRANSCRIPTION FACTORS; and MICROTUBULE-ASSOCIATED PROTEINS.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
A subgroup of mitogen-activated protein kinases that activate TRANSCRIPTION FACTOR AP-1 via the phosphorylation of C-JUN PROTEINS. They are components of intracellular signaling pathways that regulate CELL PROLIFERATION; APOPTOSIS; and CELL DIFFERENTIATION.
Intracellular signaling protein kinases that play a signaling role in the regulation of cellular energy metabolism. Their activity largely depends upon the concentration of cellular AMP which is increased under conditions of low energy or metabolic stress. AMP-activated protein kinases modify enzymes involved in LIPID METABOLISM, which in turn provide substrates needed to convert AMP into ATP.
Highly conserved proteins that specifically bind to and activate the anaphase-promoting complex-cyclosome, promoting ubiquitination and proteolysis of cell-cycle-regulatory proteins. Cdc20 is essential for anaphase-promoting complex activity, initiation of anaphase, and cyclin proteolysis during mitosis.
Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.
The rate dynamics in chemical or physical systems.
A protein kinase C subtype that was originally characterized as a CALCIUM-independent, serine-threonine kinase that is activated by PHORBOL ESTERS and DIACYLGLYCEROLS. It is targeted to specific cellular compartments in response to extracellular signals that activate G-PROTEIN-COUPLED RECEPTORS; TYROSINE KINASE RECEPTORS; and intracellular protein tyrosine kinase.
Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.
PKC beta encodes two proteins (PKCB1 and PKCBII) generated by alternative splicing of C-terminal exons. It is widely distributed with wide-ranging roles in processes such as B-cell receptor regulation, oxidative stress-induced apoptosis, androgen receptor-dependent transcriptional regulation, insulin signaling, and endothelial cell proliferation.
A PROTEIN-TYROSINE KINASE family that was originally identified by homology to the Rous sarcoma virus ONCOGENE PROTEIN PP60(V-SRC). They interact with a variety of cell-surface receptors and participate in intracellular signal transduction pathways. Oncogenic forms of src-family kinases can occur through altered regulation or expression of the endogenous protein and by virally encoded src (v-src) genes.
Protein kinases that catalyze the PHOSPHORYLATION of TYROSINE residues in proteins with ATP or other nucleotides as phosphate donors.
A phorbol ester found in CROTON OIL with very effective tumor promoting activity. It stimulates the synthesis of both DNA and RNA.
A group of cyclic GMP-dependent enzymes that catalyze the phosphorylation of SERINE or THREONINE residues of proteins.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
An adenine nucleotide containing one phosphate group which is esterified to both the 3'- and 5'-positions of the sugar moiety. It is a second messenger and a key intracellular regulator, functioning as a mediator of activity for a number of hormones, including epinephrine, glucagon, and ACTH.
Established cell cultures that have the potential to propagate indefinitely.
Mitogen-activated protein kinase kinase kinases (MAPKKKs) are serine-threonine protein kinases that initiate protein kinase signaling cascades. They phosphorylate MITOGEN-ACTIVATED PROTEIN KINASE KINASES; (MAPKKs) which in turn phosphorylate MITOGEN-ACTIVATED PROTEIN KINASES; (MAPKs).
A ubiquitous casein kinase that is comprised of two distinct catalytic subunits and dimeric regulatory subunit. Casein kinase II has been shown to phosphorylate a large number of substrates, many of which are proteins involved in the regulation of gene expression.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
A family of serine-threonine kinases that bind to and are activated by MONOMERIC GTP-BINDING PROTEINS such as RAC GTP-BINDING PROTEINS and CDC42 GTP-BINDING PROTEIN. They are intracellular signaling kinases that play a role the regulation of cytoskeletal organization.
A multifunctional calcium-calmodulin-dependent protein kinase subtype that occurs as an oligomeric protein comprised of twelve subunits. It differs from other enzyme subtypes in that it lacks a phosphorylatable activation domain that can respond to CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE KINASE.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Proteins prepared by recombinant DNA technology.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
Protein kinases that control cell cycle progression in all eukaryotes and require physical association with CYCLINS to achieve full enzymatic activity. Cyclin-dependent kinases are regulated by phosphorylation and dephosphorylation events.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
A non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE. It is involved in the biosynthesis of PURINES; PYRIMIDINES; and other amino acids.
A dsRNA-activated cAMP-independent protein serine/threonine kinase that is induced by interferon. In the presence of dsRNA and ATP, the kinase autophosphorylates on several serine and threonine residues. The phosphorylated enzyme catalyzes the phosphorylation of the alpha subunit of EUKARYOTIC INITIATION FACTOR-2, leading to the inhibition of protein synthesis.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
A family of cell cycle-dependent kinases that are related in structure to CDC28 PROTEIN KINASE; S CEREVISIAE; and the CDC2 PROTEIN KINASE found in mammalian species.
The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Proteins and peptides that are involved in SIGNAL TRANSDUCTION within the cell. Included here are peptides and proteins that regulate the activity of TRANSCRIPTION FACTORS and cellular processes in response to signals from CELL SURFACE RECEPTORS. Intracellular signaling peptide and proteins may be part of an enzymatic signaling cascade or act through binding to and modifying the action of other signaling factors.
An abundant 43-kDa mitogen-activated protein kinase kinase subtype with specificity for MITOGEN-ACTIVATED PROTEIN KINASE 1 and MITOGEN-ACTIVATED PROTEIN KINASE 3.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.
Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.
A mitogen-activated protein kinase subfamily that is widely expressed and plays a role in regulation of MEIOSIS; MITOSIS; and post mitotic functions in differentiated cells. The extracellular signal regulated MAP kinases are regulated by a broad variety of CELL SURFACE RECEPTORS and can be activated by certain CARCINOGENS.
A family of protein serine/threonine kinases which act as intracellular signalling intermediates. Ribosomal protein S6 kinases are activated through phosphorylation in response to a variety of HORMONES and INTERCELLULAR SIGNALING PEPTIDES AND PROTEINS. Phosphorylation of RIBOSOMAL PROTEIN S6 by enzymes in this class results in increased expression of 5' top MRNAs. Although specific for RIBOSOMAL PROTEIN S6 members of this class of kinases can act on a number of substrates within the cell. The immunosuppressant SIROLIMUS inhibits the activation of ribosomal protein S6 kinases.
A group of protein-serine-threonine kinases that was originally identified as being responsible for the PHOSPHORYLATION of CASEINS. They are ubiquitous enzymes that have a preference for acidic proteins. Casein kinases play a role in SIGNAL TRANSDUCTION by phosphorylating a variety of regulatory cytoplasmic and regulatory nuclear proteins.
Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.
A protein-serine-threonine kinase that is activated by PHOSPHORYLATION in response to GROWTH FACTORS or INSULIN. It plays a major role in cell metabolism, growth, and survival as a core component of SIGNAL TRANSDUCTION. Three isoforms have been described in mammalian cells.
Transport proteins that carry specific substances in the blood or across cell membranes.
A type of CELL NUCLEUS division by means of which the two daughter nuclei normally receive identical complements of the number of CHROMOSOMES of the somatic cells of the species.
A mitogen-activated protein kinase kinase with specificity for JNK MITOGEN-ACTIVATED PROTEIN KINASES; P38 MITOGEN-ACTIVATED PROTEIN KINASES and the RETINOID X RECEPTORS. It takes part in a SIGNAL TRANSDUCTION pathway that is activated in response to cellular stress.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
A group of enzymes that transfers a phosphate group onto an alcohol group acceptor. EC 2.7.1.
A group of enzymes removing the SERINE- or THREONINE-bound phosphate groups from a wide range of phosphoproteins, including a number of enzymes which have been phosphorylated under the action of a kinase. (Enzyme Nomenclature, 1992)
A phorbol ester found in CROTON OIL which, in addition to being a potent skin tumor promoter, is also an effective activator of calcium-activated, phospholipid-dependent protein kinase (protein kinase C). Due to its activation of this enzyme, phorbol 12,13-dibutyrate profoundly affects many different biological systems.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
An indolocarbazole that is a potent PROTEIN KINASE C inhibitor which enhances cAMP-mediated responses in human neuroblastoma cells. (Biochem Biophys Res Commun 1995;214(3):1114-20)
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.
A genus of ascomycetous fungi of the family Schizosaccharomycetaceae, order Schizosaccharomycetales.
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
A group of compounds with the heterocyclic ring structure of benzo(c)pyridine. The ring structure is characteristic of the group of opium alkaloids such as papaverine. (From Stedman, 25th ed)
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
A specific protein kinase C inhibitor, which inhibits superoxide release from human neutrophils (PMN) stimulated with phorbol myristate acetate or synthetic diacylglycerol.
Tumor-promoting compounds obtained from CROTON OIL (Croton tiglium). Some of these are used in cell biological experiments as activators of protein kinase C.
An essential amino acid occurring naturally in the L-form, which is the active form. It is found in eggs, milk, gelatin, and other proteins.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Elements of limited time intervals, contributing to particular results or situations.
Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.
Benzopyrroles with the nitrogen at the number one carbon adjacent to the benzyl portion, in contrast to ISOINDOLES which have the nitrogen away from the six-membered ring.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
A glycogen synthase kinase that was originally described as a key enzyme involved in glycogen metabolism. It regulates a diverse array of functions such as CELL DIVISION, microtubule function and APOPTOSIS.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
A transferase that catalyzes formation of PHOSPHOCREATINE from ATP + CREATINE. The reaction stores ATP energy as phosphocreatine. Three cytoplasmic ISOENZYMES have been identified in human tissues: the MM type from SKELETAL MUSCLE, the MB type from myocardial tissue and the BB type from nervous tissue as well as a mitochondrial isoenzyme. Macro-creatine kinase refers to creatine kinase complexed with other serum proteins.
A serine-threonine protein kinase that, when activated by DNA, phosphorylates several DNA-binding protein substrates including the TUMOR SUPPRESSOR PROTEIN P53 and a variety of TRANSCRIPTION FACTORS.
Structures within the nucleus of fungal cells consisting of or containing DNA, which carry genetic information essential to the cell.
Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.
A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.
ATP:pyruvate 2-O-phosphotransferase. A phosphotransferase that catalyzes reversibly the phosphorylation of pyruvate to phosphoenolpyruvate in the presence of ATP. It has four isozymes (L, R, M1, and M2). Deficiency of the enzyme results in hemolytic anemia. EC 2.7.1.40.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
A member of the Rho family of MONOMERIC GTP-BINDING PROTEINS from SACCHAROMYCES CEREVISIAE. It is involved in morphological events related to the cell cycle. This enzyme was formerly listed as EC 3.6.1.47.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
Highly conserved protein-serine threonine kinases that phosphorylate and activate a group of AGC protein kinases, especially in response to the production of the SECOND MESSENGERS, phosphatidylinositol 3,4,-biphosphate (PtdIns(3,4)P2) and phosphatidylinositol 3,4,5-triphosphate (PtdIns(3,4,5)P3).
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
A cyclic AMP-dependent protein kinase subtype primarily found in particulate subcellular fractions. They are tetrameric proteins that contain two catalytic subunits and two type II-specific regulatory subunits.
The complete gene complement contained in a set of chromosomes in a fungus.
A group of phenyl benzopyrans named for having structures like FLAVONES.
The relationship between the dose of an administered drug and the response of the organism to the drug.
An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.
A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement.
The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.
A class of cellular receptors that have an intrinsic PROTEIN-TYROSINE KINASE activity.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
A group of intracellular-signaling serine threonine kinases that bind to RHO GTP-BINDING PROTEINS. They were originally found to mediate the effects of rhoA GTP-BINDING PROTEIN on the formation of STRESS FIBERS and FOCAL ADHESIONS. Rho-associated kinases have specificity for a variety of substrates including MYOSIN-LIGHT-CHAIN PHOSPHATASE and LIM KINASES.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Intracellular fluid from the cytoplasm after removal of ORGANELLES and other insoluble cytoplasmic components.
A cell line derived from cultured tumor cells.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
The phosphoric acid ester of serine.
An enzyme that catalyzes the conversion of phosphatidylinositol (PHOSPHATIDYLINOSITOLS) to phosphatidylinositol 4-phosphate, the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate.
The sum of the weight of all the atoms in a molecule.
Derivatives of the steroid androstane having two double bonds at any site in any of the rings.
Cell lines whose original growing procedure consisted being transferred (T) every 3 days and plated at 300,000 cells per plate (J Cell Biol 17:299-313, 1963). Lines have been developed using several different strains of mice. Tissues are usually fibroblasts derived from mouse embryos but other types and sources have been developed as well. The 3T3 lines are valuable in vitro host systems for oncogenic virus transformation studies, since 3T3 cells possess a high sensitivity to CONTACT INHIBITION.
Proteins obtained from the species Schizosaccharomyces pombe. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
A c-jun amino-terminal kinase that is activated by environmental stress and pro-inflammatory cytokines. Several isoforms of the protein with molecular sizes of 43 and 48 KD exist due to multiple ALTERNATIVE SPLICING.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
A genus of ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES.
Organic nitrogenous bases. Many alkaloids of medical importance occur in the animal and vegetable kingdoms, and some have been synthesized. (Grant & Hackh's Chemical Dictionary, 5th ed)
Mutation process that restores the wild-type PHENOTYPE in an organism possessing a mutationally altered GENOTYPE. The second "suppressor" mutation may be on a different gene, on the same gene but located at a distance from the site of the primary mutation, or in extrachromosomal genes (EXTRACHROMOSOMAL INHERITANCE).
A family of highly conserved serine-threonine kinases that are involved in the regulation of MITOSIS. They are involved in many aspects of cell division, including centrosome duplication, SPINDLE APPARATUS formation, chromosome alignment, attachment to the spindle, checkpoint activation, and CYTOKINESIS.
A protein serine-threonine kinase that catalyzes the PHOSPHORYLATION of I KAPPA B PROTEINS. This enzyme also activates the transcription factor NF-KAPPA B and is composed of alpha and beta catalytic subunits, which are protein kinases and gamma, a regulatory subunit.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
Systems of enzymes which function sequentially by catalyzing consecutive reactions linked by common metabolic intermediates. They may involve simply a transfer of water molecules or hydrogen atoms and may be associated with large supramolecular structures such as MITOCHONDRIA or RIBOSOMES.
A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.
A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymes
The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.
An enzyme that catalyzes the conversion of ATP and thymidine to ADP and thymidine 5'-phosphate. Deoxyuridine can also act as an acceptor and dGTP as a donor. (From Enzyme Nomenclature, 1992) EC 2.7.1.21.
Benzo-indoles similar to CARBOLINES which are pyrido-indoles. In plants, carbazoles are derived from indole and form some of the INDOLE ALKALOIDS.
A family of ribosomal protein S6 kinases that are structurally distinguished from RIBOSOMAL PROTEIN S6 KINASES, 70-KDA by their apparent molecular size and the fact they contain two functional kinase domains. Although considered RIBOSOMAL PROTEIN S6 KINASES, members of this family are activated via the MAP KINASE SIGNALING SYSTEM and have been shown to act on a diverse array of substrates that are involved in cellular regulation such as RIBOSOMAL PROTEIN S6 and CAMP RESPONSE ELEMENT-BINDING PROTEIN.
Compounds with a six membered aromatic ring containing NITROGEN. The saturated version is PIPERIDINES.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Any of various enzymatically catalyzed post-translational modifications of PEPTIDES or PROTEINS in the cell of origin. These modifications include carboxylation; HYDROXYLATION; ACETYLATION; PHOSPHORYLATION; METHYLATION; GLYCOSYLATION; ubiquitination; oxidation; proteolysis; and crosslinking and result in changes in molecular weight and electrophoretic motility.
A 195-kDa MAP kinase kinase kinase with broad specificity for MAP KINASE KINASES. It is found localized in the CYTOSKELETON and can activate a variety of MAP kinase-dependent pathways.
Analysis of PEPTIDES that are generated from the digestion or fragmentation of a protein or mixture of PROTEINS, by ELECTROPHORESIS; CHROMATOGRAPHY; or MASS SPECTROMETRY. The resulting peptide fingerprints are analyzed for a variety of purposes including the identification of the proteins in a sample, GENETIC POLYMORPHISMS, patterns of gene expression, and patterns diagnostic for diseases.
Screening techniques first developed in yeast to identify genes encoding interacting proteins. Variations are used to evaluate interplay between proteins and other molecules. Two-hybrid techniques refer to analysis for protein-protein interactions, one-hybrid for DNA-protein interactions, three-hybrid interactions for RNA-protein interactions or ligand-based interactions. Reverse n-hybrid techniques refer to analysis for mutations or other small molecules that dissociate known interactions.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A 44 kDa mitogen-activated protein kinase kinase with specificity for MITOGEN-ACTIVATED PROTEIN KINASE 1 and MITOGEN-ACTIVATED PROTEIN KINASE 3.
An enzyme of the transferase class that uses ATP to catalyze the phosphorylation of diacylglycerol to a phosphatidate. EC 2.7.1.107.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Compounds containing 1,3-diazole, a five membered aromatic ring containing two nitrogen atoms separated by one of the carbons. Chemically reduced ones include IMIDAZOLINES and IMIDAZOLIDINES. Distinguish from 1,2-diazole (PYRAZOLES).
An enzyme that phosphorylates myosin light chains in the presence of ATP to yield myosin-light chain phosphate and ADP, and requires calcium and CALMODULIN. The 20-kDa light chain is phosphorylated more rapidly than any other acceptor, but light chains from other myosins and myosin itself can act as acceptors. The enzyme plays a central role in the regulation of smooth muscle contraction.
A type of CELL NUCLEUS division, occurring during maturation of the GERM CELLS. Two successive cell nucleus divisions following a single chromosome duplication (S PHASE) result in daughter cells with half the number of CHROMOSOMES as the parent cells.
Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.
A cyclin subtype that is transported into the CELL NUCLEUS at the end of the G2 PHASE. It stimulates the G2/M phase transition by activating CDC2 PROTEIN KINASE.
A family of calcium/calmodulin-dependent PROETIN-SERINE-THREONINE KINASES. They are ubiquitously expressed in adult and embryonic mammalian tissues, and their functions are tightly related to the early stages of eukaryotic programmed cell death.
The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.
Components of a cell produced by various separation techniques which, though they disrupt the delicate anatomy of a cell, preserve the structure and physiology of its functioning constituents for biochemical and ultrastructural analysis. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p163)
A cyclic GMP-dependent protein kinase subtype that is expressed in SMOOTH MUSCLE tissues and plays a role in regulation of smooth muscle contraction. Two isoforms, PKGIalpha and PKGIbeta, of the type I protein kinase exist due to alternative splicing of its mRNA.
Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)
Compounds of four rings containing a nitrogen. They are biosynthesized from reticuline via rearrangement of scoulerine. They are similar to BENZYLISOQUINOLINES. Members include chelerythrine and sanguinarine.
A heat-stable, low-molecular-weight activator protein found mainly in the brain and heart. The binding of calcium ions to this protein allows this protein to bind to cyclic nucleotide phosphodiesterases and to adenyl cyclase with subsequent activation. Thereby this protein modulates cyclic AMP and cyclic GMP levels.
A regulatory calcium-calmodulin-dependent protein kinase that specifically phosphorylates CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE TYPE 1; CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE TYPE 2; CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE TYPE 4; and PROTEIN KINASE B. It is a monomeric enzyme that is encoded by at least two different genes.
Genes that have a suppressor allele or suppressor mutation (SUPPRESSION, GENETIC) which cancels the effect of a previous mutation, enabling the wild-type phenotype to be maintained or partially restored. For example, amber suppressors cancel the effect of an AMBER NONSENSE MUTATION.
A non-receptor protein tyrosine kinase that is localized to FOCAL ADHESIONS and is a central component of integrin-mediated SIGNAL TRANSDUCTION PATHWAYS. Focal adhesion kinase 1 interacts with PAXILLIN and undergoes PHOSPHORYLATION in response to adhesion of cell surface integrins to the EXTRACELLULAR MATRIX. Phosphorylated p125FAK protein binds to a variety of SH2 DOMAIN and SH3 DOMAIN containing proteins and helps regulate CELL ADHESION and CELL MIGRATION.
A eukayrotic protein serine-threonine phosphatase subtype that dephosphorylates a wide variety of cellular proteins. The enzyme is comprised of a catalytic subunit and regulatory subunit. Several isoforms of the protein phosphatase catalytic subunit exist due to the presence of multiple genes and the alternative splicing of their mRNAs. A large number of proteins have been shown to act as regulatory subunits for this enzyme. Many of the regulatory subunits have additional cellular functions.
The process by which a DNA molecule is duplicated.
The phosphoric acid ester of threonine. Used as an identifier in the analysis of peptides, proteins, and enzymes.
A mitogen-activated protein kinase kinase with specificity for P38 MITOGEN-ACTIVATED PROTEIN KINASES.
A large family of regulatory proteins that function as accessory subunits to a variety of CYCLIN-DEPENDENT KINASES. They generally function as ENZYME ACTIVATORS that drive the CELL CYCLE through transitions between phases. A subset of cyclins may also function as transcriptional regulators.
A structurally-diverse family of intracellular-signaling adaptor proteins that selectively tether specific protein kinase A subtypes to distinct subcellular sites. They play a role in focusing the PROTEIN KINASE A activity toward relevant substrates. Over fifty members of this family exist, most of which bind specifically to regulatory subunits of CYCLIC AMP-DEPENDENT PROTEIN KINASE TYPE II such as CAMP PROTEIN KINASE RIIALPHA or CAMP PROTEIN KINASE RIIBETA.
A mitogen-activated protein kinase kinase with specificity for a subset of P38 MITOGEN-ACTIVATED PROTEIN KINASES that includes MITOGEN-ACTIVATED PROTEIN KINASE 12; MITOGEN-ACTIVATED PROTEIN KINASE 13; and MITOGEN-ACTIVATED PROTEIN KINASE 14.
Four carbon unsaturated hydrocarbons containing two double bonds.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
A serine threonine kinase that controls a wide range of growth-related cellular processes. The protein is referred to as the target of RAPAMYCIN due to the discovery that SIROLIMUS (commonly known as rapamycin) forms an inhibitory complex with TACROLIMUS BINDING PROTEIN 1A that blocks the action of its enzymatic activity.

Inhibitory phosphorylation of the APC regulator Hct1 is controlled by the kinase Cdc28 and the phosphatase Cdc14. (1/285)

BACKGROUND: Exit from mitosis requires inactivation of mitotic cyclin-dependent kinases (CDKs). A key mechanism of CDK inactivation is ubiquitin-mediated cyclin proteolysis, which is triggered by the late mitotic activation of a ubiquitin ligase known as the anaphase-promoting complex (APC). Activation of the APC requires its association with substoichiometric activating subunits termed Cdc20 and Hct1 (also known as Cdh1). Here, we explore the molecular function and regulation of the APC regulatory subunit Hct1 in Saccharomyces cerevisiae. RESULTS: Recombinant Hct1 activated the cyclin-ubiquitin ligase activity of APC isolated from multiple cell cycle stages. APC isolated from cells arrested in G1, or in late mitosis due to the cdc14-1 mutation, was more responsive to Hct1 than APC isolated from other stages. We found that Hct1 was phosphorylated in vivo at multiple CDK consensus sites during cell cycle stages when activity of the cyclin-dependent kinase Cdc28 is high and APC activity is low. Purified Hct1 was phosphorylated in vitro at these sites by purified Cdc28-cyclin complexes, and phosphorylation abolished the ability of Hct1 to activate the APC in vitro. The phosphatase Cdc14, which is known to be required for APC activation in vivo, was able to reverse the effects of Cdc28 by catalyzing Hct1 dephosphorylation and activation. CONCLUSIONS: We conclude that Hct1 phosphorylation is a key regulatory mechanism in the control of cyclin destruction. Phosphorylation of Hct1 provides a mechanism by which Cdc28 blocks its own inactivation during S phase and early mitosis. Following anaphase, dephosphorylation of Hct1 by Cdc14 may help initiate cyclin destruction.  (+info)

NDD1, a high-dosage suppressor of cdc28-1N, is essential for expression of a subset of late-S-phase-specific genes in Saccharomyces cerevisiae. (2/285)

cdc28-1N mutants progress through the G1 and S phases normally at the restrictive temperature but fail to undergo nuclear division. We have isolated a gene, NDD1, which at a high dosage suppresses the nuclear-division defect of cdc28-1N. NDD1 (nuclear division defective) is an essential gene. Its expression during the cell cycle is tightly regulated such that NDD1 RNA is most abundant during the S phase. Cells lacking the NDD1 gene arrest with an elongated bud, a short mitotic spindle, 2N DNA content, and an undivided nucleus, suggesting that its function is required for some aspect of nuclear division. We show that overexpression of Ndd1 results in the upregulation of both CLB1 and CLB2 transcription, suggesting that the suppression of cdc28-1N by NDD1 may be due to an accumulation of these cyclins. Overproduction of Ndd1 also enhances the expression of SWI5, whose transcription, like that of CLB1 and CLB2, is activated in the late S phase. Ndd1 is essential for the expression of CLB1, CLB2, and SWI5, since none of these genes are transcribed in its absence. Both CLB2 expression and its upregulation by NDD1 are mediated by a 240-bp promoter sequence that contains four MCM1-binding sites. However, Ndd1 does not appear to be a component of any of the protein complexes assembled on this DNA fragment, as indicated by gel mobility shift assays. Instead, overexpression of NDD1 prevents the formation of one of the complexes whose appearance correlates with the termination of CLB2 expression in G1. The inability of GAL1 promoter-driven CLB2 to suppress the lethality of NDD1 null mutant suggests that, in addition to CLB1 and CLB2, NDD1 may also be required for the transcription of other genes whose functions are necessary for G2/M transition.  (+info)

Cyclin-dependent kinase and Cks/Suc1 interact with the proteasome in yeast to control proteolysis of M-phase targets. (3/285)

Cell cycle-specific proteolysis is critical for proper execution of mitosis in all eukaryotes. Ubiquitination and subsequent proteolysis of the mitotic regulators Clb2 and Pds1 depend on the cyclosome/APC and the 26S proteasome. We report here that components of the cell cycle machinery in yeast, specifically the cell cycle regulatory cyclin-dependent kinase Cdc28 and a conserved associated protein Cks1/Suc1, interact genetically, physically, and functionally with components of the 26S proteasome. A mutation in Cdc28 (cdc28-1N) that interferes with Cks1 binding, or inactivation of Cks1 itself, confers stabilization of Clb2, the principal mitotic B-type cyclin in budding yeast. Surprisingly, Clb2-ubiquitination in vivo and in vitro is not affected by mutations in cks1, indicating that Cks1 is not essential for cyclosome/APC activity. However, mutant Cks1 proteins no longer physically interact with the proteasome, suggesting that Cks1 is required for some aspect of proteasome function during M-phase-specific proteolysis. We further provide evidence that Cks1 function is required for degradation of the anaphase inhibitor Pds1. Stabilization of Pds1 is partially responsible for the metaphase arrest phenotype of cks1 mutants because deletion of PDS1 partially relieves the metaphase block in these mutants.  (+info)

Regulation of transcription at the Saccharomyces cerevisiae start transition by Stb1, a Swi6-binding protein. (4/285)

In Saccharomyces cerevisiae, gene expression in the late G(1) phase is activated by two transcription factors, SBF and MBF. SBF contains the Swi4 and Swi6 proteins and activates the transcription of G(1) cyclin genes, cell wall biosynthesis genes, and the HO gene. MBF is composed of Mbp1 and Swi6 and activates the transcription of genes required for DNA synthesis. Mbp1 and Swi4 are the DNA binding subunits for MBF and SBF, while the common subunit, Swi6, is presumed to play a regulatory role in both complexes. We show that Stb1, a protein first identified in a two-hybrid screen with the transcriptional repressor Sin3, binds Swi6 in vitro. The STB1 transcript was cell cycle periodic and peaked in late G(1) phase. In vivo accumulation of Stb1 phosphoforms was dependent on CLN1, CLN2, and CLN3, which encode G(1)-specific cyclins for the cyclin-dependent kinase Cdc28, and Stb1 was phosphorylated by Cln-Cdc28 kinases in vitro. Deletion of STB1 caused an exacerbated delay in G(1) progression and the onset of Start transcription in a cln3Delta strain. Our results suggest a role for STB1 in controlling the timing of Start transcription that is revealed in the absence of the G(1) regulator CLN3, and they implicate Stb1 as an in vivo target of G(1)-specific cyclin-dependent kinases.  (+info)

Phosphorylation-independent inhibition of Cdc28p by the tyrosine kinase Swe1p in the morphogenesis checkpoint. (5/285)

The morphogenesis checkpoint in budding yeast delays cell cycle progression in G(2) when the actin cytoskeleton is perturbed, providing time for cells to complete bud formation prior to mitosis. Checkpoint-induced G(2) arrest involves the inhibition of the master cell cycle regulatory cyclin-dependent kinase, Cdc28p, by the Wee1 family kinase Swe1p. Results of experiments using a nonphosphorylatable CDC28(Y19F) allele suggested that the checkpoint stimulated two inhibitory pathways, one that promoted phosphorylation at tyrosine 19 (Y19) and a poorly characterized second pathway that did not require Cdc28p Y19 phosphorylation. We present the results from a genetic screen for checkpoint-defective mutants that led to the repeated isolation of the dominant CDC28(E12K) allele that is resistant to Swe1p-mediated inhibition. Comparison of this allele with the nonphosphorylatable CDC28(Y19F) allele suggested that Swe1p is still able to inhibit CDC28(Y19F) in a phosphorylation-independent manner and that both the Y19 phosphorylation-dependent and -independent checkpoint pathways in fact reflect Swe1p inhibition of Cdc28p. Remarkably, we found that a Swe1p mutant lacking catalytic activity could significantly delay the cell cycle in vivo during a physiological checkpoint response, even when expressed at single copy. The finding that a Wee1 family kinase expressed at physiological levels can inhibit a nonphosphorylatable cyclin-dependent kinase has broad implications for many checkpoint studies using such mutants in other organisms.  (+info)

A role for the Cdc7 kinase regulatory subunit Dbf4p in the formation of initiation-competent origins of replication. (6/285)

Using a reconstituted DNA replication assay from yeast, we demonstrate that two kinase complexes are essential for the promotion of replication in vitro. An active Clb/Cdc28 kinase complex, or its vertebrate equivalent, is required in trans to stimulate initiation in G(1)-phase nuclei, whereas the Dbf4/Cdc7 kinase complex must be provided by the template nuclei themselves. The regulatory subunit of Cdc7p, Dbf4p, accumulates during late G(1) phase, becomes chromatin associated prior to Clb/Cdc28 activation, and assumes a punctate pattern of localization that is similar to, and dependent on, the origin recognition complex (ORC). The association of Dbf4p with a detergent-insoluble chromatin fraction in G(1)-phase nuclei requires ORC but not Cdc6p or Clb/Cdc28 kinase activity, and correlates with competence for initiation. We propose a model in which Dbf4p targets Cdc7p to the prereplication complex prior to the G(1)/S transition, by a pathway parallel to, but independent of, the Cdc6p-dependent recruitment of MCMs.  (+info)

The role of actin in spindle orientation changes during the Saccharomyces cerevisiae cell cycle. (7/285)

In the budding yeast Saccharomyces cerevisiae, the mitotic spindle must align along the mother-bud axis to accurately partition the sister chromatids into daughter cells. Previous studies showed that spindle orientation required both astral microtubules and the actin cytoskeleton. We now report that maintenance of correct spindle orientation does not depend on F-actin during G2/M phase of the cell cycle. Depolymerization of F-actin using Latrunculin-A did not perturb spindle orientation after this stage. Even an early step in spindle orientation, the migration of the spindle pole body (SPB), became actin-independent if it was delayed until late in the cell cycle. Early in the cell cycle, both SPB migration and spindle orientation were very sensitive to perturbation of F-actin. Selective disruption of actin cables using a conditional tropomyosin double-mutant also led to defects in spindle orientation, even though cortical actin patches were still polarized. This suggests that actin cables are important for either guiding astral microtubules into the bud or anchoring them in the bud. In addition, F-actin was required early in the cell cycle for the development of the actin-independent spindle orientation capability later in the cell cycle. Finally, neither SPB migration nor the switch from actin-dependent to actin-independent spindle behavior required B-type cyclins.  (+info)

Hsl7 localizes to a septin ring and serves as an adapter in a regulatory pathway that relieves tyrosine phosphorylation of Cdc28 protein kinase in Saccharomyces cerevisiae. (8/285)

Successful mitosis requires faithful DNA replication, spindle assembly, chromosome segregation, and cell division. In the budding yeast Saccharomyces cerevisiae, the G(2)-to-M transition requires activation of Clb-bound forms of the protein kinase, Cdc28. These complexes are held in an inactive state via phosphorylation of Tyr19 in the ATP-binding loop of Cdc28 by the Swe1 protein kinase. The HSL1 and HSL7 gene products act as negative regulators of Swe1. Hsl1 is a large (1,518-residue) protein kinase with an N-terminal catalytic domain and a very long C-terminal extension. Hsl1 localizes to the incipient site of cytokinesis in the bud neck in a septin-dependent manner; however, the function of Hsl7 was not previously known. Using both indirect immunofluorescence with anti-Hsl7 antibodies and a fusion of Hsl7 to green fluorescent protein, we found that Hsl7 also localizes to the bud neck, congruent with the septin ring that faces the daughter cell. Both Swe1 and a segment of the C terminus of Hsl1 (which has no sequence counterpart in two Hsl1-related protein kinases, Gin4 and Kcc4) were identified as gene products that interact with Hsl7 in a two-hybrid screen of a random S. cerevisiae cDNA library. Hsl7 plus Swe1 and Hsl7 plus Hsl1 can be coimmunoprecipitated from extracts of cells overexpressing these proteins, confirming that Hsl7 physically associates with both partners. Also consistent with the two-hybrid results, Hsl7 coimmunoprecipitates with full-length Hsl1 less efficiently than with a C-terminal fragment of Hsl1. Moreover, Hsl7 does not localize to the bud neck in an hsl1Delta mutant, whereas Hsl1 is localized normally in an hsl7Delta mutant. Phosphorylation and ubiquitinylation of Swe1, preludes to its destruction, are severely reduced in cells lacking either Hsl1 or Hsl7 (or both), as judged by an electrophoretic mobility shift assay. Collectively, these data suggest that formation of the septin rings provides sites for docking Hsl1, exposing its C terminus and thereby permitting recruitment of Hsl7. Hsl7, in turn, presents its cargo of bound Swe1, allowing phosphorylation by Hsl1. Thus, Hsl1 and Hsl7 promote proper timing of cell cycle progression by coupling septin ring assembly to alleviation of Swe1-dependent inhibition of Cdc28. Furthermore, like septins and Hsl1, homologs of Hsl7 are found in fission yeast, flies, worms, and humans, suggesting that its function in this control mechanism may be conserved in all eukaryotes.  (+info)

In this study, we used a functional-genomics approach to explore the biological basis of the complex phenotype caused by deletion of the multifunctional Pho85 Cdk. Pho85 function is mediated through 10 Pho85 cyclins or Pcls, but both the complexity of Pho85 function and the genetic redundancy of the cyclins have hampered efforts to use traditional genetic approaches to discover functions and substrates for individual Pcl-Pho85 complexes (45). Using a combination of SGA analysis (64), expression profiling, and phenotypic tests, we have uncovered important roles for Pho85 in cell integrity and the response to adverse growth conditions. First, our work highlights a cell integrity function for the Pcl1,2 subfamily of Pho85 Cdks that is independent of the role of Pho80-Pho85 in the response to stress. Second, we uncovered a key function for Pho80-Pho85-mediated regulation of Pho4 in vacuolar function and stress response, in addition to its well-established role in phosphate regulation. The ...
Article Autophosphorylation-induced degradation of the Pho85 cyclin Pcl5 is essential for response to amino acid limitation. Pho85 cyclins (Pcls), activators of the yeast cyclin-dependent kinase (CDK) Pho85, belong together with the p35 activator of ...
Definition of cdc28 protein kinase, s cerevisiae in the Definitions.net dictionary. Meaning of cdc28 protein kinase, s cerevisiae. What does cdc28 protein kinase, s cerevisiae mean? Information and translations of cdc28 protein kinase, s cerevisiae in the most comprehensive dictionary definitions resource on the web.
In many cells the timing of entry into mitosis is controlled by the balance between the activity of inhibitory Wee1-related kinases (Swe1p in budding yeast) and the opposing effect of Cdc25-related phosphatases (Mih1p in budding yeast) that act on the cyclin-dependent kinase Cdc2 (Cdc28p in budding …
S cerevisiae NOP58 protein: involved in pre-rRNA processing, 18S rRNA synthesis, and snoRNA synthesis; a component of the small subunit processome complex
S cerevisiae Air1 protein: Air - arginine methyltransferase-interacting RING finger protein; inhibits methylation of Npl3 by Hmt1
Semantic Scholar is a free, AI-powered research tool for scientific literature, based at the Allen Institute for AI.. Learn More ...
cdna:novel chromosome:VEGA66:4:137321762:137357699:-1 gene:OTTMUSG00000009829 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:Cdc42 description:cell division cycle 42 homolog (S cerevisiae ...
Cyclin-Dependent Protein Kinase Inhibitor Set - Calbiochem The Cyclin-Dependent Protein Kinase Inhibitor Set controls the biological activity of Cyclin-Dependent Protein Kinase. This small molecule/inhibitor is primarily used for Phosphorylation & Dephosphorylation applications. - Find MSDS or SDS, a COA, data sheets and more information.
Four of the mutants examined (tpm1Δ, sac6Δ, pfy1-111, and myo2-66) displayed a clear reduction in viability when the morphogenesis checkpoint was crippled by elimination of Swe1p (Fig. 2 B). This strongly suggests that the actin perturbations caused by the mutants triggered the checkpoint response, as confirmed below.. Intriguingly, the degree of growth benefit provided by Swe1p varied depending on the growth temperature, in a mutant-specific manner. The difference between the growth of different mutants in combination with swe1Δ was most extreme at the temperatures shown in Fig. 2 B but was often reduced at other (7°C higher or lower) temperatures. In the most dramatic example, growth of myo2-66 swe1Δ cells was impaired relative to myo2-66 cells at 29°C, but not at 28°C (Fig. 2 B). This was unexpected because the strain grows slowly and has impaired actin organization at both temperatures. One problem in interpreting growth assays for very sick strains is the accumulation of suppressor ...
C8H6ClN Molecular formula, C8H6ClN Chemical compound C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 140-53-4, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - | 15013-71-5, C8H6ClN | - |
C9H9ClN2 Molecular formula, C9H9ClN2 Chemical compound C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 15861-35-5, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 405173-97-9, C9H9ClN2 | - | 39791-96-3, C9H9ClN2 | - | 39791-96-3
CDC25A is a member of the CDC25 family of phosphatases. CDC25A is required for progression from G1 to the S phase of the cell cycle. It activates the cyclin-dependent kinase CDC2 by removing two phosphate groups. CDC25A is specifically degraded in response to DNA damage, which prevents cells with chromosomal abnormalities from progressing through cell division. CDC25A is an oncogene, although its exact role in oncogenesis has not been demonstrated. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008 ...
Elastografia SWE wątroby - wybrane artykuły z piśmiennictwa naukowego poświęcone nowoczesnym metodom oceny włóknienia wątroby.| Elastograf.pl
Addgene NGS Result GTCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATAT GGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTG ACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGT ATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGT CAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAG TACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCA TCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGC GGGGGGGGGGGGGGGGCGCGGGGCGGGGCGGGGCGGGGCGGRGRGGGGCGGCGGCRGCCAATCAGAGCGG CGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGG CGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCC GGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTA GCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGC CCTTTGTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCT ...
EMMX proudly develops novel molecules and reagents to drug discovery and cancer research. We are scientists driven by a devotion to discovery and innovation, and we work hard every day to find new ways to streamline life science research.. ...
Principal Investigator:ANDO Shoji, Project Period (FY):1996 - 1997, Research Category:Grant-in-Aid for Scientific Research (C), Section:一般, Research Field:Bioorganic chemistry
No Worm CLN is a medicine available in a number of countries worldwide. A list of US medications equivalent to No Worm CLN is available on the Drugs.com website.
tl;dr version: why does S/Bayanus ferment sucrose to an apparent attenuation of more than 95% while S/Cerevisiae ferments it to an apparent attenuation of about 65-70%?. Details:. Ive been experimenting with sugar wash fermentations, using white table sugar (sucrose) and S/Cerevisiae yeast strains marketed as distilling yeast. Attenuation proceeded from an OG of 1,100-1.110 to an SG of around 1.030 (apparent attenuation about 65-70%).. This matches what Beersmith predicts, e.g. using 5kg dextrose in an 18 litre batch size with, say, US-05.. When I replace S/Cerevisia strains in Beersmith with Red Star Champagne yeast (S/Bayanus) my projected FG drops from 1.032-1.033 to about 1.003. Based on experience Im happy to accept that (although I havent tried it yet) but what I dont understand is why champagne yeast (S/Bayanus) ferments sucrose so much better. What Beersmith predicts confirms what I have heard from other home distillers who use champagne yeasts for sugar fermentations, so Im glad to ...
Gentaur molecular products has all kinds of products like :search , SibEm \ Sbf I \ E101 for more molecular products just contact us
TY - JOUR. T1 - Alterations in cyclin-dependent protein kinase 5 (CDK5) protein levels, activity and immunocytochemistry in canine motor neuron disease. AU - Green, Sherril L.. AU - Vulliet, Philip R. AU - Pinter, Martin J.. AU - Cork, Linda C.. PY - 1998/11. Y1 - 1998/11. N2 - Hereditary canine spinal muscular atrophy (HCSMA) is a dominantly inherited motor neuron disease in Brittany spaniels that is clinically characterized by progressive muscle weakness leading to paralysis. Histopathologically, degeneration is confined to motor neurons with accumulation of phosphorylated neurofilaments in axonal internodes. Cyclin- dependent kinase 5 (CDK5), a kinase related to the cell cycle kinase cdc2, phosphorylates neurofilaments and regulates neurofilament dynamics. We examined CDK5 activity, protein levels, and cellular immunoreactivity in nervous tissue from dogs with HCSMA, from closely age-matched controls and from dogs with other neurological diseases. On immunoblot analysis, CDK5 protein levels ...
Overexpression of mitotic cyclin CLB2 results in premature spindle elongation in swe1Δ mutants.A. Overexpression of CLB2 is toxic to swe1Δ mutants. WT and swe
I logged on to this site after following a link from CDC. I was curious about CD and considering a change from LL. After reading the ridiculous opinions of...
Are you looking to buy Ammonia printing service online in bulk? Find the best Ammonia printing service , Ammonia printing service manufacturer, supplier, Ammonia printing service exporter & wholesaler in India.
In contrast to the absence of any significant requirement for Clb3 proteolysis for mitotic exit, mitotic Clb3 proteolysis is required for control of Start. Start is conditional on cells attaining a sufficient cell size; it depends on Cln3 as an initial upstream signal, and on the Cln1,2-dependent positive feedback loop (Cross and Tinkelenberg 1991; Dirick and Nasmyth 1991; Cross 1995; Skotheim et al. 2008). Start is also specifically blocked by mating pheromones (Cross 1995). All of these controls are abrogated by removal of the Clb3 D box: CLB3∆db cells pass Start even when very small, as indicated by the absence of nuclear Whi5, and by accelerated budding and DNA replication, in a Cln3-independent fashion; CLB3∆db results in mating factor insensitivity, and eliminates the requirement for any of CLN1,2,3 CLB5,6. Rescue of CLN deficiency by cyclins has been previously reported, but has involved expression of the rescuing cyclins from a strong promoter such as ADH1 (Koff et al. 1991; Léopold ...
Supplementary Materialsijms-20-05987-s001. MMP-2 up-regulation, respectively. Finally, combined DEGs were validated in medical data including TCGA and immunohistochemistry from HPA database, demonstrating that up-regulation was related to CCA pathogenesis. This study is the 1st providing more information and molecular mechanisms about global transcriptome alterations and oncogenic enhancement of chronic alcohol exposure in normal cholangiocytes. 0.05) and ( 0.01), respectively. 2.2. RNA Extraction, Sequencing and Quantification RNA was isolated from un-treated and chronic 20 mM alcohol-treated cells for RNA sequencing analysis. Data acquisition that composed of obtaining natural read, read positioning, and quantification, was quality checked at each step. FastQC version 0.3 was used to calculate for quality checking and showed the low error rate of 0.1%. CP-640186 hydrochloride The percentage of mapped reads indicated high overall sequence accuracy and low DNA contamination. The RNA integrity ...
cyclin G associated kinase ENTREZID: 2580 | Type: NA | Map: 4p16.3 OMIM: 300335 Summary Entrez In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues.
The molecular networks regulating the G1CS transition in budding yeast and mammals are strikingly identical in network structure. fungi, specifically and (budding Aviptadil Acetate and fission fungus, respectively), to recognize genes with important functions attributed particularly to cell routine control or execution. These lines of study converged in the past due 1980s. Cyclins, 1st recognized in sea invertebrates, were discovered to regularly activate cyclin-dependent proteins kinases (Cdks), defined as central to cell routine regulation in candida displays. CdkCcyclin complexes and oscillation of Cdk kinase activity had been subsequently found to become at the primary of most eukaryotic cell routine control. Further function showed that additional cell routine regulators recognized in candida screens had been present and working in highly comparable ways in pet systems. Certainly, conservation of framework and function was regularly sufficient to permit for cross-kingdom hereditary ...
More than 70 mutations in the CLN6 gene have been found to cause CLN6 disease. This condition impairs motor and mental development, typically starting in early to late childhood, causing gradually worsening problems with movement and a decline in intellectual function. In some cases, signs and symptoms of CLN6 disease do not appear until adulthood.. Most CLN6 gene mutations result in the production of an abnormal CLN6 protein that is quickly broken down (degraded). As a result, there is a severe reduction in the amount of functional CLN6 protein in cells. While it is not known how the loss of this protein causes the signs and symptoms of CLN6 disease, it is likely that the proteins quick degradation contributes to the childhood onset of CLN6 disease.. In the cases in which CLN6 disease develops in adulthood, CLN6 gene mutations often change single protein building blocks (amino acids), resulting in a CLN6 protein with reduced function. Research suggests that these CLN6 gene mutations allow ...
多种适用的CDC25CELISA试剂盒,如人等。在antibodies-online.cn对比CDC25CELISA试剂盒,以便找到您需要的产品。
This is by far the craziest most uncertain time I have ever experienced in my lifetime and to make things worse the FACTS keep changing
Cardiomyocytes cease to divide shortly after birth and an irreversible cell cycle arrest is evident accompanied by the downregulation of cyclin-dependent kinase activities. To get a better understanding of the cardiac cell cycle and its regulation, the effect of functional recovery of the mitosis-promoting factor (MPF) consisting of cyclin B1 and the cyclin-dependent kinase Cdc2 was assessed in primary cultures of postmitotic ventricular adult rat cardiomyocytes ( ARC). Gene transfer into ARC was achieved using the adenovirus-enhanced transferrinfection system that was characterized by the absence of cytotoxic events. Simultaneous ectopic expression of wild-type versions of cyclin B1 and Cdc2 was sufficient to induce MPF activity. Reestablished MPF resulted in a mitotic phenotype, marked by an abnormal condensation of the nuclei, histone H3 phosphorylation and variable degree of decay of the contractile apparatus. Although a complete cell division was not observed, the results provided ...
Complete information for CLN3 gene (Protein Coding), CLN3, Battenin, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
多种适用的CDC25BELISA试剂盒,如人, 小鼠, 大鼠等。在antibodies-online.cn对比CDC25BELISA试剂盒,以便找到您需要的产品。
a class=explain href=http://www.cdc.gov/emailupdates/,What's this?,/a, ,label,,span class=tp-sr-only,Submit Button,/span, ,input class=button submit name=commit type=submit value=Submit /,,/label ...
Poznaj swe mapy przy grach internetowego, iz grasz. Uchwycenie teren jest niezwykle wazne zwyciestwo. Gdzie sa najlepsze miejsca, z jakiego sie ukryc oraz zasadzki przeciwników? Dokad wolno zrobic skróty do odwiedzenia daja lepsze sytuacje strategiczna? Ten typ madrosci przynosi wazna przewage strategiczna. Nie doceniac taktyke tlumienia plomienia bedac przez internet shooter. Jezeli grasz na zestawy, posiadajac poszczególnego zawodnika tylko zawierajace obszar z zywym ogniem jego koledzy z ekipy daje wielka okazje podkrasc sie do odwiedzenia nieprzyjaciela albo przynajmniej lepiej sytuacje strategiczna. Pracujac razem, w jaki sposób jest to naprawde byc moze podwyzszyc swe wygrane. Jezeli grasz przy rozrywki sportowe, natomiast nie masz jakiegokolwiek badz doswiadczenia z zanim, ustawic pulap klopoty dzieki debiutanta. To pomoze Tobie wyjsc na unikalnych cech zabawy oraz wyuczyc sie przemieszczac przy polu. Jesli zostanie zestawiona wyzej niz, iz jest prawdopodobne, by draznic oraz nie ...
Poznaj swe mapy przy grach internetowego, iz grasz. Uchwycenie teren jest niezwykle wazne zwyciestwo. Gdzie sa najlepsze miejsca, z jakiego sie ukryc oraz zasadzki przeciwników? Dokad wolno zrobic skróty do odwiedzenia daja lepsze sytuacje strategiczna? Ten typ madrosci przynosi wazna przewage strategiczna. Nie doceniac taktyke tlumienia plomienia bedac przez internet shooter. Jezeli grasz na zestawy, posiadajac poszczególnego zawodnika tylko zawierajace obszar z zywym ogniem jego koledzy z ekipy daje wielka okazje podkrasc sie do odwiedzenia nieprzyjaciela albo przynajmniej lepiej sytuacje strategiczna. Pracujac razem, w jaki sposób jest to naprawde byc moze podwyzszyc swe wygrane. Jezeli grasz przy rozrywki sportowe, natomiast nie masz jakiegokolwiek badz doswiadczenia z zanim, ustawic pulap klopoty dzieki debiutanta. To pomoze Tobie wyjsc na unikalnych cech zabawy oraz wyuczyc sie przemieszczac przy polu. Jesli zostanie zestawiona wyzej niz, iz jest prawdopodobne, by draznic oraz nie ...
... CDC28 protein kinase regulatory subunit 1B". Harper, J.W. 2001. Protein destruction: Adapting roles for Cks proteins. Cur ... "Human cDNAs encoding homologs of the small p34Cdc28/Cdc2-associated protein of Saccharomyces cerevisiae and Schizosaccharomyces ... Cyclin-dependent kinases regulatory subunit 1 is a protein that in humans is encoded by the CKS1B gene. The CKS1B protein binds ... 1996). "Crystal structure and mutational analysis of the human CDK2 kinase complex with cell cycle-regulatory protein CksHs1". ...
... cdc2 protein kinase MeSH D12.776.167.200.067.500 - cdc28 protein kinase, s cerevisiae MeSH D12.776.167.200.067.875 - cyclin- ... dependent kinase 5 MeSH D12.776.167.200.067.900 - cyclin-dependent kinase 9 MeSH D12.776.167.200.580.500 - cdc2 protein kinase ... RNA-binding protein EWS MeSH D12.776.624.664.700.250 - lymphocyte specific protein tyrosine kinase p56(lck) MeSH D12.776. ... wnt1 protein MeSH D12.776.624.664.700.978 - wnt2 protein MeSH D12.776.624.776.355.100 - cyclin-dependent kinase inhibitor p15 ...
... cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 ... The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene ... Cyclin-dependent kinase 4 also known as cell division protein kinase 4 is an enzyme that in humans is encoded by the CDK4 gene ... 1995). "Identification of human cyclin-dependent kinase 8, a putative protein kinase partner for cyclin C". Proc. Natl. Acad. ...
"Entrez Gene: CKS2 CDC28 protein kinase regulatory subunit 2". Human CKS2 genome location and CKS2 gene details page in the UCSC ... "Human cDNAs encoding homologs of the small p34Cdc28/Cdc2-associated protein of Saccharomyces cerevisiae and Schizosaccharomyces ... Cyclin-dependent kinases regulatory subunit 2 is a protein that in humans is encoded by the CKS2 gene. CKS2 protein binds to ... 2005). "A human protein-protein interaction network: a resource for annotating the proteome". Cell. 122 (6): 957-68. doi: ...
This protein kinase is highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, also known as Cdk1 in ... The protein encoded by this gene is a member of the cyclin-dependent kinase family of Ser/Thr protein kinases. ... Cyclin-dependent kinase 2, also known as cell division protein kinase 2, or Cdk2, is an enzyme that in humans is encoded by the ... Cheng A, Kaldis P, Solomon MJ (November 2000). "Dephosphorylation of human cyclin-dependent kinases by protein phosphatase type ...
Cell division protein kinase 3 is an enzyme that in humans is encoded by the CDK3 gene. CDK3 complements cdc28 mutants of ... Saccharomyces cerevisiae suggesting that it may be involved in cell cycle control. CDK3 can phosphorylate histone H1 and ... 1995). "Chromosomal mapping of members of the cdc2 family of protein kinases, cdk3, cdk6, PISSLRE, and PITALRE, and a cdk ... Meikrantz W, Schlegel R (1996). "Suppression of apoptosis by dominant negative mutants of cyclin-dependent protein kinases". J ...
More specifically, she demonstrated that CDC28 protein kinase is not required for the metaphase to anaphase transition and CLB2 ... The Amon lab primarily investigates yeast (Saccharomyces cerevisiae) as a model for understanding the controls that govern cell ... "Destruction of the CDC28/CLB mitotic kinase is not required for the metaphase to anaphase transition in budding yeast". The ... Amon's team demonstrated that CDC20 is the target protein in the spindle checkpoint during mitosis. Amon's more recent work has ...
CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe ... Cyclin-dependent kinase 7, or cell division protein kinase 7, is an enzyme that in humans is encoded by the CDK7 gene. The ... This protein forms a trimeric complex with cyclin H and MAT1, which functions as a Cdk-activating kinase (CAK). It is an ... protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. ...
... cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to ... Cell division protein kinase 10 is an enzyme that in humans is encoded by the CDK10 gene. The protein encoded by this gene ... Graña X, Claudio PP, De Luca A, Sang N, Giordano A (Jul 1994). "PISSLRE, a human novel CDC2-related protein kinase". Oncogene. ... "Entrez Gene: CDK10 cyclin-dependent kinase (CDC2-like) 10". Kasten M, Giordano A (Apr 2001). "Cdk10, a Cdc2-related kinase, ...
... cerevisiae homologue Swe1 In S. cerevisiae, cyclin-dependent kinase Cdc28 (Cdk1 homologue) is phosphorylated by Swe1 (Wee1 ... The corresponding proteins are Wee1-like protein kinase and Wee1-like protein kinase 2 which act on the human Cdk1 homologue ... Wee1-like protein kinase Cell cycle β-transducin repeat-containing protein 1/2 (β-TrCP1/2) F-box protein-containing SKP1/Cul1/F ... The S. cerevisiae protein Swe1 is also regulated by degradation. Swe1 is hyperphosphorylated by Clb2-Cdc28 and Cdc5 which may ...
... cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of ... Cyclin-dependent kinase 9 or CDK9 is a cyclin-dependent kinase associated with P-TEFb. The protein encoded by this gene is a ... HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein ... "Entrez Gene: CDK9 cyclin-dependent kinase 9 (CDC2-related kinase)". MacLachlan TK, Sang N, De Luca A, Puri PL, Levrero M, ...
CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe ... It is regulated by cyclins, more specifically by Cyclin D proteins and Cyclin-dependent kinase inhibitor proteins. The protein ... This kinase is a catalytic subunit of the protein kinase complex, important for the G1 phase progression and G1/S transition of ... CDK6 is a protein kinase activating cell proliferation, it is involved in an important point of restriction in the cell cycle. ...
... most notably CDC28, which encodes the yeast Cdk kinase. Other significant discoveries include introduction of the concept of ... He shared the 2001 Nobel Prize in Physiology or Medicine with Paul Nurse and Tim Hunt, for their discoveries of protein ... Saccharomyces cerevisiae). These genes regulate the cell cycle and mutations in the genes are involved in some types of cancer ... Working in yeast, Hartwell identified the fundamental role of checkpoints in cell cycle control, and CDC genes such as CDC28, ...
ISBN 978-0-19-920610-0. Nasmyth K (April 1993). "Control of the yeast cell cycle by the Cdc28 protein kinase". Curr. Opin. Cell ... Cdk1 activity is best understood in S. cerevisiae, so Cdk1 S. cerevisiae activity is described here. In the budding yeast, ... Cdk1 is comprised mostly by the bare protein kinase motif, which other protein kinases share. Cdk1, like other kinases, ... Cyclin-dependent kinase 1 also known as CDK1 or cell division cycle protein 2 homolog is a highly conserved protein that ...
Tyers M, Tokiwa G, Nash R, Futcher B (May 1992). "The Cln3-Cdc28 kinase complex of S. cerevisiae is regulated by proteolysis ... It is a 65 kD, unstable protein; like other cyclins, it functions by binding and activating cyclin-dependent kinase (CDK). Cln3 ... Cln/Cdc28 kinases activate bound transcription factor SBF (Swi4/Swi6) at start, whereas Clb/Cdc28 kinases displace it from the ... "Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae". The EMBO Journal. 14 (19 ...
... cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 ... protein kinase activity. • kinase activity. • protein serine/threonine kinase activity. • cyclin-dependent protein serine/ ... The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene ... Dephospho-(reductase kinase) kinase (EC 2.7.11.3). *AMP-activated protein kinase α *PRKAA1 ...
... cdc2 protein kinase MeSH D12.644.360.250.067.500 - cdc28 protein kinase, s cerevisiae MeSH D12.644.360.250.067.875 - cyclin- ... map kinase kinase kinase 1 MeSH D12.644.360.400.200 - map kinase kinase kinase 2 MeSH D12.644.360.400.300 - map kinase kinase ... kinase 3 MeSH D12.644.360.400.400 - map kinase kinase kinase 4 MeSH D12.644.360.400.500 - map kinase kinase kinase 5 MeSH ... mitogen-activated protein kinase kinases MeSH D12.644.360.440.100 - map kinase kinase 1 MeSH D12.644.360.440.200 - map kinase ...
... cdc2 protein kinase MeSH D08.811.913.696.620.682.700.200.067.500 - cdc28 protein kinase, s cerevisiae MeSH D08.811.913.696. ... map kinase kinase kinase 1 MeSH D08.811.913.696.620.682.700.559.200 - map kinase kinase kinase 2 MeSH D08.811.913.696.620.682. ... map kinase kinase kinase 3 MeSH D08.811.913.696.620.682.700.559.400 - map kinase kinase kinase 4 MeSH D08.811.913.696.620.682. ... mitogen-activated protein kinase kinases MeSH D08.811.913.696.620.682.700.565.100 - map kinase kinase 1 MeSH D08.811.913.696. ...
Furthermore, Cdc6 indirectly inhibits activation of the p34cdc2/CDC28 M phase kinase, thus nuclear division is suppressed. CDC6 ... From studies with E. coli γ clamp loading complex, it was suggested that domain III mediates protein-protein interactions with ... It is mainly studied in the budding yeast Saccharomyces cerevisiae (P09119). It is an essential regulator of DNA replication ... In addition, it is a member of the family of AAA+ ATPases and highly related to ORC1; both are the same protein in archaea. ...
In S. cerevisiae, the association of Cdc28 with cyclins, Cln1, Cln2, or Cln3, results in the transition from G1 phase to S ... is a protein complex formed by the association of an inactive catalytic subunit of a protein kinase, cyclin-dependent kinase ( ... Given that this region is so conserved across the protein superfamily of kinases, this mechanism where the αC-Helix has been ... Once in the S phase, Cln1 and Cln2 dissociates with Cdc28 and complexes between Cdc28 and Clb5 or Clb6 are formed. In G2 phase ...
... cdc2 protein kinase MeSH D12.776.476.250.067.500 - cdc28 protein kinase, s cerevisiae MeSH D12.776.476.250.067.875 - cyclin- ... dependent kinase 5 MeSH D12.776.476.250.067.900 - cyclin-dependent kinase 9 MeSH D12.776.476.250.580.500 - cdc2 protein kinase ... mitogen-activated protein kinase 1 MeSH D12.776.476.450.169.750 - mitogen-activated protein kinase 3 MeSH D12.776.476.450. ... 169.875 - mitogen-activated protein kinase 6 MeSH D12.776.476.450.169.937 - mitogen-activated protein kinase 7 MeSH D12.776. ...
Cell cycle-regulated phosphorylation of Orc2, Orc6, Cdc6, and MCM by the cyclin-dependent protein kinase Cdc28 regulates ... "Yeast two-hybrid analysis of the origin recognition complex of Saccharomyces cerevisiae: interaction between subunits and ... Cyclin dependant kinases (CDK) Cyclins DNA helicase DnaA Pre-replication complex Origin+Recognition+Complex at the US National ... Play media The following proteins are present in the ORC: Archaea feature a simplified version of the ORC, Mcm, and as a ...
Most knowledge of CDK structure and function is based on CDKs of S. pombe (Cdc2), S. cerevisiae (CDC28), and vertebrates (CDC2 ... A cyclin-dependent kinase inhibitor (CKI) is a protein that interacts with a cyclin-CDK complex to block kinase activity, ... Cyclin-dependent kinases (CDKs) are the families of protein kinases first discovered for their role in regulating the cell ... CDKs are relatively small proteins, with molecular weights ranging from 34 to 40 kDa, and contain little more than the kinase ...
This regulation is accomplished by the cyclin-dependent kinase Cdk1 (Cdc28 in yeast), which is turned off in G1 and expressed ... DeFazio LG, Stansel RM, Griffith JD, Chu G (June 2002). "Synapsis of DNA ends by DNA-dependent protein kinase". The EMBO ... Palmbos PL, Wu D, Daley JM, Wilson TE (December 2008). "Recruitment of Saccharomyces cerevisiae Dnl4-Lif1 complex to a double- ... "Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D ...
The stress-activated protein kinase (SAPK) Hog1 phosphorylates Sic1 at a single residue at the carboxyl terminus. This leads to ... In the G1 phase of the cell cycle, Sic1 binds tightly to the Cdc28-Clb complex and inhibits it. Low Cdc28-Clb activity leads to ... cerevisiae". Cell. 79 (2): 233-44. doi:10.1016/0092-8674(94)90193-7. PMID 7954792. S2CID 34939988. Morgan DO (1997). The Cell ... 2). Sic1 can also be phosphorylated by other kinases, such as Pho85-Pc11, a kinase which becomes essential when Cln1 and Cln2 ...
Saccharomyces cerevisiae yeast expressing dominant mutant alleles of CDC28 arrest in G1, which indicates that CDC28 is ... Cyclins are proteins that control progression through the cell cycle by activating cyclin-dependent kinases. Destruction of a ... The suspected mechanism is dependent on p27Kip1, a cyclin-dependent kinase inhibitor. p27Kip1 protein levels are elevated in ... Mendenhall MD, Richardson HE, Reed SI (June 1988). "Dominant negative protein kinase mutations that confer a G1 arrest ...
Erich A. Nigg (2005). "Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle". BioEssays. 17 (6): 471- ... Cdk1 is also known as Cdc2 in fission yeast and Cdc28 in budding yeast) is activated by Cdc25, a protein phosphatase. As ... the budding yeast Saccharomyces cerevisiae. Proteolytic degradation of cell cycle regulators and corresponding effects on the ... Many factors including cyclins, cyclin-dependent kinases (CDKs), ubiquitin ligases, inhibitors of cyclin-dependent kinases, and ...
In S. cerevisiae, nuclear export is promoted by cyclin-dependent kinase (CDK) activity. Mcm proteins that are associated with ... Binding of Cdc45 to chromatin depends on Clb-Cdc28 kinase activity as well as functional Cdc6 and Mcm2, which suggests that ... One kinase is the Cdc7-Dbf4 kinase called Dbf4-dependent kinase (DDK) and the other is cyclin-dependent kinase (CDK). Chromatin ... Eukaryotic checkpoint proteins are well conserved and involve two phosphatidylinositol 3-kinase-related kinases (PIKKs), ATR ...
Huang CY, Ferrell JE (Sep 1996). "Ultrasensitivity in the mitogen-activated protein kinase cascade". Proceedings of the ... cerevisiae like for instance unfolded protein response. In mammals, amongst others c-Myc, Src3, Cyclin E, and the Notch ... Cdc4 recruits several other substrates than Sic1 to the SCF core complex, including the Cln-Cdc28 inhibitor / cytoskeletal ... This results in proteins that differ only at their N-termini. Cdc4 protein interacts with Cdc34, an ubiquitin-conjugating ...
Erich A. Nigg (2005). "Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle". BioEssays. 17 (6): 471- ... However, experiments using budding yeast cells with cdc28-as1, an INM-PP1 (ATP analog)-sensitive Cdk allele, proved that ... the budding yeast Saccharomyces cerevisiae. Proteolytic degradation of cell cycle regulators and corresponding effects on the ... Many factors including cyclins, cyclin-dependent kinases (CDKs), ubiquitin ligases, inhibitors of cyclin-dependent kinases, and ...
Esta quinasa es muy similar a los productos génicos de S. cerevisiae cdc28, y S. pombe cdc2. Es una subunidad catalítica del ... de 2000). «p12(DOC-1) is a novel cyclin-dependent kinase 2-associated protein». Mol. Cell. Biol. (UNITED STATES) 20 (17): 6300- ... de 1993). «The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases». Cell (UNITED STATES) 75 ... de 2000). «Dephosphorylation of human cyclin-dependent kinases by protein phosphatase type 2C alpha and beta 2 isoforms». J. ...
Nguyen VQ, Co C, Li JJ (June 2001). "Cyclin-dependent kinases prevent DNA re-replication through multiple mechanisms". Nature ... interaction between subunits and identification of binding proteins". FEMS Yeast Res. 7 (8): 1263-9. PMID 17825065. doi:10.1111 ... e MCM pola proteína quinase dependente de ciclina Cdc28 regula a iniciación da replicación do ADN, incluíndo o bloqueo da ... "Yeast two-hybrid analysis of the origin recognition complex of Saccharomyces cerevisiae: ...
... cloned the CDC28 gene from the budding yeast Saccharomyces cerevisiae. As a group leader in Cambridge Nasmyth became interested ... Schwob, E; Böhm, T; Mendenhall, M. D.; Nasmyth, K (1994). "The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S ... Michaelis, C.; Ciosk, R.; Nasmyth, K. (3 October 1997). "Cohesins: chromosomal proteins that prevent premature separation of ... Together with Kelly Tatchell he cloned the S. cerevisiae mating-type locus and found, surprisingly, that 'silent' copies of the ...
... the cyclin-dependent kinase Cdc28 begins homologous recombination by phosphorylating the Sae2 protein. After being so activated ... "Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae". Microbiology and Molecular ... In one of the earliest steps, the stress-activated protein kinase, c-Jun N-terminal kinase (JNK), phosphorylates SIRT6 on ... Cyclin-dependent kinases (CDKs), which modify the activity of other proteins by adding phosphate groups to (that is, ...
The dual role of the Cdc28 protein kinase in the S. cerevisiae cell cycle thus parallels that demonstrated for the cdc2 protein ... Mitotic role for the Cdc28 protein kinase of Saccharomyces cerevisiae. Message Subject (Your Name) has sent you a message from ... Mitotic role for the Cdc28 protein kinase of Saccharomyces cerevisiae.. S I Reed and C Wittenberg ... The Cdc28 protein kinase functions in the G1 to S phase transition of the cell cycle of the budding yeast Saccharomyces ...
... Information and translations of cdc28 protein kinase, s cerevisiae in the ... s cerevisiae in the Definitions.net dictionary. Meaning of cdc28 protein kinase, s cerevisiae. ... What does cdc28 protein kinase, s cerevisiae mean?. Definitions for cdc28 protein kinase, s cerevisiae. Here are all the ... CDC28 Protein Kinase, S cerevisiae. A protein kinase encoded by the Saccharomyces cerevisiae CDC28 gene and required for ...
cyclin-dependent kinases regulatory subunit 2. Names. CDC28 protein kinase 2. CKS-2. CKS1(S. cerevisiae Cdc28/Cdc2 kinase ... CKS2 CDC28 protein kinase regulatory subunit 2 [Homo sapiens] CKS2 CDC28 protein kinase regulatory subunit 2 [Homo sapiens]. ... CDC28 protein kinase regulatory subunit 2provided by HGNC. Primary source. HGNC:HGNC:2000 See related. Ensembl:ENSG00000123975 ... CKS2 CDC28 protein kinase regulatory subunit 2 [ Homo sapiens (human) ] Gene ID: 1164, updated on 4-Mar-2018 ...
As all three serines are phosphorylated by purified CDC28-dependent H1 kinase activity in vitro, we propose a model in which ... The protein is nuclear in G1 cells but cytoplasmic in S, G2, and M phase cells. We have identified SWI5s nuclear localization ... the CDC28 kinase acts directly to control nuclear entry of SWI5. ... cell cycle-dependent nuclear entry to a heterologous protein. ... cerevisiae transcription factor SWI5 is cell cycle dependent. ... The role of phosphorylation and the CDC28 protein kinase in ...
Each phase of the cell division cycle is driven forward by cell-cycle kinases (Cdk) and coordinated with other phases of the ... IME2 protein, S cerevisiae * Protein-Serine-Threonine Kinases * CDC28 Protein Kinase, S cerevisiae ... Each phase of the cell division cycle is driven forward by cell-cycle kinases (Cdk) and coordinated with other phases of the ... Below, I describe the overlapping roles of Ime2p and Cdk during meiosis in yeast and speculate on how these two kinases ...
YBR160W CDC28; cyclin-dependent serine/threonine-protein kinase CDC28 YDL108W KIN28; TFIIH complex serine/threonine-protein ... YKL101W HSL1; protein kinase HSL1 YCL024W KCC4; serine/threonine protein kinase YDR507C GIN4; protein kinase GIN4 YDR409W SIZ1 ... YBL009W ALK2; protein kinase ALK2 YGL021W ALK1; protein kinase ALK1 YJL164C TPK1; cAMP-dependent protein kinase catalytic ... YPL209C IPL1; aurora kinase YMR311C GLC8; Glc8p YHL007C STE20; mitogen-activated protein kinase kinase kinase kinase STE20 ...
... the Cdk-activating kinase. We have purified and cloned CAK from S … ... Activation of the cyclin-dependent kinases to promote cell cycle progression requires their association with cyclins as well as ... Protein-Serine-Threonine Kinases * CDC2-CDC28 Kinases * CDC28 Protein Kinase, S cerevisiae ... A temperature-sensitive mutation in CAK1 confers a G2 delay accompanied by low Cdc28p protein kinase activity and shows genetic ...
Protein Aliases: CDC28 protein kinase 2; CKS-2; CKS1(S. cerevisiae Cdc28/Cdc2 kinase subunit) homolog-2; Cyclin-dependent ... protein binding protein kinase binding histone binding ubiquitin binding cyclin-dependent protein serine/threonine kinase ... CKS2 protein binds to the catalytic subunit of the cyclin dependent kinases and is essential for their biological function. The ... meiosis I regulation of mitotic cell cycle positive regulation of cyclin-dependent protein serine/threonine kinase activity ...
The KSS1 gene encodes an apparent protein kinase homologous to the CDC28 (S. cerevisiae) and cdc2+ (S. pombe) gene products. ... A putative protein kinase overcomes pheromone-induced arrest of cell cycling in S. cerevisiae.. Courchesne WE1, Kunisawa R, ... suggesting that the KSS1 and WHI1 proteins act in the same growth control pathway. ...
Hadwiger, J.A., and Reed, S.I. (1988). Invariant phosphorylation of the Saccharomyces cerevisiae Cdc28 protein kinase. Mol. ... In kinase assays from protein extracts of flower buds, the activity of VF was the same as that of the wild-type CDKA;1 (Figure ... Gonzalez, N., Gevaudant, F., Hernould, M., Chevalier, C., and Mouras, A. (2007). The cell cycle-associated protein kinase WEE1 ... Imajuku, Y., Hirayama, T., Endoh, H., and Oka, A. (1992). Exon-intron organization of the Arabidopsis thaliana protein kinase ...
Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae. ... CDC28 specifies a cyclin-dependent protein kinase, and activity of such kinases is vital for cell cycle progression in all ... Novel sensing mechanisms and targets for the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae.Mol. Microbiol ... including key residues required forSNF1 and CDC28 protein kinase activity. The deletion of CDC25 removes the GDP-GTP exchange ...
However, in meiosis, the protein kinase Ime2 was required rather than the related cyclin-dependent kinase Cdc28. Ime2 was ... In the yeast Saccharomyces cerevisiae, Dirick et al. (p. 1854) found that entry into meiotic S phase required the B-type ... However, the Ime2 protein kinase might have functionally replaced the complex of Cdc28 with G1-specific cyclins, which controls ... and the other uses the Daxx adaptor protein to somehow activate the protein kinase JNK, whose phosphorylation activity appears ...
1991 A cyclin B homolog in S. cerevisiae: chronic activation of the Cdc28 protein kinase by cyclin prevents exit from mitosis. ... 1995 Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae. EMBO J. 14: 4803- ... 1993 An inhibitor of p34CDC28 protein kinase activity from Saccharomyces cerevisiae. Science 259: 216-219. ... a protein kinase that phosphorylates and inhibits Clb-Cdc28 complexes) (Booher et al. 1993; Mendenhall 1993; Schwob et al. 1994 ...
1991 A cyclin B homolog in S. cerevisiae: chronic activation of the Cdc28 protein kinase by cyclin prevents exit from mitosis. ... two protein kinases, cyclin-dependent kinase (Cdk)1p (also known as Cdc28p) and Cdc7p, must be activated. These kinases both ... 1993 Cell cycle regulation of the yeast Cdc7 protein kinase by association with the Dbf4 protein. Mol. Cell. Biol. 13: 2899- ... 1994 The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S phase transition in Saccharomyces cerevisiae. Mol. Cell. ...
A model of START regulation involves activation of CDC28 kinase by any CLN protein, leading to activation of CLN1 and CLN2 ... They probably act by activating the CDC28 protein kinase. Expression of CLN1 or CLN3 under the control of an inducible promoter ... The cell cycle in Saccharomyces cerevisiae is controlled by regulation of START in late G1. The CLN1, CLN2 and CLN3 family of ... The cell cycle in Saccharomyces cerevisiae is controlled by regulation of START in late G1. The CLN1, CLN2 and CLN3 family of ...
CKS1B CDC28 protein kinase regulatory subunit 1B". Harper, J.W. 2001. Protein destruction: Adapting roles for Cks proteins. Cur ... "Human cDNAs encoding homologs of the small p34Cdc28/Cdc2-associated protein of Saccharomyces cerevisiae and Schizosaccharomyces ... Cyclin-dependent kinases regulatory subunit 1 is a protein that in humans is encoded by the CKS1B gene. The CKS1B protein binds ... 1996). "Crystal structure and mutational analysis of the human CDK2 kinase complex with cell cycle-regulatory protein CksHs1". ...
In the budding yeast S. cerevisiae, cell cycle progression is controlled by the Cdc28 protein kinase and cyclins. In particular ... encoding a kinase capable of phosphorylating Cdc28 on tyrosine 19, thus inhibiting its kinase activity. During the checkpoint- ... mitosis is triggered by activation of Cdc28 by Clb cyclins. In cells that cannot polarize the actin cytoskeleton or form a bud ... both of these contribute to lowering Cdc28 activity. However, we have found that both of these transcriptional responses are ...
Potential regulation of Ste20 function by the Cln1-Cdc28 and Cln2-Cdc28 cyclin-dependent protein kinases. J Biol Chem 273:25089 ... Pan X, Heitman J (1999) Cyclic AMP-dependent protein kinase regulates pseudohyphal differentiation in Saccharomyces cerevisiae ... Green fluorescent protein-cell wall fusion proteins are covalently incorporated into the cell wall of Saccharomyces cerevisiae ... Kuchin S, Vyas VK, Carlson M (2002) Snf1 protein kinase and the repressors Nrg1 and Nrg2 regulate FLO11, haploid invasive ...
Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae. ... The yeast Saccharomyces cerevisiae contains three related protein kinases that are members of the PAK (p21-activated kinase) ... Characterization of SKM1, a Saccharomyces cerevisiae gene encoding a novel Ste20/PAK-like protein kinase.Mol. Microbiol. 23 ... an adapter in a regulatory pathway that relieves tyrosine phosphorylation of Cdc28 protein kinase in Saccharomyces cerevisiae. ...
Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae. ... The protein kinase Pho85 is required for asymmetric accumulation of the Ash1 protein in Saccharomyces cerevisiae. Mol. ... Novel sensing mechanisms and targets for the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol. ... Mutation of the SPS1-encoded protein kinase of Saccharomyces cerevisiae leads to defects in transcription and morphology during ...
... the cell cycle is directed by CDK protein kinases, such as the CDK of Saccharomyces cerevisiae, Cdc28. The activity of Cdc28 is ... Schweitzer B, Philippsen P (1991) CDC15, an essential cell cycle gene in Saccharomyces cerevisiae, encodes a protein kinase ... Mah AS, Jang J, Deshaies RJ (2001) Protein kinase Cdc15 activates the Dbf2-Mob1 kinase complex. Proc Natl Acad Sci USA 98:7325- ... FEAR proteins could indeed be the parallel mechanism for CDK-Clb2 inactivation in the absence of MEN proteins, and MEN proteins ...
This review summarizes what we currently understand about how the action of septin-associated protein kinases and their ... This review summarizes what we currently understand about how the action of septin-associated protein kinases and their ... In addition, and importantly, the activities of certain septin-associated protein kinases also regulate the state of ... In addition, and importantly, the activities of certain septin-associated protein kinases also regulate the state of ...
Progression through the cell cycle phases is controlled by the cyclin-dependent protein kinases (CDKs). These enzymes ... including calmodulin-related proteins, a calcium-transporting ATPase, and a family of CDPKs, which are composed of a protein ... The Plasmodium falciparum genome encodes a number of proteins putatively involved in calcium signaling, ... kinase catalytic domain fused to a calcium-binding domain. ... MAP kinase pathways in the yeast Saccharomyces cerevisiae. ...
Interacts with the CDC2 protein kinase to form MPF. G2/M cyclins accumulate steadily during G2 and are abruptly destroyed at ... Protein-protein interaction databases. BioGRIDi. 36287, 294 interactors. ComplexPortali. CPX-1701, CLB2-CDC28 kinase complex ... "The role of CDC28 and cyclins during mitosis in the budding yeast S. cerevisiae.". Surana U., Robitsch H., Price C., Schuster T ... cyclin-dependent protein serine/threonine kinase regulator activity Source: SGD ,p>Inferred from Direct Assay,/p> ,p>Used to ...
A cyclin B homolog in S. cerevisiae: chronic activation of the Cdc28 protein kinase by cyclin prevents exit from mitosis. Cell ... with an essential Ser/Thr protein kinase active-site signature (nucleotides 160 to 172) and a protein kinase ATP-binding region ... A multicopy suppressor gene of the Saccharomyces cerevisiae G1 cell cycle mutant gene dbf4 encodes a protein kinase and is ... One such protein that plays a crucial role in both mitosis and cytokinesis is polo-like kinase (Plk). It is a highly conserved ...
S.cerevisiae protein kinase (CKS1) gene, complete cds. 1989/11/23. 729. ... encodes a subunit of the Cdc28 protein kinase complex. ... Saccharomyces cerevisiae genes for Cks1 protein, Esr1 protein, ... The Saccharomyces cerevisiae CKS1 gene, a homolog of the Schizosaccharomyces pombe suc1+ gene, ... hypothetical protein, partial and complete cds. 1994/07/27. 8700. M26033. ...
1991). The role of phosphorylation and the CDC28 protein kinase in cell cycle-regulated nuclear import of the S. cerevisiae ... 1992). A plant homologue to mammalian brain 14-3-3 protein and protein kinase C inhibitor. FEBS Lett. 296, 222-224. ... Our data show that only plastid precursor proteins interact with 14-3-3 proteins (Figures 1B and 3A). Even when these proteins ... explains the involvement of 14-3-3 proteins in the regulation of protein kinases and other cellular events involving protein ...
A new human p34 protein kinase, CDK2, identified by complementation of a cdc28 mutation in Saccharomyces cerevisiae, is a ... Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae ... Cyclins are key regulators of a family of protein kinases called cyclin-dependent kinases (Cdks). Specific cyclins interact ... Cyclins are key regulators of a family of protein kinases called cyclin-dependent kinases (Cdks). Specific cyclins interact ...
... cdc2 protein kinase MeSH D12.776.167.200.067.500 - cdc28 protein kinase, s cerevisiae MeSH D12.776.167.200.067.875 - cyclin- ... dependent kinase 5 MeSH D12.776.167.200.067.900 - cyclin-dependent kinase 9 MeSH D12.776.167.200.580.500 - cdc2 protein kinase ... RNA-binding protein EWS MeSH D12.776.624.664.700.250 - lymphocyte specific protein tyrosine kinase p56(lck) MeSH D12.776. ... wnt1 protein MeSH D12.776.624.664.700.978 - wnt2 protein MeSH D12.776.624.776.355.100 - cyclin-dependent kinase inhibitor p15 ...
This protein kinase is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit ... The protein encoded by this gene is a member of the Ser/Thr protein kinase family. ... cyclin-dependent kinase 2 Assay Type: Probe Assay Design: exonic Application: Gene Expression Unique Assay ID: qHsaCEP0051246 ... cyclin-dependent kinase 2 Assay Type: Probe Application: Gene Expression Unique Assay ID: dHsaCPE5035686 Info: FAM; Same primer ...
  • The Cdc28 protein kinase functions in the G1 to S phase transition of the cell cycle of the budding yeast Saccharomyces cerevisiae. (pnas.org)
  • Of the five Cdks expressed in budding yeast Saccharomyces cerevisiae , two are activated by members of large cyclin families ( 2 , 43 , 65 ). (asm.org)
  • One function of these structures that has been well-documented in studies conducted in budding yeast Saccharomyces cerevisiae is to serve as a scaffold that recruits regulatory proteins, which dictate the spatial and temporal control of certain aspects of the cell division cycle. (frontiersin.org)
  • Here, we show that untimely activation of replication origins during the G1 phase is genotoxic and induces genomic instability in the budding yeast Saccharomyces cerevisiae . (prolekare.cz)
  • For example, in the budding yeast Saccharomyces cerevisiae , all components of the pre-RC, including ORC, Cdc6, Cdt1, and Mcm2-7, are inhibited by the master cell cycle regulator, cyclin-dependent kinase (CDK). (prolekare.cz)
  • Analysis of cell cycle regulation in the budding yeast Saccharomyces cerevisiae has shown that a central regulatory protein kinase, Cdc28, undergoes changes in activity through the cell cycle by associating with distinct groups of cyclins that accumulate at different times. (rupress.org)
  • The cyclin-dependent protein kinase (CDK) encoded by CDC28 is the master regulator of cell division in the budding yeast Saccharomyces cerevisiae. (stanford.edu)
  • Whereas the Cdc28 protein kinase of the budding yeast Saccharomyces cerevisiae plays an essential role in cell cycle progression during the G1 interval, a function in the progression from the G2 interval into M phase has been inferred for its homologs, including the Cdc2Hs protein kinase of humans. (scripps.edu)
  • Cell cycle progression in the budding yeast Saccharomyces cerevisiae is controlled by the Cdc28 protein kinase, which is sequentially activated by different sets of cyclins. (mysciencework.com)
  • Cyclin-dependent kinase-associated protein 1 (Cks1) is involved in the control of the transcription of a subset of genes in addition to its role in controlling the cell cycle in the budding yeast Saccharomyces cerevisiae. (ox.ac.uk)
  • In the budding yeast, Saccharomyces cerevisiae, the major CAK is a 44-kDa protein kinase known as Cak1. (ox.ac.uk)
  • report a new checkpoint pathway for stopping mitosis if cell wall synthesis is impaired in the emerging daughter cell of the budding yeast, Saccharomyces cerevisiae . (sciencemag.org)
  • In the budding yeast, Saccharomyces cerevisiae , the existence of gene knockout mutants as well as methods for the global profiling of transcript levels presents a unique opportunity to identify the targets of a developmental MAPK signaling pathway. (pnas.org)
  • Activation of the cyclin-dependent kinases to promote cell cycle progression requires their association with cyclins as well as phosphorylation of a threonine (residue 161 in human p34cdc2). (nih.gov)
  • The recovery-promoting activity of the KSS1 gene requires a functional WHI1 gene, which encodes a yeast homolog to animal cyclins, suggesting that the KSS1 and WHI1 proteins act in the same growth control pathway. (nih.gov)
  • In Saccharomyces cerevisiae , four B-type cyclins, Clb1 - 4 , carry out essential mitotic roles, with substantial but incomplete overlap of function among them. (genetics.org)
  • THE eukaryotic cell cycle is regulated by cyclin-dependent kinases (CDKs) bound to cyclins ( Bloom and Cross 2007 ). (genetics.org)
  • In the budding yeast S. cerevisiae , cell cycle progression is controlled by the Cdc28 protein kinase and cyclins. (searlescholars.net)
  • In particular, mitosis is triggered by activation of Cdc28 by Clb cyclins. (searlescholars.net)
  • Cdc28 (or Cdk1) is devoted entirely to cell cycle control and is activated by nine cyclins, Cln1 to -3 and Clb1 to -6 ( 42 ). (asm.org)
  • Reddy, A.S.N. 2004-10-06 00:00:00 Cyclins are key regulators of a family of protein kinases called cyclin-dependent kinases (Cdks). (deepdyve.com)
  • Cyclins are key regulators of a family of protein kinases called cyclin-dependent kinases (Cdks). (deepdyve.com)
  • Cyclins function as regulators of CDK kinases. (abcam.com)
  • Progression from one phase to another is controlled by cyclin dependent kinases (CDK) and their activators, cyclins. (antibodies-online.com)
  • Mitotic cyclins stably associate with this protein and function as regulatory subunits. (antibodies-online.com)
  • The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). (jax.org)
  • Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. (jax.org)
  • Cdks (cyclin-dependent kinases) are heteromeric serine/threonine kinases that control progression through the cell cycle in concert with their regulatory subunits, the cyclins. (genecards.org)
  • Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins. (rupress.org)
  • Our results suggest that activation of Cdc28 by G1 cyclins (Cln1, Cln2, or Cln3) in unbudded G1 cells triggers polarization of the cortical actin cytoskeleton to a specialized pre-bud site at one end of the cell, while activation of Cdc28 by mitotic cyclins (Clb1 or Clb2) in budded G2 cells causes depolarization of the cortical actin cytoskeleton and secretory apparatus. (rupress.org)
  • However, it took a long time to realise that Cdc2 and cyclins form a stoichiometric complex and that a cyclin subunit is necessary for the Cdc2 subunit to gain its protein kinase activity. (biologists.org)
  • Cyclins were first recognized as proteins whose abundance oscillates during the early cell cycles of marine invertebrate eggs and their connection with MPF (maturation-promoting factor), the entity defined in frog and starfish oocytes whose activity controls entry into M phase, was far from clear at first. (biologists.org)
  • Thus, paradoxically, the wealth of information about cell cycle genes in S. cerevisiae provided only a limited number of clues at first in putting cyclins together with CDKs. (biologists.org)
  • This phosphorylation occurs in the G 2 /M phase by Cdc28 in combination with G 2 /M phase cyclins. (sciencemag.org)
  • Nine cyclins of S. cerevisiae are generally classified by cell cycle phase as follows: the G 1 phase cyclins (Cln1, Cln2, and Cln3), the S phase cyclins (Clb5 and Clb6), and the G 2 /M phase cyclins (Clb1, Clb2, Clb3, and Clb4) ( 4 ). (sciencemag.org)
  • Negative regulation of G1 and G2 by S-phase cyclins of Saccharomyces cerevisiae. (mysciencework.com)
  • Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins. (naver.com)
  • [8] Also, the precise control mechanisms between the phases, and the changes in levels of 'cyclins' - "proteins that showed cell-cycle-oscillatory behaviour" [9] were discovered and studied in more details. (edu.au)
  • E2F induces transcription of genes including cyclins A and E, DNA polymerase and thymidine kinase. (sinobiological.com)
  • These events require activation of Cdc28 kinase by G1 cyclins. (ox.ac.uk)
  • We have studied the kinase complexes formed between Cdc28 and each of the G1 cyclins Cln1, Cln2, and Cln3. (cshl.edu)
  • CKS2 protein binds to the catalytic subunit of the cyclin dependent kinases and is essential for their biological function. (nih.gov)
  • Expression of cyclin kinase subunit 2 in human breast cancer and its prognostic significance. (nih.gov)
  • Clinical and biological impact of cyclin-dependent kinase subunit 2 in esophageal squamous cell carcinoma. (nih.gov)
  • Oncogenic potential of cyclin kinase subunit-2 in cholangiocarcinoma. (nih.gov)
  • Cyclin-dependent kinases regulatory subunit 1 is a protein that in humans is encoded by the CKS1B gene. (wikipedia.org)
  • NCS1 encodes a protein with significant similarity to a mammalian phosphotyrosyl phosphatase activator (PTPA) regulatory subunit for type 2A protein phosphatases (PP2As). (asm.org)
  • Here we report on one of these groups, which encodes a regulatory subunit for type 2A protein phosphatases (PP2As). (asm.org)
  • Human Cdk subunit 1 ( Cks1 ), as well as S-phase kinase-associated protein 2 ( Skp2 ), is an essential and specific factor in the p27 proteolysis by SCF Skp2 ubiquitin ligase. (aacrjournals.org)
  • Cellular transition to anaphase and mitotic exit has been linked to the loss of cyclin-dependent kinase 1 (Cdk1) kinase activity as a result of anaphase-promoting complex/cyclosome (APC/C)-dependent specific degradation of its cyclin B1 subunit. (rupress.org)
  • It is a catalytic subunit of the cyclin-dependent protein kinase complex, whose activity is restricted to the G1-S phase, and is essential for cell cycle G1/S phase transition. (abcam.com)
  • Alexandru G, Uhlmann F, Mechtler K, Poupart MA, Nasmyth K (2001) Phosphorylation of the cohesin subunit Scc1 by Polo/Cdc5 kinase regulates sister chromatid separation in yeast. (springer.com)
  • This protein is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. (antibodies-online.com)
  • TFIID comprises the TATA box-binding protein and a set of highly conserved associated factors (TAF(II)s). yTAF(II)145, the core subunit of the yeast TAF(II) complex, is dispensable for transcription of most yeast genes but specifically required for progression through G1/S. Here we show that transcription of G1 and certain B-type cyclin genes is dependent upon yTAF(II)145. (umassmed.edu)
  • It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. (jax.org)
  • This concept of a direct association between a cyclin subunit and a cell cycle kinase subunit (Cdc2) emerged from analysis of the G2/M transition. (biologists.org)
  • This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. (senescence.info)
  • This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. (abnova.com)
  • This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. (abnova.com)
  • This cyclin tightly associates with CDK9 kinase, and was found to be a major subunit of the transcription elongation factor p-TEFb. (abnova.com)
  • This cyclin and its kinase partner were also found to be involved in the phosphorylation and regulation of the carboxy-terminal domain (CTD) of the largest RNA polymerase II subunit. (abnova.com)
  • Thus, the Kss1 MAPK cascade programs development by coordinately modulating a cell adhesion factor, a secreted host-destroying activity, and a specialized subunit of the Cdc28 cyclin-dependent kinase. (pnas.org)
  • It is a highly conserved serine/threonine kinase characterized by two polo boxes at the C terminus ( 18 , 35 ) and has been found in all eukaryotes, from Saccharomyces cerevisiae to human ( 8 ). (asm.org)
  • Transit sequences of chloroplast-destined precursor proteins are phosphorylated on a serine or threonine residue. (plantcell.org)
  • Any process that modulates the frequency, rate or extent of cyclin-dependent protein serine/threonine kinase activity. (princeton.edu)
  • The role of phosphorylation and the CDC28 protein kinase in cell cycle-regulated nuclear import of the S. cerevisiae transcription factor SWI5. (ox.ac.uk)
  • This phosphorylation is carried out by CAK, the Cdk-activating kinase. (nih.gov)
  • Dever TE, Feng L, Wek RC, Cigan AM, Donahue TF, Hinnebusch AG (1992) Phosphorylation of initiation factor 2 alpha by protein kinase GCN2 mediates gene-specific translational control of GCN4 in yeast. (springer.com)
  • The amino acid motif around the phosphorylation site is related to the phosphopeptide binding motif for 14-3-3 proteins. (plantcell.org)
  • Plant 14-3-3 proteins interact specifically with wheat germ lysate-synthesized chloroplast precursor proteins and require an intact phosphorylation motif within the transit sequence. (plantcell.org)
  • Our data indicate that cells preserve a low level of the initiation factor Sld2 to prevent untimely initiation during the normal cell cycle in addition to controlling the phosphorylation of Sld2 and Sld3 by cyclin-dependent kinase. (prolekare.cz)
  • Its activity is also regulated by protein phosphorylation. (abcam.com)
  • SCF (Skp1/Culin/F-box protein) protein-ubiquitin ligases ubiquitylate proteins that are marked by phosphorylation at specific sequences known as phosphodegrons. (springer.com)
  • Targeting of proteins for destruction by phosphorylation provides a mechanism for linking cell cycle regulation to internal and external signaling pathways via regulated protein kinase activities. (springer.com)
  • The Cdc25 phosphatase promotes entry into mitosis by removing cyclin-dependent kinase 1 (Cdk1) inhibitory phosphorylation. (rupress.org)
  • Moreover, there are no clearly defined molecular links between Cdk1 inhibitory phosphorylation and proteins known to be involved in the control of cell size or cell growth. (rupress.org)
  • This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). (jax.org)
  • The Cln3-Cdc28 kinase complex of S. cerevisiae is regulated by proteolysis and phosphorylation. (naver.com)
  • 2011) Phosphorylation of MCM3 protein by cyclin E/cyclin-dependent kinase 2 (Cdk2) regulates its function in cell cycle. (sinobiological.com)
  • Phosphorylation of phosphatidate phosphatase regulates its membrane association and physiological functions in Saccharomyces cerevisiae: identification of SER(602), THR(723), AND SER(744) as the sites phosphorylated by CDC28 (CDK1)-encoded cyclin-dependent kinase. (semanticscholar.org)
  • Treatment with alpha-factor induces a preferential association and/or phosphorylation of Far1 by the Cln1, Cln2, and Cln3 kinase complexes. (cshl.edu)
  • Complete activation of most cyclin-dependent protein kinases (CDKs) requires phosphorylation by the CDK-activating kinase (CAK). (ox.ac.uk)
  • Cak1 is required for the phosphorylation and activation of Cdc28, a major CDK involved in cell cycle control. (ox.ac.uk)
  • Loss of Cak1 function reduced the phosphorylation and activity of both Cdc28 and Kin28 but did not affect the activity of Pho85 or Srb10. (ox.ac.uk)
  • We conclude that Cak1 is required for the activating phosphorylation of Kin28 as well as that of Cdc28. (ox.ac.uk)
  • Mitotic role for the Cdc28 protein kinase of Saccharomyces cerevisiae. (pnas.org)
  • A temperature-sensitive mutation in CAK1 confers a G2 delay accompanied by low Cdc28p protein kinase activity and shows genetic interactions with altered expression of the gene for the major mitotic cyclin, CLB2. (nih.gov)
  • Removal of the Clb3 D box results in abundant Clb3 protein and associated kinase throughout the cell cycle, but mitotic exit occurs with close to normal timing. (genetics.org)
  • Furthermore, the degradation of a protein other than cyclin B1 is essential to activate a phosphatase that, in turn, enables mitotic exit. (rupress.org)
  • Exit from mitosis in mammalian cells requires the inactivation of Cdk1, the protein kinase that drives the mitotic state ( Murray, 2004 ). (rupress.org)
  • The anaphase promoting complex/cyclosome (APC/C) is activated during mitosis and G1 where it is responsible for eliminating proteins that impede mitotic progression and that would have deleterious consequences if allowed to accumulate during G1. (springer.com)
  • 1995 ). p25 rum1 orders S-phase and mitosis by acting as an inhibitor of the p34 cdc2 mitotic kinase. (biologists.org)
  • A vast body of information concerning how Cdc28 activity is timed and coordinated with various mitotic events has accrued. (stanford.edu)
  • Nevertheless, both Clb5 and Clb6 were shown to be responsible for down-regulation of the protein kinase activities associated with Cln2, a G1 cyclin, and Clb2, a mitotic cyclin, in vivo. (mysciencework.com)
  • Genetic evidence suggested that the inhibition of mitotic cyclin-dependent kinase activities was dependent on and possibly mediated through the CDC6 gene product. (mysciencework.com)
  • Characterisation of the CDC7 gene product of Saccharomyces cerevisiae as a protein kinase needed for the initiation of mitotic DNA synthesis. (naver.com)
  • The Saccharomyces cerevisiae Start-specific transcription factor Swi4 interacts through the ankyrin repeats with the mitotic Clb2/Cdc28 kinase and through its conserved carboxy terminus with Swi6. (ox.ac.uk)
  • In G2 and M phases, the transcriptional activity of SCB-binding factor is repressed by the mitotic Clb2/Cdc28 kinase. (ox.ac.uk)
  • In many eucaryotic cells, the midzone of the mitotic spindle forms a distinct structure containing a specific set of proteins. (pubmedcentralcanada.ca)
  • ACT3: a putative centractin homologue in S. cerevisiae is required for proper orientation of the mitotic spindle. (pubmedcentralcanada.ca)
  • At the end of the cell cycle, the splitting of the ring into two independent structures depends on the function of the mitotic exit network in which the protein phosphatase Cdc14 participates. (microbiologyresearch.org)
  • Entry into mitosis is universally controlled by cyclin-dependent kinases (CDKs). (plantcell.org)
  • Progression through the eukaryotic cell cycle is governed by cyclin-dependent kinases (CDKs) in conjunction with their cyclin partners ( Morgan, 1997 ). (plantcell.org)
  • Cyclin-dependent kinases (Cdks) are key regulators of the cell division cycle. (asm.org)
  • our data highlight a cell integrity function for the Pcl1,2 subgroup of Pho85 Cdks that is independent of a role for the Pho80-Pho85 kinase in the response to stress. (asm.org)
  • Cyclin-dependent kinases (Cdks) are heterodimeric protein complexes that are essential activators of cell cycle progression in eukaryotic cells. (asm.org)
  • Progression through the cell cycle phases is controlled by the cyclin-dependent protein kinases (CDKs). (asmscience.org)
  • Four human protein kinases (underlined) representing the four major families in the CMGC group (CDKs, MAPKs, GSK3, and CDK-like) were included in the alignment to anchor the position of these families in the tree. (asmscience.org)
  • It is now firmly established that progression of the cell cycle- that is, transitions between one phase of the cycle and the next- are controlled by cyclin-dependent kinases (CDKs). (biologists.org)
  • Cell cycle progression is precisely regulated by cyclin-dependent protein kinases (CDKs). (sciencemag.org)
  • Cdks are constitutively expressed and are regulated by several kinases and phosphastases, including Wee1, CDK-activating kinase and Cdc25 phosphatase. (sinobiological.com)
  • A protein kinase encoded by the Saccharomyces cerevisiae CDC28 gene and required for progression from the G1 PHASE to the S PHASE in the CELL CYCLE. (definitions.net)
  • Cyclin-dependent kinase-associated protein Cks2 is associated with bladder cancer progression. (nih.gov)
  • however, recent study in the budding yeast S. cerevisiae indicates that progression of meiosis is also controlled by a master regulator specific to meiosis, namely the Ime2p kinase. (nih.gov)
  • Below, I describe the overlapping roles of Ime2p and Cdk during meiosis in yeast and speculate on how these two kinases cooperate to drive the progression of meiosis. (nih.gov)
  • In particular, septin-associated protein kinases couple cell cycle progression with cellular morphogenesis. (frontiersin.org)
  • Control of this progression requires participation of multiple proteins that ensure precise coordination of different events in time and space. (asm.org)
  • Because casein kinase 1 is associated with sites of polar growth, it may regulate Mih1 as part of a signaling mechanism that links successful completion of growth-related events to cell cycle progression. (rupress.org)
  • The various cyclin/Cdc28 complexes control different aspects of cell cycle progression, including the commitment step known as START and mitosis. (rupress.org)
  • Among these, Cdc28 (CDK1) functions as a major regulator of cell cycle progression ( 3 ). (sciencemag.org)
  • The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. (nih.gov)
  • A major control point in cell cycle progression in eukaryotic cells occurs at the end of the G1 phase in a process called Start in Saccharomyces cerevisiae . (biomedcentral.com)
  • The ankyrin repeats constitute a domain by which a cell cycle-specific transcription factor can interact with cyclin-dependent kinase complexes, thus enabling it to link its transcriptional activity to cell cycle progression. (ox.ac.uk)
  • Nim1-related kinases coordinate cell cycle progression with the organization of the peripheral cytoskeleton in yeast. (microbiologyresearch.org)
  • cdk2 binds cyclin type A and E proteins and controls progression into S-phase. (bioon.com.cn)
  • A second possibility is that the feedback loop is initiated by a triggering kinase that activates Cdc25 to generate a small amount of active Cdk1. (rupress.org)
  • From Cdc2 to Cdk1: when did the cell cycle kinase join its cyclin partner? (biologists.org)
  • According to previous reports, the activation of homologous recombination during specific cell phases depends on the kinase activity of cyclin-dependent kinase 1 (CDK1). (sciencemag.org)
  • Here, we report that the budding yeast CDK1, Cdc28, phosphorylates the major homologous recombination regulators Rad51 and Rad52. (sciencemag.org)
  • cdk2 is a cell cycle protein closely related to Cdc2 (cdk1) that has proved useful as a marker of proliferation. (bioon.com.cn)
  • The fact that the strain in which all six CLB genes are deleted is viable if Clb1p is overexpressed indicates that this specificity can be subverted by overexpression of a single Clb protein ( H aase and R eed 1999 ). (genetics.org)
  • In an attempt to identify genes encoding proteins that interact with the Cdc28 protein kinase, high-copy plasmid suppressors of a temperature-sensitive cdc28 mutation were isolated. (scripps.edu)
  • Second, we used distances between proteins of duplicate genes in the protein interaction network as a metric of their diversification. (biomedcentral.com)
  • The higher a gene's duplicate count, the further the proteins of this gene and its duplicates drift away from one another in the networks, which is especially true for genetically antagonizing duplicate genes. (biomedcentral.com)
  • A prominent category of constituents in biochemical networks is proteins encoded by duplicate genes, also termed paralogs [ 6 ]. (biomedcentral.com)
  • Proteins of duplicate genes are thus abundant in biochemical networks. (biomedcentral.com)
  • In this model, multiple fungal signal transduction pathways are activated by its nematode prey to further regulate downstream genes associated with diverse cellular processes such as energy metabolism, biosynthesis of the cell wall and adhesive proteins, cell division, glycerol accumulation and peroxisome biogenesis. (prolekare.cz)
  • The Saccharomyces cerevisiae PAH1-encoded phosphatidate phosphatase (PAP) catalyzes the penultimate step in the synthesis of triacylglycerol and plays a role in the transcriptional regulation of phospholipid synthesis genes. (semanticscholar.org)
  • Bender A, Pringle JR. Use of a screen for synthetic lethal and multicopy suppressee mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae. (pubmedcentralcanada.ca)
  • One of the MAPK-regulated genes is PGU1 , which encodes a secreted enzyme that hydrolyzes polygalacturonic acid, a structural barrier to microbial invasion present in the natural plant substrate of S. cerevisiae . (pnas.org)
  • We present evidence that the Cdc28 protein kinase is also required for mitosis and that this function is executed in the G2 interval of the cell cycle. (pnas.org)
  • In cells that cannot polarize the actin cytoskeleton or form a bud, mitosis is delayed due to a checkpoint control pathway that inhibits Cdc28. (searlescholars.net)
  • En este trabajo aportamos pruebas que demuestran que en algunos mutantes MEN ("mitosis exit network") el ciclo celular no se detiene en la transición anafase-telofase. (isciii.es)
  • This review summarizes what we currently understand about how the action of septin-associated protein kinases and their substrates control information flow to drive the cell cycle into and out of mitosis, to regulate bud growth, and especially to direct timely and efficient execution of cytokinesis and cell abscission. (frontiersin.org)
  • Polo-like kinases (Plks) are known to play critical roles in controlling both mitosis and cytokinesis. (asm.org)
  • A single Plk homologue in T. brucei , Tb PLK , was found to be capable of complementing the Plk (Cdc5) functions in Saccharomyces cerevisiae , thus raising the question of how it may function in the trypanosome with cytokinesis dissociated from mitosis. (asm.org)
  • One such protein that plays a crucial role in both mitosis and cytokinesis is polo-like kinase (Plk). (asm.org)
  • Inactivation of Cdc28 following cyclin destruction in mitosis triggers redistribution of cortical actin structures to the neck region for cytokinesis. (rupress.org)
  • The same year, Wagenaar analyzed the timing of synthesis of proteins required for mitosis in the early cell cycles of sea urchin embryos ( Wagenaar, 1983 ), extending previous reports that puromycin added at the time of fertilization prevents the first division ( Hultin, 1961 ). (biologists.org)
  • Berlin V, Styles CA, Fink GR. BIK1, a protein required for microtubule function during mating and mitosis in Saccharomyces cerevisiae, colocalizes with tubulin. (pubmedcentralcanada.ca)
  • Earnshaw WC, Mackay AM. Role of nonhistone proteins in the chromosomal events of mitosis. (pubmedcentralcanada.ca)
  • Breitkreutz A, Boucher L, Breitkreutz BJ, Sultan M, Jurisica I, Tyers M (2003) Phenotypic and transcriptional plasticity directed by a yeast mitogen-activated protein kinase network. (springer.com)
  • This induced interaction depends upon the Fus3 protein kinase, a mitogen-activated protein kinase homolog that functions near the bottom of the alpha-factor signal transduction pathway. (cshl.edu)
  • Thus, we trace a path through which a mitogen-activated protein kinase regulates a Cdc2 kinase. (cshl.edu)
  • Despite the importance of mitogen-activated protein kinase (MAPK) signaling in eukaryotic biology, the mechanisms by which signaling yields phenotypic changes are poorly understood. (pnas.org)
  • Mitogen-activated protein kinase (MAPK) signal transduction cascades play crucial roles in both normal and abnormal eukaryotic development. (pnas.org)
  • Western blot analysis showed that Cks1/Skp2-cotransfected cells expressed a much lower level of p27 protein than the controls. (aacrjournals.org)
  • These findings indicate that Cks1, as well as Skp2, regulates the expression level of p27 protein in gastric carcinomas. (aacrjournals.org)
  • One such suppressor, CKS1, was found to encode an 18-kilodalton protein that shared a high degree of homology with the suc1+ protein (p13) of Schizosaccharomyces pombe (67% amino acid sequence identity). (scripps.edu)
  • Disruption of the chromosomal CKS1 gene conferred a G1 arrest phenotype similar to that of cdc28 mutants. (scripps.edu)
  • The presence of the 18-kilodalton Cks1 protein in yeast lysates was demonstrated by using Cks-1 specific antiserum. (scripps.edu)
  • Furthermore, the Cks1 protein was shown to be physically associated with active forms of the Cdc28 protein kinase. (scripps.edu)
  • These data suggest that Cks1 is an essential component of the Cdc28 protein kinase complex. (scripps.edu)
  • We propose that the selective ability of Cks1 to bind ubiquitin allows this small molecule the flexibility to bind large protein complexes with specificity and that this may represent a novel mechanism of regulating transcriptional activation. (ox.ac.uk)
  • These included the known associated proteins Cdc28, Sic1 and Cks1. (cshl.edu)
  • Ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. (genecards.org)
  • By inhibiting the activity of Cdc28/Clb cyclin-dependent protein kinase (CDK) complexes, Sic1 prevents the premature initiation of S phase in the yeast Saccharomyces cerevisiae. (stanford.edu)
  • Based on the mutational data and sequence comparisons, we argue that Sic1 and p25rum1 are structurally distinct from the known mammalian CDK inhibitors, but may bind CDK complexes in a manner more closely resembling CDK substrates like the retinoblastoma and E2F proteins. (stanford.edu)
  • STE12, a protein involved in cell-type-specific transcription and signal transduction in yeast, is part of protein-DNA complexes. (naver.com)
  • Different cyclin-dependent kinase complexes trigger the process of DNA synthesis. (edu.au)
  • CDK2 is a member of the Ser/Thr protein kinase family. (abcam.com)
  • It binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. (abcam.com)
  • 2011) Briefly bound to activate: transient binding of a second catalytic magnesium activates the structure and dynamics of CDK2 kinase for catalysis. (sinobiological.com)
  • The dual role of the Cdc28 protein kinase in the S. cerevisiae cell cycle thus parallels that demonstrated for the cdc2 protein kinase of the fission yeast Schizosaccharomyces pombe. (pnas.org)
  • Interacts with the CDC2 protein kinase to form MPF. (uniprot.org)
  • 1998 ). Vectors for the expression of tagged proteins in Schizosaccharomyces pombe . (biologists.org)
  • Van Horn D, Yoo C, Xue D, Shi H, Wolin S. The La protein in Schizosaccharomyces pombe: a conserved yet dispensable phosphoprotein that functions in tRNA maturation. (labome.org)
  • The Saccharomyces cerevisiae gene CDC28 encodes a protein kinase required for cell cycle initiation. (scripps.edu)
  • The Saccharomyces cerevisiae CDC7 gene encodes a protein kinase that functions in three aspects of DNA metabolism: replication, repair, and meiotic recombination. (naver.com)
  • We conclude that the 14-3-3-Hsp70-precursor protein complex is a bona fide intermediate in the in vivo protein import pathway in plants. (plantcell.org)
  • The pathway maps illustrate protein interactions and regulation to provide a comprehensive picture of signaling and disease processes. (bio-rad.com)
  • Inhibiting a specific protein kinase's activity often reveals whether that kinase is critical to a signaling pathway. (sciencemag.org)
  • Instead, they connect with each other to form pathways, such as the MAP kinase cascades and the glycolysis pathway. (biomedcentral.com)
  • Previous studies have suggested that the Pch2 protein acts in a checkpoint pathway that monitors chromosome synapsis. (labome.org)
  • Regulation of ribosome biogenesis by the rapamycin-sensitive TOR-signaling pathway in Saccharomyces cerevisiae. (naver.com)
  • Although the Ras-cAMP pathway does not appear to affect CLN3 transcription, cAMP increases Cln3 protein levels and Cln3-Cdc28 kinase activity. (yeastgenome.org)
  • The Stress Activated MAP Kinase (SAPK) Hog1 is central to this pathway. (biomedcentral.com)
  • A well-characterized model of the osmotic stress pathway in S. cerevisiae was recently described by Krantz and coworkers (2006) [ 18 ]. (biomedcentral.com)
  • Genetic analysis of various combinations of mutants demonstrated that the cell wall integrity checkpoint pathway was separate from other established checkpoint pathways, such as the morphogenesis checkpoint pathway that acts through the kinase Swe1 to inhibit the CDK, Cdc28. (sciencemag.org)
  • We have combined transcriptional profiling with genetics to determine how the Kss1 MAPK signaling pathway controls dimorphic development in Saccharomyces cerevisiae . (pnas.org)
  • Inappropriate activation of one such pathway, the extracellular signal-regulated kinase cascade, promotes a significant fraction of human cancers. (pnas.org)
  • This is in contrast with observations of the homologous protein kinase from a variety of metazoans, where activity and function are associated with the G2 to M phase transition. (pnas.org)
  • The KSS1 gene encodes an apparent protein kinase homologous to the CDC28 (S. cerevisiae) and cdc2+ (S. pombe) gene products. (nih.gov)
  • In S. cerevisiae , the process of homologous recombination is highly suppressed in the G 1 phase and is induced in the G 2 /M phase. (sciencemag.org)
  • Santos B, Snyder M. Sbe2p and sbe22p, two homologous Golgi proteins involved in yeast cell wall formation. (labome.org)
  • Kwon Y, Seong C, Chi P, Greene E, Klein H, Sung P. ATP-dependent chromatin remodeling by the Saccharomyces cerevisiae homologous recombination factor Rdh54. (labome.org)
  • S. cerevisiae Kap95 (homologous to mammalian importin β) is the β-karyopherin involved in the nuclear import of proteins with classical NLS. (biomedcentral.com)
  • CKS1B and CKS2 proteins have demonstrated principal roles in cell cycle regulation. (wikipedia.org)
  • The cell cycle in Saccharomyces cerevisiae is controlled by regulation of START in late G1. (epfl.ch)
  • A model of START regulation involves activation of CDC28 kinase by any CLN protein, leading to activation of CLN1 and CLN2 transcription in a positive feedback loop and passage through START. (epfl.ch)
  • Budding yeast ( S. cerevisiae ) has served as a path-finding model eukaryote in which to explore the structure, function, and regulation of septins and septin-associated proteins. (frontiersin.org)
  • Collectively, these observations suggest that Mih1 regulation is achieved by a balance of opposing kinase and phosphatase activities. (rupress.org)
  • 1998) Regulation of the Cln3-Cdc28 kinase by cAMP in Saccharomyces cerevisiae. (yeastgenome.org)
  • This regulation requires untranslated regions of the CLN3 message, and can be explained by changes in protein synthesis rates caused by cAMP. (yeastgenome.org)
  • Das M, Wiley DJ, Chen X, Shah K, Verde F. The conserved NDR kinase Orb6 controls polarized cell growth by spatial regulation of the small GTPase Cdc42. (harvard.edu)
  • Clb2/Cdc28 kinase is not required for the repression of MCB-binding factor transcriptional activity in G2 and M phase. (ox.ac.uk)
  • By coimmunoprecipitation, we show that Swi4 but not Mbp1 interacts with Clb2/Cdc28 kinase in vivo during the G2 and M phases of the cell cycle. (ox.ac.uk)
  • We demonstrate that the ankyrin repeats of Swi4 mediate the interaction with Clb2/Cdc28 kinase. (ox.ac.uk)
  • Active Clb2-Cdc28 kinase complex was purified from yeast cells after inserting the CHH tag into Clb2. (cshl.edu)
  • The fks1-1154 cells that also carried a mutation in ARP1 exhibited bipolar spindle formation, accumulation of Clb2, and activation of the Clb2-associated cyclin-dependent kinase (CDK), Cdc28. (sciencemag.org)
  • Second, it is a distant cousin of the most well-characterized unicellular eukaryote, Saccharomyces cerevisiae , so that the function of a C. albicans gene may be suggested by its role in S. cerevisiae . (asm.org)
  • In the model fungus Saccharomyces cerevisiae adhesion can be induced by starvation for amino acids, and depends on the transcriptional activator of the general amino acid control system, Gcn4p. (springer.com)
  • Brachmann CB, Davies A, Cost GJ, Caputon E, Li J, Hieter P, Boeke JD (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. (springer.com)
  • Braus GH, Grundmann O, Brückner S, Mösch HU (2003) Amino acid starvation and Gcn4p regulate adhesive growth and FLO11 gene expression in Saccharomyces cerevisiae . (springer.com)
  • The Saccharomyces cerevisiae p21-activated kinases, Ste20p and Cla4p, have individual functions but appear to share an essential function(s) as well because a strain lacking both kinases is inviable. (asm.org)
  • The yeast Saccharomyces cerevisiae contains three related protein kinases that are members of the PAK (p21-activated kinase) family, proteins that interact with, and presumably are regulated by, Cdc42p, a p21 GTPase required to establish polarity of the actin cytoskeleton ( 9 , 17 ). (asm.org)
  • now show that by engineering such mutations in Saccharomyces cerevisiae cdc28, a protein kinase intimately involved in cell-cycle control, ATP analogs can be used in vivo to inhibit mutant cdc28 activity and to affect cell division. (sciencemag.org)
  • Amerik AY, Li SJ, Hochstrasser M (2000) Analysis of the deubiquitinating enzymes of the yeast Saccharomyces cerevisiae . (springer.com)
  • 1997 ). The p20 and Ded1 proteins have antagonistic roles in eIF4E-dependent translation in Saccharomyces cerevisiae . (biologists.org)
  • The G1-to-S transition of the cell cycle in the yeast Saccharomyces cerevisiae involves an extensive transcriptional program driven by transcription factors SBF (Swi4-Swi6) and MBF (Mbp1-Swi6). (biomedcentral.com)
  • In the model yeast Saccharomyces cerevisiae , the commitment to a new round of cell division takes place towards the end of the G1 phase of the cell cycle, a process called START [ 1 ]. (biomedcentral.com)
  • Mitra N, Roeder G. A novel nonnull ZIP1 allele triggers meiotic arrest with synapsed chromosomes in Saccharomyces cerevisiae. (labome.org)
  • An extremely strong 17-bp transcription aetivation sequence was identified between -422 and -404 bp, This sequence contained a MADS box consensus binding site, most closely related to the Mcm1 binding site of Saccharomyces cerevisiae. (naver.com)
  • A role for CDC7 in repression of transcription at the silent mating-type locus HMR in Saccharomyces cerevisiae. (naver.com)
  • Lipid metabolism and transport define longevity of the yeast Saccharomyces cerevisiae. (semanticscholar.org)
  • We have isolated ASE1, a gene encoding a component of the Saccharomyces cerevisiae spindle midzone. (pubmedcentralcanada.ca)
  • In the yeast Saccharomyces cerevisiae, the Cdc28 protein kinase controls commitment to cell division at Start, but no biologically relevant G1-phase substrates have been identified. (cshl.edu)
  • The yeast Saccharomyces cerevisiae grows at widely varying rates in different growth media. (yeastgenome.org)
  • Cell cycle control in Saccharomyces cerevisiae , p 607-695. (asmscience.org)
  • 1974. Saccharomyces cerevisiae cell cycle. (asmscience.org)
  • In Saccharomyces cerevisiae , the Cdc3, Cdc10, Cdc11, Cdc12 and Shs1/Sep7 septins assemble as a ring that marks the cytokinetic plane throughout the budding cycle. (microbiologyresearch.org)
  • Involvement of an actomyosin contractile ring in Saccharomyces cerevisiae cytokinesis. (microbiologyresearch.org)
  • In The Molecular and Cellular Biology of the Yeast Saccharomyces cerevisiae , pp. 1 -90. (microbiologyresearch.org)
  • cdc42 GTP-Binding Protein, Saccharomyces cerevisiae" is a descriptor in the National Library of Medicine's controlled vocabulary thesaurus, MeSH (Medical Subject Headings) . (harvard.edu)
  • This graph shows the total number of publications written about "cdc42 GTP-Binding Protein, Saccharomyces cerevisiae" by people in Harvard Catalyst Profiles by year, and whether "cdc42 GTP-Binding Protein, Saccharomyces cerevisiae" was a major or minor topic of these publication. (harvard.edu)
  • Below are the most recent publications written about "cdc42 GTP-Binding Protein, Saccharomyces cerevisiae" by people in Profiles. (harvard.edu)
  • Use of bimolecular fluorescence complementation to study in vivo interactions between Cdc42p and Rdi1p of Saccharomyces cerevisiae. (harvard.edu)
  • Putative orthologues of functionally defined signalling components in Saccharomyces cerevisiae were identified by performing reciprocal BLASTP searches, and the percent amino acid identities of these orthologues recorded. (biomedcentral.com)
  • However, these stress signalling pathways have been characterized to the greatest extent in the relatively benign model yeast, Saccharomyces cerevisiae . (biomedcentral.com)
  • We have examined connections between nutrients, and the expression and activity of Cln3-Cdc28 kinase that regulates the G1-S boundary of the cell cycle in yeast, a point referred to as Start. (yeastgenome.org)
  • Sho1 is a putative osmosensor that regulates the Pbs2-Hog1 MAP kinase module directly [ 16 ], whereas Sln1 controls a phosphorelay system that down-regulates the MAP kinase module in the absence of hyperosmotic stress [ 4 , 17 ]. (biomedcentral.com)
  • We found that altering the activity of Cdc28 had profound effects on morphogenesis during the yeast cell cycle. (rupress.org)
  • A sequence-specific DNA-binding protein that plays an essential role as a global regulator of yeast cell cycle control. (harvard.edu)
  • Because Cdc28 protein kinase and Dbf4 protein, a Cdc7 kinase regulator, are also important for induced mutagnesis and the CDC7 promoter is not induced in response to DNA damage, Cdc7 protein kinase may be regulated post-translationally following DNA damage, in the same manner as it is regulated during the cell cycle. (naver.com)
  • To better understand these apparently disparate roles, we constructed a yeast strain in which the resident CDC28 gene was replaced by its human homolog, CDC2Hs. (scripps.edu)
  • CDK4 (Cyclin Dependent Kinase 4) is a Protein Coding gene. (genecards.org)
  • This protein protein interaction antibody pair set comes with two antibodies to detect the protein-protein interaction, one against the CDK4 protein, and the other against the CCND1 protein for use in in situ Proximity Ligation Assay . (abnova.com)
  • Representative image of Proximity Ligation Assay of protein-protein interactions between CDK4 and CCND1. (abnova.com)
  • Cdk4 forms a complex with cyclin D and phosphorylates Rb protein, leading to liberation of the transcription factor E2F. (sinobiological.com)
  • By testing a series of Sic1 truncation mutants, we have mapped the minimal domain necessary for Cdc28/Clb inhibition in vivo to the C-terminal 70 amino acids of Sic1. (stanford.edu)
  • In the opaque phase, cells differentially express the gene OP4, which encodes a putative protein 402 amino acids in length that contains a highly hydrophobic amino-terminal sequence and a carboxy-terminal sequence with a pI of 10.73. (naver.com)
  • The origins are bound throughout the cell cycle by a six-member protein complex known as the origin-recognition complex (ORC). (genetics.org)
  • Several lines of evidence point to the Mcm complex as the substrate of Cdc7p kinase. (genetics.org)
  • In addition, and importantly, the activities of certain septin-associated protein kinases also regulate the state of organization of the septins themselves, creating a complex feedback loop. (frontiersin.org)
  • Protein import experiments of precursor from the oligomeric complex into intact pea chloroplasts reveal three- to fourfold higher translocation rates compared with the free precursor, which is not complexed. (plantcell.org)
  • In the first reaction, known as licensing, a specific protein-origin DNA complex, called the pre-replicative complex (pre-RC), is assembled at origins during the G1 phase of the cell cycle by the loading of an inactive form of the Mcm2-7 helicase complex. (prolekare.cz)
  • This protein associates with and is regulated by the regulatory subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A) and p27Kip1 (CDKN1B). (abcam.com)
  • Their activation at START depends primarily on the cyclin/cyclin-dependent kinase (CDK) complex Cln3-Cdc28. (biomedcentral.com)
  • Each red dot represents the detection of protein-protein interaction complex. (abnova.com)
  • Each cyclin is expressed during a specific cell phase and forms a complex with CDK to phosphorylate target proteins that are related to cell cycle-dependent functions ( 3 , 4 ). (sciencemag.org)
  • Dong H, Roeder G. Organization of the yeast Zip1 protein within the central region of the synaptonemal complex. (labome.org)
  • Component of the lid subcomplex of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins. (string-db.org)
  • The kinase complex containing this cyclin and the elongation factor can interact with, and act as a cofactor of human immunodeficiency virus type 1 (HIV-1) Tat protein, and was shown to be both necessary and sufficient for full activation of viral transcription. (abnova.com)
  • PAP is phosphorylated at multiple Ser and Thr residues and is dephosphorylated for in vivo function by the Nem1p-Spo7p protein phosphatase complex localized in the nuclear/endoplasmic reticulum membrane. (semanticscholar.org)
  • Here, we have investigated TNTs in CML cells and following treatment with the highly effective CML therapeutics tyrosine kinase inhibitors (TKIs) and interferon‐α (IFNα). (uio.no)
  • GO annotations related to this gene include transferase activity, transferring phosphorus-containing groups and protein tyrosine kinase activity . (genecards.org)
  • This was accomplished through a genetic and molecular analysis of the mechanism by which the mcm5-bob1 mutation bypasses the function of the Cdc7p/Dbf4p kinase. (genetics.org)
  • Molecular genetic studies of the Cdc7 protein kinase and induced mutagenesis in yeast. (naver.com)
  • The Plasmodium falciparum genome encodes a number of proteins putatively involved in calcium signaling, including calmodulin-related proteins, a calcium-transporting ATPase, and a family of CDPKs, which are composed of a protein kinase catalytic domain fused to a calcium-binding domain. (asmscience.org)
  • Discovering the physiological substrates of protein kinases is a major challenge, and we have pursued a number of genomics approaches to reveal the processes regulated by Pho85 and to understand the root cause of reduced cellular fitness in pho85 Δ mutant strains. (asm.org)
  • In the case of pre-bud site assembly following START, we found that the actin rearrangement could be triggered by Cln/Cdc28 activation in the absence of de novo protein synthesis, suggesting that the kinase may directly phosphorylate substrates (such as actin-binding proteins) that regulate actin distribution in cells. (rupress.org)
  • Links the pheromone response G-protein beta gamma subunits to downstream signaling components. (uniprot.org)
  • Casein kinase 1 is responsible for most of the hyperphosphorylation of Mih1, whereas protein phosphatase 2A associated with Cdc55 dephosphorylates Mih1. (rupress.org)
  • A low expression level of cyclin-dependent kinase (Cdk) inhibitor p27 is associated with high aggressiveness and poor prognosis of various carcinomas. (aacrjournals.org)
  • p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, is related to p21 (1994) Toyoshima Hideo et al. (naver.com)
  • At this time, their cytoplasm has gained MPF activity and, even in the absence of protein synthesis ( Wasserman and Masui, 1975 ), it drives recipient oocytes into M phase when transferred into G2-arrested oocytes. (biologists.org)
  • This demonstrated that protein synthesis is required at each cell cycle for chromosome condensation and nuclear envelope breakdown and thus for the G2/M phase transition to occur. (biologists.org)
  • At this point the cycle progresses into a phase of rapid protein synthesis to ensure cellular growth. (edu.au)
  • In Start, yeast cells decide whether or not to initiate a new cell cycle depending on external (nutrient availability, presence of pheromones) and internal (protein synthesis/cell size, DNA integrity) cues [ 14 ]. (biomedcentral.com)
  • The intracellular localization of the S. cerevisiae transcription factor SWI5 is cell cycle dependent. (ox.ac.uk)
  • Expression of VTC4 is regulated by Pho4, a transcription factor that is inhibited by the Pho80-Pho85 kinase. (asm.org)
  • Cyclin A1 was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. (abcam.com)
  • Cyclin-dependent kinase that phosphorylates the transcription factor ETS2 (in vitro) and positively controls its proteasomal degradation (in cells) (PubMed:24218572). (nih.gov)
  • Thus, a new generation of engineered kinases and inhibitors may provide greater flexibility and reliability to the study of kinase activity in vivo. (sciencemag.org)
  • This product is an active protein and may elicit a biological response in vivo, handle with caution. (abcam.com)
  • In particular, as discussed here, septin-based structures recruit, and thereby localize (and, in some cases, regulate the activity of) a multiplicity of protein kinases that integrate multiple inputs into signaling pathways and ultimately initiate ensuing biological responses (Figure 1 ). (frontiersin.org)
  • Identifying the pathways in which kinases function leads to a greater understanding of what proteins are important for physiological processes. (sciencemag.org)
  • An analysis of protein-protein interactions in cross-talk pathways reveals CRKL as a novel prognostic marker in hepatocellular carcinoma. (abnova.com)
  • We find that Cln3 protein levels are highest in glucose and lower in poorer carbon sources. (yeastgenome.org)
  • Shokat and colleagues have recently developed kinase mutants that accommodate bulky ATP analog kinase inhibitors yet retain near-wild-type kinase activity in the absence of the inhibitors. (sciencemag.org)
  • All three cak1 mutants displayed significant synthetic interactions with loss-of-function mutations in CDC28 and KIN28. (ox.ac.uk)
  • p>Describes annotations that are concluded from looking at variations or changes in a gene product such as mutations or abnormal levels and includes techniques such as knockouts, overexpression, anti-sense experiments and use of specific protein inhibitors. (uniprot.org)
  • Kinase Inhibitors: New and Improved! (sciencemag.org)
  • However, the generation of supposed specific kinase inhibitors is tenuous at best. (sciencemag.org)
  • Wild-type protein kinases are unable to bind the bulky inhibitors. (sciencemag.org)
  • As all three serines are phosphorylated by purified CDC28-dependent H1 kinase activity in vitro, we propose a model in which the CDC28 kinase acts directly to control nuclear entry of SWI5. (ox.ac.uk)
  • This checkpoint requires the SWE1 gene, encoding a kinase capable of phosphorylating Cdc28 on tyrosine 19, thus inhibiting its kinase activity. (searlescholars.net)
  • During the checkpoint-induced G2 delay, CLB transcription is repressed, while SWE1 transcription is induced: both of these contribute to lowering Cdc28 activity. (searlescholars.net)
  • The kinase activity. (antibodies-online.com)
  • Environmental stimuli and progress through the cell cycle are monitored through checkpoint mechanisms that influence Cdc28 activity at key cell cycle stages. (stanford.edu)
  • The yeast STE12 protein binds to the DNA sequence mediating pheromone induction. (naver.com)
  • The contrast between C. albicans and S. cerevisiae can provide unique insight into regulatory mechanisms, interpathway relationships, and general aspects of eukaryotic biology. (asm.org)
  • Septins are a family of eukaryotic GTP-binding proteins that associate into linear rods, which, in turn, polymerize end-on-end into filaments, and further assemble into other, more elaborate super-structures at discrete subcellular locations. (frontiersin.org)
  • In eukaryotic cells, the basic cellular functions occurring inside the nucleus, like transcription or DNA replication, require the transport of proteins across the nuclear envelope. (biomedcentral.com)
  • This protein kinase is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. (bio-rad.com)
  • Cyclin A1 (CCNA1) belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. (abcam.com)
  • Thus, although the La protein is dispensable for growth in these yeasts, both the structure of the protein and its function in pre-tRNA maturation have been highly conserved throughout evolution. (labome.org)
  • We find that homozygous mutations may be isolated at three nonessential loci ( ADE2, RIM20 , and YGR189 ), while only allelic triplications were found at two essential loci ( SNF1 and CDC28 ). (asm.org)
  • Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. (senescence.info)