Cardiomyopathy, Dilated: A form of CARDIAC MUSCLE disease that is characterized by ventricular dilation, VENTRICULAR DYSFUNCTION, and HEART FAILURE. Risk factors include SMOKING; ALCOHOL DRINKING; HYPERTENSION; INFECTION; PREGNANCY; and mutations in the LMNA gene encoding LAMIN TYPE A, a NUCLEAR LAMINA protein.Cardiomyopathy, Hypertrophic: A form of CARDIAC MUSCLE disease, characterized by left and/or right ventricular hypertrophy (HYPERTROPHY, LEFT VENTRICULAR; HYPERTROPHY, RIGHT VENTRICULAR), frequent asymmetrical involvement of the HEART SEPTUM, and normal or reduced left ventricular volume. Risk factors include HYPERTENSION; AORTIC STENOSIS; and gene MUTATION; (FAMILIAL HYPERTROPHIC CARDIOMYOPATHY).Cardiomyopathies: A group of diseases in which the dominant feature is the involvement of the CARDIAC MUSCLE itself. Cardiomyopathies are classified according to their predominant pathophysiological features (DILATED CARDIOMYOPATHY; HYPERTROPHIC CARDIOMYOPATHY; RESTRICTIVE CARDIOMYOPATHY) or their etiological/pathological factors (CARDIOMYOPATHY, ALCOHOLIC; ENDOCARDIAL FIBROELASTOSIS).Cardiomyopathy, Restrictive: A form of CARDIAC MUSCLE disease in which the ventricular walls are excessively rigid, impeding ventricular filling. It is marked by reduced diastolic volume of either or both ventricles but normal or nearly normal systolic function. It may be idiopathic or associated with other diseases (ENDOMYOCARDIAL FIBROSIS or AMYLOIDOSIS) causing interstitial fibrosis.Takotsubo Cardiomyopathy: A transient left ventricular apical dysfunction or ballooning accompanied by electrocardiographic (ECG) T wave inversions. This abnormality is associated with high levels of CATECHOLAMINES, either administered or endogenously secreted from a tumor or during extreme stress.Cardiomyopathy, Hypertrophic, Familial: An autosomal dominant inherited form of HYPERTROPHIC CARDIOMYOPATHY. It results from any of more than 50 mutations involving genes encoding contractile proteins such as VENTRICULAR MYOSINS; cardiac TROPONIN T; ALPHA-TROPOMYOSIN.Chagas Cardiomyopathy: A disease of the CARDIAC MUSCLE developed subsequent to the initial protozoan infection by TRYPANOSOMA CRUZI. After infection, less than 10% develop acute illness such as MYOCARDITIS (mostly in children). The disease then enters a latent phase without clinical symptoms until about 20 years later. Myocardial symptoms of advanced CHAGAS DISEASE include conduction defects (HEART BLOCK) and CARDIOMEGALY.Myocardium: The muscle tissue of the HEART. It is composed of striated, involuntary muscle cells (MYOCYTES, CARDIAC) connected to form the contractile pump to generate blood flow.Cardiomyopathy, Alcoholic: Disease of CARDIAC MUSCLE resulting from chronic excessive alcohol consumption. Myocardial damage can be caused by: (1) a toxic effect of alcohol; (2) malnutrition in alcoholics such as THIAMINE DEFICIENCY; or (3) toxic effect of additives in alcoholic beverages such as COBALT. This disease is usually manifested by DYSPNEA and palpitations with CARDIOMEGALY and congestive heart failure (HEART FAILURE).Echocardiography: Ultrasonic recording of the size, motion, and composition of the heart and surrounding tissues. The standard approach is transthoracic.Arrhythmogenic Right Ventricular Dysplasia: A congenital cardiomyopathy that is characterized by infiltration of adipose and fibrous tissue into the RIGHT VENTRICLE wall and loss of myocardial cells. Primary injuries usually are at the free wall of right ventricular and right atria resulting in ventricular and supraventricular arrhythmias.Diabetic Cardiomyopathies: Diabetes complications in which VENTRICULAR REMODELING in the absence of CORONARY ATHEROSCLEROSIS and hypertension results in cardiac dysfunctions, typically LEFT VENTRICULAR DYSFUNCTION. The changes also result in myocardial hypertrophy, myocardial necrosis and fibrosis, and collagen deposition due to impaired glucose tolerance.Electrocardiography: Recording of the moment-to-moment electromotive forces of the HEART as projected onto various sites on the body's surface, delineated as a scalar function of time. The recording is monitored by a tracing on slow moving chart paper or by observing it on a cardioscope, which is a CATHODE RAY TUBE DISPLAY.Ventricular Function, Left: The hemodynamic and electrophysiological action of the left HEART VENTRICLE. Its measurement is an important aspect of the clinical evaluation of patients with heart disease to determine the effects of the disease on cardiac performance.Myocarditis: Inflammatory processes of the muscular walls of the heart (MYOCARDIUM) which result in injury to the cardiac muscle cells (MYOCYTES, CARDIAC). Manifestations range from subclinical to sudden death (DEATH, SUDDEN). Myocarditis in association with cardiac dysfunction is classified as inflammatory CARDIOMYOPATHY usually caused by INFECTION, autoimmune diseases, or responses to toxic substances. Myocarditis is also a common cause of DILATED CARDIOMYOPATHY and other cardiomyopathies.Ventricular Dysfunction, Left: A condition in which the LEFT VENTRICLE of the heart was functionally impaired. This condition usually leads to HEART FAILURE; MYOCARDIAL INFARCTION; and other cardiovascular complications. Diagnosis is made by measuring the diminished ejection fraction and a depressed level of motility of the left ventricular wall.Heart Ventricles: The lower right and left chambers of the heart. The right ventricle pumps venous BLOOD into the LUNGS and the left ventricle pumps oxygenated blood into the systemic arterial circulation.Heart Septum: This structure includes the thin muscular atrial septum between the two HEART ATRIA, and the thick muscular ventricular septum between the two HEART VENTRICLES.Heart Failure: A heterogeneous condition in which the heart is unable to pump out sufficient blood to meet the metabolic need of the body. Heart failure can be caused by structural defects, functional abnormalities (VENTRICULAR DYSFUNCTION), or a sudden overload beyond its capacity. Chronic heart failure is more common than acute heart failure which results from sudden insult to cardiac function, such as MYOCARDIAL INFARCTION.Ventricular Outflow Obstruction: Occlusion of the outflow tract in either the LEFT VENTRICLE or the RIGHT VENTRICLE of the heart. This may result from CONGENITAL HEART DEFECTS, predisposing heart diseases, complications of surgery, or HEART NEOPLASMS.Myocardial Contraction: Contractile activity of the MYOCARDIUM.Myocytes, Cardiac: Striated muscle cells found in the heart. They are derived from cardiac myoblasts (MYOBLASTS, CARDIAC).Heart: The hollow, muscular organ that maintains the circulation of the blood.Stroke Volume: The amount of BLOOD pumped out of the HEART per beat, not to be confused with cardiac output (volume/time). It is calculated as the difference between the end-diastolic volume and the end-systolic volume.Death, Sudden, Cardiac: Unexpected rapid natural death due to cardiovascular collapse within one hour of initial symptoms. It is usually caused by the worsening of existing heart diseases. The sudden onset of symptoms, such as CHEST PAIN and CARDIAC ARRHYTHMIAS, particularly VENTRICULAR TACHYCARDIA, can lead to the loss of consciousness and cardiac arrest followed by biological death. (from Braunwald's Heart Disease: A Textbook of Cardiovascular Medicine, 7th ed., 2005)Cardiac Myosins: Myosin type II isoforms found in cardiac muscle.Peripartum Period: The period shortly before, during, and immediately after giving birth.Echocardiography, Doppler: Measurement of intracardiac blood flow using an M-mode and/or two-dimensional (2-D) echocardiogram while simultaneously recording the spectrum of the audible Doppler signal (e.g., velocity, direction, amplitude, intensity, timing) reflected from the moving column of red blood cells.Ventricular Myosins: Isoforms of MYOSIN TYPE II, specifically found in the ventricular muscle of the HEART. Defects in the genes encoding ventricular myosins result in FAMILIAL HYPERTROPHIC CARDIOMYOPATHY.Fibrosis: Any pathological condition where fibrous connective tissue invades any organ, usually as a consequence of inflammation or other injury.Tachycardia, Ventricular: An abnormally rapid ventricular rhythm usually in excess of 150 beats per minute. It is generated within the ventricle below the BUNDLE OF HIS, either as autonomic impulse formation or reentrant impulse conduction. Depending on the etiology, onset of ventricular tachycardia can be paroxysmal (sudden) or nonparoxysmal, its wide QRS complexes can be uniform or polymorphic, and the ventricular beating may be independent of the atrial beating (AV dissociation).Sarcomeres: The repeating contractile units of the MYOFIBRIL, delimited by Z bands along its length.Endomyocardial Fibrosis: A condition characterized by the thickening of the ventricular ENDOCARDIUM and subendocardium (MYOCARDIUM), seen mostly in children and young adults in the TROPICAL CLIMATE. The fibrous tissue extends from the apex toward and often involves the HEART VALVES causing restrictive blood flow into the respective ventricles (CARDIOMYOPATHY, RESTRICTIVE).Pedigree: The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.Myocardial Ischemia: A disorder of cardiac function caused by insufficient blood flow to the muscle tissue of the heart. The decreased blood flow may be due to narrowing of the coronary arteries (CORONARY ARTERY DISEASE), to obstruction by a thrombus (CORONARY THROMBOSIS), or less commonly, to diffuse narrowing of arterioles and other small vessels within the heart. Severe interruption of the blood supply to the myocardial tissue may result in necrosis of cardiac muscle (MYOCARDIAL INFARCTION).Myosin Heavy Chains: The larger subunits of MYOSINS. The heavy chains have a molecular weight of about 230 kDa and each heavy chain is usually associated with a dissimilar pair of MYOSIN LIGHT CHAINS. The heavy chains possess actin-binding and ATPase activity.Hypertrophy, Left Ventricular: Enlargement of the LEFT VENTRICLE of the heart. This increase in ventricular mass is attributed to sustained abnormal pressure or volume loads and is a contributor to cardiovascular morbidity and mortality.Arrhythmias, Cardiac: Any disturbances of the normal rhythmic beating of the heart or MYOCARDIAL CONTRACTION. Cardiac arrhythmias can be classified by the abnormalities in HEART RATE, disorders of electrical impulse generation, or impulse conduction.Endocardium: The innermost layer of the heart, comprised of endothelial cells.Plakophilins: Members of the armadillo family of proteins that are found in DESMOSOMES and interact with various proteins including desmocadherins; DESMOPLAKIN; ACTIN FILAMENTS; and KERATINS.Heart Transplantation: The transference of a heart from one human or animal to another.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Lamin Type A: A subclass of developmentally regulated lamins having a neutral isoelectric point. They are found to disassociate from nuclear membranes during mitosis.Ventricular Remodeling: The geometric and structural changes that the HEART VENTRICLES undergo, usually following MYOCARDIAL INFARCTION. It comprises expansion of the infarct and dilatation of the healthy ventricle segments. While most prevalent in the left ventricle, it can also occur in the right ventricle.Troponin T: One of the three polypeptide chains that make up the TROPONIN complex. It is a cardiac-specific protein that binds to TROPOMYOSIN. It is released from damaged or injured heart muscle cells (MYOCYTES, CARDIAC). Defects in the gene encoding troponin T result in FAMILIAL HYPERTROPHIC CARDIOMYOPATHY.Hemodynamics: The movement and the forces involved in the movement of the blood through the CARDIOVASCULAR SYSTEM.Cardiac Pacing, Artificial: Regulation of the rate of contraction of the heart muscles by an artificial pacemaker.Diastole: Post-systolic relaxation of the HEART, especially the HEART VENTRICLES.Heart Diseases: Pathological conditions involving the HEART including its structural and functional abnormalities.Puerperal Disorders: Disorders or diseases associated with PUERPERIUM, the six-to-eight-week period immediately after PARTURITION in humans.Sarcoglycans: A family of transmembrane dystrophin-associated proteins that play a role in the membrane association of the DYSTROPHIN-ASSOCIATED PROTEIN COMPLEX.Cardiomegaly: Enlargement of the HEART, usually indicated by a cardiothoracic ratio above 0.50. Heart enlargement may involve the right, the left, or both HEART VENTRICLES or HEART ATRIA. Cardiomegaly is a nonspecific symptom seen in patients with chronic systolic heart failure (HEART FAILURE) or several forms of CARDIOMYOPATHIES.Defibrillators, Implantable: Implantable devices which continuously monitor the electrical activity of the heart and automatically detect and terminate ventricular tachycardia (TACHYCARDIA, VENTRICULAR) and VENTRICULAR FIBRILLATION. They consist of an impulse generator, batteries, and electrodes.Death, Sudden: The abrupt cessation of all vital bodily functions, manifested by the permanent loss of total cerebral, respiratory, and cardiovascular functions.Magnetic Resonance Imaging, Cine: A type of imaging technique used primarily in the field of cardiology. By coordinating the fast gradient-echo MRI sequence with retrospective ECG-gating, numerous short time frames evenly spaced in the cardiac cycle are produced. These images are laced together in a cinematic display so that wall motion of the ventricles, valve motion, and blood flow patterns in the heart and great vessels can be visualized.Desmoglein 2: A CALCIUM-dependent adhesion molecule of DESMOSOMES that also plays a role in embryonic STEM CELL proliferation.Follow-Up Studies: Studies in which individuals or populations are followed to assess the outcome of exposures, procedures, or effects of a characteristic, e.g., occurrence of disease.Systole: Period of contraction of the HEART, especially of the HEART VENTRICLES.Mice, Transgenic: Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.Disease Models, Animal: Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.Cardiac Catheterization: Procedures in which placement of CARDIAC CATHETERS is performed for therapeutic or diagnostic procedures.Glycogen Storage Disease Type IIb: An X-linked dominant multisystem disorder resulting in cardiomyopathy, myopathy and INTELLECTUAL DISABILITY. It is caused by mutation in the gene encoding LYSOSOMAL-ASSOCIATED MEMBRANE PROTEIN 2.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Mutation, Missense: A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)Isolated Noncompaction of the Ventricular Myocardium: Rare congenital cardiomyopathies characterized by the lack of left ventricular myocardium compaction. The noncompaction results in numerous prominent trabeculations and a loose myocardial meshwork (spongy myocardium) in the LEFT VENTRICLE. Heterogeneous clinical features include diminished systolic function sometimes associated with left ventricular dilation, that presents either neonatally or progressively. Often, the RIGHT VENTRICLE is also affected. CONGESTIVE HEART FAILURE; PULMONARY EMBOLISM; and ventricular ARRHYTHMIA are commonly seen.Pregnancy Complications, Cardiovascular: The co-occurrence of pregnancy and a cardiovascular disease. The disease may precede or follow FERTILIZATION and it may or may not have a deleterious effect on the pregnant woman or FETUS.Desmin: An intermediate filament protein found predominantly in smooth, skeletal, and cardiac muscle cells. Localized at the Z line. MW 50,000 to 55,000 is species dependent.Dystrophin: A muscle protein localized in surface membranes which is the product of the Duchenne/Becker muscular dystrophy gene. Individuals with Duchenne muscular dystrophy usually lack dystrophin completely while those with Becker muscular dystrophy have dystrophin of an altered size. It shares features with other cytoskeletal proteins such as SPECTRIN and alpha-actinin but the precise function of dystrophin is not clear. One possible role might be to preserve the integrity and alignment of the plasma membrane to the myofibrils during muscle contraction and relaxation. MW 400 kDa.Treatment Outcome: Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.Ventricular Dysfunction: A condition in which HEART VENTRICLES exhibit impaired function.Adrenergic beta-Antagonists: Drugs that bind to but do not activate beta-adrenergic receptors thereby blocking the actions of beta-adrenergic agonists. Adrenergic beta-antagonists are used for treatment of hypertension, cardiac arrhythmias, angina pectoris, glaucoma, migraine headaches, and anxiety.Mitral Valve: The valve between the left atrium and left ventricle of the heart.Heart Function Tests: Examinations used to diagnose and treat heart conditions.Mitral Valve Insufficiency: Backflow of blood from the LEFT VENTRICLE into the LEFT ATRIUM due to imperfect closure of the MITRAL VALVE. This can lead to mitral valve regurgitation.Ablation Techniques: Removal of tissue by vaporization, abrasion, or destruction. Methods used include heating tissue by hot liquids or microwave thermal heating, freezing (CRYOABLATION), chemical ablation, and photoablation with LASERS.3-Iodobenzylguanidine: A guanidine analog with specific affinity for tissues of the sympathetic nervous system and related tumors. The radiolabeled forms are used as antineoplastic agents and radioactive imaging agents. (Merck Index, 12th ed) MIBG serves as a neuron-blocking agent which has a strong affinity for, and retention in, the adrenal medulla and also inhibits ADP-ribosyltransferase.Prognosis: A prediction of the probable outcome of a disease based on a individual's condition and the usual course of the disease as seen in similar situations.Cardiotonic Agents: Agents that have a strengthening effect on the heart or that can increase cardiac output. They may be CARDIAC GLYCOSIDES; SYMPATHOMIMETICS; or other drugs. They are used after MYOCARDIAL INFARCT; CARDIAC SURGICAL PROCEDURES; in SHOCK; or in congestive heart failure (HEART FAILURE).Catheter Ablation: Removal of tissue with electrical current delivered via electrodes positioned at the distal end of a catheter. Energy sources are commonly direct current (DC-shock) or alternating current at radiofrequencies (usually 750 kHz). The technique is used most often to ablate the AV junction and/or accessory pathways in order to interrupt AV conduction and produce AV block in the treatment of various tachyarrhythmias.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Heart Block: Impaired conduction of cardiac impulse that can occur anywhere along the conduction pathway, such as between the SINOATRIAL NODE and the right atrium (SA block) or between atria and ventricles (AV block). Heart blocks can be classified by the duration, frequency, or completeness of conduction block. Reversibility depends on the degree of structural or functional defects.Predictive Value of Tests: In screening and diagnostic tests, the probability that a person with a positive test is a true positive (i.e., has the disease), is referred to as the predictive value of a positive test; whereas, the predictive value of a negative test is the probability that the person with a negative test does not have the disease. Predictive value is related to the sensitivity and specificity of the test.Biopsy: Removal and pathologic examination of specimens in the form of small pieces of tissue from the living body.Muscular Dystrophy, Duchenne: An X-linked recessive muscle disease caused by an inability to synthesize DYSTROPHIN, which is involved with maintaining the integrity of the sarcolemma. Muscle fibers undergo a process that features degeneration and regeneration. Clinical manifestations include proximal weakness in the first few years of life, pseudohypertrophy, cardiomyopathy (see MYOCARDIAL DISEASES), and an increased incidence of impaired mentation. Becker muscular dystrophy is a closely related condition featuring a later onset of disease (usually adolescence) and a slowly progressive course. (Adams et al., Principles of Neurology, 6th ed, p1415)Syncope: A transient loss of consciousness and postural tone caused by diminished blood flow to the brain (i.e., BRAIN ISCHEMIA). Presyncope refers to the sensation of lightheadedness and loss of strength that precedes a syncopal event or accompanies an incomplete syncope. (From Adams et al., Principles of Neurology, 6th ed, pp367-9)Epicardial Mapping: Recording the locations and measurements of electrical activity in the EPICARDIUM by placing electrodes on the surface of the heart to analyze the patterns of activation and to locate arrhythmogenic sites.Tropomyosin: A protein found in the thin filaments of muscle fibers. It inhibits contraction of the muscle unless its position is modified by TROPONIN.Electrocardiography, Ambulatory: Method in which prolonged electrocardiographic recordings are made on a portable tape recorder (Holter-type system) or solid-state device ("real-time" system), while the patient undergoes normal daily activities. It is useful in the diagnosis and management of intermittent cardiac arrhythmias and transient myocardial ischemia.Prospective Studies: Observation of a population for a sufficient number of persons over a sufficient number of years to generate incidence or mortality rates subsequent to the selection of the study group.Ventricular Dysfunction, Right: A condition in which the RIGHT VENTRICLE of the heart was functionally impaired. This condition usually leads to HEART FAILURE or MYOCARDIAL INFARCTION, and other cardiovascular complications. Diagnosis is made by measuring the diminished ejection fraction and a depressed level of motility of the right ventricular wall.Connectin: A giant elastic protein of molecular mass ranging from 2,993 kDa (cardiac), 3,300 kDa (psoas), to 3,700 kDa (soleus) having a kinase domain. The amino- terminal is involved in a Z line binding, and the carboxy-terminal region is bound to the myosin filament with an overlap between the counter-connectin filaments at the M line.Myofibrils: The long cylindrical contractile organelles of STRIATED MUSCLE cells composed of ACTIN FILAMENTS; MYOSIN filaments; and other proteins organized in arrays of repeating units called SARCOMERES .Mitochondria, Heart: The mitochondria of the myocardium.Bundle-Branch Block: A form of heart block in which the electrical stimulation of HEART VENTRICLES is interrupted at either one of the branches of BUNDLE OF HIS thus preventing the simultaneous depolarization of the two ventricles.Electrophysiologic Techniques, Cardiac: Methods to induce and measure electrical activities at specific sites in the heart to diagnose and treat problems with the heart's electrical system.Troponin I: One of the three polypeptide chains that make up the TROPONIN complex. It inhibits F-actin-myosin interactions.Myosins: A diverse superfamily of proteins that function as translocating proteins. They share the common characteristics of being able to bind ACTINS and hydrolyze MgATP. Myosins generally consist of heavy chains which are involved in locomotion, and light chains which are involved in regulation. Within the structure of myosin heavy chain are three domains: the head, the neck and the tail. The head region of the heavy chain contains the actin binding domain and MgATPase domain which provides energy for locomotion. The neck region is involved in binding the light-chains. The tail region provides the anchoring point that maintains the position of the heavy chain. The superfamily of myosins is organized into structural classes based upon the type and arrangement of the subunits they contain.Echocardiography, Doppler, Color: Echocardiography applying the Doppler effect, with the superposition of flow information as colors on a gray scale in a real-time image.Tachycardia: Abnormally rapid heartbeat, usually with a HEART RATE above 100 beats per minute for adults. Tachycardia accompanied by disturbance in the cardiac depolarization (cardiac arrhythmia) is called tachyarrhythmia.Coxsackievirus Infections: A heterogeneous group of infections produced by coxsackieviruses, including HERPANGINA, aseptic meningitis (MENINGITIS, ASEPTIC), a common-cold-like syndrome, a non-paralytic poliomyelitis-like syndrome, epidemic pleurodynia (PLEURODYNIA, EPIDEMIC) and a serious MYOCARDITIS.Pericarditis, Constrictive: Inflammation of the PERICARDIUM that is characterized by the fibrous scarring and adhesion of both serous layers, the VISCERAL PERICARDIUM and the PARIETAL PERICARDIUM leading to the loss of pericardial cavity. The thickened pericardium severely restricts cardiac filling. Clinical signs include FATIGUE, muscle wasting, and WEIGHT LOSS.Case-Control Studies: Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.Coronary Circulation: The circulation of blood through the CORONARY VESSELS of the HEART.Propanolamines: AMINO ALCOHOLS containing the propanolamine (NH2CH2CHOHCH2) group and its derivatives.Heart-Assist Devices: Small pumps, often implantable, designed for temporarily assisting the heart, usually the LEFT VENTRICLE, to pump blood. They consist of a pumping chamber and a power source, which may be partially or totally external to the body and activated by electromagnetic motors.Retrospective Studies: Studies used to test etiologic hypotheses in which inferences about an exposure to putative causal factors are derived from data relating to characteristics of persons under study or to events or experiences in their past. The essential feature is that some of the persons under study have the disease or outcome of interest and their characteristics are compared with those of unaffected persons.Pacemaker, Artificial: A device designed to stimulate, by electric impulses, contraction of the heart muscles. It may be temporary (external) or permanent (internal or internal-external).Natriuretic Peptide, Brain: A PEPTIDE that is secreted by the BRAIN and the HEART ATRIA, stored mainly in cardiac ventricular MYOCARDIUM. It can cause NATRIURESIS; DIURESIS; VASODILATION; and inhibits secretion of RENIN and ALDOSTERONE. It improves heart function. It contains 32 AMINO ACIDS.Genetic Testing: Detection of a MUTATION; GENOTYPE; KARYOTYPE; or specific ALLELES associated with genetic traits, heritable diseases, or predisposition to a disease, or that may lead to the disease in descendants. It includes prenatal genetic testing.Echocardiography, Doppler, Pulsed: Echocardiography applying the Doppler effect, with velocity detection combined with range discrimination. Short bursts of ultrasound are transmitted at regular intervals and the echoes are demodulated as they return.IodobenzenesDesmocollins: A group of desmosomal cadherins with cytoplasmic tails that are divergent from those of classical CADHERINS. Their intracytoplasmic domains bind PLAKOGLOBIN; PLAKOPHILINS; and DESMOPLAKINS.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.LIM Domain Proteins: A large class of structurally-related proteins that contain one or more LIM zinc finger domains. Many of the proteins in this class are involved in intracellular signaling processes and mediate their effects via LIM domain protein-protein interactions. The name LIM is derived from the first three proteins in which the motif was found: LIN-11, Isl1 and Mec-3.Severity of Illness Index: Levels within a diagnostic group which are established by various measurement criteria applied to the seriousness of a patient's disorder.Metoprolol: A selective adrenergic beta-1 blocking agent that is commonly used to treat ANGINA PECTORIS; HYPERTENSION; and CARDIAC ARRHYTHMIAS.Magnetic Resonance Imaging: Non-invasive method of demonstrating internal anatomy based on the principle that atomic nuclei in a strong magnetic field absorb pulses of radiofrequency energy and emit them as radiowaves which can be reconstructed into computerized images. The concept includes proton spin tomographic techniques.Desmoplakins: Desmoplakins are cytoskeletal linker proteins that anchor INTERMEDIATE FILAMENTS to the PLASMA MEMBRANE at DESMOSOMES.Heart Conduction System: An impulse-conducting system composed of modified cardiac muscle, having the power of spontaneous rhythmicity and conduction more highly developed than the rest of the heart.Noonan Syndrome: A genetically heterogeneous, multifaceted disorder characterized by short stature, webbed neck, ptosis, skeletal malformations, hypertelorism, hormonal imbalance, CRYPTORCHIDISM, multiple cardiac abnormalities (most commonly including PULMONARY VALVE STENOSIS), and some degree of INTELLECTUAL DISABILITY. The phenotype bears similarities to that of TURNER SYNDROME that occurs only in females and has its basis in a 45, X karyotype abnormality. Noonan syndrome occurs in both males and females with a normal karyotype (46,XX and 46,XY). Mutations in a several genes (PTPN11, KRAS, SOS1, NF1 and RAF1) have been associated the the NS phenotype. Mutations in PTPN11 are the most common. LEOPARD SYNDROME, a disorder that has clinical features overlapping those of Noonan Syndrome, is also due to mutations in PTPN11. In addition, there is overlap with the syndrome called neurofibromatosis-Noonan syndrome due to mutations in NF1.Receptors, Adrenergic, beta-1: A subclass of beta-adrenergic receptors (RECEPTORS, ADRENERGIC, BETA). The adrenergic beta-1 receptors are equally sensitive to EPINEPHRINE and NOREPINEPHRINE and bind the agonist DOBUTAMINE and the antagonist METOPROLOL with high affinity. They are found in the HEART, juxtaglomerular cells, and in the central and peripheral nervous systems.Desmosomes: A type of junction that attaches one cell to its neighbor. One of a number of differentiated regions which occur, for example, where the cytoplasmic membranes of adjacent epithelial cells are closely apposed. It consists of a circular region of each membrane together with associated intracellular microfilaments and an intercellular material which may include, for example, mucopolysaccharides. (From Glick, Glossary of Biochemistry and Molecular Biology, 1990; Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Ventricular Pressure: The pressure within a CARDIAC VENTRICLE. Ventricular pressure waveforms can be measured in the beating heart by catheterization or estimated using imaging techniques (e.g., DOPPLER ECHOCARDIOGRAPHY). The information is useful in evaluating the function of the MYOCARDIUM; CARDIAC VALVES; and PERICARDIUM, particularly with simultaneous measurement of other (e.g., aortic or atrial) pressures.Muscle Proteins: The protein constituents of muscle, the major ones being ACTINS and MYOSINS. More than a dozen accessory proteins exist including TROPONIN; TROPOMYOSIN; and DYSTROPHIN.Carbazoles: Benzo-indoles similar to CARBOLINES which are pyrido-indoles. In plants, carbazoles are derived from indole and form some of the INDOLE ALKALOIDS.Exercise Test: Controlled physical activity which is performed in order to allow assessment of physiological functions, particularly cardiovascular and pulmonary, but also aerobic capacity. Maximal (most intense) exercise is usually required but submaximal exercise is also used.Dobutamine: A catecholamine derivative with specificity for BETA-1 ADRENERGIC RECEPTORS. It is commonly used as a cardiotonic agent after CARDIAC SURGERY and during DOBUTAMINE STRESS ECHOCARDIOGRAPHY.Ventricular Premature Complexes: A type of cardiac arrhythmia with premature contractions of the HEART VENTRICLES. It is characterized by the premature QRS complex on ECG that is of abnormal shape and great duration (generally >129 msec). It is the most common form of all cardiac arrhythmias. Premature ventricular complexes have no clinical significance except in concurrence with heart diseases.Cardiac Output, Low: A state of subnormal or depressed cardiac output at rest or during stress. It is a characteristic of CARDIOVASCULAR DISEASES, including congenital, valvular, rheumatic, hypertensive, coronary, and cardiomyopathic. The serious form of low cardiac output is characterized by marked reduction in STROKE VOLUME, and systemic vasoconstriction resulting in cold, pale, and sometimes cyanotic extremities.Fatal Outcome: Death resulting from the presence of a disease in an individual, as shown by a single case report or a limited number of patients. This should be differentiated from DEATH, the physiological cessation of life and from MORTALITY, an epidemiological or statistical concept.Heart Rate: The number of times the HEART VENTRICLES contract per unit of time, usually per minute.Heterozygote: An individual having different alleles at one or more loci regarding a specific character.Doxorubicin: Antineoplastic antibiotic obtained from Streptomyces peucetius. It is a hydroxy derivative of DAUNORUBICIN.Diabetes Mellitus, Experimental: Diabetes mellitus induced experimentally by administration of various diabetogenic agents or by PANCREATECTOMY.Friedreich Ataxia: An autosomal recessive disease, usually of childhood onset, characterized pathologically by degeneration of the spinocerebellar tracts, posterior columns, and to a lesser extent the corticospinal tracts. Clinical manifestations include GAIT ATAXIA, pes cavus, speech impairment, lateral curvature of spine, rhythmic head tremor, kyphoscoliosis, congestive heart failure (secondary to a cardiomyopathy), and lower extremity weakness. Most forms of this condition are associated with a mutation in a gene on chromosome 9, at band q13, which codes for the mitochondrial protein frataxin. (From Adams et al., Principles of Neurology, 6th ed, p1081; N Engl J Med 1996 Oct 17;335(16):1169-75) The severity of Friedreich ataxia associated with expansion of GAA repeats in the first intron of the frataxin gene correlates with the number of trinucleotide repeats. (From Durr et al, N Engl J Med 1996 Oct 17;335(16):1169-75)Muscular Dystrophies: A heterogeneous group of inherited MYOPATHIES, characterized by wasting and weakness of the SKELETAL MUSCLE. They are categorized by the sites of MUSCLE WEAKNESS; AGE OF ONSET; and INHERITANCE PATTERNS.Cardiovascular Agents: Agents that affect the rate or intensity of cardiac contraction, blood vessel diameter, or blood volume.Ventricular Septum: The muscular structure separating the right and the left lower chambers (HEART VENTRICLES) of the heart. The ventricular septum consists of a very small membranous portion just beneath the AORTIC VALVE, and a large thick muscular portion consisting of three sections including the inlet septum, the trabecular septum, and the outlet septum.Penetrance: The percent frequency with which a dominant or homozygous recessive gene or gene combination manifests itself in the phenotype of the carriers. (From Glossary of Genetics, 5th ed)Radionuclide Ventriculography: Imaging of a ventricle of the heart after the injection of a radioactive contrast medium. The technique is less invasive than cardiac catheterization and is used to assess ventricular function.Amyloidosis: A group of sporadic, familial and/or inherited, degenerative, and infectious disease processes, linked by the common theme of abnormal protein folding and deposition of AMYLOID. As the amyloid deposits enlarge they displace normal tissue structures, causing disruption of function. Various signs and symptoms depend on the location and size of the deposits.Mitochondrial Myopathies: A group of muscle diseases associated with abnormal mitochondria function.Sarcoplasmic Reticulum Calcium-Transporting ATPases: Calcium-transporting ATPases that catalyze the active transport of CALCIUM into the SARCOPLASMIC RETICULUM vesicles from the CYTOPLASM. They are primarily found in MUSCLE CELLS and play a role in the relaxation of MUSCLES.Antibiotics, Antineoplastic: Chemical substances, produced by microorganisms, inhibiting or preventing the proliferation of neoplasms.Disease Progression: The worsening of a disease over time. This concept is most often used for chronic and incurable diseases where the stage of the disease is an important determinant of therapy and prognosis.Ventricular Fibrillation: A potentially lethal cardiac arrhythmia that is characterized by uncoordinated extremely rapid firing of electrical impulses (400-600/min) in HEART VENTRICLES. Such asynchronous ventricular quivering or fibrillation prevents any effective cardiac output and results in unconsciousness (SYNCOPE). It is one of the major electrocardiographic patterns seen with CARDIAC ARREST.Heart Aneurysm: A localized bulging or dilatation in the muscle wall of a heart (MYOCARDIUM), usually in the LEFT VENTRICLE. Blood-filled aneurysms are dangerous because they may burst. Fibrous aneurysms interfere with the heart function through the loss of contractility. True aneurysm is bound by the vessel wall or cardiac wall. False aneurysms are HEMATOMA caused by myocardial rupture.Atrial Natriuretic Factor: A potent natriuretic and vasodilatory peptide or mixture of different-sized low molecular weight PEPTIDES derived from a common precursor and secreted mainly by the HEART ATRIUM. All these peptides share a sequence of about 20 AMINO ACIDS.Sports: Activities or games, usually involving physical effort or skill. Reasons for engagement in sports include pleasure, competition, and/or financial reward.Anti-Arrhythmia Agents: Agents used for the treatment or prevention of cardiac arrhythmias. They may affect the polarization-repolarization phase of the action potential, its excitability or refractoriness, or impulse conduction or membrane responsiveness within cardiac fibers. Anti-arrhythmia agents are often classed into four main groups according to their mechanism of action: sodium channel blockade, beta-adrenergic blockade, repolarization prolongation, or calcium channel blockade.Risk Factors: An aspect of personal behavior or lifestyle, environmental exposure, or inborn or inherited characteristic, which, on the basis of epidemiologic evidence, is known to be associated with a health-related condition considered important to prevent.Trypanosoma cruzi: The agent of South American trypanosomiasis or CHAGAS DISEASE. Its vertebrate hosts are man and various domestic and wild animals. Insects of several species are vectors.Enterovirus B, Human: A species of ENTEROVIRUS infecting humans and containing 36 serotypes. It is comprised of all the echoviruses and a few coxsackieviruses, including all of those previously named coxsackievirus B.Gadolinium DTPA: A complex of gadolinium with a chelating agent, diethylenetriamine penta-acetic acid (DTPA see PENTETIC ACID), that is given to enhance the image in cranial and spinal MRIs. (From Martindale, The Extra Pharmacopoeia, 30th ed, p706)Barth Syndrome: Rare congenital X-linked disorder of lipid metabolism. Barth syndrome is transmitted in an X-linked recessive pattern. The syndrome is characterized by muscular weakness, growth retardation, DILATED CARDIOMYOPATHY, variable NEUTROPENIA, 3-methylglutaconic aciduria (type II) and decreases in mitochondrial CARDIOLIPIN level. Other biochemical and morphological mitochondrial abnormalities also exist.Atrioventricular Block: Impaired impulse conduction from HEART ATRIA to HEART VENTRICLES. AV block can mean delayed or completely blocked impulse conduction.Enterovirus: A genus of the family PICORNAVIRIDAE whose members preferentially inhabit the intestinal tract of a variety of hosts. The genus contains many species. Newly described members of human enteroviruses are assigned continuous numbers with the species designated "human enterovirus".Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Calcium: A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.Contrast Media: Substances used to allow enhanced visualization of tissues.Papillary Muscles: Conical muscular projections from the walls of the cardiac ventricles, attached to the cusps of the atrioventricular valves by the chordae tendineae.Coronary Angiography: Radiography of the vascular system of the heart muscle after injection of a contrast medium.Body Surface Potential Mapping: Recording of regional electrophysiological information by analysis of surface potentials to give a complete picture of the effects of the currents from the heart on the body surface. It has been applied to the diagnosis of old inferior myocardial infarction, localization of the bypass pathway in Wolff-Parkinson-White syndrome, recognition of ventricular hypertrophy, estimation of the size of a myocardial infarct, and the effects of different interventions designed to reduce infarct size. The limiting factor at present is the complexity of the recording and analysis, which requires 100 or more electrodes, sophisticated instrumentation, and dedicated personnel. (Braunwald, Heart Disease, 4th ed)Survival Analysis: A class of statistical procedures for estimating the survival function (function of time, starting with a population 100% well at a given time and providing the percentage of the population still well at later times). The survival analysis is then used for making inferences about the effects of treatments, prognostic factors, exposures, and other covariates on the function.Mice, Knockout: Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.Phonocardiography: Graphic registration of the heart sounds picked up as vibrations and transformed by a piezoelectric crystal microphone into a varying electrical output according to the stresses imposed by the sound waves. The electrical output is amplified by a stethograph amplifier and recorded by a device incorporated into the electrocardiograph or by a multichannel recording machine.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Muscular Diseases: Acquired, familial, and congenital disorders of SKELETAL MUSCLE and SMOOTH MUSCLE.Gated Blood-Pool Imaging: Radionuclide ventriculography where scintigraphic data is acquired during repeated cardiac cycles at specific times in the cycle, using an electrocardiographic synchronizer or gating device. Analysis of right ventricular function is difficult with this technique; that is best evaluated by first-pass ventriculography (VENTRICULOGRAPHY, FIRST-PASS).Angiocardiography: Radiography of the heart and great vessels after injection of a contrast medium.gamma Catenin: A multi-functional catenin that is highly homologous to BETA CATENIN. Gamma catenin binds CADHERINS and helps link their cytoplasmic tails to ACTIN in the CYTOSKELETON via ALPHA CATENIN. It is also found in DESMOSOMES where it mediates the link between DESMOSOMAL CADHERINS and DESMOPLAKIN.Mice, Inbred mdx: A strain of mice arising from a spontaneous MUTATION (mdx) in inbred C57BL mice. This mutation is X chromosome-linked and produces viable homozygous animals that lack the muscle protein DYSTROPHIN, have high serum levels of muscle ENZYMES, and possess histological lesions similar to human MUSCULAR DYSTROPHY. The histological features, linkage, and map position of mdx make these mice a worthy animal model of DUCHENNE MUSCULAR DYSTROPHY.Gadolinium: Gadolinium. An element of the rare earth family of metals. It has the atomic symbol Gd, atomic number 64, and atomic weight 157.25. Its oxide is used in the control rods of some nuclear reactors.Ventricular Function, Right: The hemodynamic and electrophysiological action of the right HEART VENTRICLE.Heart Atria: The chambers of the heart, to which the BLOOD returns from the circulation.Mice, Inbred C57BLSyndrome: A characteristic symptom complex.Fabry Disease: An X-linked inherited metabolic disease caused by a deficiency of lysosomal ALPHA-GALACTOSIDASE A. It is characterized by intralysosomal accumulation of globotriaosylceramide and other GLYCOSPHINGOLIPIDS in blood vessels throughout the body leading to multi-system complications including renal, cardiac, cerebrovascular, and skin disorders.Survival Rate: The proportion of survivors in a group, e.g., of patients, studied and followed over a period, or the proportion of persons in a specified group alive at the beginning of a time interval who survive to the end of the interval. It is often studied using life table methods.LEOPARD Syndrome: An autosomal dominant disorder with an acronym of its seven features (LENTIGO; ELECTROCARDIOGRAM abnormalities; ocular HYPERTELORISM; PULMONARY STENOSIS; abnormal genitalia; retardation of growth; and DEAFNESS or SENSORINEURAL HEARING LOSS). This syndrome is caused by mutations of PTPN11 gene encoding the non-receptor PROTEIN TYROSINE PHOSPHATASE, type 11, and is an allelic to NOONAN SYNDROME. Features of LEOPARD syndrome overlap with those of NEUROFIBROMATOSIS 1 which is caused by mutations in the NEUROFIBROMATOSIS 1 GENES.Chronic Disease: Diseases which have one or more of the following characteristics: they are permanent, leave residual disability, are caused by nonreversible pathological alteration, require special training of the patient for rehabilitation, or may be expected to require a long period of supervision, observation, or care. (Dictionary of Health Services Management, 2d ed)Amiodarone: An antianginal and class III antiarrhythmic drug. It increases the duration of ventricular and atrial muscle action by inhibiting POTASSIUM CHANNELS and VOLTAGE-GATED SODIUM CHANNELS. There is a resulting decrease in heart rate and in vascular resistance.Ethanol: A clear, colorless liquid rapidly absorbed from the gastrointestinal tract and distributed throughout the body. It has bactericidal activity and is used often as a topical disinfectant. It is widely used as a solvent and preservative in pharmaceutical preparations as well as serving as the primary ingredient in ALCOHOLIC BEVERAGES.Echocardiography, Stress: A method of recording heart motion and internal structures by combining ultrasonic imaging with exercise testing (EXERCISE TEST) or pharmacologic stress.Endocardial Fibroelastosis: A condition characterized by the thickening of ENDOCARDIUM due to proliferation of fibrous and elastic tissue, usually in the left ventricle leading to impaired cardiac function (CARDIOMYOPATHY, RESTRICTIVE). It is most commonly seen in young children and rarely in adults. It is often associated with congenital heart anomalies (HEART DEFECTS CONGENITAL;) INFECTION; or gene mutation. Defects in the tafazzin protein, encoded by TAZ gene, result in a form of autosomal dominant familial endocardial fibroelastosis.alpha-Crystallin B Chain: One of the alpha crystallin subunits. In addition to being expressed in the lens (LENS, CRYSTALLINE), alpha-crystallin B chain has been found in a variety of tissues such as HEART; BRAIN; MUSCLE; and KIDNEY. Accumulation of the protein in the brain is associated with NEURODEGENERATIVE DISEASES such as CREUTZFELDT-JAKOB SYNDROME and ALEXANDER DISEASE.Biological Markers: Measurable and quantifiable biological parameters (e.g., specific enzyme concentration, specific hormone concentration, specific gene phenotype distribution in a population, presence of biological substances) which serve as indices for health- and physiology-related assessments, such as disease risk, psychiatric disorders, environmental exposure and its effects, disease diagnosis, metabolic processes, substance abuse, pregnancy, cell line development, epidemiologic studies, etc.Pericardium: A conical fibro-serous sac surrounding the HEART and the roots of the great vessels (AORTA; VENAE CAVAE; PULMONARY ARTERY). Pericardium consists of two sacs: the outer fibrous pericardium and the inner serous pericardium. The latter consists of an outer parietal layer facing the fibrous pericardium, and an inner visceral layer (epicardium) resting next to the heart, and a pericardial cavity between these two layers.Exercise Tolerance: The exercise capacity of an individual as measured by endurance (maximal exercise duration and/or maximal attained work load) during an EXERCISE TEST.Totiviridae: A family of RNA viruses that infect fungi and protozoa. There are three genera: TOTIVIRUS; GIARDIAVIRUS; and LEISHMANIAVIRUS.Cardiac Complexes, Premature: A group of cardiac arrhythmias in which the cardiac contractions are not initiated at the SINOATRIAL NODE. They include both atrial and ventricular premature beats, and are also known as extra or ectopic heartbeats. Their frequency is increased in heart diseases.Myocardial Stunning: Prolonged dysfunction of the myocardium after a brief episode of severe ischemia, with gradual return of contractile activity.Organ Size: The measurement of an organ in volume, mass, or heaviness.Risk Assessment: The qualitative or quantitative estimation of the likelihood of adverse effects that may result from exposure to specified health hazards or from the absence of beneficial influences. (Last, Dictionary of Epidemiology, 1988)Hypertrophy: General increase in bulk of a part or organ due to CELL ENLARGEMENT and accumulation of FLUIDS AND SECRETIONS, not due to tumor formation, nor to an increase in the number of cells (HYPERPLASIA).Receptors, Adrenergic, beta: One of two major pharmacologically defined classes of adrenergic receptors. The beta adrenergic receptors play an important role in regulating CARDIAC MUSCLE contraction, SMOOTH MUSCLE relaxation, and GLYCOGENOLYSIS.Oxidative Stress: A disturbance in the prooxidant-antioxidant balance in favor of the former, leading to potential damage. Indicators of oxidative stress include damaged DNA bases, protein oxidation products, and lipid peroxidation products (Sies, Oxidative Stress, 1991, pxv-xvi).Cardiac Resynchronization Therapy: The restoration of the sequential order of contraction and relaxation of the HEART ATRIA and HEART VENTRICLES by atrio-biventricular pacing.Desmosomal Cadherins: A single-pass transmembrane glycoproteins that mediate CALCIUM-dependent CELL ADHESION and are core components of DESMOSOMES.Cardiotoxins: Agents that have a damaging effect on the HEART. Such damage can occur from ALKYLATING AGENTS; FREE RADICALS; or metabolites from OXIDATIVE STRESS and in some cases is countered by CARDIOTONIC AGENTS. Induction of LONG QT SYNDROME or TORSADES DE POINTES has been the reason for viewing some drugs as cardiotoxins.Ventricular Function: The hemodynamic and electrophysiological action of the HEART VENTRICLES.

Cardiac troponin T mutations: correlation between the type of mutation and the nature of myofilament dysfunction in transgenic mice. (1/152)

1. The heterogenic nature of familial hypertrophic cardiomyopathy (FHC) in humans suggests a link between the type of mutation and the nature of patho-physiological alterations in cardiac myocytes. Exactly how FHC-associated mutations in cardiac troponin T (cTnT) lead to impaired cardiac function is unclear. 2. We measured steady-state isometric force and ATPase activity in detergent-skinned cardiac fibre bundles from three transgenic (TG) mouse hearts in which 50, 92 and 6 % of the native cTnT was replaced by the wild type (WT) cTnT, R92Q mutant cTnT (R92Q) and the C-terminal deletion mutant of cTnT (cTnT(DEL)), respectively. 3. Normalized pCa-tension relationships of R92Q and cTnT(DEL) fibres demonstrated a significant increase in sensitivity to Ca2+ at short (2.0 microm) and long (2.3 microm) sarcomere lengths (SL). At short SL, the pCa50 values, representing the midpoint of the pCa-tension relationship, were 5.69 +/- 0.01, 5.96 +/- 0.01 and 5.81 +/- 0.01 for WT, R92Q and cTnT(DEL) fibres, respectively. At long SL, the pCa50 values were 5.81 +/- 0.01, 6.08 +/- 0.01 and 5.95 +/- 0.01 for WT, R92Q and cTnT(DEL) fibres, respectively. 4. The difference in pCa required for half-maximal activation (DeltapCa50) at short and long SL was 0.12 +/- 0.01 for the R92Q (92 %) TG fibres, which is significantly less than the previously reported DeltapCa50 value of 0.29 +/- 0.02 for R92Q (67 %) TG fibres. 5. At short SL, Ca2+-activated maximal tension in both R92Q and cTnT(DEL) fibres decreased significantly (24 and 21 %, respectively; P < 0.005), with no corresponding decrease in Ca2+-activated maximal ATPase activity. Therefore, at short SL, the tension cost in R92Q and cTnT(DEL) fibres increased by 35 and 29 %, respectively (P < 0.001). 6. The fibre bundles reconstituted with the recombinant mutant cTnT(DEL) protein developed only 37 % of the Ca2+-activated maximal force developed by recombinant WT cTnT reconstituted fibre bundles, with no apparent changes in Ca2+ sensitivity. 7. Our data indicate that an important mutation-linked effect on cardiac function is the result of an inefficient use of ATP at the myofilament level. Furthermore, the extent of the mutation-induced dysfunction depends not only on the nature of the mutation, but also on the concentration of the mutant protein in the sarcomere.  (+info)

Genotype-phenotype assessment in autosomal recessive arrhythmogenic right ventricular cardiomyopathy (Naxos disease) caused by a deletion in plakoglobin. (2/152)

OBJECTIVES: The purpose of this study was to examine the genotype-phenotype relation with respect to penetrance, age and severity of expression, disease progression and prognosis in a recessively inherited arrhythmogenic right ventricular cardiomyopathy (ARVC). BACKGROUND: Naxos disease is a recessively inherited ARVC caused by a mutation in the gene encoding plakoglobin (cell adhesion protein) in which the cardiac phenotype is associated with palmoplantar keratoderma and woolly hair. METHODS: Twelve families with Naxos disease underwent cardiac and molecular genetic investigation. Serial cardiac assessment with annual resting 12-lead and 24-h ambulatory electrocardiogram (ECG) and two-dimensional echocardiography was performed during 1 to 16 years, median 7 +/- 6 years in all 78 surviving members. RESULTS: Twenty-eight surviving members were homozygous and 40 were heterozygous for the mutation. All adults who were homozygous (n = 26) fulfilled the diagnostic criteria for ARVC, the youngest by the age of 13 years. In eight who were heterozygous, minor ECG or echocardiographic abnormalities were observed. Of the 26 subjects who were affected homozygotes, 92% showed ECG abnormalities, 92% ventricular arrhythmias, 100% right ventricular structural alterations and 27% left ventricular involvement. During follow-up (10 +/- 6 years), 16 (62%) developed structural progression, 12 (46%) arrhythmic events and 7 (27%) heart failure. The annual disease-related and sudden death mortality was 3% and 2.3%, respectively. CONCLUSIONS: Autosomal recessive ARVC caused by a mutation in plakoglobin was 100% penetrant by adolescence. Affected subjects who were homozygous experienced progressive disease with adverse prognosis. A minority of subjects who were heterozygous showed minor ECG/echocardiographic changes, but clinically significant disease did not develop.  (+info)

Functional analysis of a troponin I (R145G) mutation associated with familial hypertrophic cardiomyopathy. (3/152)

Familial hypertrophic cardiomyopathy has been associated with several mutations in the gene encoding human cardiac troponin I (HCTnI). A missense mutation in the inhibitory region of TnI replaces an arginine residue at position 145 with a glycine and cosegregates with the disease. Results from several assays indicate that the inhibitory function of HCTnI(R145G) is significantly reduced. When HCTnI(R145G) was incorporated into whole troponin, Tn(R145G) (HCTnT small middle dotHCTnI(R145G) small middle dotHCTnC), only partial inhibition of the actin-tropomyosin-myosin ATPase activity was observed in the absence of Ca(2+) compared with wild type Tn (HCTnT small middle dotHCTnI small middle dotHCTnC). Maximal activation of actin-tropomyosin-myosin ATPase in the presence of Ca(2+) was also decreased in Tn(R145G) when compared with Tn. Using skinned cardiac muscle fibers, we determined that in comparison with the wild type complex 1) the complex containing HCTnI(R145G) only inhibited 84% of Ca(2+)-unregulated force, 2) the recovery of Ca(2+)-activated force was decreased, and 3) there was a significant increase in the Ca(2+) sensitivity of force development. Computer modeling of troponin C and I variables predicts that the primary defect in TnI caused by these mutations would lead to diastolic dysfunction. These results suggest that severe diastolic dysfunction and somewhat decreased contractility would be prominent clinical features and that hypertrophy could arise as a compensatory mechanism.  (+info)

Accelerated cardiomyopathy in mice with overexpression of cardiac G(s)alpha and a missense mutation in the alpha-myosin heavy chain. (4/152)

BACKGROUND: To understand further the pathogenesis of familial hypertrophic cardiomyopathy, we determined how the cardiomyopathy induced by an Arg403-->Gln missense mutation in the alpha-myosin heavy chain (403) is affected by chronically enhancing sympathetic drive by mating the mice with those overexpressing G(s)alpha (G(s)alpha x403). METHODS AND RESULTS: Heart rate in 3-month-old conscious mice was elevated similarly (P<0.05) in mice overexpressing G(s)alpha (G(s)alpha mice; 746 +/- 14 bpm) and G(s)alpha x403 mice (718+/- 19 bpm) compared with littermate wild-type mice (WT; 623+/- 18 bpm) and 403 mice (594+/- 16 bpm). Left ventricular ejection fraction (LVEF), as determined by echocardiography, was enhanced in G(s)alpha x403 mice (88+/- 1%, P<0.001) compared with WT (69+/- 1%), 403 (75+/- 1%), and G(s)alpha (69 +/- 2%) mice. Isolated cardiomyocytes from G(s)alpha x403 mice also exhibited higher (P<0.001) baseline percent contraction (11.9+/- 0.5%) than WT (7.0+/- 0.5%), 403 (5.5+/- 0.5%), and G(s)alpha (7.8+/- 0.3%) cardiomyocytes. Relaxation of myocytes was impaired in 403 mice compared with WT but enhanced in G(s)alpha and normalized in G(s)alpha x403 mice. This was also observed in vivo. In vivo isoproterenol (0.1 microgram . kg(-1) . min(-1)) increased LVEF to maximal levels in G(s)alpha x403 and G(s)alpha, whereas in 403, the response was attenuated compared with WT. At 10 months of age, G(s)alpha x403 had significantly depressed LVEF (57 +/- 4%). Histopathological examination demonstrated that myocyte hypertrophy and fibrosis were already present in young G(s)alpha x403 mice and that old animals had severe cardiomyopathy. By 15 months of age, the survival of G(s)alpha x403 was 0% compared with 100% for WT, 71% for G(s)alpha, and 100% for 403 mice (P<0.05). CONCLUSIONS: These results show that the cardiomyopathy developed by G(s)alpha x403 mice is synergistic rather than additive, most likely owing to the elevated baseline function combined with enhanced responsiveness to sympathetic stimulation.  (+info)

Constitutively active AMP kinase mutations cause glycogen storage disease mimicking hypertrophic cardiomyopathy. (5/152)

Mutations in PRKAG2, the gene for the gamma 2 regulatory subunit of AMP-activated protein kinase, cause cardiac hypertrophy and electrophysiologic abnormalities, particularly preexcitation (Wolff-Parkinson-White syndrome) and atrioventricular conduction block. To understand the mechanisms by which PRKAG2 defects cause disease, we defined novel mutations, characterized the associated cardiac histopathology, and studied the consequences of introducing these mutations into the yeast homologue of PRKAG2, Snf4. Although the cardiac pathology caused by PRKAG2 mutations Arg302Gln, Thr400Asn, and Asn488Ile include myocyte enlargement and minimal interstitial fibrosis, these mutations were not associated with myocyte and myofibrillar disarray, the pathognomonic features of hypertrophic cardiomyopathy caused by sarcomere protein mutations. Instead PRKAG2 mutations caused pronounced vacuole formation within myocytes. Several lines of evidence indicated these vacuoles were filled with glycogen-associated granules. Analyses of the effects of human PRKAG2 mutations on Snf1/Snf4 kinase function demonstrated constitutive activity, which could foster glycogen accumulation. Taken together, our data indicate that PRKAG2 mutations do not cause hypertrophic cardiomyopathy but rather lead to a novel myocardial metabolic storage disease, in which hypertrophy, ventricular pre-excitation and conduction system defects coexist.  (+info)

Genetic polymorphisms in the renin-angiotensin-aldosterone system associated with expression of left ventricular hypertrophy in hypertrophic cardiomyopathy: a study of five polymorphic genes in a family with a disease causing mutation in the myosin binding protein C gene. (6/152)

BACKGROUND: Hypertrophic cardiomyopathy (HCM) is an inherited disease of the sarcomere characterised clinically by myocardial hypertrophy and its consequences. Phenotypic expression is heterogeneous even within families with the same aetiological mutation and may be influenced by additional genetic factors. OBJECTIVE: To determine the influence of genetic polymorphisms of the renin-angiotensin-aldosterone system (RAAS) on ECG and two dimensional echocardiographic left ventricular hypertrophy (LVH) in genetically identical patients with HCM. PATIENTS AND METHODS: Polymorphisms of five RAAS components were determined in 26 gene carriers from a single family with HCM caused by a previously identified myosin binding protein C mutation. Genotypes associated with a higher activation status of the RAAS were labelled "pro-LVH genotypes". RESULTS: There was a non-biased distribution of pro-LVH genotypes in the gene carriers. Those without pro-LVH genotypes did not manifest cardiac hypertrophy whereas gene carriers with pro-LVH genotypes did (mean (SD) left ventricular muscle mass 190 (48) v 320 (113), p = 0.002; interventricular septal thickness 11.5 (2.0) v 16.4 (6.7), p = 0.01; pathological ECG 0% (0 of 10) v 63% (10 of 16), respectively). Multivariate analysis controlling for age, sex, and hypertension confirmed an independent association between the presence of pro-LVH polymorphisms and left ventricular mass. When each polymorphism was assessed individually, carriers of each pro-LVH genotype had a significantly greater left ventricular mass than those with no pro-LVH mutation; these associations, with the exception of cardiac chymase A AA polymorphism (p = 0.06), remained significant in multivariate analysis. CONCLUSION: Genetic polymorphisms of the RAAS influence penetrance and degree of LVH in 26 gene carriers from one family with HCM caused by a myosin binding protein C mutation.  (+info)

Mutations of the light meromyosin domain of the beta-myosin heavy chain rod in hypertrophic cardiomyopathy. (7/152)

Familial hypertrophic cardiomyopathy (HCM) is caused by mutations in 9 sarcomeric protein genes. The most commonly affected is beta-myosin heavy chain (MYH7), where missense mutations cluster in the head and neck regions and directly affect motor function. Comparable mutations have not been described in the light meromyosin (LMM) region of the myosin rod, nor would these be expected to directly affect motor function. We studied 82 probands with HCM in whom no mutations had been found in MYH7 exons encoding the head and neck regions of myosin nor in the other frequently implicated disease genes. Primers were designed to amplify exons 24 to 40 of MYH7. These amplimers were subjected to temperature modulated heteroduplex analysis by denaturing high-performance liquid chromatography. An Ala1379Thr missense mutation in exon 30 segregated with disease in three families and was not present in 200 normal chromosomes. The mutation occurred on two haplotypes, indicating that it was not a polymorphism linked with another disease-causing mutation. The position of this residue within the LMM region of myosin suggests that it may be important for thick filament assembly or for accessory protein binding. A further missense mutation in exon 37, Ser1776Gly, segregated with disease in a single family and was absent from 400 population-matched control chromosomes. Because the Ser1776 residue occupies a core position in the myosin rod at which the substitution of glycine is extremely energetically unfavorable, it is likely to disrupt the coiled-coil structure. We conclude that mutation of the LMM can cause HCM and that such mutations may act through novel mechanisms of disease pathogenesis involving myosin filament assembly or interaction with thick filament binding proteins.  (+info)

Mutation of the myosin converter domain alters cross-bridge elasticity. (8/152)

Elastic distortion of a structural element of the actomyosin complex is fundamental to the ability of myosin to generate motile forces. An elastic element allows strain to develop within the actomyosin complex (cross-bridge) before movement. Relief of this strain then drives filament sliding, or more generally, movement of a cargo. Even with the known crystal structure of the myosin head, however, the structural element of the actomyosin complex in which elastic distortion occurs remained unclear. To assign functional relevance to various structural elements of the myosin head, e.g., to identify the elastic element within the cross-bridge, we studied mechanical properties of muscle fibers from patients with familial hypertrophic cardiomyopathy with point mutations in the head domain of the beta-myosin heavy chain. We found that the Arg-719 --> Trp (Arg719Trp) mutation, which is located in the converter domain of the myosin head fragment, causes an increase in force generation and fiber stiffness under isometric conditions by 48-59%. Under rigor and relaxing conditions, fiber stiffness was 45-47% higher than in control fibers. Yet, kinetics of active cross-bridge cycling were unchanged. These findings, especially the increase in fiber stiffness under rigor conditions, indicate that cross-bridges with the Arg719Trp mutation are more resistant to elastic distortion. The data presented here strongly suggest that the converter domain that forms the junction between the catalytic and the light-chain-binding domain of the myosin head is not only essential for elastic distortion of the cross-bridge, but that the main elastic distortion may even occur within the converter domain itself.  (+info)

Background: Hypertrophic cardiomyopathy (HCM), with an estimated prevalence of 1 in 500, is hereditary and often remains asymptomatic and undiagnosed. Although potentially treatable, HCM is a leading cause of sudden cardiac death among adolescents and young adults. While previous HCM-related mortality estimates were extrapolated from cohort studies, this study applies two definitions to death certificate data to estimate national mortality rates and identify at-risk groups.. Methods: Death certificates of 12-35 year olds with HCM-related deaths in 1999-2013 were obtained from the National Vital Statistics System. Two definitions were applied: 1) specific-underlying-cause-of-death (UCD) ICD-10 code for HCM (I42.1, I42.2); and 2) sensitive-deaths that met the specific definition; had a UCD code for cardiomyopathy, unspecified (I42.9); or had a contributing cause code of I42.1, I42.2, or I42.9 and a HCM-related UCD (Figure). Deaths with external injury (V01-Y89) or congenital (Q00-Q99) codes were ...
Thank you for your interest in spreading the word on Circulation.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
Thank you for your interest in spreading the word on Circulation Research.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
Build: Wed Jun 21 18:33:50 EDT 2017 (commit: 4a3b2dc). National Center for Advancing Translational Sciences (NCATS), 6701 Democracy Boulevard, Bethesda MD 20892-4874 • 301-435-0888. ...
MYBPC1兔多克隆抗体(ab110363)可与人样本反应并经WB实验严格验证并得到3个独立的用户反馈。所有产品均提供质保服务,中国75%以上现货。
HCM - MedHelps HCM Center for Information, Symptoms, Resources, Treatments and Tools for HCM. Find HCM information, treatments for HCM and HCM symptoms.
pFN21AE3002 4909 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
pFN21AE2049 6718 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
Familial hypertrophic cardiomyopathy is an autosomal dominant myocardial disorder characterized by left ventricle hypertrophy with histological features of myocyte hypertrophy, myofibrillar disarray, and interstitial fibrosis. The disease has a broad spectrum of clinical manifestations from a benign asymptomatic course to a malignant course with serious arrhythmias, heart failure, and sudden cardiac death. One of the most common genetic causes for hypertrophic cardiomyopathy involves mutations in cardiac myosin-binding protein C (MYBPC3) gene.
Familial hypertrophic cardiomyopathy is a genetically heterogeneous disease with variable clinical features that is inherited as autosomal dominant with variable penetrance. Recent developments in genetics of hereditary cardiomyopathy have not only enlightened many points about pathogenesis, but have also provided great benefit to diagnostic approaches of clinicians. Heterozygous mutation of c3691-3692insTTCA in MYBPC3 gene was identified in a pediatric patient with diagnosis of hypertrophic cardiomyopathy at clinic. Hypertrophy was observed in sister and father of the patient in echocardiography screening, and it was subsequently determined that they also had same mutation. This mutation has not previously been defined and reported previously in the literature as cause of hypertrophic cardiomyopathy.. Keywords: Echocardiography, hypertrophic cardiomyopathy, molecular genetics, MYBPC ...
MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. MYBPC gene is linked to CMH4 and demonstrated a splice donor mutationin 1 family with familial hypertrophic cardiomyopathy and a duplication mutation in a second. Both mutations were predicted to disrupt the high-affinity, C-terminal myosin-binding domain of cardiac MyBP-C. Again, findings demonstrated that as in the case of the 3 forms that had been defined in molecular terms previously, familial hypertrophic cardiomyopathy is a disease of the sarcomere.
Familial hypertrophic cardiomyopathy, also known as FHC or HCM, is a rare condition best known publicly for its association with sudden death among young athletes. It is estimated that about 1 in 500 people have HCM and the associated thickening of the heart muscle (hypertrophy). An irregular heartbeat (arrhythmia) may lead to collapse and death during or after an athletic competition. There are usually no symptoms of a heart condition before the sudden collapse, which is also called sudden cardiac death or SCD. Fortunately, SCD occurs to a very small fraction of those carrying HCM mutations. Ordinary screening does not pick up this condition. A family history of sudden death before age 50 may be the only clue that a child or teenager needs a closer medical check before starting a sport. Most HCM appears to be inherited in a dominant fashion. Family members who carry the same genes may not have cardiac hypertrophy; those who do have hypertrophy can be treated clinically, and they will ...
Familial hypertrophic cardiomyopathy 12 information including symptoms, diagnosis, misdiagnosis, treatment, causes, patient stories, videos, forums, prevention, and prognosis.
The literature shows that genetic testing could stimulate solidarity among family members, but also lead to major conflicts. To prevent negative effects, clinical geneticists and ethicists have stressed the importance of good communication within families. In this qualitative study, we followed six extended families in the southern and eastern Netherlands involved in genetic testing for familial hypertrophic cardiomyopathy for three and a half years. In total 57 members of these families were interviewed in depth, most more than once. Our analysis shows that genetic testing does affect families, but that families perform a lot of balancing work in order to prevent genetic testing from becoming too all-encompassing. There is much more continuity in family life than is often thought. Moreover, as these families demonstrate different styles of family work, establishing a single norm of good communication in clinical genetics might in fact be more harmful for family life than genetic testing ...
In a pathbreaking proof of concept experimental study, MYBPC3 gene mutation causing hypertrophic cardiomyopathy has been corrected in human embryos using CRISPR-Cas9 gene editing technique.
Hypertrophic cardiomyopathy (HCM) is a genetic cardiac disease, which affects the structure of heart muscle tissue. The clinical symptoms include arrhythmias, progressive heart failure, and even sudden cardiac death but the mutation carrier can also be totally asymptomatic. To date, over 1400 mutations have been linked to HCM, mostly in genes encoding for sarcomeric proteins. However, the pathophysiological mechanisms of the disease are still largely unknown. Two founder mutations for HCM in Finland are located in myosin-binding protein C (MYBPC3-Gln1061X) and α-tropomyosin (TPM1-Asp175Asn) genes. We studied the properties of HCM cardiomyocytes (CMs) derived from patient-specific human induced pluripotent stem cells (hiPSCs) carrying either MYBPC3-Gln1061X or TPM1-Asp175Asn mutation. Both types of HCM-CMs displayed pathological phenotype of HCM but, more importantly, we found differences between CMs carrying either MYBPC3-Gln1061X or TPM1-Asp175Asn gene mutation in their cellular size, Ca2+ ...
Wolff-Parkinson-White pattern Familial hypertrophic cardiomyopathy 6 not provided Primary familial hypertrophic cardiomyopathy Glycogen storage disease of heart, lethal congenital ...
The UNC-45 chaperone protein interacts with and affects the folding, stability, and the ATPase activity of myosins. It plays a critical role in the cardiomyopathy development and in the breast cancer tumor growth. Here we propose the first structural model of the UNC-45-myosin complex using various in silico methods. Initially, the human UNC-45B binding epitope was identified and the protein was docked to the cardiac myosin (MYH7) motor domain. The final UNC45B-MYH7 structure was obtained by performing of total 630 ns molecular dynamics simulations. The results indicate a complex formation, which is mainly stabilized by electrostatic interactions. Remarkably, the contact surface area is similar to that of the myosin-actin complex. A significant interspecies difference in the myosin binding epitope is observed. Our results reveal the structural basis of MYH7 exons 15-16 hypertrophic cardiomyopathy mutations and provide directions for drug targeting ...
Familial hypertrophic cardiomyopathy is a primary disease of the sarcomere. The R403Q mutation resides at the actin-interaction site on myosin and leads to progressive hypertrophic cardiomyopathy which progresses towards heart failure. Along with deteriorating cardiac function, these hearts experience an overall change in metabolic landscape, suggesting altered energetic function in hearts that express the R403Q mutation. We tested the hypothesis that the R403Q mutation intrinsically increases the energetic cost of contraction. To do this, we determined myofilament function in demembranated cardiac trabeculae from male wild-type (WT) and R403Q mice at 2 months of age, prior to overt signs of cardiac pathology. Firstly, steady-state Ca2+ sensitivity of force generation was not significantly different between male R403Q (n=4) and WT counterparts (n=2) consistent with previous findings. Secondly, the rate of force redevelopment (ktr) in skinned cardiac tissue was measured following unloaded ...
Familial hypertrophic cardiomyopathy (FHC) is the most common cause of sudden cardiac death in young individuals. Molecular mechanisms underlying this disorder are largely unknown; this study aims at revealing how disruptions in actin-myosin interactions can play a role in the pathogenesis of this disorder. Cross-bridge (XB) kinetics and the degree of order were examined in contracting myofibrils from the ex vivo ventricles of transgenic (Tg) mice expressing FHC regulatory light chain (RLC) mutation K104E and Troponin I mutation, R21C. Because the degree of order and the kinetics are best studied when an individual XB makes a significant contribution to the overall signal, the number of observed XBs in an ex vivo ventricle was minimized to 20. Autofluorescence and photobleaching were minimized by using a relatively long-lived red-emitting dye. In case of K104E, mutated XBs were significantly better ordered during steady-state contraction and during rigor, but the mutation had no effect on the degree of
patient:. - Demographic characteristics. - Risk factors for cardiovascular diseases. - Data on familial cardiomyopathy. - Co-morbidities. - Precipitating factors of HF. - Clinical signs and symptoms. - Blood tests performed. - Use of invasive/ non-invasive diagnostic procedures. - Use of pharmacological treatments. - Use of non-pharmacological treatments. Follow-up data. A follow-up visit after 6 and 12 months will be scheduled for ...
0002] Hypertrophic cardiomyopathy ("HCM") is an often fatal but manageable disease. The incidence is reported to be about 1/400 (approximately 750,000) in the general U.S. population. The variable expressivity of this disease suggests it may be higher, making HCM the most common monogenic cardiac disorder in the U.S. Macon and McKenna et al., ACC/ESC Expert Consensus Document on Hypertrophic Cardiomyopathy, J of American College of Cardiology (2003) 42: 1-27. In addition, it is the most frequent cause of unexpected sudden death in teenagers and young adults. Elliott, Poloniecki et al., Sudden death in hypertrophic cardiomyopathy: Identification of high risk patients, J of American College of Cardiology (2000) 36: 2212-2218. The disease is characterized by a thickening of the heart muscle (hypertrophy) in the absence of hypertension or any other apparent cause. HCM is difficult to diagnose. Clinical presentation and progression of HCM varies widely among affected patients and the symptoms ...
Hypertrophic cardiomyopathy occurs as an autosomal dominant familial disorder or as a sporadic disease without familial involvement. While missense mutations in the beta cardiac myosin heavy chain (MHC) gene account for approximately half of all cases of familial hypertrophic cardiomyopathy, the molecular causes of sporadic hypertrophic cardiomyopathy are unknown. To determine whether beta cardiac MHC mutations are also associated with sporadic disease, we screened this gene in seven individuals with sporadic hypertrophic cardiomyopathy. Mutations in the beta cardiac MHC genes were identified in two probands with sporadic disease. In that their parents were neither clinically nor genetically affected, we conclude that mutations in each proband arose de novo. Transmission of the mutation and disease to an offspring occurred in one pedigree, predicting that these are germline mutations. The demonstration of hypertrophic cardiomyopathy arising within a pedigree coincident with the appearance of a ...
TNNI3 patients may show pure RCM and HCM with or without restrictive pattern. Different phenotypes may coexist in the same family [4,8,9]. In the present family, as in other families observed in our centre with TNNI3-related cardiomyopathy, only the presence of a pure RCM without conduction disease in at least one member of the family seems to predict mutations of this gene. Differential clinical diagnosis includes pure restrictive phenotype caused by mutations of the Desmin gene, which are however characterized by the presence of atrioventricular block preceding the onset of restrictive haemodynamics and in some case, of clinically overt myopathy or increased sCPK. [6 ...
Global Hypertrophic Cardiomyopathy Therapeutics Market - Key Trends With heart diseases emerging as one of the most common causes of mortality among men and women worldwide, Transparency Market Research (TMR) expects the demand for hypertrophic cardiomyopathy (HCM) therapeutics to surge considerably. Furthermore, the market is expected to gain significant impetus from successful government interventions aimed at spreading awareness about hypertrophic cardiomyopathy.. View Report-. https://www.transparencymarketresearch.com/hypertrophic-cardiomyopathy-therapeutics-market.html. TMR projects the global HCM therapeutics market to expand at a moderate 1.4% CAGR between 2015 and 2023. Despite witnessing positive opportunities, the rising demand for advanced medical devices could threaten the markets growth to an extent. Nevertheless, since the majority of HCM drugs are yet to get approved, the hypertrophic cardiomyopathy therapeutics market is likely to gain momentum post their approval in the near ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
Looking for information on Hypertrophic Cardiomyopathy in Muskegon? We have compiled a list of businesses and services around Muskegon that should help you with your search. We hope this page helps you find information on Hypertrophic Cardiomyopathy in Muskegon.
Looking for information on Hypertrophic Cardiomyopathy in Wilton? We have compiled a list of businesses and services around Wilton that should help you with your search. We hope this page helps you find information on Hypertrophic Cardiomyopathy in Wilton.
Nikita Sinha is a junior undergraduate student at Caltech. Upon graduating, she plans to pursue either an MD or a combined MD-PhD Degree. Nikita s passion for the sciences has never been in doubt. Nikita was first exposed to the exciting world of research through the SHARP program at UC Berkley where she worked on designing a revolutionary new approach to making computers with nanomagnets. She was amazed by the impacts of this technology which could tremendously reduce power consumption in computers and allow for the design of supercomputers. Having found the endeavor to create new knowledge intellectually challenging and satisfying, she further pursued this passion for research through the SIMR program at Stanford s Cardiovascular Institute. Her project involved optimization of an allele-specific silencing construct for the therapy of a hypertrophic cardiomyopathy mutation. This research at Stanford sparked her interest in the biological sciences, and so immediately upon entering Caltech, she ...
Compared to men, women with a hereditary heart condition called hypertrophic cardiomyopathy are substantially more likely to be diagnosed later in life and with more severe symptoms, an Italian study indicates. This occurs despite the fact that hypertrophic cardiomyopathy "should theoretically be present in males and females equally," Dr. Iacopo Olivotto commented to Reuters Health, because it is a genetic disease with an inheritance pattern that requires only one parent to have the condition. People with hypertrophic cardiomyopathy (HCM) suffer from progressive weakening of the heart, which becomes enlarged in an attempt to compensate ...
Diagnosis and Management of Hypertrophic Cardiomyopathy : Diagnosis and Management of Hypertrophic Cardiomyopathy is a unique, multi-authored compendium of information regarding the complexities of clinical and genetic diagnosis, natural history, and management of hypertrophic cardiomyopathy (HCM)-the most common and important of the genetic cardiovascular diseases-as well as related issues impacting the health of trained athletes. Edited by Dr.
Another name for Hypertrophic Cardiomyopathy is Hypertrophic Cardiomyopathy. To better understand hypertrophic cardiomyopathy, it helps to understand ...
Late gadolinium enhancement in hypertrophic cardiomyopathy: When should we use it in risk stratification of our patients? Hypertrophic cardiomyopathy (HCM) is associated with complications including heart failure and sudden cardiac death (SCD). The ...
The normal heart has strong muscular walls that pump blood out of the heart.. Hypertrophic cardiomyopathy is a condition in which the walls of the heart; the muscular pumping chambers, become abnormally thick. There is likely a genetic cause.. In hypertrophic cardiomyopathy, the heart fails to pump adequately. In many patients, this condition may not cause symptoms until it is very severe. Individuals with this condition may be at higher risk for sudden cardiac arrest. Symptoms can include breathlessness, rhythm abnormalities, and fainting.. ...
The normal heart has strong muscular walls that pump blood out of the heart.. Hypertrophic cardiomyopathy is a condition in which the walls of the heart; the muscular pumping chambers, become abnormally thick. There is likely a genetic cause.. In hypertrophic cardiomyopathy, the heart fails to pump adequately. In many patients, this condition may not cause symptoms until it is very severe. Individuals with this condition may be at higher risk for sudden cardiac arrest. Symptoms can include breathlessness, rhythm abnormalities, and fainting.. ...
... (HCM) is a genetically transmitted disease that directly affects the heart muscle.
This is the business view business. Hypertrophic cardiomyopathy Is a condition in which the heart muscle becomes thick. The thickening makes it harder for blood to leave the heart forcing the heart to work harder to pump blood. Hypertrophic cardiomyopathy is often asymmetrical, meaning one ...
Hypertrophic cardiomyopathy (HCM) is a genetically determined heart muscle disease caused by mutations in one of several sarcomere genes which encode components of the contractile apparatus. (See.)HCM is characterized by an enormous diversity in both
Hypertrophic cardiomyopathy (HCM) is an inherited disease of the heart muscle. HCM can cause the wall of the heart muscle to thicken.More about this condition.
I said I would tell you why Skip has to take so many pills, well the title says it all. He has Feline Hypertrophic Cardiomyopathy (HCM). HCM is a very serious heart condition. Last year, I noticed that Skips breath smelled and I knew that he needed his teeth cleaned and probably a couple pulled. …
Hypertrophic cardiomyopathy clinically presents as a hypertrophic change of the left ventricles wall in combination with non-dilated ventricular chambers. Read more about HCM.
UPMC has established a center to treat patients with hypertrophic cardiomyopathy (HCM), a condition in which the heart muscle is abnormally thick without apparent cause...
Marcela suffered from hypertrophic cardiomyopathy. This is a heart disease which required her to have a heart transplant. Organ donors are needed very much. Recipients go on to lead nornal lives.
The Hypertrophic Cardiomyopathy Program at NYU Langone brings together a team of experienced cardiac experts who help to manage your condition. Learn more.
Mayo Clinics world-renowned heart team is uniquely qualified to diagnose and treat hypertrophic cardiomyopathy, providing the exact care each patient needs. Our heart team has…
Overview of Hypertrophic cardiomyopathy as a medical condition including introduction, prevalence, prognosis, profile, symptoms, diagnosis, misdiagnosis, and treatment
Genetic testing can identify the abnormalities which are currently known to be identified in patients with hypertrophic cardiomyopathy. Learn more here.
Care guide for Hypertrophic Cardiomyopathy (Inpatient Care). Includes: possible causes, signs and symptoms, standard treatment options and means of care and support.
Rene L. Begay, Sharon Graw, Gianfranco Sinagra, Marco Merlo, Dobromir Slavov, Katherine Gowan, Kenneth L. Jones, Giulia Barbati, Anita Spezzacatene, Francesca Brun, Andrea Di Lenarda, John E. Smith, Henk L. Granzier, Luisa Mestroni, Matthew Taylor, the Familial Cardiomyopathy Registry ...
Complete information for MYBPC3 gene (Protein Coding), Myosin Binding Protein C3, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Familial hypertrophic cardiomyopathy (HCM) is caused by mutations in at least 8 contractile protein genes, most commonly beta myosin heavy chain, myosin binding protein C, and cardiac troponin T. Affected individuals are heterozygous for a particular mutation, and most evidence suggests that the mutant protein acts in a dominant-negative fashion. To investigate the functional properties of a truncated troponin T shown to cause HCM, both wild-type and mutant human cardiac troponin T were overexpressed in Escherichia coli, purified, and combined with human cardiac troponins I and C to reconstitute human cardiac troponin. Significant differences were found between the regulatory properties of wild-type and mutant troponin in vitro, as follows. (1) In actin-tropomyosin-activated myosin ATPase assays at pCa 9, wild-type troponin caused 80% inhibition of ATPase, whereas the mutant complex gave negligible inhibition. (2) Similarly, in the in vitro motility assay, mutant troponin failed to decrease both the
Looking for online definition of Feline hypertrophic cardiomyopathy in the Medical Dictionary? Feline hypertrophic cardiomyopathy explanation free. What is Feline hypertrophic cardiomyopathy? Meaning of Feline hypertrophic cardiomyopathy medical term. What does Feline hypertrophic cardiomyopathy mean?
The proband (II-15) was an 82-year-old man with mild, asymmetrical LV hypertrophy localized to the basal and midseptum, marked biatrial dilatation, and a restrictive LV filling pattern with preserved systolic function. He had been diagnosed with nonobstructive HCM almost 3 decades earlier and followed at our institution since 2005. Remarkably, he had a history of paroxysmal AF that presented at the age of 30, which subsequently evolved into permanent AF with advanced AV block, requiring VVI pacing at the age of 68 (Figure 2). In 2008, he proved to be negative for mutations in the coding regions and splice sites of the 8 most prevalent sarcomere genes. Despite his early onset of disease manifestations and adverse cardiac remodeling, consistent with restrictive evolution of HCM, he remained fully active with only mild functional limitation (functional class New York Heart Association class II). Furthermore, he remained free from cardioembolic complications although he repeatedly refused treatment ...
TY - JOUR. T1 - Dual chamber pacing relieves obstruction in japanese-variant hypertrophic cardiomyopathy. AU - Wever-Pinzon, Omar. AU - Romero, Jorge E.. AU - Cordova, Juan P.. PY - 2013/9. Y1 - 2013/9. N2 - Japanese-variant or apical hypertrophic cardiomyopathy (HCM) is a specific type of HCM, first described in Japan and initially thought to carry a benign prognosis. However, current evidence suggests that these patients experience severe symptoms and are at increased risk of ventricular arrhythmias and death, especially in the presence of an apical akinetic chamber. The management of patients who do not respond to medical therapy is challenging. We describe a patient with Japanesevariant HCM, with an apical akinetic chamber and severe symptoms who failed medical therapy. The use of dual chamber pacing relieved obstruction and significantly improved the patients symptoms.. AB - Japanese-variant or apical hypertrophic cardiomyopathy (HCM) is a specific type of HCM, first described in Japan and ...
Hypertrophic cardiomyopathy (HCM) has caused Cuttino Mobley to retire from the NBA. Hypertrophic cardiomyopathy occurs when the myocardium is enlarged, usually for an unknown reason. The disease distorts the morphology of the heart, and at times of high flow, can cause the outflow tract of the left ventricle to collapse, leading to sudden death. Specifically, the theory is that systolic anterior motion (SAM) of the anterior leaflet of the mitral valve, caused either by Venturi forces or drag, can lead to the obstruction. According to JAMA, "Hypertrophic cardiomyopathy is the most common cause of cardiovascular sudden death in young people, including trained competitive athletes (most commonly in basketball and football and in black athletes ...
Patients with hypertrophic cardiomyopathy are not immune from nationwide problems of inactivity and obesity. This study suggests that these issues may in fact be exaggerated in patients with hypertrophic cardiomyopathy. This may be due to apprehension regarding exercise on the part of patients, as well as by exercise restrictions imposed by physicians. Well-designed, likely multicenter, prospective studies will be necessary to determine the risks and benefits of different exercise regimens on hypertrophic cardiomyopathy disease progression and complications.. ...
TY - JOUR. T1 - Echocardiography-guided genetic testing in hypertrophic cardiomyopathy. T2 - Septal morphological features predict the presence of myofilament mutations. AU - Binder, Josepha. AU - Ommen, Steve R.. AU - Gersh, Bernard J.. AU - Van Driest, Sara L.. AU - Tajik, A. Jamil. AU - Nishimura, Rick A.. AU - Ackerman, Michael J.. PY - 2006/4. Y1 - 2006/4. N2 - OBJECTIVE: To examine the relationship among age, septal morphological subtype, and presence of hypertrophic cardiomyopathy (HCM)-associated myofilament mutations. PATIENTS AND METHODS: Comprehensive mutation analysis of the 8 HCM susceptibility genes that encode the myofilaments of the cardiac sarcomere was performed previously in 382 unrelated patients with HCM. Blinded to genotype status, we used echocardiography to characterize the left ventricular morphological features. Multivariate regression was used to assess the relationship among morphological subtypes, clinical data, and genetic variables. RESULTS: The mean ± SD age of ...
Troponin plays a central role in regulation of muscle contraction. It is the Ca2+ switch of striated muscles including the heart and in the cardiac muscle is physiologically modulated by PKA-dependent phosphorylation at Ser22 and 23. Many cardiomyopathy-related mutations affect Ca2+ regulation and/or disrupt the relationship between Ca2+ binding and phosphorylation. Unlike the mechanism of heart activation, the modulation of Ca2+-sensitivity by phosphorylation of the cardiac specific N-terminal segment of TnI (1-30) is structurally subtle and has proven hard to investigate. The crystal structure of cardiac troponin describes only the relatively stable core of the molecule and the crucial mobile parts of the molecule are missing including TnI C terminal region, TnI (1-30), TnI (134-149) (inhibitory peptide) and the C-terminal 28 amino acids of TnT that are intrinsically disordered.Recent studies over the years have been performed to answer this matter by building structural models of cardiac troponin
DESCRIPTION (provided by applicant): The regulatory function of the cardiac sarcomere resides in the thin filament. It is a complex macromolecular structure comprised of multiple protein subunits, which interact and modulate contractile function in response to both chronic and acute physiologic stress. The binding of Ca2+ to Troponin C initiates a cascade of allosteric changes in the interactions of the proteins within the troponin (cTnC, cTnl and cTnT) and tropomyosin-actin complexes, facilitating the formation of the actinomyosin complex and the power stroke of muscle contraction. While normal hearts retain the ability to alter these complex interactions, for example, via contractile protein isoform shifts and post-translational modifications, many naturally-occurring thin filament mutations are poorly tolerated. In fact, mutations in cardiac Troponin T (cTnT) result in a particularly severe form of Familial Hypertrophic Cardiomyopathy (FHC) characterized by a high frequency of early sudden ...
Hypertrophic cardiomyopathy (HCM), an inherited disease of the heart muscle, is among the most common Mendelian cardiac diseases, occurring in 1 in 500 people (1). Advances in genetics have facilitated identification of a subpopulation of patients with pathogenic variants in cardiac sarcomere genes. The earliest family mapped by positional cloning had a disease-causing mutation at position 403 of the β-myosin heavy chain (MHC) protein (2). A knock-in mouse model of this variant recapitulated aspects of human disease (3); many other sarcomere genes have been implicated subsequently (4). In clinics today, coding regions of numerous cardiac sarcomere genes are routinely sequenced, and, excluding those patients with discrete upper septal thickening, clearly pathogenic variants are identified in 30% to 50% of patients (5), thus marking a subset of "sarcomeric" HCM.. Current therapy for HCM is primarily palliative. Beta-blockers, nondihydropyridine calcium channel blockers, and the class Ia ...
Hypertrophic cardiomyopathy (HCM) is characterized by asymmetric left ventricular hypertrophy, diastolic dysfunction and myocardial disarray. HCM is caused by mutations in sarcomeric genes, but in 40 of patients, the mutation is not yet identified. We hypothesized that FHL1, encoding four-and-a-half-LIM domains 1, could be another disease gene since it has been shown to cause distinct myopathies, sometimes associated with cardiomyopathy. We evaluated 121 HCM patients, devoid of a mutation in known disease genes. We identified three novel variants in FHL1 (c.134delA/K45Sfs, c.459CA/C153X and c.827GC/C276S). Whereas the c.459CA variant was associated with muscle weakness in some patients, the c.134delA and c.827GC variants were associated with isolated HCM. Gene transfer of the latter variants in C2C12 myoblasts and cardiac myocytes revealed reduced levels of FHL1 mutant proteins, which could be rescued by proteasome inhibition. Contractility measurements after adeno-associated virus transduction ...
The last 2 decades have borne witness to a rapid and vigorous expansion of our understanding of the genetic basis underlying many cardiovascular diseases. As fellows-in-training, this marks an exciting time with a rapid tempo of discovery that keeps us in constant motion, which challenges us to keep up with current developments to provide optimal cardiovascular care to our patients. Since the discovery in 1990 that a mutation in the β cardiac myosin heavy chain, a component of the sarcomere, caused familial hypertrophic cardiomyopathy (1,2), investigators in the field of cardiovascular genetics have developed an increasingly complex understanding of the pathophysiologic basis of inherited cardiac diseases (3). Genetic testing for these heritable diseases has rapidly advanced from basic scientific discovery to clinical application, and commercially targeted gene testing and comprehensive disease panels have entered mainstream cardiology practice in the past several years (4). Clinical screening ...
This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments ...
Fitness gains are possible without exercise pains. This website is designed to show you how to maintain heart health through step-by-step videos, key medical information and a proven exercise program. Blending the best in cardiac medicine with the latest fitness practices, we have designed a safe and effective series of exercises that can be done individually or as part of a program. Created specifically for hypertrophic cardiomyopathy (HCM) patients, our Beginner, Intermediate or Advanced HCM programs can be followed by anyone seeking to improve their overall fitness. We invite you to try our holistic approach to exercise created to promote well-being, resilience to stress and a happy, healthy heart.. ...
Hypertrophic cardiomyopathy, or HCM, is the most common heart disease diagnosed in cats. It is a disease that affects the heart muscle, causing the muscle to become thickened and ineffective in pumping the blood through the heart and the rest of the body.
By Dr. David Gross. My mothers Maine Coon cat has cardiomyopathy. What is that?. "Cardio" obviously pertains to the heart, "myo" pertains to muscle and "pathy" signifies pathology or abnormality. Therefore, cardiomyopathy is pathology or abnormality of the heart muscle. We describe two kinds of cardiomyopathy; hypertrophic and dilated. Both types occur because of genetic mutations in one or more of the various proteins that comprise the heart muscle.. A study published in 1993 in the American Journal of Cardiology compared lesions found in 38 humans, 51 cats and 10 dogs that died of spontaneous hypertrophic cardiomyopathy. The authors of the paper discovered almost identical changes in all of the subjects.. Hypertrophic cardiomyopathy results in an increase in the volume of the heart muscle. As the muscle, usually that of the left ventricle, the chamber of the heart responsible for pumping blood out into the body, is forced to work harder it becomes thicker. As this happens the muscle also ...
Early screening for a genetic variant that predisposes people to hypertrophic cardiomyopathy could help reduce the incidence of sudden cardiac death.
Cleveland Clinics Hypertrophic Cardiomyopathy Center is a multidisciplinary specialty treatment group dedicated to the diagnosis and treatment HCM in individuals and family members, bringing together clinicians that specialize in HCM, including physicians and nurses from Cardiovascular Medicine, Genetics, Cardiothoracic Surgery, Pediatric Cardiology, and Psychology with expertise in diagnostic and genetic testing, medical management, and interventional and surgical procedures.
UVA is Virginias only designated HCM Center of Excellence by the Hypertrophic Cardiomyopathy Association. Learn more about our cardiovascular screening, genetic testing, treatment options to help you and your family manage congenital heart defects.
This is a photograph of the cross-section of a cats heart diseased by hypertrophic cardiomyopathy (HCM). The cats human companion wanted to find out the cause of death. The photograph was taken by the staff at the Cuyahoga Falls Veterinary Clinic. This photo has been used with permission for teaching/educational purposes at www.pictures-of-cats.org (PoC). I want to thank Ryan G. Gates, DVM of the clinic for granting permission. If people want to use the picture please ask the clinic first ...
This work proposes an image processing methodology to distinguish fibrotic from normal tissue by the assessment of the local mechanical properties of the myocardium in magnetic resonance tagging images. The procedure uses the information provided by short axis images of the above mentioned modality to estimate the Green-Lagrange strain tensor; a modified method based on the Harmonic Phase is employed for motion estimation. The method has been applied to the analysis of the local deformation patterns in a set of patients affected by hypertrophic cardiomyopathy in order to find the agreement between hyperenhanced zones in late enhancement images and areas in the myocardium with abnormal tensor values (both the radial and the circumferential components as well as the shearing component have been accounted for). The agreement is measured taken as ground truth manual segmentation of late enhancement images carried out by two cardiologists. Finally, a set of example images illustrate the agreement ...
The past three decades have seen major progress in our understanding of the clinical, hemodynamic, and morphologic abnormalities in hypertrophic cardiomyopathy [1]. Major future advances will...
Contemporary Clinical Medicine: Great Teachers: Hypertrophic Cardiomyopathy: Now a Contemporary and Treatable Disease Shaped by 50 Years of Clinical Research
Learn more about Hypertrophic Cardiomyopathy -- Adult at Medical City Dallas DefinitionCausesRisk FactorsSymptomsDiagnosisTreatmentPreventionrevision ...
Learn more about Hypertrophic Cardiomyopathy -- Adult at Medical City Dallas DefinitionCausesRisk FactorsSymptomsDiagnosisTreatmentPreventionrevision ...
Semantic Scholar extracted view of Therapy of hypertrophic cardiomyopathy: medical or surgical? clinical and pathophysiologic considerations. by Maria Inés Fernández Canedo et al.
Anita Spezzacatene, Gianfranco Sinagra, Marco Merlo, Giulia Barbati, Sharon L. Graw, Francesca Brun, Dobromir Slavov, Andrea Di Lenarda, Ernesto E. Salcedo, Jeffrey A. Towbin, Jeffrey E. Saffitz, Frank I. Marcus, Wojciech Zareba, Matthew R. G. Taylor, Luisa Mestroni, the Familial Cardiomyopathy Registry ...
Hypertrophic cardiomyopathy (HCM) is a common familial autosomal dominant heart condition, with a heterogeneous phenotypic expression, characterized by left ventricular hypertrophy in the absence of associated conditions that could explain it (high blood pressure, aortic stenosis). Hypertrophic cardiomyopathy is probably the most common genetically transmitted cardiovascular disease, with a prevalence in the general population of about 0.2%. […] ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
Conclusions: These data suggest that HCM is associated with increased prevalence of dilated SV, but not MAA. The lower odds of DA in HCM patients who were gene positive, suggest that this associated may not be genetically mediated. Further studies are required to identify the pathophysiology behind this association.
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
Advanced search is divided into two main parts, and one or more groups in each of the main parts. The main parts are the "Search for" (including) and the "Remove from search" (excluding) part. (The excluding part might not be visible until you hit "NOT" for the first time ...
[A condition in which the myocardium is hypertrophied without an obvious cause. The hypertrophy is generally asymmetric and may be associated with obstruction of the ventricular outflow tract.]
Please can you enlighten on the cause of Postprandial Ventricular Extrasystoles - Prognosis and Treatment ? Patient, aged 59 years, diagnosed with Hypertrophic cardiomyopathy 23 yrs. ago, detecte...
Familial hypertrophic cardiomyopathy (HCM) is caused by mutations in 9 sarcomeric protein genes. The most commonly affected is beta-myosin heavy chain (MYH7), where missense mutations cluster in the head and neck regions and directly affect motor function. Comparable mutations have not been described in the light meromyosin (LMM) region of the myosin rod, nor would these be expected to directly affect motor function. We studied 82 probands with HCM in whom no mutations had been found in MYH7 exons encoding the head and neck regions of myosin nor in the other frequently implicated disease genes. Primers were designed to amplify exons 24 to 40 of MYH7. These amplimers were subjected to temperature modulated heteroduplex analysis by denaturing high-performance liquid chromatography. An Ala1379Thr missense mutation in exon 30 segregated with disease in three families and was not present in 200 normal chromosomes. The mutation occurred on two haplotypes, indicating that it was not a polymorphism linked with
We described a patient with familial non-obstructive hypertrophic cardiomyopathy and complete atrioventricular block. A 27-year-old male was admitted to our institution with syncope. Electrocardiography demonstrated complete atrioventricular block. Two-dimensional echocardiography revealed non-obstructive hypertrophic cardiomyopathy. A temporary transvenous ventricular pacemaker was inserted urgently, and subsequently replaced by a permanent dual-chamber pacemaker. Meanwhile, non-obstructive hypertrophic cardiomyopathy was diagnosed in the mother, the aunt and one of the brothers of the patient in the screening of the family, but atrioventricular conduction block was not detected in them. In the electrophysiological study of the mother, inducible ventricular tachycardia was detected. The reason for diversity of the arrhythmias in the members of the same family with hypertrophic cardiomyopathy may be explained by penetrance. The phenotype of the familial hypertrophic cardiomyopathy is influenced ...
HealthDay)-Racial differences in disease expression and adverse clinical outcomes exist between black and white patients with hypertrophic cardiomyopathy, according to a study published online Dec. 4 in JAMA Cardiology.. Lauren A. Eberly, M.D., from Brigham and Womens Hospital in Boston, and colleagues assessed data from the Sarcomeric Human Cardiomyopathy Registry (1989 through 2018) to evaluate the associations among race, disease expression, care provision, and clinical outcomes among patients with hypertrophic cardiomyopathy.. The researchers identified 2,467 patients with hypertrophic cardiomyopathy (8.3 percent black; 91.7 percent white). Black patients were younger at the time of diagnosis (mean age, 36.5 versus 41.9 years), had a higher prevalence of New York Heart Association (NYHA) class III or IV heart failure at presentation (22.6 versus 15.8 percent), had lower rates of genetic testing (54.1 versus 62.1 percent), and were less likely to have sarcomeric mutations identified by ...
Previous studies have injected CRISPR-Cas9 after IVF, but faced mosaicism problems, characterized by embryos having a mixture of cells with and without the repaired mutation. Mosaicism would lead to organisms with some tissues or organs that bear the mutations and some that do not. In this study, the researchers injected sperm and CRISPR-Cas9 into the egg at the same time to improve the accuracy of the gene correction. Thanks to this strategy, mosaicism did not occur. CRISPR-Cas9 cut the DNA at the correct position in all tested embryos (100%) and 42 out of the 58 embryos (72.4%) did not carry the hypertrophic cardiomyopathy mutation. In other words, this technique increased the probability of inheriting the healthy gene from 50% to 72.4%. Moreover, while doing this research the scientists also discovered that human embryos have an alternative DNA repair system, where the Cas9-induced cuts in the DNA coming from the sperm are repaired using the healthy eggs DNA as a template. In the remaining ...
Extrinsic Cardiomyopathy are a more common type of Cardiomyopathy. It is where the primary pathology is outside the myocardium. Meanwhile, intrinsic Cardiomyopathy is defined as weakness inside the muscle of the heart. There are three more specific types of Cardiomyopathy. These are Dilated Cardiomyopathy, Hypertrophic Cardiomyopathy and Restrictive Cardiomyopathy. Dilated Cardiomyopathy is the most common form. This form can lead to enlargement of the heart, especially the left ventricle, and the pumping function decreases. Hypertrophic Cardiomyopathy is when the muscle thickens, which can get in the way of the blood flow and prevents the heart to pump properly. Restrictive Cardiomyopathy is the most rarest form of Cardiomyopathy. It is when the walls of the ventricles stiffens but not thickens and can resist the normal filling of blood in the heart ...
Background: Hypertrophic cardiomyopathy (HCM) is often caused by sarcomere gene mutations, resulting in left ventricular hypertrophy (LVH), myocardial fibrosis, and increased risk of sudden cardiac death and heart failure. Studies in mouse models of sarcomeric HCM demonstrated that early treatment with an angiotensin receptor blocker (ARB) reduced development of LVH and fibrosis. In contrast, prior human studies using ARBs for HCM have targeted heterogeneous adult cohorts with well-established disease. The VANISH trial is testing the safety and feasibility of disease-modifying therapy with an ARB in genotyped HCM patients with early disease. Methods: A randomized, placebo-controlled, double-blind clinical trial is being conducted in sarcomere mutation carriers, 8 to 45 years old, with HCM and no/minimal symptoms, or those with early phenotypic manifestations but no LVH. Participants are randomly assigned to receive valsartan 80 to 320 mg daily (depending on age and weight) or placebo. The ...
Hypertrophic cardiomyopathy (HCM) is a primary myocardial disorder with an autosomal dominant pattern of inheritance that is characterized by hypertrophy of the left ventricles with histological features of myocyte hypertrophy, myfibrillar disarray, and interstitial fibrosis. HCM is one of the most common inherited cardiac disorders, with a prevalence in young adults of 1 in 500. Hundreds of mutations in the genes that encode protein constituents of the sarcomere have been identified in HCM. These mutations increase the Ca2+ sensitivity of cardiac myofilaments. Increased myofilament Ca2+ sensitivity is expected to increase the ATP utilization by actomyosin at submaximal Ca2+ concentrations, which might cause an imbalance in energy supply and demand in the heart under severe stress. The inefficient use of ATP suggests that an inability to maintain normal ATP levels could be the central abnormality. This theory might be supported by the discovery of the role of a mutant PRKAG2 gene in HCM, which ...
Hypertrophic cardiomyopathy (HCM) is a primary myocardial disorder with an autosomal dominant pattern of inheritance that is characterized by hypertrophy of the left ventricles with histological features of myocyte hypertrophy, myfibrillar disarray, and interstitial fibrosis. HCM is one of the most common inherited cardiac disorders, with a prevalence in young adults of 1 in 500. Hundreds of mutations in the genes that encode protein constituents of the sarcomere have been identified in HCM. These mutations increase the Ca2+ sensitivity of cardiac myofilaments. Increased myofilament Ca2+ sensitivity is expected to increase the ATP utilization by actomyosin at submaximal Ca2+ concentrations, which might cause an imbalance in energy supply and demand in the heart under severe stress. The inefficient use of ATP suggests that an inability to maintain normal ATP levels could be the central abnormality. This theory might be supported by the discovery of the role of a mutant PRKAG2 gene in HCM, which ...
We sought to evaluate the relation between atrial fibrillation (AF) and the extent of myocardial scarring together with left ventricular (LV) and atrial parameters assessed by late gadolinium-enhancement (LGE) cardiovascular magnetic resonance (CMR) in patients with hypertrophic cardiomyopathy (HCM). AF is the most common arrhythmia in HCM. Myocardial scarring is also identified frequently in HCM. However, the impact of myocardial scarring assessed by LGE CMR on the presence of AF has not been evaluated yet. 87 HCM patients underwent LGE CMR, echocardiography and regular ECG recordings. LV function, volumes, myocardial thickness, left atrial (LA) volume and the extent of LGE, were assessed using CMR and correlated to AF. Additionally, the presence of diastolic dysfunction and mitral regurgitation were obtained by echocardiography and also correlated to AF. Episodes of AF were documented in 37 patients (42%). Indexed LV volumes and mass were comparable between HCM patients with and without AF. However,
Medical definition of hypertrophic cardiomyopathy: cardiomyopathy that is characterized by ventricular hypertrophy especially of the left ventricle…
Learn about the treatment options available for hypertrophic cardiomyopathy, including alcohol septal ablation, an innovative minimally invasive procedure we offer for cardiomyopathy that improves blood flow out of the heart.
... (HCM) is far and away the most common form of heart disease in the cat. Diagnosis of HCM means that there is a primary disease process causing the myocytes of the heart to behave inappropriately, and leads to enlargement of the heart, primarily of the left ventricle (the main muscular chamber that pumps blood to the body). Secondary hypertrophic diseases of the heart may be caused by hyperthyroidism or hypertension, and lead to signs that mimic HCM, but if addressed early may be reversible by treating the underlying condition. Primary HCM is not reversible, and has been shown to have a genetic link, particularly in Main Coons. Unfortunately, genotyping is not yet available. It is not yet possible to isolate the gene that causes HCM in cats, but through studying family trees, it has been shown to be an autosomal dominant gene in some Main Coons and likely other breeds as well. In cats, HCM presents with a high degree of phenotypic heterogeneity from patient to ...
Left Ventricular Assist Device (LVAD) therapy use is increasing rapidly in advanced heart failure (HF). Little data exists on the application of this therapy in patients with advanced HF due to Hypertrophic Cardiomyopathy (HCM). Altered ventricular geometry, thickened septum and reduced LV end-diastolic diameter (LVEDD) in HCM may lead to increased suction events, arrhythmias and inflow cannula malfunction. We hypothesized that patients with end stage HCM benefit from LVAD therapy and have a similar rate of complications to those with ischemic or dilated CM. Between 2009 and 2014, 5 patients with end stage HCM (HCM and EF We conclude that select patients with end stage HCM may benefit from LVAD therapy with a similar rate of complications compared to traditional candidates. Additional study is warranted to further evaluate durable mechanical support in this population.
GRAND RAPIDS, Mich., March 28- The Spectrum Health Hypertrophic Cardiomyopathy Program has been designated a national Center of Excellence by the Hypertrophic Cardiomyopathy Association (HCMA). Spectrum Health joins 25 other centers nationwide with this recognition, and becomes the second center in the state of Michigan.. Hypertrophic cardiomyopathy (HCM) is the most common genetic cardiovascular disorder, and affects at least 1 in 500 people in the United States. It is characterized by abnormal thickening of the heart muscle which can cause multiple problems including obstruction of blood flow out of the heart, congestive heart failure symptoms, or heart rhythm disorders leading to loss of consciousness or sudden cardiac death.. HCMA Centers of Excellence are recognized for providing comprehensive diagnostic, treatment, education and research programs.. "This designation is the culmination of years spent building the necessary resources and collaboration of specialties, followed by an intensive ...
Familial hypertrophic cardiomyopathy (FHCM) is an autosomal dominant disease with protean clinical manifestations, ranging from asymptomatic to that of severe heart failure or sudden death. There ist no known parameter in individuals with hypertrophic cardiomyopathy (HCM) that predicts a specific clinical event. This is particularly troublesome for premature sudden death that frequently occurs in young athletes without prior symptoms. Recent identifications of mutations in the beta-myosin heavy chain (betaMHC) gene that co-segregate with the inheritance of the disease provides an opportunity to determine whether certain mutations are more likely to induce a particular clinical event. In this study we analyzed the genotype and phenotype of individuals from two unrelated families with HCM in which the affected individuals have the same missense mutation in exon 13 (G1208A) of the coding sequence for betaMHC. Results: We studied 54 individuals from the two families, 21 were affected with HCM of ...
TY - JOUR. T1 - Apical myectomy for patients with hypertrophic cardiomyopathy and advanced heart failure. AU - Nguyen, Anita. AU - Schaff, Hartzell V. AU - Nishimura, Rick A.. AU - Geske, Jeffrey B.. AU - Dearani, Joseph A.. AU - King, Katherine S.. AU - Ommen, Steve R.. PY - 2019/1/1. Y1 - 2019/1/1. N2 - Objective: In patients with apical hypertrophic cardiomyopathy, extensive apical hypertrophy may reduce left ventricular end-diastolic volume and contribute to diastolic dysfunction, angina, and ventricular arrhythmias. Transapical myectomy to augment left ventricular cavity size can increase stroke volume and decrease left ventricular end-diastolic pressure. In this study, we describe early outcomes of patients with apical hypertrophic cardiomyopathy after transapical myectomy and compare survival with that of patients with hypertrophic cardiomyopathy listed for heart transplantation. Methods: Between September 1993 and March 2017, 113 symptomatic patients with apical hypertrophic ...
PURPOSE. To examine the distribution of myosin-binding protein C (MyBP-C) in human extraocular muscles (EOMs) and to correlate the myosin heavy chain (MyHC) and the MyBP-C composition of the fibers.. METHODS. Samples from 17 EOMs, 3 levator palpebrae ( LP), and 6 limb muscles were analyzed with SDS-PAGE and immunoblot or processed for immunocytochemistry with monoclonal antibodies (mAbs) against MyBP-C-fast, MyBP-C-slow, MyHCIIa, MyHCI, MyHCsto, MyHC alpha-cardiac, and MyHCemb.. RESULTS. In the limb muscle samples, fast fibers were labeled with anti-MyBP-C-fast and anti-MyBP-C-slow, whereas the slow fibers were immunostained with anti-MyBP-C-slow only, in accordance with previous studies. In 11 EOM samples MyBPC-fast was not detected, and weak staining with anti-MyBP-Cfast was seen only in a few fibers in the proximal part of 2 muscles. The mAb against MyBP-C-slow labeled all fibers, but fibers containing MyHCI were generally more strongly stained. In the levator palpebrae, immunostaining with ...
OBJECTIVE: Angina and the presence of myocardial ischaemia are common in hypertrophic cardiomyopathy. Dual chamber pacing results in clinical improvement in these patients. This study evaluates the effects of permanent dual chamber pacing on absolute regional myocardial perfusion and perfusion reserve. SETTING: University hospital. PATIENTS AND DESIGN: Six patients with hypertrophic cardiomyopathy and severe symptoms of angina received a dual chamber pacemaker. Absolute myocardial regional perfusion and perfusion reserve (dipyridamole 0.56 mg/kg) were measured by dynamic positron emission tomography with 13N-ammonia both during sinus rhythm and 3 months after pacemaker insertion. Results were compared with those from 28 healthy volunteers. RESULTS: Pacing resulted in a reduction of anginal complaints and a reduction in intraventricular pressure gradient from 65 (SD 30) mm Hg to 19 (10) mm Hg. During sinus rhythm, baseline perfusion was higher in patients with hypertrophic cardiomyopathy than ...
Many of cTnT mutations linked to cardiomyopathies fall the TNT1 domain/N terminal tail region of unresolved high definition structure. This region (∼94-170) of cTnT is critical to Tm binding and contraction regulation. Here, the impact of the E163R mutation in cTnT-TNT1 on contractile function and tension cost was investigated using intact and skinned preparations from WT and transgenic mouse hearts. Methods: Left and right ventricular trabeculae were dissected from non-transgenic wild type (WT) and heterozygous (E163R or R92Q) mouse hearts and mounted isometrically to record twitch tension or, when skinned, Ca2+ activated force. Myofibrillar ATPase activity was measured by fluorimetric enzyme coupled assay (de Tombe and Stienen, 1995). In this thesis we aimed to assess the primary alterations of the contractile function and of tension cost caused by E163R cTnT-TNT1domain mutation, using skinned preparations or single myofibrils from WT and transgenic mouse hearts. Than we aimed to ...
Cardiomyopathy: Dilated (Alcoholic) · Hypertrophic · Restrictive (Loeffler endocarditis, Cardiac amyloidosis, Endocardial ... Atrial flutter · Ventricular flutter · Atrial fibrillation (Familial) · Ventricular fibrillation. Pacemaker. Wandering ...
Familial renal disease is inherited in Abyssinians and Persians. *Feline hypertrophic cardiomyopathy ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Tachycardia-induced. *Restrictive. *Loeffler endocarditis. *Cardiac ...
"Familial hypertrophic cardiomyopathy". Genetics Home Reference. U.S. National Library of Medicine.. This article incorporates ... Cardiomyopathy[edit]. Mutations in the MT-TI gene may also cause cardiomyopathy, a disorder of the heart characterized by the ... and hypertrophic cardiomyopathy.[10] A patient with a 4269A,G mutation in MT-TI was found with the deficiency.[11] ... causing hypertrophic cardiomyopathy". Human Mutation. 8 (3): 216-22. doi:10.1002/(SICI)1098-1004(1996)8:3,216::AID-HUMU4,3.0.CO ...
Familial[edit]. This type is caused by mutations of proteins involved in amyloid formation, including transthyretin (TTR), ... Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Tachycardia-induced. *Restrictive. *Loeffler endocarditis. *Cardiac ... This disease has multiple types including light chain, familial, and senile.[2] One of the most studied types is light chain ... For familial amyloidosis, ACE-inhibitors and beta-blockers can be prescribed if there is no autonomic neuropathy.[1] ...
... this in more detail in cardiac tissue and found that murine hearts lacking desmin developed hypertrophic cardiomyopathy and ... "Missense mutations in desmin associated with familial cardiac and skeletal myopathy". Nature Genetics. 19 (4): 402-3. doi: ... "Non-compaction cardiomyopathy is caused by a novel in-frame desmin (DES) deletion mutation within the 1A coiled-coil rod ... "Desmin mutation responsible for idiopathic dilated cardiomyopathy". Circulation. 100 (5): 461-4. doi:10.1161/01.cir.100.5.461. ...
Hypertrophic cardiomyopathy, autosomal dominant mutations of TNNT2; hypertrophy usually mild; restrictive phenotype may be ... Familial adenomatous polyposis. *galactosemia. *Gaucher disease. *Gaucher-like disease. *Gelatinous drop-like corneal dystrophy ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Tachycardia-induced. *Restrictive. *Loeffler endocarditis. *Cardiac ...
Hypertrophic cardiomyopathy (thickening of part of the heart muscle) is also sometimes found and can cause death;[1] asymmetric ...
A micrograph showing hypertrophic decidual vasculopathy, a finding seen in gestational hypertension and pre-eclampsia. H&E ... Hjartardottir S, Leifsson BG, Geirsson RT, Steinthorsdottir V (2004). "Paternity change and the recurrence risk in familial ... Peripartum cardiomyopathy. *Postpartum depression. *Postpartum psychosis. *Postpartum thyroiditis. *Puerperal fever. *Puerperal ...
Echocardiography can help detect cardiomyopathies, such as hypertrophic cardiomyopathy, dilated cardiomyopathy, and many others ... It is the most common type of hypertension, affecting 95% of hypertensive patients,[26][27][28][29] it tends to be familial and ... Heart disease, Cardiovascular disease, Atherosclerosis, Cardiomyopathy, Hypertension (High Blood Pressure). Significant tests. ... Cardiac disorders such as coronary heart disease, including myocardial infarction, heart failure, cardiomyopathy, and ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Tachycardia-induced. *Restrictive. *Loeffler endocarditis. *Cardiac ...
Coronary heart disease, aortic stenosis, cardiomyopathy, electrolyte problems, heart attack[1][2]. ... Ventricular tachycardia can occur due to coronary heart disease, aortic stenosis, cardiomyopathy, electrolyte problems, or a ... Ventricular tachycardia can occur due to coronary heart disease, aortic stenosis, cardiomyopathy, electrolyte problems (e.g., ... "Catheter ablation of ventricular tachycardia in ischaemic and non-ischaemic cardiomyopathy: where are we today? A clinical ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
I42.1) Obstructive hypertrophy cardiomyopathy. *(I42.2) Other hypertrophic cardiomyopathy. *(I42.3) Endomyocardial ( ... I43) Cardiomyopathy in diseases classified elsewhere. Other[edit]. *(I50) Heart failure *(I50.0) Congestive heart failure * ...
Cardiomyopathy: Dilated (Alcoholic), Hypertrophic, and Restrictive *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
The breed can be prone to gingivitis, which can lead to more serious periodontitis.[10] Familial renal amyloidosis or AA ... Hypertrophic cardiomyopathy. *Immunodeficiency virus. *Infectious peritonitis. *Leukemia virus. *Lower urinary tract disease ... Niewold TA, van der Linde-Sipman JS, Murphy C, Tooten PC, Gruys E (September 1999). "Familial amyloidosis in cats: Siamese and ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Hypertrophic cardiomyopathy 1, 8, 10. *Usher syndrome 1B. *Freeman-Sheldon syndrome. *DFN A3, 4, 11, 17, 22; B2, 30, 37, 48 ... KRT18 (Familial cirrhosis). *KRT81/KRT83/KRT86 (Monilethrix). *Naegeli-Franceschetti-Jadassohn syndrome. *Reticular pigmented ...
In populations where hypertrophic cardiomyopathy is screened out prior to involvement in competitive athletics, it is a common ... It is seen predominantly in males, and 30-50% of cases have a familial distribution. Up to 80% of individuals with ARVD present ... 110 ms) of QRS in V1 - V3 Family history Familial disease confirmed on autopsy or surgery Minor criteria Right ventricular ... The disease is a type of nonischemic cardiomyopathy that involves primarily the right ventricle. It is characterized by ...
Jasperson, KW; Tuohy, TM; Neklason, DW; Burt, RW (2010). "Hereditary and familial colon cancer". Gastroenterology. 138 (6): ... the hypertrophic growth response and cardiac conductance. miRNA's in animal models have also been linked to cholesterol ... "Targeted deletion of Dicer in the heart leads to dilated cardiomyopathy and heart failure". Proc. Natl. Acad. Sci. U.S.A. 105 ( ... "Mutation Altering the miR-184 Seed Region Causes Familial Keratoconus with Cataract". The American Journal of Human Genetics. ...
Other examples are hypertrophic cardiomyopathy, osteogenesis imperfecta, Familial hypercholesterolemia. Allelic heterogeneity ...
Gaucher disease (mutations in the GBA gene), Crohn's disease (mutation of NOD2) and familial hypertrophic cardiomyopathy ( ...
Familial Hypertrophic Cardiomyopathy with Atypical Location. Guler, Ahmet; Tigen, Kursat M.; Aung, Soe M.; Karabay, Can Yucel; ... The article describes the clinical case of a 25-year-old woman who was diagnosed with familial hypertrophic cardiomyopathy (HCM ... Apical Hypertrophic Cardiomyopathy. Ates, Mehmet; Kwong, Raymond Y.; Lipton, Martin J.; Tatli, Servet; Stainback, Raymond F ... Background: Patients with hypertrophic cardiomyopathy (HCM) exhibit a difference in left ventricular outflow tract (LVOT) ...
... to activate immune signaling Patient-specific induced pluripotent stem cells as a model for familial dilated cardiomyopathy The ... and the risk of infantile hypertrophic pyloric stenosis MC1R is a potent regulator of PTEN after UV exposure in melanocytes ... p53 and promote cellular quiescence Rare variants in cardiomyopathy genes associated with stress-induced cardiomyopathy ... from mechanism to therapy Partial restoration of cardiac function with ΔPDZ nNOS in aged mdx model of Duchenne cardiomyopathy ...
Danon disease; Cardiomyopathy. *Danon disease; Hypertrophic cardiomyopathy. *Deafness dystonia syndrome. *Deafness, X-linked ... Familial exudative vitreoretinopathy, X-linked. *Fanconi anemia, complementation group B; VACTERL association with hydrocephaly ... Endometrial carcinoma; Macrocephaly/autism syndrome; Meningioma, familial; Squamous cell carcinoma of the head and neck; ... Familial X-linked hypophosphatemic vitamin D refractory rickets. * ...
Dilated cardiomyopathy- DCM *Fabry Disease *Familial Amyloid Polyneuropathy *Hereditary myopathy with early respiratory failure ... Hypertrophic cardiomyopathy- HCM *Idiopathic Ventricular Fibrillation *Jervell-Lange Nielsen syndrome - JLNS *Jervell-Lange ... Familial nonpolyposis colon cancer - HNPCC - Lynch syndrome *Familial nonpolyposis colon cancer - HNPCC - Lynch syndrome - ... Familial nonpolyposis colon cancer - HNPCC - Lynch syndrome - Colorectal cancer hereditary nonpolyposis type 2 ...
Dilated cardiomyopathy- DCM *Fabry Disease *Familial Amyloid Polyneuropathy *Hereditary myopathy with early respiratory failure ... Hypertrophic cardiomyopathy- HCM *Idiopathic Ventricular Fibrillation *Jervell-Lange Nielsen syndrome - JLNS *Jervell-Lange ... Familial nonpolyposis colon cancer - HNPCC - Lynch syndrome *Familial nonpolyposis colon cancer - HNPCC - Lynch syndrome - ... Familial nonpolyposis colon cancer - HNPCC - Lynch syndrome - Colorectal cancer hereditary nonpolyposis type 2 ...
cardiomyopathy: A invention provided to respond allow the site of death in the organ. Rosiglitazone sends be isoform more ... The morbid cell deteriorates that Allergic brain heart chapter of DRC joins familial candidate of the UPS, occurring a ... a submaximal 5 natriuretic or a as Hypertrophic Pregn-4-ene-3,20-dione not relevant) at least one of the clinical signs ... d: The high-risk network that concludes the coronary cardiomyopathy of the references and the congestive discharge of the ...
Growth hormone deficiency Nystagmus Transient ischemic attack Stroke Developmental regression Hypertrophic cardiomyopathy Joint ... Abetalipoproteinemia/ homozygous familial hypobetalipoproteinemia (ABL/HoFHBL) is a severe form of familial ... Hearing impairment Behavioral abnormality Congestive heart failure Diarrhea Cardiomyopathy Fatigue Fever Muscle weakness ... More info about NEUROFIBROMATOSIS, FAMILIAL SPINAL Low match HYPOTHYROIDISM, CONGENITAL, NONGOITROUS, 2; CHNG2. In 80 to 85% of ...
Hypertrophic cardiomyopathy Hypokinesia Hypovolemia Iatrogenic complications Impedance cardiography Instability ... Familial Fingerprinting Flecainide Friction resistance Functional reserves Functional state Gene Gerontology Gua Figures Health ...
Hypertrophic cardiomyopathy Hypokinesia Hypovolemia Iatrogenic complications Impedance cardiography Instability ... Familial Fingerprinting Flecainide Friction resistance Functional reserves Functional state Gene Gerontology Gua Figures Health ...
Hypertrophic cardiomyopathy (0) * Inflammatory disease (1) * Kabuki syndrome (0) * Long QT syndrome 1 (0) ... Familial long QT syndrome (1) * Focal segmental glomerulosclerosis (0) * Frontotemporal dementia (7) ...
Hypertrophic cardiomyopathy (HCM) is characterized by a heterogeneous presentation and clinical course. Generalization of the ... The collection is the most extensive published to date and extends previous observations of familial aggregation that are ...
Familial hypertrophic cardiomyopathy - Genetics Ho.... *Asperger syndrome - Genetics Home Reference. *Mycosis fungoides - ...
West Midlands Familial Hypercholesterolaemia (FH) service. *Cardiac devices. *Hypertrophic Cardiomyopathy (HCM). *Atrial ...
Hypertrophic cardiomyopathy (HCM3) * Hypokalemia * Hypotrichosis and short life expectancy * Mucopolysaccharidosis type VI ( ... Familial nephropathy (FN) * Familial Nephropathy (FN) partnerlaboratory * Fanconi syndrome * Finnish Hound ataxia (FHA) ...
A Next-Generation Sequencing Approach to Identify Gene Mutations in Early- and Late-Onset Hypertrophic Cardiomyopathy Patients ... Familial partial lipodystrophies (FPLD) are diseases relating to abnormal adipose tissue topography and reduction in total fat ... Familial partial lipodystrophy linked to a novel peroxisome proliferator activator receptor -gamma (pparg) mutation, h449l: A ... Hegele, R.A.; Cao, H.; Frankowski, C.; Mathews, S.T.; Leff, T. Pparg f388l, a transactivation-deficient mutant, in familial ...
In vitro rescue study of a malignant familial hypertrophic cardiomyopathy phenotype by pseudo-phosphorylation of myosin ... Here we stomex information about present a case of biventricular failure due to stress cardiomyopathy after pericardiectomy. ...
... myosin-binding protein-C gene in familial hypertrophic cardiomyopathy. Journal of Clinical Investigation. 100 (1997) 475-482. ... and hypertrophic cardiomyopathy (Rottbauer et al., 1997). The I- band region of titin, largely composed of immunoglobulin-like ...
... could define such hot spots in TNNT2 were looked for in unrelated French families with familial hypertrophic cardiomyopathy. ... A 73-year-old female with a history of surgical ventricular restoration for ischemic cardiomyopathy presented with ...
19-year-old Sean ONeill was diagnosed with hypertrophic cardiomyopathy four years ago.. Sun 11:01 AM 14,637 Views 4 Comments ... who passed away from Familial Dilated Cardiomyopathy at the age of 24. ... it was discovered that ONeill has hypertrophic cardiomyopathy (HCM). HCM occurs if the heart muscle cells enlarge and cause ...
High-Dose Tafamidis Boosts Survival in Transthyretin Amyloidosis Cardiomyopathy * Diagnosis of Hypertrophic Cardiomyopathy: ... and consistent model system exists that can reliably prognosticate patients with transthyretin-type amyloid cardiomyopathy," ...
English to German: Gene Mutations in Apical Hypertrophic Cardiomyopathy. General field: Medical. Detailed field: Medical: ... Clinical evaluations demonstrated familial apical HCM in 4 probands, and in 3 probands disease-causing mutations were ... Gene Mutations in Apical Hypertrophic Cardiomyopathy. From the Department of Genetics, Harvard Medical School, Boston, Mass (M. ... Nonobstructive hypertrophy localized to the cardiac apex is an uncommon morphological variant of hypertrophic cardiomyopathy ( ...
In contrast, a deletion mutation ΔE160 in cTnT that causes familial hypertrophic cardiomyopathy (HCM) decreased the free Ca 2+ ... In contrast, a deletion mutation ΔE160 in cTnT that causes familial hypertrophic cardiomyopathy (HCM) decreased the free Ca 2+ ... In contrast, a deletion mutation ΔE160 in cTnT that causes familial hypertrophic cardiomyopathy (HCM) decreased the free Ca 2+ ... In contrast, a deletion mutation ΔE160 in cTnT that causes familial hypertrophic cardiomyopathy (HCM) decreased the free Ca 2+ ...
Aims To explore the cost-effectiveness of alternative methods of screening family members for hypertrophic cardiomyopathy (HCM ... Adolescent, Adult, Aged, Cardiomyopathy, Hypertrophic, Familial, Child, Cost-Benefit Analysis, Death, Sudden, Cardiac, Decision ... DNA testing for hypertrophic cardiomyopathy: a cost-effectiveness model. Wordsworth S., Leal J., Blair E., Legood R., Thomson K ... Aims To explore the cost-effectiveness of alternative methods of screening family members for hypertrophic cardiomyopathy (HCM ...
Cross-bridge kinetics in myofibrils containing familial hypertrophic cardiomyopathy R58Q mutation in the regulatory light chain ...
Hypertrophic cardiomyopathy occurs as an autosomal dominant familial disorder or as a sporadic disease without familial ... The clinical benefits of defining mutations responsible for familial hypertrophic cardiomyopathy should also be available to ... gene account for approximately half of all cases of familial hypertrophic cardiomyopathy, the molecular causes of sporadic ... Sporadic hypertrophic cardiomyopathy due to de novo myosin mutations. Creators Name:. Watkins, H. and Thierfelder, L. and Hwang ...
  • Occurrence of Renal Cell Carcinoma in Other DisordersVon Hippel-Lindau syndrome ( OMIM ) is a familial multicancer syndrome in which there is a susceptibility to a variety of neoplasms, including renal cell carcinoma of clear cell histology and renal cysts. (mendelian.co)
  • Abetalipoproteinemia/ homozygous familial hypobetalipoproteinemia (ABL/HoFHBL) is a severe form of familial hypobetalipoproteinemia (see this term) characterized by permanently low levels (below the 5th percentile) of apolipoprotein B and LDL cholesterol, and by growth delay, malabsorption, hepatomegaly, and neurological and neuromuscular manifestations. (mendelian.co)
  • Barry J. Maron, Iacopo Olivotto et al, Epidemiology of cardiomyopathy-relateddeathrevisited in a large non-referralbased population. (ccrjournal.org)
  • Genetic testing for AD is only available for a small number of families with early-onset familial AD, with testing likely to be initiated in a living affected relative. (geneticseducation.ca)