A form of CARDIAC MUSCLE disease that is characterized by ventricular dilation, VENTRICULAR DYSFUNCTION, and HEART FAILURE. Risk factors include SMOKING; ALCOHOL DRINKING; HYPERTENSION; INFECTION; PREGNANCY; and mutations in the LMNA gene encoding LAMIN TYPE A, a NUCLEAR LAMINA protein.
A form of CARDIAC MUSCLE disease, characterized by left and/or right ventricular hypertrophy (HYPERTROPHY, LEFT VENTRICULAR; HYPERTROPHY, RIGHT VENTRICULAR), frequent asymmetrical involvement of the HEART SEPTUM, and normal or reduced left ventricular volume. Risk factors include HYPERTENSION; AORTIC STENOSIS; and gene MUTATION; (FAMILIAL HYPERTROPHIC CARDIOMYOPATHY).
A group of diseases in which the dominant feature is the involvement of the CARDIAC MUSCLE itself. Cardiomyopathies are classified according to their predominant pathophysiological features (DILATED CARDIOMYOPATHY; HYPERTROPHIC CARDIOMYOPATHY; RESTRICTIVE CARDIOMYOPATHY) or their etiological/pathological factors (CARDIOMYOPATHY, ALCOHOLIC; ENDOCARDIAL FIBROELASTOSIS).
A form of CARDIAC MUSCLE disease in which the ventricular walls are excessively rigid, impeding ventricular filling. It is marked by reduced diastolic volume of either or both ventricles but normal or nearly normal systolic function. It may be idiopathic or associated with other diseases (ENDOMYOCARDIAL FIBROSIS or AMYLOIDOSIS) causing interstitial fibrosis.
A transient left ventricular apical dysfunction or ballooning accompanied by electrocardiographic (ECG) T wave inversions. This abnormality is associated with high levels of CATECHOLAMINES, either administered or endogenously secreted from a tumor or during extreme stress.
An autosomal dominant inherited form of HYPERTROPHIC CARDIOMYOPATHY. It results from any of more than 50 mutations involving genes encoding contractile proteins such as VENTRICULAR MYOSINS; cardiac TROPONIN T; ALPHA-TROPOMYOSIN.
A disease of the CARDIAC MUSCLE developed subsequent to the initial protozoan infection by TRYPANOSOMA CRUZI. After infection, less than 10% develop acute illness such as MYOCARDITIS (mostly in children). The disease then enters a latent phase without clinical symptoms until about 20 years later. Myocardial symptoms of advanced CHAGAS DISEASE include conduction defects (HEART BLOCK) and CARDIOMEGALY.
The muscle tissue of the HEART. It is composed of striated, involuntary muscle cells (MYOCYTES, CARDIAC) connected to form the contractile pump to generate blood flow.
Disease of CARDIAC MUSCLE resulting from chronic excessive alcohol consumption. Myocardial damage can be caused by: (1) a toxic effect of alcohol; (2) malnutrition in alcoholics such as THIAMINE DEFICIENCY; or (3) toxic effect of additives in alcoholic beverages such as COBALT. This disease is usually manifested by DYSPNEA and palpitations with CARDIOMEGALY and congestive heart failure (HEART FAILURE).
Ultrasonic recording of the size, motion, and composition of the heart and surrounding tissues. The standard approach is transthoracic.
A congenital cardiomyopathy that is characterized by infiltration of adipose and fibrous tissue into the RIGHT VENTRICLE wall and loss of myocardial cells. Primary injuries usually are at the free wall of right ventricular and right atria resulting in ventricular and supraventricular arrhythmias.
Diabetes complications in which VENTRICULAR REMODELING in the absence of CORONARY ATHEROSCLEROSIS and hypertension results in cardiac dysfunctions, typically LEFT VENTRICULAR DYSFUNCTION. The changes also result in myocardial hypertrophy, myocardial necrosis and fibrosis, and collagen deposition due to impaired glucose tolerance.
Recording of the moment-to-moment electromotive forces of the HEART as projected onto various sites on the body's surface, delineated as a scalar function of time. The recording is monitored by a tracing on slow moving chart paper or by observing it on a cardioscope, which is a CATHODE RAY TUBE DISPLAY.
The hemodynamic and electrophysiological action of the left HEART VENTRICLE. Its measurement is an important aspect of the clinical evaluation of patients with heart disease to determine the effects of the disease on cardiac performance.
Inflammatory processes of the muscular walls of the heart (MYOCARDIUM) which result in injury to the cardiac muscle cells (MYOCYTES, CARDIAC). Manifestations range from subclinical to sudden death (DEATH, SUDDEN). Myocarditis in association with cardiac dysfunction is classified as inflammatory CARDIOMYOPATHY usually caused by INFECTION, autoimmune diseases, or responses to toxic substances. Myocarditis is also a common cause of DILATED CARDIOMYOPATHY and other cardiomyopathies.
A condition in which the LEFT VENTRICLE of the heart was functionally impaired. This condition usually leads to HEART FAILURE; MYOCARDIAL INFARCTION; and other cardiovascular complications. Diagnosis is made by measuring the diminished ejection fraction and a depressed level of motility of the left ventricular wall.
The lower right and left chambers of the heart. The right ventricle pumps venous BLOOD into the LUNGS and the left ventricle pumps oxygenated blood into the systemic arterial circulation.
This structure includes the thin muscular atrial septum between the two HEART ATRIA, and the thick muscular ventricular septum between the two HEART VENTRICLES.
A heterogeneous condition in which the heart is unable to pump out sufficient blood to meet the metabolic need of the body. Heart failure can be caused by structural defects, functional abnormalities (VENTRICULAR DYSFUNCTION), or a sudden overload beyond its capacity. Chronic heart failure is more common than acute heart failure which results from sudden insult to cardiac function, such as MYOCARDIAL INFARCTION.
Occlusion of the outflow tract in either the LEFT VENTRICLE or the RIGHT VENTRICLE of the heart. This may result from CONGENITAL HEART DEFECTS, predisposing heart diseases, complications of surgery, or HEART NEOPLASMS.
Contractile activity of the MYOCARDIUM.
Striated muscle cells found in the heart. They are derived from cardiac myoblasts (MYOBLASTS, CARDIAC).
The hollow, muscular organ that maintains the circulation of the blood.
The amount of BLOOD pumped out of the HEART per beat, not to be confused with cardiac output (volume/time). It is calculated as the difference between the end-diastolic volume and the end-systolic volume.
Unexpected rapid natural death due to cardiovascular collapse within one hour of initial symptoms. It is usually caused by the worsening of existing heart diseases. The sudden onset of symptoms, such as CHEST PAIN and CARDIAC ARRHYTHMIAS, particularly VENTRICULAR TACHYCARDIA, can lead to the loss of consciousness and cardiac arrest followed by biological death. (from Braunwald's Heart Disease: A Textbook of Cardiovascular Medicine, 7th ed., 2005)
Myosin type II isoforms found in cardiac muscle.
The period shortly before, during, and immediately after giving birth.
Measurement of intracardiac blood flow using an M-mode and/or two-dimensional (2-D) echocardiogram while simultaneously recording the spectrum of the audible Doppler signal (e.g., velocity, direction, amplitude, intensity, timing) reflected from the moving column of red blood cells.
Isoforms of MYOSIN TYPE II, specifically found in the ventricular muscle of the HEART. Defects in the genes encoding ventricular myosins result in FAMILIAL HYPERTROPHIC CARDIOMYOPATHY.
Any pathological condition where fibrous connective tissue invades any organ, usually as a consequence of inflammation or other injury.
An abnormally rapid ventricular rhythm usually in excess of 150 beats per minute. It is generated within the ventricle below the BUNDLE OF HIS, either as autonomic impulse formation or reentrant impulse conduction. Depending on the etiology, onset of ventricular tachycardia can be paroxysmal (sudden) or nonparoxysmal, its wide QRS complexes can be uniform or polymorphic, and the ventricular beating may be independent of the atrial beating (AV dissociation).
The repeating contractile units of the MYOFIBRIL, delimited by Z bands along its length.
A condition characterized by the thickening of the ventricular ENDOCARDIUM and subendocardium (MYOCARDIUM), seen mostly in children and young adults in the TROPICAL CLIMATE. The fibrous tissue extends from the apex toward and often involves the HEART VALVES causing restrictive blood flow into the respective ventricles (CARDIOMYOPATHY, RESTRICTIVE).
The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.
A disorder of cardiac function caused by insufficient blood flow to the muscle tissue of the heart. The decreased blood flow may be due to narrowing of the coronary arteries (CORONARY ARTERY DISEASE), to obstruction by a thrombus (CORONARY THROMBOSIS), or less commonly, to diffuse narrowing of arterioles and other small vessels within the heart. Severe interruption of the blood supply to the myocardial tissue may result in necrosis of cardiac muscle (MYOCARDIAL INFARCTION).
The larger subunits of MYOSINS. The heavy chains have a molecular weight of about 230 kDa and each heavy chain is usually associated with a dissimilar pair of MYOSIN LIGHT CHAINS. The heavy chains possess actin-binding and ATPase activity.
Enlargement of the LEFT VENTRICLE of the heart. This increase in ventricular mass is attributed to sustained abnormal pressure or volume loads and is a contributor to cardiovascular morbidity and mortality.
Any disturbances of the normal rhythmic beating of the heart or MYOCARDIAL CONTRACTION. Cardiac arrhythmias can be classified by the abnormalities in HEART RATE, disorders of electrical impulse generation, or impulse conduction.
The innermost layer of the heart, comprised of endothelial cells.
Members of the armadillo family of proteins that are found in DESMOSOMES and interact with various proteins including desmocadherins; DESMOPLAKIN; ACTIN FILAMENTS; and KERATINS.
The transference of a heart from one human or animal to another.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
A subclass of developmentally regulated lamins having a neutral isoelectric point. They are found to disassociate from nuclear membranes during mitosis.
The geometric and structural changes that the HEART VENTRICLES undergo, usually following MYOCARDIAL INFARCTION. It comprises expansion of the infarct and dilatation of the healthy ventricle segments. While most prevalent in the left ventricle, it can also occur in the right ventricle.
One of the three polypeptide chains that make up the TROPONIN complex. It is a cardiac-specific protein that binds to TROPOMYOSIN. It is released from damaged or injured heart muscle cells (MYOCYTES, CARDIAC). Defects in the gene encoding troponin T result in FAMILIAL HYPERTROPHIC CARDIOMYOPATHY.
The movement and the forces involved in the movement of the blood through the CARDIOVASCULAR SYSTEM.
Regulation of the rate of contraction of the heart muscles by an artificial pacemaker.
Post-systolic relaxation of the HEART, especially the HEART VENTRICLES.
Pathological conditions involving the HEART including its structural and functional abnormalities.
Disorders or diseases associated with PUERPERIUM, the six-to-eight-week period immediately after PARTURITION in humans.
A family of transmembrane dystrophin-associated proteins that play a role in the membrane association of the DYSTROPHIN-ASSOCIATED PROTEIN COMPLEX.
Enlargement of the HEART, usually indicated by a cardiothoracic ratio above 0.50. Heart enlargement may involve the right, the left, or both HEART VENTRICLES or HEART ATRIA. Cardiomegaly is a nonspecific symptom seen in patients with chronic systolic heart failure (HEART FAILURE) or several forms of CARDIOMYOPATHIES.
Implantable devices which continuously monitor the electrical activity of the heart and automatically detect and terminate ventricular tachycardia (TACHYCARDIA, VENTRICULAR) and VENTRICULAR FIBRILLATION. They consist of an impulse generator, batteries, and electrodes.
The abrupt cessation of all vital bodily functions, manifested by the permanent loss of total cerebral, respiratory, and cardiovascular functions.
A type of imaging technique used primarily in the field of cardiology. By coordinating the fast gradient-echo MRI sequence with retrospective ECG-gating, numerous short time frames evenly spaced in the cardiac cycle are produced. These images are laced together in a cinematic display so that wall motion of the ventricles, valve motion, and blood flow patterns in the heart and great vessels can be visualized.
A CALCIUM-dependent adhesion molecule of DESMOSOMES that also plays a role in embryonic STEM CELL proliferation.
Studies in which individuals or populations are followed to assess the outcome of exposures, procedures, or effects of a characteristic, e.g., occurrence of disease.
Period of contraction of the HEART, especially of the HEART VENTRICLES.
Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.
Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.
Procedures in which placement of CARDIAC CATHETERS is performed for therapeutic or diagnostic procedures.
An X-linked dominant multisystem disorder resulting in cardiomyopathy, myopathy and INTELLECTUAL DISABILITY. It is caused by mutation in the gene encoding LYSOSOMAL-ASSOCIATED MEMBRANE PROTEIN 2.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)
Rare congenital cardiomyopathies characterized by the lack of left ventricular myocardium compaction. The noncompaction results in numerous prominent trabeculations and a loose myocardial meshwork (spongy myocardium) in the LEFT VENTRICLE. Heterogeneous clinical features include diminished systolic function sometimes associated with left ventricular dilation, that presents either neonatally or progressively. Often, the RIGHT VENTRICLE is also affected. CONGESTIVE HEART FAILURE; PULMONARY EMBOLISM; and ventricular ARRHYTHMIA are commonly seen.
The co-occurrence of pregnancy and a cardiovascular disease. The disease may precede or follow FERTILIZATION and it may or may not have a deleterious effect on the pregnant woman or FETUS.
An intermediate filament protein found predominantly in smooth, skeletal, and cardiac muscle cells. Localized at the Z line. MW 50,000 to 55,000 is species dependent.
A muscle protein localized in surface membranes which is the product of the Duchenne/Becker muscular dystrophy gene. Individuals with Duchenne muscular dystrophy usually lack dystrophin completely while those with Becker muscular dystrophy have dystrophin of an altered size. It shares features with other cytoskeletal proteins such as SPECTRIN and alpha-actinin but the precise function of dystrophin is not clear. One possible role might be to preserve the integrity and alignment of the plasma membrane to the myofibrils during muscle contraction and relaxation. MW 400 kDa.
Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.
A condition in which HEART VENTRICLES exhibit impaired function.
Drugs that bind to but do not activate beta-adrenergic receptors thereby blocking the actions of beta-adrenergic agonists. Adrenergic beta-antagonists are used for treatment of hypertension, cardiac arrhythmias, angina pectoris, glaucoma, migraine headaches, and anxiety.
The valve between the left atrium and left ventricle of the heart.
Examinations used to diagnose and treat heart conditions.
Backflow of blood from the LEFT VENTRICLE into the LEFT ATRIUM due to imperfect closure of the MITRAL VALVE. This can lead to mitral valve regurgitation.
Removal of tissue by vaporization, abrasion, or destruction. Methods used include heating tissue by hot liquids or microwave thermal heating, freezing (CRYOABLATION), chemical ablation, and photoablation with LASERS.
A guanidine analog with specific affinity for tissues of the sympathetic nervous system and related tumors. The radiolabeled forms are used as antineoplastic agents and radioactive imaging agents. (Merck Index, 12th ed) MIBG serves as a neuron-blocking agent which has a strong affinity for, and retention in, the adrenal medulla and also inhibits ADP-ribosyltransferase.
A prediction of the probable outcome of a disease based on a individual's condition and the usual course of the disease as seen in similar situations.
Agents that have a strengthening effect on the heart or that can increase cardiac output. They may be CARDIAC GLYCOSIDES; SYMPATHOMIMETICS; or other drugs. They are used after MYOCARDIAL INFARCT; CARDIAC SURGICAL PROCEDURES; in SHOCK; or in congestive heart failure (HEART FAILURE).
Removal of tissue with electrical current delivered via electrodes positioned at the distal end of a catheter. Energy sources are commonly direct current (DC-shock) or alternating current at radiofrequencies (usually 750 kHz). The technique is used most often to ablate the AV junction and/or accessory pathways in order to interrupt AV conduction and produce AV block in the treatment of various tachyarrhythmias.
Elements of limited time intervals, contributing to particular results or situations.
Impaired conduction of cardiac impulse that can occur anywhere along the conduction pathway, such as between the SINOATRIAL NODE and the right atrium (SA block) or between atria and ventricles (AV block). Heart blocks can be classified by the duration, frequency, or completeness of conduction block. Reversibility depends on the degree of structural or functional defects.
In screening and diagnostic tests, the probability that a person with a positive test is a true positive (i.e., has the disease), is referred to as the predictive value of a positive test; whereas, the predictive value of a negative test is the probability that the person with a negative test does not have the disease. Predictive value is related to the sensitivity and specificity of the test.
Removal and pathologic examination of specimens in the form of small pieces of tissue from the living body.
An X-linked recessive muscle disease caused by an inability to synthesize DYSTROPHIN, which is involved with maintaining the integrity of the sarcolemma. Muscle fibers undergo a process that features degeneration and regeneration. Clinical manifestations include proximal weakness in the first few years of life, pseudohypertrophy, cardiomyopathy (see MYOCARDIAL DISEASES), and an increased incidence of impaired mentation. Becker muscular dystrophy is a closely related condition featuring a later onset of disease (usually adolescence) and a slowly progressive course. (Adams et al., Principles of Neurology, 6th ed, p1415)
A transient loss of consciousness and postural tone caused by diminished blood flow to the brain (i.e., BRAIN ISCHEMIA). Presyncope refers to the sensation of lightheadedness and loss of strength that precedes a syncopal event or accompanies an incomplete syncope. (From Adams et al., Principles of Neurology, 6th ed, pp367-9)
Recording the locations and measurements of electrical activity in the EPICARDIUM by placing electrodes on the surface of the heart to analyze the patterns of activation and to locate arrhythmogenic sites.
A protein found in the thin filaments of muscle fibers. It inhibits contraction of the muscle unless its position is modified by TROPONIN.
Method in which prolonged electrocardiographic recordings are made on a portable tape recorder (Holter-type system) or solid-state device ("real-time" system), while the patient undergoes normal daily activities. It is useful in the diagnosis and management of intermittent cardiac arrhythmias and transient myocardial ischemia.
Observation of a population for a sufficient number of persons over a sufficient number of years to generate incidence or mortality rates subsequent to the selection of the study group.
A condition in which the RIGHT VENTRICLE of the heart was functionally impaired. This condition usually leads to HEART FAILURE or MYOCARDIAL INFARCTION, and other cardiovascular complications. Diagnosis is made by measuring the diminished ejection fraction and a depressed level of motility of the right ventricular wall.
A giant elastic protein of molecular mass ranging from 2,993 kDa (cardiac), 3,300 kDa (psoas), to 3,700 kDa (soleus) having a kinase domain. The amino- terminal is involved in a Z line binding, and the carboxy-terminal region is bound to the myosin filament with an overlap between the counter-connectin filaments at the M line.
The long cylindrical contractile organelles of STRIATED MUSCLE cells composed of ACTIN FILAMENTS; MYOSIN filaments; and other proteins organized in arrays of repeating units called SARCOMERES .
The mitochondria of the myocardium.
A form of heart block in which the electrical stimulation of HEART VENTRICLES is interrupted at either one of the branches of BUNDLE OF HIS thus preventing the simultaneous depolarization of the two ventricles.
Methods to induce and measure electrical activities at specific sites in the heart to diagnose and treat problems with the heart's electrical system.
One of the three polypeptide chains that make up the TROPONIN complex. It inhibits F-actin-myosin interactions.
A diverse superfamily of proteins that function as translocating proteins. They share the common characteristics of being able to bind ACTINS and hydrolyze MgATP. Myosins generally consist of heavy chains which are involved in locomotion, and light chains which are involved in regulation. Within the structure of myosin heavy chain are three domains: the head, the neck and the tail. The head region of the heavy chain contains the actin binding domain and MgATPase domain which provides energy for locomotion. The neck region is involved in binding the light-chains. The tail region provides the anchoring point that maintains the position of the heavy chain. The superfamily of myosins is organized into structural classes based upon the type and arrangement of the subunits they contain.
Echocardiography applying the Doppler effect, with the superposition of flow information as colors on a gray scale in a real-time image.
Abnormally rapid heartbeat, usually with a HEART RATE above 100 beats per minute for adults. Tachycardia accompanied by disturbance in the cardiac depolarization (cardiac arrhythmia) is called tachyarrhythmia.
A heterogeneous group of infections produced by coxsackieviruses, including HERPANGINA, aseptic meningitis (MENINGITIS, ASEPTIC), a common-cold-like syndrome, a non-paralytic poliomyelitis-like syndrome, epidemic pleurodynia (PLEURODYNIA, EPIDEMIC) and a serious MYOCARDITIS.
Inflammation of the PERICARDIUM that is characterized by the fibrous scarring and adhesion of both serous layers, the VISCERAL PERICARDIUM and the PARIETAL PERICARDIUM leading to the loss of pericardial cavity. The thickened pericardium severely restricts cardiac filling. Clinical signs include FATIGUE, muscle wasting, and WEIGHT LOSS.
Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.
The circulation of blood through the CORONARY VESSELS of the HEART.
AMINO ALCOHOLS containing the propanolamine (NH2CH2CHOHCH2) group and its derivatives.
Small pumps, often implantable, designed for temporarily assisting the heart, usually the LEFT VENTRICLE, to pump blood. They consist of a pumping chamber and a power source, which may be partially or totally external to the body and activated by electromagnetic motors.
Studies used to test etiologic hypotheses in which inferences about an exposure to putative causal factors are derived from data relating to characteristics of persons under study or to events or experiences in their past. The essential feature is that some of the persons under study have the disease or outcome of interest and their characteristics are compared with those of unaffected persons.
A device designed to stimulate, by electric impulses, contraction of the heart muscles. It may be temporary (external) or permanent (internal or internal-external).
A PEPTIDE that is secreted by the BRAIN and the HEART ATRIA, stored mainly in cardiac ventricular MYOCARDIUM. It can cause NATRIURESIS; DIURESIS; VASODILATION; and inhibits secretion of RENIN and ALDOSTERONE. It improves heart function. It contains 32 AMINO ACIDS.
Detection of a MUTATION; GENOTYPE; KARYOTYPE; or specific ALLELES associated with genetic traits, heritable diseases, or predisposition to a disease, or that may lead to the disease in descendants. It includes prenatal genetic testing.
Echocardiography applying the Doppler effect, with velocity detection combined with range discrimination. Short bursts of ultrasound are transmitted at regular intervals and the echoes are demodulated as they return.
A group of desmosomal cadherins with cytoplasmic tails that are divergent from those of classical CADHERINS. Their intracytoplasmic domains bind PLAKOGLOBIN; PLAKOPHILINS; and DESMOPLAKINS.
Biochemical identification of mutational changes in a nucleotide sequence.
A large class of structurally-related proteins that contain one or more LIM zinc finger domains. Many of the proteins in this class are involved in intracellular signaling processes and mediate their effects via LIM domain protein-protein interactions. The name LIM is derived from the first three proteins in which the motif was found: LIN-11, Isl1 and Mec-3.
Levels within a diagnostic group which are established by various measurement criteria applied to the seriousness of a patient's disorder.
A selective adrenergic beta-1 blocking agent that is commonly used to treat ANGINA PECTORIS; HYPERTENSION; and CARDIAC ARRHYTHMIAS.
Non-invasive method of demonstrating internal anatomy based on the principle that atomic nuclei in a strong magnetic field absorb pulses of radiofrequency energy and emit them as radiowaves which can be reconstructed into computerized images. The concept includes proton spin tomographic techniques.
Desmoplakins are cytoskeletal linker proteins that anchor INTERMEDIATE FILAMENTS to the PLASMA MEMBRANE at DESMOSOMES.
An impulse-conducting system composed of modified cardiac muscle, having the power of spontaneous rhythmicity and conduction more highly developed than the rest of the heart.
A genetically heterogeneous, multifaceted disorder characterized by short stature, webbed neck, ptosis, skeletal malformations, hypertelorism, hormonal imbalance, CRYPTORCHIDISM, multiple cardiac abnormalities (most commonly including PULMONARY VALVE STENOSIS), and some degree of INTELLECTUAL DISABILITY. The phenotype bears similarities to that of TURNER SYNDROME that occurs only in females and has its basis in a 45, X karyotype abnormality. Noonan syndrome occurs in both males and females with a normal karyotype (46,XX and 46,XY). Mutations in a several genes (PTPN11, KRAS, SOS1, NF1 and RAF1) have been associated the the NS phenotype. Mutations in PTPN11 are the most common. LEOPARD SYNDROME, a disorder that has clinical features overlapping those of Noonan Syndrome, is also due to mutations in PTPN11. In addition, there is overlap with the syndrome called neurofibromatosis-Noonan syndrome due to mutations in NF1.
A subclass of beta-adrenergic receptors (RECEPTORS, ADRENERGIC, BETA). The adrenergic beta-1 receptors are equally sensitive to EPINEPHRINE and NOREPINEPHRINE and bind the agonist DOBUTAMINE and the antagonist METOPROLOL with high affinity. They are found in the HEART, juxtaglomerular cells, and in the central and peripheral nervous systems.
A type of junction that attaches one cell to its neighbor. One of a number of differentiated regions which occur, for example, where the cytoplasmic membranes of adjacent epithelial cells are closely apposed. It consists of a circular region of each membrane together with associated intracellular microfilaments and an intercellular material which may include, for example, mucopolysaccharides. (From Glick, Glossary of Biochemistry and Molecular Biology, 1990; Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
The pressure within a CARDIAC VENTRICLE. Ventricular pressure waveforms can be measured in the beating heart by catheterization or estimated using imaging techniques (e.g., DOPPLER ECHOCARDIOGRAPHY). The information is useful in evaluating the function of the MYOCARDIUM; CARDIAC VALVES; and PERICARDIUM, particularly with simultaneous measurement of other (e.g., aortic or atrial) pressures.
The protein constituents of muscle, the major ones being ACTINS and MYOSINS. More than a dozen accessory proteins exist including TROPONIN; TROPOMYOSIN; and DYSTROPHIN.
Benzo-indoles similar to CARBOLINES which are pyrido-indoles. In plants, carbazoles are derived from indole and form some of the INDOLE ALKALOIDS.
Controlled physical activity which is performed in order to allow assessment of physiological functions, particularly cardiovascular and pulmonary, but also aerobic capacity. Maximal (most intense) exercise is usually required but submaximal exercise is also used.
A catecholamine derivative with specificity for BETA-1 ADRENERGIC RECEPTORS. It is commonly used as a cardiotonic agent after CARDIAC SURGERY and during DOBUTAMINE STRESS ECHOCARDIOGRAPHY.
A type of cardiac arrhythmia with premature contractions of the HEART VENTRICLES. It is characterized by the premature QRS complex on ECG that is of abnormal shape and great duration (generally >129 msec). It is the most common form of all cardiac arrhythmias. Premature ventricular complexes have no clinical significance except in concurrence with heart diseases.
A state of subnormal or depressed cardiac output at rest or during stress. It is a characteristic of CARDIOVASCULAR DISEASES, including congenital, valvular, rheumatic, hypertensive, coronary, and cardiomyopathic. The serious form of low cardiac output is characterized by marked reduction in STROKE VOLUME, and systemic vasoconstriction resulting in cold, pale, and sometimes cyanotic extremities.
Death resulting from the presence of a disease in an individual, as shown by a single case report or a limited number of patients. This should be differentiated from DEATH, the physiological cessation of life and from MORTALITY, an epidemiological or statistical concept.
The number of times the HEART VENTRICLES contract per unit of time, usually per minute.
An individual having different alleles at one or more loci regarding a specific character.
Antineoplastic antibiotic obtained from Streptomyces peucetius. It is a hydroxy derivative of DAUNORUBICIN.
Diabetes mellitus induced experimentally by administration of various diabetogenic agents or by PANCREATECTOMY.
An autosomal recessive disease, usually of childhood onset, characterized pathologically by degeneration of the spinocerebellar tracts, posterior columns, and to a lesser extent the corticospinal tracts. Clinical manifestations include GAIT ATAXIA, pes cavus, speech impairment, lateral curvature of spine, rhythmic head tremor, kyphoscoliosis, congestive heart failure (secondary to a cardiomyopathy), and lower extremity weakness. Most forms of this condition are associated with a mutation in a gene on chromosome 9, at band q13, which codes for the mitochondrial protein frataxin. (From Adams et al., Principles of Neurology, 6th ed, p1081; N Engl J Med 1996 Oct 17;335(16):1169-75) The severity of Friedreich ataxia associated with expansion of GAA repeats in the first intron of the frataxin gene correlates with the number of trinucleotide repeats. (From Durr et al, N Engl J Med 1996 Oct 17;335(16):1169-75)
A heterogeneous group of inherited MYOPATHIES, characterized by wasting and weakness of the SKELETAL MUSCLE. They are categorized by the sites of MUSCLE WEAKNESS; AGE OF ONSET; and INHERITANCE PATTERNS.
Agents that affect the rate or intensity of cardiac contraction, blood vessel diameter, or blood volume.
The muscular structure separating the right and the left lower chambers (HEART VENTRICLES) of the heart. The ventricular septum consists of a very small membranous portion just beneath the AORTIC VALVE, and a large thick muscular portion consisting of three sections including the inlet septum, the trabecular septum, and the outlet septum.
The percent frequency with which a dominant or homozygous recessive gene or gene combination manifests itself in the phenotype of the carriers. (From Glossary of Genetics, 5th ed)
Imaging of a ventricle of the heart after the injection of a radioactive contrast medium. The technique is less invasive than cardiac catheterization and is used to assess ventricular function.
A group of sporadic, familial and/or inherited, degenerative, and infectious disease processes, linked by the common theme of abnormal protein folding and deposition of AMYLOID. As the amyloid deposits enlarge they displace normal tissue structures, causing disruption of function. Various signs and symptoms depend on the location and size of the deposits.
A group of muscle diseases associated with abnormal mitochondria function.
Calcium-transporting ATPases that catalyze the active transport of CALCIUM into the SARCOPLASMIC RETICULUM vesicles from the CYTOPLASM. They are primarily found in MUSCLE CELLS and play a role in the relaxation of MUSCLES.
Chemical substances, produced by microorganisms, inhibiting or preventing the proliferation of neoplasms.
The worsening of a disease over time. This concept is most often used for chronic and incurable diseases where the stage of the disease is an important determinant of therapy and prognosis.
A potentially lethal cardiac arrhythmia that is characterized by uncoordinated extremely rapid firing of electrical impulses (400-600/min) in HEART VENTRICLES. Such asynchronous ventricular quivering or fibrillation prevents any effective cardiac output and results in unconsciousness (SYNCOPE). It is one of the major electrocardiographic patterns seen with CARDIAC ARREST.
A localized bulging or dilatation in the muscle wall of a heart (MYOCARDIUM), usually in the LEFT VENTRICLE. Blood-filled aneurysms are dangerous because they may burst. Fibrous aneurysms interfere with the heart function through the loss of contractility. True aneurysm is bound by the vessel wall or cardiac wall. False aneurysms are HEMATOMA caused by myocardial rupture.
A potent natriuretic and vasodilatory peptide or mixture of different-sized low molecular weight PEPTIDES derived from a common precursor and secreted mainly by the HEART ATRIUM. All these peptides share a sequence of about 20 AMINO ACIDS.
Activities or games, usually involving physical effort or skill. Reasons for engagement in sports include pleasure, competition, and/or financial reward.
Agents used for the treatment or prevention of cardiac arrhythmias. They may affect the polarization-repolarization phase of the action potential, its excitability or refractoriness, or impulse conduction or membrane responsiveness within cardiac fibers. Anti-arrhythmia agents are often classed into four main groups according to their mechanism of action: sodium channel blockade, beta-adrenergic blockade, repolarization prolongation, or calcium channel blockade.
An aspect of personal behavior or lifestyle, environmental exposure, or inborn or inherited characteristic, which, on the basis of epidemiologic evidence, is known to be associated with a health-related condition considered important to prevent.
The agent of South American trypanosomiasis or CHAGAS DISEASE. Its vertebrate hosts are man and various domestic and wild animals. Insects of several species are vectors.
A species of ENTEROVIRUS infecting humans and containing 36 serotypes. It is comprised of all the echoviruses and a few coxsackieviruses, including all of those previously named coxsackievirus B.
A complex of gadolinium with a chelating agent, diethylenetriamine penta-acetic acid (DTPA see PENTETIC ACID), that is given to enhance the image in cranial and spinal MRIs. (From Martindale, The Extra Pharmacopoeia, 30th ed, p706)
Rare congenital X-linked disorder of lipid metabolism. Barth syndrome is transmitted in an X-linked recessive pattern. The syndrome is characterized by muscular weakness, growth retardation, DILATED CARDIOMYOPATHY, variable NEUTROPENIA, 3-methylglutaconic aciduria (type II) and decreases in mitochondrial CARDIOLIPIN level. Other biochemical and morphological mitochondrial abnormalities also exist.
Impaired impulse conduction from HEART ATRIA to HEART VENTRICLES. AV block can mean delayed or completely blocked impulse conduction.
A genus of the family PICORNAVIRIDAE whose members preferentially inhabit the intestinal tract of a variety of hosts. The genus contains many species. Newly described members of human enteroviruses are assigned continuous numbers with the species designated "human enterovirus".
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.
Substances used to allow enhanced visualization of tissues.
Conical muscular projections from the walls of the cardiac ventricles, attached to the cusps of the atrioventricular valves by the chordae tendineae.
Radiography of the vascular system of the heart muscle after injection of a contrast medium.
Recording of regional electrophysiological information by analysis of surface potentials to give a complete picture of the effects of the currents from the heart on the body surface. It has been applied to the diagnosis of old inferior myocardial infarction, localization of the bypass pathway in Wolff-Parkinson-White syndrome, recognition of ventricular hypertrophy, estimation of the size of a myocardial infarct, and the effects of different interventions designed to reduce infarct size. The limiting factor at present is the complexity of the recording and analysis, which requires 100 or more electrodes, sophisticated instrumentation, and dedicated personnel. (Braunwald, Heart Disease, 4th ed)
A class of statistical procedures for estimating the survival function (function of time, starting with a population 100% well at a given time and providing the percentage of the population still well at later times). The survival analysis is then used for making inferences about the effects of treatments, prognostic factors, exposures, and other covariates on the function.
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
Graphic registration of the heart sounds picked up as vibrations and transformed by a piezoelectric crystal microphone into a varying electrical output according to the stresses imposed by the sound waves. The electrical output is amplified by a stethograph amplifier and recorded by a device incorporated into the electrocardiograph or by a multichannel recording machine.
Transport proteins that carry specific substances in the blood or across cell membranes.
Acquired, familial, and congenital disorders of SKELETAL MUSCLE and SMOOTH MUSCLE.
Radionuclide ventriculography where scintigraphic data is acquired during repeated cardiac cycles at specific times in the cycle, using an electrocardiographic synchronizer or gating device. Analysis of right ventricular function is difficult with this technique; that is best evaluated by first-pass ventriculography (VENTRICULOGRAPHY, FIRST-PASS).
Radiography of the heart and great vessels after injection of a contrast medium.
A multi-functional catenin that is highly homologous to BETA CATENIN. Gamma catenin binds CADHERINS and helps link their cytoplasmic tails to ACTIN in the CYTOSKELETON via ALPHA CATENIN. It is also found in DESMOSOMES where it mediates the link between DESMOSOMAL CADHERINS and DESMOPLAKIN.
A strain of mice arising from a spontaneous MUTATION (mdx) in inbred C57BL mice. This mutation is X chromosome-linked and produces viable homozygous animals that lack the muscle protein DYSTROPHIN, have high serum levels of muscle ENZYMES, and possess histological lesions similar to human MUSCULAR DYSTROPHY. The histological features, linkage, and map position of mdx make these mice a worthy animal model of DUCHENNE MUSCULAR DYSTROPHY.
Gadolinium. An element of the rare earth family of metals. It has the atomic symbol Gd, atomic number 64, and atomic weight 157.25. Its oxide is used in the control rods of some nuclear reactors.
The hemodynamic and electrophysiological action of the right HEART VENTRICLE.
The chambers of the heart, to which the BLOOD returns from the circulation.
A characteristic symptom complex.
An X-linked inherited metabolic disease caused by a deficiency of lysosomal ALPHA-GALACTOSIDASE A. It is characterized by intralysosomal accumulation of globotriaosylceramide and other GLYCOSPHINGOLIPIDS in blood vessels throughout the body leading to multi-system complications including renal, cardiac, cerebrovascular, and skin disorders.
The proportion of survivors in a group, e.g., of patients, studied and followed over a period, or the proportion of persons in a specified group alive at the beginning of a time interval who survive to the end of the interval. It is often studied using life table methods.
An autosomal dominant disorder with an acronym of its seven features (LENTIGO; ELECTROCARDIOGRAM abnormalities; ocular HYPERTELORISM; PULMONARY STENOSIS; abnormal genitalia; retardation of growth; and DEAFNESS or SENSORINEURAL HEARING LOSS). This syndrome is caused by mutations of PTPN11 gene encoding the non-receptor PROTEIN TYROSINE PHOSPHATASE, type 11, and is an allelic to NOONAN SYNDROME. Features of LEOPARD syndrome overlap with those of NEUROFIBROMATOSIS 1 which is caused by mutations in the NEUROFIBROMATOSIS 1 GENES.
Diseases which have one or more of the following characteristics: they are permanent, leave residual disability, are caused by nonreversible pathological alteration, require special training of the patient for rehabilitation, or may be expected to require a long period of supervision, observation, or care. (Dictionary of Health Services Management, 2d ed)
An antianginal and class III antiarrhythmic drug. It increases the duration of ventricular and atrial muscle action by inhibiting POTASSIUM CHANNELS and VOLTAGE-GATED SODIUM CHANNELS. There is a resulting decrease in heart rate and in vascular resistance.
A clear, colorless liquid rapidly absorbed from the gastrointestinal tract and distributed throughout the body. It has bactericidal activity and is used often as a topical disinfectant. It is widely used as a solvent and preservative in pharmaceutical preparations as well as serving as the primary ingredient in ALCOHOLIC BEVERAGES.
A method of recording heart motion and internal structures by combining ultrasonic imaging with exercise testing (EXERCISE TEST) or pharmacologic stress.
A condition characterized by the thickening of ENDOCARDIUM due to proliferation of fibrous and elastic tissue, usually in the left ventricle leading to impaired cardiac function (CARDIOMYOPATHY, RESTRICTIVE). It is most commonly seen in young children and rarely in adults. It is often associated with congenital heart anomalies (HEART DEFECTS CONGENITAL;) INFECTION; or gene mutation. Defects in the tafazzin protein, encoded by TAZ gene, result in a form of autosomal dominant familial endocardial fibroelastosis.
One of the alpha crystallin subunits. In addition to being expressed in the lens (LENS, CRYSTALLINE), alpha-crystallin B chain has been found in a variety of tissues such as HEART; BRAIN; MUSCLE; and KIDNEY. Accumulation of the protein in the brain is associated with NEURODEGENERATIVE DISEASES such as CREUTZFELDT-JAKOB SYNDROME and ALEXANDER DISEASE.
Measurable and quantifiable biological parameters (e.g., specific enzyme concentration, specific hormone concentration, specific gene phenotype distribution in a population, presence of biological substances) which serve as indices for health- and physiology-related assessments, such as disease risk, psychiatric disorders, environmental exposure and its effects, disease diagnosis, metabolic processes, substance abuse, pregnancy, cell line development, epidemiologic studies, etc.
A conical fibro-serous sac surrounding the HEART and the roots of the great vessels (AORTA; VENAE CAVAE; PULMONARY ARTERY). Pericardium consists of two sacs: the outer fibrous pericardium and the inner serous pericardium. The latter consists of an outer parietal layer facing the fibrous pericardium, and an inner visceral layer (epicardium) resting next to the heart, and a pericardial cavity between these two layers.
The exercise capacity of an individual as measured by endurance (maximal exercise duration and/or maximal attained work load) during an EXERCISE TEST.
A family of RNA viruses that infect fungi and protozoa. There are three genera: TOTIVIRUS; GIARDIAVIRUS; and LEISHMANIAVIRUS.
A group of cardiac arrhythmias in which the cardiac contractions are not initiated at the SINOATRIAL NODE. They include both atrial and ventricular premature beats, and are also known as extra or ectopic heartbeats. Their frequency is increased in heart diseases.
Prolonged dysfunction of the myocardium after a brief episode of severe ischemia, with gradual return of contractile activity.
The measurement of an organ in volume, mass, or heaviness.
The qualitative or quantitative estimation of the likelihood of adverse effects that may result from exposure to specified health hazards or from the absence of beneficial influences. (Last, Dictionary of Epidemiology, 1988)
General increase in bulk of a part or organ due to CELL ENLARGEMENT and accumulation of FLUIDS AND SECRETIONS, not due to tumor formation, nor to an increase in the number of cells (HYPERPLASIA).
One of two major pharmacologically defined classes of adrenergic receptors. The beta adrenergic receptors play an important role in regulating CARDIAC MUSCLE contraction, SMOOTH MUSCLE relaxation, and GLYCOGENOLYSIS.
A disturbance in the prooxidant-antioxidant balance in favor of the former, leading to potential damage. Indicators of oxidative stress include damaged DNA bases, protein oxidation products, and lipid peroxidation products (Sies, Oxidative Stress, 1991, pxv-xvi).
The restoration of the sequential order of contraction and relaxation of the HEART ATRIA and HEART VENTRICLES by atrio-biventricular pacing.
A single-pass transmembrane glycoproteins that mediate CALCIUM-dependent CELL ADHESION and are core components of DESMOSOMES.
Agents that have a damaging effect on the HEART. Such damage can occur from ALKYLATING AGENTS; FREE RADICALS; or metabolites from OXIDATIVE STRESS and in some cases is countered by CARDIOTONIC AGENTS. Induction of LONG QT SYNDROME or TORSADES DE POINTES has been the reason for viewing some drugs as cardiotoxins.
The hemodynamic and electrophysiological action of the HEART VENTRICLES.
Diseases caused by abnormal function of the MITOCHONDRIA. They may be caused by mutations, acquired or inherited, in mitochondrial DNA or in nuclear genes that code for mitochondrial components. They may also be the result of acquired mitochondria dysfunction due to adverse effects of drugs, infections, or other environmental causes.

Cardiac troponin T mutations: correlation between the type of mutation and the nature of myofilament dysfunction in transgenic mice. (1/152)

1. The heterogenic nature of familial hypertrophic cardiomyopathy (FHC) in humans suggests a link between the type of mutation and the nature of patho-physiological alterations in cardiac myocytes. Exactly how FHC-associated mutations in cardiac troponin T (cTnT) lead to impaired cardiac function is unclear. 2. We measured steady-state isometric force and ATPase activity in detergent-skinned cardiac fibre bundles from three transgenic (TG) mouse hearts in which 50, 92 and 6 % of the native cTnT was replaced by the wild type (WT) cTnT, R92Q mutant cTnT (R92Q) and the C-terminal deletion mutant of cTnT (cTnT(DEL)), respectively. 3. Normalized pCa-tension relationships of R92Q and cTnT(DEL) fibres demonstrated a significant increase in sensitivity to Ca2+ at short (2.0 microm) and long (2.3 microm) sarcomere lengths (SL). At short SL, the pCa50 values, representing the midpoint of the pCa-tension relationship, were 5.69 +/- 0.01, 5.96 +/- 0.01 and 5.81 +/- 0.01 for WT, R92Q and cTnT(DEL) fibres, respectively. At long SL, the pCa50 values were 5.81 +/- 0.01, 6.08 +/- 0.01 and 5.95 +/- 0.01 for WT, R92Q and cTnT(DEL) fibres, respectively. 4. The difference in pCa required for half-maximal activation (DeltapCa50) at short and long SL was 0.12 +/- 0.01 for the R92Q (92 %) TG fibres, which is significantly less than the previously reported DeltapCa50 value of 0.29 +/- 0.02 for R92Q (67 %) TG fibres. 5. At short SL, Ca2+-activated maximal tension in both R92Q and cTnT(DEL) fibres decreased significantly (24 and 21 %, respectively; P < 0.005), with no corresponding decrease in Ca2+-activated maximal ATPase activity. Therefore, at short SL, the tension cost in R92Q and cTnT(DEL) fibres increased by 35 and 29 %, respectively (P < 0.001). 6. The fibre bundles reconstituted with the recombinant mutant cTnT(DEL) protein developed only 37 % of the Ca2+-activated maximal force developed by recombinant WT cTnT reconstituted fibre bundles, with no apparent changes in Ca2+ sensitivity. 7. Our data indicate that an important mutation-linked effect on cardiac function is the result of an inefficient use of ATP at the myofilament level. Furthermore, the extent of the mutation-induced dysfunction depends not only on the nature of the mutation, but also on the concentration of the mutant protein in the sarcomere.  (+info)

Genotype-phenotype assessment in autosomal recessive arrhythmogenic right ventricular cardiomyopathy (Naxos disease) caused by a deletion in plakoglobin. (2/152)

OBJECTIVES: The purpose of this study was to examine the genotype-phenotype relation with respect to penetrance, age and severity of expression, disease progression and prognosis in a recessively inherited arrhythmogenic right ventricular cardiomyopathy (ARVC). BACKGROUND: Naxos disease is a recessively inherited ARVC caused by a mutation in the gene encoding plakoglobin (cell adhesion protein) in which the cardiac phenotype is associated with palmoplantar keratoderma and woolly hair. METHODS: Twelve families with Naxos disease underwent cardiac and molecular genetic investigation. Serial cardiac assessment with annual resting 12-lead and 24-h ambulatory electrocardiogram (ECG) and two-dimensional echocardiography was performed during 1 to 16 years, median 7 +/- 6 years in all 78 surviving members. RESULTS: Twenty-eight surviving members were homozygous and 40 were heterozygous for the mutation. All adults who were homozygous (n = 26) fulfilled the diagnostic criteria for ARVC, the youngest by the age of 13 years. In eight who were heterozygous, minor ECG or echocardiographic abnormalities were observed. Of the 26 subjects who were affected homozygotes, 92% showed ECG abnormalities, 92% ventricular arrhythmias, 100% right ventricular structural alterations and 27% left ventricular involvement. During follow-up (10 +/- 6 years), 16 (62%) developed structural progression, 12 (46%) arrhythmic events and 7 (27%) heart failure. The annual disease-related and sudden death mortality was 3% and 2.3%, respectively. CONCLUSIONS: Autosomal recessive ARVC caused by a mutation in plakoglobin was 100% penetrant by adolescence. Affected subjects who were homozygous experienced progressive disease with adverse prognosis. A minority of subjects who were heterozygous showed minor ECG/echocardiographic changes, but clinically significant disease did not develop.  (+info)

Functional analysis of a troponin I (R145G) mutation associated with familial hypertrophic cardiomyopathy. (3/152)

Familial hypertrophic cardiomyopathy has been associated with several mutations in the gene encoding human cardiac troponin I (HCTnI). A missense mutation in the inhibitory region of TnI replaces an arginine residue at position 145 with a glycine and cosegregates with the disease. Results from several assays indicate that the inhibitory function of HCTnI(R145G) is significantly reduced. When HCTnI(R145G) was incorporated into whole troponin, Tn(R145G) (HCTnT small middle dotHCTnI(R145G) small middle dotHCTnC), only partial inhibition of the actin-tropomyosin-myosin ATPase activity was observed in the absence of Ca(2+) compared with wild type Tn (HCTnT small middle dotHCTnI small middle dotHCTnC). Maximal activation of actin-tropomyosin-myosin ATPase in the presence of Ca(2+) was also decreased in Tn(R145G) when compared with Tn. Using skinned cardiac muscle fibers, we determined that in comparison with the wild type complex 1) the complex containing HCTnI(R145G) only inhibited 84% of Ca(2+)-unregulated force, 2) the recovery of Ca(2+)-activated force was decreased, and 3) there was a significant increase in the Ca(2+) sensitivity of force development. Computer modeling of troponin C and I variables predicts that the primary defect in TnI caused by these mutations would lead to diastolic dysfunction. These results suggest that severe diastolic dysfunction and somewhat decreased contractility would be prominent clinical features and that hypertrophy could arise as a compensatory mechanism.  (+info)

Accelerated cardiomyopathy in mice with overexpression of cardiac G(s)alpha and a missense mutation in the alpha-myosin heavy chain. (4/152)

BACKGROUND: To understand further the pathogenesis of familial hypertrophic cardiomyopathy, we determined how the cardiomyopathy induced by an Arg403-->Gln missense mutation in the alpha-myosin heavy chain (403) is affected by chronically enhancing sympathetic drive by mating the mice with those overexpressing G(s)alpha (G(s)alpha x403). METHODS AND RESULTS: Heart rate in 3-month-old conscious mice was elevated similarly (P<0.05) in mice overexpressing G(s)alpha (G(s)alpha mice; 746 +/- 14 bpm) and G(s)alpha x403 mice (718+/- 19 bpm) compared with littermate wild-type mice (WT; 623+/- 18 bpm) and 403 mice (594+/- 16 bpm). Left ventricular ejection fraction (LVEF), as determined by echocardiography, was enhanced in G(s)alpha x403 mice (88+/- 1%, P<0.001) compared with WT (69+/- 1%), 403 (75+/- 1%), and G(s)alpha (69 +/- 2%) mice. Isolated cardiomyocytes from G(s)alpha x403 mice also exhibited higher (P<0.001) baseline percent contraction (11.9+/- 0.5%) than WT (7.0+/- 0.5%), 403 (5.5+/- 0.5%), and G(s)alpha (7.8+/- 0.3%) cardiomyocytes. Relaxation of myocytes was impaired in 403 mice compared with WT but enhanced in G(s)alpha and normalized in G(s)alpha x403 mice. This was also observed in vivo. In vivo isoproterenol (0.1 microgram . kg(-1) . min(-1)) increased LVEF to maximal levels in G(s)alpha x403 and G(s)alpha, whereas in 403, the response was attenuated compared with WT. At 10 months of age, G(s)alpha x403 had significantly depressed LVEF (57 +/- 4%). Histopathological examination demonstrated that myocyte hypertrophy and fibrosis were already present in young G(s)alpha x403 mice and that old animals had severe cardiomyopathy. By 15 months of age, the survival of G(s)alpha x403 was 0% compared with 100% for WT, 71% for G(s)alpha, and 100% for 403 mice (P<0.05). CONCLUSIONS: These results show that the cardiomyopathy developed by G(s)alpha x403 mice is synergistic rather than additive, most likely owing to the elevated baseline function combined with enhanced responsiveness to sympathetic stimulation.  (+info)

Constitutively active AMP kinase mutations cause glycogen storage disease mimicking hypertrophic cardiomyopathy. (5/152)

Mutations in PRKAG2, the gene for the gamma 2 regulatory subunit of AMP-activated protein kinase, cause cardiac hypertrophy and electrophysiologic abnormalities, particularly preexcitation (Wolff-Parkinson-White syndrome) and atrioventricular conduction block. To understand the mechanisms by which PRKAG2 defects cause disease, we defined novel mutations, characterized the associated cardiac histopathology, and studied the consequences of introducing these mutations into the yeast homologue of PRKAG2, Snf4. Although the cardiac pathology caused by PRKAG2 mutations Arg302Gln, Thr400Asn, and Asn488Ile include myocyte enlargement and minimal interstitial fibrosis, these mutations were not associated with myocyte and myofibrillar disarray, the pathognomonic features of hypertrophic cardiomyopathy caused by sarcomere protein mutations. Instead PRKAG2 mutations caused pronounced vacuole formation within myocytes. Several lines of evidence indicated these vacuoles were filled with glycogen-associated granules. Analyses of the effects of human PRKAG2 mutations on Snf1/Snf4 kinase function demonstrated constitutive activity, which could foster glycogen accumulation. Taken together, our data indicate that PRKAG2 mutations do not cause hypertrophic cardiomyopathy but rather lead to a novel myocardial metabolic storage disease, in which hypertrophy, ventricular pre-excitation and conduction system defects coexist.  (+info)

Genetic polymorphisms in the renin-angiotensin-aldosterone system associated with expression of left ventricular hypertrophy in hypertrophic cardiomyopathy: a study of five polymorphic genes in a family with a disease causing mutation in the myosin binding protein C gene. (6/152)

BACKGROUND: Hypertrophic cardiomyopathy (HCM) is an inherited disease of the sarcomere characterised clinically by myocardial hypertrophy and its consequences. Phenotypic expression is heterogeneous even within families with the same aetiological mutation and may be influenced by additional genetic factors. OBJECTIVE: To determine the influence of genetic polymorphisms of the renin-angiotensin-aldosterone system (RAAS) on ECG and two dimensional echocardiographic left ventricular hypertrophy (LVH) in genetically identical patients with HCM. PATIENTS AND METHODS: Polymorphisms of five RAAS components were determined in 26 gene carriers from a single family with HCM caused by a previously identified myosin binding protein C mutation. Genotypes associated with a higher activation status of the RAAS were labelled "pro-LVH genotypes". RESULTS: There was a non-biased distribution of pro-LVH genotypes in the gene carriers. Those without pro-LVH genotypes did not manifest cardiac hypertrophy whereas gene carriers with pro-LVH genotypes did (mean (SD) left ventricular muscle mass 190 (48) v 320 (113), p = 0.002; interventricular septal thickness 11.5 (2.0) v 16.4 (6.7), p = 0.01; pathological ECG 0% (0 of 10) v 63% (10 of 16), respectively). Multivariate analysis controlling for age, sex, and hypertension confirmed an independent association between the presence of pro-LVH polymorphisms and left ventricular mass. When each polymorphism was assessed individually, carriers of each pro-LVH genotype had a significantly greater left ventricular mass than those with no pro-LVH mutation; these associations, with the exception of cardiac chymase A AA polymorphism (p = 0.06), remained significant in multivariate analysis. CONCLUSION: Genetic polymorphisms of the RAAS influence penetrance and degree of LVH in 26 gene carriers from one family with HCM caused by a myosin binding protein C mutation.  (+info)

Mutations of the light meromyosin domain of the beta-myosin heavy chain rod in hypertrophic cardiomyopathy. (7/152)

Familial hypertrophic cardiomyopathy (HCM) is caused by mutations in 9 sarcomeric protein genes. The most commonly affected is beta-myosin heavy chain (MYH7), where missense mutations cluster in the head and neck regions and directly affect motor function. Comparable mutations have not been described in the light meromyosin (LMM) region of the myosin rod, nor would these be expected to directly affect motor function. We studied 82 probands with HCM in whom no mutations had been found in MYH7 exons encoding the head and neck regions of myosin nor in the other frequently implicated disease genes. Primers were designed to amplify exons 24 to 40 of MYH7. These amplimers were subjected to temperature modulated heteroduplex analysis by denaturing high-performance liquid chromatography. An Ala1379Thr missense mutation in exon 30 segregated with disease in three families and was not present in 200 normal chromosomes. The mutation occurred on two haplotypes, indicating that it was not a polymorphism linked with another disease-causing mutation. The position of this residue within the LMM region of myosin suggests that it may be important for thick filament assembly or for accessory protein binding. A further missense mutation in exon 37, Ser1776Gly, segregated with disease in a single family and was absent from 400 population-matched control chromosomes. Because the Ser1776 residue occupies a core position in the myosin rod at which the substitution of glycine is extremely energetically unfavorable, it is likely to disrupt the coiled-coil structure. We conclude that mutation of the LMM can cause HCM and that such mutations may act through novel mechanisms of disease pathogenesis involving myosin filament assembly or interaction with thick filament binding proteins.  (+info)

Mutation of the myosin converter domain alters cross-bridge elasticity. (8/152)

Elastic distortion of a structural element of the actomyosin complex is fundamental to the ability of myosin to generate motile forces. An elastic element allows strain to develop within the actomyosin complex (cross-bridge) before movement. Relief of this strain then drives filament sliding, or more generally, movement of a cargo. Even with the known crystal structure of the myosin head, however, the structural element of the actomyosin complex in which elastic distortion occurs remained unclear. To assign functional relevance to various structural elements of the myosin head, e.g., to identify the elastic element within the cross-bridge, we studied mechanical properties of muscle fibers from patients with familial hypertrophic cardiomyopathy with point mutations in the head domain of the beta-myosin heavy chain. We found that the Arg-719 --> Trp (Arg719Trp) mutation, which is located in the converter domain of the myosin head fragment, causes an increase in force generation and fiber stiffness under isometric conditions by 48-59%. Under rigor and relaxing conditions, fiber stiffness was 45-47% higher than in control fibers. Yet, kinetics of active cross-bridge cycling were unchanged. These findings, especially the increase in fiber stiffness under rigor conditions, indicate that cross-bridges with the Arg719Trp mutation are more resistant to elastic distortion. The data presented here strongly suggest that the converter domain that forms the junction between the catalytic and the light-chain-binding domain of the myosin head is not only essential for elastic distortion of the cross-bridge, but that the main elastic distortion may even occur within the converter domain itself.  (+info)

Background: Hypertrophic cardiomyopathy (HCM), with an estimated prevalence of 1 in 500, is hereditary and often remains asymptomatic and undiagnosed. Although potentially treatable, HCM is a leading cause of sudden cardiac death among adolescents and young adults. While previous HCM-related mortality estimates were extrapolated from cohort studies, this study applies two definitions to death certificate data to estimate national mortality rates and identify at-risk groups.. Methods: Death certificates of 12-35 year olds with HCM-related deaths in 1999-2013 were obtained from the National Vital Statistics System. Two definitions were applied: 1) specific-underlying-cause-of-death (UCD) ICD-10 code for HCM (I42.1, I42.2); and 2) sensitive-deaths that met the specific definition; had a UCD code for cardiomyopathy, unspecified (I42.9); or had a contributing cause code of I42.1, I42.2, or I42.9 and a HCM-related UCD (Figure). Deaths with external injury (V01-Y89) or congenital (Q00-Q99) codes were ...
Thank you for your interest in spreading the word on Circulation.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
Thank you for your interest in spreading the word on Circulation Research.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
Build: Wed Jun 21 18:33:50 EDT 2017 (commit: 4a3b2dc). National Center for Advancing Translational Sciences (NCATS), 6701 Democracy Boulevard, Bethesda MD 20892-4874 • 301-435-0888. ...
MYBPC1兔多克隆抗体(ab110363)可与人样本反应并经WB实验严格验证并得到3个独立的用户反馈。所有产品均提供质保服务,中国75%以上现货。
HCM - MedHelps HCM Center for Information, Symptoms, Resources, Treatments and Tools for HCM. Find HCM information, treatments for HCM and HCM symptoms.
pFN21AE1361 5002 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
pFN21AE2508 6067 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
Familial hypertrophic cardiomyopathy is an autosomal dominant myocardial disorder characterized by left ventricle hypertrophy with histological features of myocyte hypertrophy, myofibrillar disarray, and interstitial fibrosis. The disease has a broad spectrum of clinical manifestations from a benign asymptomatic course to a malignant course with serious arrhythmias, heart failure, and sudden cardiac death. One of the most common genetic causes for hypertrophic cardiomyopathy involves mutations in cardiac myosin-binding protein C (MYBPC3) gene.
It has been demonstrated previously that clinical phenotypes of HCM (hypertrophic cardiomyopathy) caused by mutations in the cardiac MyBP-C (myosin-binding protein C) gene show late onset, low penetrance and favourable clinical course. However, we have encountered severe phenotypes in several carriers of the MyBP-C gene mutations. The aim of the present study was to screen novel MyBP-C gene mutations in patients with HCM and to investigate the genetic differences in affected subjects with severe phenotypes. The MyBP-C gene was screened in 292 Japanese probands with HCM, and a novel c.2067+1G→A mutation was present in 15 subjects in five families. Clinical phenotypes of carriers of the c.2067+1G→A mutation were compared with those of a previously identified Arg820Gln (Arg820→Gln) mutation in the MyBP-C gene. The disease penetrance in subjects aged ≥30 years was 90% in carriers of the c.2067+1G→A mutation and 61% in carriers of the Arg820Gln mutation. Sudden death occurred in four ...
Familial hypertrophic cardiomyopathy is a genetically heterogeneous disease with variable clinical features that is inherited as autosomal dominant with variable penetrance. Recent developments in genetics of hereditary cardiomyopathy have not only enlightened many points about pathogenesis, but have also provided great benefit to diagnostic approaches of clinicians. Heterozygous mutation of c3691-3692insTTCA in MYBPC3 gene was identified in a pediatric patient with diagnosis of hypertrophic cardiomyopathy at clinic. Hypertrophy was observed in sister and father of the patient in echocardiography screening, and it was subsequently determined that they also had same mutation. This mutation has not previously been defined and reported previously in the literature as cause of hypertrophic cardiomyopathy.. Keywords: Echocardiography, hypertrophic cardiomyopathy, molecular genetics, MYBPC ...
Familial hypertrophic cardiomyopathy (HCM) is a prevalent hereditary cardiac disorder linked to arrhythmia and sudden cardiac death. While the causes of HCM have been identified as genetic mutations in the cardiac sarcomere, the pathways by which sarcomeric mutations engender myocyte hypertrophy and …
MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. MYBPC gene is linked to CMH4 and demonstrated a splice donor mutationin 1 family with familial hypertrophic cardiomyopathy and a duplication mutation in a second. Both mutations were predicted to disrupt the high-affinity, C-terminal myosin-binding domain of cardiac MyBP-C. Again, findings demonstrated that as in the case of the 3 forms that had been defined in molecular terms previously, familial hypertrophic cardiomyopathy is a disease of the sarcomere.
Familial hypertrophic cardiomyopathy, also known as FHC or HCM, is a rare condition best known publicly for its association with sudden death among young athletes. It is estimated that about 1 in 500 people have HCM and the associated thickening of the heart muscle (hypertrophy). An irregular heartbeat (arrhythmia) may lead to collapse and death during or after an athletic competition. There are usually no symptoms of a heart condition before the sudden collapse, which is also called sudden cardiac death or SCD. Fortunately, SCD occurs to a very small fraction of those carrying HCM mutations. Ordinary screening does not pick up this condition. A family history of sudden death before age 50 may be the only clue that a child or teenager needs a closer medical check before starting a sport. Most HCM appears to be inherited in a dominant fashion. Family members who carry the same genes may not have cardiac hypertrophy; those who do have hypertrophy can be treated clinically, and they will ...
Familial hypertrophic cardiomyopathy 12 information including symptoms, diagnosis, misdiagnosis, treatment, causes, patient stories, videos, forums, prevention, and prognosis.
Familial Hypertrophic Cardiomyopathy Type 2 (CMH2): Read more about Symptoms, Diagnosis, Treatment, Complications, Causes and Prognosis.
The literature shows that genetic testing could stimulate solidarity among family members, but also lead to major conflicts. To prevent negative effects, clinical geneticists and ethicists have stressed the importance of good communication within families. In this qualitative study, we followed six extended families in the southern and eastern Netherlands involved in genetic testing for familial hypertrophic cardiomyopathy for three and a half years. In total 57 members of these families were interviewed in depth, most more than once. Our analysis shows that genetic testing does affect families, but that families perform a lot of balancing work in order to prevent genetic testing from becoming too all-encompassing. There is much more continuity in family life than is often thought. Moreover, as these families demonstrate different styles of family work, establishing a single norm of good communication in clinical genetics might in fact be more harmful for family life than genetic testing ...
In a pathbreaking proof of concept experimental study, MYBPC3 gene mutation causing hypertrophic cardiomyopathy has been corrected in human embryos using CRISPR-Cas9 gene editing technique.
Hypertrophic cardiomyopathy (HCM) is a genetic cardiac disease, which affects the structure of heart muscle tissue. The clinical symptoms include arrhythmias, progressive heart failure, and even sudden cardiac death but the mutation carrier can also be totally asymptomatic. To date, over 1400 mutations have been linked to HCM, mostly in genes encoding for sarcomeric proteins. However, the pathophysiological mechanisms of the disease are still largely unknown. Two founder mutations for HCM in Finland are located in myosin-binding protein C (MYBPC3-Gln1061X) and α-tropomyosin (TPM1-Asp175Asn) genes. We studied the properties of HCM cardiomyocytes (CMs) derived from patient-specific human induced pluripotent stem cells (hiPSCs) carrying either MYBPC3-Gln1061X or TPM1-Asp175Asn mutation. Both types of HCM-CMs displayed pathological phenotype of HCM but, more importantly, we found differences between CMs carrying either MYBPC3-Gln1061X or TPM1-Asp175Asn gene mutation in their cellular size, Ca2+ ...
Wolff-Parkinson-White pattern Familial hypertrophic cardiomyopathy 6 not provided Primary familial hypertrophic cardiomyopathy Glycogen storage disease of heart, lethal congenital ...
The UNC-45 chaperone protein interacts with and affects the folding, stability, and the ATPase activity of myosins. It plays a critical role in the cardiomyopathy development and in the breast cancer tumor growth. Here we propose the first structural model of the UNC-45-myosin complex using various in silico methods. Initially, the human UNC-45B binding epitope was identified and the protein was docked to the cardiac myosin (MYH7) motor domain. The final UNC45B-MYH7 structure was obtained by performing of total 630 ns molecular dynamics simulations. The results indicate a complex formation, which is mainly stabilized by electrostatic interactions. Remarkably, the contact surface area is similar to that of the myosin-actin complex. A significant interspecies difference in the myosin binding epitope is observed. Our results reveal the structural basis of MYH7 exons 15-16 hypertrophic cardiomyopathy mutations and provide directions for drug targeting ...
Familial hypertrophic cardiomyopathy is a primary disease of the sarcomere. The R403Q mutation resides at the actin-interaction site on myosin and leads to progressive hypertrophic cardiomyopathy which progresses towards heart failure. Along with deteriorating cardiac function, these hearts experience an overall change in metabolic landscape, suggesting altered energetic function in hearts that express the R403Q mutation. We tested the hypothesis that the R403Q mutation intrinsically increases the energetic cost of contraction. To do this, we determined myofilament function in demembranated cardiac trabeculae from male wild-type (WT) and R403Q mice at 2 months of age, prior to overt signs of cardiac pathology. Firstly, steady-state Ca2+ sensitivity of force generation was not significantly different between male R403Q (n=4) and WT counterparts (n=2) consistent with previous findings. Secondly, the rate of force redevelopment (ktr) in skinned cardiac tissue was measured following unloaded ...
Familial hypertrophic cardiomyopathy (FHC) is the most common cause of sudden cardiac death in young individuals. Molecular mechanisms underlying this disorder are largely unknown; this study aims at revealing how disruptions in actin-myosin interactions can play a role in the pathogenesis of this disorder. Cross-bridge (XB) kinetics and the degree of order were examined in contracting myofibrils from the ex vivo ventricles of transgenic (Tg) mice expressing FHC regulatory light chain (RLC) mutation K104E and Troponin I mutation, R21C. Because the degree of order and the kinetics are best studied when an individual XB makes a significant contribution to the overall signal, the number of observed XBs in an ex vivo ventricle was minimized to 20. Autofluorescence and photobleaching were minimized by using a relatively long-lived red-emitting dye. In case of K104E, mutated XBs were significantly better ordered during steady-state contraction and during rigor, but the mutation had no effect on the degree of
patient:. - Demographic characteristics. - Risk factors for cardiovascular diseases. - Data on familial cardiomyopathy. - Co-morbidities. - Precipitating factors of HF. - Clinical signs and symptoms. - Blood tests performed. - Use of invasive/ non-invasive diagnostic procedures. - Use of pharmacological treatments. - Use of non-pharmacological treatments. Follow-up data. A follow-up visit after 6 and 12 months will be scheduled for ...
0002] Hypertrophic cardiomyopathy (HCM) is an often fatal but manageable disease. The incidence is reported to be about 1/400 (approximately 750,000) in the general U.S. population. The variable expressivity of this disease suggests it may be higher, making HCM the most common monogenic cardiac disorder in the U.S. Macon and McKenna et al., ACC/ESC Expert Consensus Document on Hypertrophic Cardiomyopathy, J of American College of Cardiology (2003) 42: 1-27. In addition, it is the most frequent cause of unexpected sudden death in teenagers and young adults. Elliott, Poloniecki et al., Sudden death in hypertrophic cardiomyopathy: Identification of high risk patients, J of American College of Cardiology (2000) 36: 2212-2218. The disease is characterized by a thickening of the heart muscle (hypertrophy) in the absence of hypertension or any other apparent cause. HCM is difficult to diagnose. Clinical presentation and progression of HCM varies widely among affected patients and the symptoms ...
Hypertrophic cardiomyopathy occurs as an autosomal dominant familial disorder or as a sporadic disease without familial involvement. While missense mutations in the beta cardiac myosin heavy chain (MHC) gene account for approximately half of all cases of familial hypertrophic cardiomyopathy, the molecular causes of sporadic hypertrophic cardiomyopathy are unknown. To determine whether beta cardiac MHC mutations are also associated with sporadic disease, we screened this gene in seven individuals with sporadic hypertrophic cardiomyopathy. Mutations in the beta cardiac MHC genes were identified in two probands with sporadic disease. In that their parents were neither clinically nor genetically affected, we conclude that mutations in each proband arose de novo. Transmission of the mutation and disease to an offspring occurred in one pedigree, predicting that these are germline mutations. The demonstration of hypertrophic cardiomyopathy arising within a pedigree coincident with the appearance of a ...
Obstructive hypertrophic cardiomyopathy (HCOM) is known as a familial genetic disorder. The most potent risk factor in the development of hypertrophic cardiomyopathy aregenetic mutations in Beta-myosin heavy chain, Myosin binding protein C, and Cardiac troponin T. Genes involved in the pathogenesis of hypertrophic cardiomyopathy include but not limited to MYH7, TNNT2, TPM1. However, hypertension, thyroid disease, diabetes, and obesity also play a role in non obstructive forms of hypertrophic cardiomyopathy. This is in response to chronic effects of abnormal pressure and volumes on the myocardium and is different from apical hypertrophy (Yamaguchi syndrome). ...
RATIONALE: Most sarcomere gene mutations that cause hypertrophic cardiomyopathy are missense alleles that encode dominant negative proteins. The potential exceptions are mutations in the MYBPC3 gene (encoding cardiac myosin-binding protein-C [MyBP-C]), which frequently encode truncated proteins. OBJECTIVE: We sought to determine whether there was evidence of haploinsufficiency in hypertrophic cardiomyopathy caused by MYBPC3 mutations by comparing left ventricular muscle from patients undergoing surgical myectomy with samples from donor hearts. METHODS AND RESULTS: MyBP-C protein and mRNA levels were quantitated using immunoblotting and RT-PCR. Nine of 37 myectomy samples had mutations in MYBPC3: 2 missense alleles (Glu258Lys, Arg502Trp) and 7 premature terminations. No specific truncated MyBP-C peptides were detected in whole muscle homogenates of hypertrophic cardiomyopathy tissue. However, the overall level of MyBP-C in myofibrils was significantly reduced (P|0.0005) in tissue containing either a
TNNI3 patients may show pure RCM and HCM with or without restrictive pattern. Different phenotypes may coexist in the same family [4,8,9]. In the present family, as in other families observed in our centre with TNNI3-related cardiomyopathy, only the presence of a pure RCM without conduction disease in at least one member of the family seems to predict mutations of this gene. Differential clinical diagnosis includes pure restrictive phenotype caused by mutations of the Desmin gene, which are however characterized by the presence of atrioventricular block preceding the onset of restrictive haemodynamics and in some case, of clinically overt myopathy or increased sCPK. [6 ...
Global Hypertrophic Cardiomyopathy Therapeutics Market - Key Trends With heart diseases emerging as one of the most common causes of mortality among men and women worldwide, Transparency Market Research (TMR) expects the demand for hypertrophic cardiomyopathy (HCM) therapeutics to surge considerably. Furthermore, the market is expected to gain significant impetus from successful government interventions aimed at spreading awareness about hypertrophic cardiomyopathy.. View Report-. https://www.transparencymarketresearch.com/hypertrophic-cardiomyopathy-therapeutics-market.html. TMR projects the global HCM therapeutics market to expand at a moderate 1.4% CAGR between 2015 and 2023. Despite witnessing positive opportunities, the rising demand for advanced medical devices could threaten the markets growth to an extent. Nevertheless, since the majority of HCM drugs are yet to get approved, the hypertrophic cardiomyopathy therapeutics market is likely to gain momentum post their approval in the near ...
The Centenary Institute is a world-leading independent medical research institute with a particular focus on cancer, inflammation and cardiovascular disease.
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
TY - JOUR. T1 - A case of congenital hypertrophic cardiomyopathy. AU - Seo, Hyeon Seok. AU - Lee, In Hak. AU - Song, Young Wooh. AU - Choi, Byung Min. AU - Jang, Gi Young. AU - Son, Chang Sung. AU - Lee, Joo Won. PY - 2013/1. Y1 - 2013/1. N2 - Congenital hypertrophic cardiomyopathy (HCMP) is a very rare congenital heart disease. Here, we report a case of neonatal HCMP, which was confirmed by two-dimensional echocardiography and autopsy. The HCMP rapidly progressed and the patients condition deteriorated, despite the treatment for congestive heart failure.. AB - Congenital hypertrophic cardiomyopathy (HCMP) is a very rare congenital heart disease. Here, we report a case of neonatal HCMP, which was confirmed by two-dimensional echocardiography and autopsy. The HCMP rapidly progressed and the patients condition deteriorated, despite the treatment for congestive heart failure.. KW - Cardiomyopathy, hypertrophic. KW - Newborns. UR - ...
Looking for information on Hypertrophic Cardiomyopathy in Wilton? We have compiled a list of businesses and services around Wilton that should help you with your search. We hope this page helps you find information on Hypertrophic Cardiomyopathy in Wilton.
Looking for information on Hypertrophic Cardiomyopathy in Muskegon? We have compiled a list of businesses and services around Muskegon that should help you with your search. We hope this page helps you find information on Hypertrophic Cardiomyopathy in Muskegon.
Nikita Sinha is a junior undergraduate student at Caltech. Upon graduating, she plans to pursue either an MD or a combined MD-PhD Degree. Nikita s passion for the sciences has never been in doubt. Nikita was first exposed to the exciting world of research through the SHARP program at UC Berkley where she worked on designing a revolutionary new approach to making computers with nanomagnets. She was amazed by the impacts of this technology which could tremendously reduce power consumption in computers and allow for the design of supercomputers. Having found the endeavor to create new knowledge intellectually challenging and satisfying, she further pursued this passion for research through the SIMR program at Stanford s Cardiovascular Institute. Her project involved optimization of an allele-specific silencing construct for the therapy of a hypertrophic cardiomyopathy mutation. This research at Stanford sparked her interest in the biological sciences, and so immediately upon entering Caltech, she ...
Compared to men, women with a hereditary heart condition called hypertrophic cardiomyopathy are substantially more likely to be diagnosed later in life and with more severe symptoms, an Italian study indicates. This occurs despite the fact that hypertrophic cardiomyopathy should theoretically be present in males and females equally, Dr. Iacopo Olivotto commented to Reuters Health, because it is a genetic disease with an inheritance pattern that requires only one parent to have the condition. People with hypertrophic cardiomyopathy (HCM) suffer from progressive weakening of the heart, which becomes enlarged in an attempt to compensate ...
Diagnosis and Management of Hypertrophic Cardiomyopathy : Diagnosis and Management of Hypertrophic Cardiomyopathy is a unique, multi-authored compendium of information regarding the complexities of clinical and genetic diagnosis, natural history, and management of hypertrophic cardiomyopathy (HCM)-the most common and important of the genetic cardiovascular diseases-as well as related issues impacting the health of trained athletes. Edited by Dr.
Another name for Hypertrophic Cardiomyopathy is Hypertrophic Cardiomyopathy. To better understand hypertrophic cardiomyopathy, it helps to understand ...
Late gadolinium enhancement in hypertrophic cardiomyopathy: When should we use it in risk stratification of our patients? Hypertrophic cardiomyopathy (HCM) is associated with complications including heart failure and sudden cardiac death (SCD). The ...
The normal heart has strong muscular walls that pump blood out of the heart.. Hypertrophic cardiomyopathy is a condition in which the walls of the heart; the muscular pumping chambers, become abnormally thick. There is likely a genetic cause.. In hypertrophic cardiomyopathy, the heart fails to pump adequately. In many patients, this condition may not cause symptoms until it is very severe. Individuals with this condition may be at higher risk for sudden cardiac arrest. Symptoms can include breathlessness, rhythm abnormalities, and fainting.. ...
The normal heart has strong muscular walls that pump blood out of the heart.. Hypertrophic cardiomyopathy is a condition in which the walls of the heart; the muscular pumping chambers, become abnormally thick. There is likely a genetic cause.. In hypertrophic cardiomyopathy, the heart fails to pump adequately. In many patients, this condition may not cause symptoms until it is very severe. Individuals with this condition may be at higher risk for sudden cardiac arrest. Symptoms can include breathlessness, rhythm abnormalities, and fainting.. ...
Hypertrophic Cardiomyopathy. Hypertrophic Cardiomyopathy (HCM) is a genetically transmitted disease that directly affects the heart muscle.
This is the business view business. Hypertrophic cardiomyopathy Is a condition in which the heart muscle becomes thick. The thickening makes it harder for blood to leave the heart forcing the heart to work harder to pump blood. Hypertrophic cardiomyopathy is often asymmetrical, meaning one ...
Hypertrophic cardiomyopathy (HCM) is the commonest inherited cardiovascular disorder with a prevalence of one in 500 in the general population. It is believed to be a disease of the cardiac sarcomere and is caused by a variety of mutations in genes responsible for sarcomeric contractile proteins. It is characterised macroscopically by myocardial hypertrophy and microscopically by myocyte fibrosis and disarray. Most patients tend to present with functional limitation and symptoms such as palpitation, chest pain or syncope. The underlying mechanisms involved are complex, multiple and not yet fully understood. Further clarification of these mechanisms may enable improvements in current symptom control or the development of new avenues of therapy. A small but significant proportion of patients suffer sudden cardiac death and this can be the initial presentation of the condition. In fact, HCM is the commonest cause of sudden death among individuals below the age of 30 years. The identification of ...
Background - Our knowledge of hypertrophic cardiomyopathy (HCM) mainly originates from quarternary centres. The objective is to assess the current management of HCM patients in a large multicentre French register according to the level of expertise. Methods and results - A total of 1431 HCM patients were recruited across 26 (11 expert and 15 non-expert) centres in REMY, a prospective hospital-based register of adult HCM patients. A sarcomeric origin was suspected in 1284 (89.7%) patients [261 (20.3%) with a reported gene mutation, 242 (18.8%) genotype-negative], while 107 (7.5%) had a diagnosis of non-sarcomeric HCM. Patients managed in non-expert centres were older (P | 0.01) and presented more often with NYHA III/IV class dyspnoea (P | 0.01), congestive heart failure (P | 0.01), low LEVF (P | 0.01), less often with a syncope history (P | 0.01) and lower LV obstruction (P | 0.01) than patients in expert centres. Genotype positive sarcomeric aetiologies were less frequent in non-expert centres (P | 0
The definition and classification of hypertrophic cardiomyopathy (HCM) have varied over the decades, primarily because the phenotypic expression of ventricular hypertrophy can result from a myriad of diseases, especially among children. For the purposes of this article, HCM is a primary cardiac disorder that results from known or suspected ge...
Find details on Heart: hypertrophic cardiomyopathy (HCM) in cats including diagnosis and symptoms, pathogenesis, prevention, treatment, prognosis and more. All information is peer reviewed.
Hypertrophic cardiomyopathy (HCM) is a genetically determined heart muscle disease caused by mutations in one of several sarcomere genes which encode components of the contractile apparatus. (See.)HCM is characterized by an enormous diversity in both
In Year 1, we compiled metabolite profiles from heart tissue in 2 mouse models of hypertrophic cardiomyopathy HCM in the pre-clinical stage of disease 5 week old mice. Using GC-TOF, only 1 metabolite was significantly lower in MyHC mutants compared to littermate controls at baseline. In contrast, we found differences in levels of 13 metabolites in TnT mutants when compared to littermate-controls. Taken together, our results suggest allele-specific differences in metabolic remodeling at the preclinical stage of HCM in mouse models.
Hypertrophic cardiomyopathy (HCM) is an inherited disease of the heart muscle. HCM can cause the wall of the heart muscle to thicken.More about this condition.
I said I would tell you why Skip has to take so many pills, well the title says it all. He has Feline Hypertrophic Cardiomyopathy (HCM). HCM is a very serious heart condition. Last year, I noticed that Skips breath smelled and I knew that he needed his teeth cleaned and probably a couple pulled. …
September 1990). "Familial hypertrophic cardiomyopathy is a genetically heterogeneous disease". The Journal of Clinical ... hypertrophic cardiomyopathy, osteogenesis imperfecta, and familial hypercholesterolemia. Heterogenous loci involved in ... Goldstein JL, Dana SE, Brunschede GY, Brown MS (March 1975). "Genetic heterogeneity in familial hypercholesterolemia: evidence ... September 2015). "Challenges and solutions for gene identification in the presence of familial locus heterogeneity". European ...
"First description of germline mosaicism in familial hypertrophic cardiomyopathy". Journal of Medical Genetics. 37 (2): 132-134 ... two offspring of a French woman who had no phenotypic expression of the AD disorder hypertrophic cardiomyopathy, inherited the ... Autosomal dominant or X-linked familial disorders often prompt prenatal testing for germline mosaicism. This diagnosis may ...
"Familial hypertrophic cardiomyopathy". Genetics Home Reference. U.S. National Library of Medicine.. This article incorporates ... Cardiomyopathy[edit]. Mutations in the MT-TI gene may also cause cardiomyopathy, a disorder of the heart characterized by the ... and hypertrophic cardiomyopathy.[10] A patient with a 4269A,G mutation in MT-TI was found with the deficiency.[11] ... causing hypertrophic cardiomyopathy". Human Mutation. 8 (3): 216-22. doi:10.1002/(SICI)1098-1004(1996)8:3,216::AID-HUMU4,3.0.CO ...
"Alpha-tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere". ... Clinical Implications of Beta Cardiac Myosin Heavy Chain Mutations in Hypertrophic Cardiomyopathy (University of London, 1996) ... especially on hypertrophic cardiomyopathy and the genetic causes of "sudden cardiac death". He is chairman of an international ...
2005). "The E22K mutation of myosin RLC that causes familial hypertrophic cardiomyopathy increases calcium sensitivity of force ...
Familial AF presenting in the setting of another inherited cardiac disease (hypertrophic cardiomyopathy, dilated cardiomyopathy ... hypertrophic cardiomyopathy (HCM), pericarditis, congenital heart disease, and previous heart surgery.[24] Congenital heart ... Non-familial AF associated with genetic backgrounds (polymorphism in the ACE gene) that may predispose to atrial fibrillation ... High blood pressure, valvular heart disease, coronary artery disease, cardiomyopathy, congenital heart disease, COPD, obesity, ...
... cardiomyopathy, hypertrophic MeSH C14.280.238.100.500 - cardiomyopathy, hypertrophic, familial MeSH C14.280.238.160 - ... cardiomyopathy, hypertrophic MeSH C14.280.484.150.070.210 - discrete subaortic stenosis MeSH C14.280.484.275 - heart murmurs ... cardiomyopathy, restrictive MeSH C14.280.238.190 - chagas cardiomyopathy MeSH C14.280.238.281 - endocardial fibroelastosis MeSH ... cardiomyopathy, alcoholic MeSH C14.280.238.070 - cardiomyopathy, dilated MeSH C14.280.238.100 - ...
... at Curlie GeneReviews/NIH/NCBI/UW entry on Familial Hypertrophic Cardiomyopathy Overview National ... Familial hypertrophic cardiomyopathy is inherited as an autosomal dominant trait and is attributed to mutations in one of a ... Kittleson MD, Meurs KM, Munro MJ, Kittleson JA, Liu SK, Pion PD, Towbin JA (June 1999). "Familial hypertrophic cardiomyopathy ... December 2005). "A cardiac myosin binding protein C mutation in the Maine Coon cat with familial hypertrophic cardiomyopathy". ...
HCM occurs in approximately 2 per 1,000 people in the general population, being a primary and familial malformation. The ... Hypertrophic cardiomyopathy, HCM can be symptomatic or asymptomatic. In a limited number of cases it can lead to sudden cardiac ... Hypertrophic Cardiomyopathy: For Patients, Their Families and Interested Physicians by Barry J. Maron), Lisa Salberg - 3rd ...
Hypertrophic cardiomyopathy (HCM) or HOCM (O = obstructive) is considered the most common cause of sudden cardiac death in ... Long QT syndrome is a familial condition that is uncommon, but is a known source of sudden death in young people. It can cause ... Common categories of sudden cardiac death causes are:[citation needed] Cardiomyopathies Conduction disorders Coronary artery ... and Cardiomyopathy. Formal education for doctors is now available in Sports Cardiology, such as a Masters Degree in Sports ...
Familial renal disease is inherited in Abyssinians and Persians. *Feline hypertrophic cardiomyopathy ...
It is the least common of the three original subtypes of cardiomyopathy: hypertrophic, dilated, and restrictive. It should not ... "Mutations in FLNC are Associated with Familial Restrictive Cardiomyopathy". Human Mutation. 37 (3): 269-279. doi:10.1002/humu. ... Restrictive cardiomyopathy (RCM) is a form of cardiomyopathy in which the walls of the heart are rigid (but not thickened). ... "Mutations in FLNC are Associated with Familial Restrictive Cardiomyopathy". Human Mutation. 37 (3): 269-279. doi:10.1002/humu. ...
Cardiomyopathy (I42.0) Dilated cardiomyopathy (I42.1) Obstructive hypertrophy cardiomyopathy (I42.2) Other hypertrophic ... On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic ... Alcoholic cardiomyopathy (I42.8) Other cardiomyopathies Arrhythmogenic right ventricular dysplasia (I43) Cardiomyopathy in ... "2019 ICD-10-CM Diagnosis Code I42.9: Cardiomyopathy, unspecified". The Web's Free 2019 ICD-10-CM/PCS Medical Coding Reference. ...
Hypertrophic cardiomyopathy, autosomal dominant mutations of TNNT2; hypertrophy usually mild; restrictive phenotype may be ... Familial adenomatous polyposis. *galactosemia. *Gaucher disease. *Gaucher-like disease. *Gelatinous drop-like corneal dystrophy ...
Hypertriglycidemia Hypertrophic branchial myopathy Hypertrophic cardiomyopathy Hypertrophic hemangiectasia Hypertrophic ... familial benign type 1 Hypercalcemia, familial benign type 2 Hypercalcemia, familial benign type 3 Hypercalcemia, familial ... familial type 1 Hypocalcinuric hypercalcemia, familial type 2 Hypocalcinuric hypercalcemia, familial type 3 Hypocalcinuric ... familial Hypoglycemia with deficiency of glycogen synthetase in the liver Hypoglycemia Hypogonadism cardiomyopathy Hypogonadism ...
Hypertrophic cardiomyopathy, autosomal dominant mutations of TNNT2; hypertrophy usually mild; restrictive phenotype may be ... Familial adenomatous polyposis. *galactosemia. *Gaucher disease. *Gaucher disease type 1. *Gaucher disease type 2 ...
Dilated cardiomyopathy implies that the muscle damage has resulted in enlargement of the heart. Hypertrophic cardiomyopathy ... familial dilated cardiomyopathy, or a thromboembolic event in a first-degree relative.[74] ... In severe cardiomyopathy, the effects of decreased cardiac output and poor perfusion become more apparent, and patients will ... Cardiomyopathy refers specifically to problems within the heart muscle, and these problems can result in heart failure. ...
Hypertrophic cardiomyopathy is the most common cause of sudden death in young people, including trained athletes, and is caused ... they increase susceptibility to certain cancers and classes of familial hypercholesterolaemia; in 1997, a frameshift mutation ... Mutations in the Troponin C gene (TNNC1) are a rare genetic cause of hypertrophic cardiomyopathy. A recent study has indicated ... in Troponin C was the cause of hypertrophic cardiomyopathy (and sudden cardiac death) in a 19-year-old male. Finding a cure for ...
... and hypertrophic cardiomyopathy. The condition presents early in life and the average life expectancy is 2.5 years with death ... Ward OC (April 1964). "A New Familial Cardiac Syndrome in Children". Journal of the Irish Medical Association. 54: 103-6. PMID ... while other variants have been associated with dilated cardiomyopathy. Some variants which affect both the early and late ...
Familial[edit]. This type is caused by mutations of proteins involved in amyloid formation, including transthyretin (TTR), ... Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Tachycardia-induced. *Restrictive. *Loeffler endocarditis. *Cardiac ... This disease has multiple types including light chain, familial, and senile.[2] One of the most studied types is light chain ... For familial amyloidosis, ACE-inhibitors and beta-blockers can be prescribed if there is no autonomic neuropathy.[1] ...
Echocardiography can help detect cardiomyopathies, such as hypertrophic cardiomyopathy, dilated cardiomyopathy, and many others ... It is the most common type of hypertension, affecting 95% of hypertensive patients,[26][27][28][29] it tends to be familial and ... Heart disease, Cardiovascular disease, Atherosclerosis, Cardiomyopathy, Hypertension (High Blood Pressure). Significant tests. ... Cardiac disorders such as coronary heart disease, including myocardial infarction, heart failure, cardiomyopathy, and ...
Hypertrophic cardiomyopathy 1, 8, 10. *Usher syndrome 1B. *Freeman-Sheldon syndrome. *DFN A3, 4, 11, 17, 22; B2, 30, 37, 48 ... "Sur une forme particulière d'atrophie musculaire progressive, souvent familiale débutant par les pieds et les jambes et ...
Hypertrophic cardiomyopathy 1, 8, 10. *Usher syndrome 1B. *Freeman-Sheldon syndrome. *DFN A3, 4, 11, 17, 22; B2, 30, 37, 48 ... KRT18 (Familial cirrhosis). *KRT81/KRT83/KRT86 (Monilethrix). *Naegeli-Franceschetti-Jadassohn syndrome. *Reticular pigmented ...
Hypertrophic cardiomyopathy. *Left ventricular hypertrophy in athletes. *Congestive heart failure or heart failure with normal ... A complex syndrome or a hypertensive 'cardiomyopathy'?". European Heart Journal. 21 (20): 1653-65. doi:10.1053/euhj.2000.2339. ...
The breed can be prone to gingivitis, which can lead to more serious periodontitis.[10] Familial renal amyloidosis or AA ... Hypertrophic cardiomyopathy. *Immunodeficiency virus. *Infectious peritonitis. *Leukemia virus. *Lower urinary tract disease ... Niewold TA, van der Linde-Sipman JS, Murphy C, Tooten PC, Gruys E (September 1999). "Familial amyloidosis in cats: Siamese and ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
I42.1) Obstructive hypertrophy cardiomyopathy. *(I42.2) Other hypertrophic cardiomyopathy. *(I42.3) Endomyocardial ( ... I43) Cardiomyopathy in diseases classified elsewhere. Other[edit]. *(I50) Heart failure *(I50.0) Congestive heart failure * ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Tachycardia-induced. *Restrictive. *Loeffler endocarditis. *Cardiac ...
Hypertrophic cardiomyopathy (thickening of part of the heart muscle) is also sometimes found and can cause death;[1] asymmetric ...
Cardiomyopathy: Dilated (Alcoholic), Hypertrophic, and Restrictive *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Tachycardia-induced. *Restrictive. *Loeffler endocarditis. *Cardiac ...
A micrograph showing hypertrophic decidual vasculopathy, a finding seen in gestational hypertension and pre-eclampsia. H&E ... Hjartardottir S, Leifsson BG, Geirsson RT, Steinthorsdottir V (2004). "Paternity change and the recurrence risk in familial ... Peripartum cardiomyopathy. *Postpartum depression. *Postpartum psychosis. *Postpartum thyroiditis. *Puerperal fever. *Puerperal ...
心肌病變:扩张性(酒精性(英语:Alcoholic cardiomyopathy))、肥大性(英语:Hypertrophic cardiomyopathy)、限制性(英语:Restrictive cardiomyopathy) *Loeffler
... familial dyskinesia-facial myokymia (Bird-Raskind syndrome) due to an ADCY5 gene mutation, glutaric aciduria, Lesch-Nyhan ... Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Tachycardia-induced. *Restrictive. *Loeffler endocarditis. *Cardiac ...
Cardiomyopathy: Dilated (Alcoholic) · Hypertrophic · Restrictive (Loeffler endocarditis, Cardiac amyloidosis, Endocardial ... Atrial flutter · Ventricular flutter · Atrial fibrillation (Familial) · Ventricular fibrillation. Pacemaker. Wandering ...
354,000 with cardiomyopathy (2015)[5]. Myocarditis, also known as inflammatory cardiomyopathy, is inflammation of the heart ... 1983.) "Myocarditis - Cardiomyopathy Historic Survey and Definition", International Boehringer Mannheim Symposia, 1:5. ... In 2015 cardiomyopathy, including myocarditis, resulted in 354,000 deaths up from 294,000 in 1990.[8][9] The initial ... Complications may include heart failure due to dilated cardiomyopathy or cardiac arrest.[1] ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
Cardiomyopathy *Dilated *Alcoholic. *Hypertrophic. *Restrictive. *Loeffler endocarditis. *Cardiac amyloidosis. *Endocardial ...
... this in more detail in cardiac tissue and found that murine hearts lacking desmin developed hypertrophic cardiomyopathy and ... "Missense mutations in desmin associated with familial cardiac and skeletal myopathy". Nature Genetics. 19 (4): 402-3. doi: ... "Non-compaction cardiomyopathy is caused by a novel in-frame desmin (DES) deletion mutation within the 1A coiled-coil rod ... "Desmin mutation responsible for idiopathic dilated cardiomyopathy". Circulation. 100 (5): 461-4. doi:10.1161/01.cir.100.5.461. ...
Familial hypertrophic cardiomyopathy is a heart condition characterized by thickening (hypertrophy) of the heart (cardiac) ... medlineplus.gov/genetics/condition/familial-hypertrophic-cardiomyopathy/ Familial hypertrophic cardiomyopathy. ... Genetic Testing Registry: Familial hypertrophic cardiomyopathy 1 *Genetic Testing Registry: Familial hypertrophic ... Genetic Testing Registry: Familial hypertrophic cardiomyopathy 4 *Genetic Testing Registry: Familial hypertrophic ...
A form of hypertrophic cardiomyopathy, a heart disorder characterized by ventricular hypertrophy, which is usually asymmetric ... CMH27 is a severe, early-onset form with features of hypertrophic and dilated cardiomyopathy. ...
Two brothers (patient A & patient B) with a morphological severe form of hypertrophic cardiomyopathy (HCM) and early onset are ... Patient A was diagnosed with hypertrophic obstructive cardiomyopathy (HOCM) at the age of 9 months based on echocardiography ... As a first step, all patients with HCM should be considered, whatever the familial context, except when it is a familial form ... Danon Cardiomyopathy is a multi-system disease. Mild peripheral muscle myopathy and elevated liver enzymes was the reason that ...
Study familial hypertrophic cardiomyopathy using patient-specific induced pluripotent stem cells.. Han L1, Li Y1, Tchao J1, ... Familial hypertrophic cardiomyopathy (HCM) is one the most common heart disorders, with gene mutations in the cardiac sarcomere ... Study familial hypertrophic cardiomyopathy using patient-specific induced pluripotent stem cells. Cardiovasc Res. 2014 Nov 1; ... Study familial hypertrophic cardiomyopathy using patient-specific induced pluripotent stem cells. Cardiovasc Res. 2014 Nov 1; ...
Cardiomyopathy, Hypertrophic. Cardiomyopathy, Hypertrophic, Familial. Cardiovascular Diseases. Heart Diseases. Cardiomyopathies ... Genetic Analysis of Familial Hypertrophic Cardiomyopathy. The safety and scientific validity of this study is the ... A locus for familial hypertrophic cardiomyopathy is closely linked to the cardiac myosin heavy chain genes, CRI-L436, and CRI- ... Familial hypertrophic cardiomyopathy is a disease of heart muscle that is genetically transmitted as an autosomal dominant ...
Familial hypertrophic cardiomyopathy, also known as FHC or HCM, is a rare condition best known publicly for its association ... Retrieved from "https://www.SNPedia.com/index.php?title=Familial_hypertrophic_cardiomyopathy&oldid=1316364" ...
Family screening for hypertrophic cardiomyopathy using conventional techniques yields some equivocal cases. Although mutations ... Cardiomyopathy, Hypertrophic / diagnosis*, genetics*, physiopathology. Coronary Circulation. Female. Humans. Male. Pedigree. ... Because coronary flow reserve is reduced in patients with typical hypertrophic cardiomyopathy independent of the severity of ... Both subjects underwent screening for hypertrophic cardiomyopathy because of a family history of the disease. Positron-emission ...
Familial hypertrophic cardiomyopathy (HCM) is a prevalent hereditary cardiac disorder linked to arrhythmia and sudden cardiac ... Familial hypertrophic cardiomyopathy (HCM) is a prevalent hereditary cardiac disorder linked to arrhythmia and sudden cardiac ... Abnormal calcium handling properties underlie familial hypertrophic cardiomyopathy pathology in patient-specific induced ...
Hypertrophic Cardiomyopathy (CMH) is a form of cardiomyopathy, characterized by an abnormal and usually asymmetrical, ... 1985) reported apical hypertrophic cardiomyopathy in father and daughter of a Lebanese Christian family. In both, identical ... Apical hypertrophic cardiomyopathy in a father and daughter. Am J Med Genet. 1985; 22(1):75-80. ... Six of these Qatari patients (14.3%) were diagnosed with Hypertrophic Cardiomyopathy (HCM), based on their echocardiographic ...
Hypertrophic cardiomyopathy (HCM) is one of the major cardiac genetic disorders among South Asians, leading to contractile ... Hypertrophic cardiomyopathy (HCM) is one of the major cardiac genetic disorders among South Asians, leading to contractile ... Hypertrophic Cardiomyopathy, a Treatable Form of CVD. The Cardiomyopathies. Cardiomyopathies are a heterogeneous group of ... How should hypertrophic cardiomyopathy be classified? Molecular diagnosis for hypertrophic cardiomyopathy: Not ready for prime ...
Localization of gene for familial hypertrophic cardiomyopathy to chromosome 14q1 in a diverse US population.. J F Hejtmancik, P ... Thus, 14q1 appears to be the locus for familial hypertrophic cardiomyopathy in a significant proportion of the US population. ... CONCLUSIONS These results indicate that the loci for familial hypertrophic cardiomyopathy in our families is primarily 14q1 but ... BACKGROUND Familial hypertrophic cardiomyopathy, an inherited primary cardiac abnormality characterized by ventricular ...
familial hypertrophic cardiomyopathy (HCM). 4 key reasons Mitalipov paper doesnt herald safe CRISPR human genetic modification ...
... and questions answered by our Genetic and Rare Diseases Information Specialists for Familial hypertrophic cardiomyopathy ... Familial hypertrophic cardiomyopathy Información en español Title Other Names:. Cardiomyopathy familial hypertrophic; Heritable ... ghr.nlm.nih.gov/condition/familial-hypertrophic-cardiomyopathy. *Hypertrophic cardiomyopathy. Mayo Clinic. October, 2016; http ... Familial. hypertrophic cardiomyopathy. (HCM) is caused by mutations. in any of several known genes. , and possibly other genes ...
Familial hypertrophic cardiomyopathy 12 information including symptoms, diagnosis, misdiagnosis, treatment, causes, patient ... Contents for Familial hypertrophic cardiomyopathy 12: *Familial hypertrophic cardiomyopathy 12 *What is Familial hypertrophic ... Videos related to Familial hypertrophic cardiomyopathy 12 *Types of Familial hypertrophic cardiomyopathy 12 *Causes of Familial ... Familial hypertrophic cardiomyopathy 12: Introduction. Familial hypertrophic cardiomyopathy 12: An inherited heart condition ...
Cardiomyopathy, familial hypertrophic 6; CMH6 disease page. Quantitative data and detailed annnotation of the targets of ... Cardiomyopathy, familial hypertrophic 6; CMH6. GtoPdb Disease Summaries. This section gives an overview of the disease, and ... Familial hypertrophic cardiomyopathy , Familial isolated hypertrophic cardiomyopathy Database Links Disease Ontology: DOID: ...
Familial hypertrophic cardiomyopathy(FHC) is caused by missence mutations in β-myosin heavy chain or other various sarcomeric ... Familial hypertrophic cardiomyopathy(FHC) is caused by missence mutations in β-myosin heavy chain or other various sarcomeric ... Functional Characterization of Dictyostelium Discoideum Mutant Myosins Equivalent to Human Familial Hypertrophic Cardiomyopathy ... Functional Characterization of Dictyostelium Discoideum Mutant Myosins Equivalent to Human Familial Hypertrophic Cardiomyopathy ...
Misdiagnosis of Familial hypertrophic cardiomyopathy 10 including hidden diseases, diagnosis mistakes, alternative diagnoses, ... Diagnostic Tests for Familial hypertrophic cardiomyopathy 10. *Home Diagnostic Testing for Familial hypertrophic cardiomyopathy ... Familial hypertrophic cardiomyopathy 10: Hidden Causes Misdiagnosed?. Causes of Familial hypertrophic cardiomyopathy 10 may ... Undiagnosed Familial hypertrophic cardiomyopathy 10. *Misdiagnosis of Underlying Causes of Familial hypertrophic cardiomyopathy ...
Novel α-Actinin 2 Variant Associated With Familial Hypertrophic Cardiomyopathy and Juvenile Atrial ArrhythmiasCLINICAL ... Novel α-Actinin 2 Variant Associated With Familial Hypertrophic Cardiomyopathy and Juvenile Atrial ArrhythmiasCLINICAL ... Novel α-Actinin 2 Variant Associated With Familial Hypertrophic Cardiomyopathy and Juvenile Atrial ArrhythmiasCLINICAL ... Novel α-Actinin 2 Variant Associated With Familial Hypertrophic Cardiomyopathy and Juvenile Atrial ArrhythmiasCLINICAL ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
Cardiomyopathy, Familial Hypertrophic, 2 Cardiomyopathy, Familial Hypertrophic, 3 Cardiomyopathy, Familial Hypertrophic, 4 ... Cardiomyopathy, Familial Hypertrophic, 25 Cardiomyopathy, Familial Hypertrophic, 8 Cardiomyopathy, Familial Hypertrophic, 10 ... Cardiomyopathy, Familial Hypertrophic, 12 Cardiomyopathy, Familial Hypertrophic, 13 Cardiomyopathy, Familial Hypertrophic, 14 ... Cardiomyopathy, Familial Hypertrophic, 7 Cardiomyopathy, Familial Hypertrophic, 9 Cardiomyopathy, Familial Hypertrophic, 16 ...
Build: Sat Feb 17 08:59:16 EST 2018 (commit: 16064c5). National Center for Advancing Translational Sciences (NCATS), 6701 Democracy Boulevard, Bethesda MD 20892-4874 • 301-435-0888. ...
... A hereditary heart disorder characterized by ventricular hypertrophy, which is ...
... Creator. Geelen, Els ... Constructing "Best Interests": Genetic Testing of Children in Families With Hypertrophic Cardiomyopathy  Geelen, Els; Van ... extended families in the southern and eastern Netherlands involved in genetic testing for familial hypertrophic cardiomyopathy ...
ABSENCE OF MAJOR DELETIONS OR REARRANGEMENTS OF CARDIAC MYOSIN HEAVY-CHAIN GENES IN FAMILIAL HYPERTROPHIC CARDIOMYOPATHY ... ABSENCE OF MAJOR DELETIONS OR REARRANGEMENTS OF CARDIAC MYOSIN HEAVY-CHAIN GENES IN FAMILIAL HYPERTROPHIC CARDIOMYOPATHY ... ABSENCE OF MAJOR DELETIONS OR REARRANGEMENTS OF CARDIAC MYOSIN HEAVY-CHAIN GENES IN FAMILIAL HYPERTROPHIC CARDIOMYOPATHY ...
Genetics Home Reference GHR contains information on Familial hypertrophic cardiomyopathy. Familial hypertrophic cardiomyopathy ... familial. List of variants in gene TTN studied for Familial hypertrophic cardiomyopathy 9 ClinVar Miner.. List of variants in ... Familial Hypertrophic Cardiomyopathy Circulation Research.. The results of molecular genetics studies have shown that familial ... Some cases of familial hypertrophic cardiomyopathy are caused by missense mutations of the beta myosin heavy chain beta MHC ...
Hypertrophic, Familial; Familial Hypertrophic Cardiomyopathy. On-line free medical diagnosis assistant. Ranked list of possible ... Cardiomyopathy, Hypertrophic, Familial (Familial Hypertrophic Cardiomyopathy). An autosomal dominant inherited form of ... Hypertrophic, Familial"Drugs, active principles and "Cardiomyopathy, Hypertrophic, Familial"Medicinal plantsQuestions and ... HYPERTROPHIC CARDIOMYOPATHY. It results from any of more than 50 mutations involving genes encoding contractile proteins such ...
Familial Hypertrophic Cardiomyopathy. Hypertrophic cardiomyopathy36 is transmitted as an autosomal dominant disease. Its ... Familial hypertrophic cardiomyopathy with Wolff-Parkinson-White syndrome maps to a locus on chromosome 7p3. J Clin Invest. 1995 ... Familial hypertrophic cardiomyopathy: microsatellite haplotyping and identification of a hot spot for mutations in the β-myosin ... Mutations in the cardiac myosin binding protein-C gene on chromosome 11 cause familial hypertrophic cardiomyopathy. Nat Genet. ...
Familial hypertrophic cardiomyopathy is an autosomal dominant genetic disease considered the most common cause of sudden ... Familial Hypertrophic Cardiomyopathy: Late Potentials and Other Prognostic Markers Ândrea Chaves-Markman 1 , Manuel Markman 2 ... Familial Hypertrophic Cardiomyopathy: Late Potentials and Other Prognostic Markers Ândrea Chaves-Markman et al. Cureus. 2020. . ... Familial hypertrophic cardiomyopathy is an autosomal dominant genetic disease considered the most common cause of sudden ...
Cellular and molecular aspects of familial hypertrophic cardiomyopathy caused by mutations in the cardiac troponin I gene. ... keywords = "Cardiac, Familial hypertrophic cardiomyopathy, Muscle contraction and calcium, Toponin I",. author = "Gomes, { ... Cellular and molecular aspects of familial hypertrophic cardiomyopathy caused by mutations in the cardiac troponin I gene. / ... Mutations in the cardiac troponin I (CTnI) gene occur in ∼5% of families with familial hypertrophic cardiomyopathy (FHC) and 20 ...
Cardiomyopathy familial hypertrophic type 11 (ACTC1) Test Free Home Sample collection centers in Delhi Mumbai Kolkata Chennai ... Cost of Cardiomyopathy familial hypertrophic type 11 (ACTC1) Test in India. Cardiomyopathy familial hypertrophic type 11 (ACTC1 ... Cardiomyopathy familial hypertrophic type 11 (ACTC1) Cost. Cardiomyopathy familial hypertrophic type 11 (ACTC1) Test Price in ... Cardiomyopathy familial hypertrophic type 11 (ACTC1) Test Price in Mumbai. ₹ 19000.00. Cardiomyopathy familial hypertrophic ...
  • Familial hypertrophic cardiomyopathy (HCM) is one the most common heart disorders, with gene mutations in the cardiac sarcomere. (nih.gov)
  • Familial HCM may be caused by mutations in any of several genes and is typically inherited in an autosomal dominant manner. (nih.gov)
  • Familial hypertrophic cardiomyopathy (HCM) is caused by mutations in any of several genes . (nih.gov)
  • While it is unclear exactly how mutations in these genes cause familial HCM, they are thought to lead to abnormal structure or function of sarcomeres, or reduce the amount of proteins made. (nih.gov)
  • Familial hypertrophic cardiomyopathy (HCM) is caused by mutations in any of several known genes , and possibly other genes that have not yet been identified. (nih.gov)
  • Familial hypertrophic cardiomyopathy(FHC) is caused by missence mutations in β-myosin heavy chain or other various sarcomeric proteins. (springer.com)
  • Familial Hypertrophic Cardiomyopathy Mutations in the Regulatory Light Chains of Myosin Affect Their Structure, Ca2Binding, and Phosphorylation. (fungionline.org.uk)
  • The effect of the familial hypertrophic cardiomyopathy mutations, A13T, F18L, E22K, R58Q, and P95A, found in the regulatory light chains of human cardiac myosin has been investigated. (fungionline.org.uk)
  • The results of molecular genetics studies have shown that familial hypertrophic cardiomyopathy is a disease of the sarcomere involving mutations in 7 different genes encoding proteins of the myofibrillar apparatus: myosin heavy chain, ventricular myosin essential light chain, ventricular myosin regulatory light chain, cardiac troponin T, cardiac troponin I, tropomyosin, and cardiac myosin binding protein C. (fungionline.org.uk)
  • Clinical and prognostic evaluation of familial hypertrophic cardiomyopathy in two South African families with different cardiac beta myosin heavy chain gene mutations. (fungionline.org.uk)
  • Some cases of familial hypertrophic cardiomyopathy are caused by missense mutations of the beta myosin heavy chain beta MHC gene on chromosome 14 and at least 17 such mutations have been described. (fungionline.org.uk)
  • Mutations in the cardiac troponin I (CTnI) gene occur in ∼5% of families with familial hypertrophic cardiomyopathy (FHC) and 20 mutations in this gene that cause FHC have now been described. (elsevier.com)
  • Gomes, AV & Potter, JD 2004, ' Cellular and molecular aspects of familial hypertrophic cardiomyopathy caused by mutations in the cardiac troponin I gene ', Molecular and Cellular Biochemistry , vol. 263, no. 1, pp. 99-114. (elsevier.com)
  • Some people with these mutations also have features of hypertrophic cardiomyopathy, a form of heart disease that enlarges and weakens the heart (cardiac) muscle. (nih.gov)
  • Mutations in the TNNI3 gene can cause familial hypertrophic cardiomyopathy, a condition characterized by thickening (hypertrophy) of the cardiac muscle. (nih.gov)
  • Most TNNI3 gene mutations in familial hypertrophic cardiomyopathy change single protein building blocks (amino acids) in the cardiac troponin I protein. (nih.gov)
  • It is unclear how these mutations lead to the features of familial hypertrophic cardiomyopathy. (nih.gov)
  • Approximately 10 mutations in the TNNI3 gene have been found to cause familial restrictive cardiomyopathy, which is characterized by stiffening of the heart muscle. (nih.gov)
  • Mutations in the TNNI3 gene can also cause another heart conditions called dilated cardiomyopathy. (nih.gov)
  • Mutations in human cardiac troponin I that are associated with restrictive cardiomyopathy affect basal ATPase activity and the calcium sensitivity of force development. (nih.gov)
  • Genetic and functional data suggest that mutations which cause hypertrophic cardiomyopathy act as dominant negative alleles that impair cross-bridge cycling and contractile function and interfere with sarcomere assembly. (ox.ac.uk)
  • One of the most common genetic causes for hypertrophic cardiomyopathy involves mutations in cardiac myosin-binding protein C ( MYBPC3 ) gene. (ddccliniclab.org)
  • Mutations in the MT-TI gene may also cause cardiomyopathy , a disorder of the heart characterized by the thickening of the heart, usually in the interventricular septum , which results in a weakened heart muscle that is unable to pump blood effectively. (wikipedia.org)
  • It is unclear why such mutations result in the symptoms of isolated cardiomyopathy. (wikipedia.org)
  • Familial hypertrophic cardiomyopathy FHC is an autosomal dominant disease, which in about 30% of the patients is caused by missense mutations in one allele of the β-myosin heavy chain β-MHC gene MYH7. (duhnnae.com)
  • Biallelic Truncating Mutations in ALPK3 Cause Severe Pediatric Cardiomyopathy. (nih.gov)
  • Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. (genecards.org)
  • Mutations in this gene cause cardiomyopathy familial hypertrophic type 16, a hereditary heart disorder. (genecards.org)
  • More than 3800 gene mutations are linked to inherited cardiomyopathies (ICs) and identification of underlying gene mutations continues to expand ( https://www.ncbi.nlm.nih.gov/clinvar/ ). (frontiersin.org)
  • In skinned porcine cardiac muscles, RLC-depleted and IVS6-1 reconstituted muscle strips displayed a significant decrease in maximal contractile force and a significantly increased Ca 2+ sensitivity, both hallmarks of hypertrophic cardiomyopathy-associated mutations in MYL2 . (frontiersin.org)
  • METHODS: Coronary flow reserve was measured in two subjects: one with a MYH7 mutation but without typical diagnostic features of hypertrophic cardiomyopathy, and one with borderline left ventricular hypertrophy but no mutation in the MYH7 gene. (biomedsearch.com)
  • In rare cases, a person with familial HCM has a mutation in both copies of the responsible gene, which leads to more severe signs and symptoms. (nih.gov)
  • 12 A familial hypertrophic cardiomyopathy that has material basis in heterozygous mutation in the gene encoding the gamma-2 regulatory subunit of AMP-activated protein kinase (PRKAG2). (malacards.org)
  • PayPerView: Phenotypic Variation of Familial Hypertrophic Cardiomyopathy Caused by the Phe 110 Ile Mutation in Cardiac Troponin T Karger Publishers. (fungionline.org.uk)
  • Familial Hypertrophic Cardiomyopathy Related Cardiac Troponin C L29Q Mutation Alters Length-Dependent Activation and Functional Effects of Phosphomimetic Troponin I. (fungionline.org.uk)
  • KeywordsHypertrophic cardiomyopathy Allelic imbalance Cardiac β-myosin heavy chain Myosin missense mutation mRNA quantification Electronic supplementary materialThe online version of this article doi:10.1007-s00395-011-0205-9 contains supplementary material, which is available to authorized users. (duhnnae.com)
  • Heterozygous mutation of c3691-3692insTTCA in MYBPC3 gene was identified in a pediatric patient with diagnosis of hypertrophic cardiomyopathy at clinic. (archivestsc.com)
  • This mutation has not previously been defined and reported previously in the literature as cause of hypertrophic cardiomyopathy. (archivestsc.com)
  • Background: The cardiac troponin T I79N mutation, linked to familial hypertrophic cardiomyopathy, carries a high risk of sudden cardiac death even in the absence of significant cardiac hypertrophy. (elsevier.com)
  • Novel ALPK3 mutation in a Tunisian patient with pediatric cardiomyopathy and facio-thoraco-skeletal features. (nih.gov)
  • A hypertrophic cardiomyopathy that has_material_basis_in homozygous or heterozygous mutation in the MYL3 gene. (jax.org)
  • Here we report a significant change in cardiac energetics in transgenic mice bearing the missense mutation R92Q within the tropomyosin-binding domain of cTnT, a mutation associated with a clinically severe form of familial hypertrophic cardiomyopathy. (jci.org)
  • We present a case of apical hypertrophic cardiomyopathy with MYBPC3 mutation in a young Cameroonian. (ccrjournal.org)
  • The cardiac troponin T (TnT) I79N mutation has been linked to familial hypertrophic cardiomyopathy and high incidence of sudden death, despite causing little or no cardiac hypertrophy in patients. (elsevier.com)
  • Mutation of the MYH7 gene in a child with hypertrophic cardiomyopathy and Wolff-Parkinson-White syndrome. (biomedsearch.com)
  • In the literature, only a gene mutation on chromosome 7q3 has been described in familial HCM coexisting with WPW syndrome to date. (biomedsearch.com)
  • Even in the absence of symptoms, familial HCM can have serious consequences such as life-threatening arrhythmias , heart failure , and an increased risk of sudden death. (nih.gov)
  • Abstract -Genetic approaches have succeeded in defining the molecular basis of an increasing array of heart diseases, such as hypertrophic cardiomyopathy and the long-QT syndromes, associated with serious arrhythmias. (ahajournals.org)
  • This study aimed to investigate the association between the presence of late potentials and a family history of sudden death, syncope, and complex ventricular arrhythmias on patients with hypertrophic cardiomyopathy. (cdc.gov)
  • According to this study, the presence of late potentials was not associated with familial sudden death, syncope, and complex ventricular arrhythmias. (cdc.gov)
  • Hypertrophic cardiomyopathy is a disease characterized by the presence of a nondilated, usually hypertrophied left ventricle (LV) and greater susceptibility to arrhythmias and sudden death. (jci.org)
  • Hypertrophic cardiomyopathy and other genetic heart muscle diseases are associated with risks for atrial and ventricular arrhythmias. (vanderbilthealth.com)
  • These alterations could increase your risk-or your children's risk-of developing a disease, such as coronary artery disease , aortic aneurysms , cardiomyopathy , arrhythmias and others. (osu.edu)
  • Familial hypertrophic cardiomyopathy is a heart condition characterized by thickening (hypertrophy) of the heart (cardiac) muscle. (medlineplus.gov)
  • However, it is not clear how these contraction problems are related to hypertrophy or the symptoms of familial hypertrophic cardiomyopathy. (medlineplus.gov)
  • A form of hypertrophic cardiomyopathy, a heart disorder characterized by ventricular hypertrophy, which is usually asymmetric and often involves the interventricular septum. (uniprot.org)
  • Because coronary flow reserve is reduced in patients with typical hypertrophic cardiomyopathy independent of the severity of left ventricular hypertrophy, this measurement may help to identify patients with equivocal features of the disease. (biomedsearch.com)
  • BACKGROUND Familial hypertrophic cardiomyopathy, an inherited primary cardiac abnormality characterized by ventricular hypertrophy, is the leading cause of sudden death in the young. (ahajournals.org)
  • The results showed that asymmetric septal hypertrophy was the most common type (73%), 63% had a positive familial history of hypertrophic cardiomyopathy, 55% sudden cardiac death, and 23% syncope. (cdc.gov)
  • We report that a gene responsible for familial hypertrophic cardiomyopathy (FHC) in a kindred with a mild degree of cardiac hypertrophy maps to chromosome 15q2. (ox.ac.uk)
  • Familial hypertrophic cardiomyopathy: a genetic model of cardiac hypertrophy. (ox.ac.uk)
  • Familial hypertrophic cardiomyopathy is an autosomal dominant disorder manifesting as cardiac hypertrophy in the absence of increased cardiac work load, which has been studied as a model of myocardial hypertrophy in humans. (ox.ac.uk)
  • Familial hypertrophic cardiomyopathy is an autosomal dominant myocardial disorder characterized by left ventricle hypertrophy with histological features of myocyte hypertrophy, myofibrillar disarray, and interstitial fibrosis. (ddccliniclab.org)
  • Hypertrophic Cardiomyopathy is a genetic disorder with asymmetric left ventricular hypertrophy. (ccrjournal.org)
  • An intrinsic cardiomyopathy that is characterized by abnormal thickening (hypertrophy) of the heart without any obvious cause. (bioontology.org)
  • 1 Since this description, hypertrophic cardiomyopathy is now considered a familial disease characterised morphologically by unexplained hypertrophy, and at the histological level by myocyte disarray, 2 fibrosis, 3 and abnormalities of the intramyocardial small vessels. (bmj.com)
  • Defects of VCL, which encodes a cytoskeletal protein present in cell-cell and cell-matrix junctions, cause familial hypertrophic cardiomyopathy type 15. (thefreedictionary.com)
  • Familial hypertrophic cardiomyopathy (HCM) is a prevalent hereditary cardiac disorder linked to arrhythmia and sudden cardiac death. (nih.gov)
  • Recent developments in genetics of hereditary cardiomyopathy have not only enlightened many points about pathogenesis, but have also provided great benefit to diagnostic approaches of clinicians. (archivestsc.com)
  • In some people, hypertrophic cardiomyopathy develops into restrictive cardiomyopathy (described below), although it can be difficult to distinguish these two disorders. (nih.gov)
  • As a result, heart muscle relaxation is disrupted, leading to abnormal heart function, impaired blood flow, and the signs and symptoms of familial restrictive cardiomyopathy, such as fatigue and fainting. (nih.gov)
  • These subtypes are: dilated, hypertrophic, and restrictive. (rarediseases.org)
  • Defects in TNNI3 are the cause of cardiomyopathy familial restrictive type 1 (RCM1) [MIM:115210]. (abcam.com)
  • 1985) reported apical hypertrophic cardiomyopathy in father and daughter of a Lebanese Christian family. (cags.org.ae)
  • Sylvie Ndongo Amougou, Helles Murielle Lema, Mazou Ngou Temgoua, Ngam Mary Engonwei, Samuel Kingue, Familial Apical Hypertrophic Cardiomyopathy in a Young Adult: A Rare Occasion for Making Precise Diagnostic in a Low Income Country, Cardiology and Cardiovascular Research . (ccrjournal.org)
  • Apical aneurysms are outpouchings of the left ventricular apex that are relatively common in patients with apical hypertrophic cardiomyopathy or hypertrophic cardiomyopathy with midventricular obstruc. (bioportfolio.com)
  • Genetics Home Reference GHR contains information on Familial hypertrophic cardiomyopathy. (fungionline.org.uk)
  • Genetics Home Reference provides information about familial atrial fibrillation. (nih.gov)
  • Genetics Home Reference provides information about familial hypertrophic cardiomyopathy. (nih.gov)
  • Studies were conducted to determine if the familial hypertrophic cardiomyopathy locus was the same in all three kindreds and to identify the gene responsible. (clinicaltrials.gov)
  • Thus, 14q1 appears to be the locus for familial hypertrophic cardiomyopathy in a significant proportion of the US population. (ahajournals.org)
  • A familial hypertrophic cardiomyopathy locus maps to chromosome 15q2. (ox.ac.uk)
  • E/e' ratio and left atrial area are predictors of atrial fibrillation in patients with hypertrophic cardiomyopathy. (bioportfolio.com)
  • Atrial fibrillation (AF) occurs in about 20%-25% of patients with hypertrophic cardiomyopathy and is associated with increased risk of cardioembolism and heart failure impacting on patients' morbidity. (bioportfolio.com)
  • A second echocardiography could be performed from the age of 30-35 years, when athletes age and become master athletes, to especially evaluate pathological cardiac remodelling to exercise (eg, atrial and/or right ventricular dilation), late onset cardiomyopathies and wall motion abnormalities due to myocarditis or coronary artery disease. (bmj.com)
  • The symptoms of familial hypertrophic cardiomyopathy are variable, even within the same family. (medlineplus.gov)
  • Patient A was diagnosed with hypertrophic obstructive cardiomyopathy (HOCM) at the age of 9 months based on echocardiography measurements. (escardio.org)
  • To map the genetic defect responsible for familial hypertrophic cardiomyopathy. (clinicaltrials.gov)
  • Other genes that have not yet been identified may also be responsible for familial HCM. (nih.gov)
  • The genes known to be responsible for familial HCM give the body instructions to make proteins that play important roles in contraction of the heart muscle. (nih.gov)
  • People with familial hypertrophic cardiomyopathy have an increased risk of sudden death, even if they have no other symptoms of the condition. (medlineplus.gov)
  • Familial hypertrophic cardiomyopathy , also known as FHC or HCM, is a rare condition best known publicly for it's association with sudden death among young athletes. (snpedia.com)
  • Hypertrophic cardiomyopathy (HCM) is one of the major cardiac genetic disorders among South Asians, leading to contractile dysfunction, heart failure, and sudden cardiac death. (frontiersin.org)
  • BACKGROUND-Familial hypertrophic cardiomyopathy is the most common inherited cardiac disorder, with sudden cardiac death at a young age the most frequent cause of death in affected individuals. (fungionline.org.uk)
  • Familial hypertrophic cardiomyopathy FHC is the most commonly inherited cardiovascular disease with a prevalence of 1500 individuals 4 and is the most common cause of sudden cardiac death in young athletes 5. (fungionline.org.uk)
  • Familial hypertrophic cardiomyopathy is an autosomal dominant genetic disease considered the most common cause of sudden cardiac death in individuals under 35 years old, especially the athletes. (cdc.gov)
  • Although some people with hypertrophic cardiomyopathy have no obvious health effects, all affected individuals have an increased risk of heart failure and sudden death. (nih.gov)
  • Hypertrophic cardiomyopathy (HCM) is the most common monogenic heart disease and the most frequent cause of sudden cardiac death (SCD) in the young. (clinicaltrials.gov)
  • Hypertrophic cardiomyopathy (HCM) is the most important cause of sudden death in apparently healthy young people. (clinicaltrials.gov)
  • Hypertrophic cardiomyopathy (HCM) is the most important cause of sudden death in apparently healthy young individuals but its clinical manifestations are highly variable. (clinicaltrials.gov)
  • In some individuals, cardiomyopathy may progress to cause congestive heart failure, cardiac arrest, and sudden death. (rarediseases.org)
  • These genetic abnormalities can result in problems with the heart's muscle function ( cardiomyopathy ) or problems with the heart's electrical system, which may put patients at risk for sudden cardiac death. (uhhospitals.org)
  • PATIENTS 72 patients with hypertrophic cardiomyopathy who had suffered sudden death or progression to end stage cardiac failure (resulting in death or heart transplantation). (bmj.com)
  • According to one study just 21% of 48 athletes who died of hypertrophic cardiomyopathy related sudden death had previous signs or symptoms of cardiac disease (chest pain, exertional dyspnea, syncope, dizziness) before death (Koester, 2001). (bartleby.com)
  • The proteins produced from the genes associated with familial hypertrophic cardiomyopathy play important roles in contraction of the heart muscle by forming muscle cell structures called sarcomeres . (medlineplus.gov)
  • Hypertrophic cardiomyopathy is genetically heterogeneous with three known disease-genes and two further mapped loci. (ox.ac.uk)
  • Exome-wide association study reveals novel susceptibility genes to sporadic dilated cardiomyopathy. (nih.gov)
  • ALPK3 should be included in the list of genes to be considered in genetic studies for patients affected with pediatric syndromic cardiomyopathy. (nih.gov)
  • Familial hypertrophic cardiomyopathy (HCM) displays autosomal dominant inheritance with incomplete penetration of defective genes. (biomedsearch.com)
  • Familial hypertrophic cardiomyopathy Genetic and Rare Diseases Information Center GARD an NCATS Program. (fungionline.org.uk)
  • Sarcomere cardiomyopathies are genetic diseases that perturb contractile function and lead to hypertrophic or dilated myocardial remodeling. (bioportfolio.com)
  • Diseases associated with FHOD3 include Hypertrophic Cardiomyopathy and Hemochromatosis, Type 2B . (genecards.org)
  • Background: Familial Cardiomyopathies (FC) are a collection of cardiac diseases that vary vastly genetically, and pathologically (1, 2). (bartleby.com)
  • CONCLUSIONS: Noninvasive quantification of coronary flow reserve by positron-emission tomography may have a role in identifying patients with equivocal hypertrophic cardiomyopathy and should be further explored. (biomedsearch.com)
  • Ischemic cardiomyopathy refers to a lack of blood flow and oxygen (ischemia) to the heart and this often results from hardening of the arteries (coronary artery disease). (rarediseases.org)
  • Localization of gene for familial hypertrophic cardiomyopathy to chromosome 14q1 in a diverse US population. (ahajournals.org)
  • Mapping a gene for familial hypertrophic cardiomyopathy to chromosome 14q1. (medscape.com)
  • As a first step, all patients with HCM should be considered, whatever the familial context, except when it is a familial form with a male to male transmission (which excludes X linked disease). (escardio.org)
  • 2006) analyzed data pertaining to all patients less than 50-years of age, who were hospitalized between 1996 and 2003 with cardiomyopathy in Qatar. (cags.org.ae)
  • Six of these Qatari patients (14.3%) were diagnosed with Hypertrophic Cardiomyopathy (HCM), based on their echocardiographic measurements. (cags.org.ae)
  • A case series study was carried out from March 2001 to December 2002, including 22 patients with hypertrophic cardiomyopathy according to transthoracic echocardiogram criteria. (cdc.gov)
  • G in the MT-TI gene have been found in patients with cardiomyopathy in varying severities and onset. (wikipedia.org)
  • Expanding the clinical and genetic spectrum of ALPK3 variants: Phenotypes identified in pediatric cardiomyopathy patients and adults with heterozygous variants. (nih.gov)
  • The Hypertrophic Cardiomyopathy (HCM) Center brings together a group of healthcare providers with special expertise in treating patients with HCM. (intermountainhealthcare.org)
  • Nearly all patients with pediatric cardiomyopathy have the nonischemic type. (rarediseases.org)
  • Diagnosis and treatment of patients with hypertrophic cardiomyopathy are discussed. (kardiologiapolska.pl)
  • Comprising physicians specializing in cardiomyopathy, congestive heart failure, cardiac electrophysiology, medical genetics and a certified genetic counselor, the Center for Cardiovascular Genetics is designed to identify patients with inherited conditions or genetically determined cardiac disease. (uhhospitals.org)
  • As an outpatient clinic, patients may meet and be evaluated by an electrophysiologist (a doctor specializing in heart rhythm disorders), a cardiologist specializing in cardiomyopathy, and a registered nurse. (uhhospitals.org)
  • Patients with hypertrophic cardiomyopathy are being compared to a control group. (bioportfolio.com)
  • This study evaluates mechanisms of arrhythmogenicity in hypertrophic cardiomyopathy, in comparison to patients with well-understood arrhythmogenic substrate (ischemic cardiomyopathy), as w. (bioportfolio.com)
  • The purpose of this research study is to further establish the diagnostic use of magnetocardiography (MCG) in patients with hypertrophic cardiomyopathy (HCM). (bioportfolio.com)
  • Effect of Spironolactone on Myocardial Fibrosis and Other Clinical Variables in Patients with Hypertrophic Cardiomyopathy: a Prospective, Randomized Trial. (bioportfolio.com)
  • We follow over 300 patients with hypertrophic cardiomyopathy. (vanderbilthealth.com)
  • Torsion Mechanics as an Indicator of More Advanced Left Ventricular Systolic Dysfunction in Secondary Mitral Regurgitation in Patients with Dilated Cardiomyopathy: A 2D Speckle-Tracking Analysis. (bioportfolio.com)
  • Hypertrophic cardiomyopathy: prognostic factors and survival analysis in 128 Egyptian patients. (medscape.com)
  • Hindieh W, Adler A, Weissler-Snir A, Fourey D, Harris S, Rakowski H. Exercise in patients with hypertrophic cardiomyopathy: A review of current evidence, national guideline recommendations and a proposal for a new direction to fitness. (medscape.com)
  • It is also clear that patients with hypertrophic cardiomyopathy may progress to a burnt out phase, characterised by wall thinning, cavity enlargement, and impaired systolic function. (bmj.com)
  • In order to clarify these issues we have performed a quantitative assessment of the distribution of disarray, fibrosis, and small vessel changes in a large consecutive group of patients with hypertrophic cardiomyopathy and have evaluated the interrelations between these features and their relation to the macroscopic findings. (bmj.com)
  • Two brothers (patient A & patient B) with a morphological severe form of hypertrophic cardiomyopathy (HCM) and early onset are presented. (escardio.org)
  • An autosomal dominant inherited form of HYPERTROPHIC CARDIOMYOPATHY. (lookfordiagnosis.com)
  • Our experienced team provides comprehensive, life-long care for people with hypertrophic cardiomyopathy. (vanderbilthealth.com)
  • Seventy two hearts with a diagnosis of hypertrophic cardiomyopathy were obtained at necropsy or transplantation. (bmj.com)
  • Study familial hypertrophic cardiomyopathy using patient-specific induced pluripotent stem cells. (nih.gov)
  • To date most published reports on the histopathology of hypertrophic cardiomyopathy have derived from work undertaken during the 1970s and early 1980s, 3 8 9 in an era when the broader phenotype of hypertrophic cardiomyopathy was not fully appreciated. (bmj.com)
  • Barry J. Maron, Steve R. ommen et al, Hypertrophic cardiomyopathy present and future, with translation into contemporary cardiovascular medecine. (ccrjournal.org)
  • In both, identical segments of the left ventricle were involved by the hypertrophic process with differing degrees of severity. (cags.org.ae)
  • The accumulation of this substance enlarges these cells, which may lead to hypertrophic cardiomyopathy. (nih.gov)
  • Familial hypertrophic cardiomyopathy: clinical features, molecular genetics and molecular genetic testing: Expert Review of Molecular Diagnostics: Vol 4, No 1. (fungionline.org.uk)
  • Familial hypertrophic cardiomyopathy: clinical features, molecular genetics and molecular genetic testing. (fungionline.org.uk)
  • List of variants in gene TTN studied for Familial hypertrophic cardiomyopathy 9 ClinVar Miner. (fungionline.org.uk)
  • We concluded of hypertrophic cardiomyopathy with abnormality in the myosin binding protein C (MYBPC3) found on genetic analysis. (ccrjournal.org)
  • Hypertrophic cardiomyopathy (HCM) is an autosomal dominant disorder and is the most common heritable cardiomyopathy. (revespcardiol.org)
  • Genetic Pathogenesis of Hypertrophic and Dilated Cardiomyopathy. (bioportfolio.com)
  • Autosomal dominant or X-linked familial disorders often prompt prenatal testing for germline mosaicism. (wikipedia.org)
  • As is often the case with genetic testing in general, there are benefits and limitations of genetic testing for familial HCM. (nih.gov)
  • In this qualitative study, we followed six extended families in the southern and eastern Netherlands involved in genetic testing for familial hypertrophic cardiomyopathy for three and a half years. (georgetown.edu)
  • This study is an international, multi-center, randomized, double-blind, placebo controlled clinical trial of the effects of perhexiline maleate on a rank-ordered, hierarchical variable consisting of outcome and functional measures in 350 subjects with hypertrophic cardiomyopathy and symptoms of moderate to severe congestive heart failure. (clinicaltrials.gov)
  • Dilated cardiomyopathy is a disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. (abcam.com)
  • CMH27 is a severe, early-onset form with features of hypertrophic and dilated cardiomyopathy. (uniprot.org)
  • Dilated cardiomyopathy increases the risk of heart failure and premature death. (nih.gov)
  • Cardiomyopathy, or heart muscle disease, is a major cause of heart failure. (intermountainhealthcare.org)
  • Our team has special expertise in treating women with peripartum cardiomyopathy - a rare form of heart failure that occurs in the late stages of pregnancy, during delivery, or shortly afterwards. (intermountainhealthcare.org)
  • Infants who were IVS6-1 +∕+ -positive died between 4 and 6 months of age due to cardiomyopathy and heart failure. (frontiersin.org)
  • G variant has been reported in Old Order Amish children with severe hypertrophic cardiomyopathy. (ddccliniclab.org)