Carbon nitrogen lyases. Medical search

A nonmetallic element with atomic symbol C, atomic number 6, and atomic weight [12.0096; 12.0116]. It may occur as several different allotropes including DIAMOND; CHARCOAL; and GRAPHITE; and as SOOT from incompletely burned fuel.

An element with the atomic symbol N, atomic number 7, and atomic weight [14.00643; 14.00728]. Nitrogen exists as a diatomic gas and makes up about 78% of the earth's atmosphere by volume. It is a constituent of proteins and nucleic acids and found in all living cells.

A class of enzymes that catalyze the cleavage of C-C, C-O, and C-N, and other bonds by other means than by hydrolysis or oxidation. (Enzyme Nomenclature, 1992) EC 4.

Enzymes which catalyze the elimination of delta-4,5-D-glucuronate residues from polysaccharides containing 1,4-beta-hexosaminyl and 1,3-beta-D-glucuronosyl or 1,3-alpha-L-iduronosyl linkages thereby bringing about depolymerization. EC 4.2.2.4 acts on chondroitin sulfate A and C as well as on dermatan sulfate and slowly on hyaluronate. EC 4.2.2.5 acts on chondroitin sulfate A and C.

The process in certain BACTERIA; FUNGI; and CYANOBACTERIA converting free atmospheric NITROGEN to biologically usable forms of nitrogen, such as AMMONIA; NITRATES; and amino compounds.

A colorless, odorless gas that can be formed by the body and is necessary for the respiration cycle of plants and animals.

Carbon monoxide (CO). A poisonous colorless, odorless, tasteless gas. It combines with hemoglobin to form carboxyhemoglobin, which has no oxygen carrying capacity. The resultant oxygen deprivation causes headache, dizziness, decreased pulse and respiratory rates, unconsciousness, and death. (From Merck Index, 11th ed)

Nanometer-sized tubes composed mainly of CARBON. Such nanotubes are used as probes for high-resolution structural and chemical imaging of biomolecules with ATOMIC FORCE MICROSCOPY.

A species of gram-negative, facultatively anaerobic, rod-shaped bacteria that causes vascular wilts on a wide range of plant species. It was formerly named Erwinia chrysanthemi.

Stable nitrogen atoms that have the same atomic number as the element nitrogen, but differ in atomic weight. N-15 is a stable nitrogen isotope.

Enzymes which catalyze the elimination of glucuronate residues from chondroitin A,B, and C or which catalyze the hydrolysis of sulfate groups of the 2-acetamido-2-deoxy-D-galactose 6-sulfate units of chondroitin sulfate. EC 4.2.2.-.

Inorganic compounds that contain nitrogen as an integral part of the molecule.

High molecular weight polysaccharides present in the cell walls of all plants. Pectins cement cell walls together. They are used as emulsifiers and stabilizers in the food industry. They have been tried for a variety of therapeutic uses including as antidiarrheals, where they are now generally considered ineffective, and in the treatment of hypercholesterolemia.

The circulation of nitrogen in nature, consisting of a cycle of biochemical reactions in which atmospheric nitrogen is compounded, dissolved in rain, and deposited in the soil, where it is assimilated and metabolized by bacteria and plants, eventually returning to the atmosphere by bacterial decomposition of organic matter.

Nitrogen oxide (NO2). A highly poisonous gas. Exposure produces inflammation of lungs that may only cause slight pain or pass unnoticed, but resulting edema several days later may cause death. (From Merck, 11th ed) It is a major atmospheric pollutant that is able to absorb UV light that does not reach the earth's surface.

The urea concentration of the blood stated in terms of nitrogen content. Serum (plasma) urea nitrogen is approximately 12% higher than blood urea nitrogen concentration because of the greater protein content of red blood cells. Increases in blood or serum urea nitrogen are referred to as azotemia and may have prerenal, renal, or postrenal causes. (From Saunders Dictionary & Encyclopedia of Laboratory Medicine and Technology, 1984)

Light harvesting proteins found in phycobilisomes.

A thick-rooted perennial (Cichorium intybus) native to Europe but widely grown for its young leaves used as salad greens and for its roots, dried and ground-roasted, used to flavor or adulterate coffee. (From Webster, 3d ed)

Toxic asphyxiation due to the displacement of oxygen from oxyhemoglobin by carbon monoxide.

Stable carbon atoms that have the same atomic number as the element carbon, but differ in atomic weight. C-13 is a stable carbon isotope.

Nitrogenous products of NITRIC OXIDE synthases, ranging from NITRIC OXIDE to NITRATES. These reactive nitrogen intermediates also include the inorganic PEROXYNITROUS ACID and the organic S-NITROSOTHIOLS.

Enzymes that catalyze a reverse aldol condensation. A molecule containing a hydroxyl group and a carbonyl group is cleaved at a C-C bond to produce two smaller molecules (ALDEHYDES or KETONES). EC 4.1.2.

Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.

Enzymes that catalyze the cleavage of a carbon-oxygen bond by means other than hydrolysis or oxidation. EC 4.2.

Inorganic oxides that contain nitrogen.

A genus of gram-negative, facultatively anaerobic, rod-shaped bacteria whose organisms are associated with plants as pathogens, saprophytes, or as constituents of the epiphytic flora.

Enzymes that catalyze the cleavage of a carbon-carbon bond of a 3-hydroxy acid. (Dorland, 28th ed) EC 4.1.3.

An enzyme of the isomerase class that catalyzes the eliminative cleavage of polysaccharides containing 1,4-linked D-glucuronate or L-iduronate residues and 1,4-alpha-linked 2-sulfoamino-2-deoxy-6-sulfo-D-glucose residues to give oligosaccharides with terminal 4-deoxy-alpha-D-gluc-4-enuronosyl groups at their non-reducing ends. (From Enzyme Nomenclature, 1992) EC 4.2.2.7.

A family of signal transducing adaptor proteins that control the METABOLISM of NITROGEN. They are primarily found in prokaryotes.

A solvent for oils, fats, lacquers, varnishes, rubber waxes, and resins, and a starting material in the manufacturing of organic compounds. Poisoning by inhalation, ingestion or skin absorption is possible and may be fatal. (Merck Index, 11th ed)

Any of several processes for the permanent or long-term artificial or natural capture or removal and storage of carbon dioxide and other forms of carbon, through biological, chemical or physical processes, in a manner that prevents it from being released into the atmosphere.

A cell wall-degrading enzyme found in microorganisms and higher plants. It catalyzes the random hydrolysis of 1,4-alpha-D-galactosiduronic linkages in pectate and other galacturonans. EC 3.2.1.15.

A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.

Proteins found in any species of bacterium.

The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.

Inorganic or organic salts and esters of nitric acid. These compounds contain the NO3- radical.

A colorless alkaline gas. It is formed in the body during decomposition of organic materials during a large number of metabolically important reactions. Note that the aqueous form of ammonia is referred to as AMMONIUM HYDROXIDE.

Salts of alginic acid that are extracted from marine kelp and used to make dental impressions and as absorbent material for surgical dressings.

A colorless, flammable, poisonous liquid, CS2. It is used as a solvent, and is a counterirritant and has local anesthetic properties but is not used as such. It is highly toxic with pronounced CNS, hematologic, and dermatologic effects.

Total mass of all the organisms of a given type and/or in a given area. (From Concise Dictionary of Biology, 1990) It includes the yield of vegetative mass produced from any given crop.

Plants of the division Rhodophyta, commonly known as red algae, in which the red pigment (PHYCOERYTHRIN) predominates. However, if this pigment is destroyed, the algae can appear purple, brown, green, or yellow. Two important substances found in the cell walls of red algae are AGAR and CARRAGEENAN. Some rhodophyta are notable SEAWEED (macroalgae).

Substances or mixtures that are added to the soil to supply nutrients or to make available nutrients already present in the soil, in order to increase plant growth and productivity.

The unconsolidated mineral or organic matter on the surface of the earth that serves as a natural medium for the growth of land plants.

A genus of gram-negative, aerobic, rod-shaped bacteria characterized by an outer membrane that contains glycosphingolipids but lacks lipopolysaccharide. They have the ability to degrade a broad range of substituted aromatic compounds.

Term used to designate tetrahydroxy aldehydic acids obtained by oxidation of hexose sugars, i.e. glucuronic acid, galacturonic acid, etc. Historically, the name hexuronic acid was originally given to ascorbic acid.

The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)

A key enzyme in the glyoxylate cycle. It catalyzes the conversion of isocitrate to succinate and glyoxylate. EC 4.1.3.1.

The rate dynamics in chemical or physical systems.

Open chain tetrapyrroles that function as light harvesting chromophores in PHYCOBILIPROTEINS.

An enzyme that catalyzes the eliminative degradation of polysaccharides containing 1,4-beta-D-hexosaminyl and 1,3-beta-D-glucuronosyl or 1,3-alpha-L-iduronosyl linkages to disaccharides containing 4-deoxy-beta-D-gluc-4-enuronosyl groups. (Enzyme Nomenclature, 1992)

Derivatives of ammonium compounds, NH4+ Y-, in which all four of the hydrogens bonded to nitrogen have been replaced with hydrocarbyl groups. These are distinguished from IMINES which are RN=CR2.

Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.

The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.

A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in nature. Some species are pathogenic for humans, animals, and plants.

The 30-kDa membrane-bound c-type cytochrome protein of mitochondria that functions as an electron donor to CYTOCHROME C GROUP in the mitochondrial and bacterial RESPIRATORY CHAIN. (From Enzyme Nomenclature, 1992, p545)

A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.

The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.

An enzyme that catalyzes the conversion of ATP, L-glutamate, and NH3 to ADP, orthophosphate, and L-glutamine. It also acts more slowly on 4-methylene-L-glutamate. (From Enzyme Nomenclature, 1992) EC 6.3.1.2.

The functional hereditary units of BACTERIA.

A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in SOIL and WATER. Its organisms are also found in raw meats, MILK and other FOOD, hospital environments, and human clinical specimens. Some species are pathogenic in humans.

A genus of gram-negative, anaerobic, rod-shaped bacteria. Its organisms are normal inhabitants of the oral, respiratory, intestinal, and urogenital cavities of humans, animals, and insects. Some species may be pathogenic.

Any liquid or solid preparation made specifically for the growth, storage, or transport of microorganisms or other types of cells. The variety of media that exist allow for the culturing of specific microorganisms and cell types, such as differential media, selective media, test media, and defined media. Solid media consist of liquid media that have been solidified with an agent such as AGAR or GELATIN.

Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.

The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.

A sugar acid formed by the oxidation of the C-6 carbon of GLUCOSE. In addition to being a key intermediate metabolite of the uronic acid pathway, glucuronic acid also plays a role in the detoxification of certain drugs and toxins by conjugating with them to form GLUCURONIDES.

A compound formed in the liver from ammonia produced by the deamination of amino acids. It is the principal end product of protein catabolism and constitutes about one half of the total urinary solids.

The relationship between two different species of organisms that are interdependent; each gains benefits from the other or a relationship between different species where both of the organisms in question benefit from the presence of the other.

The gaseous envelope surrounding a planet or similar body. (From Random House Unabridged Dictionary, 2d ed)

The synthesis by organisms of organic chemical compounds, especially carbohydrates, from carbon dioxide using energy obtained from light rather than from the oxidation of chemical compounds. Photosynthesis comprises two separate processes: the light reactions and the dark reactions. In higher plants; GREEN ALGAE; and CYANOBACTERIA; NADPH and ATP formed by the light reactions drive the dark reactions which result in the fixation of carbon dioxide. (from Oxford Dictionary of Biochemistry and Molecular Biology, 2001)

An enzyme that, in the course of purine ribonucleotide biosynthesis, catalyzes the conversion of 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole to 5'-phosphoribosyl-4-carboxamide-5-aminoimidazole and the conversion of adenylosuccinic acid to AMP. EC 4.3.2.2.

A species of gram-positive bacteria in the STREPTOCOCCUS MILLERI GROUP. It is the most frequently seen isolate of that group, has a proclivity for abscess formation, and is most often isolated from the blood, gastrointestinal, and urogenital tract.

The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.

A plant genus of the family EUPHORBIACEAE, order Euphorbiales, subclass Rosidae. Commercial natural RUBBER is mainly obtained from Hevea brasiliensis but also from some other plants.

Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.

Expanded structures, usually green, of vascular plants, characteristically consisting of a bladelike expansion attached to a stem, and functioning as the principal organ of photosynthesis and transpiration. (American Heritage Dictionary, 2d ed)

Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.

Deoxyribonucleic acid that makes up the genetic material of bacteria.

An enzyme system that catalyzes the fixing of nitrogen in soil bacteria and blue-green algae (CYANOBACTERIA). EC 1.18.6.1.

A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.

The relationships of groups of organisms as reflected by their genetic makeup.

A group of alkylating agents derived from mustard gas, with the sulfur replaced by nitrogen. They were formerly used as toxicants and vesicants, but now function as antineoplastic agents. These compounds are also powerful mutagens, teratogens, immunosuppressants, and carcinogens.

A kingdom of eukaryotic, heterotrophic organisms that live parasitically as saprobes, including MUSHROOMS; YEASTS; smuts, molds, etc. They reproduce either sexually or asexually, and have life cycles that range from simple to complex. Filamentous fungi, commonly known as molds, refer to those that grow as multicellular colonies.

A functional system which includes the organisms of a natural community together with their environment. (McGraw Hill Dictionary of Scientific and Technical Terms, 4th ed)

A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).

A measure of the total greenhouse gas emissions produced by an individual, organization, event, or product. It is measured in units of equivalent kilograms of CARBON DIOXIDE generated in a given time frame.

The usually underground portions of a plant that serve as support, store food, and through which water and mineral nutrients enter the plant. (From American Heritage Dictionary, 1982; Concise Dictionary of Biology, 1990)

Unstable isotopes of carbon that decay or disintegrate emitting radiation. C atoms with atomic weights 10, 11, and 14-16 are radioactive carbon isotopes.

The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.

Elimination of ENVIRONMENTAL POLLUTANTS; PESTICIDES and other waste using living organisms, usually involving intervention of environmental or sanitation engineers.

Woody, usually tall, perennial higher plants (Angiosperms, Gymnosperms, and some Pterophyta) having usually a main stem and numerous branches.

Acids derived from monosaccharides by the oxidation of the terminal (-CH2OH) group farthest removed from the carbonyl group to a (-COOH) group. (From Stedmans, 26th ed)

Heteropolysaccharides which contain an N-acetylated hexosamine in a characteristic repeating disaccharide unit. The repeating structure of each disaccharide involves alternate 1,4- and 1,3-linkages consisting of either N-acetylglucosamine or N-acetylgalactosamine.

A species of gram-negative, facultatively anaerobic, rod-shaped bacteria that occurs in soil, fecal matter, and sewage. It is an opportunistic pathogen and causes cystitis and pyelonephritis.

Oligosaccharides containing two monosaccharide units linked by a glycosidic bond.

Enzymes that catalyze the cleavage of a carbon-nitrogen bond by means other than hydrolysis or oxidation. Subclasses are the AMMONIA-LYASES, the AMIDINE-LYASES, the amine-lyases, and other carbon-nitrogen lyases. EC 4.3.

Enzymes that catalyze the cleavage of a carbon-carbon bond by means other than hydrolysis or oxidation. This subclass contains the DECARBOXYLASES, the ALDEHYDE-LYASES, and the OXO-ACID-LYASES. EC 4.1.

A non-essential amino acid present abundantly throughout the body and is involved in many metabolic processes. It is synthesized from GLUTAMIC ACID and AMMONIA. It is the principal carrier of NITROGEN in the body and is an important energy source for many cells.

Sulfur compounds in which the sulfur atom is attached to three organic radicals and an electronegative element or radical.

The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)

An element with atomic symbol O, atomic number 8, and atomic weight [15.99903; 15.99977]. It is the most abundant element on earth and essential for respiration.

Derivatives of chondroitin which have a sulfate moiety esterified to the galactosamine moiety of chondroitin. Chondroitin sulfate A, or chondroitin 4-sulfate, and chondroitin sulfate C, or chondroitin 6-sulfate, have the sulfate esterified in the 4- and 6-positions, respectively. Chondroitin sulfate B (beta heparin; DERMATAN SULFATE) is a misnomer and this compound is not a true chondroitin sulfate.

The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.

The sequence of carbohydrates within POLYSACCHARIDES; GLYCOPROTEINS; and GLYCOLIPIDS.

The presence of bacteria, viruses, and fungi in the soil. This term is not restricted to pathogenic organisms.

Cellular processes in biosynthesis (anabolism) and degradation (catabolism) of CARBOHYDRATES.

One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.

Anaerobic degradation of GLUCOSE or other organic nutrients to gain energy in the form of ATP. End products vary depending on organisms, substrates, and enzymatic pathways. Common fermentation products include ETHANOL and LACTIC ACID.

Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.

A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.

A naturally occurring glycosaminoglycan found mostly in the skin and in connective tissue. It differs from CHONDROITIN SULFATE A (see CHONDROITIN SULFATES) by containing IDURONIC ACID in place of glucuronic acid, its epimer, at carbon atom 5. (from Merck, 12th ed)

A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement.

A novel jasmonate- and elicitor-responsive element in the periwinkle secondary metabolite biosynthetic gene Str interacts with a jasmonate- and elicitor-inducible AP2-domain transcription factor, ORCA2. (1/87)

Jasmonate (JA) is an important plant stress hormone that induces various plant defense responses, including the biosynthesis of protective secondary metabolites. The induction of the secondary metabolite biosynthetic gene Strictosidine synthase (Str) in Catharanthus roseus (periwinkle) cells by elicitor requires JA as a second messenger. A 42 bp region in the Str promoter is both necessary and sufficient for JA- and elicitor-responsive expression. This region is unlike other previously identified JA-responsive regions, and contains a GCC-box-like element. Yeast one-hybrid screening identified cDNAs encoding two AP2-domain proteins. These octadecanoid-derivative responsive Catharanthus AP2-domain (ORCA) proteins bind in a sequence-specific manner the JA- and elicitor-responsive element. ORCA2 trans-activates the Str promoter and its expression is rapidly inducible with JA and elicitor, whereas Orca1 is expressed constitutively. The results indicate that a GCC-box-like element and ORCA2 play key roles in JA- and elicitor-responsive expression of the terpenoid indole alkaloid biosynthetic gene Str. (+info)

Destabilase from the medicinal leech is a representative of a novel family of lysozymes. (2/87)

Intrinsic lysozyme-like activity was demonstrated for destabilase from the medicinal leech supported by (1) high specific lysozyme activity of the highly purified destabilase, (2) specific inhibition of the lysozyme-like activity by anti-destabilase antibodies, and (3) appreciable lysozyme-like activity in insect cells infected with recombinant baculoviruses carrying cDNAs encoding different isoforms of destabilase. Several isoforms of destabilase constitute a protein family at least two members of which are characterized by lysozyme activity. The corresponding gene family implies an ancient evolutionary history of the genes although the function(s) of various lysozymes in the leech remains unclear. Differences in primary structures of the destabilase family members and members of known lysozyme families allow one to assign the former to a new family of lysozymes. New proteins homologous to destabilase were recently described for Caenorhabditis elegans and bivalve mollusks suggesting that the new lysozyme family can be widely distributed among invertebrates. It remains to be investigated whether the two enzymatic activities (isopeptidase and lysozyme-like) are attributes of one and the same protein. (+info)

Sequencing, tissue distribution and chromosomal assignment of a novel ubiquitin-specific protease USP23. (3/87)

We have identified human and mouse cDNAs encoding a novel ubiquitin-specific protease designated USP23. Both cDNAs encode a 62-kDa protein containing the highly conserved His and Cys domains characteristic of the C19 cysteine protease family of ubiquitin-specific processing proteases (UCH-2). Human tissue Northern blots revealed USP23 to be ubiquitously expressed, whereas USP12, its closest human paralogue, displayed a more restricted expression pattern. The human USP23 gene mapped to chromosome 1q22. (+info)

Identification of a novel isopeptidase with dual specificity for ubiquitin- and NEDD8-conjugated proteins. (4/87)

Covalent conjugation of proteins by ubiquitin or ubiquitin-like molecules is an important form of post-translational modification and plays a critical role in many cellular processes. Similar to the concept of phosphorylation and dephosphorylation, these conjugates are regulated by a large number of deconjugating enzymes. Here, we report the cloning of a 2,141-base pair DNA fragment from human placenta cDNA library by a strategy that involves expressed sequence tag data base searching, polymerase chain reaction, and rapid amplification of cDNA ends. Nucleotide sequence analysis revealed that the cloned cDNA contains an open reading frame of 1,143 base pairs encoding a novel protease, USP21, which is composed of 381 residues with a calculated molecular mass of 43 kDa. The human USP21 gene is located on chromosome 1q21 and encodes a member of the ubiquitin-specific protease family with highly conserved Cys and His domains. The activity and specificity of USP21 were determined by using a COS cell expression system in vivo. We showed that USP21 is capable of removing ubiquitin from ubiquitinated proteins as expected. Furthermore, USP21 is capable of removing NEDD8 from NEDD8 conjugates but has no effect on Sentrin-1 conjugates. As expected from its biochemical activity, overexpression of USP21 has a profound growth inhibitory effect on U2OS cells. Thus, USP21 is the first ubiquitin-specific protease shown to have dual specificity for both ubiquitin and NEDD8 and may play an important role in the regulation of cell growth. (+info)

Structure of cyanase reveals that a novel dimeric and decameric arrangement of subunits is required for formation of the enzyme active site. (5/87)

BACKGROUND: Cyanase is an enzyme found in bacteria and plants that catalyzes the reaction of cyanate with bicarbonate to produce ammonia and carbon dioxide. In Escherichia coli, cyanase is induced from the cyn operon in response to extracellular cyanate. The enzyme is functionally active as a homodecamer of 17 kDa subunits, and displays half-site binding of substrates or substrate analogs. The enzyme shows no significant amino acid sequence homology with other proteins. RESULTS: We have determined the crystal structure of cyanase at 1.65 A resolution using the multiwavelength anomalous diffraction (MAD) method. Cyanase crystals are triclinic and contain one homodecamer in the asymmetric unit. Selenomethionine-labeled protein offers 40 selenium atoms for use in phasing. Structures of cyanase with bound chloride or oxalate anions, inhibitors of the enzyme, allowed identification of the active site. CONCLUSIONS: The cyanase monomer is composed of two domains. The N-terminal domain shows structural similarity to the DNA-binding alpha-helix bundle motif. The C-terminal domain has an 'open fold' with no structural homology to other proteins. The subunits of cyanase are arranged in a novel manner both at the dimer and decamer level. The dimer structure reveals the C-terminal domains to be intertwined, and the decamer is formed by a pentamer of these dimers. The active site of the enzyme is located between dimers and is comprised of residues from four adjacent subunits of the homodecamer. The structural data allow a conceivable reaction mechanism to be proposed. (+info)

Microbial thiocyanate utilization under highly alkaline conditions. (6/87)

Three kinds of alkaliphilic bacteria able to utilize thiocyanate (CNS-) at pH 10 were found in highly alkaline soda lake sediments and soda soils. The first group included obligate heterotrophs that utilized thiocyanate as a nitrogen source while growing at pH 10 with acetate as carbon and energy sources. Most of the heterotrophic strains were able to oxidize sulfide and thiosulfate to tetrathionate. The second group included obligately autotrophic sulfur-oxidizing alkaliphiles which utilized thiocyanate nitrogen during growth with thiosulfate as the energy source. Genetic analysis demonstrated that both the heterotrophic and autotrophic alkaliphiles that utilized thiocyanate as a nitrogen source were related to the previously described sulfur-oxidizing alkaliphiles belonging to the gamma subdivision of the division Proteobacteria (the Halomonas group for the heterotrophs and the genus Thioalkalivibrio for autotrophs). The third group included obligately autotrophic sulfur-oxidizing alkaliphilic bacteria able to utilize thiocyanate as a sole source of energy. These bacteria could be enriched on mineral medium with thiocyanate at pH 10. Growth with thiocyanate was usually much slower than growth with thiosulfate, although the biomass yield on thiocyanate was higher. Of the four strains isolated, the three vibrio-shaped strains were genetically closely related to the previously described sulfur-oxidizing alkaliphiles belonging to the genus Thioalkalivibrio. The rod-shaped isolate differed from the other isolates by its ability to accumulate large amounts of elemental sulfur inside its cells and by its ability to oxidize carbon disulfide. Despite its low DNA homology with and substantial phenotypic differences from the vibrio-shaped strains, this isolate also belonged to the genus Thioalkalivibrio according to a phylogenetic analysis. The heterotrophic and autotrophic alkaliphiles that grew with thiocyanate as an N source possessed a relatively high level of cyanase activity which converted cyanate (CNO-) to ammonia and CO2. On the other hand, cyanase activity either was absent or was present at very low levels in the autotrophic strains grown on thiocyanate as the sole energy and N source. As a result, large amounts of cyanate were found to accumulate in the media during utilization of thiocyanate at pH 10 in batch and thiocyanate-limited continuous cultures. This is a first direct proof of a "cyanate pathway" in pure cultures of thiocyanate-degrading bacteria. Since it is relatively stable under alkaline conditions, cyanate is likely to play a role as an N buffer that keeps the alkaliphilic bacteria safe from inhibition by free ammonia, which otherwise would reach toxic levels during dissimilatory degradation of thiocyanate. (+info)

Control of ubiquitination of proteins in rat tissues by ubiquitin conjugating enzymes and isopeptidases. (7/87)

The activity of the ubiquitin-dependent proteolytic system in differentiated tissues under basal conditions remains poorly explored. We measured rates of ubiquitination in rat tissue extracts. Accumulation of ubiquitinated proteins increased in the presence of ubiquitin aldehyde, indicating that deubiquitinating enzymes can regulate ubiquitination. Rates of ubiquitination varied fourfold, with the highest rate in the testis. We tested whether ubiquitin-activating enzyme (E1) or ubiquitin-conjugating enzymes (E2s) could be limiting for conjugation. Immunodepletion of the E2s UBC2 or UBC4 lowered rates of conjugation similarly. Supplementation of extracts with excess UBC2 or UBC4, but not E1, stimulated conjugation. However, UBC2-stimulated rates of ubiquitination still differed among tissues, indicating that tissue differences in E3s or substrate availability may also be rate controlling. UBC2 and UBC4 stimulated conjugation half-maximally at concentrations of 10-50 and 28-44 nM, respectively. Endogenous tissue levels of UBC2, but not UBC4, appeared saturating for conjugation, suggesting that in vivo modulation of UBC4 levels can likely control ubiquitin conjugation. Thus the pool of ubiquitin conjugates and therefore the rate of degradation of proteins by this system may be controlled by E2s, E3s, and isopeptidases. The regulation of the ubiquitin pathway appears complex, but precise. (+info)

Muscle-specific RING finger-1 interacts with titin to regulate sarcomeric M-line and thick filament structure and may have nuclear functions via its interaction with glucocorticoid modulatory element binding protein-1. (8/87)

The COOH-terminal A168-170 region of the giant sarcomeric protein titin interacts with muscle-specific RING finger-1 (MURF-1). To investigate the functional significance of this interaction, we expressed green fluorescent protein fusion constructs encoding defined fragments of titin's M-line region and MURF-1 in cardiac myocytes. Upon expression of MURF-1 or its central region (containing its titin-binding site), the integrity of titin's M-line region was dramatically disrupted. Disruption of titin's M-line region also resulted in a perturbation of thick filament components, but, surprisingly, not of the NH2-terminal or I-band regions of titin, the Z-lines, or the thin filaments. This specific phenotype also was caused by the expression of titin A168-170. These data suggest that the interaction of titin with MURF-1 is important for the stability of the sarcomeric M-line region.MURF-1 also binds to ubiquitin-conjugating enzyme-9 and isopeptidase T-3, enzymes involved in small ubiquitin-related modifier-mediated nuclear import, and with glucocorticoid modulatory element binding protein-1 (GMEB-1), a transcriptional regulator. Consistent with our in vitro binding data implicating MURF-1 with nuclear functions, endogenous MURF-1 also was detected in the nuclei of some myocytes. The dual interactions of MURF-1 with titin and GMEB-1 may link myofibril signaling pathways (perhaps including titin's kinase domain) with muscle gene expression. (+info)

This enzyme belongs to the family of lyases, specifically the class of carbon-sulfur lyases. The systematic name of this enzyme ... L-homocysteine hydrogen-sulfide-lyase, and (deaminating). This enzyme participates in nitrogen metabolism and sulfur metabolism ... class is L-homocysteine hydrogen-sulfide-lyase (deaminating 2-oxobutanoate-forming). Other names in common use include ...

https://en.wikipedia.org/wiki/Homocysteine_desulfhydrase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... and L-ornithine ammonia-lyase (cyclizing). This enzyme participates in arginine and proline biosynthesis. It employs one ... name of this enzyme class is L-ornithine ammonia-lyase (cyclizing; L-proline-forming). Other names in common use include ...

https://en.wikipedia.org/wiki/Ornithine_cyclodeaminase

This enzyme belongs to the family of lyases, specifically amine lyases, which cleave carbon-nitrogen bonds. It can be isolated ... strictosidine tryptamine-lyase. Originally isolated from the plant Rauvolfia serpentina, a medicinal plant widely used in ... strictosidine tryptamine-lyase (secologanin-forming). Other names in common use include strictosidine synthetase, STR, and 3- ... from which Glu309 deprotonates tryptamine's carbon 2. This allows for strictosidine's formation under the subsequent ring ...

https://en.wikipedia.org/wiki/Strictosidine_synthase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... and 5-formimidoyltetrahydrofolate ammonia-lyase (cyclizing). This enzyme participates in folate metabolism by catabolising ... name of this enzyme class is 5-formimidoyltetrahydrofolate ammonia-lyase (cyclizing 5,10-methenyltetrahydrofolate-forming). ...

https://en.wikipedia.org/wiki/Formimidoyltetrahydrofolate_cyclodeaminase

This enzyme belongs to the family of lyases, specifically amine lyases, which cleave carbon-nitrogen bonds. The systematic name ... This enzyme is also called deacetylipecoside dopamine-lyase. This enzyme participates in indole and ipecac alkaloid ... of this enzyme class is deacetylipecoside dopamine-lyase (secologanin-forming). ...

https://en.wikipedia.org/wiki/Deacetylipecoside_synthase

This bacterium is capable of using either heparin or HS as its sole carbon and nitrogen source. To do so, it produces a range ... The lyases have mainly been used in heparin/HS studies. The bacterium produces three lyases, heparinases I (EC 4.2.2.7), II (no ... The lyases cleave heparin/HS by a beta elimination mechanism. This action generates an unsaturated double bond between C4 and ... 1990). "Examination of the substrate specificity of heparin and heparan sulfate lyases". Biochemistry. 29 (10): 2611-2617. doi: ...

https://en.wikipedia.org/wiki/Heparin

This enzyme belongs to the family of lyases, specifically the amine-lyases, which cleave carbon-nitrogen bonds. 4-hydroxy- ... The fold resembles that of N-acetylneuraminate lyase. The active site lysine is located in the barrel domain, and has access ... These are Escherichia coli N-acetylneuraminate lyase (EC 4.1.3.3) (protein NanA), which catalyses the condensation of N-acetyl- ... L-aspartate-4-semialdehyde hydro-lyase (adding pyruvate and cyclizing), dapA (gene)) is an enzyme with the systematic name L- ...

https://en.wikipedia.org/wiki/Dihydrodipicolinate_synthase

"A Carbon-Nitrogen Lyase from Leucaena leucocephala Catalyzes the First Step of Mimosine Degradation". Plant Physiology. 164 (2 ... strain TAL1145 is a C-N lyase that catabolizes L-mimosine into 3-hydroxy-4-pyridone, pyruvate, and ammonia". Amino Acids. 44 (6 ...

https://en.wikipedia.org/wiki/Mimosine

This enzyme belongs to the family of lyases, specifically in the "catch-all" class of carbon-carbon lyases. The systematic name ... and L-tryptophan indole-lyase (deaminating). This enzyme participates in tryptophan metabolism and nitrogen metabolism. It has ... of this enzyme class is L-tryptophan indole-lyase (deaminating; pyruvate-forming). Other names in common use include L- ...

https://en.wikipedia.org/wiki/Tryptophanase

This enzyme belongs to the family of hydrolases, those acting on carbon-nitrogen bonds other than peptide bonds, specifically ... This enzyme is also called allophanate lyase. This enzyme participates in urea cycle and metabolism of amino groups and ...

https://en.wikipedia.org/wiki/Allophanate_hydrolase

These fungi participate in the catabolism of phenylalanine for carbon and nitrogen. PAL in some plants and fungi also has a ... Phenylalanine ammonia lyase (PAL) is known to be present in fungi, such as Basidiomycota yeast like Rhodotorula and Ascomycota ... tyrosine ammonia lyase (TAL) for the synthesis of p-coumaric acid into p-coumaroyl-CoA. PAL likely emerged from bacteria in an ...

https://en.wikipedia.org/wiki/Plant–fungus_horizontal_gene_transfer

... s are designated as α- when the nitrogen atom is attached to the carbon atom adjacent to the carboxyl group: in this ... Aspartic acid is produced by the addition of ammonia to fumarate using a lyase. In plants, nitrogen is first assimilated into ... The key elements of an amino acid are carbon (C), hydrogen (H), oxygen (O), and nitrogen (N), although other elements are found ... Martin PD, Malley DF, Manning G, Fuller L (2002). "Determination of soil organic carbon and nitrogen at thefield level using ...

https://en.wikipedia.org/wiki/Amino_acid

"Novel aldoxime dehydratase involved in carbon-nitrogen triple bond synthesis of Pseudomonas chlororaphis B23. Sequencing, gene ... This enzyme belongs to the family of lyases, specifically the "catch-all" class of lyases that do not fit into any other sub- ... The systematic name of this enzyme class is aliphatic aldoxime hydro-lyase (aliphatic-nitrile-forming). Other names in common ... use include OxdA, and aliphatic aldoxime hydro-lyase. D-amino acid oxidase, sometimes also referred to as OXDA Kobayashi M; ...

https://en.wikipedia.org/wiki/Aliphatic_aldoxime_dehydratase

The aromatic ring is bound to phenylalanine, and the nitrogen on the ring is hydrogen bonded to hydroxyl group-containing ... After deprotonation of the amino acid alpha carbon and subsequent dehydration (hence the common name threonine dehydratase), a ... Threonine ammonia-lyase is a tetramer of identical subunits, and is arranged as a dimer of dimers. Each subunit has two domains ... Threonine ammonia-lyase is a member of the Fold Type II family, also known as the tryptophan synthase family. Though threonine ...

https://en.wikipedia.org/wiki/Threonine_ammonia-lyase

Finally, a second one-carbon unit from formyl-THF is added to the nitrogen group and the ring is covalently closed to form the ... This step is catalyzed by adenylosuccinate lyase. Inosine monophosphate is converted to guanosine monophosphate by the ... A carboxylation of the second carbon of the glycin unit is concomitantly added. This new carbon is modified by the addition of ... A one-carbon unit from folic acid coenzyme N10-formyl-THF is then added to the amino group of the substituted glycine followed ...

https://en.wikipedia.org/wiki/Nucleotide

... cleave carbon-nitrogen bonds EC 4.4 includes lyases that cleave carbon-sulfur bonds EC 4.5 includes lyases that cleave carbon- ... Lyases can be further classified into seven subclasses: EC 4.1 includes lyases that cleave carbon-carbon bonds, such as ... oxo acid lyases (EC 4.1.3), and others (EC 4.1.99) EC 4.2 includes lyases that cleave carbon-oxygen bonds, such as dehydratases ... this reaction was first classified as a lyase (EC 4.2.99.9), but was then reclassified as a transferase (EC 2.5.1.48). Lyases ...

https://en.wikipedia.org/wiki/Lyase

The beta carbon is then deprotonated, creating an alpha-beta unsaturation and pushing a lone pair onto the aldimine nitrogen. ... The basic lysine residue is then able to deprotonate the alpha carbon, pushing electron density into the nitrogen of the ... The lone pair from the pyridine nitrogen pushes electron density to the gamma carbon, which is protonated by lysine. Lysine ... Other members include cystathionine gamma synthase, cystathionine beta lyase, and methionine gamma lyase. It is also a member ...

https://en.wikipedia.org/wiki/Cystathionine_gamma-lyase

For both ASL-catalyzed reactions deprotonation of the carbon β to the leaving nitrogen occurs first, then the formation and ... Adenylosuccinate lyase (or adenylosuccinase) is an enzyme that in humans is encoded by the ADSL gene. Adenylosuccinate lyase ... Mutated adenylosuccinate lyase (ASL) causes clinical disease in patients that is referred to as adenylosuccinate lyase ... with respect to the leaving nitrogen) was abstracted by the catalytic base at the same time that the leaving nitrogen was ...

https://en.wikipedia.org/wiki/Adenylosuccinate_lyase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... ammonia-lyase, and 3,4-dihydroxy-L-phenylalanine ammonia-lyase. This enzyme participates in tyrosine metabolism. Magee WL, ... In enzymology, a dihydroxyphenylalanine ammonia-lyase (EC 4.3.1.11, entry deleted) is a non-existing enzyme that catalyzes the ... name of this enzyme class is 3,4-dihydroxy-L-phenylalanine ammonia-lyase (trans-caffeate-forming). Other names in common use ...

https://en.wikipedia.org/wiki/Dihydroxyphenylalanine_ammonia-lyase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... In enzymology, an ethanolamine ammonia-lyase (EC 4.3.1.7) is an enzyme that catalyzes the chemical reaction ethanolamine ⇌ {\ ... name of this enzyme class is ethanolamine ammonia-lyase (acetaldehyde-forming). This enzyme is also called ethanolamine ...

https://en.wikipedia.org/wiki/Ethanolamine_ammonia-lyase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... and L-threo-3-methylaspartate ammonia-lyase. This enzyme participates in c5-branched dibasic acid metabolism and nitrogen ... In enzymology, a methylaspartate ammonia-lyase (EC 4.3.1.2) is an enzyme that catalyzes the chemical reaction L-threo-3- ... "Insights into Enzyme Evolution Revealed by the Structure of Methylaspartate Ammonia Lyase". Structure. 10 (1): 105-13. doi: ...

https://en.wikipedia.org/wiki/Methylaspartate_ammonia-lyase

This enzyme belongs to the family of lyases, specifically in the "catch-all" class of carbon-carbon lyases. The systematic name ... and L-tyrosine phenol-lyase (deaminating). This enzyme participates in tyrosine metabolism and nitrogen metabolism. It employs ... In enzymology, a tyrosine phenol-lyase (EC 4.1.99.2) is an enzyme that catalyzes the chemical reaction L-tyrosine + H2O ⇌ {\ ... Kumagai H, Yamada H, Matsui H, Ohkishi H, Ogata K (1970). "Tyrosine phenol lyase. II. Cofactor requirements". J. Biol. Chem. ...

https://en.wikipedia.org/wiki/Tyrosine_phenol-lyase

The enzyme is a member of the ammonia lyase family, which cleaves carbon-nitrogen bonds. Like other lyases, PAL requires only ... L-tyrosine ammonia-lyase, phenylalanine ammonium-lyase, PAL, and L-phenylalanine ammonia-lyase. Phenylalanine ammonia lyase is ... phenylalanine ammonia-lyases), EC 4.3.1.25 (tyrosine ammonia-lyases), and EC 4.3.1.26 (phenylalanine/tyrosine ammonia-lyases). ... generating carbon and nitrogen. In plants it is a key biosynthetic enzyme that catalyzes the first step in the synthesis of a ...

https://en.wikipedia.org/wiki/Phenylalanine_ammonia-lyase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... aminodeoxygluconate ammonia-lyase, 2-amino-2-deoxy-D-gluconate ammonia-lyase, and D-glucosaminate ammonia-lyase. This enzyme ... In enzymology, a glucosaminate ammonia-lyase (EC 4.3.1.9) is an enzyme that catalyzes the chemical reaction D-glucosaminate ... name of this enzyme class is D-glucosaminate ammonia-lyase (isomerizing 2-dehydro-3-deoxy-D-gluconate-forming). Other names in ...

https://en.wikipedia.org/wiki/Glucosaminate_ammonia-lyase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... and L-aspartate ammonia-lyase. This enzyme participates in alanine and aspartate metabolism and nitrogen metabolism. As of late ... In enzymology, an aspartate ammonia-lyase (EC 4.3.1.1) is an enzyme that catalyzes the chemical reaction L-aspartate ⇌ {\ ... name of this enzyme class is L-aspartate ammonia-lyase (fumarate-forming). Other names in common use include aspartase, fumaric ...

https://en.wikipedia.org/wiki/Aspartate_ammonia-lyase

The enzyme also belongs to the family of lyases, specifically the class of carbon-sulfur lyases. The systematic name of this ... nitrogen metabolism, and sulfur metabolism. Cystathionine beta-lyase is a tetramer composed of identical subunits, and is ... Other members include cystathionine gamma-synthase, cystathionine gamma-lyase, and methionine gamma lyase. Additionally, these ... Cystathionine beta-lyase (EC 4.4.1.8), also commonly referred to as CBL or β-cystathionase, is an enzyme that primarily ...

https://en.wikipedia.org/wiki/Cystathionine_beta-lyase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... beta-diaminopropionate ammonia-lyase, 2,3-diaminopropionate ammonia-lyase, and 2,3-diaminopropanoate ammonia-lyase. It employs ... In enzymology, a diaminopropionate ammonia-lyase (EC 4.3.1.15) is an enzyme that catalyzes the chemical reaction 2,3- ... Nagasawa T, Tanizawa K, Satoda T, Yamada H (1988). "Diaminopropionate ammonia-lyase from Salmonella typhimurium Purification ...

https://en.wikipedia.org/wiki/Diaminopropionate_ammonia-lyase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... In enzymology, a serine-sulfate ammonia-lyase (EC 4.3.1.10) is an enzyme that catalyzes the chemical reaction L-serine O- ... name of this enzyme class is L-serine-O-sulfate ammonia-lyase (pyruvate-forming). This enzyme is also called (L-SOS)lyase. ...

https://en.wikipedia.org/wiki/Serine-sulfate_ammonia-lyase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... In enzymology, a L-serine ammonia-lyase (EC 4.3.1.17) is an enzyme that catalyzes the chemical reaction L-serine ⇌ {\ ... and L-serine hydro-lyase (deaminating). This enzyme participates in glycine, serine and threonine metabolism and cysteine ... name of this enzyme class is L-serine ammonia-lyase (pyruvate-forming). Other names in common use include serine deaminase, L- ...

https://en.wikipedia.org/wiki/L-serine_ammonia-lyase

This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... In enzymology, a carbamoyl-serine ammonia-lyase (EC 4.3.1.13) is an enzyme that catalyzes the chemical reaction O-carbamoyl-L- ... and O-carbamoyl-L-serine ammonia-lyase (pyruvate-forming). It employs one cofactor, pyridoxal phosphate. Copper AJ, Meister A ( ... name of this enzyme class is O-carbamoyl-L-serine ammonia-lyase (decarboxylating pyruvate-forming). Other names in common use ...

https://en.wikipedia.org/wiki/Carbamoyl-serine_ammonia-lyase

6.3: Carbon-Nitrogen. *Glutamine synthetase. *Ubiquitin ligase *Cullin. *Von Hippel-Lindau tumor suppressor ...

https://en.wikipedia.org/wiki/Aminoacyl_tRNA_synthetase

This enzyme belongs to the family of hydrolases, those acting on carbon-nitrogen bonds other than peptide bonds, specifically ...

https://en.wikipedia.org/wiki/GTP_cyclohydrolase_II

This enzyme belongs to the family of hydrolases, those acting on carbon-nitrogen bonds other than peptide bonds, specifically ... EC4 Lyases (list). *EC5 Isomerases (list). *EC6 Ligases (list). *EC7 Translocases (list) ...

https://en.wikipedia.org/wiki/Succinyl-diaminopimelate_desuccinylase

... , though, binds better than N-methylephedrine, which has an additional methyl group at the nitrogen atom. Also the ... Benzaldehyde reacts with pyruvic acid to attach a 2 carbon unit. This product then undergoes transamination and methylation to ... A new pathway proposed suggests that phenylalanine first forms cinnamoyl-CoA via the enzymes phenylalanine ammonia-lyase and ...

https://en.m.wikipedia.org/wiki/Ephedrine

However, Takaki had added many foods to the successful diet and he incorrectly attributed the benefit to increased nitrogen ... where it accumulates as a result of carbon starvation.[47] In E. coli, AThTP may account for up to 20% of total thiamine. It ... 2-hydroxyphytanoyl-CoA lyase. *transketolase. *Present in some species: *pyruvate decarboxylase (in yeast) ... ThDP is a coenzyme for several enzymes that catalyze the transfer of two-carbon units and in particular the dehydrogenation ( ...

https://en.m.wikipedia.org/wiki/Thiamin

N-Acetyl-L-cysteine is a derivative of cysteine wherein an acetyl group is attached to the nitrogen atom. This compound is sold ... In the newer R/S system of designating chirality, based on the atomic numbers of atoms near the asymmetric carbon, cysteine ( ... The enzyme cystathionine gamma-lyase converts the cystathionine into cysteine and alpha-ketobutyrate. In plants and bacteria, ... The enzyme O-acetylserine (thiol)-lyase, using sulfide sources, converts this ester into cysteine, releasing acetate.[12] ...

https://en.wikipedia.org/wiki/E920

... carbon = white, oxygen = red, nitrogen = blue) based on the PDB: 1HS6 structure. ... EC4 Lyases (list). *EC5 Isomerases (list). *EC6 Ligases (list). *EC7 Translocases (list) ...

https://en.wikipedia.org/wiki/Leukotriene-A4_hydrolase

... of the two-carbon acetate residue from acetyl coenzyme A and a molecule of four-carbon oxaloacetate to form the six-carbon ... the epsilon nitrogen lone pair of electrons on His-274 formed in the last step abstracts the hydroxyl enol proton to reform an ... One of the oxygen's lone pairs nucleophilically attacks the carbonyl carbon of citroyl−CoA. This forms a tetrahedral ... which in turn deprotonate the epsilon nitrogen atom of His-320. This nucleophilic addition results in the formation of citroyl− ...

https://en.wikipedia.org/wiki/Citrate_synthase

6.3: Carbon-Nitrogen. *Glutamine synthetase. *Ubiquitin ligase *Cullin. *Von Hippel-Lindau tumor suppressor ... EC4 Lyases (list). *EC5 Isomerases (list). *EC6 Ligases (list). *EC7 Translocases (list) ... Glutamine synthetase (GS) (EC 6.3.1.2)[3] is an enzyme that plays an essential role in the metabolism of nitrogen by catalyzing ... strain PCC 6803 is differently regulated in response to nitrogen availability". Journal of Bacteriology. 179 (8): 2678-89. doi: ...

https://en.wikipedia.org/wiki/Glutamine_synthetase

Of these amino acids, aspartate and glutamine are used, together with carbon and nitrogen atoms from other sources, to form the ... There it is cleaved by ATP citrate lyase into acetyl-CoA and oxaloacetate. The oxaloacetate is returned to mitochondrion as ... The citric acid cycle begins with the transfer of a two-carbon acetyl group from acetyl-CoA to the four-carbon acceptor ... into two molecules each of carbon dioxide and water. Through catabolism of sugars, fats, and proteins, the two-carbon organic ...

https://en.wikipedia.org/wiki/Citric_acid_cycle

... reflecting different underlying carbon- and nitrogen-isotope effects. The approach requires a relatively high amount of ... The C-P lyase enzyme system is encoded by a complicated 14-gene operon. Biodegradation transformation intermediates may ... Carbon 14-labeled pesticides do enable mass balances, but investigations with radioactively tagged substrates cannot be ... more readily assimilable carbon substrates, whereas pesticides present at trace concentrations are transformed through ...

https://en.wikipedia.org/wiki/Pesticide_degradation

6.3: Carbon-Nitrogen. *Glutamine synthetase. *Ubiquitin ligase *Cullin. *Von Hippel-Lindau tumor suppressor ...

https://en.wikipedia.org/wiki/Carbamoyl_phosphate_synthetase

This enzyme belongs to the family of ligases, specifically those forming carbon-nitrogen bonds carbon-nitrogen ligases with ...

https://en.wikipedia.org/wiki/Phosphoribosylformylglycinamidine_synthase

Bacterial and fungal proteases are particularly important to the global carbon and nitrogen cycles in the recycling of proteins ... Peptide lyases[edit]. A seventh catalytic type of proteolytic enzymes, asparagine peptide lyase, was described in 2011. Its ... Sims GK, Wander MM (2002). "Proteolytic activity under nitrogen or sulfur limitation". Appl. Soil Ecol. 568: 1-5.. ... Asparagine peptide lyases - using an asparagine to perform an elimination reaction (not requiring water) ...

https://en.wikipedia.org/wiki/E1101

The remaining proton of the now-neutral imidazole ring can reside on either nitrogen, giving rise to what are known as the N1-H ... The enzyme histidine ammonia-lyase converts histidine into ammonia and urocanic acid. A deficiency in this enzyme is present in ... As a result, carbon monoxide binding is only 200 times stronger in haemoglobin, compared to 20,000 times stronger in free haem ... It can do this by abstracting a proton with its basic nitrogen to make a positively charged intermediate and then use another ...

https://en.wikipedia.org/wiki/L-Histidine

The first enzyme involved is phenylalanine ammonia-lyase (PAL) that converts L-phenylalanine to trans-cinnamic acid and ammonia ... under phosphate-limited and carbon-limited conditions". Biotechnology and Bioengineering. 92 (5): 541-552. doi:10.1002/bit. ... which is transaminated using glutamate as the nitrogen source to give tyrosine and α-ketoglutarate. ...

https://en.wikipedia.org/wiki/Shikimate

... ammonia lyase (TAL) is an enzyme in the natural phenols biosynthesis pathway. It transforms L-tyrosine into p-coumaric ... This enzyme catalyzes the reaction causing the addition of a hydroxyl group to the end of the 6-carbon aromatic ring of ... which is transaminated using glutamate as the nitrogen source to give tyrosine and α-ketoglutarate. ... The second utilizes enzymatic synthesis from phenolics, pyruvate, and ammonia through the use of tyrosine phenol-lyase.[29] ...

https://en.m.wikipedia.org/wiki/Tyrosine

one-carbon metabolic process. • axon regeneration. • regulation of transcription involved in G1/S transition of mitotic cell ... The acidity of the targeted nitrogen on the substrate is important in the binding of the substrate to the enzyme's binding site ... which can be converted to the kinds of tetrahydrofolate cofactors used in 1-carbon transfer chemistry. In humans, the DHFR ...

https://en.wikipedia.org/wiki/Dihydrofolate_reductase

2-carbon groups, α cleavage. Bacteria, archaea and eukaryotes NAD+ and NADP+ [31]. Niacin (B3). ADP. Electrons. Bacteria, ... Other organisms require additional metals as enzyme cofactors, such as vanadium in the nitrogenase of the nitrogen-fixing ...

https://en.wikipedia.org/wiki/Cofactor_

6.3: Carbon-Nitrogen. *Glutamine synthetase. *Ubiquitin ligase *Cullin. *Von Hippel-Lindau tumor suppressor ... EC4 Lyases (list). *EC5 Isomerases (list). *EC6 Ligases (list). *EC7 Translocases (list) ... Boehlein SK, Richards NG, Schuster SM (March 1994). "Glutamine-dependent nitrogen transfer in Escherichia coli asparagine ...

https://en.wikipedia.org/wiki/Asparagine_synthase_

In the next step, two additional carbon atoms are removed by the CYP17A1 (17α-hydroxylase/17,20-lyase) enzyme in the ... were able to show that testosterone raised nitrogen retention (a mechanism central to anabolism) in the dog, after which Allan ... a solid polycyclic alcohol with a hydroxyl group at the 17th carbon atom. This also made it obvious that additional ... a mitochondrial cytochrome P450 oxidase with the loss of six carbon atoms to give pregnenolone. ...

https://en.m.wikipedia.org/wiki/Testosterone

The conversion of glutamate to glutamine is regulated by glutamine synthetase (GS) and is a key step in nitrogen metabolism.[5] ... Aspartic acid is produced by the addition of ammonia to fumarate using a lyase.[22] ... Bridgers WF (1970). "The relationship of the metabolic regulation of serine to phospholipids and one-carbon metabolism". ... Cystathionine-β-lyase (in mammals, this step is performed by homocysteine methyltransferase or betaine-homocysteine S- ...

https://en.wikipedia.org/wiki/Amino_acid_synthesis

Category:EC 4.3 (carbon-nitrogen lyases)Edit. *Category:EC 4.3.1 *Phenylalanine ammonia-lyase (EC 4.3.1.24) ... Category:Lyases (EC 4) (Lyase)Edit. Category:EC 4.1 (carbon-carbon lyases)Edit. *Category:EC 4.1.1 *Ornithine decarboxylase (EC ... 4 Category:Lyases (EC 4) (Lyase) *4.1 Category:EC 4.1 (carbon-carbon lyases) ... Category:EC 4.4 (carbon-sulfur lyases)Edit. *Category:EC 4.4.1 *Cystathionine gamma-lyase ...

https://en.m.wikipedia.org/wiki/List_of_enzymes

Taurino is the functional group attaching at the nitrogen, 2-sulfoethylamino.. See also. *Homotaurine (tramiprosate), precursor ... The cystathionine is then converted to hypotaurine by the sequential action of three enzymes: cystathionine gamma-lyase, ...

https://en.wikipedia.org/wiki/Taurine

... is a linear molecule, with a triple bond between carbon and nitrogen. A minor tautomer of HCN is HNC, hydrogen ... "Cyanogenesis in Cassava, The Role of Hydroxynitrile Lyase in Root Cyanide Production". Plant Physiology. 116 (4): 1219-1225. ... HCN has been detected in the interstellar medium[40] and in the atmospheres of carbon stars.[41] Since then, extensive studies ... This reaction is akin to steam reforming, the reaction of methane and water to give carbon monoxide and hydrogen. ...

https://en.m.wikipedia.org/wiki/Hydrogen_cyanide?fbclid=IwAR0p_VVdtr5SEhEhIMVGuN5PA3TWWw6xyZCswF36QJsD-fg6l0h1ekjkOPI

Carbon fixation and G3P synthesis. The Calvin cycle starts by using the enzyme RuBisCO to fix CO2 into five-carbon Ribulose ... Other nitrogen compounds. Chloroplasts make all of a cell's purines and pyrimidines-the nitrogenous bases found in DNA and RNA. ... "Subcellular Distribution of O-Acetylserine(thiol)lyase in Cauliflower (Brassica oleracea L.) Inflorescence". Plant Physiology ... They store CO2 in a four-carbon compound, which is why the process is called C4 photosynthesis. The four-carbon compound is ...

https://en.wikipedia.org/wiki/Chloroplasts

Righthanded β-helices, typified by the pectate lyase enzyme shown at left or P22 phage tailspike protein, have a less regular ... Oxygen atoms are red balls, nitrogen atoms are blue, and hydrogen atoms are omitted for simplicity; sidechains are shown only ... out to the first sidechain carbon atom (green). b) Edge-on view of the central two β-strands in a, showing the righthanded ... Cartoon above, atoms below with nitrogen in blue, oxygen in red (PDB: 1AXC) ...

https://en.wikipedia.org/wiki/Beta_sheet

Hydrolases: carbon-nitrogen non-peptide (EC 3.5). 3.5.1: Linear amides /. Amidohydrolases. *Asparaginase ... EC4 Lyases (list). *EC5 Isomerases (list). *EC6 Ligases (list). *EC7 Translocases (list) ...

https://en.wikipedia.org/wiki/HDAC4

EC 6.2 includes ligases used to form carbon-sulfur bonds. *EC 6.3 includes ligases used to form carbon-nitrogen bonds ( ... It is also said that a synthase is a lyase (a lyase is an enzyme that catalyzes the breaking of various chemical bonds by means ... EC 6.6 includes ligases used to form nitrogen-metal bonds, as in the chelatases ... EC 6.1 includes ligases used to form carbon-oxygen bonds. * ... EC 6.4 includes ligases used to form carbon-carbon bonds. *EC ...

https://en.wikipedia.org/wiki/Ligase

A Carbon-Nitrogen Lyase from Leucaena leucocephala Catalyzes the First Step of Mimosine Degradation. Vishal Singh Negi, Jon- ... A Carbon-Nitrogen Lyase from Leucaena leucocephala Catalyzes the First Step of Mimosine Degradation ... A Carbon-Nitrogen Lyase from Leucaena leucocephala Catalyzes the First Step of Mimosine Degradation ... A Carbon-Nitrogen Lyase from Leucaena leucocephala Catalyzes the First Step of Mimosine Degradation ...

http://www.plantphysiol.org/content/164/2/922

Recent Applications of Carbon‐Nitrogen Lyases in Asymmetric Synthesis of Noncanonical Amino Acids and Heterocyclic Compounds. ... Enantioselective Synthesis of Chiral Synthons for Artificial Dipeptide Sweeteners Catalyzed by an Engineered C-N Lyase. Zhang, ...

https://www.rug.nl/research/portal/persons/saravanan-thangavelu

Lyases synonyms, Lyases pronunciation, Lyases translation, English dictionary definition of Lyases. n. Any of a class of ... non-redux lyases and transferases for forming bonds of carbon with carbon, oxygen, sulfur, and nitrogen; oxidations; reductions ... lyase. (redirected from Lyases). Also found in: Medical, Encyclopedia.. Related to Lyases: Isomerases, Transferases ... Lyases - definition of Lyases by The Free Dictionary https://www.thefreedictionary.com/Lyases ...

http://www.thefreedictionary.com/Lyases

These findings suggest that the biofilm niches are distinguished by distinct carbon and nitrogen resource utilization, oxygen ... These findings suggest that the biofilm niches are distinguished by distinct carbon and nitrogen resource utilization, oxygen ... defined mechanisms of fungal adaptation and identified a functional shift related to different roles in carbon and nitrogen ... defined mechanisms of fungal adaptation and identified a functional shift related to different roles in carbon and nitrogen ...

https://www.frontiersin.org/articles/10.3389/fmicb.2016.00238/full

4.3 Carbon-nitrogen lyases. 4.3.1 Ammonia lyases. 3. histidase. Substrates useful in this invention include those reactive with ...

http://www.google.com/patents/US4483921?dq=6,952,563

Production of Xanthan Lyase by Microbacterium sp. XT11. The effect of carbon sources and nitrogen sources on the production of ... Optimum Culture Condition and Xanthan Lyase Production. The influence of carbon source on xanthan lyase production was ... The highest xanthan lyase activity was obtained when xanthan was used as carbon source, while much lower titers of xanthan ... Like the xanthan lyases produced by Paenibacillus and Bacillus [14, 15], Microbacterium xanthan lyase was active on the intact ...

https://www.hindawi.com/journals/tswj/2014/368434/

Lyases are enzymes that catalyse the cleavage of carbon-carbon,. carbon-oxygen and carbon-nitrogen bond, by means other than ... the carbon-hydrogen bond, such that lysine 345 here can abstract. a proton from that substrate and drive the reaction forward. ... This is a particular feature of the enzyme family known as lyases. ...

https://www.coursera.org/learn/industrial-biotech/lecture/RZoIr/how-do-enzymes-work

carbon-nitrogen lyase activity Source: UniProtKB-UniRule. *magnesium ion binding Source: UniProtKB-UniRule ...

https://www.uniprot.org/uniprot/P64556

Carbon-Nitrogen Lyases / chemistry * Carbon-Nitrogen Lyases / metabolism* * Conserved Sequence * Cysteine / metabolism ...

https://pubmed.ncbi.nlm.nih.gov/22031445/?dopt=Abstract

https://en.wikipedia.org/wiki/Phenylalanine_ammonia-lyase

Impact of nitrogen supply on carbon/nitrogen allocation: a case study on amino acids and catechins in green tea [Camellia ... Effects of Nitrogen Fertilization on Synthesis of Primary and Secondary Metabolites in Three Varieties of Kacip Fatimah ( ... Six phenylalanine ammonia-lyases from Camellia sinensis: Evolution, expression, and kinetics. Yingling Wu, Wenzhao Wang, Yanzhi ... Phenylalanine ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) and catechins (flavan-3-ols) accumulation in tea ...

https://www.pnas.org/content/91/16/7608/tab-article-info

EC 4.3 Carbon-Nitrogen Lyases. EC 4.3.1 Ammonia-Lyases. EC 4.3.1.1 aspartate ammonia-lyase. EC 4.3.1.2 methylaspartate ammonia- ... EC 4 Lyases. EC 4.1 Carbon-Carbon Lyases. EC 4.1.1 Carboxy-Lyases. EC 4.1.1.1 pyruvate decarboxylase. EC 4.1.1.2 oxalate ... EC 4.7 carbon-phosphorus lyases. EC 4.7.1.1 α-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase. EC 4.99 Other Lyases. EC 4.99 ... EC 4.1.3.46 (R)-citramalyl-CoA lyase EC 4.1.99 Other Carbon-Carbon Lyases. EC 4.1.99.1 tryptophanase. EC 4.1.99.2 tyrosine ...

https://www.qmul.ac.uk/sbcs/iubmb/enzyme/EC4/cont4.html

https://en.wikipedia.org/wiki/Dihydroxyphenylalanine_ammonia-lyase

Carbon-nitrogen lyases. Metalloproteinases. Other toxins. Various; autonomic etc. Lectins. Nerve growth factors. ...

http://www.toxinology.com/fusebox.cfm?staticaction=snakes/ns-snvenom.htm

4.1 Carbon-carbon lyases 4.2 Carbon-oxygen lyases 4.3 Carbon-nitrogen lyases ...

https://www.kegg.jp/kegg-bin/get_htext?soc01000+105201589

Deficiency of carbon-carbon lyase. *Deficiency of carbon-halide lyase. *Deficiency of carbon-nitrogen lyase ...

http://www.icd9data.com/2011/Volume1/240-279/270-279/277/277.6.htm

... based on the formation of carbon-carbon and carbon-nitrogen bonds. Increasing the availability and applicability of a variety ... Lyase enzymes have potential to expand the application of biocatalysis in chemical synthesis - they can selectively synthesize ... screens based on assimilable nitrogen release gives rise to host growth on nitrogen free media in instances where selection ... Work Package 2.: Next Generation C-C Lyases The objectives are to deliver to the market place products from - and a portfolio ...

https://cordis.europa.eu/result/rcn/186905_en.html

... or nitrogen (N) on flavonoid biosynthesis, the mechanism of C/N interactive effects on flavonoid metabolism is still unclear. ... or nitrogen (N) on flavonoid biosynthesis, the mechanism of C/N interactive effects on flavonoid metabolism is still unclear. ... Despite numerous studies examined the effects of available carbon (C) ... Despite numerous studies examined the effects of available carbon (C) ...

https://www.frontiersin.org/articles/10.3389/fpls.2015.00673/full

carbon-nitrogen lyase activity. 0.249761226675912. bayes_pls_golite062009. 2. No functions predicted.. ...

http://www.yeastrc.org/pdr/viewProtein.do?id=530755

... including carbon-carbon lyases, carbon-oxygen lyases and carbon-nitrogen lyases. In addition to these types, there are also ... such as carbon-sulfur lyases, carbon-halide lyases and phosphorus-oxygen lyases. There are also several subclasses, but these ... Hydro-lyases - This is a form of carbon-oxygen lyases enzymes. These enzymes work by removing water from cellular structures. ... Decarboxylases - This class of lyases has a carbon-carbon reaction in the body. An example of a particular form of ...

https://www.consumerhealthdigest.com/health-conditions/metabolic-enzymes.html

Ethanolamine can be used as a source of carbon and nitrogen by phylogenetically diverse bacteria. Ethanolamine-ammonia lyase, ... also as the nitrogen source (27). The ethanolamine degradation is enabled by the enzyme ethanolamine-ammonia lyase (EC 4.3.1.7 ... Ethanolamine lyase produces acetaldehyde, which is converted by the oxidoreductase EutE to acetyl-coenzyme A, which enters the ... Ethanolamine-ammonia lyase requires adenosylcobalamin (28), which in different species may be imported from the environment, ...

https://jb.asm.org/content/191/23/7157

... heparinum or strain FIBX5 grown with glucose or heparin as the carbon source. Antisense primer AC-4 (5′CGCAAAGGCTTTTTAAGGTCCAG3 ... nitrogen, and energy (6, 11, 17). ... GAG lyase gene expression in F. heparinum.It has been reported ... Analysis of GAG lyase expression in F. heparinum.It was shown that the five transconjugant strains FIBX3, FIBX4, FIBX5, FIBX6, ... The GAG lyases from these recombinant F. heparinum strains were purified and shown to be identical to their native counterparts ...

https://jb.asm.org/content/184/12/3242

Structural Basis for the Catalytic Mechanism of Ethylenediamine- N, N-disuccinic Acid Lyase, a Carbon-Nitrogen Bond-Forming ... Catalytic mechanisms and biocatalytic applications of aspartate and methylaspartate ammonia lyases.. de Villiers M, Puthan ... Engineering methylaspartate ammonia lyase for the asymmetric synthesis of unnatural amino acids. ... resolution and stereoselective synthesis of 3-substituted aspartic acids by using engineered methylaspartate ammonia lyases. ...

https://www.ncbi.nlm.nih.gov/pubmed?cmd=search&term=de+Villiers+J%5Bau%5D&dispmax=50

Lyases. Carbon-nitrogen lyases. All UniProtKB/Swiss-Prot entries corresponding to class 4.3.-.-.. The following ENZYME entries ... 4.3.1.1 Aspartate ammonia-lyase 4.3.1.2 Methylaspartate ammonia-lyase 4.3.1.3 Histidine ammonia-lyase 4.3.1.4 ... L-serine ammonia-lyase 4.3.1.18 D-serine ammonia-lyase 4.3.1.19 Threonine ammonia-lyase 4.3.1.20 Erythro-3-hydroxy-L-aspartate ... Carbamoyl-serine ammonia-lyase 4.3.1.14 3-aminobutyryl-CoA ammonia-lyase 4.3.1.15 Diaminopropionate ammonia-lyase 4.3.1.16 ...

https://enzyme.expasy.org/EC/4.3.-.-

Tichi M.A., W.G. Meijer and F. R. Tabita.; (2001) Complex I and its involvement in redox homeostasis and carbon and nitrogen ... Wall, D.M.,Duffy P.S., DuPont C, Prescott J.F., Meijer, W.G.; (2005) Isocitrate lyase activity is required for virulence of ... Croes, L. M., W. G. Meijer, and L. Dijkhuizen; (1991) Regulation of methanol oxidation and carbon dioxide fixation in ... Shively, JM; van Keulen, G; Meijer, WG; ; (1998) Something from almost nothing: Carbon dioxide fixation in chemoautotrophs. ...

http://www.ucd.ie/conway/research/researchers/conwayfellowsa-z/professorwimmeijer/

... with sufficient carbon and nitrogen harvested during log-phase growth; (ii) CLB (carbon-limited B3 medium) harvested during ... Among these were six members of the glycoside hydrolase family 61, as well as several polysaccharide lyases and carbohydrate ... Under nitrogen or carbon limitation, lignin and manganese peroxidase expression increased relative to nutrient replete medium. ... Distribution of P. chrysosporium genes encoding upregulated transcripts in carbon limited B3 medium (CLB, inner ring), nitrogen ...

https://aem.asm.org/content/75/12/4058?ijkey=e76e1d72f54ebadeb8bf23973eaba2e6efe3cc2c&keytype2=tf_ipsecsha

... "carbon nitrogen lyase activity," and "ammonia lyase activity." ... and organs were dissected and snap-frozen in liquid nitrogen. ...

https://www.mcponline.org/content/12/6/1709

Other name(s): cyanate lyase; cyanate hydrolase; cyanase; cyanate aminohydrolase; cyanate C-N-lyase; cyanate hydratase ... which can be used as the sole source of nitrogen [6,7]. Reaction (1) can be considered as the reverse of carbamate = cyanate ... H2O, where this is assisted by reaction with bicarbonate and carbon dioxide (see mechanism above) [2], and hence is classified ... Systematic name: carbamate hydro-lyase. Comments: This enzyme, which is found in bacteria and plants, is used to decompose ...

https://www.qmul.ac.uk/sbcs/iubmb/enzyme/EC4/2/1/104.html

Lack of isocitrate lyase inChlamydomonasleads to changes in carbon metabolism and in the response to oxidative stress under ... Use of a lipid rich strain reveals mechanisms of nitrogen limitation and carbon partitioning in the haptophyte Tisochrysis ... Comparative Shotgun Proteomic Analysis of Wastewater-Cultured Microalgae: Nitrogen Sensing and Carbon Fixation for Growth and ... Carbon partitioning in lipids synthesized by Chlamydomonas reinhardtii when cultured under three unique inorganic carbon ...

http://www.plantphysiol.org/content/154/4/1737/tab-article-info

lyase activity. 2.31268471569846. bayes_pls_golite062009. carbon-nitrogen lyase activity. 2.2046475419807. bayes_pls_ ... ASL - argininosuccinate lyase. 0.0. [1..462]. [1..459]. ARLY_CANAX - Argininosuccinate lyase OS=Candida albicans GN=ARG4 PE=3 ... amidine-lyase activity. 3.84281419858187. bayes_pls_golite062009. argininosuccinate lyase activity. 3.58328346705456. bayes_pls ... ARLY_SACDO - Argininosuccinate lyase OS=Saccharomyces douglasii GN=ARG4 PE=3 SV=1. ARLY_SACPA - Argininosuccinate lyase OS= ...

http://www.yeastrc.org/pdr/viewPSPOverview.do?id=530970

It is thought to be mechanistically similar to the related enzyme histidine ammonia-lyase (EC:4.3.1.3, HAL). (wikipedia.org)
The mechanism of the reaction of PAL is thought to be similar to the mechanism of the related enzyme histidine ammonia lyase. (wikipedia.org)
PAL is structurally similar to the mechanistically related histidine ammonia lyase, although PAL has approximately 215 additional residues. (wikipedia.org)
title=Crystal structure of histidine ammonia-lyase revealing a novel polypeptide modification as the catalytic electrophile. (wikidoc.org)
If a person lacks histidine ammonia-lyase, it results in histidinemia, a rare metabolic disorder. (brighthub.com)
6. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the recombinant enzyme is derived from a tyrosine or histidine ammonia lyase, and wherein the recombinant enzyme preferentially deaminates L-Phe. (patentsencyclopedia.com)

Phenylalanine ammonia lyase (EC 4.3.1.24) is an enzyme that catalyzes a reaction converting L-phenylalanine to ammonia and trans-cinnamic acid. (wikipedia.org)
Phenylalanine ammonia lyase (PAL) is the first and committed step in the phenyl propanoid pathway and is therefore involved in the biosynthesis of the polyphenol compounds such as flavonoids, phenylpropanoids, and lignin in plants. (wikipedia.org)
Phenylalanine ammonia lyase is found widely in plants, as well as some bacteria, yeast, and fungi, with isoenzymes existing within many different species. (wikipedia.org)
The systematic name of this enzyme class is L-phenylalanine ammonia-lyase (trans-cinnamate-forming). (wikipedia.org)
Previously, it was designated EC 4.3.1.5, but that class has been redesignated as EC 4.3.1.24 (phenylalanine ammonia-lyases), EC 4.3.1.25 (tyrosine ammonia-lyases), and EC 4.3.1.26 (phenylalanine/tyrosine ammonia-lyases). (wikipedia.org)
Phenylalanine ammonia lyase is specific for L-phe, and to a lesser extent, L-tyrosine. (wikipedia.org)
Numbers are given for the phenylalanine ammonia lyase from Petroselinum crispum (PDB 1W27). (wikipedia.org)
Phenylalanine ammonia lyase is composed of four identical subunits composed mainly of alpha-helices, with pairs of monomers forming a single active site. (wikipedia.org)
Phenylalanine ammonia lyase can perform different functions in different species. (wikipedia.org)
Induction of L-phenylalanine ammonia-lyase during utilization of phenylalanine as a carbon or nitrogen source in Rhodotorula glutinis. (semanticscholar.org)
Synthesis and degradation of phenylalanine ammonia-lyase of Rhodosporidium toruloides. (semanticscholar.org)
Production of l-Phenylalanine from trans-Cinnamic Acid with Rhodotorula glutinis Containing l-Phenylalanine Ammonia-Lyase Activity. (semanticscholar.org)
This enzyme is a member of the aromatic amino acid lyase family, other members of which are EC 4.3.1.23 (tyrosine ammonia-lyase), EC 4.3.1.24 (phenylalanine ammonia-lyase) and EC 4.3.1.25 (phenylalanine/tyrosine ammonia-lyase). (qmul.ac.uk)
Phenylalanine ammonia lyase (PAL) is the key enzyme that catalyzes the conversion of L-Phenylalanine to ammonia and trans- cinnamic acid. (innspub.net)
The present study was conducted with the main objective to optimize the phenylalanine ammonia lyase (PAL) production process by Bacillus subtilis GCB-31 on agro-industrial wastes as carrier substrates in solid state fermentation. (innspub.net)
Thermal bifunctionality of bacterial phenylalanine aminomutase and ammonia lyase enzymes. (innspub.net)
2014. Biotechnological production and applications of microbial phenylalanine ammonia lyase: a recent review. (innspub.net)
Stabilization of phenylalanine ammonia lyase containing Rhodotorulaglutinis cells for the continuous synthesis of L-phenylalanine methyl ester/96. (innspub.net)
In view of this, the research was planned to determine the effect of different concentrations of zinc (Zn) on biochemical constituents of clusterbean, such as antioxidative enzymes namely peroxidase, polyphenol oxidase, phenylalanine ammonia lyase , and tyrosine ammonia lyase , which play an important role in disease resistance mechanisms. (thefreedictionary.com)
With the exception of cinnamate 4-hydroxylase, the enzymes which act downstream of phenylalanine ammonia lyase are encoded by small gene families in all species analyzed so far. (tuscany-diet.net)
It requires no cofactors and catalyzes the reaction that links primary and secondary metabolism: the deamination of phenylalanine to trans -cinnamic acid, with the release of nitrogen as ammonia and introduction of a trans double bond between carbon atoms 7 and 8 of the side chain. (tuscany-diet.net)
In all plant species investigated, several copies of phenylalanine ammonia lyase gene are found, copies that probably respond differentially to internal and external stimuli. (tuscany-diet.net)
5. The recombinant amino acid ammonia lyase enzyme of claim 3, wherein the first amino acid is tyrosine or histidine and the second amino acid is phenylalanine. (patentsencyclopedia.com)
12. The recombinant cell of claim 11, wherein the cell encodes a recombinant tyrosine amino acid-type ammonia lyase enzyme that comprises a mutation converting a kinetic preference of the enzyme for tyrosine into a preference for phenylalanine. (patentsencyclopedia.com)

A. richmondensis transcripts involved in denitrification and in the degradation of complex carbon sources (including cellulose) were up-regulated in floating biofilms, whereas central carbon metabolism and stress-related transcripts were significantly up-regulated in streamer biofilms. (frontiersin.org)
This enzyme participates in nitrogen metabolism and sulfur metabolism. (wikipedia.org)
Despite numerous studies examined the effects of available carbon (C) or nitrogen (N) on flavonoid biosynthesis, the mechanism of C/N interactive effects on flavonoid metabolism is still unclear. (frontiersin.org)
Despite extensive studies of ethanolamine utilization in Salmonella enterica serovar Typhimurium, much remains to be learned about EutBC structure and catalytic mechanism, about the evolutionary origin of ethanolamine utilization, and about regulatory links between the metabolism of ethanolamine itself and the ethanolamine-ammonia lyase cofactor adenosylcobalamin. (asm.org)
A structure analysis of the promoter regions of the lyase genes revealed a number of putative regulatory DNA elements, such as the AREA and CREA sites, which are related to nitrogen and carbon metabolism, respectively, and the CCAAT/CAAT boxes, which are related to basal expression of genes. (deepdyve.com)
Role of glutamine transaminases in nitrogen, sulfur, selenium and 1-carbon metabolism: Glutamine Transaminases in normal and cancer Cells. (columbia.edu)
Cysteine S-conjugate β-lyases: Important roles in the metabolism of naturally occurring sulfur-and selenium-containing compounds, xenobiotics and anticancer agents. (columbia.edu)
New insights into the metabolism of organomercury compounds: Mercury-containing cysteine S-conjugates are substrates of human glutamine transaminase K and potent inactivators of cystathionine g-lyase. (columbia.edu)
Participates in cellular nitrogen metabolism and also in liver gluconeogenesis starting with precursors transported from skeletal muscles (By similarity). (hmdb.ca)
Saba, "Sphingosine-1-phosphate lyase in development and disease: sphingolipid metabolism takes flight," Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids, vol. (thefreedictionary.com)
20. David H, Akesson M, Nielsen J: Reconstruction of the central carbon metabolism of Aspergillus niger.Eur J Biochem 2003, 270:4243-4253. (biology-online.org)
Rates of nitrification correlated with the abundance of these dominant AOA populations, whose metabolism is characterized by ammonia oxidation, mixotrophic utilization of organic nitrogen, deamination, and the energetically efficient chemolithoautotrophic hydroxypropionate/hydroxybutyrate carbon fixation cycle. (sciencemag.org)
These AOA thus have the potential to couple mixotrophic and chemolithoautotrophic metabolism via mixotrophic deamination of organic nitrogen, followed by oxidation of the regenerated ammonia for additional energy to fuel carbon fixation. (sciencemag.org)
Impact of reduced O-acetylserine(thiol)lyase isoform contents on potato plant metabolism. (mpg.de)
Interaction of sulfate assimilation with carbon and nitrogen metabolism in Lemna minor. (mpg.de)
We present iNS934, the first GSMM for N. salina , including 2345 reactions, 934 genes and an exhaustive description of lipid and nitrogen metabolism. (biomedcentral.com)

He covers chiral discrimination in the active site of oxidoreductases, transferases and chiral discrimination, the influence of chirality on the hydrolysis reactions within the active site of hydrolases, the influence of chirality on the reactions in the active site of lyases , and chiral discrimination in the active site of ligases. (thefreedictionary.com)
These enzymes are grouped into six classes: hydrolases (including proteases, amylases and lipases that break down the main nutrients - fats, carbohydrates and proteins), isomerases, ligases, lyases , oxidoreductases and transferases. (thefreedictionary.com)
Unlike ligases, lyases bring about synthase reactions without the participation of energy-rich (macroergic) compounds. (thefreedictionary.com)
This enzyme belongs to the family of ligases, specifically those forming carbon-nitrogen bonds carbon-nitrogen ligases with glutamine as amido-N-donor. (wikibooks.org)

Ethanolamine-ammonia lyase, the enzyme that breaks ethanolamine into acetaldehyde and ammonia, is encoded by the gene tandem eutBC . (asm.org)
The ethanolamine degradation is enabled by the enzyme ethanolamine-ammonia lyase (EC 4.3.1.7), which cleaves ethanolamine to ethanol and ammonia ( 8 ) and is typically encoded by two genes, which are named eutB and eutC in Salmonella enterica serovar Typhimurium. (asm.org)
Ethanolamine-ammonia lyase requires adenosylcobalamin ( 28 ), which in different species may be imported from the environment, produced de novo, or synthesized from precursors, such as cyanocobalamin or hydroxycobalamin. (asm.org)
The excess of these precursors inhibits ethanolamine-ammonia lyase, and the reactivating factor EutA is used in several species to prevent EutBC inhibition. (asm.org)
The activities of the enzymes ethanolamine ammonia-lyase, CoA-dependent and CoA-independent aldehyde dehydrogenases, and isocitrate lyase were assayed in Escherichia coli which had been grown on various sources of carbon and nitrogen. (nih.gov)
Induction of ethanolamine ammonia-lyase and of maximal levels of both aldehyde dehydrogenases required the concerted effects of ethanolamine and vitamin (or coenzyme) B12. (nih.gov)
No evidence was found for structural relationships between ethanolamine ammonia-lyase, CoA-dependent aldehyde dehydrogenase and CoA-independent aldehyde dehydrogenase, but mutant and physiological studies demonstrated that the induction of the first two enzymes is under common control. (nih.gov)

Structural Basis for the Catalytic Mechanism of Ethylenediamine- N, N'-disuccinic Acid Lyase, a Carbon-Nitrogen Bond-Forming Enzyme with a Broad Substrate Scope. (nih.gov)
Hydrolysis of the a-carbon-amino bond of the ketimine results in the release of the oxo-acid corresponding to the amino acid substrate, leaving pyridoxamine phosphate at the catalytic site of the enzyme. (doctorabel.us)
A seventh catalytic type of proteolytic enzymes, asparagine peptide lyase, was described in 2011. (kiev.ua)

The dbCAN CAZyme annotation program (http://csbl.bmb.uga.edu/dbCAN/) [30] with default parameters and the Carbohydrate Active Enzymes (CAZy) database v6.0 (http://www.cazy.org) were adopted to perform the functional annotations for carbohydrate-active modules and ligninolytic enzymes, which include glycoside hydrolases (GHs), glycosyltransferases (GTs), polysaccharide lyases (PLs), carbohydrate esterases (CEs), and auxiliary activities (AAs). (thefreedictionary.com)
PDEs are from three enzyme classes: carbohydrate esterases from CE8 and CE12 family, glycoside hydrolases from GH28 family and lyases from PL1, 2, 3, 9 and 10. (biotech-asia.org)

This enzyme belongs to the family of lyases, specifically the class of carbon-sulfur lyases. (wikipedia.org)
The reductive tricarboxylic acid cycle functions as a carbon dioxide fixation pathway in the green sulfur bacterium, Chlorobium limicola. (elsevier.com)
The graph below shows the percent by mass of six common elements in the human body What are elements 5 and 6 (most common) A. zinc and sulfur B. sodium and iron C. carbon and oxygen D. chlorine and phosphorus Performance & security by Cloudflare, Please complete the security check to access. (thefortatx.com)

Bacillus cereus GS-2 isolated from fruit industrial dump site effectively produces pectin lyase (PL) and Polygalacturonase (PG). (thefreedictionary.com)
The purified xanthan lyase has a molecular mass of 110 kDa and a specific activity of 28.2 U/mg that was much higher than that of both Paenibacillus and Bacillus lyases. (hindawi.com)
However, xanthan lyase was purified from both Paenibacillus alginolyticus XL-1 and Bacillus sp. (hindawi.com)
Like the xanthan lyases produced by Paenibacillus and Bacillus [14, 15], Microbacterium xanthan lyase was active on the intact xanthan and was not associated with endoglucanase [8]. (thefreedictionary.com)
Pectin-degrading enzymes (pectinase and pectin lyase) were produced in solid state fermentation by Bacillus subtilis SAV-21 isolated from fruit and vegetable market waste soil of Yamuna Nagar, Haryana, India, and identified by 16S rDNA sequencing. (usda.gov)

Genomic and functional characterization of the oas gene family encoding O-acetylserine (thiol) lyases , enzymes catalyzing the final step in cysteine biosynthesis in Arabidopsis thaliana. (thefreedictionary.com)
It seems, in fact, that each member of each family can be used mainly for the synthesis of a specific compound, thus acting as a control point for carbon flux among the metabolic pathways leading to lignan , lignin, and flavonoid biosynthesis. (tuscany-diet.net)

The enzyme from monocots is also able to act as tyrosine ammonia lyase (EC 4.3.1.25), converting tyrosine to p-coumaric acid directly, (therefore without the 4-hydroxylation step), but with a lower efficiency. (tuscany-diet.net)
7. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the mutation is in a residue corresponding to His 89 of Rhodobacter sphaeroides Tyrosine Ammonia Lyase. (patentsencyclopedia.com)

Differing from other polysaccharide lyases acting on the polysaccharide backbone, xanthan lyase could cleave the linkage between the terminal mannosyl and the glucuronyl residues on the side chain by a β -elimination reaction, introducing a double bond between C4 and C5 of the uronosyl residue and subsequently might be exploited for further chemical modification [ 13 ]. (hindawi.com)
Among these were six members of the glycoside hydrolase family 61, as well as several polysaccharide lyases and carbohydrate esterases. (asm.org)
PNLs are grouped together with pectate lyases (PL) in Family 1 of the polysaccharide lyases, as they share a conserved structure in a parallel β-helix. (biomedcentral.com)

Pectin lyases are significant compared to that of PG and PE in capability to undergo [beta]-elimination mechanism to degrade highly esterified pectins (present in fruits) into small molecules without producing methanol (7). (thefreedictionary.com)
Pectin lyases are the only known pectinases capable of degrading highly esterified pectins (like those found in fruits) into small molecules via [beta]-elimination mechanism without producing methanol. (thefreedictionary.com)
a) Pectin lyase (PL) activity was assayed spectrophotometrically by determining uronide at 235 nm [40]. (thefreedictionary.com)
Among these, pectin lyases (PNLs) catalyze the depolymerization of esterified pectin by a β-elimination mechanism. (biomedcentral.com)
The best-characterized fungal pectin lyases are obtained from saprophytic/opportunistic fungi in the genera Aspergillus and Penicillium and from some pathogens such as Colletotrichum gloeosporioides . (biomedcentral.com)
Here we report the isolation and sequence analysis of the Clpnl2 gene, which encodes the pectin lyase 2 of C. lindemuthianum , and its expression in pathogenic and non-pathogenic races of C. lindemuthianum grown on different carbon sources. (biomedcentral.com)
Both analyses revealed an early separation of bacterial pectin lyases from those found in fungi and oomycetes. (biomedcentral.com)
Clpnl2 was found in the latter group and was grouped together with the pectin lyase from C. gloeosporioides . (biomedcentral.com)
The Clpnl2 gene of C. lindemuthianum shares the characteristic elements of genes coding for pectin lyases. (biomedcentral.com)
A time-course analysis revealed significant differences between the two fungal races in terms of the expression of Clpnl2 encoding for pectin lyase 2. (biomedcentral.com)
According to the results, pectin lyases from bacteria and fungi separated early during evolution. (biomedcentral.com)
The main enzymes involved in the degradation of the HG backbone of pectin are polygalacturonases (PGA, E.C. 3.2.1.15 and XPG, E.C. 3.2.1.67), pectate lyases (PL, E.C. 4.2.2.9 and 4.2.2.2) and pectin lyases (PNL, E.C. 4.2.2.10) [ 3 ]. (biomedcentral.com)

Kynurenine aminotransferase 3 (KAT3) catalyzes the transamination of Kynurenine to kynurenic acid, and is identical to cysteine conjugate beta-lyase 2 (CCBL2) and glutamine transaminase L (GTL). (pubmedcentralcanada.ca)
KAT1 is identical to glutamine transaminase K (GTK), a kidney type transaminase and cysteine conjugate beta-lyase 1 (CCBL1). (pubmedcentralcanada.ca)
Recently, it was demonstrated that KAT3 is not only identical to cysteine conjugate beta-lyase 2 (CCBL2), but also to glutamine transaminase L (GTL), a liver type glutamine transaminase [15] . (pubmedcentralcanada.ca)
Measurement of cysteine S-conjugate β-lyase activity. (columbia.edu)

It is also said that a synthase is a lyase (a lyase is an enzyme that catalyzes the breaking of various chemical bonds by means other than hydrolysis and oxidation, often forming a new double bond or a new ring structure) and does not require any energy, whereas a synthetase is a ligase (a ligase is an enzyme that binds two chemicals or compounds) and thus requires energy. (wikipedia.org)

Numerous genes presumed to be involved in mobilizing and recycling nitrogen were expressed under nitrogen limitation, and among these were several secreted glutamic acid proteases not previously observed. (asm.org)
In medium containing microcrystalline cellulose as the sole carbon source, numerous genes encoding carbohydrate-active enzymes were upregulated. (asm.org)
A group of α-1,4-glucan lyase genes from the fungi Morchella costata, M.vulgaris and Peziza ostracoderma. (deepdyve.com)
Marcussen, Jan 2004-09-29 00:00:00 We here report genes encoding a newly discovered class of starch- and glycogen-degrading enzyme, α-1,4-glucan lyase (EC 4.2.2.13), which degrades starch and glycogen to 1,5-anhydro-D-fructose. (deepdyve.com)
Two lyase genes (Agll1;Mo.cos and Agll1;Mo.vul) from the two fungi were fully sequenced and found to contain a coding region of 3201 bp and 3213 bp, respectively. (deepdyve.com)
The two lyase genes share 86% identity at the amino acid level. (deepdyve.com)
Heterologous expression of these genes in Escherichia coli showed that both gene products were essential for ATP-citrate lyase activity. (elsevier.com)
The cluster of genes encoding the enzymes N -acetylneuraminate lyase (NanA), epimerase (NanE), and kinase (NanK), necessary for the catabolism of sialic acid (the Nan cluster), are confined 46 bacterial species, 42 of which colonize mammals, 33 as pathogens and 9 as gut commensals. (biomedcentral.com)

Reaction (1) can be considered as the reverse of 'carbamate = cyanate + H 2 O', where this is assisted by reaction with bicarbonate and carbon dioxide (see mechanism above) [2], and hence is classified in sub-subclass 4.2.1. (qmul.ac.uk)
In particular cyanate can be decomposed to carbamate (ammonia) and carbon dioxide. (hmdb.ca)
Alternately the same enzyme can be used to synthesize cyanate using carbamate and carbon dioxide. (hmdb.ca)
RuBisCO catalyzes two reactions- the carboxylation of D- ribulose 1,5-bisphosphate, the primary event in carbon dioxide fixation, as well as the oxidative fragmentation of the pentose substrate in the photorespiration process. (string-db.org)
The cycle consumes acetate (in the form of acetyl-CoA ) and water , reduces NAD + to NADH, releasing carbon dioxide. (wikipedia.org)
The reactions of the cycle are carried out by eight enzymes that completely oxidize acetate (a two carbon molecule), in the form of acetyl-CoA, into two molecules each of carbon dioxide and water. (wikipedia.org)

Biological nitrogen fixation (BNF) is one of the most important phenomena occurring in nature, only exceeded by photosynthesis [ 1 , 2 ]. (intechopen.com)
They also give the bacteria access to their roots, allowing them to colonize and reside in the root nodules, where the modified bacteria (bacteroids) can perform nitrogen fixation [ 1 , 4 , 5 ]. (intechopen.com)
This biological nitrogen fixation process is complex, but has been best examined in some detail in the context of soybean- Bradyrhizobium plant-microbe interactions. (intechopen.com)

Among the depolymerases, polygalacturonase is the major enzyme with a hydrolytic function and lyases (or transeleminases) which cleaves glycosidic bonds forming unsaturated product[DELTA](4,5-D-galacturonate) through transelimination reaction [34]. (thefreedictionary.com)
The enzyme is a member of the ammonia lyase family, which cleaves carbon-nitrogen bonds. (wikipedia.org)
Lyase enzymes have potential to expand the application of biocatalysis in chemical synthesis - they can selectively synthesize molecules with multiple chiral centres, based on the formation of carbon-carbon and carbon-nitrogen bonds. (europa.eu)
Lyases also catalyze the reverse reaction: the joining of groups by double bonds. (thefreedictionary.com)
YM55-1 (AspB) for the asymmetric hydroamination of carbon-carbon double bonds, one of the top aspirational reactions identified for industrial pharmaceutical synthesis. (nature.com)
Lyases are enzymes cleaving C-C, C-O, C-N and other bonds by other means than by hydrolysis or oxidation. (qmul.ac.uk)
Lyase: This enzyme in the body breaks the bonds between carbon atoms or carbon nitrogen bond. (thefortatx.com)

Like other lyases, PAL requires only one substrate for the forward reaction, but two for the reverse. (wikipedia.org)
Various enzymatic biocatalysts have been developed to catalyze the hydroamination reaction, for example ammonia lyases (MALs), ethylenediamine-N, N'-disuccinic acid lyases (EDDS lyases) and aspartases 4 - 5 . (nature.com)
The deprotonated aldimine is reprotonated at carbon-4 by reaction with a histamine residue to form the pyridoxamine phosphate ketimine. (doctorabel.us)

Argentilactone is a compound that was isolated from the Brazilian savanna plant Hyptis ovalifolia , and it has been suggested to be a potent antifungal, inhibiting the dimorphism of P. brasiliensis and the enzymatic activity of isocitrate lyase, a key enzyme of the glyoxylate cycle. (asm.org)

N-Acetyl-D-neuraminic acid lyase (NanA) catalyzes the breakdown of sialic acid (Neu5Ac) to N-acetyl-D-mannosamine (ManNAc) and pyruvate. (instem.res.in)

These findings suggest that the biofilm niches are distinguished by distinct carbon and nitrogen resource utilization, oxygen availability, and environmental challenges. (frontiersin.org)
We used computational analysis of sequences, structures, genome contexts, and phylogenies of ethanolamine-ammonia lyases to address these questions and to evaluate recent data-mining studies that have suggested an association between bacterial food poisoning and the diol utilization pathways. (asm.org)
It encodes a broad spectrum of enzymes for the uptake and utilization of various sugars and organic nitrogen compounds. (biomedcentral.com)

Identification and characterisation of metabolic pathways (in particular of carbon and iron uptake) that are required for intracellular proliferation of R. equi. (ucd.ie)
Global conversion of organic carbon to CO 2 with concomitant reduction of molecular oxygen involves the combined metabolic activity of numerous organisms. (asm.org)
It grows quickly using several carbon sources, and it offers a well-defined physiological environment for the construction and manipulation of various metabolic pathways. (asm.org)

Subclasses are the AMMONIA-LYASES, the AMIDINE-LYASES, the amine-lyases, and other carbon-nitrogen lyases. (bvsalud.org)
EC 4.3.2 ), the amine-lyases ( EC 4.3.3 ), and other carbon-nitrogen lyases ( EC 4.3.99 ). (qmul.ac.uk)

This subclass contains the decarboxylases ( EC 4.1.1 ), the aldehyde-lyases catalysing the reversal of an aldol condensation ( EC 4.1.2 ), and the oxo-acid-lyases, catalysing the cleavage of a 3-hydroxy acid ( EC 4.1.3 ), or the reverse reactions. (qmul.ac.uk)

The obtained lyase amino acid sequences were used to generate PCR primers, which were further used to probe the fungal genomic libraries. (deepdyve.com)
The amino acid sequence deduced from this nucleotide fragment shares 76% identity with the M. costata lyase. (deepdyve.com)
Crystal structure information is used to make substrate-switched amino acid ammonia lyase enzymes, including TALs, PALs and HALs. (patentsencyclopedia.com)
1. A recombinant amino acid ammonia lyase enzyme, comprising at least one mutation in an active site of the enzyme, wherein the mutation switches substrate preference of the lyase enzyme from a first substrate to a second substrate. (patentsencyclopedia.com)
2. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the first substrate is an amino acid, and the second substrate is an amino acid. (patentsencyclopedia.com)
3. The recombinant amino acid ammonia lyase enzyme of claim 2, wherein the first and second amino acids are aromatic amino acids. (patentsencyclopedia.com)
8. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the enzyme comprises a 4-methylidene-imidazole-5-one (MOI) cofactor prosthetic group. (patentsencyclopedia.com)
9. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the enzyme produces trans-cinnamic acid. (patentsencyclopedia.com)
17. A library of amino acid ammonia lyase polypeptides, the library comprising:a plurality of polypeptides comprising or derived from amino acid ammonia lyase enzyme polypeptides, wherein the plurality of polypeptides collectively comprise a plurality of mutations of at least one amino acid in at least one region of the polypeptides, the region corresponding to an active site of an amino acid ammonia lyase enzyme. (patentsencyclopedia.com)

lang=en terms the difference between protease and proteinase is that protease is (enzyme) an enzyme that cuts or cleaves proteins while proteinase is (enzyme) protease. (kiev.ua)

S43539 argininosuccinate lyase (EC 4.3.2.1) - yeast (Saccharomyces sp. (yeastrc.org)
argininosuccinate lyase [Rattus sp. (yeastrc.org)

Glutamine aids in protein synthesis, helps produce ammonium, serves as a source of energy, donates carbon in the citric acid cycle and donates nitrogen for anabolic processes in the body. (brighthub.com)
The carbon skeleton of isoleucine can be used for the production of glucose or fed into the citric acid cycle to play a role in oxidation. (brighthub.com)
Through catabolism of sugars, fats, and proteins, the two-carbon organic product acetyl-CoA (a form of acetate) is produced which enters the citric acid cycle. (wikipedia.org)
The citric acid cycle begins with the transfer of a two-carbon acetyl group from acetyl-CoA to the four-carbon acceptor compound (oxaloacetate) to form a six-carbon compound (citrate). (wikipedia.org)

However, simultaneously diversifying the electrophile and nucleophile substrate scope of C-N lyases remains elusive (Figure 1). (nature.com)
This group then forms a dative bond to the imino nitrogen of the internal aldimine, increasing its electrophilicity and thus enhancing the nucleophilic attack by the substrate. (doctorabel.us)
Once the substrate-coenzyme aldimine has been formed, it loses a proton from the a-carbon. (doctorabel.us)

ATP-citrate lyase, one of the key enzymes of this cycle, was partially purified from C. limicola strain M1 and the N-terminal sequence of a 65-kDa protein was found to show similarity toward eukaryotic ATP-citrate lyase. (elsevier.com)
These properties suggested that ATP-citrate lyase from C. limicola controlled the cycle flux depending on intracellular energy conditions. (elsevier.com)
This paper provides the first direct evidence that a bacterial ATP-citrate lyase is a heteromeric enzyme, distinct from mammalian enzymes. (elsevier.com)

Overall, our analyses defined mechanisms of fungal adaptation and identified a functional shift related to different roles in carbon and nitrogen turnover for the same species of fungi growing in closely located but distinct biofilm niches. (frontiersin.org)
Many microorganisms are capable of utilizing cellulose and hemicellulose as carbon and energy sources, but a much smaller group of filamentous fungi has evolved with the ability to depolymerize lignin, the most recalcitrant component of plant cell walls. (asm.org)
Collectively known as white rot fungi, they possess the unique ability to efficiently depolymerize lignin in order to gain access to cell wall carbohydrates for carbon and energy sources. (asm.org)
As such, white rot fungi play an important, if not pivotal, role in the carbon cycle (for a review, see reference 15 ). (asm.org)

Cyanate can be decomposed by the enzyme cyanate lyase (or cyanase), which is found in bacteria and plants. (hmdb.ca)

The systematic name of this enzyme class is L-homocysteine hydrogen-sulfide-lyase (deaminating 2-oxobutanoate-forming). (wikipedia.org)

Many bacterial species synthesize polyhydroxyalkanoic acids (PHAs), which accumulate in the cytoplasm as hydrophobic granules and function as a carbon reservoir and as an electron sink ( 2 ). (asm.org)
NanA plays a key role in Neu5Ac catabolism in many pathogenic and bacterial commensals where sialic acid is available as a carbon and nitrogen source. (instem.res.in)
Like other bacterial N-acetylneuraminate lyases, FnNanA also shares the triosephosphate isomerase (TIM)-barrel fold. (instem.res.in)
Bacterial and fungal proteases are particularly important to the global carbon and nitrogen cycles in the recycling of proteins, and such activity tends to be regulated by nutritional signals in these organisms. (kiev.ua)

These approaches commonly target individual biological processes (e.g., carbon degradation). (frontiersin.org)

They perform many critical ecosystem functions including the decomposition of organic matter, carbon storage, nutrient transfer, metal transformation and accumulation, and soil formation. (frontiersin.org)
Most biomolecules are organic compounds, and just four elements - oxygen, carbon, hydrogen, and nitrogen -make up 96% of the human body 's mass. (thefortatx.com)

The deduced molecular masses of 121 530 and 121 971 Da agree with the values found for the two purified lyases. (deepdyve.com)
International contributors to a dozen chapters review biotransformation from the perspective of a major pharmaceutical company and the basics of molecular biology for nonspecialists, then describe key biocatalysts (e.g., lipases, proteases, sulfatases, hydroxal nitrile lyases ) and their applications in the resolution of interesting molecules such as drug metabolites. (thefreedictionary.com)

The five GAG lyases were purified from these transconjugant strains and shown to be identical to their wild-type counterparts. (asm.org)

Anatomy2

Organisms17

Diseases2

Chemicals and Drugs59

Analytical, Diagnostic and Therapeutic Techniques and Equipment7

Phenomena and Processes26

Disciplines and Occupations1

Technology, Industry, Agriculture2

Information Science5

Health Care8

A novel jasmonate- and elicitor-responsive element in the periwinkle secondary metabolite biosynthetic gene Str interacts with a jasmonate- and elicitor-inducible AP2-domain transcription factor, ORCA2. (1/87)

Destabilase from the medicinal leech is a representative of a novel family of lysozymes. (2/87)

Sequencing, tissue distribution and chromosomal assignment of a novel ubiquitin-specific protease USP23. (3/87)

Identification of a novel isopeptidase with dual specificity for ubiquitin- and NEDD8-conjugated proteins. (4/87)

Structure of cyanase reveals that a novel dimeric and decameric arrangement of subunits is required for formation of the enzyme active site. (5/87)

Microbial thiocyanate utilization under highly alkaline conditions. (6/87)

Control of ubiquitination of proteins in rat tissues by ubiquitin conjugating enzymes and isopeptidases. (7/87)

Muscle-specific RING finger-1 interacts with titin to regulate sarcomeric M-line and thick filament structure and may have nuclear functions via its interaction with glucocorticoid modulatory element binding protein-1. (8/87)

Carbon

Nitrogen

Lyases

Chondroitin Lyases

Nitrogen Fixation

Carbon Dioxide

Carbon Monoxide

Nanotubes, Carbon

Pectobacterium chrysanthemi

Nitrogen Isotopes

Chondroitinases and Chondroitin Lyases

Nitrogen Compounds

Pectins

Nitrogen Cycle

Nitrogen Dioxide

Blood Urea Nitrogen

Phycobiliproteins

Chicory

Carbon Monoxide Poisoning

Carbon Isotopes

Reactive Nitrogen Species

Aldehyde-Lyases

Molecular Sequence Data

Carbon-Oxygen Lyases

Nitrogen Oxides

Erwinia

Oxo-Acid-Lyases

Heparin Lyase

PII Nitrogen Regulatory Proteins

Carbon Tetrachloride

Carbon Sequestration

Polygalacturonase

Substrate Specificity

Bacterial Proteins

Amino Acid Sequence

Nitrates

Ammonia

Alginates

Carbon Disulfide

Biomass

Rhodophyta

Fertilizers

Soil

Sphingomonas

Hexuronic Acids

Hydrogen-Ion Concentration

Isocitrate Lyase

Kinetics

Phycobilins

Chondroitin ABC Lyase

Quaternary Ammonium Compounds

Gene Expression Regulation, Bacterial

Cloning, Molecular

Pseudomonas

Cytochromes c1

Escherichia coli

Carbon Tetrachloride Poisoning

Sequence Homology, Amino Acid

Glutamate-Ammonia Ligase

Genes, Bacterial

Flavobacterium

Bacteroides

Culture Media

Amino Acids

Base Sequence

Glucuronic Acid

Urea

Symbiosis

Atmosphere

Photosynthesis

Adenylosuccinate Lyase

Streptococcus anginosus

Temperature

Hevea

Plants

Plant Leaves

Mutation

DNA, Bacterial

Nitrogenase

Sequence Analysis, DNA