Campylobacter sputorum: A species of CAMPYLOBACTER comprised of three biovars based on their reaction to CATALASE and UREASE. They have been isolated from humans, CATTLE, and SHEEP.Campylobacter: A genus of bacteria found in the reproductive organs, intestinal tract, and oral cavity of animals and man. Some species are pathogenic.Campylobacter Infections: Infections with bacteria of the genus CAMPYLOBACTER.Campylobacter jejuni: A species of bacteria that resemble small tightly coiled spirals. Its organisms are known to cause abortion in sheep and fever and enteritis in man and may be associated with enteric diseases of calves, lambs, and other animals.Campylobacter fetus: A species of bacteria present in man and many kinds of animals and birds, often causing infertility and/or abortion.Campylobacter coli: A species of gram-negative, rod-shaped bacteria isolated from the intestinal tract of swine, poultry, and man. It may be pathogenic.Campylobacter lari: A species of thermophilic CAMPYLOBACTER found in healthy seagulls and causing ENTERITIS in humans.Burkholderiaceae: A family of gram negative, aerobic, non-sporeforming, rod-shaped bacteria.Campylobacter upsaliensis: A species of CAMPYLOBACTER isolated from DOGS; CATS; and humans.Enteritis: Inflammation of any segment of the SMALL INTESTINE.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Chickens: Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.Poultry Diseases: Diseases of birds which are raised as a source of meat or eggs for human consumption and are usually found in barnyards, hatcheries, etc. The concept is differentiated from BIRD DISEASES which is for diseases of birds not considered poultry and usually found in zoos, parks, and the wild.Metabolism: The chemical reactions that occur within the cells, tissues, or an organism. These processes include both the biosynthesis (ANABOLISM) and the breakdown (CATABOLISM) of organic materials utilized by the living organism.Feces: Excrement from the INTESTINES, containing unabsorbed solids, waste products, secretions, and BACTERIA of the DIGESTIVE SYSTEM.Biohazard Release: Uncontrolled release of biological material from its containment. This either threatens to, or does, cause exposure to a biological hazard. Such an incident may occur accidentally or deliberately.Copyright: It is a form of protection provided by law. In the United States this protection is granted to authors of original works of authorship, including literary, dramatic, musical, artistic, and certain other intellectual works. This protection is available to both published and unpublished works. (from Circular of the United States Copyright Office, 6/30/2008)Treponemal Infections: Infections with bacteria of the genus TREPONEMA.Dermatitis: Any inflammation of the skin.Foot Diseases: Anatomical and functional disorders affecting the foot.Treponema: A genus of microorganisms of the order SPIROCHAETALES, many of which are pathogenic and parasitic for man and animals.Digital Dermatitis: Highly contagious infectious dermatitis with lesions near the interdigital spaces usually in cattle. It causes discomfort and often severe lameness (LAMENESS, ANIMAL). Lesions can be either erosive or proliferative and wart-like with papillary growths and hypertrophied hairs. DICHELOBACTER NODOSUS and TREPONEMA are the most commonly associated causative agents for this mixed bacterial infection disease.Nostrums: Medicines whose effectiveness is unproven and whose ingredients are often secret.Microbial Sensitivity Tests: Any tests that demonstrate the relative efficacy of different chemotherapeutic agents against specific microorganisms (i.e., bacteria, fungi, viruses).Quackery: The fraudulent misrepresentation of the diagnosis and treatment of disease.Anti-Bacterial Agents: Substances that reduce the growth or reproduction of BACTERIA.Drug Resistance, Bacterial: The ability of bacteria to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).Drug Resistance, Microbial: The ability of microorganisms, especially bacteria, to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).Bacteria: One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.Calcaneus: The largest of the TARSAL BONES which is situated at the lower and back part of the FOOT, forming the HEEL.Diagnostic Errors: Incorrect diagnoses after clinical examination or technical diagnostic procedures.Bone and Bones: A specialized CONNECTIVE TISSUE that is the main constituent of the SKELETON. The principle cellular component of bone is comprised of OSTEOBLASTS; OSTEOCYTES; and OSTEOCLASTS, while FIBRILLAR COLLAGENS and hydroxyapatite crystals form the BONE MATRIX.Cellulitis: An acute, diffuse, and suppurative inflammation of loose connective tissue, particularly the deep subcutaneous tissues, and sometimes muscle, which is most commonly seen as a result of infection of a wound, ulcer, or other skin lesions.ConjunctivitisErythema: Redness of the skin produced by congestion of the capillaries. This condition may result from a variety of causes.Bone Remodeling: The continuous turnover of BONE MATRIX and mineral that involves first an increase in BONE RESORPTION (osteoclastic activity) and later, reactive BONE FORMATION (osteoblastic activity). The process of bone remodeling takes place in the adult skeleton at discrete foci. The process ensures the mechanical integrity of the skeleton throughout life and plays an important role in calcium HOMEOSTASIS. An imbalance in the regulation of bone remodeling's two contrasting events, bone resorption and bone formation, results in many of the metabolic bone diseases, such as OSTEOPOROSIS.Purpura, Thrombotic Thrombocytopenic: An acquired, congenital, or familial disorder caused by PLATELET AGGREGATION with THROMBOSIS in terminal arterioles and capillaries. Clinical features include THROMBOCYTOPENIA; HEMOLYTIC ANEMIA; AZOTEMIA; FEVER; and thrombotic microangiopathy. The classical form also includes neurological symptoms and end-organ damage, such as RENAL FAILURE.Hemolytic-Uremic Syndrome: A syndrome that is associated with microvascular diseases of the KIDNEY, such as RENAL CORTICAL NECROSIS. It is characterized by hemolytic anemia (ANEMIA, HEMOLYTIC); THROMBOCYTOPENIA; and ACUTE RENAL FAILURE.Plasma Exchange: Removal of plasma and replacement with various fluids, e.g., fresh frozen plasma, plasma protein fractions (PPF), albumin preparations, dextran solutions, saline. Used in treatment of autoimmune diseases, immune complex diseases, diseases of excess plasma factors, and other conditions.Purpura, Thrombocytopenic: Any form of purpura in which the PLATELET COUNT is decreased. Many forms are thought to be caused by immunological mechanisms.Purpura, Thrombocytopenic, Idiopathic: Thrombocytopenia occurring in the absence of toxic exposure or a disease associated with decreased platelets. It is mediated by immune mechanisms, in most cases IMMUNOGLOBULIN G autoantibodies which attach to platelets and subsequently undergo destruction by macrophages. The disease is seen in acute (affecting children) and chronic (adult) forms.ADAM Proteins: A family of membrane-anchored glycoproteins that contain a disintegrin and metalloprotease domain. They are responsible for the proteolytic cleavage of many transmembrane proteins and the release of their extracellular domain.Flatulence: Production or presence of gas in the gastrointestinal tract which may be expelled through the anus.Institutionalization: The caring for individuals in institutions and their adaptation to routines characteristic of the institutional environment, and/or their loss of adaptation to life outside the institution.Heartburn: Substernal pain or burning sensation, usually associated with regurgitation of gastric juice into the esophagus.Drug-Related Side Effects and Adverse Reactions: Disorders that result from the intended use of PHARMACEUTICAL PREPARATIONS. Included in this heading are a broad variety of chemically-induced adverse conditions due to toxicity, DRUG INTERACTIONS, and metabolic effects of pharmaceuticals.Diagnostic Techniques and Procedures: Methods, procedures, and tests performed to diagnose disease, disordered function, or disability.Abbreviations as Topic: Shortened forms of written words or phrases used for brevity.Digestive System: A group of organs stretching from the MOUTH to the ANUS, serving to breakdown foods, assimilate nutrients, and eliminate waste. In humans, the digestive system includes the GASTROINTESTINAL TRACT and the accessory glands (LIVER; BILIARY TRACT; PANCREAS).Schools: Educational institutions.Desulfovibrio: A genus of gram-negative, anaerobic, rod-shaped bacteria capable of reducing sulfur compounds to hydrogen sulfide. Organisms are isolated from anaerobic mud of fresh and salt water, animal intestines, manure, and feces.

Speciation of Campylobacter coli, C. jejuni, C. helveticus, C. lari, C. sputorum, and C. upsaliensis by matrix-assisted laser desorption ionization-time of flight mass spectrometry. (1/1)

Multiple strains of Campylobacter coli, C. jejuni, C. helveticus, C. lari, C. sputorum, and C. upsaliensis isolated from animal, clinical, or food samples have been analyzed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). Whole bacterial cells were harvested from colonies or confluent growth on agar and transferred directly into solvent and then to a spot of dried 3-methoxy-4-hydroxycinnamic acid (matrix). Multiple ions in the 5,000- to 15,000-Da mass range were evident in spectra for each strain; one or two ions in the 9,500- to 11,000-Da range were consistently high intensity. "Species-identifying" biomarker ions (SIBIs) were evident from analyses of multiple reference strains for each of the six species, including the genome strains C. jejuni NCTC 11168 and C. jejuni RM1221. Strains grown on nine different combinations of media and atmospheres yielded SIBI masses within +/-5 Da with external instrument calibration. The highest-intensity C. jejuni SIBIs were cytosolic proteins, including GroES, HU/HCj, and RplL. Multiple intraspecies SIBIs, corresponding probably to nonsynonymous nucleotide polymorphisms, also provided some intraspecies strain differentiation. MALDI-TOF MS analysis of 75 additional Campylobacter strains isolated from humans, poultry, swine, dogs, and cats revealed (i) associations of SIBI type with source, (ii) strains previously speciated incorrectly, and (iii) "strains" composed of more than one species. MALDI-TOF MS provides an accurate, sensitive, and rapid method for identification of multiple Campylobacter species relevant to public health and food safety.  (+info)

Biohazard level, growth media and temperature, gram stain, industrial applications and more information forCampylobacter sputorum.
If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Centers RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.. ...
The phylogenetic relationships of all species in the genus Campylobacter, Wolinella succinogenes, and other gram-negative bacteria were determined by comparison of partial 16S ribosomal ribonucleic acid sequences. The results of this study indicate that species now recognized in the genus Campylobacter make up three separate ribosomal ribonucleic acid sequence homology groups. Homology group I contains the following true Campylobacter species: Campylobacter fetus (type species), Campylobacter coli, Campylobacter jejuni, Campylobacter laridis, Campylobacter hyointestinalis, Campylobacter concisus, Campylobacter mucosalis, Campylobacter sputorum, and
Casa Dental of Santa Ana provides emergency dental care for the whole family. Our emergency dentist can help stop the pain in a relaxed, caring environment.
INDO RUNNERS adalah gerakan lari independen terbesar di Indonesia (artikel detik.com 6 Des 2013), dengan misi menyebarkan virus lari ke seluruh lapisan masyarakat Indonesia. Ini adalah home base untuk Team
Campylobacter lari MeSH B03.440.180.650 --- Campylobacter rectus MeSH B03.440.180.700 --- Campylobacter sputorum MeSH B03.440. ... Campylobacter lari MeSH B03.660.150.100.700 --- Campylobacter rectus MeSH B03.660.150.100.740 --- Campylobacter sputorum MeSH ... Campylobacter MeSH B03.660.150.100.100 --- Campylobacter coli MeSH B03.660.150.100.220 --- Campylobacter fetus MeSH B03.660. ... Campylobacter coli MeSH B03.440.180.325 --- Campylobacter fetus MeSH B03.440.180.375 --- Campylobacter hyointestinalis MeSH ...
Campylobacter sputorum in their morphological and phenotypic characteristics and were given the name Campylobacter sputorum ... found that Campylobacter sputorum subsp. mucosalis is a distinct species and is not a subspecies of C. sputorum. Thus, its name ... Campylobacter mucosalis strains can be distinguished from all other catalase-negative Campylobacter strains except C. concisus ... Campylobacter mucosalis strains can be distinguished from Campylobacter concisus strains by their susceptibility to cephalothin ...
"Multilocus Sequence Typing Methods for the Emerging Campylobacter Species C. hyointestinalis, C. lanienae, C. sputorum, C. ... "Prevalence of Campylobacter Species in Adult Crohn's Disease and the Preferential Colonization Sites of Campylobacter Species ... P. Vandamme; F. E. Dewhirst; B. J. Paster; S. L. W. On (2005). "Genus I. Campylobacter". In Garrity, G.; Krieg, N. R.; Staley, ... Campylobacter concisus is a Gram-negative, highly fastidious, mesophilic bacterium that grows under both anaerobic and ...
C. sputorum. C. subantarcticus. C. upsaliensis. C. ureolyticus. C. volucris Campylobacter (meaning "curved bacteria") is a ... The confusing taxonomy of Campylobacter over the past decades make identifying the earliest reports of Campylobacter ... Similar studies have investigated the genes responsible for motility in Campylobacter species. All Campylobacter species ... "CAMPYLOBACTER : Food Safety Watch". www.foodsafetywatch.org. Retrieved 2017-03-17.. *^ a b Samie, A.; Obi, C.L.; Barrett, L.J ...
Campylobacter spp., Escherichia coli, Salmonella spp., Listeria spp., Shigella spp. and Trichinella spp.. animals domesticated ... milk, exhaled air, sputum, urine, faeces and pus from infected animals. Tularemia. Francisella tularensis. lagomorphs (type A) ... The most significant zoonotic pathogens causing foodborne diseases are Escherichia coli O157:H7, Campylobacter, Caliciviridae, ... Humphrey T, O'Brien S, Madsen M (2007). "Campylobacters as zoonotic pathogens: A food production perspective". International ...
S-layers have diverse but mostly poorly understood functions, but are known to act as virulence factors in Campylobacter and ... Often these techniques are designed for specific specimens; for example, a sputum sample will be treated to identify organisms ...
sputum, feces East Asia ingestion of raw or undercooked freshwater crabs crayfishes or other crustaceans ... Campylobacter jejuni *Campylobacteriosis, Guillain-Barré syndrome. *Helicobacter pylori *Peptic ulcer, MALT lymphoma, Gastric ...
... sputum, urine, faeces and pus, so the disease can be transmitted by direct contact, contact with the excreta of an infected ... Campylobacter jejuni. *Clostridium perfringens. *Escherichia coli O104:H4. *Escherichia coli O157:H7 ...
... blood or sputum.[2] ... Campylobacter jejuni *Campylobacteriosis, Guillain-Barré ...
Campylobacter spp., Escherichia coli, Salmonella spp., Listeria spp., Shigella spp. and Trichinella spp. animals domesticated ... milk, exhaled air, sputum, urine, faeces and pus from infected animals Tularemia Francisella tularensis lagomorphs (type A), ... The most significant zoonotic pathogens causing foodborne diseases are Escherichia coli O157:H7, Campylobacter, Caliciviridae, ... Humphrey T, O'Brien S, Madsen M (2007). "Campylobacters as zoonotic pathogens: A food production perspective". International ...
... is a BSL2 organism and should be considered a potential cause of human disease.. ... industrial applications and more information forCampylobacter sputorum. ...
Campylobacter sputorum biovar sputorum ATCC ® 49916™ Designation: LRA 116.06.89 TypeStrain=False Application: Quality control ... Campylobacter sputorum biovar sputorum On et al. (ATCC® 49916™) Strain Designations: LRA 116.06.89 / Type Strain: no / ...
Isolation of Campylobacter sputorum from lesions of papillomatous digital dermatitis in dairy cattle ... Isolation of Campylobacter sputorum from lesions of papillomatous digital dermatitis in dairy cattle ...
Campylobacter sputorum biovar sputorum On et al. (ATCC® 49916™) ATCC® Number: 49916™ Deposited As Campylobacter sputorum subsp ... Campylobacter upsaliensis Sandstedt and Ursing (ATCC® 43953™) ATCC® Number: 43953™ Strain Designations: NCTC 11540 [C303] ...
Molecular analysis and characterization of a urease gene operon from Campylobacter sputorum biovar paraureolyticus ...
Campylobacter sputorum bv. faecalis CCUG 20703 ATP synthase F1 complex alpha subunit (atpA) gene, complete cds. CCUG 20703 ... Intraspecific and Interspecific Relationships of Veterinary Campylobacters Revealed by Numerical-Analysis of Electrophoretic ...
fetus ATCC 27374, 435-bp fragment; lane 7: C. sputorum biovar fecalis ATCC 33711, 650-bp fragment of 23S rRNA (which occurred ... Colony Multiplex PCR Assay for Identification and Differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, ... Colony Multiplex PCR Assay for Identification and Differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, ... Colony Multiplex PCR Assay for Identification and Differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, ...
Campylobacter food poisoning. 182. Campylobacter jejuni infection. 183. Campylobacter sputorum infection. 184. Cancer. 185. ...
9. Campylobacter sputorum infection. 10. Candidiasis. More causes » , Show All Causes , Show causes with descriptions. , Start ...
C. sputorum. C. upsaliensis Campylobacter is a bacterium. It is found in the intestines of many types of animals. Campylobacter ... Alpha · Beta · Gamma/Enterobacteriaceae (Salmonella, Vibrio, Shigella) · Delta · Epsilon (Campylobacter) / Aquificae (Aquifex) ... a b c Samie A, Obi CL, Barrett LJ, Powell SM, Guerrant RL (June 2007). "Prevalence of Campylobacter species, Helicobacter ... Genus: Campylobacter. Species: C. concisus - C. curvus - C. fetus - C. hominis - C. jejuni ...
Over the past decade, studies on human hosted Campylobacter species strongly suggest that Campylobacter concisus plays a role ... Over the past decade, studies on human hosted Campylobacter species strongly suggest that Campylobacter concisus plays a role ... Here we review the most recent advancements on C. concisus and other human hosted Campylobacter species including their ... Here we review the most recent advancements on C. concisus and other human hosted Campylobacter species including their ...
Campylobacter concisus ATCC 33237. ɛ-Proteobacteria. +. Campylobacter sputorum subsp. sputorum ATCC 35980. ɛ-Proteobacteria. + ... Campylobacter concisus (FDC 288). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGTGGC GT GCCTAA T ACATGCAA-GTC. G T CTTGTAC ... Campylobacter showae (CCUG 3054). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA-GTC. G T CTTGTAC ... Campylobacter rectus (CCUG 19168). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA-GTC. G T ...
skirrowii BT59/06; I, Campylobacter sputorum subsp. bubulus; J, C. hyointestinalis NCTC11608; and K, C. fetus subsp fetus. ... Campylobacter incidence on a chicken farm and the spread of Campylobacter during the slaughter process. Int. J. Food Microbiol. ... Sequential hybridization of Campylobacter with the SVR probes. A mixture of five Campylobacter strains on mCCDA (A) was probed ... The 16S rRNA probe also specifically enumerated Campylobacter spp. on selective plates, on which Campylobacter colonies can be ...
Stool culture was negative for Campylobacter, Escherichia coli 0157, Salmonella, Yersinia and Shigella. Multiple sputum samples ...
Campylobacter sputorum infection ... osteomyelitis*Camurati-Engelmann Disease ... scoliosis, knock-knee, coxa valga, changes in ...
Electron transport-linked proton translocation at nitrite reduction in Campylobacter sputorum subspeciesbubulus. Arch. ...
Campylobacter sputorum in their morphological and phenotypic characteristics and were given the name Campylobacter sputorum ... found that Campylobacter sputorum subsp. mucosalis is a distinct species and is not a subspecies of C. sputorum. Thus, its name ... Campylobacter mucosalis strains can be distinguished from all other catalase-negative Campylobacter strains except C. concisus ... Campylobacter mucosalis strains can be distinguished from Campylobacter concisus strains by their susceptibility to cephalothin ...
... the risk of broiler carcass contamination is greater when there is a higher degree of Campylobacter intestinal colonization of ... Clonality of Campylobacter sputorum bv. paraureolyticus determined by macrorestriction profiling and biotyping, and evidence ... The effects of Campylobacter numbers in caeca on the contamination of broiler carcasses with Campylobacter. Int J Food ... Shedding of Campylobacter spp. in Finnish cattle on dairy farms. J Appl Microbiol 107:898-905.[PubMed][CrossRef]. ...
Sixty-nine reference strains and 19 clinical isolates of Campylobacter jejuni subsp. jejuni, … ... fingerprinting method was tested for its ability to identify and subtype the most important Campylobacter species found in ... lawsonii, Campylobacter mucosalis, Campylobacter helveticus and Campylobacter sputorum were subjected to analysis. The topology ... jejuni, Campylobacter jejuni subsp. doylei, Campylobacter upsaliensis, Campylobacter coli, Campylobacter lari, Campylobacter ...
De Vries W, Niekus HG, Boellaard M, Stouthamer AH (1980) Growth yields and energy generation by Campylobacter sputorum ... Electron transport-linked proton translocation at nitrite reduction in Campylobacter sputorum subspecies bubulus. Arch ... nov., Campylobacter concisus sp. nov. and Eikenella corrodens from humans with peridontal disease. Intern J Sys Bacteriol 31: ...
Total viable count and differential count ofVibrio (Campylobacter) sputorum, Fusobacterium nucleatum, Selenomonas sputigena, ...
"Multilocus Sequence Typing Methods for the Emerging Campylobacter Species C. hyointestinalis, C. lanienae, C. sputorum, C. ... "Prevalence of Campylobacter Species in Adult Crohns Disease and the Preferential Colonization Sites of Campylobacter Species ... P. Vandamme; F. E. Dewhirst; B. J. Paster; S. L. W. On (2005). "Genus I. Campylobacter". In Garrity, G.; Krieg, N. R.; Staley, ... Campylobacter concisus is a Gram-negative, highly fastidious, mesophilic bacterium that grows under both anaerobic and ...
Speciation of Campylobacter coli, C. jejuni, C. helveticus, C. lari, C. sputorum, and C. upsaliensis by matrix-assisted laser ... Genotypic identification of erythromycin-resistant Campylobacter isolates as Helicobacter species and analysis of resistance ... Major errors were one identification as Acinetobacter species instead of Campylobacter jejuni, and two Sphingomonas spp. ... 3 of 10 Campylobacter coli, 1 of 2 Chryseobacterium species, 1 of 3 Haemophilus parainfluenzae, 1 of 2 Sphingomonas ...
Campylobacter laridis infection ... diarrhea, abdominal pain, nausea, vomiting, vomiting*Campylobacter sputorum infection ... ... Campylobacter jejuni ... bloody diarrhea, abdominal pain, nausea, vomiting, vomiting*Campylobacter jejuni infection ... bloody ... Campylobacter fetus infection ... intermittent diarrhea, abdominal pain, nausea*Campylobacter food poisoning ... bloody ... Campylobacter fetus infection ... toxic megacolon*Campylobacter jejuni infection ... diarrhea*Caterpillar complication ...
Campylobacter sputorum (Prévot 1940) Véron and Chatelain 1973 (Approved Lists 1980) emend. On et al. 1998. (Part 1) ...
  • Determining the survival and persistence of Campylobacter at different sites is essential for the development of farm-to-fork strategies for the control and prevention of food-borne campylobacteriosis and, in particular, to inform quantitative risk assessment models. (asm.org)
  • Even though studies have repeatedly identified domestic dogs as a risk factor for human campylobacteriosis, our understanding of Campylobacter ecology in this reservoir is limited. (biomedcentral.com)
  • Campylobacter concisus , which was in last month's update of aerobic bacteria names, is also in the update of anaerobic bacteria that follows because it is an obligate anaerobe. (thefreedictionary.com)
  • Campylobacter - this is a very dangerous bacteria and it is common during the winter months. (mycarpetstinks.com)
  • thought process which is common practice for driving with diabetes the critically ill patients impairment of the medial pre- frontal cortex and increased bowel permeability, allowing bacteria to pass through the late afternoon, and coincides with a ziehlnielsen stain, sputum culture results. (iama.edu)
  • Colony lifts of campylobacters were hybridized sequentially with up to two labeled strain-specific probes, followed by the generic 16S rRNA probe. (asm.org)
  • Campylobacter concisus is a Gram-negative, highly fastidious, mesophilic bacterium that grows under both anaerobic and microaerobic conditions with the presence of hydrogen significantly aiding growth. (wikipedia.org)
  • A Gram stain of sputum shows segmented neutrophils and small gram-negative rods that stain poorly. (benwhite.com)
  • Multiple sputum samples were negative for acid-fast bacilli. (cmaj.ca)
  • Carcass contamination is related to the within-flock prevalence of campylobacter colonization ( 1 ). (asm.org)
  • Many mycobacteria are commonly isolated from the environment (especially water), and may colonize normally nonsterile body sites, such as sputum and wounds. (cdc.gov)
  • Gastric lavage or sputum samples were collected from consecutively enrolled TB suspect children visiting Jimma University Hospital in 2011 and cultured on Middlebrook 7H11 and Löwenstein-Jensen media. (biomedcentral.com)
  • Gastric lavage (n = 43) or sputum (n = 58) samples were collected from 101 children and 31.7% (32/101) of the samples were positive for AFB by microscopy, culture and/or PCR. (biomedcentral.com)
  • Sometimes a sputum culture test is done, but Mycoplasma don't grow well in a culture. (ahealthyme.com)
  • Secondary EN often requires treatment of the instigating underlying process to treat the skin lesions. (renalandurologynews.com)