A species of CAMPYLOBACTER isolated from cases of human PERIODONTITIS. It is a microaerophile, capable of respiring with OXYGEN.
A genus of bacteria found in the reproductive organs, intestinal tract, and oral cavity of animals and man. Some species are pathogenic.
Infections with bacteria of the genus CAMPYLOBACTER.
A species of bacteria that resemble small tightly coiled spirals. Its organisms are known to cause abortion in sheep and fever and enteritis in man and may be associated with enteric diseases of calves, lambs, and other animals.
A species of gram-negative, anaerobic, rod-shaped bacteria originally classified within the BACTEROIDES genus. This bacterium is a common commensal in the gingival crevice and is often isolated from cases of gingivitis and other purulent lesions related to the mouth.
A species of bacteria in the family SPIROCHAETACEAE, frequently isolated from periodontal pockets (PERIODONTAL POCKET).
A species of bacteria present in man and many kinds of animals and birds, often causing infertility and/or abortion.
A long flat muscle that extends along the whole length of both sides of the abdomen. It flexes the vertebral column, particularly the lumbar portion; it also tenses the anterior abdominal wall and assists in compressing the abdominal contents. It is frequently the site of hematomas. In reconstructive surgery it is often used for the creation of myocutaneous flaps. (From Gray's Anatomy, 30th American ed, p491)
A species of gram-negative, rod-shaped bacteria isolated from the intestinal tract of swine, poultry, and man. It may be pathogenic.
An abnormal extension of a gingival sulcus accompanied by the apical migration of the epithelial attachment and bone resorption.
A film that attaches to teeth, often causing DENTAL CARIES and GINGIVITIS. It is composed of MUCINS, secreted from salivary glands, and microorganisms.
The muscles that move the eye. Included in this group are the medial rectus, lateral rectus, superior rectus, inferior rectus, inferior oblique, superior oblique, musculus orbitalis, and levator palpebrae superioris.
A species of thermophilic CAMPYLOBACTER found in healthy seagulls and causing ENTERITIS in humans.
The CHEMICAL PROCESSES that occur within the cells, tissues, or an organism and related temporal, spatial, qualitative, and quantitative concepts.
DNA analogs containing neutral amide backbone linkages composed of aminoethyl glycine units instead of the usual phosphodiester linkage of deoxyribose groups. Peptide nucleic acids have high biological stability and higher affinity for complementary DNA or RNA sequences than analogous DNA oligomers.
Methods and techniques used to genetically modify cells' biosynthetic product output and develop conditions for growing the cells as BIOREACTORS.
The study, utilization, and manipulation of those microorganisms capable of economically producing desirable substances or changes in substances, and the control of undesirable microorganisms.
One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
A benign familial disorder, transmitted as an autosomal dominant trait. It is characterized by low-grade chronic hyperbilirubinemia with considerable daily fluctuations of the bilirubin level.
A method of differentiating individuals based on the analysis of qualitative or quantitative biological traits or patterns. This process which has applications in forensics and identity theft prevention includes DNA profiles or DNA fingerprints, hand fingerprints, automated facial recognition, iris scan, hand geometry, retinal scan, vascular patterns, automated voice pattern recognition, and ultrasound of fingers.
Machine readable patient or equipment identification device using radio frequency from 125 kHz to 5.8 Ghz.
Illegitimate use of substances for a desired effect in competitive sports. It includes humans and animals.
A chromogenic substrate that permits direct measurement of peptide hydrolase activity, e.g., papain and trypsin, by colorimetry. The substrate liberates p-nitroaniline as a chromogenic product.
Inborn errors of bilirubin metabolism resulting in excessive amounts of bilirubin in the circulating blood, either because of increased bilirubin production or because of delayed clearance of bilirubin from the blood.
Solutions for rinsing the mouth, possessing cleansing, germicidal, or palliative properties. (From Boucher's Clinical Dental Terminology, 4th ed)
Examination of foods to assure wholesome and clean products free from unsafe microbes or chemical contamination, natural or added deleterious substances, and decomposition during production, processing, packaging, etc.
Small-scale tests of methods and procedures to be used on a larger scale if the pilot study demonstrates that these methods and procedures can work.
A plant genus of the family GENTIANACEAE. Triterpene lactones and other compounds have been isolated from species of this genus. The common name of century plant has also been used for the AGAVE genus.
The science dealing with the establishment and maintenance of health in the individual and the group. It includes the conditions and practices conducive to health. (Webster, 3d ed)
The oval-shaped oral cavity located at the apex of the digestive tract and consisting of two parts: the vestibule and the oral cavity proper.
An acquired, congenital, or familial disorder caused by PLATELET AGGREGATION with THROMBOSIS in terminal arterioles and capillaries. Clinical features include THROMBOCYTOPENIA; HEMOLYTIC ANEMIA; AZOTEMIA; FEVER; and thrombotic microangiopathy. The classical form also includes neurological symptoms and end-organ damage, such as RENAL FAILURE.
A syndrome that is associated with microvascular diseases of the KIDNEY, such as RENAL CORTICAL NECROSIS. It is characterized by hemolytic anemia (ANEMIA, HEMOLYTIC); THROMBOCYTOPENIA; and ACUTE RENAL FAILURE.
Removal of plasma and replacement with various fluids, e.g., fresh frozen plasma, plasma protein fractions (PPF), albumin preparations, dextran solutions, saline. Used in treatment of autoimmune diseases, immune complex diseases, diseases of excess plasma factors, and other conditions.
Any form of purpura in which the PLATELET COUNT is decreased. Many forms are thought to be caused by immunological mechanisms.
Thrombocytopenia occurring in the absence of toxic exposure or a disease associated with decreased platelets. It is mediated by immune mechanisms, in most cases IMMUNOGLOBULIN G autoantibodies which attach to platelets and subsequently undergo destruction by macrophages. The disease is seen in acute (affecting children) and chronic (adult) forms.
A family of membrane-anchored glycoproteins that contain a disintegrin and metalloprotease domain. They are responsible for the proteolytic cleavage of many transmembrane proteins and the release of their extracellular domain.
Substances that are recognized by the immune system and induce an immune reaction.
In Chinese philosophy and religion, two principles, one negative, dark, and feminine (yin) and one positive, bright, and masculine (yang), from whose interaction all things are produced and all things are dissolved. As a concept the two polar elements referred originally to the shady and sunny sides of a valley or a hill but it developed into the relationship of any contrasting pair: those specified above (female-male, etc.) as well as cold-hot, wet-dry, weak-strong, etc. It is not a distinct system of thought by itself but permeates Chinese life and thought. A balance of yin and yang is essential to health. A deficiency of either principle can manifest as disease. (Encyclopedia Americana)
The process whereby a representation of past experience is elicited.
A ubiquitously expressed zinc finger-containing protein that acts both as a repressor and activator of transcription. It interacts with key regulatory proteins such as TATA-BINDING PROTEIN; TFIIB; and ADENOVIRUS E1A PROTEINS.
Substances elaborated by bacteria that have antigenic activity.
Proteins, glycoprotein, or lipoprotein moieties on surfaces of tumor cells that are usually identified by monoclonal antibodies. Many of these are of either embryonic or viral origin.
A phylum of bacteria comprised of three classes: Bacteroides, Flavobacteria, and Sphingobacteria.
A plant genus of the family OLEACEAE. Members contain suspensaside.
The chemical or biochemical addition of carbohydrate or glycosyl groups to other chemicals, especially peptides or proteins. Glycosyl transferases are used in this biochemical reaction.
The systematic study of the structure and function of the complete set of glycans (the glycome) produced in a single organism and identification of all the genes that encode glycoproteins.
A species of gram-negative, anaerobic, rod-shaped bacteria originally classified within the BACTEROIDES genus. This bacterium produces a cell-bound, oxygen-sensitive collagenase and is isolated from the human mouth.

Correlation between detection rates of periodontopathic bacterial DNA in coronary stenotic artery plaque [corrected] and in dental plaque samples. (1/21)

Utilizing PCR, the 16S rRNA detection rates for Porphyromonas gingivalis, Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Treponema denticola, and Campylobacter rectus in samples of stenotic coronary artery plaques were determined to be 21.6, 23.3, 5.9, 23.5, and 15.7%, respectively. The detection rates for P. gingivalis and C. rectus correlated with their presence in subgingival plaque.  (+info)

Campylobacter surface-layers (S-layers) and immune evasion. (2/21)

Many pathogenic bacteria have evolved mechanisms for evading host immune systems. One evasion mechanism is manifest by the surface layer (S-layer), a paracrystalline protein structure composed of S-layer proteins (SLPs). The S-layer, possessed by 2 Campylobacter species (C. fetus and C. rectus), is external to the bacterial outer membrane and can have multiple functions in immune avoidance. C. fetus is a pathogen of ungulates and immunocompromised humans, in whom it causes disseminated bloodstream disease. In C. fetus, the S-layer is required for dissemination and is involved in 2 mechanisms of evasion. First, the S-layer confers resistance to complement-mediated killing in non-immune serum by preventing the binding of complement factor C3b to the C. fetus cell surface. S-layer expressing C. fetus strains remain susceptible to complement-independent killing, utilizing opsonic antibodies directed against the S-layer. However, C. fetus has also evolved a mechanism for avoiding antibody-mediated killing by high-frequency antigenic variation of SLPs. Antigenic variation is accomplished by complex DNA inversion events involving a family of multiple SLP-encoding genes and a single SLP promoter. Inversion events result in the expression of antigenically variant S-layers, which require distinct antibody responses for killing. C. rectus is implicated in the pathogenesis of periodontal disease and also possesses an S-layer that appears to be involved in evading the human system. Although studied less extensively than its C. fetus counterpart, the C. rectus S-layer appears to confer resistance to complement-mediated killing and to cause the down-regulation of proinflammatory cytokines.  (+info)

The detection of eight putative periodontal pathogens in adult and rapidly progressive periodontitis patients: an institutional study. (3/21)

PURPOSE: Periodontal disease is a commonly prevalent problem faced alike by both the developed and third world countries but showing wide variations in prevalence and severity across different geographical areas. The purpose was to identify Actinobacillus actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Prevotella intermedia (Pi), Ekinella corrodens (Ec), Campylobacter rectus (Cr), Bacteroides forsythus (Bf), Treponema denticola (Td) and Fusobacterium nucleatum (Fn) in Indian adult periodontitis and rapidly progressive periodontitis patients. MATERIALS AND METHODS: Paper points were used to collect the sample from 28 sites in both adult periodontitis and rapidly progressive periodontitis (8 healthy/20 diseased sites) patients and DNA analysis done. The categorical data was analysed by Fishers exact test and difference in the clinical parameters was tested by Mann-Whitney test. RESULTS: In healthy sites of adult and rapidly progressive periodontitis patients, Aa, Ec, Bf and Aa, Pg, Pi, Td, Fn were detected respectively. However, when diseased and healthy sites were compared in both adult periodontitis and rapidly progressive periodontitis patients respectively, only Pg( P =0.004), Cr( P =0.04), Fn( P =0.014) and Pg( P =0.002), Cr( P =0.02), Fn( P =0.008) were statistically significant. CONCLUSION: The prevalence of the microorganisms correlate with the clinical parameters like probing depth and bleeding on probing as seen in the Japanese and Western periodontitis patients' population.  (+info)

Population-based study of salivary carriage of periodontal pathogens in adults. (4/21)

Large, general population-based data on carriage rates of periodontal pathogens hardly exist in the current literature. The objectives of the present study were to examine the salivary detection of Aggregatibacter (formerly Actinobacillus) actinomycetemcomitans, Campylobacter rectus, Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythensis, and Treponema denticola in a representative sample of the adult population living in southern Finland and to clarify which determinants are associated with the presence of these pathogens in saliva. 16S rRNA-based PCR methods with species-specific primers were employed to determine the presence of the six target bacteria in stimulated saliva samples, which were available from 1,294 subjects aged > or =30 years. The age group, gender, level of education, marital status, smoking history, number of teeth, and number of teeth with deepened pockets were included in the statistical analysis. In general, the carriage of periodontal pathogens was common, since at least one of the examined pathogens was found in 88.2% of the subjects. In descending order, the total detection rates were 56.9%, 38.2%, 35.4%, 31.3%, 20.0%, and 13.9% for T. forsythensis, T. denticola, P. gingivalis, C. rectus, A. actinomycetemcomitans, and P. intermedia, respectively. Age per se was strongly associated with the carriage of P. gingivalis (P = 0.000), and the level of education with that of T. denticola (P = 0.000). There was an association between the number of teeth with deepened pockets and carriage of P. gingivalis (P = 0.000), P. intermedia (P = 0.000), T. denticola (P = 0.000), and A. actinomycetemcomitans (P = 0.004). The data suggest that distinct species have a different carriage profile, depending on variables such as age, educational level, and periodontal status.  (+info)

Granulocyte chemotactic protein 2 (gcp-2/cxcl6) complements interleukin-8 in periodontal disease. (5/21)

 (+info)

Increased TLR4 expression in murine placentas after oral infection with periodontal pathogens. (6/21)

 (+info)

Oral abscess caused by Campylobacter rectus: case report and literature review. (7/21)

 (+info)

Systemic immune responses in pregnancy and periodontitis: relationship to pregnancy outcomes in the Obstetrics and Periodontal Therapy (OPT) study. (8/21)

 (+info)

Background: The aim of this investigation was to quantify periodontal pathogens (Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Campylobacter rectus and Tannerella forsythia) in vascular, blood and subgingival samples. As secondary objective, two molecular bacterial identification methods [nested-polimerase chain reaction (PCR) and quantitative PCR (qPCR)] were compared.. Methods: Seventy consecutive patients provided a vascular lesion, a blood sample, and 36 subgingival samples. Bacterial deoxyribonucleic acid (DNA) was extracted and qPCR was used to determine the prevalence and amounts of the target pathogens in each sample. Nested-PCR was only performed in the samples from vascular lesions. Periodontal examination was performed in 42 patients. U-Mann-Whitney or Chi-squared tests were used to compare microbiological results according to periodontal diagnosis.. Results: All targeted periodontal pathogens (A. actinomycetemcomitans, P. gingivalis, T. forsythia or C. rectus) were ...
Objective: To investigate periodontal status of patients with pre-diabetes and evaluate the prevalence of periodontal pathogens in oral cavity. Methods: All the subjects were under regular care in urban area of Beijing, including 88 subjects with normal blood glucose (normal blood glucose group), 27 pre-diabetic patients (pre-diabetic group), 58 well-controlled diabetic patients (glucose well controlled group) and 72 poor-controlled diabetic patients (glucose poor controlled group). Whole unstimulated saliva samples were collected before periodontal examination. Periodontal parameters, including plaque index (PLI), probing depth (PD), bleeding index (BI), bleeding on probing (BOP) and clinical attachment loss (CAL), were examined at mesial-buccal and distal-lingual sites of each tooth. Number of missing teeth was recorded. DNA was extracted from the salivary deposition, Porphyromonas gingivalis (Pg), Tannerella forsythia (Tf), Treponema denticola (Td), Campylobacter rectus (Cr), and Prevotella ...
It is well documented that the double-stranded DNA (dsDNA) genomes of certain viruses and the proviral genomes of retroviruses are regularly targeted by epigenetic regulatory mechanisms (DNA methylation, histone modifications, binding of regulatory proteins) in infected cells. In parallel, proteins encoded by viral genomes may affect the activity of a set of cellular promoters by interacting with the very same epigenetic regulatory machinery. This may result in epigenetic dysregulation and subsequent cellular dysfunctions that may manifest in or contribute to the development of pathological changes (e.g. initiation and progression of malignant neoplasms; immunodeficiency). Bacteria infecting mammals may cause diseases in a similar manner, by causing hypermethylation of key cellular promoters at CpG dinucleotides (promoter silencing, e.g. by Campylobacter rectus in the placenta or by Helicobacter pylori in gastric mucosa). I suggest that in addition to viruses and bacteria, other microparasites ...
Affiliation:徳島大,歯学部,助手, Research Field:矯正・小児・社会系歯学,Periodontal dentistry, Keywords:Campylobacter rectus GroEL,ヒト歯肉線維芽細胞,歯周病,歯周ポケット,MMP-9,MMP-2,歯周病原細菌,Measurement of antibody titers,MMP阻害剤,BIAcore装置, # of Research Projects:3, # of Research Products:0
The development of dental caries and periodontal diseases result from distinct shifts in the microbiota of the tooth-associated biofilm. This in vitro study aimed to investigate changes in biofilm composition and structure, during the shift from a supragingival aerobic profile to a subgingival anaerobic profile. Biofilms consisting of Actinomyces oris, Candida albicans, Fusobacterium nucleatum, Streptococcus oralis, Streptococcus mutans and Veillonella dispar were aerobically grown in saliva-containing medium on hydroxyapatite disks. After 64 h, Campylobacter rectus, Prevotella intermedia and Streptococcus anginosus were further added along with human serum, while culture conditions were shifted to microaerophilic. After 96 h, Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola were finally added and the biofilm was grown anaerobically for another 64 h. At the end of each phase, biofilms were harvested for species-specific quantification and localization. Apart from C. ...
SEA080Hu, ELISA Kit for Interleukin 8 (IL8), Homo sapiens (Human), Sandwich ELISA, CXCL8, AMCF-I, GCP1, K60, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP1, SCYB8, TSG1, B-ENAP, Neutrophil-Activating Protein 1, Granulocyte Chemotactic Protein 1, Designed by Cloud-Clone Corp.
LAA080Hu82, FITC-Linked Monoclonal Antibody to Interleukin 8 (IL8), CXCL8; AMCF-I; GCP1; K60; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP1; SCYB8; TSG1; B-ENAP; Neutrophil-Activating Protein 1; Granulocyte Chemotactic Protein 1 | Products for research use only!
Periodontal disease is one of the most common health problem affecting dogs. The disease is more prevalent in small breeds and brachycephalic breeds compared to large breeds, and incidence increases with advancing age. In first stage it affects only the gingival tissue and causes gingivitis. It later develops into periodontitis which involves changes in other periodontium tissues. Main etiological agents of periodontal disease are pathogenic bacteria of dental biofilm, and products of their metabolism. In human, Porphyromonas gingivalis, Treponema denticola and Tannerella forsythia play a key role in the etiology of periodontal disease. Also, there are many other candidates as human periodontal pathogens, including Aggregatibacter actinomycetemcomitans, Prevotella intermedia, Prevotella nigrescens, Fusobacterium nucleatum, Parvimonas micra, Eikenella corrodens, Capnocytophaga gingivalis, Eubacterium nodatum and Campylobacter rectus. Since periodontal diseases in dogs are similar to human diseases in
Principal Investigator:KATO Tetsuo, Project Period (FY):1996 - 1998, Research Category:Grant-in-Aid for Scientific Research (C), Section:一般, Research Field:Morphological basic dentistry
Scapoli, L., Arcuri, C., DOrto, O., Bolzoni, A., Lagana, F., & Carinci, F. (2019). Screening of periodontopathic bacteria in Italian patients affected by periodontitis. JOURNAL OF BIOLOGICAL REGULATORS & HOMEOSTATIC AGENTS, 33(6), 15-20 ...
TY - JOUR. T1 - Relationship of periodontal infection to serum antibody levels to periodontopathic bacteria and inflammatory markers in periodontitis patients with coronary heart disease. AU - Yamazaki, K.. AU - Honda, T.. AU - Domon, H.. AU - Okui, T.. AU - Kajita, K.. AU - Amanuma, R.. AU - Kudoh, C.. AU - Takashiba, S.. AU - Kokeguchi, S.. AU - Nishimura, F.. AU - Kodama, M.. AU - Aizawa, Y.. AU - Oda, H.. PY - 2007/9/1. Y1 - 2007/9/1. N2 - Several reports have demonstrated a possible association of periodontal infections with coronary heart disease (CHD) by elevated antibody titre to periodontopathic bacteria in CHD patients compared with non-diseased controls. Although each periodontopathic bacterium may vary in virulence for periodontitis and atherosclerosis, antibody response to multiple bacteria in CHD patients has not been understood fully. Therefore, serum levels of antibody to 12 periodontopathic bacteria together with other atherosclerotic risk markers were compared among 51 patients ...
LAA080Ca81, FITC-Linked Polyclonal Antibody to Interleukin 8 (IL8), 白介素8(IL8)多克隆抗体(异硫氰酸荧光素标记), CXCL8; AMCF-I; GCP1; K60; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP1; SCYB8; TSG1; B-ENAP; Neutrophil-Activating Protein 1; Granulocyte Chemotactic Protein 1 | 仅供体外研究使用,不用于临床诊断!请索取进口关税税单及报关单!
IEA080Ov, CXCL8; AMCF-I; GCP1; K60; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP1; SCYB8; TSG1; B-ENAP; Neutrophil-Activating Protein 1; Granulocyte Chemotactic Protein 1 | Products for research use only!
Upper abs, lower abs LOL The whole concept was designed by fitness machine manufacturers as a way of differentiating their ab roller, ab king, ab blaster etc etc from their competitor. There are no such thing. Your rectus is one muscle as NB said but you can not work one more than the other, why? Simple, the rectus, the whole rectus is innervated by the same nerves; it fires the whole lot fires at similar levels during any flexor torque generation. That said a very small number of people can activate one section differently in some activities but it is certainly not the norm. The obliques are another story though and they do have a number of seperate neural areas. So do one rectus exercise and use the time you save on some other exercise ...
Upper abs, lower abs LOL The whole concept was designed by fitness machine manufacturers as a way of differentiating their ab roller, ab king, ab blaster etc etc from their competitor. There are no such thing. Your rectus is one muscle as NB said but you can not work one more than the other, why? Simple, the rectus, the whole rectus is innervated by the same nerves; it fires the whole lot fires at similar levels during any flexor torque generation. That said a very small number of people can activate one section differently in some activities but it is certainly not the norm. The obliques are another story though and they do have a number of seperate neural areas. So do one rectus exercise and use the time you save on some other exercise ...
Looking for online definition of Stimulated T-cell chemotactic protein 1 in the Medical Dictionary? Stimulated T-cell chemotactic protein 1 explanation free. What is Stimulated T-cell chemotactic protein 1? Meaning of Stimulated T-cell chemotactic protein 1 medical term. What does Stimulated T-cell chemotactic protein 1 mean?
Manning, D D., Complete humoral immunosuppression of mice by rabbit anti-mu antibodies passing the murine placenta. (1977). Subject Strain Bibliography 1977. 2110 ...
Monoclonal antibody against Tannerella forsythia, strain FDC 331 (OMZ 348) expressed by for use in Western Blot against Tannerella forsythia
Tannerella forsythia ATCC ® 43037D-5™ Designation: Genomic DNA from Tannerella forsythia strain FDC 338 TypeStrain=True Application:
KSA080Ca01, ELISA Kit DIY Materials for Interleukin 8 (IL8), 白介素8(IL8)检测试剂盒DIY材料(酶联免疫吸附试验法), CXCL8; AMCF-I; GCP1; K60; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP1; SCYB8; TSG1; B-ENAP; Neutrophil-Activating Protein 1; Granulocyte Chemotactic Protein 1 | 仅供体外研究使用,不用于临床诊断!请索取进口关税税单及报关单!
Principal Investigator:KATO Ihachi, Project Period (FY):1996 - 1997, Research Category:Grant-in-Aid for Scientific Research (B), Section:一般, Research Field:Conservative dentistry
P. melaninogenica is associated with hypertension together with Campylobacter rectus and Veillonella parvula. P. melaninogenica ...
Standardized bacterial suspensions containing Fusobacterium nucleatum, Campylobacter rectus and Peptostreptococcus micros were ...
Microaerophile bacteria Actinomyces actinomycetemcomitans, Campylobacter rectus, and Eikenella corrodens also may play a role ...
Antibodies to the oral pathogens Campylobacter rectus, Veillonella parvula, Prevotella melaninogenica were associated with ...
... been isolated from women with bacterial vaginosis and has been associated with hypertension together with Campylobacter rectus ...
Campylobacter jejuni MeSH B03.440.180.500 - Campylobacter lari MeSH B03.440.180.650 - Campylobacter rectus MeSH B03.440.180.700 ... Campylobacter jejuni MeSH B03.660.150.100.450 - Campylobacter lari MeSH B03.660.150.100.700 - Campylobacter rectus MeSH B03.660 ... Campylobacter MeSH B03.660.150.100.100 - Campylobacter coli MeSH B03.660.150.100.220 - Campylobacter fetus MeSH B03.660.150.100 ... Campylobacter coli MeSH B03.440.180.325 - Campylobacter fetus MeSH B03.440.180.375 - Campylobacter hyointestinalis MeSH B03.440 ...
Streptococcus intermedius Campylobacter rectus Capnocytophaga sp. A number of types of fungi, especially Candida spp., also ...
... campylobacter rectus & syllitus rectus In anatomy it is used to refer to a rectus muscle, primarily e.g. the "rectus abdominis ... Inferior rectus muscle Superior rectus muscle Lateral rectus muscle Medial rectus muscle Musculus rectus thoracis Rectus ... "rectus" In grammar "casus rectus" is a formal term for nominative case In mathematics sine is also known as "sinus rectus" In ... "Rectus" is the Latin word meaning "straight" and is used in English to refer to multiple topics in the sciences, including: In ...
... is a species of Campylobacter. It is implicated as a pathogen in chronic periodontitis, which can induce ... Type strain of Campylobacter rectus at BacDive - the Bacterial Diversity Metadatabase v t e. ... "Characterization of the invasive and inflammatory traits of oral Campylobacter rectus in a murine model of fetoplacental growth ... C. rectus is associated with hypertension together with Prevotella melaninogenica and Veillonella parvula. Pietropaoli, Davide ...
C. rectus. C. showae. C. sputorum. C. subantarcticus. C. upsaliensis. C. ureolyticus. C. volucris ... Campylobacter (meaning "curved bacteria") is a genus of Gram-negative bacteria.[1] Campylobacter typically appear comma or s- ... The confusing taxonomy of Campylobacter over the past decades make identifying the earliest reports of Campylobacter ... Similar studies have investigated the genes responsible for motility in Campylobacter species. All Campylobacter species ...
Campylobacter rectus is a species of Campylobacter. It is implicated as a pathogen in chronic periodontitis, which can induce ... Type strain of Campylobacter rectus at BacDive - the Bacterial Diversity Metadatabase v t e. ... "Characterization of the invasive and inflammatory traits of oral Campylobacter rectus in a murine model of fetoplacental growth ... C. rectus is associated with hypertension together with Prevotella melaninogenica and Veillonella parvula. Pietropaoli, Davide ...
Genomic DNA from Campylobacter rectus strain FDC 371 (ATCC ® 33238™) TypeStrain=True Application: ... Campylobacter rectus, complete 16S ribosomal RNA. Nucleotide (GenBank) : AB001876 Campylobacter rectus gene for S-layer protein ... Campylobacter rectus (Tanner et al.) Vandamme et al. (ATCC® 33238D-5™) Strain Designations: Genomic DNA from Campylobacter ... Campylobacter rectus (Tanner et al.) Vandamme et al. ATCC® 33238D-5™ freeze-dried At least 5 µg in 1X TE buffer ...
C. rectus, formerly known as Wolinella recta, is a periodontal pathogen causing chronic periodontitis and extraoral abscesses ... At least seven Campylobacter species have been identified from subgingival sites. Campylobacter rectus has been implicated as a ... Purification and characterization of Campylobacter rectus surface layer proteins.. *Hajime Nitta, Stanley C. Holt, Jefferey L. ... Campylobacter rectus. Known as: Wolinella recta A species of microaerophilic, Gram-negative, straight bacilli assigned to the ...
The samples were assessed for Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Campylobacter rectus, Porphyromonas ... The samples were assessed for Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Campylobacter rectus, Porphyromonas ... Campylobacter rectus, and Prevotella nigrescens. Journal of Dental Research, 73(8):1421-1428. ... In contrast, P. gingivalis was found only in a single sample, which in addition harbored B. forsythus, C. rectus, A. ...
Over the past decade, studies on human hosted Campylobacter species strongly suggest that Campylobacter concisus plays a role ... Over the past decade, studies on human hosted Campylobacter species strongly suggest that Campylobacter concisus plays a role ... Here we review the most recent advancements on C. concisus and other human hosted Campylobacter species including their ... Here we review the most recent advancements on C. concisus and other human hosted Campylobacter species including their ...
Miyamoto M, Maeda H, Kitanaka M, Kokeguchi S, Takashiba S, Murayama Y. The S-layer protein from Campylobacter rectus: Sequence ... keywords = "Campylobacter rectus, DNA sequencing, RTX toxin, S-layer",. author = "Manabu Miyamoto and Hiroshi Maeda and ... The S-layer protein from Campylobacter rectus : Sequence determination and function of the recombinant protein. In: FEMS ... Fingerprint Dive into the research topics of The S-layer protein from Campylobacter rectus: Sequence determination and ...
Campylobacter rectus (Tanner et al.) Vandamme et al. (ATCC® 33238D-5™) ATCC® Number: 33238D-5™ Strain Designations: Genomic DNA ... Campylobacter upsaliensis Sandstedt and Ursing (ATCC® BAA-1059D-5™) ATCC® Number: BAA-1059D-5™ Strain Designations: Genomic DNA ...
crec_s_362 Campylobacter rectus ATCC 33238 genomic library in pSMART HC-kan Campylobacter rectus genomic, genomic survey ... crec_s_361 Campylobacter rectus ATCC 33238 genomic library in pSMART HC-kan Campylobacter rectus genomic, genomic survey ... crec_s_360 Campylobacter rectus ATCC 33238 genomic library in pSMART HC-kan Campylobacter rectus genomic, genomic survey ... crec_s_359 Campylobacter rectus ATCC 33238 genomic library in pSMART HC-kan Campylobacter rectus genomic, genomic survey ...
SSH69 Campylobacter rectus 33238 subtracted library Campylobacter rectus genomic, genomic survey sequence. ATCC 33238 T ... SSH75 Campylobacter rectus 33238 subtracted library Campylobacter rectus genomic, genomic survey sequence. ATCC 33238 T ... SSH77 Campylobacter rectus 33238 subtracted library Campylobacter rectus genomic, genomic survey sequence. ATCC 33238 T ... SSH82 Campylobacter rectus 33238 subtracted library Campylobacter rectus genomic, genomic survey sequence. ATCC 33238 T ...
Campylobacter rectus; Sa, Staphylococcus aureus; Aa, Aggregatibacter actinomycetemcomitans; La, Lactobacillus acidophilus; Vp, ... The Gram-negative anaerobes such as prevotellas, but also Veillonella, Tannarella, Campylobacter, Fusobacterium, and ...
Campylobacter rectus. TTT-CGG-AGC-GTA-AAC-TCC-TTTT-C. TTT-CTG-CAA-GCA-GAC-ACT-CTT. 60. 598. ... In human periodontitis, Campylobacter rectus is present in larger numbers in diseased sites (Doğan et al. 2003) with active ... Campylobacter rectus, Enterococcus faecium, Prevotella nigrescens, Tannerella forsythia and Treponema denticola are associated ... Statistically significant differences were observed for Campylobacter rectus, Enterococcus faecium, Prevotella nigrescens, T. ...
Campylobacter rectus. Adverse pregnancy outcomes. [151]. Fusobacterium nucleatum. [152]. Lactobacillus salivarius. Rheumatoid ... Campylobacter concisus. [126]. Prevotella. spp.. Lactobacillus. spp.. Dialister. spp.. Filifactor. spp.. Pathogenesis and ... Campylobacter. Human Immunodeficiency Virus infection. [154]. Chryseomonas. Veillonella. Streptococcus. Atherosclerosis. [155] ... Campylobacter. , and Granulicatella. were found at higher levels in healthy controls. [87]. Fluorescence in situ hybridization ...
Campylobacter gracilis and Campylobacter rectus in primary endodontic infections. Int Endod J. 2003;36:174-80. DOIPubMed ... Illness associated with Campylobacter laridis, a newly recognized Campylobacter species. J Clin Microbiol. 1985;21:222-5.PubMed ... Pacanowski J, Lalande V, Lacombe K, Boudraa C, Lesprit P, Legrand P, Campylobacter bacteremia: clinical features and factors ... C. gracilis, originally known as Bacteroides gracilis, was transferred to the genus Campylobacter in 1995 after analysis of the ...
C. rectus. C. showae. C. sputorum. C. upsaliensis Campylobacter is a bacterium. It is found in the intestines of many types of ... Alpha · Beta · Gamma/Enterobacteriaceae (Salmonella, Vibrio, Shigella) · Delta · Epsilon (Campylobacter) / Aquificae (Aquifex) ... a b c Samie A, Obi CL, Barrett LJ, Powell SM, Guerrant RL (June 2007). "Prevalence of Campylobacter species, Helicobacter ... Genus: Campylobacter. Species: C. concisus - C. curvus - C. fetus - C. hominis - C. jejuni ...
Campylobacter rectus (CCUG 19168). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA-GTC. G T ... Campylobacter concisus (FDC 288). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGTGGC GT GCCTAA T ACATGCAA-GTC. G T CTTGTAC ... Campylobacter showae (CCUG 3054). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA-GTC. G T CTTGTAC ... Campylobacter curvus (ATCC 35224T; VPI 9584). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA-GTC ...
minor Campylobacter species C. rectus, C. fetus, C. coli, C. upsaliensis;. * C. fetus septicemia in immune-compromised (ie ...
P. melaninogenica is associated with hypertension together with Campylobacter rectus and Veillonella parvula. P. melaninogenica ...
Campylobacter rectus, Capnocytophaga spp., Porphyromonas gingivalis, and Tannerella forsythia. However, it should be stressed ...
Campylobacter rectus (C.rectus) Mikrorganisme penyebab periodontitis kronis, antara lain : Etiologi dan faktor predisposisi. • ...
Wang, B.N.; Kraig, E.; Kolodrubetz, D. Use of defined mutants to assess the role of the Campylobacter rectus S-layer in ... namely Campylobacter rectus is found. This organism is thought to be capable of inducing pro-inflammatory cytokines and its S- ... Identification of the carbohydrate moieties and glycosylation motifs in Campylobacter jejuni flagellin. J. Biol. Chem. 2001, ... layer may temper this response to facilitate the survival of C. rectus at the site of infection [43]. ...
Campylobacter rectus (Wolinella), Campylobacter showae, Microsporum, Flexispira, Bilophila, etc View list of Fastidious ...
Campylobacter rectus, Campylobacter showae, Streptococcus constellatus and Campylobacter gracilis. The 3rd complex consisted of ... The 4th complex was comprised of 3 Capnocytophaga species, Campylobacter concisus, Eikenella corrodens and Actinobacillus ...
Campylobacter rectus, Catonella morbi, Haemophilus haemolyticus, and Parvimonas micra. N. meningitidis abundance was negatively ...
... found that APOs mothers had significantly higher levels of Bacteroides forsythus and Campylobacter rectus. Then, F. nucleatum, ... and Campylobacter concisus (Amer et al., 2017).. Lichen planus is a common chronic mucocutaneous inflammatory. The prevalence ... Megasphaera and Campylobacter species than in healthy controls (Dang et al., 2012). Another study reported that microbial ...
nucleatum and Campylobacter rectus, only children of smokers carried these pathogens. We have previously identified high levels ... Campylobacter, Actinomyces, and Haemophilus. Thus, the subgingival biofilm demonstrated greater species richness as well as ... mothers were smokers demonstrated significant clustering as well as higher levels of Fusobacterium nucleatum and Campylobacter ...
... and Campylobacter rectus are also reviewed. A pattern emerges indicating that only select subtype(s) of a given species, e.g., ...
Campylobacter rectus. *Change of Oral Health Impact Profile-14 (OHIP-14) [ Time Frame: Inclusion Visit (Day 0) and 6 month ...
These bacteria include Aggregatibacter actinomycetemcomitans, Campylobacter rectus, Desulfovibrio species.. HALITOSIS: CAN WE ...
  • C. rectus is associated with hypertension together with Prevotella melaninogenica and Veillonella parvula. (wikipedia.org)
  • Interdental supragingival plaque--a natural habitat of Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Campylobacter rectus, and Prevotella nigrescens. (semanticscholar.org)
  • The samples were assessed for Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Campylobacter rectus, Porphyromonas gingivalis, and the Prevotella intermedia/Prevotella nigrescens group of organisms. (uzh.ch)
  • A number of bacteria, including Actinobacillus actinomycetemcomitans , Campylobacter rectus , Prevotella intermedia , Fusobacterium nucleatum , Porphyromonas gingivalis , and Bacteroides forsythus , have been associated with progressive disease ( 3 ). (asm.org)
  • The HSV-1-positive patients revealed higher median loads of Prevotella intermedia (Pi) and Campylobacter rectus (Cr) compared with HSV-1-negative patients. (thejcdp.com)
  • The objectives of the present study were to examine the salivary detection of Aggregatibacter (formerly Actinobacillus ) actinomycetemcomitans , Campylobacter rectus , Porphyromonas gingivalis , Prevotella intermedia , Tannerella forsythensis , and Treponema denticola in a representative sample of the adult population living in southern Finland and to clarify which determinants are associated with the presence of these pathogens in saliva. (asm.org)
  • Etiologic bacteria of periodontal diseases typically include gram-negative anaerobic bacteria: among those, Porphyromonas gingivalis , Prevotella intermedia , Tannerella forsythensis (formerly Bacteroides forsythus ), and Treponema denticola are strictly anaerobic and Aggregatibacter (formerly Actinobacillus ) actinomycetemcomitans and Campylobacter rectus are facultative/microaerobic ( 2 , 4 , 13 , 33 ). (asm.org)
  • Porphyromonas gingivalis antagonises Campylobacter rectus induced cytokine production by human monocytes. (semanticscholar.org)
  • The recently identified virulence mechanisms of oral species Fusobacterium nucleatum, Porphyromonas gingivalis, Streptococcus mutans, and Campylobacter rectus are also reviewed. (nih.gov)
  • Specific monoclonal antibodies were used in an immunocytochemical assay to identify Campylobacter rectus, Eikenella corrodens, Porphyromonas gingivalis, pathogen-related oral spirochetes (PROS, using Treponema pallidum subspecies pallidum monoclonal antibodies), T. denticola (serotypes A-D), T. socranskii subspecies buccale and T. socranskii subspecies socranskii. (unboundmedicine.com)
  • Researchers discovered tiny terrors like Porphyromonas gulae, Tannerella forsythia, and Campylobacter rectus-all bacteria that dentists have determined cause gum disease in human beings. (petassure.com)
  • Real-time polymerase chain reaction was used for detecting and quantifying Fusobacterium nucleatum (Fn), Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Campylobacter rectus (Cr), and Tannerella forsythia (Tf). (ub.edu)
  • IgG levels to several species, including Porphyromonas gingivalis, Treponema denticola, and Campylobacter rectus, were highest in patients with GAgP and significantly different from LCP and GCP, but not from LAgP. (elsevier.com)
  • Pututive periodontal pathogens, including Porphrymonas gingivalis, Tannerella forsythia, Campylobacter rectus and Fusobacterium nucleatum have been identified in the amniotic fluid of subjects with preterm birth/low birth weight neonates. (dentalcare.com)
  • Fusobacterium nucleatum and Campylobacter rectus were frequently found in both groups. (bvsalud.org)
  • In contrast, P. gingivalis was found only in a single sample, which in addition harbored B. forsythus, C. rectus, A. actinomycetemcomitans (serotypes b and e), and P. intermedia. (uzh.ch)
  • Campylobacter gracilis and Campylobacter rectus in primary endodontic infections. (semanticscholar.org)
  • Campylobacter gracilis is a newly recognized species ( 2 ) that is commonly found in the oral flora and that has been associated with periodontal diseases and pleuropulmonary infections ( 3 - 6 ). (cdc.gov)
  • C. gracilis , originally known as Bacteroides gracilis , was transferred to the genus Campylobacter in 1995 after analysis of the cellular fatty acids, respiratory quinones, and proteins of B. gracilis and a comparison of them with the corresponding chemotaxonomic features of Campylobacter spp. (cdc.gov)
  • Campylobacter gracilis is a 10.1007/978-1-59745-207-6_25 newly recognized species ( 2 ) that is commonly found in the 2. (cdc.gov)
  • Species associated with this group included: Eubacterium nodatum, Campylobacter rectus, Campylobacter showae, Streptococcus constellatus and Campylobacter gracilis. (nih.gov)
  • Bacteroides gracilis and Bacteroides ureolyticus are generically misnamed and are closely related to the genus Campylobacter. (microbiologyresearch.org)
  • The purpose of this study is to identify the presence of Campylobacter species ( C. rectus , C. concisus , C. gracilis and C. ureolyticus ) in Chilean patients with chronic periodontitis, and to establish the relationship of these microorganisms with the periodontal conditions of smoker and non-smoker patients. (bvsalud.org)
  • Campylobacter rectus is a species of Campylobacter. (wikipedia.org)
  • Campylobacter species in health, gingivitis, and periodontitis. (semanticscholar.org)
  • At least seven Campylobacter species have been identified from subgingival sites. (semanticscholar.org)
  • the Campylobacter species that cause human acute intestinal disease such as Campylobacter jejuni and Campylobacter coli originate from animals. (frontiersin.org)
  • Over the past decade, studies on human hosted Campylobacter species strongly suggest that Campylobacter concisus plays a role in the development of inflammatory bowel disease (IBD). (frontiersin.org)
  • In addition to C. concisus , humans are also colonized by a number of other Campylobacter species, most of which are in the oral cavity. (frontiersin.org)
  • Here we review the most recent advancements on C. concisus and other human hosted Campylobacter species including their clinical relevance, transmission, virulence factors, disease associated genes, interactions with the human immune system and pathogenic mechanisms. (frontiersin.org)
  • Some of these animal hosted Campylobacter species, such as Campylobacter jejuni and Campylobacter coli , can cause acute bacterial gastroenteritis in humans through consumption of contaminated food or water ( Galanis, 2007 ). (frontiersin.org)
  • Several Campylobacter species utilize humans as their natural host and accumulated evidence supports their role in chronic inflammatory diseases of the human intestinal tract. (frontiersin.org)
  • Campylobacter species are well known to cause gastrointestinal infections in humans. (cdc.gov)
  • [ 3 ] At least a dozen species of Campylobacter have been implicated in human disease, with C. jejuni and C. coli the most common. (thefullwiki.org)
  • Campylobacter species contain two flagellin genes in tandem for motility, flaA and flaB . (thefullwiki.org)
  • 2005). "Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species" . (thefullwiki.org)
  • The 4th complex was comprised of 3 Capnocytophaga species, Campylobacter concisus, Eikenella corrodens and Actinobacillus actinomycetemcomitans serotype a. (nih.gov)
  • These bacteria include Aggregatibacter actinomycetemcomitans, Campylobacter rectus, Desulfovibrio species. (thefreedictionary.com)
  • The first species (subsequently referred to campylobacter) were first described in 1886 by Theodor Escherich. (mlst.net)
  • For species differentiation, campylobacters are cultivated at various temperature conditions. (mlst.net)
  • Most Campylobacter species can cause disease and can infect humans and other animals. (wikipedia.org)
  • [2] humans can contract the disease from eating food contaminated with Campylobacter species. (wikipedia.org)
  • Campylobacter species generally appear curved or comma-shaped, and are able to move via unipolar or bipolar flagella . (wikipedia.org)
  • The genomes of several Campylobacter species have been sequenced, beginning with C. jejuni in 2000. (wikipedia.org)
  • Additionally, several markers were found in all Campylobacter species except for C. fetus , the most distantly related species. (wikipedia.org)
  • Similar studies have investigated the genes responsible for motility in Campylobacter species. (wikipedia.org)
  • The genus Campylobacter includes many species, some of which are known human and animal pathogens. (biomedcentral.com)
  • To expand our understanding of Campylobacter ecology in dogs, a collection of fecal samples from 70 healthy and 65 diarrheic pet dogs were examined for the presence and levels of 14 Campylobacter species using quantitative PCR. (biomedcentral.com)
  • Levels of individual Campylobacter species detected ranged from 10 3 to 10 8 organisms per gram of feces. (biomedcentral.com)
  • In addition, many individual samples contained multiple species of Campylobacter , with healthy dogs carrying from 0-7 detectable species while diarrheic dogs carried from 0-12 detectable species. (biomedcentral.com)
  • These findings represent the largest number of Campylobacter species specifically tested for in animals and is the first report to determine quantifiable levels of Campylobacter being shed from dogs. (biomedcentral.com)
  • This study demonstrates that domestic dogs can carry a wide range of Campylobacter species naturally and that there is a notable increase in species richness detectable in the diarrheic population. (biomedcentral.com)
  • With several of the detected Campylobacter species known or emerging pathogens, these results are relevant to both ecological and public health discussions. (biomedcentral.com)
  • Phylogenetic tree based on 16S rRNA highlighting the position of C. jejuni 327 relative to the other type and non-type strains within the species Campylobacter jejuni . (biomedcentral.com)
  • A species of CAMPYLOBACTER isolated from cases of human PERIODONTITIS. (bvsalud.org)
  • A high prevalence of the Campylobacter genus in the analyzed populations (93.3%) was found, being C. rectus the most frequent (80%) species. (bvsalud.org)
  • The origin of infection of Campylobacter species found in the oral cavity dental tissue is attributed to the accumulation of associated to oral pathologies are C. rectus, C. plaque (PEREZ-CHAPARRO et al. (bvsalud.org)
  • Campylobacter species in Chilean. (bvsalud.org)
  • At 6 months, Campylobacter rectus increased in both groups, while Tannerella forsythensis decreased subgingivally in the test group. (nih.gov)
  • As C. jejuni and C. coli are the main Campylobacter pathogens which cause human acute intestinal disease and they originate from animal sources, Campylobacteriosis has historically been considered to be zoonotic. (frontiersin.org)
  • [ 2 ] Campylobacter jejuni is now recognized as one of the main causes of bacterial foodborne disease in many developed countries. (thefullwiki.org)
  • [ 5 ] The first Campylobacter genome to be sequenced was C. jejuni , in 2000. (thefullwiki.org)
  • 2000). "The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. (thefullwiki.org)
  • There is often performed for other indications for diuretic therapy of cervical infection with campylobacter jejuni may not be taken into account in the novels pollyanna (1923) and pollyanna grows up (1995) by the retired english civil engineer and patent agent henry dircks (1846 53) to replace lost sodium, chloride and bicarbonate but it is numbered 81 90, you receive 9. (dsaj.org)
  • Within the Campylobacter genus, C. jejuni , and its close relative C. coli , are reported as the most common cause of human acute bacterial enteritis. (biomedcentral.com)
  • Researchers from Taiwan, Finland, Sweden, Demark and the Netherlands have examined various dog populations and have been able to culture C. jejuni, C. coli, C. upsaliensis, C. helveticus, C. lari and other Campylobacter spp. (biomedcentral.com)
  • Strains shown are those within Campylobacter jejuni having corresponding NCBI genome project IDs listed below. (biomedcentral.com)
  • and related taxa and either 3 H-labeled 23S rRNAs from reference strains belonging to Campylobacter fetus, Campylobacter concisus, Campylobacter sputorum, Campylobacter coli , and Campylobacter nitrofigilis , an unnamed Campylobacter sp. (microbiologyresearch.org)
  • Revision of Campylobacter, Helicobacter, and Wolinella Taxonomy: Emendation of Generic Descriptions and Proposal of Arcobacter gen. nov. (microbiologyresearch.org)
  • Wolinella curva and Wolinella recta are transferred to the genus Campylobacter as Campylobacter curvus comb. (microbiologyresearch.org)
  • 1995) Characterization of erythromycin resistance in Campylobacter ( Wolinella) rectus! (gx-computers.com)
  • In conclusion, C. rectus, E. faecium, P. nigrescens, T. forsythia, and T. denticola were associated with severe lesions caused by ovine periodontitis, and F. nucleatum was the most prevalent microorganism in the subgengival sulcus biofilm of healthy sheep. (scielo.br)
  • Conclui-se que C. rectus, E. faecium, P. nigrescens, T. forsythia e T. denticola estão associados às lesões resultantes da periodontite ovina com manifestação clínica grave e F. nucleatum o micro-organismo mais prevalente no biofilme subgengival de animais periodontalmente sadios. (scielo.br)
  • Bacteroides forsythus and C. rectus were detected in 10 (48%) and nine (43%) subjects, respectively. (uzh.ch)
  • The genus Campylobacter , (meaning 'twisted bacteria') first discovered in 1963 [ 1 ] , describes Gram-negative , spiral, microaerophilic bacteria . (thefullwiki.org)
  • No cualquiera puede presentar los blasones de este medico internista, reumatologo, profesor e investigador de la Universidad Johns Hopkins y lider del equipo de investigadores que identifico la bacteria Aggregatibacter actinomycetemcomitans, presente en la boca y que desencadena la produccion de ciertas proteinas las cuales confunden al sistema inmunologico provocando la afectacion de celulas y tejidos, como las articulaciones. (thefreedictionary.com)
  • Campylobacter is a genus of gram-negative bacteria. (mlst.net)
  • Under the influence of atmospheric oxygen, Campylobacter bacteria can turn into a spherical shape. (mlst.net)
  • We found that all of the named campylobacters and related taxa belong to the same phylogenetic group, which we name rRNA superfamily VI and which is far removed from the gram-negative bacteria allocated to the five rRNA superfamilies sensu De Ley. (microbiologyresearch.org)
  • Campylobacter (meaning "curved bacteria") is a genus of Gram-negative bacteria . (wikipedia.org)
  • Relationship between Campylobacter rectus and periodontal status during pregnancy," Oral Microbiology and Immunology , vol. 23, no. 1, pp. 55-59, 2008. (hindawi.com)
  • Resultados: se encontró enfermedad periodontal en el 82 % de todos los participantes. (bvsalud.org)
  • Conclusiones: la atención primaria de salud sigue siendo la mejor opción para mejorar la salud periodontal en la población que no tiene acceso a servicios especializados. (bvsalud.org)
  • The genus Campylobacter was described by the scientists of Sebald and Véron in 1963. (mlst.net)
  • Campylobacter cinaedi and Campylobacter fennelliae are included in this genus as Helicobacter cinaedi comb. (microbiologyresearch.org)
  • 327 is a subspecies of the genus Campylobacter of the family Campylobacteraceae in the phylum Proteobacteria . (biomedcentral.com)
  • The genus Campylobacter belongs to the Epsilonproteobacteria [ 2 ] and is classified in the family Campylobacteraceae [ 3 , Table 1 ], which includes the genera Campylobacter , Arcobacter, Dehalospirillum and Sulfurospirillum . (biomedcentral.com)
  • The microflora includes microorganisms such as Aggregatibacter actinomycetemcomitans , Peptostreptococcus micros , Campylobacter rectus , Capnocytophaga spp. (hindawi.com)
  • A homology search showed a high similarity to the Campylobacter fetus S-layer proteins, especially in their N-terminus. (elsevier.com)
  • Campylobacter sputorum subsp. (asm.org)
  • Effects of Maternal Campylobacter rectus Infection on Murine Placenta, Fetal and Neonatal Survival, and Brain Development. (semanticscholar.org)
  • Campylobacteriosis is an infection by campylobacter. (thefullwiki.org)
  • Another source of infection is contact with infected animals, which often carry Campylobacter asymptomatically. (wikipedia.org)
  • Campylobacter can cause a gastrointestinal infection called campylobacteriosis. (wikipedia.org)
  • Por el contrario, existio un incremento significativo (p 0,05) en la deteccion de Aggregatibacter actinomycetemcomitans en el grupo RAR+Pb (Tabla 5). (thefreedictionary.com)
  • The genomes of several Campylobacter spec have been sequenced, providing insights into their mechanisms of pathogenesis. (thefullwiki.org)
  • Even though studies have repeatedly identified domestic dogs as a risk factor for human campylobacteriosis, our understanding of Campylobacter ecology in this reservoir is limited. (biomedcentral.com)
  • However, extraintestinal illnesses caused by Campylobacter spp. (cdc.gov)
  • extraintestinal illnesses caused by Campylobacter spp. (cdc.gov)
  • The symptoms of campylobacter infections were describe in 1886 in infants by Theodor Escherish. (thefullwiki.org)
  • Campylobacter rectus in human periodontitis. (semanticscholar.org)
  • El análisis de regresión logística multinomial mostró un odds ratio de 14.3 (IC 95 %: 2.5, 82.1), 13.4 (IC 95 %: 1.7, 103.5), 29.2 (IC 95 %: 3.2, 260.9) y 68 (IC 95 %: 6.6, 711.0) placa en gingivitis, periodontitis crónica leve, moderada y grave, respectivamente. (bvsalud.org)
  • The gene encoding the crystalline surface layer (S-layer) protein from Campylobacter rectus, designated slp, was sequenced and the recombinant gene product was expressed in Escherichia coli. (elsevier.com)
  • Purification and characterization of Campylobacter rectus surface layer proteins. (semanticscholar.org)
  • [1] Campylobacter typically appear comma or s-shaped and motile. (wikipedia.org)
  • Campylobacter , along with Arcobacter and Sulfurospirillum , are the three genera that belong to the family, Campylobacteraceae. (frontiersin.org)
  • ACFU01000000 Campylobacter rectus RM3267, whole genome shotgun sequencing project. (atcc.org)
  • Campylobacter is one of the leading causes of food-borne gastroenteritis and has a high prevalence in poultry. (biomedcentral.com)
  • L04317 Campylobacter rectus, complete 16S ribosomal RNA. (atcc.org)
  • S. mutans , C. rectus , V. parvula , and F. nucleatum were not influenced by the extracts. (sigmaaldrich.com)
  • Campylobacter rectus to elicit fetal growth restriction. (elsevier.com)
  • The Slp protein had the same N-terminal sequence as a 104-kDa cytotoxin isolated from the culture supernatants of C. rectus. (elsevier.com)
  • Broiler meat and broiler flocks throughout the production chain in many EU-Member States, along with raw milk were reported as the most important food vehicles in food-borne Campylobacter outbreaks in 2008. (biomedcentral.com)
  • AB001876 Campylobacter rectus gene for S-layer protein, complete cds. (atcc.org)
  • Hybridization experiments were carried out between DNAs from more than 70 strains of Campylobacter spp. (microbiologyresearch.org)
  • Diseases arise from the consumption of raw water from open reservoirs contaminated with campylobacter, as well as from emergency water supply networks contaminated with sewage discharges, sewage from meat processing plants, poultry, and livestock facilities. (mlst.net)
  • The confusing taxonomy of Campylobacter over the past decades make identifying the earliest reports of Campylobacter bacteriophages difficult. (wikipedia.org)
  • Campylobacters do not have the ability to survive in the environment for a long time in contact with oxygen, but they are well preserved in the aquatic environment at low temperatures. (mlst.net)