Metabolic Phenomena: The CHEMICAL PROCESSES that occur within the cells, tissues, or an organism and related temporal, spatial, qualitative, and quantitative concepts.Peptide Nucleic Acids: DNA analogs containing neutral amide backbone linkages composed of aminoethyl glycine units instead of the usual phosphodiester linkage of deoxyribose groups. Peptide nucleic acids have high biological stability and higher affinity for complementary DNA or RNA sequences than analogous DNA oligomers.Metabolic Engineering: Methods and techniques used to genetically modify cells' biosynthetic product output and develop conditions for growing the cells as BIOREACTORS.Industrial Microbiology: The study, utilization, and manipulation of those microorganisms capable of economically producing desirable substances or changes in substances, and the control of undesirable microorganisms.Bacteria: One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.Nucleic Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)Gilbert Disease: A benign familial disorder, transmitted as an autosomal dominant trait. It is characterized by low-grade chronic hyperbilirubinemia with considerable daily fluctuations of the bilirubin level.Biometric Identification: A method of differentiating individuals based on the analysis of qualitative or quantitative biological traits or patterns. This process which has applications in forensics and identity theft prevention includes DNA profiles or DNA fingerprints, hand fingerprints, automated facial recognition, iris scan, hand geometry, retinal scan, vascular patterns, automated voice pattern recognition, and ultrasound of fingers.Radio Frequency Identification Device: Machine readable patient or equipment identification device using radio frequency from 125 kHz to 5.8 Ghz.Doping in Sports: Illegitimate use of substances for a desired effect in competitive sports. It includes humans and animals.NorwayBenzoylarginine Nitroanilide: A chromogenic substrate that permits direct measurement of peptide hydrolase activity, e.g., papain and trypsin, by colorimetry. The substrate liberates p-nitroaniline as a chromogenic product.Hyperbilirubinemia, Hereditary: Inborn errors of bilirubin metabolism resulting in excessive amounts of bilirubin in the circulating blood, either because of increased bilirubin production or because of delayed clearance of bilirubin from the blood.Dental Plaque: A film that attaches to teeth, often causing DENTAL CARIES and GINGIVITIS. It is composed of MUCINS, secreted from salivary glands, and microorganisms.Mouthwashes: Solutions for rinsing the mouth, possessing cleansing, germicidal, or palliative properties. (From Boucher's Clinical Dental Terminology, 4th ed)Food Inspection: Examination of foods to assure wholesome and clean products free from unsafe microbes or chemical contamination, natural or added deleterious substances, and decomposition during production, processing, packaging, etc.Pilot Projects: Small-scale tests of methods and procedures to be used on a larger scale if the pilot study demonstrates that these methods and procedures can work.Centaurium: A plant genus of the family GENTIANACEAE. Triterpene lactones and other compounds have been isolated from species of this genus. The common name of century plant has also been used for the AGAVE genus.Hygiene: The science dealing with the establishment and maintenance of health in the individual and the group. It includes the conditions and practices conducive to health. (Webster, 3d ed)Mouth: The oval-shaped oral cavity located at the apex of the digestive tract and consisting of two parts: the vestibule and the oral cavity proper.Antigens: Substances that are recognized by the immune system and induce an immune reaction.Yin-Yang: In Chinese philosophy and religion, two principles, one negative, dark, and feminine (yin) and one positive, bright, and masculine (yang), from whose interaction all things are produced and all things are dissolved. As a concept the two polar elements referred originally to the shady and sunny sides of a valley or a hill but it developed into the relationship of any contrasting pair: those specified above (female-male, etc.) as well as cold-hot, wet-dry, weak-strong, etc. It is not a distinct system of thought by itself but permeates Chinese life and thought. A balance of yin and yang is essential to health. A deficiency of either principle can manifest as disease. (Encyclopedia Americana)Mental Recall: The process whereby a representation of past experience is elicited.YY1 Transcription Factor: A ubiquitously expressed zinc finger-containing protein that acts both as a repressor and activator of transcription. It interacts with key regulatory proteins such as TATA-BINDING PROTEIN; TFIIB; and ADENOVIRUS E1A PROTEINS.Gingival NeoplasmsAntigens, Bacterial: Substances elaborated by bacteria that have antigenic activity.Antigens, Neoplasm: Proteins, glycoprotein, or lipoprotein moieties on surfaces of tumor cells that are usually identified by monoclonal antibodies. Many of these are of either embryonic or viral origin.Bacteroidetes: A phylum of bacteria comprised of three classes: Bacteroides, Flavobacteria, and Sphingobacteria.Forsythia: A plant genus of the family OLEACEAE. Members contain suspensaside.Treponema denticola: A species of bacteria in the family SPIROCHAETACEAE, frequently isolated from periodontal pockets (PERIODONTAL POCKET).Glycosylation: The chemical or biochemical addition of carbohydrate or glycosyl groups to other chemicals, especially peptides or proteins. Glycosyl transferases are used in this biochemical reaction.Glycomics: The systematic study of the structure and function of the complete set of glycans (the glycome) produced in a single organism and identification of all the genes that encode glycoproteins.Porphyromonas gingivalis: A species of gram-negative, anaerobic, rod-shaped bacteria originally classified within the BACTEROIDES genus. This bacterium produces a cell-bound, oxygen-sensitive collagenase and is isolated from the human mouth.Prevotella intermedia: A species of gram-negative, anaerobic, rod-shaped bacteria originally classified within the BACTEROIDES genus. This bacterium is a common commensal in the gingival crevice and is often isolated from cases of gingivitis and other purulent lesions related to the mouth.Acid-Base Equilibrium: The balance between acids and bases in the BODY FLUIDS. The pH (HYDROGEN-ION CONCENTRATION) of the arterial BLOOD provides an index for the total body acid-base balance.Biofilms: Encrustations, formed from microbes (bacteria, algae, fungi, plankton, or protozoa) embedding in extracellular polymers, that adhere to surfaces such as teeth (DENTAL DEPOSITS); PROSTHESES AND IMPLANTS; and catheters. Biofilms are prevented from forming by treating surfaces with DENTIFRICES; DISINFECTANTS; ANTI-INFECTIVE AGENTS; and antifouling agents.Periodontal Diseases: Pathological processes involving the PERIODONTIUM including the gum (GINGIVA), the alveolar bone (ALVEOLAR PROCESS), the DENTAL CEMENTUM, and the PERIODONTAL LIGAMENT.Dental Caries: Localized destruction of the tooth surface initiated by decalcification of the enamel followed by enzymatic lysis of organic structures and leading to cavity formation. If left unchecked, the cavity may penetrate the enamel and dentin and reach the pulp.Actinomyces: A genus of gram-positive, rod-shaped bacteria whose organisms are nonmotile. Filaments that may be present in certain species are either straight or wavy and may have swollen or clubbed heads.Oxygen: An element with atomic symbol O, atomic number 8, and atomic weight [15.99903; 15.99977]. It is the most abundant element on earth and essential for respiration.Periodontium: The structures surrounding and supporting the tooth. Periodontium includes the gum (GINGIVA), the alveolar bone (ALVEOLAR PROCESS), the DENTAL CEMENTUM, and the PERIODONTAL LIGAMENT.Fusobacteria: A phylum of anaerobic, gram-negative bacteria with a chemoorganotrophic heterotrophic metabolism. They are resident flora of the OROPHARYNX.Periodontitis: Inflammation and loss of connective tissues supporting or surrounding the teeth. This may involve any part of the PERIODONTIUM. Periodontitis is currently classified by disease progression (CHRONIC PERIODONTITIS; AGGRESSIVE PERIODONTITIS) instead of age of onset. (From 1999 International Workshop for a Classification of Periodontal Diseases and Conditions, American Academy of Periodontology)Metagenome: A collective genome representative of the many organisms, primarily microorganisms, existing in a community.Dysbiosis: Changes in quantitative and qualitative composition of MICROBIOTA. The changes may lead to altered host microbial interaction or homeostatic imbalance that can contribute to a disease state often with inflammation.Biomass: Total mass of all the organisms of a given type and/or in a given area. (From Concise Dictionary of Biology, 1990) It includes the yield of vegetative mass produced from any given crop.Microbial Interactions: The inter- and intra-relationships between various microorganisms. This can include both positive (like SYMBIOSIS) and negative (like ANTIBIOSIS) interactions. Examples include virus - bacteria and bacteria - bacteria.ArchivesBiological Science Disciplines: All of the divisions of the natural sciences dealing with the various aspects of the phenomena of life and vital processes. The concept includes anatomy and physiology, biochemistry and biophysics, and the biology of animals, plants, and microorganisms. It should be differentiated from BIOLOGY, one of its subdivisions, concerned specifically with the origin and life processes of living organisms.Periodicals as Topic: A publication issued at stated, more or less regular, intervals.Fusobacterium nucleatum: A species of gram-negative, anaerobic, rod-shaped bacteria isolated from the gingival margin and sulcus and from infections of the upper respiratory tract and pleural cavity.PubMed: A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.

Correlation between detection rates of periodontopathic bacterial DNA in coronary stenotic artery plaque [corrected] and in dental plaque samples. (1/21)

Utilizing PCR, the 16S rRNA detection rates for Porphyromonas gingivalis, Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Treponema denticola, and Campylobacter rectus in samples of stenotic coronary artery plaques were determined to be 21.6, 23.3, 5.9, 23.5, and 15.7%, respectively. The detection rates for P. gingivalis and C. rectus correlated with their presence in subgingival plaque.  (+info)

Campylobacter surface-layers (S-layers) and immune evasion. (2/21)

Many pathogenic bacteria have evolved mechanisms for evading host immune systems. One evasion mechanism is manifest by the surface layer (S-layer), a paracrystalline protein structure composed of S-layer proteins (SLPs). The S-layer, possessed by 2 Campylobacter species (C. fetus and C. rectus), is external to the bacterial outer membrane and can have multiple functions in immune avoidance. C. fetus is a pathogen of ungulates and immunocompromised humans, in whom it causes disseminated bloodstream disease. In C. fetus, the S-layer is required for dissemination and is involved in 2 mechanisms of evasion. First, the S-layer confers resistance to complement-mediated killing in non-immune serum by preventing the binding of complement factor C3b to the C. fetus cell surface. S-layer expressing C. fetus strains remain susceptible to complement-independent killing, utilizing opsonic antibodies directed against the S-layer. However, C. fetus has also evolved a mechanism for avoiding antibody-mediated killing by high-frequency antigenic variation of SLPs. Antigenic variation is accomplished by complex DNA inversion events involving a family of multiple SLP-encoding genes and a single SLP promoter. Inversion events result in the expression of antigenically variant S-layers, which require distinct antibody responses for killing. C. rectus is implicated in the pathogenesis of periodontal disease and also possesses an S-layer that appears to be involved in evading the human system. Although studied less extensively than its C. fetus counterpart, the C. rectus S-layer appears to confer resistance to complement-mediated killing and to cause the down-regulation of proinflammatory cytokines.  (+info)

The detection of eight putative periodontal pathogens in adult and rapidly progressive periodontitis patients: an institutional study. (3/21)

PURPOSE: Periodontal disease is a commonly prevalent problem faced alike by both the developed and third world countries but showing wide variations in prevalence and severity across different geographical areas. The purpose was to identify Actinobacillus actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Prevotella intermedia (Pi), Ekinella corrodens (Ec), Campylobacter rectus (Cr), Bacteroides forsythus (Bf), Treponema denticola (Td) and Fusobacterium nucleatum (Fn) in Indian adult periodontitis and rapidly progressive periodontitis patients. MATERIALS AND METHODS: Paper points were used to collect the sample from 28 sites in both adult periodontitis and rapidly progressive periodontitis (8 healthy/20 diseased sites) patients and DNA analysis done. The categorical data was analysed by Fishers exact test and difference in the clinical parameters was tested by Mann-Whitney test. RESULTS: In healthy sites of adult and rapidly progressive periodontitis patients, Aa, Ec, Bf and Aa, Pg, Pi, Td, Fn were detected respectively. However, when diseased and healthy sites were compared in both adult periodontitis and rapidly progressive periodontitis patients respectively, only Pg( P =0.004), Cr( P =0.04), Fn( P =0.014) and Pg( P =0.002), Cr( P =0.02), Fn( P =0.008) were statistically significant. CONCLUSION: The prevalence of the microorganisms correlate with the clinical parameters like probing depth and bleeding on probing as seen in the Japanese and Western periodontitis patients' population.  (+info)

Population-based study of salivary carriage of periodontal pathogens in adults. (4/21)

Large, general population-based data on carriage rates of periodontal pathogens hardly exist in the current literature. The objectives of the present study were to examine the salivary detection of Aggregatibacter (formerly Actinobacillus) actinomycetemcomitans, Campylobacter rectus, Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythensis, and Treponema denticola in a representative sample of the adult population living in southern Finland and to clarify which determinants are associated with the presence of these pathogens in saliva. 16S rRNA-based PCR methods with species-specific primers were employed to determine the presence of the six target bacteria in stimulated saliva samples, which were available from 1,294 subjects aged > or =30 years. The age group, gender, level of education, marital status, smoking history, number of teeth, and number of teeth with deepened pockets were included in the statistical analysis. In general, the carriage of periodontal pathogens was common, since at least one of the examined pathogens was found in 88.2% of the subjects. In descending order, the total detection rates were 56.9%, 38.2%, 35.4%, 31.3%, 20.0%, and 13.9% for T. forsythensis, T. denticola, P. gingivalis, C. rectus, A. actinomycetemcomitans, and P. intermedia, respectively. Age per se was strongly associated with the carriage of P. gingivalis (P = 0.000), and the level of education with that of T. denticola (P = 0.000). There was an association between the number of teeth with deepened pockets and carriage of P. gingivalis (P = 0.000), P. intermedia (P = 0.000), T. denticola (P = 0.000), and A. actinomycetemcomitans (P = 0.004). The data suggest that distinct species have a different carriage profile, depending on variables such as age, educational level, and periodontal status.  (+info)

Granulocyte chemotactic protein 2 (gcp-2/cxcl6) complements interleukin-8 in periodontal disease. (5/21)

 (+info)

Increased TLR4 expression in murine placentas after oral infection with periodontal pathogens. (6/21)

 (+info)

Oral abscess caused by Campylobacter rectus: case report and literature review. (7/21)

 (+info)

Systemic immune responses in pregnancy and periodontitis: relationship to pregnancy outcomes in the Obstetrics and Periodontal Therapy (OPT) study. (8/21)

 (+info)

*Campylobacter rectus

... is a species of Campylobacter. It is implicated as a pathogen in chronic periodontitis, which can induce ... Type strain of Campylobacter rectus at BacDive - the Bacterial Diversity Metadatabase. ... "Characterization of the invasive and inflammatory traits of oral Campylobacter rectus in a murine model of fetoplacental growth ...

*Smear layer

Standardized bacterial suspensions containing Fusobacterium nucleatum, Campylobacter rectus and Peptostreptococcus micros were ...

*Chronic periodontitis

Microaerophile bacteria Actinomyces actinomycetemcomitans, Campylobacter rectus, and Eikenella corrodens also may play a role ...

*Periodontal pathogen

Streptococcus intermedius Campylobacter rectus Capnocytophaga sp. Red complex Picolos, DK, et al. Infection patterns in chronic ...

*Rectus

... campylobacter rectus & syllitus rectus In anatomy it is used to refer to a rectus muscle, primarily e.g. the "rectus abdominis ... Inferior rectus muscle Superior rectus muscle Lateral rectus muscle Medial rectus muscle Musculus rectus thoracis Rectus ... "rectus" In grammar "casus rectus" is a formal term for nominative case In mathematics sine is also known as "sinus rectus" In ... "Rectus" is the Latin word meaning "straight" and is used in English to refer to multiple topics in the sciences, including: In ...

*List of MeSH codes (B03)

Campylobacter jejuni MeSH B03.440.180.500 --- Campylobacter lari MeSH B03.440.180.650 --- Campylobacter rectus MeSH B03.440. ... Campylobacter jejuni MeSH B03.660.150.100.450 --- Campylobacter lari MeSH B03.660.150.100.700 --- Campylobacter rectus MeSH ... Campylobacter MeSH B03.660.150.100.100 --- Campylobacter coli MeSH B03.660.150.100.220 --- Campylobacter fetus MeSH B03.660. ... Campylobacter coli MeSH B03.440.180.325 --- Campylobacter fetus MeSH B03.440.180.375 --- Campylobacter hyointestinalis MeSH ...
Background: The aim of this investigation was to quantify periodontal pathogens (Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Campylobacter rectus and Tannerella forsythia) in vascular, blood and subgingival samples. As secondary objective, two molecular bacterial identification methods [nested-polimerase chain reaction (PCR) and quantitative PCR (qPCR)] were compared.. Methods: Seventy consecutive patients provided a vascular lesion, a blood sample, and 36 subgingival samples. Bacterial deoxyribonucleic acid (DNA) was extracted and qPCR was used to determine the prevalence and amounts of the target pathogens in each sample. Nested-PCR was only performed in the samples from vascular lesions. Periodontal examination was performed in 42 patients. U-Mann-Whitney or Chi-squared tests were used to compare microbiological results according to periodontal diagnosis.. Results: All targeted periodontal pathogens (A. actinomycetemcomitans, P. gingivalis, T. forsythia or C. rectus) were ...
Objective: To investigate periodontal status of patients with pre-diabetes and evaluate the prevalence of periodontal pathogens in oral cavity. Methods: All the subjects were under regular care in urban area of Beijing, including 88 subjects with normal blood glucose (normal blood glucose group), 27 pre-diabetic patients (pre-diabetic group), 58 well-controlled diabetic patients (glucose well controlled group) and 72 poor-controlled diabetic patients (glucose poor controlled group). Whole unstimulated saliva samples were collected before periodontal examination. Periodontal parameters, including plaque index (PLI), probing depth (PD), bleeding index (BI), bleeding on probing (BOP) and clinical attachment loss (CAL), were examined at mesial-buccal and distal-lingual sites of each tooth. Number of missing teeth was recorded. DNA was extracted from the salivary deposition, Porphyromonas gingivalis (Pg), Tannerella forsythia (Tf), Treponema denticola (Td), Campylobacter rectus (Cr), and Prevotella ...
Affiliation:徳島大,歯学部,助手, Research Field:矯正・小児・社会系歯学,Periodontal dentistry, Keywords:Campylobacter rectus GroEL,ヒト歯肉線維芽細胞,歯周病,歯周ポケット,MMP-9,MMP-2,歯周病原細菌,Measurement of antibody titers,MMP阻害剤,BIAcore装置, # of Research Projects:3, # of Research Products:0
The development of dental caries and periodontal diseases result from distinct shifts in the microbiota of the tooth-associated biofilm. This in vitro study aimed to investigate changes in biofilm composition and structure, during the shift from a supragingival aerobic profile to a subgingival anaerobic profile. Biofilms consisting of Actinomyces oris, Candida albicans, Fusobacterium nucleatum, Streptococcus oralis, Streptococcus mutans and Veillonella dispar were aerobically grown in saliva-containing medium on hydroxyapatite disks. After 64 h, Campylobacter rectus, Prevotella intermedia and Streptococcus anginosus were further added along with human serum, while culture conditions were shifted to microaerophilic. After 96 h, Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola were finally added and the biofilm was grown anaerobically for another 64 h. At the end of each phase, biofilms were harvested for species-specific quantification and localization. Apart from C. ...
SEA080Hu, ELISA Kit for Interleukin 8 (IL8), Homo sapiens (Human), Sandwich ELISA, CXCL8, AMCF-I, GCP1, K60, LECT, LUCT, LYNAP, MDNCF, MONAP, NAF, NAP1, SCYB8, TSG1, B-ENAP, Neutrophil-Activating Protein 1, Granulocyte Chemotactic Protein 1, Designed by Cloud-Clone Corp.
Principal Investigator:KATO Tetsuo, Project Period (FY):1996 - 1998, Research Category:Grant-in-Aid for Scientific Research (C), Section:一般, Research Field:Morphological basic dentistry
TY - JOUR. T1 - Relationship of periodontal infection to serum antibody levels to periodontopathic bacteria and inflammatory markers in periodontitis patients with coronary heart disease. AU - Yamazaki, K.. AU - Honda, T.. AU - Domon, H.. AU - Okui, T.. AU - Kajita, K.. AU - Amanuma, R.. AU - Kudoh, C.. AU - Takashiba, S.. AU - Kokeguchi, S.. AU - Nishimura, F.. AU - Kodama, M.. AU - Aizawa, Y.. AU - Oda, H.. PY - 2007/9/1. Y1 - 2007/9/1. N2 - Several reports have demonstrated a possible association of periodontal infections with coronary heart disease (CHD) by elevated antibody titre to periodontopathic bacteria in CHD patients compared with non-diseased controls. Although each periodontopathic bacterium may vary in virulence for periodontitis and atherosclerosis, antibody response to multiple bacteria in CHD patients has not been understood fully. Therefore, serum levels of antibody to 12 periodontopathic bacteria together with other atherosclerotic risk markers were compared among 51 patients ...
LAA080Ca81, FITC-Linked Polyclonal Antibody to Interleukin 8 (IL8), 白介素8(IL8)多克隆抗体(异硫氰酸荧光素标记), CXCL8; AMCF-I; GCP1; K60; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP1; SCYB8; TSG1; B-ENAP; Neutrophil-Activating Protein 1; Granulocyte Chemotactic Protein 1 | 仅供体外研究使用,不用于临床诊断!请索取进口关税税单及报关单!
Upper abs, lower abs LOL The whole concept was designed by fitness machine manufacturers as a way of differentiating their ab roller, ab king, ab blaster etc etc from their competitor. There are no such thing. Your rectus is one muscle as NB said but you can not work one more than the other, why? Simple, the rectus, the whole rectus is innervated by the same nerves; it fires the whole lot fires at similar levels during any flexor torque generation. That said a very small number of people can activate one section differently in some activities but it is certainly not the norm. The obliques are another story though and they do have a number of seperate neural areas. So do one rectus exercise and use the time you save on some other exercise ...
Upper abs, lower abs LOL The whole concept was designed by fitness machine manufacturers as a way of differentiating their ab roller, ab king, ab blaster etc etc from their competitor. There are no such thing. Your rectus is one muscle as NB said but you can not work one more than the other, why? Simple, the rectus, the whole rectus is innervated by the same nerves; it fires the whole lot fires at similar levels during any flexor torque generation. That said a very small number of people can activate one section differently in some activities but it is certainly not the norm. The obliques are another story though and they do have a number of seperate neural areas. So do one rectus exercise and use the time you save on some other exercise ...
Looking for online definition of Stimulated T-cell chemotactic protein 1 in the Medical Dictionary? Stimulated T-cell chemotactic protein 1 explanation free. What is Stimulated T-cell chemotactic protein 1? Meaning of Stimulated T-cell chemotactic protein 1 medical term. What does Stimulated T-cell chemotactic protein 1 mean?
Manning, D D., "Complete humoral immunosuppression of mice by rabbit anti-mu antibodies passing the murine placenta." (1977). Subject Strain Bibliography 1977. 2110 ...
Monoclonal antibody against Tannerella forsythia, strain FDC 331 (OMZ 348) expressed by for use in Western Blot against Tannerella forsythia
Tannerella forsythia ATCC ® 43037D-5™ Designation: Genomic DNA from Tannerella forsythia strain FDC 338 TypeStrain=True Application:
KSA080Ca01, ELISA Kit DIY Materials for Interleukin 8 (IL8), 白介素8(IL8)检测试剂盒DIY材料(酶联免疫吸附试验法), CXCL8; AMCF-I; GCP1; K60; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP1; SCYB8; TSG1; B-ENAP; Neutrophil-Activating Protein 1; Granulocyte Chemotactic Protein 1 | 仅供体外研究使用,不用于临床诊断!请索取进口关税税单及报关单!
Principal Investigator:KATO Ihachi, Project Period (FY):1996 - 1997, Research Category:Grant-in-Aid for Scientific Research (B), Section:一般, Research Field:Conservative dentistry

Campylobacter rectus - WikipediaCampylobacter rectus - Wikipedia

Campylobacter rectus is a species of Campylobacter. It is implicated as a pathogen in chronic periodontitis, which can induce ... Type strain of Campylobacter rectus at BacDive - the Bacterial Diversity Metadatabase. ... "Characterization of the invasive and inflammatory traits of oral Campylobacter rectus in a murine model of fetoplacental growth ...
more infohttps://en.wikipedia.org/wiki/Campylobacter_rectus

Campylobacter rectus - Semantic ScholarCampylobacter rectus - Semantic Scholar

C. rectus, formerly known as Wolinella recta, is a periodontal pathogen causing chronic periodontitis and extraoral abscesses ... At least seven Campylobacter species have been identified from subgingival sites. Campylobacter rectus has been implicated as a ... Purification and characterization of Campylobacter rectus surface layer proteins.. *Hajime Nitta, Stanley C. Holt, Jefferey L. ... Campylobacter rectus. Known as: Wolinella recta A species of microaerophilic, Gram-negative, straight bacilli assigned to the ...
more infohttps://www.semanticscholar.org/topic/Campylobacter-rectus/54619

Campylobacter rectus (Tanner et al.) Vandamme et al. ATCC ® 33238DCampylobacter rectus (Tanner et al.) Vandamme et al. ATCC ® 33238D

Genomic DNA from Campylobacter rectus strain FDC 371 (ATCC ® 33238™) TypeStrain=True Application: ... Campylobacter rectus, complete 16S ribosomal RNA. Nucleotide (GenBank) : AB001876 Campylobacter rectus gene for S-layer protein ... Campylobacter rectus (Tanner et al.) Vandamme et al. (ATCC® 33238D-5™) Strain Designations: Genomic DNA from Campylobacter ... Campylobacter rectus (Tanner et al.) Vandamme et al. ATCC® 33238D-5™ freeze-dried At least 5 µg in 1X TE buffer ...
more infohttps://www.atcc.org/Products/All/33238D-5.aspx?slp=1?p=1&rel=%7B0%7D

Interdental supragingival plaque--a natural habitat of Actinobacillus actinomycetemcomitans, Bacteroides forsythus,...Interdental supragingival plaque--a natural habitat of Actinobacillus actinomycetemcomitans, Bacteroides forsythus,...

The samples were assessed for Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Campylobacter rectus, Porphyromonas ... The samples were assessed for Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Campylobacter rectus, Porphyromonas ... Campylobacter rectus, and Prevotella nigrescens. Journal of Dental Research, 73(8):1421-1428. ... In contrast, P. gingivalis was found only in a single sample, which in addition harbored B. forsythus, C. rectus, A. ...
more infohttps://www.zora.uzh.ch/id/eprint/1658/

Bacterial Nucleic Acids Page 8Bacterial Nucleic Acids Page 8

Campylobacter rectus (Tanner et al.) Vandamme et al. (ATCC® 33238D-5™) ATCC® Number: 33238D-5™ Strain Designations: Genomic DNA ... Campylobacter upsaliensis Sandstedt and Ursing (ATCC® BAA-1059D-5™) ATCC® Number: BAA-1059D-5™ Strain Designations: Genomic DNA ...
more infohttps://www.atcc.org/Products/Cells_and_Microorganisms/Bacteria/Bacterial_Nucleic_Acids.aspx?dsNav=Ro:90,Ns:Organism_Accepted_Name%7C101%7C1%7C

LMG 18219 Strain Passport - StrainInfoLMG 18219 Strain Passport - StrainInfo

crec_s_362 Campylobacter rectus ATCC 33238 genomic library in pSMART HC-kan Campylobacter rectus genomic, genomic survey ... crec_s_361 Campylobacter rectus ATCC 33238 genomic library in pSMART HC-kan Campylobacter rectus genomic, genomic survey ... crec_s_360 Campylobacter rectus ATCC 33238 genomic library in pSMART HC-kan Campylobacter rectus genomic, genomic survey ... crec_s_359 Campylobacter rectus ATCC 33238 genomic library in pSMART HC-kan Campylobacter rectus genomic, genomic survey ...
more infohttp://www.straininfo.net/strains/6468

FDC 371 Strain Passport - StrainInfoFDC 371 Strain Passport - StrainInfo

SSH69 Campylobacter rectus 33238 subtracted library Campylobacter rectus genomic, genomic survey sequence. ATCC 33238 T ... SSH75 Campylobacter rectus 33238 subtracted library Campylobacter rectus genomic, genomic survey sequence. ATCC 33238 T ... SSH77 Campylobacter rectus 33238 subtracted library Campylobacter rectus genomic, genomic survey sequence. ATCC 33238 T ... SSH82 Campylobacter rectus 33238 subtracted library Campylobacter rectus genomic, genomic survey sequence. ATCC 33238 T ...
more infohttp://www.straininfo.net/strainPassport.action?sort=accessionNumber&page=2&dir=asc&cultureId=6467

Frontiers | Effect of an oxygenating agent on oral bacteria in vitro and on dental plaque composition in healthy young adults |...Frontiers | Effect of an oxygenating agent on oral bacteria in vitro and on dental plaque composition in healthy young adults |...

Campylobacter rectus; Sa, Staphylococcus aureus; Aa, Aggregatibacter actinomycetemcomitans; La, Lactobacillus acidophilus; Vp, ... The Gram-negative anaerobes such as prevotellas, but also Veillonella, Tannarella, Campylobacter, Fusobacterium, and ...
more infohttps://www.frontiersin.org/articles/10.3389/fcimb.2014.00095/full

Subgingival bacterial microbiota associated with ovine periodontitisSubgingival bacterial microbiota associated with ovine periodontitis

Campylobacter rectus. TTT-CGG-AGC-GTA-AAC-TCC-TTTT-C. TTT-CTG-CAA-GCA-GAC-ACT-CTT. 60. 598. ... In human periodontitis, Campylobacter rectus is present in larger numbers in diseased sites (Doğan et al. 2003) with active ... Campylobacter rectus, Enterococcus faecium, Prevotella nigrescens, Tannerella forsythia and Treponema denticola are associated ... Statistically significant differences were observed for Campylobacter rectus, Enterococcus faecium, Prevotella nigrescens, T. ...
more infohttp://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-736X2019000700454&tlng=en

Design and Evaluation of Useful Bacterium-Specific PCR Primers That Amplify Genes Coding for Bacterial 16S rRNA | Applied and...Design and Evaluation of Useful Bacterium-Specific PCR Primers That Amplify Genes Coding for Bacterial 16S rRNA | Applied and...

Campylobacter rectus (CCUG 19168). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA-GTC. G T ... Campylobacter concisus (FDC 288). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGTGGC GT GCCTAA T ACATGCAA-GTC. G T CTTGTAC ... Campylobacter showae (CCUG 3054). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA-GTC. G T CTTGTAC ... Campylobacter curvus (ATCC 35224T; VPI 9584). ɛ-Proteobacteria. GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA-GTC ...
more infohttps://aem.asm.org/content/64/2/795/figures-only

DNA Pathogen FrequenciesDNA Pathogen Frequencies

Campylobacter rectus. Capnocytophaga ochracea. Other numerous oral bacteria. 12202557. 16000454. 16585688. eMedicine. 19828883 ... Campylobacter jejuni. Clostridium botulinum. Clostridium perfringens. Salmonella typhimurium (aka S. enterica serovar ...
more infohttp://www.dnafrequencies.com/dp/human.shtml

Aggregatibacter | definition of Aggregatibacter by Medical dictionaryAggregatibacter | definition of Aggregatibacter by Medical dictionary

These bacteria include Aggregatibacter actinomycetemcomitans, Campylobacter rectus, Desulfovibrio species.. HALITOSIS: CAN WE ...
more infohttps://medical-dictionary.thefreedictionary.com/Aggregatibacter

The Antimicrobial Photodynamic Therapy in the Treatment of Peri-ImplantitisThe Antimicrobial Photodynamic Therapy in the Treatment of Peri-Implantitis

Campylobacter rectus, Capnocytophaga spp., Porphyromonas gingivalis, and Tannerella forsythia. However, it should be stressed ...
more infohttps://www.hindawi.com/journals/ijd/2016/7692387/

Untitled Prezi by muhammad hamzah on PreziUntitled Prezi by muhammad hamzah on Prezi

Campylobacter rectus (C.rectus) Mikrorganisme penyebab periodontitis kronis, antara lain : Etiologi dan faktor predisposisi. • ...
more infohttps://prezi.com/pxhuaf_0gbgb/untitled-prezi/

Biomolecules  | Free Full-Text | Glycobiology Aspects of the Periodontal Pathogen Tannerella forsythia | HTMLBiomolecules | Free Full-Text | Glycobiology Aspects of the Periodontal Pathogen Tannerella forsythia | HTML

Wang, B.N.; Kraig, E.; Kolodrubetz, D. Use of defined mutants to assess the role of the Campylobacter rectus S-layer in ... namely Campylobacter rectus is found. This organism is thought to be capable of inducing pro-inflammatory cytokines and its S- ... Identification of the carbohydrate moieties and glycosylation motifs in Campylobacter jejuni flagellin. J. Biol. Chem. 2001, ... layer may temper this response to facilitate the survival of C. rectus at the site of infection [43]. ...
more infohttp://www.mdpi.com/2218-273X/2/4/467/htm

Surface Structure, Hydrophobicity, Phagocytosis, and Adherence to Matrix Proteins of Bacillus cereus Cells with and without the...Surface Structure, Hydrophobicity, Phagocytosis, and Adherence to Matrix Proteins of Bacillus cereus Cells with and without the...

1997) Purification and characterization of Campylobacter rectus surface layer proteins. Infect. Immun. 65:478-483. ... 1988) Pathogenesis of Campylobacter fetus infections. Failure of encapsulated Campylobacter fetus to bind C3b explains serum ... 1993) Role of the S-layer proteins of Campylobacter fetus in serum-resistance and antigenic variation: a model of bacterial ... 1993) Pathogenesis of Campylobacter fetus infections: critical role of high-molecular-weight S-layer proteins in virulence. J. ...
more infohttps://iai.asm.org/content/66/10/4895?ijkey=d4f0b377c75dd5cd1450802940fbfaf60e5dfb37&keytype2=tf_ipsecsha

Frontiers | Maternal-Fetal Conflict During Infection: Lessons From a Mouse Model of Placental Malaria | MicrobiologyFrontiers | Maternal-Fetal Conflict During Infection: Lessons From a Mouse Model of Placental Malaria | Microbiology

... a pattern which is replicated with Campylobacter rectus, Porphyromonas gingivalis (Arce et al., 2009) and murine ... Toll-like receptor 4 mediates intrauterine growth restriction after systemic Campylobacter rectus infection in mice. Mol. Oral ...
more infohttps://www.frontiersin.org/articles/10.3389/fmicb.2019.01126/full

Microbial complexes in subgingival plaque.  - PubMed - NCBIMicrobial complexes in subgingival plaque. - PubMed - NCBI

Campylobacter rectus, Campylobacter showae, Streptococcus constellatus and Campylobacter gracilis. The 3rd complex consisted of ... The 4th complex was comprised of 3 Capnocytophaga species, Campylobacter concisus, Eikenella corrodens and Actinobacillus ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/9495612?dopt=Abstract

Optimization of quantitative polymerase chain reactions for detection and quantification of eight periodontal bacterial...Optimization of quantitative polymerase chain reactions for detection and quantification of eight periodontal bacterial...

Rams TE, Feik D, Slots J: Campylobacter rectus in human periodontitis. Oral Microbiol Immunol. 1993, 8: 230-235. 10.1111/j.1399 ... such as Campylobacter rectus, Eubacterium nodatum, Fusobacterium nucleatum, Parvimonas (Micromonas, Peptostreptococcus) micros ...
more infohttps://bmcresnotes.biomedcentral.com/articles/10.1186/1756-0500-5-664

Preliminary Study of the Quality of the Oral Flora in Parkinson's Patients - Full Text View - ClinicalTrials.govPreliminary Study of the Quality of the Oral Flora in Parkinson's Patients - Full Text View - ClinicalTrials.gov

Campylobacter rectus. *Change of Oral Health Impact Profile-14 (OHIP-14) [ Time Frame: Inclusion Visit (Day 0) and 6 month ...
more infohttps://clinicaltrials.gov/ct2/show/NCT03827551

DiVA - Search resultDiVA - Search result

Detection frequencies for Tannerella forsythensis (formerly Bacteroides forsythus) and Campylobacter rectus differed among the ... The mean proportions of A. actinomycetemcomitans, P. gingivalis, and C. rectus were higher (P , 0.008) in GAgP than in non- ...
more infohttp://umu.diva-portal.org/smash/resultList.jsf?p=251&fs=false&language=en&searchType=SIMPLE&query=&af=%5B%5D&aq=%5B%5B%7B%22organisationId%22%3A%22754%22%7D%5D%5D&aq2=%5B%5B%5D%5D&aqe=%5B%5D&noOfRows=50&sortOrder=author_sort_asc&sortOrder2=title_sort_asc&onlyFullText=false&sf=all

DiVA - Search resultDiVA - Search result

Detection frequencies for Tannerella forsythensis (formerly Bacteroides forsythus) and Campylobacter rectus differed among the ... The mean proportions of A. actinomycetemcomitans, P. gingivalis, and C. rectus were higher (P , 0.008) in GAgP than in non- ...
more infohttp://umu.diva-portal.org/smash/resultList.jsf?searchType=ORGANISATION&language=en&onlyFullText=false&af=%5B%5D&aq=%5B%5B%7B%22organisationId%22%3A%22758%22%7D%5D%5D
  • In conclusion, C. rectus, E. faecium, P. nigrescens, T. forsythia, and T. denticola were associated with severe lesions caused by ovine periodontitis, and F. nucleatum was the most prevalent microorganism in the subgengival sulcus biofilm of healthy sheep. (scielo.br)
  • Conclui-se que C. rectus, E. faecium, P. nigrescens, T. forsythia e T. denticola estão associados às lesões resultantes da periodontite ovina com manifestação clínica grave e F. nucleatum o micro-organismo mais prevalente no biofilme subgengival de animais periodontalmente sadios. (scielo.br)