AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and ProcessesInformation Science
Caenorhabditis elegans ProteinsCaenorhabditis elegansHelminth ProteinsGenes, HelminthMolecular Sequence DataCaenorhabditisAmino Acid SequenceSequence Homology, Amino AcidVulvaDNA, HelminthMutationAnimals, Genetically ModifiedRNA, HelminthGenome, HelminthDisorders of Sex DevelopmentBase SequenceCloning, MolecularLongevityRNA InterferenceGerm CellsPhenotypeNematodaEmbryo, NonmammalianLarvaGene Expression Regulation, DevelopmentalAldicarbGonadsGreen Fluorescent ProteinsPharynxSequence AlignmentTranscription FactorsSignal TransductionOvipositionConserved SequenceLocomotionGenes, LethalAllelesMembrane ProteinsChromosome MappingAntinematodal AgentsGATA Transcription FactorsHermaphroditic OrganismsMeiosisModels, BiologicalLuminescent ProteinsGene Expression RegulationMoltingRecombinant Fusion ProteinsDNA, ComplementarySex Determination ProcessesLevamisoleMorphogenesisPhylogenyNeuronsPharyngeal MusclesNervous SystemProtein Structure, TertiaryEvolution, MolecularGenomeSuppression, GeneticTransgenesModels, Genetic
Caenorhabditis elegans Proteins: Proteins from the nematode species CAENORHABDITIS ELEGANS. The proteins from this species are the subject of scientific interest in the area of multicellular organism MORPHOGENESIS.Caenorhabditis elegans: A species of nematode that is widely used in biological, biochemical, and genetic studies.Helminth Proteins: Proteins found in any species of helminth.Genes, Helminth: The functional hereditary units of HELMINTHS.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Caenorhabditis: A genus of small free-living nematodes. Two species, CAENORHABDITIS ELEGANS and C. briggsae are much used in studies of genetics, development, aging, muscle chemistry, and neuroanatomy.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Vulva: The external genitalia of the female. It includes the CLITORIS, the labia, the vestibule, and its glands.DNA, Helminth: Deoxyribonucleic acid that makes up the genetic material of helminths.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Animals, Genetically Modified: ANIMALS whose GENOME has been altered by GENETIC ENGINEERING, or their offspring.RNA, Helminth: Ribonucleic acid in helminths having regulatory and catalytic roles as well as involvement in protein synthesis.Genome, Helminth: The genetic complement of a helminth (HELMINTHS) as represented in its DNA.Disorders of Sex Development: In gonochoristic organisms, congenital conditions in which development of chromosomal, gonadal, or anatomical sex is atypical. Effects from exposure to abnormal levels of GONADAL HORMONES in the maternal environment, or disruption of the function of those hormones by ENDOCRINE DISRUPTORS are included.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Longevity: The normal length of time of an organism's life.RNA Interference: A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.Germ Cells: The reproductive cells in multicellular organisms at various stages during GAMETOGENESIS.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Nematoda: A class of unsegmented helminths with fundamental bilateral symmetry and secondary triradiate symmetry of the oral and esophageal structures. Many species are parasites.Embryo, Nonmammalian: The developmental entity of a fertilized egg (ZYGOTE) in animal species other than MAMMALS. For chickens, use CHICK EMBRYO.Larva: Wormlike or grublike stage, following the egg in the life cycle of insects, worms, and other metamorphosing animals.Gene Expression Regulation, Developmental: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.Aldicarb: Carbamate derivative used as an insecticide, acaricide, and nematocide.Gonads: The gamete-producing glands, OVARY or TESTIS.Green Fluorescent Proteins: Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.Pharynx: A funnel-shaped fibromuscular tube that conducts food to the ESOPHAGUS, and air to the LARYNX and LUNGS. It is located posterior to the NASAL CAVITY; ORAL CAVITY; and LARYNX, and extends from the SKULL BASE to the inferior border of the CRICOID CARTILAGE anteriorly and to the inferior border of the C6 vertebra posteriorly. It is divided into the NASOPHARYNX; OROPHARYNX; and HYPOPHARYNX (laryngopharynx).Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Oviposition: The process of laying or shedding fully developed eggs (OVA) from the female body. The term is usually used for certain INSECTS or FISHES with an organ called ovipositor where eggs are stored or deposited before expulsion from the body.Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Locomotion: Movement or the ability to move from one place or another. It can refer to humans, vertebrate or invertebrate animals, and microorganisms.Genes, Lethal: Genes whose loss of function or gain of function MUTATION leads to the death of the carrier prior to maturity. They may be essential genes (GENES, ESSENTIAL) required for viability, or genes which cause a block of function of an essential gene at a time when the essential gene function is required for viability.Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Antinematodal Agents: Substances used in the treatment or control of nematode infestations. They are used also in veterinary practice.GATA Transcription Factors: A family of transcription factors that contain two ZINC FINGER MOTIFS and bind to the DNA sequence (A/T)GATA(A/G).Hermaphroditic Organisms: Animals and plants which have, as their normal mode of reproduction, both male and female sex organs in the same individual.Meiosis: A type of CELL NUCLEUS division, occurring during maturation of the GERM CELLS. Two successive cell nucleus divisions following a single chromosome duplication (S PHASE) result in daughter cells with half the number of CHROMOSOMES as the parent cells.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Luminescent Proteins: Proteins which are involved in the phenomenon of light emission in living systems. Included are the "enzymatic" and "non-enzymatic" types of system with or without the presence of oxygen or co-factors.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Molting: Periodic casting off FEATHERS; HAIR; or cuticle. Molting is a process of sloughing or desquamation, especially the shedding of an outer covering and the development of a new one. This phenomenon permits growth in ARTHROPODS, skin renewal in AMPHIBIANS and REPTILES, and the shedding of winter coats in BIRDS and MAMMALS.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Sex Determination Processes: The mechanisms by which the SEX of an individual's GONADS are fixed.Levamisole: An antihelminthic drug that has been tried experimentally in rheumatic disorders where it apparently restores the immune response by increasing macrophage chemotaxis and T-lymphocyte function. Paradoxically, this immune enhancement appears to be beneficial in rheumatoid arthritis where dermatitis, leukopenia, and thrombocytopenia, and nausea and vomiting have been reported as side effects. (From Smith and Reynard, Textbook of Pharmacology, 1991, p435-6)Morphogenesis: The development of anatomical structures to create the form of a single- or multi-cell organism. Morphogenesis provides form changes of a part, parts, or the whole organism.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Neurons: The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.Pharyngeal Muscles: The muscles of the PHARYNX are voluntary muscles arranged in two layers. The external circular layer consists of three constrictors (superior, middle, and inferior). The internal longitudinal layer consists of the palatopharyngeus, the salpingopharyngeus, and the stylopharyngeus. During swallowing, the outer layer constricts the pharyngeal wall and the inner layer elevates pharynx and LARYNX.Nervous System: The entire nerve apparatus, composed of a central part, the brain and spinal cord, and a peripheral part, the cranial and spinal nerves, autonomic ganglia, and plexuses. (Stedman, 26th ed)Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Genome: The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.Suppression, Genetic: Mutation process that restores the wild-type PHENOTYPE in an organism possessing a mutationally altered GENOTYPE. The second "suppressor" mutation may be on a different gene, on the same gene but located at a distance from the site of the primary mutation, or in extrachromosomal genes (EXTRACHROMOSOMAL INHERITANCE).Transgenes: Genes that are introduced into an organism using GENE TRANSFER TECHNIQUES.Models, Genetic: Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.

Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family. (1/5831)

We have identified a new member of the TGF-beta superfamily, CET-1, from Caenorhabditis elegans, which is expressed in the ventral nerve cord and other neurons. cet-1 null mutants have shortened bodies and male tail abnormal phenotype resembling sma mutants, suggesting cet-1, sma-2, sma-3 and sma-4 share a common pathway. Overexpression experiments demonstrated that cet-1 function requires wild-type sma genes. Interestingly, CET-1 appears to affect body length in a dose-dependent manner. Heterozygotes for cet-1 displayed body lengths ranging between null mutant and wild type, and overexpression of CET-1 in wild-type worms elongated body length close to lon mutants. In male sensory ray patterning, lack of cet-1 function results in ray fusions. Epistasis analysis revealed that mab-21 lies downstream and is negatively regulated by the cet-1/sma pathway in the male tail. Our results show that cet-1 controls diverse biological processes during C. elegans development probably through different target genes.  (+info)

Alzheimer's disease: clues from flies and worms. (2/5831)

Presenilin mutations give rise to familial Alzheimer's disease and result in elevated production of amyloid beta peptide. Recent evidence that presenilins act in developmental signalling pathways may be the key to understanding how senile plaques, neurofibrillary tangles and apoptosis are all biochemically linked.  (+info)

The Caenorhabditis elegans sex determination gene mog-1 encodes a member of the DEAH-Box protein family. (3/5831)

In the Caenorhabditis elegans hermaphrodite germ line, the sex-determining gene fem-3 is repressed posttranscriptionally to arrest spermatogenesis and permit oogenesis. This repression requires a cis-acting regulatory element in the fem-3 3' untranslated region; the FBF protein, which binds to this element; and at least six mog genes. In this paper, we report the molecular characterization of mog-1 as well as additional phenotypic characterization of this gene. The mog-1 gene encodes a member of the DEAH-box family. Three mog-1 alleles possess premature stop codons and are likely to be null alleles, and one is a missense mutation and is likely to retain residual activity. mog-1 mRNA is expressed in both germ line and somatic tissues and appears to be ubiquitous. The MOG-1 DEAH-box protein is most closely related to proteins essential for splicing in the yeast Saccharomyces cerevisiae, but splicing appears to occur normally in a mog-1-null mutant. In addition to its involvement in the sperm-oocyte switch and control of fem-3, zygotic mog-1 is required for robust germ line proliferation and for normal growth during development. We suggest that mog-1 plays a broader role in RNA regulation than previously considered.  (+info)

Characterization of a Caenorhabditis elegans recA-like gene Ce-rdh-1 involved in meiotic recombination. (4/5831)

A recA-like gene was identified in the Caenorhabditis elegans genome project database. The putative product of the gene, termed Ce-rdh-1 (C. elegans RAD51 and DMC1/LIM15 homolog 1), consists of 357 amino acid residues. The predicted amino acid sequence of Ce-rdh-1 showed 46-60% identity to both RAD51 type and DMC1/LIM15 type genes in several eukaryote species. The results of RNAi (RNA-mediated interference) indicated that repression of Ce-rdh-1 blocked chromosome condensation of six bivalents and dissociation of chiasmata in oocytes of F1 progeny. Oogenesis did not proceed to the diakinesis stage. Accordingly, all the eggs produced (F2) died in early stages. These results suggest that Ce-rdh-1 participates in meiotic recombination.  (+info)

The Caenorhabditis elegans gene ham-2 links Hox patterning to migration of the HSN motor neuron. (5/5831)

The Caenorhabditis elegans HSN motor neurons permit genetic analysis of neuronal development at single-cell resolution. The egl-5 Hox gene, which patterns the posterior of the embryo, is required for both early (embryonic) and late (larval) development of the HSN. Here we show that ham-2 encodes a zinc finger protein that acts downstream of egl-5 to direct HSN cell migration, an early differentiation event. We also demonstrate that the EGL-43 zinc finger protein, also required for HSN migration, is expressed in the HSN specifically during its migration. In an egl-5 mutant background, the HSN still expresses EGL-43, but expression is no longer down-regulated at the end of the cell's migration. Finally, we find a new role in early HSN differentiation for UNC-86, a POU homeodomain transcription factor shown previously to act downstream of egl-5 in the regulation of late HSN differentiation. In an unc-86; ham-2 double mutant the HSNs are defective in EGL-43 down-regulation, an egl-5-like phenotype that is absent in either single mutant. Thus, in the HSN, a Hox gene, egl-5, regulates cell fate by activating the transcription of genes encoding the transcription factors HAM-2 and UNC-86 that in turn individually control some differentiation events and combinatorially affect others.  (+info)

Patterning of Caenorhabditis elegans posterior structures by the Abdominal-B homolog, egl-5. (6/5831)

The Caenorhabditis elegans body axis, like that of other animals, is patterned by the action of Hox genes. In order to examine the function of one C. elegans Hox gene in depth, we determined the postembryonic expression pattern of egl-5, the C. elegans member of the Abdominal-B Hox gene paralog group, by means of whole-mount staining with a polyclonal antibody. A major site of egl-5 expression and function is in the epithelium joining the posterior digestive tract with the external epidermis. Patterning this region and its derived structures is a conserved function of Abd-B paralog group genes in other animals. Cells that initiate egl-5 expression during embryogenesis are clustered around the presumptive anus. Expression is initiated postembryonically in four additional mesodermal and ectodermal cell lineages or tissues. Once initiated in a lineage, egl-5 expression continues throughout development, suggesting that the action of egl-5 can be regarded as defining a positional cell identity. A variety of cross-regulatory interactions between egl-5 and the next more anterior Hox gene, mab-5, help define the expression domains of their respective gene products. In its expression in a localized body region, function as a marker of positional cell identity, and interactions with another Hox gene, egl-5 resembles Hox genes of other animals. This suggests that C. elegans, in spite of its small cell number and reproducible cell lineages, may not differ greatly from other animals in the way it employs Hox genes for regional specification during development.  (+info)

Merbarone, a catalytic inhibitor of DNA topoisomerase II, induces apoptosis in CEM cells through activation of ICE/CED-3-like protease. (7/5831)

Merbarone (5-[N-phenyl carboxamido]-2-thiobarbituric acid) is an anticancer drug that inhibits the catalytic activity of DNA topoisomerase II (topo II) without damaging DNA or stabilizing DNA-topo II cleavable complexes. Although the cytotoxicity of the complex-stabilizing DNA-topo II inhibitors such as VP-16 (etoposide) has been partially elucidated, the cytotoxicity of merbarone is poorly understood. Here, we report that merbarone induces programmed cell death or apoptosis in human leukemic CEM cells, characterized by internucleosomal DNA cleavage and nuclear condensation. Treatment of CEM cells with apoptosis-inducing concentrations of merbarone caused activation of c-Jun NH2-terminal kinase/stress-activated protein kinase, c-jun gene induction, activation of caspase-3/CPP32-like protease but not caspase-1, and the proteolytic cleavage of poly(ADP-ribose) polymerase. Treatment of CEM cells with a potent inhibitor of caspases, Z-Asp-2. 6-dichlorobenzoyloxymethyl-ketone, inhibited merbarone-induced caspase-3/CPP32-like activity and apoptosis in a dose-dependent manner. These results indicate that the catalytic inhibition of topo II by merbarone leads to apoptotic cell death through a caspase-3-like protease-dependent mechanism. These results further suggest that c-Jun and c-Jun NH2-terminal kinase/stress-activated protein kinase signaling may be involved in the cytotoxicity of merbarone.  (+info)

Interaction of 5-lipoxygenase with cellular proteins. (8/5831)

5-Lipoxygenase (5LO) plays a pivotal role in cellular leukotriene synthesis. To identify proteins interacting with human 5LO, we used a two-hybrid approach to screen a human lung cDNA library. From a total of 1.5 x 10(7) yeast transformants, nine independent clones representing three different proteins were isolated and found to specifically interact with 5LO. Four 1.7- to 1.8-kb clones represented a 16-kDa protein named coactosin-like protein for its significant homology with coactosin, a protein found to be associated with actin in Dictyostelium discoideum. Coactosin-like protein thus may provide a link between 5LO and the cytoskeleton. Two other yeast clones of 1.5 kb encoded transforming growth factor (TGF) type beta receptor-I-associated protein 1 partial cDNA. TGF type beta receptor-I-associated protein 1 recently has been reported to associate with the activated form of the TGF beta receptor I and may be involved in the TGF beta-induced up-regulation of 5LO expression and activity observed in HL-60 and Mono Mac 6 cells. Finally, three identical 2.1-kb clones contained the partial cDNA of a human protein with high homology to a hypothetical helicase K12H4. 8 from Caenorhabditis elegans and consequently was named DeltaK12H4. 8 homologue. Analysis of the predicted amino acid sequence revealed the presence of a RNase III motif and a double-stranded RNA binding domain, indicative of a protein of nuclear origin. The identification of these 5LO-interacting proteins provides additional approaches to studies of the cellular functions of 5LO.  (+info)

AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and ProcessesInformation Science
Caenorhabditis elegans ProteinsCaenorhabditis elegansHelminth ProteinsGenes, HelminthMolecular Sequence DataCaenorhabditisAmino Acid SequenceSequence Homology, Amino AcidVulvaDNA, HelminthMutationAnimals, Genetically ModifiedRNA, HelminthGenome, HelminthDisorders of Sex DevelopmentBase SequenceCloning, MolecularLongevityRNA InterferenceGerm CellsPhenotypeNematodaEmbryo, NonmammalianLarvaGene Expression Regulation, DevelopmentalAldicarbGonadsGreen Fluorescent ProteinsPharynxSequence AlignmentTranscription FactorsSignal TransductionOvipositionConserved SequenceLocomotionGenes, LethalAllelesMembrane ProteinsChromosome MappingAntinematodal AgentsGATA Transcription FactorsHermaphroditic OrganismsMeiosisModels, BiologicalLuminescent ProteinsGene Expression RegulationMoltingRecombinant Fusion ProteinsDNA, ComplementarySex Determination ProcessesLevamisoleMorphogenesisPhylogenyNeuronsPharyngeal MusclesNervous SystemProtein Structure, TertiaryEvolution, MolecularGenomeSuppression, GeneticTransgenesModels, Genetic

*FERM domain

Protein-tyrosine phosphatases PTPN14 and PTP-D1, PTP-RL10 and PTP2E. Caenorhabditis elegans protein phosphatase ptp-1. Chishti ... Ezrin, moesin, and radixin are highly related proteins (ERM protein family), but the other proteins in which the FERM domain is ... In molecular biology, the FERM domain (F for 4.1 protein, E for ezrin, R for radixin and M for moesin) is a widespread protein ... Non-receptor tyrosine-protein kinase TYK2. Protein-tyrosine phosphatases PTPN3 and PTPN4, enzymes that appear to act at ...

*Protein unc-119 homolog

... a mammalian ortholog of the Caenorhabditis elegans protein unc119, to synaptic ribbons of photoreceptor synapses". J. Biol. ... The encoded product shares strong homology with the C. elegans unc119 protein and it can functionally complement the C. elegans ... Protein unc-119 homolog A is a protein that in humans is encoded by the UNC119 gene. This gene is enriched in the ... 2005). "A human protein-protein interaction network: a resource for annotating the proteome". Cell. 122 (6): 957-68. doi: ...

*CTNS (gene)

Non-human protein homologs for cystinosin include ERS1 in Saccharomyces cerevisiae (yeast cells) and the Caenorhabditis elegans ... CTNS is the gene that encodes the protein cystinosin in humans. Cystinosin is a lysosomal seven-transmembrane protein that ... The protein obeys Michaelis-Menton kinetics and has an associated KM of 278 ± 49 µM. Cystinosin functions as a symporter which ... Variation in the encoded cystinosin protein results in an inhibition or loss in its ability to transport cysteine out of the ...

*XMAP215-Dis1 family

The second group consists of only the Caenorhabditis elegans protein zyg-9, which has three TOG domains. It is similar, though ... Matthews, Lisa; Philip Carter; Danielle Thierry-Mieg; Ken Kemphues (June 1998). "ZYG-9, A Caenorhabditis elegans Protein ... This protein was discovered in 1999. DdCP224: Dictyostelium discoideum Centrosomal Protein. This protein's size is ... This special property classifies this protein family as plus-end tracking proteins (+TIPs). The basic structure of the protein ...

*Crustacean neurohormone family

Caenorhabditis elegans uncharacterised protein ZC168.2. These neurohormones are peptides of 70 to 80 amino acid residues which ... In molecular biology, the crustacean neurohormone family of proteins is a family of neuropeptides expressed by arthropods. The ...

*IMD domain

Caenorhabditis elegans M04F3.5 protein. The vertebrate IRSp53/MIM family is divided into two major groups: the IRSp53 subfamily ... Vertebrate brain-specific angiogenesis nhibitor 1-associated protein 2-like proteins 1 and 2 (BAI1-associated protein 2-like ... Vertebrate ABBA-1 (MTSS1L), a MIM-related protein. Vertebrate brain-specific angiogenesis inhibitor 1-associated protein 2 ( ... a multifunctional adaptor protein that links Rac1 with a Wiskott-Aldrich syndrome family verprolin-homologous protein 2 (WAVE2/ ...

*UNC93B1

This gene encodes a protein with similarity to the Caenorhabditis elegans unc93 protein. The Unc93 protein is involved in the ... Unc-93 homolog B1 (C. elegans), also known as UNC93B1, is a protein which in humans is encoded by the UNC93B1 gene. ... This protein is an intrinsic membrane protein that spans the membrane twelve times. It is found in the endoplasmic reticulum ... Unc93B1 protein appears to be involved in the innate immune response. Defects in the protein predispose to hypersensitity to ...

*Immunoglobulin C2-set domain

Chothia C, Teichmann SA (2000). "Immunoglobulin superfamily proteins in Caenorhabditis elegans". J. Mol. Biol. 296 (5): 1367-83 ... "Protein-Protein Recognition: Juxtaposition of Domain and Interface Cores in Immunoglobulins and Other Sandwich-like Proteins". ... Immunoglobulin-like domains that are related in both sequence and structure can be found in several diverse protein families. ... CD2 displays structural and functional similarities with African swine fever virus (ASFV) LMW8-DR, a protein that is involved ...

*KX blood-group antigen family

... a Caenorhabditis elegans protein implicated in controlling the kinetics of apoptosis and a homologue of the XK family proteins ... CED-8, the only Caenorhabditis elegans Xk-family homolog, also promoted apoptotic PtdSer exposure and cell-corpse engulfment. ... "Caspase-mediated activation of Caenorhabditis elegans CED-8 promotes apoptosis and phosphatidylserine externalization". Nature ... Two covalently linked proteins, Kell and XK, constitute the Kell blood group system. Kell, a 93-Kd type II glycoprotein, is ...

*SMAD (protein)

A similar screen done in the Caenorhabditis elegans protein SMA (from gene sma for small body size) revealed three genes, Sma-2 ... Savage C, Das P, Finelli AL, Townsend SR, Sun CY, Baird SE, Padgett RW (January 1996). "Caenorhabditis elegans genes sma-2, sma ... Thus, the two proteins could be caught in a "vicious cycle" of regulation. Pin1 causes both itself and Smad2 to be associated ... Therefore, downregulating ID proteins is a pathway by which TGF-B signaling could arrest the cell cycle. In a DNA microarray ...

*Ced-3

... is one of the major protein components of the programmed cell death (PCD) pathway for Caenorhabditis elegans. There are ... "ced-3 Cell death protein 3 [ Caenorhabditis elegans ]". The National Center for Biotechnology Information. 2017-10-12. Shaham S ... elegans but for mammals as well. One of the main roles of the ced-3 protein in C. elegans is to help the development and growth ... "Direct physical interaction between the Caenorhabditis elegans 'death proteins' CED-3 and CED-4". FEBS Letters. 406 (1-2): 189- ...

*Synaptic vesicle

"The Caenorhabditis elegans JIP3 Protein UNC-16 Functions As an Adaptor to Link Kinesin-1 with Cytoplasmic Dynein". Journal of ... Trafficking proteins are more complex. They include intrinsic membrane proteins, peripherally bound proteins, and proteins such ... In C. elegans the major motor for synaptic vesicles is UNC-104. There is also evidence that other proteins such as UNC-16/ ... however none of the identified protein interactions between the vesicle proteins and release site proteins can account for the ...

*BED zinc finger

Caenorhabditis elegans Dpy-20 protein, a predicted cuticular gene transcriptional regulator; Drosophila BEAF (boundary element- ... In molecular biology the BED-type zinc finger domain is a protein domain which was named after the Drosophila proteins BEAF and ... Some proteins known to contain a BED domain include animal, plant and fungi AC1 and Hobo-like transposases; ... Aravind L (September 2000). "The BED finger, a novel DNA-binding domain in chromatin-boundary-element-binding proteins and ...

*Galactose binding lectin domain

The hypothetical B0457.1, F32A7.3A and F32A7.3B proteins from Caenorhabditis elegans. Ozeki Y, Matsui T, Suzuki M, Titani K ( ... In molecular biology, the galactose binding lectin domain is a protein domain. It is found in many proteins including the ... homologous to the SUEL protein has been identified in the following proteins: Plant beta-galactosidases EC 3.2.1.23 (lactases ... This protein is composed of three tandem repeat domains homologous to the SUEL lectin domain. All cysteine positions of each ...

*RBFOX1

"Homologues of the Caenorhabditis elegans Fox-1 protein are neuronal splicing regulators in mammals". Molecular and Cellular ... or hexaribonucleotide-binding protein 1 (HRNBP1) or RNA binding protein, fox-1 homolog (Rbfox1), is a protein that in humans is ... Rbfox1 has an RNA recognition motif that is highly conserved among RNA-binding proteins. Rbfox1, and the related protein Rbfox2 ... "A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration". Cell. 125 (4): ...

*NeuN

Underwood JG, Boutz PL, Dougherty JD, Stoilov P, Black DL (2005). "Homologues of the Caenorhabditis elegans Fox-1 protein are ... Fox-3 is one of a family of mammalian homologues of the Fox-1 protein, originally discovered in the nematode worm C. elegans as ... a protein originally found in the nematode worm C. elegans. Western blotting shows that mAb A60 binds to two bands of apparent ... a homologue to sex-determining genes in Caenorhabditis elegans, is a neuronal nuclear antigen that is commonly used as a ...

*EMI domain

"EMI domains are widespread and reveal the probable orthologs of the Caenorhabditis elegans CED-1 protein". Biochem. Biophys. ... Caenorhabditis elegans ced-1, a transmembrane receptor that mediates cell corpse engulfment. Doliana R, Bot S, Bonaldo P, ... It has been suggested that the EMI domain could be a protein-protein interaction module, as the EMI domain of EMILIN-1 was ... Vertebrate Emu proteins, which could interact with several different extracellular matrix components and serve to connect and ...

*Cell nucleus

"Stress induced nuclear granules form in response to accumulation of misfolded proteins in Caenorhabditis elegans". BMC Cell ... The PML protein is the key organizer of these domains that recruits an ever-growing number of proteins, whose only common known ... The nuclear lamina is composed mostly of lamin proteins. Like all proteins, lamins are synthesized in the cytoplasm and later ... The composition by dry weight of the nucleus is approximately: DNA 9%, RNA 1%, Histone Protein 11%, Residual Protein 14%, ...

*Cell polarity

... a Mammalian Homologue of Caenorhabditis elegans Polarity Protein PAR-3". J Cell Biol. 143 (1): 95-106. doi:10.1083/jcb.143.1.95 ... "Atypical protein kinase C cooperates with PAR-3 to establish embryonic polarity in Caenorhabditis elegans". Development. 125 ( ... proteins), 2) asymmetric localization of specific proteins or RNAs within cells (which is often mediated by the cytoskeleton), ... 3) concentration gradients of secreted proteins across the embryo such as Wnt, Nodal, and Bone Morphogenic Proteins (BMPs), and ...

*Epithelial polarity

... a Mammalian Homologue of Caenorhabditis elegans Polarity Protein PAR-3". J Cell Biol. 143 (1): 95-106. doi:10.1083/jcb.143.1.95 ... These molecules are the proteins Cdc42, atypical protein kinase C (aPKC), Par6, Par3/Bazooka/ASIP. Crumbs, "Stardust" and ... Crumbs is the only transmembrane protein in this list and the Crumbs complex serves as an apical cue to keep the aPKC complex ... Apical membrane proteins are trafficked from the Golgi to the apical, rather than baso-lateral, membrane because apical ...

*Shigeo Ohno

... a mammalian homologue of Caenorhabditis elegans polarity protein PAR-3". The Journal of Cell Biology. 143 (1): 95-106. doi: ... which is mammalian homologue of Caenorhabditis elegans Par3. This led to the finding of a conserved Par3-Par6-atypical PKC ... In 1998, he and his colleagues found the atypical PKC-specific interacting protein (ASIP) ... known for his pioneer research on Protein Kinase C and cell polarity. Ohno was born in 1952 in Niigata prefecture, Japan, and ...

*Gluconeogenesis

"Bifunctional glyoxylate cycle protein of Caenorhabditis elegans: a developmentally regulated protein of intestine and muscle". ... Transport of PEP across the mitochondrial membrane is accomplished by dedicated transport proteins; however no such proteins ... it triggers phosphorylation of enzymes and regulatory proteins by Protein Kinase A (a cyclic AMP regulated kinase) resulting in ... From breakdown of proteins, these substrates include glucogenic amino acids (although not ketogenic amino acids); from ...

*Richard I. Morimoto

Neuronal Signaling Modulates Protein Homeostasis in Caenorhabditis elegans Postsynaptic Muscle Cells. Genes and Development: 21 ... Polyglutamine Proteins at the Pathogenic Threshold Display Neuron-Specific Aggregation in a Pan-Neuronal C. elegans Model. ... Polyglutamine Aggregates Alter Protein Folding Homeostasis in C. elegans. Proc. Natl. Acad. Sci. USA. 97: 5750-5755 (2000). Shi ... Neuronal Circuitry Regulates the Response of C. elegans to Misfolded Proteins. Proc. Natl. Acad. Sci. U.S.A. 108: 14204-14209, ...

*UPF3A

... a protein with similarities to Caenorhabditis elegans SMG5 and SMG7 that functions in the dephosphorylation of Upf1". RNA. 9 (1 ... This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. It ... Regulator of nonsense transcripts 3A is a protein that in humans is encoded by the UPF3A gene. This gene encodes a protein that ... Caenorhabditis elegans SMG-4)". Mol Cell Biol. 21 (1): 209-23. doi:10.1128/MCB.21.1.209-223.2001. PMC 88795 . PMID 11113196. ...

*UPF2

... a protein with similarities to Caenorhabditis elegans SMG5 and SMG7 that functions in the dephosphorylation of Upf1". Rna. 9 (1 ... This protein is located in the perinuclear area. It interacts with translation release factors and the proteins that are ... Regulator of nonsense transcripts 2 is a protein that in humans is encoded by the UPF2 gene. This gene encodes a protein that ... Caenorhabditis elegans SMG-4)". Molecular and Cellular Biology. 21 (1): 209-23. doi:10.1128/MCB.21.1.209-223.2001. PMC 88795 . ...

*WIPI2

2000). "Identification of Novel Human Genes Evolutionarily Conserved in Caenorhabditis elegans by Comparative Proteomics". ... WD repeat domain phosphoinositide-interacting protein 2 is a protein that in humans is encoded by the WIPI2 gene. WD40 repeat ... 2001). "Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs ... The Atg proteins regulate autophagy, which is a lysosomal degradation pathway required for maintaining cell health, surviving ...
TumorPortal  TumorPortal
This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development ...
http://www.tumorportal.org/view?geneSymbol=KIAA1109
The dve-1 gene and its possible relation to ageing in roundworms  The dve-1 gene and its possible relation to ageing in roundworms
Several of the RNAi candidates (dve-1; lin-40; nhr-49; ceh-20; lin-11; and nhr-77) appeared to non-discriminately shorten lifespan in all strains tested, suggesting that the corresponding transcription factors are broadly required for survival. Interestingly, four RNAi clones (ZC123.3; nhr-119; ceh-37; and aha-1) affected wild-type and isp-1;ctb-1 mutant worms lifespan to the same extent but exerted only a moderate or no effect on daf-16 and age-1 mutant longevity ...
http://genomics.senescence.info/genes/details.php?id=915
Positioning edgetic residues in CED-9 structures. (a) P | Open-i  Positioning edgetic residues in CED-9 structures. (a) P | Open-i
Positioning edgetic residues in CED-9 structures. (a) Positions of edgetic residues in the CED-9 sequence. The portion of CED-9 present in the crystal (PDB ID c
https://openi.nlm.nih.gov/detailedresult.php?img=PMC2865203_nihms186337f5&req=4
Implications of sequencing the nematode Caenorhabditis elegans genome for plant nematology  Implications of sequencing the nematode Caenorhabditis elegans genome for plant nematology
1. Baldwin, J.G., Nadler, S.A., and Wall, D.H. 1997. Nematodes: Pervading the Earth and Linking all Life. Pp. 176-191. In: Raven, P.H. (ed.). National Academy Press, Washington, D.C. 625 pp.. 2. Bargmann, C. I. 1998. Neurobiology of the Caenorhabditis elegans genome. Science 282:2028-2033.. 3. Bargmann, C. I. And Mori, I. 1997. Chemotaxis and Thermotaxis. Pp. 717-737. In: Riddle, D.L., Blumenthal, T., Meyer, B.J. and Priess, J.R. (eds). C. elegans II. Cold Spring Harbor Laboratory Press, Plainview, NY 1222 pp.. 4. Bird, D.M. and Opperman, C. H. 1998. Caenorhabditis elegans. J. Nematol. 30:299-308.. 5. Bird, D.M., Opperman, C.H., Jones S.J.M., and Baillie, D.L. 1999. The Caenorhabditis elegans gemome: a guide in the post genomics age. Annu. Rev. Phytopathol. 37:247-265.. 6. Blaxter, M. 1998. Caenorhabditis elegans is a nematode. Science 282:2041-2046.. 7. Blaxter, M. and Bird, D. 1997. Parasitic nematodes. Pp. 851-878. In: Riddle, D.L., Blumenthal, T., Meyer, B.J. and Priess, J.R. (eds). C. ...
https://www.apsnet.org/publications/apsnetfeatures/Pages/Celegans.aspx
Decreased expression of myogenic transcription factors and myosin heavy chains in Caenorhabditis elegans muscles developed...  Decreased expression of myogenic transcription factors and myosin heavy chains in Caenorhabditis elegans muscles developed...
The molecular mechanisms underlying muscle atrophy during spaceflight are not well understood. We have analyzed the effects of a 10-day spaceflight on Caenorhabditis elegans muscle development. DNA microarray, real-time quantitative PCR, and quantitative western blot analyses revealed that the amount of MHC in both body-wall and pharyngeal muscle decrease in response to spaceflight. Decreased transcription of the body-wall myogenic transcription factor HLH-1 (CeMyoD) and of the three pharyngeal myogenic transcription factors, PEB-1, CEH-22 and PHA-4 were also observed. Upon return to Earth animals displayed reduced rates of movement, indicating a functional defect. These results demonstrate that C. elegans muscle development is altered in response to spaceflight. This altered development occurs at the level of gene transcription and was observed in the presence of innervation, not simply in isolated cells. This important finding coupled with past observations of decreased levels of the same ...
https://jeb.biologists.org/content/209/16/3209.short
Germ Granules Prevent Accumulation of Somatic Transcripts in the Adult Caenorhabditis elegans Germline | Genetics  Germ Granules Prevent Accumulation of Somatic Transcripts in the Adult Caenorhabditis elegans Germline | Genetics
The germ cells of multicellular organisms protect their developmental potential through specialized mechanisms. A shared feature of germ cells from worms to humans is the presence of nonmembrane-bound, ribonucleoprotein organelles called germ granules. Depletion of germ granules in Caenorhabditis elegans (i.e., P granules) leads to sterility and, in some germlines, expression of the neuronal transgene unc-119::gfp and the muscle myosin MYO-3. Thus, P granules are hypothesized to maintain germ cell totipotency by preventing somatic development, although the mechanism by which P granules carry out this function is unknown. In this study, we performed transcriptome and single molecule RNA-FISH analyses of dissected P granule-depleted gonads at different developmental stages. Our results demonstrate that P granules are necessary for adult germ cells to downregulate spermatogenesis RNAs and to prevent the accumulation of numerous soma-specific RNAs. P granule-depleted gonads that express the ...
http://www.genetics.org/content/206/1/163
The SH3 domain of UNC-89 (obscurin) interacts with paramyosin, a coiled-coil protein, in Caenorhabditis elegans muscle  The SH3 domain of UNC-89 (obscurin) interacts with paramyosin, a coiled-coil protein, in Caenorhabditis elegans muscle
rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:bibo="http://purl.org/ontology/bibo/" xmlns:dspace="http://digital-repositories.org/ontologies/dspace/0.1.0#" xmlns:foaf="http://xmlns.com/foaf/0.1/" xmlns:void="http://rdfs.org/ns/void#" xmlns:xsd="http://www.w3.org/2001/XMLSchema#" , ,rdf:Description rdf:about="https://kops.uni-konstanz.de/rdf/resource/123456789/34900", ,bibo:uri rdf:resource="https://kops.uni-konstanz.de/handle/123456789/34900"/, ,dc:creator,Deehan, Kevin,/dc:creator, ,dc:creator,Wilson, Kristy J.,/dc:creator, ,dc:language,eng,/dc:language, ,dcterms:abstract xml:lang="eng",UNC-89 is a giant polypeptide located at the sarcomeric M-line of Caenorhabditis elegans muscle. The human homologue is obscurin. To understand how UNC-89 is localized and functions, we have been identifying its binding partners. Screening a yeast two-hybrid library revealed that UNC-89 interacts with ...
https://kops.uni-konstanz.de/handle/123456789/34900
The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation - Infoscience  The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation - Infoscience
Centrioles are microtubule-based organelles crucial for cell division, sensing and motility. In Caenorhabditis elegans, the onset of centriole formation requires notably the proteins SAS-5 and SAS-6, which have functional equivalents across eukaryotic evolution. Whereas the molecular architecture of SAS-6 and its role in initiating centriole formation are well understood, the mechanisms by which SAS-5 and its relatives function is unclear. Here, we combine biophysical and structural analysis to uncover the architecture of SAS-5 and examine its functional implications in vivo. Our work reveals that two distinct self-associating domains are necessary to form higher-order oligomers of SAS-5: a trimeric coiled coil and a novel globular dimeric Implico domain. Disruption of either domain leads to centriole duplication failure in worm embryos, indicating that large SAS-5 assemblies are necessary for function in vivo. Rogala, Kacper B; Dynes, Nicola J; Hatzopoulos, Georgios N; Yan, Jun; Pong, Sheng Kai;
https://infoscience.epfl.ch/record/214462?ln=en
Determination of Life-Span in Caenorhabditis elegans by Four Clock Genes | Science  Determination of Life-Span in Caenorhabditis elegans by Four Clock Genes | Science
The nematode worm Caenorhabditis elegans is a model system for the study of the genetic basis of aging. Maternal-effect mutations in four genes-clk-1, clk-2, clk-3, and gro-1- interact genetically to determine both the duration of development and life-span. Analysis of the phenotypes of these mutants suggests the existence of a general physiological clock in the worm. Mutations in certain genes involved in dauer formation (an alternative larval stage induced by adverse conditions in which development is arrested) can also extend life-span, but the life extension of Clock mutants appears to be independent of these genes. The daf-2(e1370) clk-1(e2519) worms, which carry life-span-extending mutations from two different pathways, live nearly five times as long as wild-type worms.. ...
http://science.sciencemag.org/content/272/5264/1010
DIGITAL.CSIC: Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in Caenorhabditis elegans  DIGITAL.CSIC: Protein kinase VRK-1 regulates cell invasion and EGL-17/FGF signaling in Caenorhabditis elegans
The vaccinia-related kinases (VRKs) are highly conserved throughout the animal kingdom and phosphorylate several chromatin proteins and transcription factors. In early Caenorhabditis elegans embryos, VRK-1 is required for proper nuclear envelope formation. In this work, we present the first investigation of the developmental role of VRKs by means of a novel C. elegans vrk-1 mutant allele. We found that VRK-1 is essential in hermaphrodites for formation of the vulva, uterus, and utse and for development and maintenance of the somatic gonad and thus the germ line. VRK-1 regulates anchor cell polarity and the timing of anchor cell invasion through the basement membranes separating vulval and somatic gonadal cells during the L3 larval stage. VRK-1 is also required for proper specification and proliferation of uterine cells and sex myoblasts. Expression of the fibroblast growth factor-like protein EGL-17 and its receptor EGL-15 is reduced in vrk-1 mutants, suggesting that VRK-1 might act at least ...
https://digital.csic.es/handle/10261/17712
A Conserved p38 MAP Kinase Pathway in Caenorhabditis elegans Innate Immunity | Science  A Conserved p38 MAP Kinase Pathway in Caenorhabditis elegans Innate Immunity | Science
A genetic screen for Caenorhabditis elegans mutants with enhanced susceptibility to killing by Pseudomonas aeruginosaled to the identification of two genes required for pathogen resistance: sek-1, which encodes a mitogen-activated protein (MAP) kinase kinase, and nsy-1, which encodes a MAP kinase kinase kinase. RNA interference assays and biochemical analysis established that a p38 ortholog, pmk-1, functions as the downstream MAP kinase required for pathogen defense. These data suggest that this MAP kinase signaling cassette represents an ancient feature of innate immune responses in evolutionarily diverse species. ...
http://science.sciencemag.org/content/297/5581/623
Altered expression of an L1-specific, O-linked cuticle surface glycoprotein in mutants of the nematode Caenorhabditis elegans. ...  Altered expression of an L1-specific, O-linked cuticle surface glycoprotein in mutants of the nematode Caenorhabditis elegans. ...
Mouse mAb M38 was used in indirect immunofluorescence experiments to detect a stage-specific antigen on the surface of the first larval stage (L1) of the free-living nematode Caenorhabditis elegans, and to detect alterations in the apparent expression of this antigen in two distinct classes of C. elegans mutants. In previously described srf-2 and srf-3 mutants (Politz S. M., M. T. Philipp, M. Estevez, P.J. OBrien, and K. J. Chin. 1990. Proc. Natl. Acad. Sci. USA. 87:2901-2905), the antigen is not detected on the surface of any stage. Conversely, in srf-(yj43) and other similar mutants, the antigen is expressed on the surface of the first through the fourth (L4) larval stages. To understand the molecular basis of these alterations, the antigen was characterized in gel immunoblotting experiments. After SDS-PAGE separation and transfer to nitrocellulose, M38 detected a protein antigen in extracts of wild-type L1 populations. The antigen was sensitive to digestion by Pronase and O-glycanase ...
http://jcb.rupress.org/content/115/5/1237.long
On the nature of undead cells in the nematode Caenorhabditis elegans | Philosophical Transactions of the Royal Society B:...  On the nature of undead cells in the nematode Caenorhabditis elegans | Philosophical Transactions of the Royal Society B:...
During the course of normal embryonic and post-embryonic development, 131 cells in a Caenorhabditis elegans hermaphrodite undergo programmed cell death. Loss of function mutations in either of the genes ced-3 or ced-4 abolish cell deaths, enabling these undead cells to survive and be incorporated into the adult with no obvious deleterious consequences. Ultrastructural reconstructions have shown that undead cells exhibit many differentiated characteristics. Most of the reconstructed cells appeared to be neurons with all the characteristic features associated with such cells, such as processes, synaptic vesicles and presynaptic specializations. However, clear morphological differences were seen among the undead neurons, suggesting a diversity of cell type. One of the reconstructed cells was a rectal epithelial cell, which had displaced its lineal sister that normally functions in this role. Removal of the ability to undergo programmed cell death by mutation therefore reveals a diversity of ...
http://rstb.royalsocietypublishing.org/content/331/1261/263
The C. elegans Hox gene egl-5 is required for correct development of the hermaphrodite hindgut and for the response to rectal...  The C. elegans Hox gene egl-5 is required for correct development of the hermaphrodite hindgut and for the response to rectal...
Members of the Hox gene family encode transcription factors that specify positional identity along the anterior-posterior axis of nearly all metazoans. One among the Caenorhabditis elegans Hox genes is egl-5. A deletion allele of egl-5 was isolated in a screen for animals which fail to develop swollen tails when exposed to the bacterial pathogen Microbacterium nematophilum. We show that compromised rectal development, which occurs as a result of loss of egl-5 function, results in a failure of rectal epithelial cells to express the ERK MAP kinase mpk-1, which was previously shown to mediate tail-swelling in response to bacterial infection. Tissue-specific rescue experiments demonstrated that egl-5 and mpk-1 act autonomously in rectal cells in the morphological response. The weak egl-5 allele (n1439), which does not compromise rectal development, fails to affect tail-swelling. We find that this allele carries an inserted repeat element approximately 13.8 kb upstream of the egl-5 open reading frame, which
https://www.neuroscience.ox.ac.uk/publications/202875
Serotonin-deficient Mutants and Male Mating Behavior in the Nematode Caenorhabditis Elegans - PubMed  Serotonin-deficient Mutants and Male Mating Behavior in the Nematode Caenorhabditis Elegans - PubMed
Defining a behavior that requires the function of specific neurons in the free-living nematode Caenorhabditis elegans can allow one to screen for mutations that disrupt the specification or function of those neurons. We identified serotonin-immunoreactive neurons required for tail curling or turnin …
https://pubmed.ncbi.nlm.nih.gov/8254383/
IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans | EMBO Reports  IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans | EMBO Reports
RNA interference (RNAi) is a widespread and widely exploited phenomenon which has potential as a strategy for both the treatment of disease and pest control. RNAi results in down‐regulation of a specific gene in response to the production of small interfering RNAs (siRNAs). RNAi is one of a family of processes mediated by small non‐coding RNAs [1], [2]. In Caenorhabditis elegans, and in a number of other organisms, RNAi is systemic so that the introduction of dsRNA into one tissue triggers gene silencing in other tissues [3], [4], [5], [6], [7]. Furthermore, systemic RNAi enables C. elegans and other organisms to exhibit environmental RNAi [5]. For example, feeding C. elegans on bacteria expressing dsRNA initiates a widespread RNAi response [8], [9]. Studies in C. elegans and other organisms have provided mechanistic insights into RNAi [4], [10], [11], [12], [13], although the role of exogenous RNAi in the normal life of C. elegans and other animals remains unclear [14].. Whilst C. elegans ...
http://embor.embopress.org/content/early/2015/01/21/embr.201439585
A new kind of informational suppression in the nematode Caenorhabditis elegans. | Genetics  A new kind of informational suppression in the nematode Caenorhabditis elegans. | Genetics
Independent reversions of mutations affecting three different Caenorhabditis elegans genes have each yielded representatives of the same set of extragenic suppressors. Mutations at any one of six loci act as allele-specific recessive suppressors of certain allels of unc-54 (a myosin heavy chain gene), lin-29 (a heterochronic gene), and tra-2 (a sex determination gene). The same mutations also suppress certain alleles of another sex determination gene, tra-1, and of a morphogenetic gene, dpy-5. In addition to their suppression phenotype, the suppressor mutations cause abnormal morphogenesis of the male bursa and the hermaphrodite vulva. We name these genes smg-1 through smg-6 (suppressor with morphogenetic effect on genitalia), in order to distinguish them from mab (male abnormal) genes that can mutate to produce abnormal genitalia but which do not act as suppressors (smg-1 and smg-2 are new names for two previously described genes, mab-1 and mab-11). The patterns of suppression, and the ...
https://www.genetics.org/content/123/2/301?ijkey=8bcc22862e044ebad73370038642af36bfb84efb&keytype2=tf_ipsecsha
Axonal guidance defects in a Caenorhabditis elegans mutant reveal cell-extrinsic determinants of neuronal morphology.  Axonal guidance defects in a Caenorhabditis elegans mutant reveal cell-extrinsic determinants of neuronal morphology.
Mutations in the gene unc-53 of Caenorhabditis elegans result in behavioral and anatomical abnormalities. Immunocytochemistry and electron microscopy revealed neuroanatomical defects in all main longitudinal nervous tracts. Whole tracts were found to
http://www.biomedsearch.com/nih/Axonal-guidance-defects-in-Caenorhabditis/8410186.html
Caenorhabditis elegans MIG-13 protein Summary Report | CureHunter  Caenorhabditis elegans MIG-13 protein Summary Report | CureHunter
Caenorhabditis elegans MIG-13 protein: required for positioning of Q neuroblasts and their descendents along the anteroposterior axis; isolated from Caenorhabditis elegans; amino acid sequence in first source; GenBAnk AF150958
http://www.curehunter.com/public/keywordSummaryC120452-Caenorhabditis-elegans-MIG-13-protein.do
C. elegans** homologs of insect clock proteins: a tale of many stories - Institutional Repository University of Antwerp  C. elegans** homologs of insect clock proteins: a tale of many stories - Institutional Repository University of Antwerp
As a consequence of the Earths axial rotation, organisms display daily recurring rhythms in behavior and biochemical properties, such as hormone titers. The neuronal system controlling such changes is best studied in the fruit fly Drosophila melanogaster. In the nematode worm Caenorhabditis elegans, most homologs of these genes function in the heterochronic pathway controlling the (timing of) developmental events. Recent data indicate that in the worm at least one of the genes involved in developmental timing is also active in circadian rhythm control, thereby opening up new perspectives on a central (neuronal) timer interfering with many processes. Also, new neuropeptidergic clock homologs have been identified in nematodes, supporting the idea of a broad range of clock-regulated targets. We will describe the current knowledge on homologous clock genes in C. elegans with a focus on the recently discovered pigment dispersing factor gene homologs. Similarities between developmental and daily ...
https://repository.uantwerpen.be/link/irua/106368
CYP-13A12 of the nematode Caenorhabditis elegans is a PUFA-epoxygenase involved in behavioural response to reoxygenation |...  CYP-13A12 of the nematode Caenorhabditis elegans is a PUFA-epoxygenase involved in behavioural response to reoxygenation |...
A specific behavioural response of Caenorhabditis elegans, the rapid increase of locomotion in response to anoxia/reoxygenation called the O2-ON response, has been used to model key aspects of ischaemia/reperfusion injury. A genetic suppressor screen demonstrated a direct causal role of CYP (cytochrome P450)-13A12 in this response and suggested that CYP-eicosanoids, which in mammals influence the contractility of cardiomyocytes and vascular smooth muscle cells, might function in C. elegans as specific regulators of the body muscle cell activity. In the present study we show that co-expression of CYP-13A12 with the NADPH-CYP-reductase EMB-8 in insect cells resulted in the reconstitution of an active microsomal mono-oxygenase system that metabolized EPA (eicosapentaenoic acid) and also AA (arachidonic acid) to specific sets of regioisomeric epoxy and hydroxy derivatives. The main products included 17,18-EEQ (17,18-epoxyeicosatetraenoic acid) from EPA and 14,15-EET (14,15-epoxyeicosatrienoic acid) ...
http://www.biochemj.org/content/464/1/61
Genetic and molecular analysis of a Caenorhabditis elegans beta-tubulin that conveys benzimidazole sensitivity. | JCB  Genetic and molecular analysis of a Caenorhabditis elegans beta-tubulin that conveys benzimidazole sensitivity. | JCB
Benzimidazole anti-microtubule drugs, such as benomyl, induce paralysis and slow the growth of the nematode Caenorhabditis elegans. We have identified 28 mutations in C. elegans that confer resistance to benzimidazoles. All resistant mutations map to a single locus, ben-1. Virtually all these mutations are genetically dominant. Molecular cloning and DNA sequence analysis established that ben-1 encodes a beta-tubulin. Some resistant mutants are completely deleted for the ben-1 gene. Since the deletion strains appear to be fully resistant to the drugs, the ben-1 product appears to be the only benzimidazole-sensitive beta-tubulin in C. elegans. Furthermore, since animals lacking ben-1 are viable and coordinated, the ben-1 beta-tubulin appears to be nonessential for growth and movement. The ben-1 function is likely to be redundant in the nematode genome. ...
http://jcb.rupress.org/content/109/6/2993
A semi-automated system based on level sets and invariant spatial interrelation shape features for Caenorhabditis elegans...  A semi-automated system based on level sets and invariant spatial interrelation shape features for Caenorhabditis elegans...
Caenorhabditis elegans shares several molecular and physiological homologies with humans and thus plays a key role in studying biological processes. As a consequence, much progress has been made in automating the analysis of C. elegans. However, there is still a strong need to achieve more progress in automating the analysis of static images of adult worms. In this paper, a three-phase semi-automated system has been proposed. As a first phase, a novel segmentation framework, based on variational level sets and local pressure force function, has been introduced to handle effectively images corrupted with intensity inhomogeneity. Then, a set of robust invariant symbolic features for high-throughput screening of image-based C. elegans phenotypes are extracted. Finally, a classification model is applied to discriminate between the different subsets. The proposed system demonstrates its effectiveness in measuring morphological phenotypes in individual worms of C. elegans.. ...
http://wrap.warwick.ac.uk/96383/
VAB-10 spectraplakin acts in cell and nuclear migration in Caenorhabditis elegans | Development  VAB-10 spectraplakin acts in cell and nuclear migration in Caenorhabditis elegans | Development
Cytoskeletal regulation is important in cell migration. The Caenorhabditis elegans gonadal distal tip cells (DTCs) offer a simple model with which to investigate the mechanism of cell migration in organogenesis. Here, we report that one of the spectraplakin isoforms, VAB-10B1, plays an essential role in cell and nuclear migration of DTCs by regulating the actin and microtubule (MT) cytoskeleton. In the vab-10(tk27) mutant, which lacks VAB-10B1, alignment of filamentous (F)-actin and MTs was weakly and severely disorganized, respectively, which resulted in a failure to translocate the DTC nucleus and a premature termination of DTC migration. An MT growing-tip marker, EBP-2-GFP, revealed that polarized outgrowth of MTs towards the nuclei of migrating DTCs was strikingly impaired in tk27 animals. A vab-10 mini-gene encoding only the actin- and MT-binding domains significantly rescued the gonadal defects, suggesting that VAB-10B1 has a role in linking actin and MT filaments. These results suggest ...
http://dev.biologists.org/content/early/2011/08/10/dev.059568
C. elegans ced-13 can promote apoptosis and is induced in response to DNA damage.  C. elegans ced-13 can promote apoptosis and is induced in response to DNA damage.
Amino Acid Sequence, Animals, Apoptosis/*physiology, Apoptosis Regulatory Proteins, Caenorhabditis/genetics, Caenorhabditis elegans/embryology/genetics/*physiology, Caenorhabditis elegans Proteins/genetics/metabolism/*physiology, DNA/genetics/radiation effects, DNA Damage, Gene Deletion, Gene Expression Regulation; Developmental/radiation effects, Heat-Shock Proteins/genetics, Models; Biological, Molecular Sequence Data, Mutation, Proto-Oncogene Proteins/genetics/metabolism, Repressor Proteins/genetics, Sequence Homology; Amino Acid, Tumor Suppressor Protein p53/genetics/physiology, X-Rays ...
http://umu.diva-portal.org/smash/record.jsf?pid=diva2:157623
A compendium of Caenorhabditis elegans RNA binding proteins predicts e by Alex M. Tamburino, Sean P. Ryder et al.  "A compendium of Caenorhabditis elegans RNA binding proteins predicts e" by Alex M. Tamburino, Sean P. Ryder et al.
Gene expression is regulated at multiple levels, including transcription and translation, as well as mRNA and protein stability. Although systems-level functions of transcription factors and microRNAs are rapidly being characterized, few studies have focused on the posttranscriptional gene regulation by RNA binding proteins (RBPs). RBPs are important to many aspects of gene regulation. Thus, it is essential to know which genes encode RBPs, which RBPs regulate which gene(s), and how RBP genes are themselves regulated. Here we provide a comprehensive compendium of RBPs from the nematode Caenorhabditis elegans (wRBP1.0). We predict that as many as 887 (4.4%) of C. elegans genes may encode RBPs ~250 of which likely function in a gene-specific manner. In addition, we find that RBPs, and most notably gene-specific RBPs, are themselves enriched for binding and modification by regulatory proteins, indicating the potential for extensive regulation of RBPs at many different levels. wRBP1.0 will provide a
https://escholarship.umassmed.edu/sysbio_pubs/23/
Regulation of anchor cell invasion and uterine cell fates by the egl-43 Evi-1 proto-oncogene in Caenorhabditis elegans.  Regulation of anchor cell invasion and uterine cell fates by the egl-43 Evi-1 proto-oncogene in Caenorhabditis elegans.
Cell invasion is a tightly controlled process occurring during development and tumor progression. The nematode Caenorhabditis elegans serves as a genetic model to study cell invasion during normal development. In the third larval stage, the anchor ce
http://www.biomedsearch.com/nih/Regulation-anchor-cell-invasion-uterine/17573066.html
The CeCDC-14 phosphatase is required for cytokinesis in the Caenorhabditis elegans embryo | Journal of Cell Biology |...  The CeCDC-14 phosphatase is required for cytokinesis in the Caenorhabditis elegans embryo | Journal of Cell Biology |...
A search of the C. elegans genome for potential homologues of the yeast MEN/SIN genes revealed several candidate genes, although for some of these genes the sequence similarities were only limited and for TEM1, CDC15, and BFA1 no putative homologues could be identified (Table I). All candidate genes were tested in C. elegans for a possible function in a hypothetical MEN/SIN-like regulatory network, using RNAi to deplete the corresponding products. For depletion of putative MEN/SIN gene products, both RNAi feeding and injection methods (Montgomery and Fire, 1998; Timmons et al., 2001) were tried to maximize the probability of functional inactivation. The results of these experiments are summarized in Table I. A priori, we had expected that depletion of a gene product required for the regulation of mitotic exit or the onset of cytokinesis should result in embryonic lethality. However, of all components tested, only the depletion of the C. elegans homologue of the budding yeast Cdc14p phosphatase ...
https://rupress.org/jcb/article/158/5/901/32809/The-CeCDC-14-phosphatase-is-required-for
Reliable CRISPR/Cas9 Genome Engineering in Caenorhabditis elegans Using a Single Efficient sgRNA and an Easily Recognizable...  Reliable CRISPR/Cas9 Genome Engineering in Caenorhabditis elegans Using a Single Efficient sgRNA and an Easily Recognizable...
The pace of technical developments allowing the direct manipulation of genome sequences has seen a marked acceleration in recent years with the emergence of RNA-targeted nucleases derived from bacterial immune systems (Doudna and Charpentier 2014; Zetsche et al. 2015). In particular, the binary system relying on the Streptococcus pyogenes Cas9 endonuclease targeted by CRISPR (clustered, regularly interspaced, short, palindromic repeat) RNAs has been successfully used to generate point mutations, deletion, or DNA insertions in an ever-growing number of experimental systems. S. pyogenes CRISPR/Cas9 has been adapted early on in the model nematode Caenorhabditis elegans (Friedland et al. 2013; Dickinson et al. 2013; Chen et al. 2013; Frøkjær-Jensen 2013; Dickinson and Goldstein 2016). Previously, heritable genome engineering could only be achieved in C. elegans by remobilizing a Drosophila Mos1 transposon, which could be inserted and excised in the germline (Robert and Bessereau 2007; ...
http://www.g3journal.org/content/7/5/1429
The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal...  The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal...
BACKGROUND : The nematode Caenorhabditis elegans has been used extensively to identify the genetic requirements for proper nervous system development and function. Key to this process is the direction of vesicles to the growing axons and dendrites, which is required for growth-cone extension and synapse formation in the developing neurons. The contribution and mechanism of membrane traffic in neuronal development are not fully understood, however. RESULTS : We show that the C. elegans gene unc-69 is required for axon outgrowth, guidance, fasciculation and normal presynaptic organization. We identify UNC-69 as an evolutionarily conserved 108-amino-acid protein with a short coiled-coil domain. UNC-69 interacts physically with UNC-76, mutations in which produce similar defects to loss of unc-69 function. In addition, a weak reduction-of-function allele, unc-69(ju69), preferentially causes mislocalization of the synaptic vesicle marker synaptobrevin. UNC-69 and UNC-76 colocalize as puncta in ...
http://www.zora.uzh.ch/id/eprint/243/
C elegans Lin-3 protein Summary Report | CureHunter  C elegans Lin-3 protein Summary Report | CureHunter
C elegans Lin-3 protein: amino acid sequence given in first source; lin-3 encodes an inductive signal for vulval development; from Caenorhabditis elegans
http://www.curehunter.com/public/keywordSummaryC075912-C-elegans-Lin-3-protein.do
Caenorhabditis elegans: Modern Biological Analysis of an Organism: Caenorhibditus Elegans: Modern Biological Analysis of an...  Caenorhabditis elegans: Modern Biological Analysis of an Organism: Caenorhibditus Elegans: Modern Biological Analysis of an...
Buy or Rent Caenorhabditis elegans: Modern Biological Analysis of an Organism: Caenorhibditus Elegans: Modern Biological Analysis of an Organism as an eTextbook and get instant access. With VitalSource, you can save up to 80% compared to print.
https://www.vitalsource.com/products/caenorhabditis-elegans-modern-biological-analysis-author-unknown-v9780125641494
James McGhee | University of Calgary  James McGhee | University of Calgary
We are studying the development of the intestine in the small free-living nematode worm Caenorhabditis elegans. The worm intestine develops as a simple clone of cells, entirely deriving from a single cell in the eight-cell embryo. We mainly focus on the transcription factor network that drives development of the intestine. From our work and that of others, we now know all the core transcription factors that control intestinal genes, from specification to differentiation, and they all are "GATA factors" similar to the factors that are central to the development of the human intestine. We are now trying to figure out how these factors actually work, i.e. to define the molecular and thermodynamic basis of developmental specificity. Does all the specificity reside in the DNA binding domain? And if so, how much does the binding free energy to an intestinal gene differ from the binding free energy to a gene expressed in a different lineage, e.g. the hypodermis (skin)? Are there other protein domains ...
http://www.ucalgary.ca/future-students/graduate/supervisor/james-mcghee
Cis-regulatory mechanisms of gene expression in an olfactory neuron type in Caenorhabditis elegans<...  Cis-regulatory mechanisms of gene expression in an olfactory neuron type in Caenorhabditis elegans<...
TY - JOUR. T1 - Cis-regulatory mechanisms of gene expression in an olfactory neuron type in Caenorhabditis elegans. AU - Nokes, Eva B.. AU - Van Der Linden, Alexander M.. AU - Winslow, Caron. AU - Mukhopadhyay, Saikat. AU - Ma, Kristin. AU - Sengupta, Piali. PY - 2009/12. Y1 - 2009/12. N2 - The generation of cellular diversity is dependent on the precise spatiotemporal regulation of gene expression by both cis- and trans-acting mechanisms. The developmental principles regulating expression of specific gene subsets in individual cell types are not fully understood. Here we define the cis-regulatory mechanisms driving expression of cell-selective and broadly expressed genes in vivo in the AWB olfactory neuron subtype in C. elegans. We identify an element that is necessary to drive expression of neuron-selective chemoreceptor genes in the AWB neurons, and show that this element functions in a context-dependent manner. We find that the expression of broadly expressed sensory neuronal genes in the ...
https://utsouthwestern.pure.elsevier.com/en/publications/cis-regulatory-mechanisms-of-gene-expression-in-an-olfactory-neur
Paired and LIM class homeodomain proteins coordinate differentiation of the C. elegans ALA neuron | Development  Paired and LIM class homeodomain proteins coordinate differentiation of the C. elegans ALA neuron | Development
Many crucial events in metazoan development and physiology are governed by diffusible signals that trigger specific responses in highly restricted subsets of cells. This exquisite specificity of intercellular signaling requires precisely controlled expression of receptors and downstream signaling components that effect appropriate responses. The nematode Caenorhabditis elegans has proven a valuable model for the study of signaling specificity, notably for mechanisms of signaling through the Epidermal growth factor (EGF) receptor (for a review, see Moghal and Sternberg, 2003). The sole EGF-like ligand and EGF receptor in the C. elegans genome are encoded by the genes lin-3 and let-23, respectively (Hill and Sternberg, 1992; Aroian et al., 1990) (Wormbase WS210). Recently we described a role for LET-23 in the regulation of C. elegans behavior (Van Buskirk and Sternberg, 2007). Caenorhabditis elegans develops through four larval stages before adulthood, and each larval molt is preceded by ...
http://dev.biologists.org/content/137/12/2065
SMART: TLC domain annotation  SMART: TLC domain annotation
LAG1 is a longevity gene, the first such gene to be identified and cloned from the yeast Saccharomyces cerevisiae. A close homolog of this gene, which we call LAC1, has been found in the yeast genome. We have cloned the human homolog of LAG1 with the ultimate goal of examining its possible function in human aging. In the process, we have also cloned a homolog from the nematode worm Caenorhabditis elegans. Both of these homologs, LAG1Hs and LAG1Ce-1, functionally complemented the lethality of a lag1delta lac1delta double deletion, despite low overall sequence similarity to the yeast proteins. The proteins shared a short sequence, the Lag1 motif, and a similar transmembrane domain profile. Another, more distant human homolog, TRAM, which lacks this motif, did not complement. LAG1Hs also restored the life span of the double deletion, demonstrating that it functions in establishing the longevity phenotype in yeast. LAG1Hs mapped to 19p12, and it was expressed in only three tissues: brain, skeletal ...
http://smart.embl.de/smart/do_annotation.pl?DOMAIN=SM00724
Caenorhabditis elegans Olfaction - Oxford Research Encyclopedia of Neuroscience  Caenorhabditis elegans Olfaction - Oxford Research Encyclopedia of Neuroscience
To survive, animals must properly sense their surrounding environment. The types of sensation that allow for detecting these changes can be categorized as tactile, thermal, aural, or olfactory. Olfaction is one of the most primitive senses, involving the detection of environmental chemical cues. Organisms must sense and discriminate between abiotic and biogenic cues, necessitating a system that can react and respond to changes quickly. The nematode, Caenorhabditis elegans, offers a unique set of tools for studying the biology of olfactory sensation.The olfactory system in C. elegans is comprised of 14 pairs of amphid neurons in the head and two pairs of phasmid neurons in the tail. The male nervous system contains an additional 89 neurons, many of which are exposed to the environment and contribute to olfaction. The cues sensed by these olfactory neurons initiate a multitude of responses, ranging from developmental changes to behavioral responses. Environmental cues might initiate entry into or exit
https://oxfordre.com/neuroscience/view/10.1093/acrefore/9780190264086.001.0001/acrefore-9780190264086-e-191?rskey=heYMD0
An Overview of Stress Response and Hypometabolic Strategies in Caenorhabditis elegans: Conserved and Contrasting Signals with...  An Overview of Stress Response and Hypometabolic Strategies in Caenorhabditis elegans: Conserved and Contrasting Signals with...
Abstract. Studies of the molecular mechanisms that are involved in stress responses (environmental or physiological) have long been used to make links to disease states in humans. The nematode model organism, Caenorhabditis elegans, undergoes a state of hypometabolism called the dauer stage. This period of developmental arrest is characterized by a significant reduction in metabolic rate, triggered by ambient temperature increase and restricted oxygen/ nutrients. C. elegans employs a number of signal transduction cascades in order to adapt to these unfavourable conditions and survive for long times with severely reduced energy production. The suppression of cellular metabolism, providing energetic homeostasis, is critical to the survival of nematodes through the dauer period. This transition displays molecular mechanisms that are fundamental to control of hypometabolism across the animal kingdom. In general, mammalian systems are highly inelastic to environmental stresses (such as extreme ...
http://www.ijbs.com/v06p0009
Imaging the Pharynx to Measure the Uptake of Doxorubicin in Caenorhabditis elegans -BIO-PROTOCOL  Imaging the Pharynx to Measure the Uptake of Doxorubicin in Caenorhabditis elegans -BIO-PROTOCOL
Caenorhabditis elegans offers an array of advantages to investigate the roles of uptake transporters. Herein, an epifluorescent microscopy approach was developed to monitor the uptake of the autofluorescent anticancer drug, doxorubicin, into the pharynx of C. elegans by organic cation transporters.
https://bio-protocol.org/p.aspx?id=e2291
Summary information of cluster CELK01201  Summary information of cluster CELK01201
gi,17559712,ref,NP_506256.1, CaDHerin family member (cdh-6) [Caenorhabditis elegans] gi,7499172,pir,,T20968 hypothetical protein F15B9.7 - Caenorhabditis elegans gi,3875964,emb,CAB01427.1, Hypothetical protein F15B9.7 [Caenorhabditis elegans] gi,3880568,emb,CAB01449.1, C. elegans CDH-6 protein (corresponding sequence F15B9.7) [Caenorhabditis elegans ...
http://nematode.lab.nig.ac.jp/db2/ShowGeneInfo.php?celk=CELK01201
Caenorhabditis elegans Module  Caenorhabditis elegans Module
For the first days, we will introduce students to the nematode C. elegans. Students will work with different experimental set-ups that will allow us to explore a variety of C. elegans behavior. We will analyze C. elegans behavior in response to thermal, mechanical and chemical stimuli. The transparency of the animal makes it feasible to use genetically encoded calcium sensors to monitor neural activity in response to sensory stimuli. Transgenic expression of light-activated ion channels, allows us to turn neurons on and off. These optogenetic experiments will be used to define neural requirements of sensory processing. Students will use these techniques to determine 1) how C. elegans responds and remembers the temperature at which was raised; 2) analyze the neural dynamics of a compound motor sequence that is evoked by touch; 3) determine the neural requirements of calcium channels chemosensation. These experiments are an ideal introduction to Calcium imaging optogenetics in a genetically ...
http://www.mbl.edu/nsb/about/caenorhabditis-elegans/
Ageing in nematodes: Do antioxidants extend lifespan in Caenorhabditis elegans? | ScholarBank@NUS  Ageing in nematodes: Do antioxidants extend lifespan in Caenorhabditis elegans? | [email protected]
Pun, P.B.L., Gruber, J., Tang, S.Y., Ng, L.F., Cheah, I., Halliwell, B., Ong, R.L.S., Fong, S. (2010). Ageing in nematodes: Do antioxidants extend lifespan in Caenorhabditis elegans?. Biogerontology 11 (1) : 17-30. [email protected] Repository. https://doi.org/10.1007/s10522-009-9223- ...
https://scholarbank.nus.edu.sg/handle/10635/28505
Caenorhabiditis elegans  Caenorhabiditis elegans
Bacaj, T., M. Tevlin, Y. Lu, and S. Shaham. 2008. Glia are essential for sensory organ function in C. elegans. Science. 322(5902):744-747.. Heiman, M. G., and S. Shaham. 2007. Ancestral roles of glia suggested by the nervous system of Caenorhabditis elegans. Neuron Glia Biology. 3(1):55-61. (Request copy of article from the Markus Library). Shaham, S. 2006. Glia-neuron interactions in the nervous system of Caenorhabditis elegans. Current Opinion in Neurobiology. 16(5): 522-528.. Shaham, S. 2005. Glia-neuron interactions in nervous system function and development. Current Topics in Developmental Biology. 69:39-66.. Wang, Y., A. Apicella Jr., S. -K Lee, M. Ezcurra, R. D. Slone, M. Goldmit, W. R. Schafer, S. Shaham, M. Driscoll, and L. Bianchi. 2008. A glial DEG/ENaC channel functions with neuronal channel DEG-1 to mediate specific sensory functions in C. elegans. EMBO Journal. 27(18):2388-2399.. Wang, Y., A. Apicella Jr., S. -K Lee, M. Ezcurra, R. D. Slone, M. Goldmit, W. R. Schafer, S. Shaham, M. ...
http://librarynews.rockefeller.edu/?tag=caenorhabiditis-elegans
Uncover Genetic Interactions in Caenorhabditis elegans by RNA Interference | Bioscience Reports  Uncover Genetic Interactions in Caenorhabditis elegans by RNA Interference | Bioscience Reports
RNA-mediated interference (RNAi) has emerged recently as one of the most powerful functional genomics tools. RNAi has been particularly effective in the nematode worm C. elegans where RNAi has been used to analyse the loss-of-function phenotypes of almost all predicted genes. In this review, we illustrate how RNAi has been used to analyse gene function in C. elegans as well as pointing to some future directions for using RNAi to examine genetic interactions in a systematic manner.. ...
http://www.bioscirep.org/content/25/5-6/299
Global regulation of Hox gene expression in C. elegans by a SAM domain protein<...  Global regulation of Hox gene expression in C. elegans by a SAM domain protein<...
TY - JOUR. T1 - Global regulation of Hox gene expression in C. elegans by a SAM domain protein. AU - Zhang, Hong. AU - Azevedo, Ricardo B R. AU - Lints, Robyn. AU - Doyle, Christina. AU - Teng, Yingqi. AU - Haber, Daniel. AU - Emmons, Scott W.. PY - 2003/6/1. Y1 - 2003/6/1. N2 - Polycomb group (PcG)-mediated repression of C. elegans Hox genes has not been demonstrated, and genes homologous to components of one of the PcG complexes (PRC1) have not been identified in the C. elegans genome. We find that a mechanism of general Hox gene repression exists in C. elegans, carried out in part by SOP-2, a protein related to, but not orthologous with, any PcG protein. sop-2 mutations lead to widespread ectopic expression of Hox genes and homeotic transformations. SOP-2 contains a SAM domain, a self-associating protein domain found in other repressors, including a core component of PRC1 and ETS transcription factors. Phylogenetic analysis indicates that this domain is more closely related to those of the ...
https://einstein.pure.elsevier.com/en/publications/global-regulation-of-hox-gene-expression-in-c-elegans-by-a-sam-do-2
Lysosomal biogenesis and function is critical for necrotic cell death in Caenorhabditis elegans | Journal of Cell Biology |...  Lysosomal biogenesis and function is critical for necrotic cell death in Caenorhabditis elegans | Journal of Cell Biology |...
To generate pmec-17LMP-1∷GFP, we fused GFP at the COOH terminus of the C. elegans LMP-1 protein. The translational fusion includes the entire LMP-1 coding sequence lacking the stop codon, a Gly-Ser-Ser-Pro-Gly-Leu-Ala-Lys-Gly-Pro-Lys-Gly linker, and GFP. The resulting chimera was expressed in touch receptor neurons under the control of the mec-17 promoter. The plasmid carrying the reporter fusion was constructed in two steps. First, the mec-17 promoter was amplified from N2 genomic DNA with the primers 5′ CGGGATCCGAATCGTCTCACAACTGATCC 3′ and 5′ AACTGCAGGTGACTACTTGAGACCTG 3′. A 1,900-bp PstI-BamHI fragment was cloned into the promoterless gfp vector pPD95.77 (Fire et al., 1990). Second, the LMP-1 coding region was amplified from genomic DNA using the primers 5′ CGGGATCCGACGCTGGCATATCCTTGTCTC 3′ and 5′ CGGGATCCAATTGAACTATGTTGAAATCG 3′. A BamHI PCR fragment was cloned downstream of the mec-17 promoter on the pPD95.77 plasmid vector. For RNAi experiments, we used HT115(DE3) ...
https://rupress.org/jcb/article/173/2/231/44286/Lysosomal-biogenesis-and-function-is-critical-for
Two Forms of Learning following Training to a Single Odorant in Caenorhabditis elegans AWC Neurons | Journal of Neuroscience  Two Forms of Learning following Training to a Single Odorant in Caenorhabditis elegans AWC Neurons | Journal of Neuroscience
It is significant that the majority of the processes involved in the integration of the CS and US in associative learning and in nonassociative memory formation ostensibly occurs within the AWC sensory neuron itself. Indeed, all the genes discussed in our model are known to be expressed in and required within or act on, in the case of ins-1, the AWC to mediate olfactory adaptation (Colbert et al., 1997; LEtoile et al., 2002; Palmitessa et al., 2005; Chalasani et al., 2010; Lin et al., 2010), lending support to the remarkable notion that the majority of processing occurs within the primary olfactory neuron. Indeed, this appears to be a common theme in a number of paradigms in C. elegans. For example, work by the Iino group has suggested that salt starvation associative learning requires insulin signaling within the salt-sensing ASE sensory neuron (Tomioka et al., 2006). Furthermore, food starvation associative learning leads to a modulation of the temperature at which the temperature-sensing AFD ...
http://www.jneurosci.org/content/32/26/9035.full
Global Cysteine-Reactivity Profiling during Impaired Insulin/IGF-1 Sig by , Yonghak Seo et al.  "Global Cysteine-Reactivity Profiling during Impaired Insulin/IGF-1 Sig" by , Yonghak Seo et al.
In the nematode Caenorhabditis elegans, inactivating mutations in the insulin/IGF-1 receptor, DAF-2, result in a 2-fold increase in lifespan mediated by DAF-16, a FOXO-family transcription factor. Downstream protein activities that directly regulate longevity during impaired insulin/IGF-1 signaling (IIS) are poorly characterized. Here, we use global cysteine-reactivity profiling to identify protein activity changes during impaired IIS. Upon confirming that cysteine reactivity is a good predictor of functionality in C. elegans, we profiled cysteine-reactivity changes between daf-2 and daf-16;daf-2 mutants, and identified 40 proteins that display a | 2-fold change. Subsequent RNAi-mediated knockdown studies revealed that lbp-3 and K02D7.1 knockdown caused significant increases in lifespan and dauer formation. The proteins encoded by these two genes, LBP-3 and K02D7.1, are implicated in intracellular fatty acid transport and purine metabolism, respectively. These studies demonstrate that cysteine
https://escholarship.umassmed.edu/metnet_pubs/31/
Welcome to the Si elegans project site  Welcome to the Si elegans project site
The nematode Caenorhabditis elegans may hold the key to brain-like computational architectures: Si elegans will provide the scientific community with a reconfigurable, scalable and modular neuromimetic open-access computational platform to explore neural principles that give rise to complex behaviour and to derive a neuro-inspired technological blueprint for a new era of brain-like computational architectures.The Si elegans project started on April 1st 2013. ...
http://www.si-elegans.eu
CIL:1044, Caenorhabditis elegans, muscle cell. CIL. Dataset  CIL:1044, Caenorhabditis elegans, muscle cell. CIL. Dataset
The purpose of the dataset C. elegans muscle aging is to deduce the age of the nemathode based on images of muscles. Images of C. elegans were taken ...
http://cellimagelibrary.org/images/1044
CIL:1007, Caenorhabditis elegans, muscle cell. CIL. Dataset  CIL:1007, Caenorhabditis elegans, muscle cell. CIL. Dataset
The purpose of the dataset C. elegans muscle aging is to deduce the age of the nemathode based on images of muscles. Images of C. elegans were taken ...
http://ccdb.ucsd.edu/images/1007
Caenorhabditis elegans num-1 negatively regulates endocytic recycling  Caenorhabditis elegans num-1 negatively regulates endocytic recycling
Much of the material taken into cells by endocytosis is rapidly returned to the plasma membrane by the endocytic recycling pathway. Although recycling is vital for the correct localization of cell membrane receptors and lipids, the molecular mechanisms that regulate recycling are only partially understood. Here we show that in C. elegans, endocytic recycling is inhibited by NUM-1A, the nematode Numb homologue. NUM-1A::GFP fusion protein is localized to the baso-lateral surfaces of many polarized epithelial cells including the hypodermis and the intestine. We show that increased NUM-1A levels cause morphological defects in these cells similar to those caused by loss-of-function mutations in rme-1, a positive regulator of recycling both in C. elegans and mammals. We describe the isolation of worms lacking num-1A activity and show that, consistent with a model in which NUM-1A negatively regulates recycling in the intestine, loss of num-1A function bypasses the requirement for RME-1. Genetic ...
http://umu.diva-portal.org/smash/record.jsf?pid=diva2:150991
Structure Cluster - 1PEV: Crystal Structure of the Actin Interacting Protein from Caenorhabditis Elegans 3D...  Structure Cluster - 1PEV: Crystal Structure of the Actin Interacting Protein from Caenorhabditis Elegans 3D...
1PEV: Identification of functional residues on Caenorhabditis elegans actin-interacting protein 1 (UNC-78) for disassembly of actin depolymerizing factor/cofilin-bound actin filaments.
http://www.rcsb.org/pdb/explore/structureCluster.do?structureId=1PEV
C elegans worms, light microscopy - Stock Video Clip K002/8244 - Science Photo Library  C elegans worms, light microscopy - Stock Video Clip K002/8244 - Science Photo Library
C. elegans worms. Light microscopy of Caenorhabditis elegans worms. This is a soil-dwelling hermaphrodite nematode worm and one of the most studied animals in biological and genetic research. A tendency to reproduce by self-fertilisation (resulting in identical offspring), along with the short time taken to reach maturity, make this tiny worm an ideal subject. - Stock Video Clip K002/8244
http://www.sciencephoto.com/media/407266/view
Annabel Ferguson  Annabel Ferguson
The FOXO transcription factor DAF-16 is required for the metabolic, developmental, and longevity phenotypes produced by reductions in daf-2 insulin/IGF-1-like receptor or germline stem cell signaling (Hsin and Kenyon, 1999; Kenyon et al., 1993; Riddle et al., 1981). The homology between DAF-16 and human FOXO transcription factors make C. elegans an important model for the study of their regulation by signaling pathways or interacting proteins (Lin et al., 1997; Ogg et al., 1997). The daf-16(mgDf50) allele is a commonly used daf-16 null allele due to the presence of a large deletion within the gene (Ogg et al., 1997). While the deleted region is thought to span the entire daf-16 coding region, the precise endpoints are still unknown. Thus, the only way to confirm the presence of the mgDf50 allele following genetic crosses is to identify the homozygous mutant through either the presence of daf-16 phenotypes (such as the loss of constitutive dauer arrest in daf-2 mutants) or the lack of PCR ...
http://wbg.wormbook.org/author/a-b/
Summary information of cluster CELK04322  Summary information of cluster CELK04322
gi,17508791,ref,NP_492239.1, C-x8-C-x5-C-x3-H type zinc finger containing protein (76.1 kD) (1I793) [Caenorhabditis elegans] gi,7506947,pir,,T24365 hypothetical protein T02E1.3b - Caenorhabditis elegans gi,3879305,emb,CAB04666.1, Hypothetical protein T02E1.3b [Caenorhabditis elegans ...
http://nematode.lab.nig.ac.jp/db2/ShowGeneInfo.php?celk=CELK04322
SH3 Interactome Conserves General Function Over Specific Form by Xiaofeng Xin, David Gfeller et al.  "SH3 Interactome Conserves General Function Over Specific Form" by Xiaofeng Xin, David Gfeller et al.
Src homology 3 (SH3) domains bind peptides to mediate protein-protein interactions that assemble and regulate dynamic biological processes. We surveyed the repertoire of SH3 binding specificity using peptide phage display in a metazoan, the worm Caenorhabditis elegans, and discovered that it structurally mirrors that of the budding yeast Saccharomyces cerevisiae.We then mapped the worm SH3 interactome using stringent yeast two-hybrid and compared it with the equivalent map for yeast.We found that the wormSH3 interactome resembles the analogous yeast network because it is significantly enriched for proteins with roles in endocytosis. Nevertheless, orthologous SH3 domain mediated interactions are highly rewired. Our results suggest a model of network evolution where general function of the SH3 domain network is conserved over its specific form.
https://scholarworks.umt.edu/biosci_pubs/333/
The Nerve Ring of the Nematode Caenorhabditis elegans: Sensory Input and Motor Output  The Nerve Ring of the Nematode Caenorhabditis elegans: Sensory Input and Motor Output
Fig. 27 - Longitudinal section taken near the midline showing a sagittal view of the ventral muscle plate (region enclosed by arrows, MP). The most obvious deviation from a purely commisural nature of the ring occurs in its participation in the integration of sensory input and cephalic muscle motor output. Primary input is effected by synapses formed by the posterior processes of the bipolar papillary neurons whose cell hody locations have been described. The entry of these fibers into the ring is shown in the three parts of figure 28. In figure 28A the subdorsal papillary fibers are grouped as a bundle outside of the circumferential fibers of the nerve ring, but nonetheless within the thin glial sheath formed by the four LSM pocket cell bodies. In figure 28B at the posterior edge of the ring they are seen to turn from a longitudinal to a radial dIrection and plunge into the center of the circumferential fibers. At the level of figure 28C, taken anterior to figure 28A, all fibers except for ...
http://wormatlas.org/ver1/Ware_build0.2/observations4.html
The embryonic cell lineage of the nematode Caenorhabditis elegans. - PubMed - NCBI  The embryonic cell lineage of the nematode Caenorhabditis elegans. - PubMed - NCBI
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
https://www.ncbi.nlm.nih.gov/pubmed/6684600?dopt=Abstract
Browsing by Subject Caenorhabditis elegans  Browsing by Subject "Caenorhabditis elegans"
The C. elegans grinder is an intricately designed, macromolecular structure located in the terminal bulb of the pharynx. It acts as the teeth of C. elegans, crushing bacteria before they are passed to the intestine. The ...
http://repositories.tdl.org/utswmed-ir/browse?value=Caenorhabditis+elegans&type=subject
Magnetosensitive neurons mediate geomagnetic orientation in Caenorhabditis elegans | eLife  Magnetosensitive neurons mediate geomagnetic orientation in Caenorhabditis elegans | eLife
With the aid of a pair of sensory neurons, the nematode worm C. elegans is able to detect the Earths magnetic field and use it to navigate towards food sources.
https://elifesciences.org/articles/07493
Figures and data in Magnetosensitive neurons mediate geomagnetic orientation in Caenorhabditis elegans | eLife  Figures and data in Magnetosensitive neurons mediate geomagnetic orientation in Caenorhabditis elegans | eLife
With the aid of a pair of sensory neurons, the nematode worm C. elegans is able to detect the Earths magnetic field and use it to navigate towards food sources.
https://elifesciences.org/articles/07493/figures
let-413 - Protein lap1 - Caenorhabditis elegans - let-413 gene & protein  let-413 - Protein lap1 - Caenorhabditis elegans - let-413 gene & protein
Critical role in assembling adherens junctions; adapter protein involved in polarizing protein trafficking in epithelial cells. Necessary to maintain, not establish, the entire terminal web (organelle-depleted, intermediate filament-rich layer of cytoplasm that underlies the apical microvilli of polarized epithelial cells) or brush border assembly at the apical surface gut cells. Required for correct localization of ifb-2 intermediate filaments in the terminal web.
http://www.uniprot.org/uniprot/O61967
Course@CRG: C. Elegans | Barcelona Institute of Science and Technology - BIST  [email protected]: C. Elegans | Barcelona Institute of Science and Technology - BIST
Description. C. elegans, one of the most attractive and popular genetic model organisms, is used to address questions and advance our understanding of several complex biological processes. The course will provide a general practical introduction to using C. elegans in research. It will cover the pros and cons of using C. elegans compared to other model organisms. The course participants will have hands on experience with popular techniques such as RNAi, genetic crosses, transgenic and GFP reporter strains. Thus, during the course the participants will not only be familiarized with using C. elegans as model organism but also be able to interact and network with experts in the field. The practical part of this course is complemented by lectures given by several internationally renowned C. elegans researchers.. The experiments will include the studies of the life cycle and early development of wild type worms and the phenotypic analysis of mutants.. It will cover:. Maintenance, decontamination and ...
http://bist.eu/events/event/coursecrg-c-elegans/
Characterization of the let-653 gene in Caenorhabditis elegans | SpringerLink  Characterization of the let-653 gene in Caenorhabditis elegans | SpringerLink
A mutation in the let-653 gene of Caenorhabditis elegansresults in larval death. The lethal arrest is concurrent with the appearance of a vacuole anterior to the lower pharyngeal bulb. The position...
https://link.springer.com/article/10.1007%2FBF02191712
sgk-1 - Serine/threonine-protein kinase sgk-1 - Caenorhabditis elegans - sgk-1 gene & protein  sgk-1 - Serine/threonine-protein kinase sgk-1 - Caenorhabditis elegans - sgk-1 gene & protein
Acts downstream of PI3 kinase age-1 and kinase pdk-1 in the daf-2/insulin receptor-like transduction pathway (PubMed:15068796). Essential role in regulating development, stress response, and longevity (PubMed:15068796, PubMed:18782349). Phosphorylates Forkhead-related daf-16 and the longevity-promoting skn-1 transcription factors, which inhibits their entry into the nucleus and antagonizes their function (PubMed:18358814). Acts downstream of rict-1 to regulate fat storage, size, and development (PubMed:19240135, PubMed:19260765). Downstream of age-1 and together with akt-1/2, promotes cell survival during embryonic development (PubMed:25383666). Does not appear to play a role in immune function (PubMed:18782349).
http://www.uniprot.org/uniprot/Q2PJ68
Cell death and differentiation - deadly dowry how engulfment pathways promote cell killing | Gas and electricity  Cell death and differentiation - deadly dowry how engulfment pathways promote cell killing | Gas and electricity
During the development of the nematode Caenorhabditis elegans cell death occurs in a highly reproducible manner, and this is one of the reasons why the worm
http://gaselectricity.in/cell-death-and-differentiation-deadly-dowry_-how-engulfment-pathways-promote-cell-killing
Addgene: Microtubules induce self-organization of polarized PAR domains in Caenorhabditis elegans zygotes.  Addgene: Microtubules induce self-organization of polarized PAR domains in Caenorhabditis elegans zygotes.
Please note: Your browser does not support the features used on Addgenes website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more ...
https://www.addgene.org/browse/article/5813/
Stochastic and genetic factors influence tissue-specific decline in ageing C. Elegans<...  Stochastic and genetic factors influence tissue-specific decline in ageing C. Elegans<...
TY - JOUR. T1 - Stochastic and genetic factors influence tissue-specific decline in ageing C. Elegans. AU - Herndon, Laura A.. AU - Schmeissner, Peter J.. AU - Dudaronek, Justyna M.. AU - Brown, Paula A.. AU - Listner, Kristin M.. AU - Sakano, Yuko. AU - Paupard, Marie C.. AU - Hall, David H.. AU - Driscoll, Monica. PY - 2002/10/24. Y1 - 2002/10/24. N2 - The nematode Caenorhabditis elegans is an important model for studying the genetics of ageing, with over 50 life-extension mutations known so far. However, little is known about the pathobiology of ageing in this species, limiting attempts to connect genotype with senescent phenotype. Using ultrastructural analysis and visualization of specific cell types with green fluorescent protein, we examined cell integrity in different tissues as the animal ages. We report remarkable preservation of the nervous system, even in advanced old age, in contrast to a gradual, progressive deterioration of muscle, resembling human sarcopenia. The age-1(hx546) ...
https://einstein.pure.elsevier.com/en/publications/stochastic-and-genetic-factors-influence-tissue-specific-decline--2
Frontiers | Behavioral Phenotyping and Pathological Indicators of Parkinsons Disease in C. elegans Models | Genetics  Frontiers | Behavioral Phenotyping and Pathological Indicators of Parkinson's Disease in C. elegans Models | Genetics
Parkinsons disease (PD) is a neurodegenerative disorder with symptoms that progressively worsen with age. Pathologically, PD is characterized by the aggregation of α-synuclein in cells of the substantia nigra in the brain and loss of dopaminergic neurons. This pathology is associated with impaired movement and reduced cognitive function. The etiology of PD can be attributed to a combination of environmental and genetic factors. A popular animal model, the nematode roundworm Caenorhabditis elegans, has been frequently used to study the role of genetic and environmental factors in the molecular pathology and behavioral phenotypes associated with PD. The current review summarizes cellular markers and behavioral phenotypes in transgenic and toxin-induced PD models of C. elegans.
https://www.frontiersin.org/articles/10.3389/fgene.2017.00077/full
A Complex Regulatory Network Coordinating Cell Cycles During C. elegans Development Is Revealed by a Genome-Wide RNAi Screen |...  A Complex Regulatory Network Coordinating Cell Cycles During C. elegans Development Is Revealed by a Genome-Wide RNAi Screen |...
The analyses presented here indicate that ubc-25 acts as a negative regulator of steady-state CYE-1 expression, but it is not known whether this regulation is achieved through direct ubiquitinylation of CYE-1 by UBC-25. It is likely that UBC-25 ubiquitinylates a range of targets to regulate a variety of processes. In fact, ubc-25 was previously recognized for roles not directly related to the cell cycle, such as promoting a Ras-mediated cell-fate decision (Rocheleau et al. 2008) and maintaining neuromuscular homeostasis (Schulze et al. 2003). It would be interesting to determine whether the putative interaction partner, C30H7.2, acts with UBC-25 in these alternative processes. Our genetic analyses provide insights into the regulatory mechanisms that may explain the relatively mild loss of function phenotypes observed when individual components are inactivated. First, other genes within a family may provide redundant activity. For example, 22 ubc genes are encoded in the C. elegans genome and we ...
http://www.g3journal.org/content/4/5/795.full
The unc-51 gene and its possible relation to dietary restriction in Caenorhabditis elegans  The unc-51 gene and its possible relation to dietary restriction in Caenorhabditis elegans
unc-51(e369) mutation reduces mean but extends maximum lifespan. unc-51(e369) mutation reduces lifespan of eat-2 mutants to that of wild-type [2387]. ...
http://genomics.senescence.info/diet/details.php?id=151
Systematic and quantitative analysis of the early embryonic development of Caenorhabditis elegans  Systematic and quantitative analysis of the early embryonic development of Caenorhabditis elegans
El nemátodo Caernorhabditis elegans ofrece la posibilidad de estudiar el desarrollo embrionario con una resolución celular. En esta tesis, describo el uso de un algoritmo semi-automático de seguimiento nuclear para analizar movimientos celulares en el embrión temprano, así como la manera en que el embrión responde a deformaciones mecánicas y a perturbaciones genéticas. Durante el proceso de gastrulación, observamos que ciertas células no solo ingresan al interior del embrión, pero también egresan hasta la superficie. Asimismo, identificamos linajes celulares que llevan a cabo ambos tipos de movimientos direccionales, esto es, primero internalizan y luego la continuan su movimiento hasta finalmente re-emerger en la superficie, "transgressing" o "tunneling" a través del embrión. Hemos descubierto que los movimientos estereotípicos de rotación en el embrión temprano, descritos previamente, son altamente variables en ausencia de compresión y esta variabilidad total en la rotación ...
http://www.tdx.cat/handle/10803/128514
immunostaining but GFP is bleached - Immunology and Histology  immunostaining but GFP is bleached - Immunology and Histology
I am staining some protein molecules in C. elegans body wall muscle. I aslo want to check the GFP after immunostaining.( It is a GFP fusion protein rescue line. ) Unfortunately the GFP is bleached. I have tried to incubate the 1st Antibody 1 hour, 2hours or overnight. It doesnt help a lot if I shorten the incubation time, actually it makes the staining worse. I fix the embryo in 4%PFA. I am thinking to do GFP and my protein of insterest double staining if I cant solve the GFP bleaching problem. It is important for me to check my GFP fusion protein and other protein molecules co-localization ...
http://www.protocol-online.org/biology-forums/posts/21199.html
Using Caenorhabditis elegans as a Model System to Study Protein Homeostasis in a Multicellular Organism | Protocol  Using Caenorhabditis elegans as a Model System to Study Protein Homeostasis in a Multicellular Organism | Protocol
To study the relationship between protein homeostasis, stress and aging, we monitored changes in protein folding by following protein...
https://www.jove.com/video/50840/using-caenorhabditis-elegans-as-model-system-to-study-protein
DEVELOPMENT OF GENE TARGETING IN C. ELEGANS AND D. RERIO USING ZINC FINGER | Innovative Molecular Analysis Technologies (IMAT)  DEVELOPMENT OF GENE TARGETING IN C. ELEGANS AND D. RERIO USING ZINC FINGER | Innovative Molecular Analysis Technologies (IMAT)
The goal of this research is to develop methods for the precise modification of specific target genes in two important genetic model organisms, the nematode Caenorhabditis elegans and the zebrafish Danio rerio. Both nematodes and fish are powerful experimental systems that combine elegant developmental biology with large scale genetics. Both systems have contributed to our understanding of fundamental problems in cancer biology, including programmed cell death, the control of organogenesis, the interaction of cancer susceptibility genes with the environment, and the genetics of melanoma. An important limitation of these model systems is that techniques for site-specific manipulation of the genome are not currently available in either nematodes or fish. Thus, in contrast to murine embryonic stem cells and the yeast S. cerevisiae, it is not possible to knock out specific genes or to precisely control the time and place of gene expression. In the last two years, a powerful new approach to ...
https://imat.cancer.gov/about-imat/grants-awarded/2006/development-gene-targeting-c-elegans-and-d-rerio-using-zinc-finger
Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans. - PubMed - NCBI  Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans. - PubMed - NCBI
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
https://www.ncbi.nlm.nih.gov/pubmed/11242085?dopt=Abstract
SUDigital: Record#4063: Genome-Wide Identification of Binding Sites Defines Distinct Functions for Caenorhabditis elegans PHA-4...  SUDigital: Record#4063: Genome-Wide Identification of Binding Sites Defines Distinct Functions for Caenorhabditis elegans PHA-4...
Molecular and Cellular Biology Zhong, Mei; Niu, Wei; Lu, Zhi John; Sarov, Mihail; Janette, Judith; Raha, Debasish; Sheaffer, Karyn L.; Lam, Hugo Y. K.; Preston, Elicia; Slightham, Cindie; Hillier, LaDeana W.; Agarwal, Ashish; Auerbach, Raymond; Hyman, Anthony A.; Gerstein, Mark; Kim, Stuart K.; Waterston, Robert H.; Reinke, Valerie; Snyder, Michael; Murray, John I.; Mango, Susan; Brock, Trisha Jane
http://lib.sudigital.org/record/4063?ln=en
nck-1 gene cDNA ORF clone, Caenorhabditis elegans - GenScript  nck-1 gene cDNA ORF clone, Caenorhabditis elegans - GenScript
Next-day shipping cDNA ORF clones derived from nck-1 NCK (Non-Catalytic region of tyrosine Kinase) adaptor protein family available at GenScript, starting from $99.00.
https://www.genscript.com/gene/caenorhabditis-elegans/180690/recombinant-antibody-services.html?src=pullmenu
Comparison of complete nuclear receptor sets from the human, Caenorhabditis elegans and Drosophila genomes | Genome Biology |...  Comparison of complete nuclear receptor sets from the human, Caenorhabditis elegans and Drosophila genomes | Genome Biology |...
Protein homology searches were performed using individual members of the NR family compared against the human genome database (HTG section from GenBank) using TBLASTN [8]. Results of all sequence hits were stored in an in-house Oracle database. Homologous sequences (those with a BLAST expectation value of 0.1 or lower) were then compared with the entire query NR data set using BLASTN [8]. By choosing the criteria on the basis of automated assessment for 95% sequence identity over 200 base pairs (bp) at the nucleotide level, we could map these hits to individual members of the protein family (bins). Those sequence hits that could not automatically be placed in bins on the basis of the selected criteria were either mapped to other protein families (if their sequences matched a known gene in GenBank), considered as potentially novel NR sequences (when key domains were present) or deemed irrelevant (no match to anything). We then applied Hidden Markov Models (HMMs) built on the DBD and LBD domains ...
https://0-genomebiology-biomedcentral-com.brum.beds.ac.uk/articles/10.1186/gb-2001-2-8-research0029
Next‐Generation Sequencing for Identification of EMS‐Induced Mutations in Caenorhabditis elegans - Current Protocols  Next‐Generation Sequencing for Identification of EMS‐Induced Mutations in Caenorhabditis elegans - Current Protocols
Forward genetic analysis using chemical mutagenesis in model organisms is a powerful tool for investigation of molecular mechanisms in biological systems
http://www.currentprotocols.com/WileyCDA/CPUnit/refId-mb0729.html
Caenorhabditis elegans - Everything2.com  Caenorhabditis elegans - Everything2.com
Soil nematode about 1mm long that lives in temperate regions. Doesnt really have a common name... except maybe tiny worm or something generic like th...
https://everything2.com/title/Caenorhabditis+elegans
Addgene: Single-copy insertion of transgenes in Caenorhabditis elegans  Addgene: Single-copy insertion of transgenes in Caenorhabditis elegans
Please note: Your browser does not support the features used on Addgenes website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more ...
https://www.addgene.org/browse/article/2271/
SWISS-MODEL | Caenorhabditis elegans  SWISS-MODEL | Caenorhabditis elegans
The SWISS-MODEL Repository is a database of annotated 3D protein structure models generated by the SWISS-MODEL homology-modelling pipeline
https://swissmodel.expasy.org/repository/species/6239
Automated behavioural fingerprinting of C. elegans mutants - M...  Automated behavioural fingerprinting of C. elegans mutants - M...
Automated behavioural fingerprinting of C. elegans mutants: Rapid advances in genetics, genomics, and imaging have given insight into the molecular and cellular
https://www.mysciencework.com/publication/show/automated-behavioural-fingerprinting-c-elegans-mutants-7396c597
Sreekanth Chalasani - Salk Institute for Biological Studies  Sreekanth Chalasani - Salk Institute for Biological Studies
Sreekanth Chalasani uses an organism with a much simpler nervous system than humans to answer questions about neuroscience: the roundworm Caenorhabditis elegans. This animal has only 302 neurons and a few thousand connections between these cells. Each neuron is mapped and named, making it easier to study the effect of environment or gene changes at the resolution of individual cells. But despite its simplicity, the C. elegans nervous system has commonalities with a human brain: if you give a worm a dose of the antidepressant Prozac, for example, it becomes less fearful of predators; and if you mutate a gene linked to autism in humans, the worm shows less interest in other worms.. Among other studies, Chalasanis lab is asking how the roundworm nervous system, one of the simplest in nature, gives rise to such behaviors as fear and aggression. He is exploring what these tiny creatures can tell us about human aggressions and fears, emotions and behaviors often necessary for our survival, but which ...
http://www.salk.edu/scientist/sreekanth-chalasani/
C. elegans - Paperback - Ian A. Hope - Oxford University Press  C. elegans - Paperback - Ian A. Hope - Oxford University Press
Caenorhabditis Elegans has been a popular model organism for biological research for over thirty years and has been used to investigate many aspects of animal development, for example apoptosis, the Hox genes, signal transduction pathways, and the development of the nervous system. It has recently taken on new importance with the publication of the entire genome sequence in 1998. The first chapter gives all the basic information on C.
https://global.oup.com/academic/product/c-elegans-9780199637386?facet_narrowbyproducttype_facet=Digital&facet_narrowbytype_facet=Academic%2520Research&lang=en&cc=us
Volume IV - March 2015  Volume IV - March 2015
Department of Biology. Cover Photo: Green fluorescent protein (GFP) has revolutionized molecular biology by allowing scientists to label individual proteins in a cell or, as in this photo, entire organisms. Here, the nematode Caenorhabditis elegans, a common model organism in the study of developmental biology and genetics, is labeled with GFP to provide a clear view of its body plan. The photograph was taken in the Fall 2014 semester in Gilmer Hall at Hampden-Sydney. Note the unborn C. elegans that can be seen developing inside the adult nematodes. (From Grayland W. Godfrey 15). ...
http://blogs.hsc.edu/sciencejournal/2015/03/02/volume-iv-march-2015/
Papers | Hobert lab  Papers | Hobert lab
2016. Research Papers. Gendrel M, Atlas EG, Hobert O. (2016) "A cellular and regulatory map of the GABAergic nervous system of C. elegans." eLife. 2016 Oct.. Oren-Suissa M, Bayer EA, Hobert O. (2016) "Sexually dimorphic synaptic connectivity established by sex-specific synapse pruning in C. elegans." Nature. 2016 May.. Reviews & Commentaries. Hobert O, Glenwinkel L, White J. (2016) "Revisiting Neuronal Cell Type Classification in Caenorhabditis elegans." Curr. Biol. 2016 Nov.. Hobert O. (2016) "A map of terminal regulators of neuronal identity in C.elegans." WIREs Dev. Biol. 2016 May.. Hobert O. (2016) "Terminal selectors of neuronal identity." Curr. Top. Dev. Biol. 2016 Jan.. Howell K and Hobert O. (2016) "Small Immunoglobulin domain proteins at synapses and the maintenance of neuronal features." Neuron. 2016 Jan.. 2015. Research Papers. Pereira L, Kratsios P, Serrano-Saiz E, Sheftel H, Mayo A, Hall DH, White JG, LeBoeuf B, Garcia LR, Alon U, Hobert O. (2015) "A cellular and regulatory map of ...
http://hobertlab.org/publications/
千葉大学 大学院工学研究科・工学部  千葉大学 大学院工学研究科・工学部
ODR-8， the C. elegans ortholog of Ufm1 specific protease 2， promotes ER maturation of G-protein coupled receptors by a non-catalytic， Ufm1-independent mechanism ...
http://www.eng.chiba-u.ac.jp/outProfile.tsv%3Fno=1634.html
Alternative splicing in C. elegans  Alternative splicing in C. elegans
Genetic analysis in C. elegans has led to the identification of splicing regulatory pathways. MEC-8 is a two RNA recognition motif (RRM)-containing, nuclear protein. Mutations in mec-8 lead to mechanosensory and other defects. Mutations in mec-8 are synthetically lethal with viable mutations in the unc-52 gene (Lundquist et al., 1996). UNC-52 is a homolog of the mammaliam perlecan protein, an extracellular matrix molecule important in muscle anchorage (Rogalski et al., 1993). These viable unc-52 mutations occur in the alternatively spliced exons 17 and 18 (Figure 4b). Every possible combination of inclusion or skipping of exons 16, 17 and 18 has been detected (Rogalski et al., 1995). Skipping of exons 17 and 18 is dependent on the function of mec-8 (Lundquist et al., 1996). MEC-8 protein is found in all nuclei in embryos, but only in a subset of mechanosensory neurons and hypodermal cells in adults (Spike et al., 2002). unc-52 mutant alleles with stop codons in exons 17 and 18 develop a ...
http://dev.wormbook.org/chapters/www_altsplicing/altsplicing.html
SMART: Secondary literature for DSL domain  SMART: Secondary literature for DSL domain
Caenorhabditis elegans germ-line proliferation is controlled by an inductive interaction between the somatic distal tip cell and the germ line. GLP-1, a member of the Notch family of transmembrane receptors, is required continuously in the germ line to transduce the proliferative signal. In the absence of GLP-1, all proliferative germ cells exit the mitotic cell cycle and enter meiotic prophase. We have characterized an activating mutation in glp-1, oz112gf, that has the opposite phenotype. Homozygous glp-1(oz112gf) hermaphrodites and males have a completely tumorous germ line in which germ cells never leave the mitotic cycle. In glp-1(oz112gf) heterozygotes, germ-line polarity is established correctly, but as adults age, the distal proliferative population expands leading to a late-onset tumorous phenotype. The mutant receptor is constitutively active, promoting proliferation in the absence of ligand. The normal distal-proximal spatial restriction of GLP-1 expression is lost in tumorous and ...
http://smart.embl.de/smart/show_secondary.cgi?domain=DSL
RPI ISL Medical Image Databases  RPI ISL Medical Image Databases
Purpose: this database is used to evaluate the image segmentation algorithms for Caenorhabditis elegans (C-elegans) UNC-59 and UNC-61, the nematode worms used in biology for investigation of neural system functions ...
https://www.ecse.rpi.edu/homepages/cvrl/database/Medical_Image_Databases.htm
miRNAs - Humpath.com - Human pathology  miRNAs - Humpath.com - Human pathology
The let-7 miRNA was originally discovered in the nematode Caenorhabditis elegans, where it regulates cell proliferation and differentiation, but subsequent work has shown that both its sequence and its function are highly conserved in mammals ...
http://humpath.com/spip.php?mot277
Nektarios Tavernarakis  Nektarios Tavernarakis
The main focus of our research is the study of neuronal function and dysfunction, using the nematode Caenorhabditis elegans as a model organism. Among...
http://www.imbb.forth.gr/en/research-en/neurosciences/item/68-nektarios-tavernarakis
Items where Year is 2011 - ePrints Repository  Items where Year is 2011 - ePrints Repository
Griffith, G.M and Hastings, R and Nash, S and Petalas, M and Howling, P and Moss, J and Oliver, C and Petty, J and Tunnicliffe, P (2011) "You have to sit and explain it all, and explain yourself." Mothers experiences of caring for an adult with a rare genetic intellectual disability syndrome. Journal of Genetic Counseling, 20. pp. 167-177.. Fukuda, Daisuke and Haines, Anthony S. and Song, Zhongshu and Murphy, Annabel C. and Hothersall, Joanne and Stephens, Elton R. and Gurney, Rachel and Cox, Russell J. and Crosby, John and Willis, Christine L. and Simpson, Thomas J. and Thomas, Christopher M. (2011) A Natural Plasmid Uniquely Encodes Two Biosynthetic Pathways Creating a Potent Anti-MRSA Antibiotic. PLoS ONE, 6 (3). e18031. ISSN 1932-6203. Marsh, Elizabeth K. and van den Berg, Maaike C. W. and May, Robin C. (2011) A Two-Gene Balance Regulates Salmonella Typhimurium Tolerance in the Nematode Caenorhabditis elegans. PLoS ONE, 6 (3). e16839. ISSN 1932-6203. Khan, M and Gorard, Stephen (2011) A ...
http://eprints.bham.ac.uk/view/year/2011.default.html
Hardin, Jeff - Genetics - UW-Madison  Hardin, Jeff - Genetics - UW-Madison
Search PubMed for more publications by Jeff Hardin. Choi, H.-J.*, Loveless, T.*, Lynch, A.M., Bang, I., Hardin, J+, and Weis, W.I.+. A conserved phosphorylation switch controls the interaction between cadherin and β-catenin In vitro and In vivo. Developmental Cell 33, 82-93. [*Co-first authors; +Co-senior authors]. Walck-Shannon, E. and Hardin, J. (2014). Cell intercalation from top to bottom. Nature Rev. Mol. Cell. Bio 15:34-48.. Maiden, S.L., Harrison, N., Keegan, J., Cain, B., Lynch, A.M., Pettitt, J., and Hardin, J. (2013). Specific conserved C-terminal amino acids of Caenorhabditis elegans HMP-1/α-catenin modulate F-actin binding independently of vinculin. J. Biol. Chem. 288:5694-5706.. Lynch, A.M., Grana, T., Cox-Paulson, E., Couthier, A., Cameron, M., Chin-Sang, I., Pettitt, J., and Hardin, J. (2012). A genome-wide functional screen identifies MAGI-1 as an L1CAM-dependent stabilizer of apical junctions in C. elegans. Curr. Biol. 22, 1891-1899.. Cox-Paulson, E., Walck-Shannon, E., Lynch, ...
https://genetics.wisc.edu/staff/hardin-jeff/
Found in Translation  Found in Translation
MiRNAs were first described more than a decade ago by scientists working with Caenorhabditis elegans, a species of nematode worm favored by researchers because of the simplicity of its genome. During their normal life cycle, these worms go through four stages of development. But a particular group of worms were observed getting stuck in the first stage. The larvae kept growing larger but not maturing into adults. A team of researchers at Harvard University isolated the gene that caused this malfunction but found that instead of coding for a protein as most genes do, it coded for a particular molecule of RNA ...
http://whsc.emory.edu/_pubs/momentum/2006winter/found_in_translation.html
chemicals | ECU Honors College Research Connections  chemicals | ECU Honors College Research Connections
Faculty Information Faculty Name: Xiaoping Pan Department: Biology Contact Information: [email protected], Room 514 Science & Technology Building Research Description Highlights of Research: Our research of Biochemical Toxicology investigates the mode of action of various substances and materials including crude oil/dispersant system, abused drugs, and metallic nanoparticles, and environmental obesogens etc. Experimental organisms include Caenorhabditis elegans (C. elegans) and Rattus. » Read more ...
http://blog.ecu.edu/sites/honorscollegeresearchconnections/tag/chemicals/
小鼠 anti-Arabidopsis thaliana POLR2F 抗体 (ABIN3071653)  小鼠 anti-Arabidopsis thaliana POLR2F 抗体 (ABIN3071653)
适用: Arabidopsis thaliana, Caenorhabditis elegans (C. elegans) 宿主: 小鼠 1张图片 | Order POLR2F antibody (ABIN3071653).
http://www.antibodies-online.cn/antibody/3071653/anti-Polymerase+RNA+II+DNA+Directed+Polypeptide+F+POLR2F+C-Term,+Non-phosphorylated,+phosphorylated+antibody/
The Caenorhabditis elegans homolog of the Opitz syndrome gene, madd-2/Mid1, regulates anchor cell invasion during vulval...  The Caenorhabditis elegans homolog of the Opitz syndrome gene, madd-2/Mid1, regulates anchor cell invasion during vulval...
Mutations in the human Mid1 gene cause Opitz G/BBB syndrome, which is characterized by various midline closure defects. The Caenorhabditis elegans homolog of Mid1, madd-2, positively regulates signaling by the unc-40 Netrin receptor during the extension of muscle arms to the midline and in axon guidance and branching. During uterine development, a specialized cell called anchor cell (AC) breaches the basal laminae separating the uterus from the epidermis and invades the underlying vulval tissue. AC invasion is guided by an UNC-6 Netrin signal from the ventral nerve cord and an unknown guidance signal from the vulval cells. Using genetic epistasis analysis, we show that madd-2 regulates AC invasion downstream of or in parallel with the Netrin signaling pathway. Measurements of AC shape, polarity and dynamics indicate that MADD-2 prevents the formation of ectopic AC protrusions in the absence of guidance signals. We propose that MADD-2 represses the intrinsic invasive capacity of the AC, while the ...
http://www.zora.uzh.ch/id/eprint/69277/
WormBase - Wikipedia  WormBase - Wikipedia
WormBase is an online biological database about the biology and genome of the nematode model organism Caenorhabditis elegans and contains information about other related nematodes. WormBase is used by the C. elegans research community both as an information resource and as a place to publish and distribute their results. The database is regularly updated with new versions being released every two months. WormBase is one of the organizations participating in the Generic Model Organism Database (GMOD) project. WormBase comprises the following main data sets: The annotated genomes of Caenorhabditis elegans, Caenorhabditis briggsae, Caenorhabditis remanei, Caenorhabditis brenneri, Caenorhabditis angaria, Pristionchus pacificus, Haemonchus contortus, Meloidogyne hapla, Meloidogyne incognita, Brugia malayi and Onchocerca volvulus; Hand-curated annotations describing the function of ~20,500 C. elegans protein-coding genes and ~16,000 C. elegans non-coding genes; Gene families; Orthologies; Genomic ...
https://en.wikipedia.org/wiki/WormBase
Large-scale RNAi screens identify novel genes that interact with the C. elegans retinoblastoma pathway as well as splicing...  Large-scale RNAi screens identify novel genes that interact with the C. elegans retinoblastoma pathway as well as splicing...
The retinoblastoma tumor suppressor (Rb) acts in a conserved pathway that is deregulated in most human cancers. Inactivation of the single Rb-related gene in Caenorhabditis elegans, lin-35, has only limited effects on viability and fertility, yet causes changes in cell-fate and cell-cycle regulation when combined with inactivation of specific other genes. For instance, lin-35 Rb is a synthetic multivulva (synMuv) class B gene, which causes a multivulva phenotype when inactivated simultaneously with a class A or C synMuv gene. We used the ORFeome RNAi library to identify genes that interact with C. elegans lin-35 Rb and identified 57 genes that showed synthetic or enhanced RNAi phenotypes in lin-35 mutants as compared to rrf-3 and eri-1 RNAi hypersensitive mutants. Based on characterizations of a deletion allele, the synthetic lin-35 interactor zfp-2 was found to suppress RNAi and to cooperate with lin-35 Rb in somatic gonad development. Interestingly, ten splicing-related genes were found to function
https://bmcdevbiol.biomedcentral.com/articles/10.1186/1471-213X-7-30
Human Body Muscles - localprivate.info  Human Body Muscles - localprivate.info
17 best ideas about human body muscles on pinterest , white stuff at muscles. Human Body Muscles delightful for you to the blog, within this time period Im going to demonstrate concerning Human body muscles.. And today, this is the 1st image, human body muscles, human body muscles and bones, human body muscles quiz, human body muscles worksheet, human body muscles diagram labeled, human body muscles labeled, human body muscles chart, human body muscles female, human body muscles names, human body muscles anatomy :. ...
http://localprivate.info/human-body-muscles/
The alkaloid compound harmane increases the lifespan of |em|Caenorhabditis elegans|/em| during bacterial infection, by...  The alkaloid compound harmane increases the lifespan of |em|Caenorhabditis elegans|/em| during bacterial infection, by...
The nematode Caenorhabditis elegans has in recent years been proven to be a powerful in vivo model for testing antimicrobial compounds. We report here that the alkaloid compound Harmane (2-methyl-β-carboline) increases the lifespan of nematodes infected with a human pathogen, the Shiga toxin-producing Escherichia coli O157:H7 strain EDL933 and several other bacterial pathogens. This was shown to be unrelated to the weak antibiotic effect of Harmane. Using GFP-expressing E. coli EDL933, we showed that Harmane does not lower the colonization burden in the nematodes. We also found that the expression of the putative immune effector gene F35E12.5 was up-regulated in response to Harmane treatment. This indicates that Harmane stimulates the innate immune response of the nematode; thereby increasing its lifespan during bacterial infection. Expression of F35E12.5 is predominantly regulated through the p38 MAPK pathway; however, intriguingly the lifespan extension resulting from Harmane was higher in ...
http://www.forskningsdatabasen.dk/catalog/240227086
expert reaction to ibuprofen and longevity in yeast, nematode worms and fruit flies | Science Media Centre  expert reaction to ibuprofen and longevity in yeast, nematode worms and fruit flies | Science Media Centre
Researchers publishing in the journal PLOS Genetics have reported the use of ibuprofen to expand the lifespan of three model organisms: yeast, nematode worms, and fruit flies. They also note changes in cell-cycle, as well as size.. Dr David J Clancy, Lecturer researching genetics and biology of ageing, Lancaster University, said:. "Work by Michael Polymenis and colleagues, published in Public Library of Science - Genetics, elegantly demonstrates a link between the commonly used anti-inflammatory drug ibuprofen, metabolism of the amino acid tryptophan, and lifespan in the model organisms yeast and nematode worms. Part of this effect may be related to slowing of the cell cycle resulting in slower early development and growth.. "Although they did test the drug in the fruit fly Drosophila and observed lifespan increase, the result needs to be repeated using better controls and testing for the effect on tryptophan metabolism. Once that is confirmed, tests in mice should be done.. "Unfortunately the ...
http://www.sciencemediacentre.org/expert-reaction-to-ibuprofen-and-longevity-in-yeast-nematode-worms-and-fruit-flies/
Actin filament disassembling activity of Caenorhabditis elegans actin-interacting protein 1 (UNC-78) is dependent on filament...  Actin filament disassembling activity of Caenorhabditis elegans actin-interacting protein 1 (UNC-78) is dependent on filament...
Marian Blanca Ramírez from the CSIC in Spain has been studying the effects of LRRK2, a protein associated with Parkinsons disease, on cell motility. A Travelling Fellowship from Journal of Cell Science allowed her to spend time in Prof Maddy Parsons lab at Kings College London, learning new cell migration assays and analysing fibroblasts cultured from individuals with Parkinsons. Read more on her story here. Where could your research take you? The deadline to apply for the current round of Travelling Fellowships is 30 Nov 2017. Apply now!. ...
http://jcs.biologists.org/content/early/2003/09/02/jcs.00717
The Annona muricata leaf ethanol extract affects mobility and reproduction in mutant strain NB327 Caenorhabditis elegans  The Annona muricata leaf ethanol extract affects mobility and reproduction in mutant strain NB327 Caenorhabditis elegans
PubMed Central Canada (PMC Canada) provides free access to a stable and permanent online digital archive of full-text, peer-reviewed health and life sciences research publications. It builds on PubMed Central (PMC), the U.S. National Institutes of Health (NIH) free digital archive of biomedical and life sciences journal literature and is a member of the broader PMC International (PMCI) network of e-repositories.
http://pubmedcentralcanada.ca/pmcc/articles/PMC5614673/
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and ProcessesInformation Science
Caenorhabditis elegans ProteinsCaenorhabditis elegansHelminth ProteinsGenes, HelminthMolecular Sequence DataCaenorhabditisAmino Acid SequenceSequence Homology, Amino AcidVulvaDNA, HelminthMutationAnimals, Genetically ModifiedRNA, HelminthGenome, HelminthDisorders of Sex DevelopmentBase SequenceCloning, MolecularLongevityRNA InterferenceGerm CellsPhenotypeNematodaEmbryo, NonmammalianLarvaGene Expression Regulation, DevelopmentalAldicarbGonadsGreen Fluorescent ProteinsPharynxSequence AlignmentTranscription FactorsSignal TransductionOvipositionConserved SequenceLocomotionGenes, LethalAllelesMembrane ProteinsChromosome MappingAntinematodal AgentsGATA Transcription FactorsHermaphroditic OrganismsMeiosisModels, BiologicalLuminescent ProteinsGene Expression RegulationMoltingRecombinant Fusion ProteinsDNA, ComplementarySex Determination ProcessesLevamisoleMorphogenesisPhylogenyNeuronsPharyngeal MusclesNervous SystemProtein Structure, TertiaryEvolution, MolecularGenomeSuppression, GeneticTransgenesModels, Genetic

Serotonin-deficient Mutants and Male Mating Behavior in the Nematode Caenorhabditis Elegans - PubMedSerotonin-deficient Mutants and Male Mating Behavior in the Nematode Caenorhabditis Elegans - PubMed

Defining a behavior that requires the function of specific neurons in the free-living nematode Caenorhabditis elegans can allow ... The G-protein-coupled serotonin receptor SER-1 regulates egg laying and male mating behaviors in Caenorhabditis elegans. ... Sex-specific regulation of neuronal functions in Caenorhabditis elegans: the sex-determining protein TRA-1 represses goa-1/Gα(i ... Serotonin-deficient Mutants and Male Mating Behavior in the Nematode Caenorhabditis Elegans C M Loer et al. J Neurosci. Dec ...
more infohttps://pubmed.ncbi.nlm.nih.gov/8254383/

British Library EThOS: A genetic suppressor screen identifies a novel, conserved ion channel complex as a new downstream target...British Library EThOS: A genetic suppressor screen identifies a novel, conserved ion channel complex as a new downstream target...

Caenorhabditis elegans nematodes expressing activated RHO-1 (G14V) in their cholinergic motor neurons (nRHO-1*) become ... conserved protein, important in the localization of NCA-1 and NCA-2, C. elegans homologues of the novel mammalian ion channel ...
more infohttp://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.565369

Apical junction molecule [Caenorhabditis elegans] - Protein - NCBIApical junction molecule [Caenorhabditis elegans] - Protein - NCBI

Apical junction molecule [Caenorhabditis elegans] Apical junction molecule [Caenorhabditis elegans]. gi,1061385445,ref,NP_ ... Molecular and functional analysis of apical junction formation in the gut epithelium of Caenorhabditis elegans. [Dev Biol. 2004 ... Cooperative regulation of AJM-1 controls junctional integrity in Caenorhabditis elegans epithelia. [Nat Cell Biol. 2001] ... Molecular and functional analysis of apical junction formation in the gut epithelium of Caenorhabditis elegans.. Segbert C, ...
more infohttps://www.ncbi.nlm.nih.gov/protein/NP_001317733

Calcium-dependent secretion activator [Caenorhabditis elegans] - Protein - NCBICalcium-dependent secretion activator [Caenorhabditis elegans] - Protein - NCBI

Calcium-dependent secretion activator [Caenorhabditis elegans] Calcium-dependent secretion activator [Caenorhabditis elegans]. ... Calcium-dependent secretion activator [Caenorhabditis elegans]. NCBI Reference Sequence: NP_001293902.1. Identical Proteins ... RefSeq protein isoforms See 19 reference sequence protein isoforms for the unc-31 gene. ... UNC-31/CAPS docks and primes dense core vesicles in C. elegans neurons.. Lin XG, Ming M, Chen MR, Niu WP, Zhang YD, Liu B, Jiu ...
more infohttps://www.ncbi.nlm.nih.gov/protein/NP_001293902

The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation - InfoscienceThe Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation - Infoscience

In Caenorhabditis elegans, the onset of centriole formation requires notably the proteins SAS-5 and SAS-6, which have ... The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation Rogala, Kacper B ; ... In Caenorhabditis elegans, the onset of centriole formation requires notably the proteins SAS-5 and SAS-6, which have ... Home , The Caenorhabditis elegans protein SAS-5 forms large oligomeric assemblies critical for centriole formation ...
more infohttps://infoscience.epfl.ch/record/214462?ln=en

Rapid Degradation of Caenorhabditis elegans Proteins at Single-Cell Resolution with a Synthetic Auxin | G3: Genes | Genomes |...Rapid Degradation of Caenorhabditis elegans Proteins at Single-Cell Resolution with a Synthetic Auxin | G3: Genes | Genomes |...

2002 Multiple Skp1-related proteins in Caenorhabditis elegans: Diverse patterns of interaction with Cullins and F-box proteins. ... Rapid Degradation of Caenorhabditis elegans Proteins at Single-Cell Resolution with a Synthetic Auxin. View ORCID Profile ... Rapid Degradation of Caenorhabditis elegans Proteins at Single-Cell Resolution with a Synthetic Auxin. View ORCID Profile ... Rapid Degradation of Caenorhabditis elegans Proteins at Single-Cell Resolution with a Synthetic Auxin. View ORCID Profile ...
more infohttps://www.g3journal.org/content/10/1/267

Regulatory elements of Caenorhabditis elegans ribosomal protein genes | BMC Genomics | Full TextRegulatory elements of Caenorhabditis elegans ribosomal protein genes | BMC Genomics | Full Text

... elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. In this study, we performed an in- ... depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans ... Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, ... Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily ...
more infohttps://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-13-433

Neuronal circuitry regulates the response of Caenorhabditis elegans to misfolded proteins | PNASNeuronal circuitry regulates the response of Caenorhabditis elegans to misfolded proteins | PNAS

2000) Polyglutamine aggregates alter protein folding homeostasis in Caenorhabditis elegans. Proc Natl Acad Sci USA 97:5750-5755 ... Neuronal circuitry regulates the response of Caenorhabditis elegans to misfolded proteins Message Subject (Your Name) has sent ... Caenorhabditis elegans as a model system for studying non-cell-autonomous mechanisms in protein-misfolding diseases ... Neuronal circuitry regulates the response of Caenorhabditis elegans to misfolded proteins. Veena Prahlad and Richard I. ...
more infohttps://www.pnas.org/content/108/34/14204?ijkey=644362e40c6460bd335bbd2aff5121b092532788&keytype2=tf_ipsecsha

C46A5.1 - Uncharacterized protein - Caenorhabditis elegans - C46A5.1 gene & proteinC46A5.1 - Uncharacterized protein - Caenorhabditis elegans - C46A5.1 gene & protein

Caenorhabditis briggsae. Caenorhabditis tropicalis. Caenorhabditis elegans. Caenorhabditis remanei (Caenorhabditis vulgaris). ... tr,Q18652,Q18652_CAEEL Uncharacterized protein OS=Caenorhabditis elegans GN=C46A5.1 PE=4 SV=1 ... Protein predictedi ,p>This indicates the type of evidence that supports the existence of the protein. Note that the protein ... Protein. Similar proteins. Organisms. Length. Cluster ID. Cluster name. Size. Q18652. A8XRK5. A0A1I7SXY4. E3M536. ...
more infohttp://www.uniprot.org/uniprot/Q18652

C01G5.5 - Uncharacterized protein - Caenorhabditis elegans - C01G5.5 gene & proteinC01G5.5 - Uncharacterized protein - Caenorhabditis elegans - C01G5.5 gene & protein

Caenorhabditis elegans. Caenorhabditis tropicalis. Caenorhabditis latens. Caenorhabditis remanei (Caenorhabditis vulgaris). ... Caenorhabditis brenneri (Nematode worm). Caenorhabditis japonica. 287. UniRef50_Q17568. Cluster: Uncharacterized protein. 8. ... tr,Q17568,Q17568_CAEEL Uncharacterized protein OS=Caenorhabditis elegans GN=C01G5.5 PE=1 SV=1 ... to allow unambiguous identification of a protein.,p>,a href=/help/protein_names target=_top>More...,/a>,/p>Protein namesi. ...
more infohttp://www.uniprot.org/uniprot/Q17568

Comparative analysis of the Saccharomyces cerevisiae and Caenorhabditis elegans protein interaction networks | BMC Evolutionary...Comparative analysis of the Saccharomyces cerevisiae and Caenorhabditis elegans protein interaction networks | BMC Evolutionary...

We compare the genomes of Saccharomyces cerevisiae and Caenorhabditis elegans with those of closely related species to ... The signature of protein evolution is shaped by a proteins abundance in the organism and its function and the biological ... allows us to resolve the way in which protein interaction network structure and abundance of proteins affect the evolutionary ... Early studies suggested that the position of a protein in the network determines its evolutionary rate but there has been ...
more infohttps://bmcevolbiol.biomedcentral.com/articles/10.1186/1471-2148-5-23/email/correspondent/c1/new

Caenorhabditis elegans MIG-13 protein Summary Report | CureHunterCaenorhabditis elegans MIG-13 protein Summary Report | CureHunter

... isolated from Caenorhabditis elegans; amino acid sequence in first source; GenBAnk AF150958 ... Caenorhabditis elegans MIG-13 protein: required for positioning of Q neuroblasts and their descendents along the ... Helminth Proteins: 1*Caenorhabditis elegans Proteins: 4*Caenorhabditis elegans MIG-13 protein ... Caenorhabditis elegans MIG-13 protein. Subscribe to New Research on Caenorhabditis elegans MIG-13 protein ...
more infohttp://www.curehunter.com/public/keywordSummaryC120452-Caenorhabditis-elegans-MIG-13-protein.do

Human CED-6 encodes a functional homologue of the Caenorhabditis elegans engulfment protein CED-6. - Zurich Open Repository...Human CED-6 encodes a functional homologue of the Caenorhabditis elegans engulfment protein CED-6. - Zurich Open Repository...

Liu, Q A; Hengartner, M O (1999). Human CED-6 encodes a functional homologue of the Caenorhabditis elegans engulfment protein ... Human CED-6 encodes a functional homologue of the Caenorhabditis elegans engulfment protein CED-6. ... Our previous analysis of the engulfment gene ced-6 in Caenorhabditis elegans has suggested that CED-6 is an adaptor protein ... Our previous analysis of the engulfment gene ced-6 in Caenorhabditis elegans has suggested that CED-6 is an adaptor protein ...
more infohttps://www.zora.uzh.ch/id/eprint/1038/

Polyglutamine aggregates alter protein folding homeostasis in Caenorhabditis elegans | PNASPolyglutamine aggregates alter protein folding homeostasis in Caenorhabditis elegans | PNAS

Polyglutamine aggregates alter protein folding homeostasis in Caenorhabditis elegans. Sanjeev H. Satyal, Enrico Schmidt, ... Polyglutamine aggregates alter protein folding homeostasis in Caenorhabditis elegans. Sanjeev H. Satyal, Enrico Schmidt, ... Polyglutamine aggregates alter protein folding homeostasis in Caenorhabditis elegans Message Subject (Your Name) has sent you a ... Polyglutamine aggregates alter protein folding homeostasis in Caenorhabditis elegans. Sanjeev H. Satyal, Enrico Schmidt, ...
more infohttps://www.pnas.org/content/97/11/5750?ijkey=dbe76c68fcb880af9ddb415c904da6fcde226085&keytype2=tf_ipsecsha

Immunoprecipitation of Proteins in Caenorhabditis elegansImmunoprecipitation of Proteins in Caenorhabditis elegans

IP can be performed to isolate and concentrate one particular protein from a sample of thousands of different proteins. IP is ... This protocol outlines the methods used to IP proteins in whole worm lysates and their preparation for detection on Western ... also readily performed to pull down interacting proteins of complexes out of solution. ... is a biochemical technique to precipitate a protein out of solution using an antigen that can specifically bind to that protein ...
more infohttps://bio-protocol.org/cn/e1436

Structure Cluster - 1PEV: Crystal Structure of the Actin Interacting Protein from Caenorhabditis Elegans 3D...Structure Cluster - 1PEV: Crystal Structure of the Actin Interacting Protein from Caenorhabditis Elegans 3D...

Identification of functional residues on Caenorhabditis elegans actin-interacting protein 1 (UNC-78) for disassembly of actin ... Description: Actin interacting protein 1 protein , Length: 611 No structure alignment results are available for 1PEV.A ... Pre-calculated protein structure alignments at the RCSB PDB website. Bioinformatics 26: 2983-2985 ...
more infohttp://www.rcsb.org/pdb/explore/structureCluster.do?structureId=1PEV

A Compendium of Caenorhabditis elegans RNA Binding Proteins Predicts Extensive Regulation at Multiple Levels | G3: Genes |...A Compendium of Caenorhabditis elegans RNA Binding Proteins Predicts Extensive Regulation at Multiple Levels | G3: Genes |...

A Compendium of Caenorhabditis elegans RNA Binding Proteins Predicts Extensive Regulation at Multiple Levels. Alex M. Tamburino ... A Compendium of Caenorhabditis elegans RNA Binding Proteins Predicts Extensive Regulation at Multiple Levels. Alex M. Tamburino ... A Compendium of Caenorhabditis elegans RNA Binding Proteins Predicts Extensive Regulation at Multiple Levels. Alex M. Tamburino ... A Compendium of Caenorhabditis elegans RNA Binding Proteins Predicts Extensive Regulation at Multiple Levels ...
more infohttp://www.g3journal.org/content/3/2/297.supplemental

Conversion of the LIN-1 ETS Protein of Caenorhabditis elegans from a SUMOylated Transcriptional Repressor to a Phosphorylated...Conversion of the LIN-1 ETS Protein of Caenorhabditis elegans from a SUMOylated Transcriptional Repressor to a Phosphorylated...

1995 The Caenorhabditis elegans gene mek-2 is required for vulval induction and encodes a protein similar to the protein kinase ... 1995 The Caenorhabditis elegans gene lin-1 encodes an ETS-domain protein and defines a branch of the vulval induction pathway. ... 1994 Suppression of activated Let-60 ras protein defines a role of Caenorhabditis elegans Sur-1 MAP kinase in vulval ... Conversion of the LIN-1 ETS Protein of Caenorhabditis elegans from a SUMOylated Transcriptional Repressor to a Phosphorylated ...
more infohttp://www.genetics.org/content/199/3/761

Mitochondrial Unfolded-Protein Response (UPRmt) (Caenorhabditis elegans) - WikiPathwaysMitochondrial Unfolded-Protein Response (UPRmt) (Caenorhabditis elegans) - WikiPathways

Protein Fragments. CLPP-1. Unfolded Proteins. SPG-7. TOMM-40. DVE-1. Paraquat. 7. 1, 2. ATFS-1. ATFS-1. HSP-60. HSP-6. eIF2- ... Protein. C18E9.6 (WormBase) UBL-5. Protein. F46F11.4 (WormBase) Unfolded Proteins. Protein. dnj-10. GeneProduct. F22B7.5 ( ... Mitochondrial Unfolded-Protein Response (UPRmt) (Caenorhabditis elegans). From WikiPathways. Revision as of 22:37, 29 January ... Protein. ZC376.7 (WormBase) CLPP-1. Protein. ZK970.2 (WormBase) ClpX-like Protease/ (D2030.2). Protein. D2030.2 (Ensembl) ClpX- ...
more infohttps://www.wikipathways.org/index.php?title=Pathway:WP525&oldid=73483

Mitochondrial Unfolded-Protein Response (UPRmt) (Caenorhabditis elegans) - WikiPathwaysMitochondrial Unfolded-Protein Response (UPRmt) (Caenorhabditis elegans) - WikiPathways

Protein. Y47G6A.10 (WormBase) UBL-5. Protein. F46F11.4 (WormBase) Unfolded Proteins. Protein. eIF2-alpha (Y37E3.10). Protein. ... Mitochondrial Unfolded-Protein Response (UPRmt) (Caenorhabditis elegans). From WikiPathways. Revision as of 23:55, 20 December ... Protein Fragments. SPG-7. HSP-6. Lon Protease/. C34B2.6. 3. 1, 6. translation. ATFS-1. ATFS-1. HSP-60. HSP-6. eIF2-alpha. ( ... Protein. ZC376.7 (WormBase) CLPP-1. Protein. ZK970.2 (WormBase) ClpX-like Protease/ (D2030.2). Protein. D2030.2 (Ensembl) ClpX- ...
more infohttps://www.wikipathways.org/index.php?title=Pathway:WP525&oldid=73030

Identification and Characterization of Human Orthologues to Saccharomyces cerevisiae Upf2 Protein and Upf3 Protein ...Identification and Characterization of Human Orthologues to Saccharomyces cerevisiae Upf2 Protein and Upf3 Protein ...

1999) SMG-2 is a phosphorylated protein required for mRNA surveillance in Caenorhabditis elegans and related to Upf1p of yeast. ... and HA-tagged proteins, respectively (Fig. 5A and B). Western blot analysis of total protein demonstrated that each protein was ... Comparison of Upf3-X and hUpf3 proteins from H. sapiens, C. elegans, S. pombe, and S. cerevisiae. (A) Amino acid alignment of ... Here, we describe human orthologues to S. cerevisiae Upf2p and S. cerevisiae Upf3p (Caenorhabditis elegans SMG-4) based on ...
more infohttps://mcb.asm.org/content/21/1/209?ijkey=fd1d905b96a7cd76cf9e8c9a1ab7b9730c2b57b2&keytype2=tf_ipsecsha

Actin filament disassembling activity of Caenorhabditis elegans actin-interacting protein 1 (UNC-78) is dependent on filament...Actin filament disassembling activity of Caenorhabditis elegans actin-interacting protein 1 (UNC-78) is dependent on filament...

Actin filament disassembling activity of Caenorhabditis elegans actin-interacting protein 1 (UNC-78) is dependent on filament ... Actin filament disassembling activity of Caenorhabditis elegans actin-interacting protein 1 (UNC-78) is dependent on filament ... Actin filament disassembling activity of Caenorhabditis elegans actin-interacting protein 1 (UNC-78) is dependent on filament ... Actin filament disassembling activity of Caenorhabditis elegans actin-interacting protein 1 (UNC-78) is dependent on filament ...
more infohttp://jcs.biologists.org/content/early/2003/09/02/jcs.00717

spe-12 Encodes a Sperm Cell Surface Protein That Promotes Spermiogenesis in Caenorhabditis elegans | Geneticsspe-12 Encodes a Sperm Cell Surface Protein That Promotes Spermiogenesis in Caenorhabditis elegans | Genetics

1989 Posttranslational insertion of a membrane protein on Caenorhabditis elegans sperm occurs without de novo protein synthesis ... 1983 Identification of a large multigene family encoding the major sperm protein of Caenorhabditis elegans. J. Mol. Biol. 171: ... Mitogen-activated protein (MAP) kinase signaling pathways in the nematode Caenorhabditis elegans, for example, are known to ... spe-12 Encodes a Sperm Cell Surface Protein That Promotes Spermiogenesis in Caenorhabditis elegans. Jeremy Nance, Alicia N. ...
more infohttp://www.genetics.org/content/152/1/209?ijkey=d736adcbf4d302a2f29428da5561abd8e99df7cb&keytype2=tf_ipsecsha

Bioactive Peptides from Angelica sinensis Protein Hydrolyzate Delay Senescence in Caenorhabditis elegans through Antioxidant...Bioactive Peptides from Angelica sinensis Protein Hydrolyzate Delay Senescence in Caenorhabditis elegans through Antioxidant...

Bioactive Peptides from Angelica sinensis Protein Hydrolyzate Delay Senescence in Caenorhabditis elegans through Antioxidant ... P. B. L. Pun, J. Gruber, S. Y. Tang et al., "Ageing in nematodes: do antioxidants extend lifespan in Caenorhabditis elegans?" ... P. Martorell, E. Bataller, S. Llopis et al., "A cocoa peptide protects Caenorhabditis elegans from oxidative stress and β- ... Q. Wang, F. Yang, W. Guo et al., "Caenorhabditis elegans in Chinese medicinal studies: making the case for aging and ...
more infohttps://www.hindawi.com/journals/omcl/2016/8956981/ref/

Checkpoint Proteins Control Survival of the Postmitotic Cells in Caenorhabditis elegans | ScienceCheckpoint Proteins Control Survival of the Postmitotic Cells in Caenorhabditis elegans | Science

Checkpoint Proteins Control Survival of the Postmitotic Cells in Caenorhabditis elegans. By Anders Olsen, Maithili C. ... Checkpoint Proteins Control Survival of the Postmitotic Cells in Caenorhabditis elegans. By Anders Olsen, Maithili C. ... Checkpoint Proteins Control Survival of the Postmitotic Cells in Caenorhabditis elegans Message Subject. (Your Name) has ...
more infohttp://science.sciencemag.org/content/312/5778/1381.full
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPsychiatry and PsychologyPhenomena and ProcessesInformation Science
Caenorhabditis elegans ProteinsCaenorhabditis elegansHelminth ProteinsGenes, HelminthMolecular Sequence DataCaenorhabditisAmino Acid SequenceSequence Homology, Amino AcidVulvaDNA, HelminthMutationAnimals, Genetically ModifiedRNA, HelminthGenome, HelminthDisorders of Sex DevelopmentBase SequenceCloning, MolecularLongevityRNA InterferenceGerm CellsPhenotypeNematodaEmbryo, NonmammalianLarvaGene Expression Regulation, DevelopmentalAldicarbGonadsGreen Fluorescent ProteinsPharynxSequence AlignmentTranscription FactorsSignal TransductionOvipositionConserved SequenceLocomotionGenes, LethalAllelesMembrane ProteinsChromosome MappingAntinematodal AgentsGATA Transcription FactorsHermaphroditic OrganismsMeiosisModels, BiologicalLuminescent ProteinsGene Expression RegulationMoltingRecombinant Fusion ProteinsDNA, ComplementarySex Determination ProcessesLevamisoleMorphogenesisPhylogenyNeuronsPharyngeal MusclesNervous SystemProtein Structure, TertiaryEvolution, MolecularGenomeSuppression, GeneticTransgenesModels, Genetic
NeuronsGeneDrosophilaRegulationGenesMembrane ProteinsEpitheliumTaxonomyMetazoanSecretionMolecular chaperonesActinCompendiumEncodesDifferent proteinsSequenceGenomesEndogenousMechanismsMediatesHomeostasisConformationAggregationCytoskeletonHomologyPeptidesMRNAPolyglutamineCellOxidativeNucleotideFunctionBindEnzymesInsightHuman diseasesFunctionalTyrosine

Neurons11

search
  • UNC-31/CAPS docks and primes dense core vesicles in C. elegans neurons. (nih.gov)
  • PKA activation bypasses the requirement for UNC-31 in the docking of dense core vesicles from C. elegans neurons. (nih.gov)
  • Previous findings that the heat shock response in Caenorhabditis elegans is regulated by thermosensory neurons led us to consider whether neuronal activity could also be responsible for the inadequate response of an organism to chronic protein misfolding. (pnas.org)
  • Whereas polyglutamine expansion-expressing animals with WT thermosensory neurons readily express protein aggregates, leading to cellular dysfunction without concomitant up-regulation of molecular chaperones, modulation of the nervous system results in chaperone up-regulation that suppresses aggregation and toxicity. (pnas.org)
  • Cell-nonautonomous control of chaperone expression by the thermosensory neurons allows C. elegans to respond differently to acute stress such as heat shock, and chronic stress caused by the expression of misfolded proteins, suggesting that neuronal signaling determines the course of cellular proteotoxicity. (pnas.org)
  • Previous studies in the metazoan Caenorhabditis elegans have shown that the HSR is regulated by the AFD thermosensory neurons and AIY interneurons ( 29 ). (pnas.org)
  • Huntington's disease, the most frequent of these autosomal dominant diseases, is characterized by insoluble granular and fibrous deposits of huntingtin protein in neurons ( 6 , 7 ). (pnas.org)
  • Salidroside protects Caenorhabditis elegans neurons from polyglutamine-mediated toxicity by reducing oxidative stress," Molecules , vol. 19, no. 6, pp. 7757-7769, 2014. (hindawi.com)
  • In Caenorhabditis elegans , 10 putative ionotropic glutamate receptor subunits have been identified, a surprising number for an organism with only 302 neurons. (jneurosci.org)
  • We also show that expression of these subunits in this circuit is differentially regulated by the homeodomain protein UNC-42 and that UNC-42 is also required for axonal pathfinding of neurons in the circuit. (jneurosci.org)
  • To address questions of receptor complexity, composition, and organization at the level of individual neurons, we have examined the expression and regulation of ionotropic glutamate receptor subunits in the nervous system of C. elegans . (jneurosci.org)

Gene18

search

Drosophila4

search

Regulation3

search

Genes6

search

Membrane Proteins2

search

Epithelium1

search

Taxonomy1

search
  • p>This subsection of the 'Names and Taxonomy' section provides an exhaustive list of all names of the protein, from commonly used to obsolete, to allow unambiguous identification of a protein. (uniprot.org)

Metazoan1

search
  • All metazoan genomes encode multiple RAS GTPase activating proteins (RasGAPs) that negatively regulate the conserved RAS/MAPK signaling pathway. (uzh.ch)

Secretion1

search

Molecular chaperones4

search
  • HSF-1 regulates the inducible expression of HS proteins (HSPs), many of which are molecular chaperones that protect the proteome by enhancing folding, suppressing misfolding, and targeting damaged proteins for degradation ( 8 ). (pnas.org)
  • The current hypothesis for the induction of chaperones is that elevated levels of misfolded and damaged proteins caused by environmental insults or errors in protein biogenesis titrate the molecular chaperones away from HSF-1 and toward association with misfolded proteins, resulting in the derepression and activation of HSF-1 ( 9 , 10 ). (pnas.org)
  • The elevated levels of heat shock proteins, also termed molecular chaperones because of their involvement in various steps of protein folding, assist the cell in restoring the protein-folding homeostasis after stress exposure ( 20 , 21 ). (pnas.org)
  • Mitochondria have dedicated molecular chaperones and proteases that promote proper protein folding, complex assembly and quality control. (wikipathways.org)

Actin3

search
  • ERM proteins are made of three domains, the FERM domain, a central helical domain and a C-terminal tail domain, which binds F-actin. (wikipedia.org)
  • FERM domain containing proteins include: Band 4.1, which links the spectrin-actin cytoskeleton of erythrocytes to the plasma membrane. (wikipedia.org)
  • Filopodin, a slime mould protein that binds actin and which is involved in the control of cell motility and chemotaxis. (wikipedia.org)

Compendium1

search

Encodes2

search

Different proteins1

search

Sequence5

search
  • View conserved domains detected in this protein sequence using CD-search. (nih.gov)
  • Note that the 'protein existence' evidence does not give information on the accuracy or correctness of the sequence(s) displayed. (uniprot.org)
  • Here, we describe our isolation and characterization of a human cDNA encoding a protein, hCED-6, with strong sequence similarity to C. elegans CED-6. (uzh.ch)
  • The efficiency of protein folding can be affected by several factors, including primary sequence mutations or alterations in the cellular environment. (pnas.org)
  • Sequence analysis of the predicted proteins identified two NMDA and eight non-NMDA receptor subunits. (jneurosci.org)

Genomes1

search
  • The protein-folding environment in mitochondria is challenged by organelle architecture, the presence of reactive oxygen species and the difficulties associated with assembly of the electron transport chain, which consists of components encoded by both the mitochondrial and the nuclear genomes. (wikipathways.org)

Endogenous1

search
  • Note: Depending on protein expression and specificity of antibody, this protocol can also be used to immunoprecipitate endogenous proteins. (bio-protocol.org)

Mechanisms2

search
  • In situ techniques for targeted protein degradation enable a detailed analysis of developmental events, mechanisms, and functions. (g3journal.org)
  • The mechanisms that enable ETS proteins to switch cell fates in response to signaling pathway activation are not fully defined, and to address this important issue it is critical to elucidate the function of these proteins both prior to ERK activation and following phosphorylation by ERK. (genetics.org)

Mediates2

search
  • Here we demonstrate using the yeast two-hybrid system that SUMOylation of LIN-1 mediates interactions with a protein predicted to be involved in transcriptional repression: the RAD-26 Mi-2β/CHD4 component of the nu cleosome r emodeling and histone d eacetylation (NuRD) transcriptional repression complex. (genetics.org)
  • ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. (wikipathways.org)

Homeostasis2

search
  • The altered homeostasis associated with polyglutamine aggregates causes both the sequestration of an otherwise soluble protein with shorter arrays of glutamine repeats and the relocalization of a nuclear glutamine-rich protein. (pnas.org)
  • The mitochondrial UPR - protecting organelle protein homeostasis. (wikipathways.org)

Conformation2

search
  • Therefore, the absence of a consistent HSR in diseases of protein conformation is unexpected. (pnas.org)
  • A common theme is the initial appearance of an altered protein conformation, which can apparently act as a seed for misfolded proteins, initiating a cascade of events that culminates in the deposition of proteinaceous aggregates inside or outside the cell ( 4 ). (pnas.org)

Aggregation7

search
  • However, for many protein conformational diseases, it is unclear why this quality-control system does not efficiently counter protein aggregation. (pnas.org)
  • Instead, the protein quality control system appears to be impaired as a result of the titration of chaperones, disruption of proteasomal activity ( 17 - 19 ), modification of HSF-1 and its regulators, or sequestration of important cofactors by aggregation-prone proteins ( 17 - 21 ). (pnas.org)
  • Similarly, the purposeful overexpression of specific chaperones or the expression of constitutively active HSF-1 can inhibit protein aggregation and toxicity in multiple cell and animal models ( 23 - 28 ). (pnas.org)
  • These observations of induced aggregation and relocalization have implications for disorders involving protein aggregation. (pnas.org)
  • As a result of these factors, abnormal protein conformations can arise that may be prone to aggregation. (pnas.org)
  • The presence of misfolded proteins itself can be a potent force to initiate and sustain protein aggregation leading to pathology and disease. (pnas.org)
  • It also produces an aggregation of the proteins containing the expansion. (pnas.org)

Cytoskeleton2

search
  • FERM domains are found in a number of cytoskeletal-associated proteins that associate with various proteins at the interface between the plasma membrane and the cytoskeleton. (wikipedia.org)
  • Protein-tyrosine phosphatases PTPN3 and PTPN4, enzymes that appear to act at junctions between the membrane and the cytoskeleton. (wikipedia.org)

Homology2

search

Peptides1

search
  • M. Memarpoor-Yazdi, H. Mahaki, and H. Zare-Zardini, "Antioxidant activity of protein hydrolysates and purified peptides from Zizyphus jujuba fruits," Journal of Functional Foods , vol. 5, no. 1, pp. 62-70, 2013. (hindawi.com)

MRNA2

search
  • Nonsense-mediated mRNA decay (NMD), also called mRNA surveillance, is an important pathway used by all organisms that have been tested to degrade mRNAs that prematurely terminate translation and, as a consequence, eliminate the production of aberrant proteins that could be potentially harmful. (asm.org)
  • spe-12 mRNA is expressed in the sperm-producing germ line and the protein localizes to the spermatid cell surface. (genetics.org)

Polyglutamine5

search
  • Expansion of polyglutamine repeats in several unrelated proteins causes neurodegenerative diseases with distinct but related pathologies. (pnas.org)
  • To provide a model system for investigating common pathogenic features, we have examined the behavior of polyglutamine expansions expressed in Caenorhabditis elegans . (pnas.org)
  • The CAG repeat disorders are caused by expansions of polyglutamine tracts in unrelated proteins and include Huntington's disease, dentatorubral pallidoluysian atrophy, spinal bulbar muscular atrophy, and several types of spinocerebellar ataxias ( 5 ). (pnas.org)
  • The expression of polyglutamine repeats containing proteins in different model animal systems reproduces features of the diseased state, such as the age-dependent appearance of aggregates and neuronal death ( 9 - 13 ). (pnas.org)
  • The formation of aggregates in vitro depends on the appearance of fragments of huntingtin containing polyglutamine repeats, consistent with the proposal that protein aggregate formation is generally preceded by the appearance of an initial seed of misfolded protein ( 16 ). (pnas.org)

Cell3

search
  • The LIN-1 ETS transcription factor plays a pivotal role in controlling cell fate decisions during development of the Caenorhabditis elegans vulva. (genetics.org)
  • Marian Blanca Ramírez from the CSIC in Spain has been studying the effects of LRRK2, a protein associated with Parkinson's disease, on cell motility. (biologists.org)
  • Talin, a cytoskeletal protein concentrated in regions of cell-substratum contact and, in lymphocytes, of cell-cell contacts. (wikipedia.org)

Oxidative1

search
  • W. Chen, L. Rezaizadehnajafi, and M. Wink, "Influence of resveratrol on oxidative stress resistance and life span in Caenorhabditis elegans ," Journal of Pharmacy and Pharmacology , vol. 65, no. 5, pp. 682-688, 2013. (hindawi.com)

Nucleotide1

search
  • The tool works with standard single letter nucleotide or protein codes including ambiguities and can match Prosite patterns in protein sequences. (nih.gov)

Function1

search
  • this carboxy-terminal extension appears not to be essential for CED-6 function in C. elegans, however. (uzh.ch)

Bind2

search
  • Immunoprecipitation (IP) is a biochemical technique to precipitate a protein out of solution using an antigen that can specifically bind to that protein. (bio-protocol.org)
  • EGL-27 also binds UBC-9 , an enzyme involved in SUMOylation, and MEP-1 , a zinc-finger protein previously shown to bind LIN-1 . (genetics.org)

Enzymes1

search
  • In eukaryotes, these processes are often associated with characteristic epigenetic changes brought about by the activity of chromatin-associated proteins and enzymes that influence the transition between chromatin states, thereby influencing transcriptional activity. (beds.ac.uk)

Insight1

search
  • We provide insight into how the AID system functions in C. elegans by determining that TIR1 depends on C. elegans SKR-1 / 2 , CUL-1 , and RBX-1 to degrade target proteins. (g3journal.org)

Human diseases2

search
  • The consequence of chronic protein misfolding is the basis of many human diseases. (pnas.org)
  • These issues have significant implications for human health, since ETS proteins contribute to human diseases including cancer ( Dittmer 2003 ). (genetics.org)

Functional1

search

Tyrosine2

search
  • Focal-adhesion kinases (FAKs), cytoplasmic protein tyrosine kinases involved in signalling through integrins. (wikipedia.org)
  • Protein-tyrosine phosphatases PTPN14 and PTP-D1, PTP-RL10 and PTP2E. (wikipedia.org)