Caenorhabditis elegans: A species of nematode that is widely used in biological, biochemical, and genetic studies.Caenorhabditis elegans Proteins: Proteins from the nematode species CAENORHABDITIS ELEGANS. The proteins from this species are the subject of scientific interest in the area of multicellular organism MORPHOGENESIS.Caenorhabditis: A genus of small free-living nematodes. Two species, CAENORHABDITIS ELEGANS and C. briggsae are much used in studies of genetics, development, aging, muscle chemistry, and neuroanatomy.Genes, Helminth: The functional hereditary units of HELMINTHS.Helminth Proteins: Proteins found in any species of helminth.Vulva: The external genitalia of the female. It includes the CLITORIS, the labia, the vestibule, and its glands.DNA, Helminth: Deoxyribonucleic acid that makes up the genetic material of helminths.Animals, Genetically Modified: ANIMALS whose GENOME has been altered by GENETIC ENGINEERING, or their offspring.RNA, Helminth: Ribonucleic acid in helminths having regulatory and catalytic roles as well as involvement in protein synthesis.Genome, Helminth: The genetic complement of a helminth (HELMINTHS) as represented in its DNA.Disorders of Sex Development: In gonochoristic organisms, congenital conditions in which development of chromosomal, gonadal, or anatomical sex is atypical. Effects from exposure to abnormal levels of GONADAL HORMONES in the maternal environment, or disruption of the function of those hormones by ENDOCRINE DISRUPTORS are included.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Longevity: The normal length of time of an organism's life.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.RNA Interference: A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Germ Cells: The reproductive cells in multicellular organisms at various stages during GAMETOGENESIS.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Nematoda: A class of unsegmented helminths with fundamental bilateral symmetry and secondary triradiate symmetry of the oral and esophageal structures. Many species are parasites.Embryo, Nonmammalian: The developmental entity of a fertilized egg (ZYGOTE) in animal species other than MAMMALS. For chickens, use CHICK EMBRYO.Larva: Wormlike or grublike stage, following the egg in the life cycle of insects, worms, and other metamorphosing animals.Gene Expression Regulation, Developmental: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Aldicarb: Carbamate derivative used as an insecticide, acaricide, and nematocide.Gonads: The gamete-producing glands, OVARY or TESTIS.Green Fluorescent Proteins: Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Pharynx: A funnel-shaped fibromuscular tube that conducts food to the ESOPHAGUS, and air to the LARYNX and LUNGS. It is located posterior to the NASAL CAVITY; ORAL CAVITY; and LARYNX, and extends from the SKULL BASE to the inferior border of the CRICOID CARTILAGE anteriorly and to the inferior border of the C6 vertebra posteriorly. It is divided into the NASOPHARYNX; OROPHARYNX; and HYPOPHARYNX (laryngopharynx).Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Oviposition: The process of laying or shedding fully developed eggs (OVA) from the female body. The term is usually used for certain INSECTS or FISHES with an organ called ovipositor where eggs are stored or deposited before expulsion from the body.Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Locomotion: Movement or the ability to move from one place or another. It can refer to humans, vertebrate or invertebrate animals, and microorganisms.Genes, Lethal: Genes whose loss of function or gain of function MUTATION leads to the death of the carrier prior to maturity. They may be essential genes (GENES, ESSENTIAL) required for viability, or genes which cause a block of function of an essential gene at a time when the essential gene function is required for viability.Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Antinematodal Agents: Substances used in the treatment or control of nematode infestations. They are used also in veterinary practice.GATA Transcription Factors: A family of transcription factors that contain two ZINC FINGER MOTIFS and bind to the DNA sequence (A/T)GATA(A/G).Hermaphroditic Organisms: Animals and plants which have, as their normal mode of reproduction, both male and female sex organs in the same individual.Meiosis: A type of CELL NUCLEUS division, occurring during maturation of the GERM CELLS. Two successive cell nucleus divisions following a single chromosome duplication (S PHASE) result in daughter cells with half the number of CHROMOSOMES as the parent cells.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Luminescent Proteins: Proteins which are involved in the phenomenon of light emission in living systems. Included are the "enzymatic" and "non-enzymatic" types of system with or without the presence of oxygen or co-factors.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Molting: Periodic casting off FEATHERS; HAIR; or cuticle. Molting is a process of sloughing or desquamation, especially the shedding of an outer covering and the development of a new one. This phenomenon permits growth in ARTHROPODS, skin renewal in AMPHIBIANS and REPTILES, and the shedding of winter coats in BIRDS and MAMMALS.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Sex Determination Processes: The mechanisms by which the SEX of an individual's GONADS are fixed.Levamisole: An antihelminthic drug that has been tried experimentally in rheumatic disorders where it apparently restores the immune response by increasing macrophage chemotaxis and T-lymphocyte function. Paradoxically, this immune enhancement appears to be beneficial in rheumatoid arthritis where dermatitis, leukopenia, and thrombocytopenia, and nausea and vomiting have been reported as side effects. (From Smith and Reynard, Textbook of Pharmacology, 1991, p435-6)Morphogenesis: The development of anatomical structures to create the form of a single- or multi-cell organism. Morphogenesis provides form changes of a part, parts, or the whole organism.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Neurons: The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.Pharyngeal Muscles: The muscles of the PHARYNX are voluntary muscles arranged in two layers. The external circular layer consists of three constrictors (superior, middle, and inferior). The internal longitudinal layer consists of the palatopharyngeus, the salpingopharyngeus, and the stylopharyngeus. During swallowing, the outer layer constricts the pharyngeal wall and the inner layer elevates pharynx and LARYNX.Nervous System: The entire nerve apparatus, composed of a central part, the brain and spinal cord, and a peripheral part, the cranial and spinal nerves, autonomic ganglia, and plexuses. (Stedman, 26th ed)Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Genome: The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.Suppression, Genetic: Mutation process that restores the wild-type PHENOTYPE in an organism possessing a mutationally altered GENOTYPE. The second "suppressor" mutation may be on a different gene, on the same gene but located at a distance from the site of the primary mutation, or in extrachromosomal genes (EXTRACHROMOSOMAL INHERITANCE).Transgenes: Genes that are introduced into an organism using GENE TRANSFER TECHNIQUES.Models, Genetic: Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.Intestines: The section of the alimentary canal from the STOMACH to the ANAL CANAL. It includes the LARGE INTESTINE and SMALL INTESTINE.Subcutaneous Tissue: Loose connective tissue lying under the DERMIS, which binds SKIN loosely to subjacent tissues. It may contain a pad of ADIPOCYTES, which vary in number according to the area of the body and vary in size according to the nutritional state.Sex Determination Analysis: Validation of the SEX of an individual by inspection of the GONADS and/or by genetic tests.Muscles: Contractile tissue that produces movement in animals.Cell Lineage: The developmental history of specific differentiated cell types as traced back to the original STEM CELLS in the embryo.Body Patterning: The processes occurring in early development that direct morphogenesis. They specify the body plan ensuring that cells will proceed to differentiate, grow, and diversify in size and shape at the correct relative positions. Included are axial patterning, segmentation, compartment specification, limb position, organ boundary patterning, blood vessel patterning, etc.Trans-Splicing: The joining of RNA from two different genes. One type of trans-splicing is the "spliced leader" type (primarily found in protozoans such as trypanosomes and in lower invertebrates such as nematodes) which results in the addition of a capped, noncoding, spliced leader sequence to the 5' end of mRNAs. Another type of trans-splicing is the "discontinuous group II introns" type (found in plant/algal chloroplasts and plant mitochondria) which results in the joining of two independently transcribed coding sequences. Both are mechanistically similar to conventional nuclear pre-mRNA cis-splicing. Mammalian cells are also capable of trans-splicing.Microscopy, Fluorescence: Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.RNA, Double-Stranded: RNA consisting of two strands as opposed to the more prevalent single-stranded RNA. Most of the double-stranded segments are formed from transcription of DNA by intramolecular base-pairing of inverted complementary sequences separated by a single-stranded loop. Some double-stranded segments of RNA are normal in all organisms.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Cell Polarity: Orientation of intracellular structures especially with respect to the apical and basolateral domains of the plasma membrane. Polarized cells must direct proteins from the Golgi apparatus to the appropriate domain since tight junctions prevent proteins from diffusing between the two domains.Behavior, Animal: The observable response an animal makes to any situation.Genes, Reporter: Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.Muscle, Striated: One of two types of muscle in the body, characterized by the array of bands observed under microscope. Striated muscles can be divided into two subtypes: the CARDIAC MUSCLE and the SKELETAL MUSCLE.Nerve Tissue ProteinsProtein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.Multigene Family: A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)Thermosensing: The sensation of cold, heat, coolness, and warmth as detected by THERMORECEPTORS.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Haemonchus: A genus of parasitic nematode worms which infest the duodenum and stomach of domestic and wild herbivores, which ingest it with the grasses (POACEAE) they eat. Infestation of man is accidental.Drosophila melanogaster: A species of fruit fly much used in genetics because of the large size of its chromosomes.Receptors, Notch: A family of conserved cell surface receptors that contain EPIDERMAL GROWTH FACTOR repeats in their extracellular domain and ANKYRIN repeats in their cytoplasmic domains. The cytoplasmic domain of notch receptors is released upon ligand binding and translocates to the CELL NUCLEUS where it acts as transcription factor.Gene Deletion: A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.Reproduction: The total process by which organisms produce offspring. (Stedman, 25th ed)Chromosomes: In a prokaryotic cell or in the nucleus of a eukaryotic cell, a structure consisting of or containing DNA which carries the genetic information essential to the cell. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Sensory Receptor Cells: Specialized afferent neurons capable of transducing sensory stimuli into NERVE IMPULSES to be transmitted to the CENTRAL NERVOUS SYSTEM. Sometimes sensory receptors for external stimuli are called exteroceptors; for internal stimuli are called interoceptors and proprioceptors.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.Blastomeres: Undifferentiated cells resulting from cleavage of a fertilized egg (ZYGOTE). Inside the intact ZONA PELLUCIDA, each cleavage yields two blastomeres of about half size of the parent cell. Up to the 8-cell stage, all of the blastomeres are totipotent. The 16-cell MORULA contains outer cells and inner cells.Ethyl Methanesulfonate: An antineoplastic agent with alkylating properties. It also acts as a mutagen by damaging DNA and is used experimentally for that effect.X Chromosome: The female sex chromosome, being the differential sex chromosome carried by half the male gametes and all female gametes in human and other male-heterogametic species.Fertility: The capacity to conceive or to induce conception. It may refer to either the male or female.RNA-Binding Proteins: Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.Two-Hybrid System Techniques: Screening techniques first developed in yeast to identify genes encoding interacting proteins. Variations are used to evaluate interplay between proteins and other molecules. Two-hybrid techniques refer to analysis for protein-protein interactions, one-hybrid for DNA-protein interactions, three-hybrid interactions for RNA-protein interactions or ligand-based interactions. Reverse n-hybrid techniques refer to analysis for mutations or other small molecules that dissociate known interactions.Motor Neurons: Neurons which activate MUSCLE CELLS.Protein Transport: The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.Oocytes: Female germ cells derived from OOGONIA and termed OOCYTES when they enter MEIOSIS. The primary oocytes begin meiosis but are arrested at the diplotene state until OVULATION at PUBERTY to give rise to haploid secondary oocytes or ova (OVUM).Aging: The gradual irreversible changes in structure and function of an organism that occur as a result of the passage of time.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.Drosophila Proteins: Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.Oogenesis: The process of germ cell development in the female from the primordial germ cells through OOGONIA to the mature haploid ova (OVUM).Embryonic Development: Morphological and physiological development of EMBRYOS.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Epistasis, Genetic: A form of gene interaction whereby the expression of one gene interferes with or masks the expression of a different gene or genes. Genes whose expression interferes with or masks the effects of other genes are said to be epistatic to the effected genes. Genes whose expression is affected (blocked or masked) are hypostatic to the interfering genes.Genes, Suppressor: Genes that have a suppressor allele or suppressor mutation (SUPPRESSION, GENETIC) which cancels the effect of a previous mutation, enabling the wild-type phenotype to be maintained or partially restored. For example, amber suppressors cancel the effect of an AMBER NONSENSE MUTATION.Homeodomain Proteins: Proteins encoded by homeobox genes (GENES, HOMEOBOX) that exhibit structural similarity to certain prokaryotic and eukaryotic DNA-binding proteins. Homeodomain proteins are involved in the control of gene expression during morphogenesis and development (GENE EXPRESSION REGULATION, DEVELOPMENTAL).Introns: Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.Neuropeptides: Peptides released by NEURONS as intercellular messengers. Many neuropeptides are also hormones released by non-neuronal cells.TailCilia: Populations of thin, motile processes found covering the surface of ciliates (CILIOPHORA) or the free surface of the cells making up ciliated EPITHELIUM. Each cilium arises from a basic granule in the superficial layer of CYTOPLASM. The movement of cilia propels ciliates through the liquid in which they live. The movement of cilia on a ciliated epithelium serves to propel a surface layer of mucus or fluid. (King & Stansfield, A Dictionary of Genetics, 4th ed)Chromosome Pairing: The alignment of CHROMOSOMES at homologous sequences.Protein Isoforms: Different forms of a protein that may be produced from different GENES, or from the same gene by ALTERNATIVE SPLICING.Galectins: A class of animal lectins that bind specifically to beta-galactoside in a calcium-independent manner. Members of this class are distiguished from other lectins by the presence of a conserved carbohydrate recognition domain. The majority of proteins in this class bind to sugar molecules in a sulfhydryl-dependent manner and are often referred to as S-type lectins, however this property is not required for membership in this class.Receptor, Insulin: A cell surface receptor for INSULIN. It comprises a tetramer of two alpha and two beta subunits which are derived from cleavage of a single precursor protein. The receptor contains an intrinsic TYROSINE KINASE domain that is located within the beta subunit. Activation of the receptor by INSULIN results in numerous metabolic changes including increased uptake of GLUCOSE into the liver, muscle, and ADIPOSE TISSUE.Ascaris suum: A species of parasitic nematode usually found in domestic pigs and a few other animals. Human infection can also occur, presumably as result of handling pig manure, and can lead to intestinal obstruction.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Mosaicism: The occurrence in an individual of two or more cell populations of different chromosomal constitutions, derived from a single ZYGOTE, as opposed to CHIMERISM in which the different cell populations are derived from more than one zygote.Cell Cycle Proteins: Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.Cell Nucleus: Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Axons: Nerve fibers that are capable of rapidly conducting impulses away from the neuron cell body.Spermatogenesis: The process of germ cell development in the male from the primordial germ cells, through SPERMATOGONIA; SPERMATOCYTES; SPERMATIDS; to the mature haploid SPERMATOZOA.Gene Components: The parts of the gene sequence that carry out the different functions of the GENES.Zygote: The fertilized OVUM resulting from the fusion of a male and a female gamete.Drosophila: A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.Biological Evolution: The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.Spindle Apparatus: A microtubule structure that forms during CELL DIVISION. It consists of two SPINDLE POLES, and sets of MICROTUBULES that may include the astral microtubules, the polar microtubules, and the kinetochore microtubules.Crosses, Genetic: Deliberate breeding of two different individuals that results in offspring that carry part of the genetic material of each parent. The parent organisms must be genetically compatible and may be from different varieties or closely related species.Mitosis: A type of CELL NUCLEUS division by means of which the two daughter nuclei normally receive identical complements of the number of CHROMOSOMES of the somatic cells of the species.Protein-Serine-Threonine Kinases: A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.Rhabditoidea: A superfamily of nematodes of the order RHABDITIDA. Characteristics include an open tube stoma and an excretory system with lateral canals.

Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family. (1/9183)

We have identified a new member of the TGF-beta superfamily, CET-1, from Caenorhabditis elegans, which is expressed in the ventral nerve cord and other neurons. cet-1 null mutants have shortened bodies and male tail abnormal phenotype resembling sma mutants, suggesting cet-1, sma-2, sma-3 and sma-4 share a common pathway. Overexpression experiments demonstrated that cet-1 function requires wild-type sma genes. Interestingly, CET-1 appears to affect body length in a dose-dependent manner. Heterozygotes for cet-1 displayed body lengths ranging between null mutant and wild type, and overexpression of CET-1 in wild-type worms elongated body length close to lon mutants. In male sensory ray patterning, lack of cet-1 function results in ray fusions. Epistasis analysis revealed that mab-21 lies downstream and is negatively regulated by the cet-1/sma pathway in the male tail. Our results show that cet-1 controls diverse biological processes during C. elegans development probably through different target genes.  (+info)

Alzheimer's disease: clues from flies and worms. (2/9183)

Presenilin mutations give rise to familial Alzheimer's disease and result in elevated production of amyloid beta peptide. Recent evidence that presenilins act in developmental signalling pathways may be the key to understanding how senile plaques, neurofibrillary tangles and apoptosis are all biochemically linked.  (+info)

Alterations in the conserved SL1 trans-spliced leader of Caenorhabditis elegans demonstrate flexibility in length and sequence requirements in vivo. (3/9183)

Approximately 70% of mRNAs in Caenorhabditis elegans are trans spliced to conserved 21- to 23-nucleotide leader RNAs. While the function of SL1, the major C. elegans trans-spliced leader, is unknown, SL1 RNA, which contains this leader, is essential for embryogenesis. Efforts to characterize in vivo requirements of the SL1 leader sequence have been severely constrained by the essential role of the corresponding DNA sequences in SL1 RNA transcription. We devised a heterologous expression system that circumvents this problem, making it possible to probe the length and sequence requirements of the SL1 leader without interfering with its transcription. We report that expression of SL1 from a U2 snRNA promoter rescues mutants lacking the SL1-encoding genes and that the essential embryonic function of SL1 is retained when approximately one-third of the leader sequence and/or the length of the leader is significantly altered. In contrast, although all mutant SL1 RNAs were well expressed, more severe alterations eliminate this essential embryonic function. The one non-rescuing mutant leader tested was never detected on messages, demonstrating that part of the leader sequence is essential for trans splicing in vivo. Thus, in spite of the high degree of SL1 sequence conservation, its length, primary sequence, and composition are not critical parameters of its essential embryonic function. However, particular nucleotides in the leader are essential for the in vivo function of the SL1 RNA, perhaps for its assembly into a functional snRNP or for the trans-splicing reaction.  (+info)

The Caenorhabditis elegans sex determination gene mog-1 encodes a member of the DEAH-Box protein family. (4/9183)

In the Caenorhabditis elegans hermaphrodite germ line, the sex-determining gene fem-3 is repressed posttranscriptionally to arrest spermatogenesis and permit oogenesis. This repression requires a cis-acting regulatory element in the fem-3 3' untranslated region; the FBF protein, which binds to this element; and at least six mog genes. In this paper, we report the molecular characterization of mog-1 as well as additional phenotypic characterization of this gene. The mog-1 gene encodes a member of the DEAH-box family. Three mog-1 alleles possess premature stop codons and are likely to be null alleles, and one is a missense mutation and is likely to retain residual activity. mog-1 mRNA is expressed in both germ line and somatic tissues and appears to be ubiquitous. The MOG-1 DEAH-box protein is most closely related to proteins essential for splicing in the yeast Saccharomyces cerevisiae, but splicing appears to occur normally in a mog-1-null mutant. In addition to its involvement in the sperm-oocyte switch and control of fem-3, zygotic mog-1 is required for robust germ line proliferation and for normal growth during development. We suggest that mog-1 plays a broader role in RNA regulation than previously considered.  (+info)

NMD3 encodes an essential cytoplasmic protein required for stable 60S ribosomal subunits in Saccharomyces cerevisiae. (5/9183)

A mutation in NMD3 was found to be lethal in the absence of XRN1, which encodes the major cytoplasmic exoribonuclease responsible for mRNA turnover. Molecular genetic analysis of NMD3 revealed that it is an essential gene required for stable 60S ribosomal subunits. Cells bearing a temperature-sensitive allele of NMD3 had decreased levels of 60S subunits at the nonpermissive temperature which resulted in the formation of half-mer polysomes. Pulse-chase analysis of rRNA biogenesis indicated that 25S rRNA was made and processed with kinetics similar to wild-type kinetics. However, the mature RNA was rapidly degraded, with a half-life of 4 min. Nmd3p fractionated as a cytoplasmic protein and sedimented in the position of free 60S subunits in sucrose gradients. These results suggest that Nmd3p is a cytoplasmic factor required for a late cytoplasmic assembly step of the 60S subunit but is not a ribosomal protein. Putative orthologs of Nmd3p exist in Drosophila, in nematodes, and in archaebacteria but not in eubacteria. The Nmd3 protein sequence does not contain readily recognizable motifs of known function. However, these proteins all have an amino-terminal domain containing four repeats of Cx2C, reminiscent of zinc-binding proteins, implicated in nucleic acid binding or protein oligomerization.  (+info)

The nuclear receptor superfamily has undergone extensive proliferation and diversification in nematodes. (6/9183)

The nuclear receptor (NR) superfamily is the most abundant class of transcriptional regulators encoded in the Caenorhabditis elegans genome, with >200 predicted genes revealed by the screens and analysis of genomic sequence reported here. This is the largest number of NR genes yet described from a single species, although our analysis of available genomic sequence from the related nematode Caenorhabditis briggsae indicates that it also has a large number. Existing data demonstrate expression for 25% of the C. elegans NR sequences. Sequence conservation and statistical arguments suggest that the majority represent functional genes. An analysis of these genes based on the DNA-binding domain motif revealed that several NR classes conserved in both vertebrates and insects are also represented among the nematode genes, consistent with the existence of ancient NR classes shared among most, and perhaps all, metazoans. Most of the nematode NR sequences, however, are distinct from those currently known in other phyla, and reveal a previously unobserved diversity within the NR superfamily. In C. elegans, extensive proliferation and diversification of NR sequences have occurred on chromosome V, accounting for > 50% of the predicted NR genes.  (+info)

Characterization of a mutant pancreatic eIF-2alpha kinase, PEK, and co-localization with somatostatin in islet delta cells. (7/9183)

Phosphorylation of eukaryotic translation initiation factor-2alpha (eIF-2alpha) is one of the key steps where protein synthesis is regulated in response to changes in environmental conditions. The phosphorylation is carried out in part by three distinct eIF-2alpha kinases including mammalian double-stranded RNA-dependent eIF-2alpha kinase (PKR) and heme-regulated inhibitor kinase (HRI), and yeast GCN2. We report the identification and characterization of a related kinase, PEK, which shares common features with other eIF-2alpha kinases including phosphorylation of eIF-2alpha in vitro. We show that human PEK is regulated by different mechanisms than PKR or HRI. In contrast to PKR or HRI, which are dependent on autophosphorylation for their kinase activity, a point mutation that replaced the conserved Lys-614 with an alanine completely abolished the eIF-2alpha kinase activity, whereas the mutant PEK was still autophosphorylated when expressed in Sf-9 cells. Northern blot analysis indicates that PEK mRNA was predominantly expressed in pancreas, though low expression was also present in several tissues. Consistent with the high levels of mRNA in pancreas, the PEK protein was only detected in human pancreatic islets, and the kinase co-localized with somatostatin, a pancreatic delta cell-specific hormone. Thus PEK is believed to play an important role in regulating protein synthesis in the pancreatic islet, especially in islet delta cells.  (+info)

Characterization of a Caenorhabditis elegans recA-like gene Ce-rdh-1 involved in meiotic recombination. (8/9183)

A recA-like gene was identified in the Caenorhabditis elegans genome project database. The putative product of the gene, termed Ce-rdh-1 (C. elegans RAD51 and DMC1/LIM15 homolog 1), consists of 357 amino acid residues. The predicted amino acid sequence of Ce-rdh-1 showed 46-60% identity to both RAD51 type and DMC1/LIM15 type genes in several eukaryote species. The results of RNAi (RNA-mediated interference) indicated that repression of Ce-rdh-1 blocked chromosome condensation of six bivalents and dissociation of chiasmata in oocytes of F1 progeny. Oogenesis did not proceed to the diakinesis stage. Accordingly, all the eggs produced (F2) died in early stages. These results suggest that Ce-rdh-1 participates in meiotic recombination.  (+info)

*Caenorhabditis elegans small RNAs

7-trimethylguanosine cap structures in Caenorhabditis elegans". BMC Molecular Biology. 8: 86. doi:10.1186/1471-2199-8-86. PMC ... Small RNAs (sRNAs) have been identified within the C. elegans genome and comparative genomics has shown that they are conserved ...

*Host microbe interactions in Caenorhabditis elegans

A database of behavioral and structural anatomy of Caenorhabditis elegans) WormBook (The online review of C. elegans biology). ... "Natural variation and population genetics of Caenorhabditis elegans (December 26, 2005), WormBook, ed. The C. elegans Research ... Caenorhabditis elegans-microbe interactions are here broadly defined and encompass the associations with all microbes that are ... Caenorhabditis elegans Gnotobiosis Microbiome in the Drosophila gut Microbiota Haber, M; Schüngel, M; Putz, A; Müller, S; ...

*History of research on Caenorhabditis elegans

The Nematode Caenorhabditis elegans. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory. pp. ix-xiii. ISBN 0-87969-307-X. ... The nematode worm Caenorhabditis elegans was first studied in the laboratory by Victor Nigon and Ellsworth Dougherty in the ... May 2014). "Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon". Nat. Methods. ... Six scientists have won the Nobel prize for their work on C. elegans. C. elegans was first described in 1900 by Émile Maupas, ...

*Brain

The nematode worm Caenorhabditis elegans, like Drosophila, has been studied largely because of its importance in genetics. In ... Hodgkin, J (2001). "Caenorhabditis elegans". In Brenner S, Miller JH. Encyclopedia of Genetics. Elsevier. pp. 251-256. ISBN 978 ... Ardiel, EL; Rankin, CH (2010). "An elegant mind: learning and memory in Caenorhabditis elegans". Learning and Memory. 17 (4): ... "WormBook: The online review of C. elegans biology". Retrieved 2011-10-14. Hobert, O (2005). The C. elegans Research Community, ...

*John Graham White

Caenorhabditis elegans. Wall chart". Science. 270 (5235): 415-430. doi:10.1126/science.270.5235.410. PMID 7569996. White, John ... Hyman, A. A.; White, J. G. (1987). "Determination of cell division axes in the early embryogenesis of Caenorhabditis elegans". ... Hird, S. N.; White, J. G. (1993). "Cortical and cytoplasmic flow polarity in early embryonic cells of Caenorhabditis elegans". ... Kimble, J. E.; White, J. G. (1981). "On the control of germ cell development in Caenorhabditis elegans". Developmental Biology ...

*Neuroanatomy

The nematode Caenorhabditis elegans has been studied because of its importance in genetics. In the early 1970s, Sydney Brenner ... Hodgkin, J (2001). "Caenorhabditis elegans". In Brenner S, Miller JH. Encyclopedia of Genetics. Elsevier. pp. 251-256. ISBN 978 ... elegans. Each of these has its own advantages and disadvantages as a model system. For example, the C. elegans nervous system ... "The Structure of the Nervous System of the Nematode Caenorhabditis elegans". Philosophical Transactions of the Royal Society B ...

*Developmental biology

Nematode: Caenorhabditis elegans. Good embryo supply. Well developed genetics. Low cost. Also popular for some purposes have ... Riddle, D.L., Blumenthal, T., Meyer, B.J. and Priess, J.R. (1997) C.elegans II. Cold Spring Harbor Laboratory Press, Cold ...

*MirGeneDB

Caenorhabditis elegans) • Large roundworm (Ascaris suum) Mollusca • Owl limpet (Lottia gigantea) • Pacific oyster (Crassostrea ...

*IMD domain

Caenorhabditis elegans M04F3.5 protein. The vertebrate IRSp53/MIM family is divided into two major groups: the IRSp53 subfamily ...

*MicroRNA

Decay of mature miRNAs in Caenorhabditis elegans is mediated by the 5´-to-3´ exoribonuclease XRN2, also known as Rat1p. In ... "The microRNAs of Caenorhabditis elegans". Genes Dev. 17 (8): 991-1008. doi:10.1101/gad.1074403. PMC 196042 . PMID 12672692. CS1 ... "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans". Science. 294 (5543): 858-62. Bibcode: ... "An extensive class of small RNAs in Caenorhabditis elegans". Science. 294 (5543): 862-4. Bibcode:2001Sci...294..862L. doi: ...

*Balancer chromosome

In one instance they were used to genetically screen a population of Caenorhabditis elegans. At this point in time scientists ... Herman, Robert K.; Albertson, Donna G.; Brenner, Sydney (1976-05-15). "Chromosome Rearrangements in Caenorhabditis Elegans". ...

*Presenilin

Smialowska A, Baumeister R (2006). "Presenilin function in Caenorhabditis elegans". Neurodegener Dis. 3 (4-5): 227-32. doi: ... The nematode worm C. elegans has two genes that resemble the presenilins and appear to be functionally similar, sel-12 and hop- ...

*2003 in science

Specimens of Caenorhabditis elegans survive. June 2 - The first European Mars mission Mars Express launched. September 27 - The ...

*Biology

Model organisms for developmental biology include the round worm Caenorhabditis elegans, the fruit fly Drosophila melanogaster ... "The genetics of Caenorhabditis elegans". Genetics. 77 (1): 71-94. PMC 1213120 . PMID 4366476. Sang, James H. (2001). " ...

*IMOD (software)

"Centriole assembly in Caenorhabditis elegans". Nature. 444: 619-623. doi:10.1038/nature05318. Marsh, Brad J.; Mastronarde, ...

*Mir-124 microRNA precursor family

"The microRNAs of Caenorhabditis elegans". Genes Dev. 17 (8): 991-1008. doi:10.1101/gad.1074403. PMC 196042 . PMID 12672692. ...

*Sex

Caenorhabditis Elegans: Development as Indiv. Cell", U.S. NIH, V. 21. Caenorhabditis. Alberts et al. (2002), "3. Mendelian ... doi:10.1111/j.1479-8298.2005.00118.x. Riddle, D. L.; Blumenthal, T.; Meyer, B. J.; Priess, J. R. (1997). C. Elegans II. Cold ... In the nematode C. elegans most worms are self-fertilizing XX hermaphrodites, but occasionally abnormalities in chromosome ... elegans has an hermaphrodite and a male sex (a system called androdioecy). Sometimes an organism's development is intermediate ...

*Crustacean neurohormone family

Caenorhabditis elegans uncharacterised protein ZC168.2. These neurohormones are peptides of 70 to 80 amino acid residues which ...

*SBDS

Caenorhabditis elegans hypothetical protein W06E11.4. Methanococcus jannaschii hypothetical protein MJ0592. This particular ... 2000). "Identification of novel human genes evolutionarily conserved in Caenorhabditis elegans by comparative proteomics". ...

*Equivalence group

In Caenorhabditis elegans self-fertilized eggs exit the body through the vulva. This organ develops from a subset of cell of an ... Kornfeld (1997). "Vulval development in Caenorhabditis elegans". Trends Genet. 13 (2): 55-61. doi:10.1016/S0168-9525(97)01005-6 ... Sternberg and Horvitz; Horvitz, HR (1986). "Pattern formation during vulval development in C. elegans". Cell. 44 (5): 761-72. ...

*UNC (biology)

... elegans screen'". www.cureffi.org. Retrieved 23 December 2016. Brenner, S (May 1974). "The genetics of Caenorhabditis elegans ... The term netrin was first used in a study done in 1990 in Caenorhabditis elegans and was called UNC-6. Studies performed on ... UNC is a set of proteins first identified through a set of screening tests in Caenorhabditis elegans, looking for roundworms ... There are three phases in hermaphrodite distal tip cell migration in Caenorhabditis elegans which are distinguished by the ...

*FERM domain

Caenorhabditis elegans protein phosphatase ptp-1. Chishti AH, Kim AC, Marfatia SM, Lutchman M, Hanspal M, Jindal H, Liu SC, Low ...

*Ageing

"Analysis of Aging in Caenorhabditis elegans". In Joel H. Rothman; Andrew Singson. Caenorhabditis Elegans: Cell Biology and ... "Glucose Restriction Extends Caenorhabditis elegans Life Span by Inducing Mitochondrial Respiration and Increasing Oxidative ... As of 2015 metformin was under study for its potential effect on slowing ageing in the worm C.elegans and the cricket. Its ... As of 2009[update], the record for lifespan extension in C. elegans is a single-gene mutation which increases adult survival by ...

*U4 spliceosomal RNA

Thomas, J; Lea K; Zucker-Aprison E; Blumenthal T (1990). "The spliceosomal snRNAs of Caenorhabditis elegans". Nucleic Acids Res ...

*Immunoglobulin C2-set domain

Chothia C, Teichmann SA (2000). "Immunoglobulin superfamily proteins in Caenorhabditis elegans". J. Mol. Biol. 296 (5): 1367-83 ...

*WIPI2

2000). "Identification of Novel Human Genes Evolutionarily Conserved in Caenorhabditis elegans by Comparative Proteomics". ...
1. Baldwin, J.G., Nadler, S.A., and Wall, D.H. 1997. Nematodes: Pervading the Earth and Linking all Life. Pp. 176-191. In: Raven, P.H. (ed.). National Academy Press, Washington, D.C. 625 pp.. 2. Bargmann, C. I. 1998. Neurobiology of the Caenorhabditis elegans genome. Science 282:2028-2033.. 3. Bargmann, C. I. And Mori, I. 1997. Chemotaxis and Thermotaxis. Pp. 717-737. In: Riddle, D.L., Blumenthal, T., Meyer, B.J. and Priess, J.R. (eds). C. elegans II. Cold Spring Harbor Laboratory Press, Plainview, NY 1222 pp.. 4. Bird, D.M. and Opperman, C. H. 1998. Caenorhabditis elegans. J. Nematol. 30:299-308.. 5. Bird, D.M., Opperman, C.H., Jones S.J.M., and Baillie, D.L. 1999. The Caenorhabditis elegans gemome: a guide in the post genomics age. Annu. Rev. Phytopathol. 37:247-265.. 6. Blaxter, M. 1998. Caenorhabditis elegans is a nematode. Science 282:2041-2046.. 7. Blaxter, M. and Bird, D. 1997. Parasitic nematodes. Pp. 851-878. In: Riddle, D.L., Blumenthal, T., Meyer, B.J. and Priess, J.R. (eds). C. ...
WormBase is an online biological database about the biology and genome of the nematode model organism Caenorhabditis elegans and contains information about other related nematodes. WormBase is used by the C. elegans research community both as an information resource and as a place to publish and distribute their results. The database is regularly updated with new versions being released every two months. WormBase is one of the organizations participating in the Generic Model Organism Database (GMOD) project. WormBase comprises the following main data sets: The annotated genomes of Caenorhabditis elegans, Caenorhabditis briggsae, Caenorhabditis remanei, Caenorhabditis brenneri, Caenorhabditis angaria, Pristionchus pacificus, Haemonchus contortus, Meloidogyne hapla, Meloidogyne incognita, Brugia malayi and Onchocerca volvulus; Hand-curated annotations describing the function of ~20,500 C. elegans protein-coding genes and ~16,000 C. elegans non-coding genes; Gene families; Orthologies; Genomic ...
The molecular mechanisms underlying muscle atrophy during spaceflight are not well understood. We have analyzed the effects of a 10-day spaceflight on Caenorhabditis elegans muscle development. DNA microarray, real-time quantitative PCR, and quantitative western blot analyses revealed that the amount of MHC in both body-wall and pharyngeal muscle decrease in response to spaceflight. Decreased transcription of the body-wall myogenic transcription factor HLH-1 (CeMyoD) and of the three pharyngeal myogenic transcription factors, PEB-1, CEH-22 and PHA-4 were also observed. Upon return to Earth animals displayed reduced rates of movement, indicating a functional defect. These results demonstrate that C. elegans muscle development is altered in response to spaceflight. This altered development occurs at the level of gene transcription and was observed in the presence of innervation, not simply in isolated cells. This important finding coupled with past observations of decreased levels of the same ...
The nematode worm Caenorhabditis elegans is a model system for the study of the genetic basis of aging. Maternal-effect mutations in four genes-clk-1, clk-2, clk-3, and gro-1- interact genetically to determine both the duration of development and life-span. Analysis of the phenotypes of these mutants suggests the existence of a general physiological clock in the worm. Mutations in certain genes involved in dauer formation (an alternative larval stage induced by adverse conditions in which development is arrested) can also extend life-span, but the life extension of Clock mutants appears to be independent of these genes. The daf-2(e1370) clk-1(e2519) worms, which carry life-span-extending mutations from two different pathways, live nearly five times as long as wild-type worms.. ...
The germ cells of multicellular organisms protect their developmental potential through specialized mechanisms. A shared feature of germ cells from worms to humans is the presence of nonmembrane-bound, ribonucleoprotein organelles called germ granules. Depletion of germ granules in Caenorhabditis elegans (i.e., P granules) leads to sterility and, in some germlines, expression of the neuronal transgene unc-119::gfp and the muscle myosin MYO-3. Thus, P granules are hypothesized to maintain germ cell totipotency by preventing somatic development, although the mechanism by which P granules carry out this function is unknown. In this study, we performed transcriptome and single molecule RNA-FISH analyses of dissected P granule-depleted gonads at different developmental stages. Our results demonstrate that P granules are necessary for adult germ cells to downregulate spermatogenesis RNAs and to prevent the accumulation of numerous soma-specific RNAs. P granule-depleted gonads that express the ...
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94.. Chitwood, B. G., and Chitwood, M. B. (1974). Introduction to Nematology. University Park Press, Baltimore.. Hodgkin, J. A. (1974). Genetic and Anatomical Aspects of the Caenorhabditis elegans Male, Ph.D. thesis. University of Cambridge, Cambridge, England.. Hodgkin, J. A., and Brenner, S. (1977). Mutations causing transformation of sexual phenotype in the nematode Caenorhabditis elegans. Genetics 86, 275-287.. Kimble, J., and Hirsh, D. (1979). The Postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans. Develop. Biol. 70, 396-417.. Klass, M., Wolf, N., and Hirsh, D. (1976). Development of the male reproductive system and sexual transformation in the nematode Caenorhabditis elegans. Develop. Biol. 52, 1-18.. Seligman, I. M., Filshie, B. K., Doy, F. A., and Crossley, A. C. (1975). Hormonal control of mor-phogenetic cell death of the wing hypodermis in Lucilia cuprina. Tissue Cell ...
Defining a behavior that requires the function of specific neurons in the free-living nematode Caenorhabditis elegans can allow one to screen for mutations that disrupt the specification or function of those neurons. We identified serotonin-immunoreactive neurons required for tail curling or turnin …
Mouse mAb M38 was used in indirect immunofluorescence experiments to detect a stage-specific antigen on the surface of the first larval stage (L1) of the free-living nematode Caenorhabditis elegans, and to detect alterations in the apparent expression of this antigen in two distinct classes of C. elegans mutants. In previously described srf-2 and srf-3 mutants (Politz S. M., M. T. Philipp, M. Estevez, P.J. OBrien, and K. J. Chin. 1990. Proc. Natl. Acad. Sci. USA. 87:2901-2905), the antigen is not detected on the surface of any stage. Conversely, in srf-(yj43) and other similar mutants, the antigen is expressed on the surface of the first through the fourth (L4) larval stages. To understand the molecular basis of these alterations, the antigen was characterized in gel immunoblotting experiments. After SDS-PAGE separation and transfer to nitrocellulose, M38 detected a protein antigen in extracts of wild-type L1 populations. The antigen was sensitive to digestion by Pronase and O-glycanase ...
P-glycoproteins can cause multidrug resistance in mammalian tumor cells by active extrusion of cytotoxic drugs. The natural function of these evolutionarily conserved, membrane-bound ATP binding transport proteins is unknown. In mammals, P-glycoproteins are abundantly present in organs associated with the digestive tract. We have studied the tissue-specific expression of Caenorhabditis elegans P-glycoprotein genes pgp-1 and pgp-3 by transformation of nematodes with pgp-lacZ gene fusion constructs in which the promoter area of the pgp genes was fused to the coding region of lacZ. Expression of pgp-1 and pgp-3, as inferred from pgp-lacZ transgenic nematodes, was confined to the intestinal cells. The expression patterns of both genes were virtually indistinguishable. Quantitative analysis of pgp mRNA levels during development showed that pgp-1, -2, and -3 were expressed throughout the life cycle of C.elegans, albeit with some variation indicating developmental regulation. The expression of P-glycoprotein
rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:bibo="http://purl.org/ontology/bibo/" xmlns:dspace="http://digital-repositories.org/ontologies/dspace/0.1.0#" xmlns:foaf="http://xmlns.com/foaf/0.1/" xmlns:void="http://rdfs.org/ns/void#" xmlns:xsd="http://www.w3.org/2001/XMLSchema#" , ,rdf:Description rdf:about="https://kops.uni-konstanz.de/rdf/resource/123456789/34900", ,bibo:uri rdf:resource="https://kops.uni-konstanz.de/handle/123456789/34900"/, ,dc:creator,Deehan, Kevin,/dc:creator, ,dc:creator,Wilson, Kristy J.,/dc:creator, ,dc:language,eng,/dc:language, ,dcterms:abstract xml:lang="eng",UNC-89 is a giant polypeptide located at the sarcomeric M-line of Caenorhabditis elegans muscle. The human homologue is obscurin. To understand how UNC-89 is localized and functions, we have been identifying its binding partners. Screening a yeast two-hybrid library revealed that UNC-89 interacts with ...
Ninety-five mutants of the nematode Caenorhabditis elegans altered in the cell lineages of the vulva have been isolated on the basis of their displaying one of two phenotypes, Vulvaless or Multivulva. In Vulvaless mutants, which define 12 genes, no vulva is present. In Multivulva mutants, which define ten genes, one or more supernumerary vulva-like protrusions are located along the ventral side of the animal. A single recessive mutation is responsible for the phenotypes of most, but not all, of these strains. Fifteen of these 22 genes are represented by multiple alleles. We have shown by a variety of genetic criteria that mutations that result in a Vulvaless or Multivulva phenotype in six of the 22 genes most likely eliminate gene function. In addition, Vulvaless or Multivulva mutations in seven of the other genes most likely result in a partial reduction of gene function; the absence of the activity of any of these genes probably results in lethality or sterility. Our results suggest that we ...
As a consequence of the Earths axial rotation, organisms display daily recurring rhythms in behavior and biochemical properties, such as hormone titers. The neuronal system controlling such changes is best studied in the fruit fly Drosophila melanogaster. In the nematode worm Caenorhabditis elegans, most homologs of these genes function in the heterochronic pathway controlling the (timing of) developmental events. Recent data indicate that in the worm at least one of the genes involved in developmental timing is also active in circadian rhythm control, thereby opening up new perspectives on a central (neuronal) timer interfering with many processes. Also, new neuropeptidergic clock homologs have been identified in nematodes, supporting the idea of a broad range of clock-regulated targets. We will describe the current knowledge on homologous clock genes in C. elegans with a focus on the recently discovered pigment dispersing factor gene homologs. Similarities between developmental and daily ...
The pace of technical developments allowing the direct manipulation of genome sequences has seen a marked acceleration in recent years with the emergence of RNA-targeted nucleases derived from bacterial immune systems (Doudna and Charpentier 2014; Zetsche et al. 2015). In particular, the binary system relying on the Streptococcus pyogenes Cas9 endonuclease targeted by CRISPR (clustered, regularly interspaced, short, palindromic repeat) RNAs has been successfully used to generate point mutations, deletion, or DNA insertions in an ever-growing number of experimental systems. S. pyogenes CRISPR/Cas9 has been adapted early on in the model nematode Caenorhabditis elegans (Friedland et al. 2013; Dickinson et al. 2013; Chen et al. 2013; Frøkjær-Jensen 2013; Dickinson and Goldstein 2016). Previously, heritable genome engineering could only be achieved in C. elegans by remobilizing a Drosophila Mos1 transposon, which could be inserted and excised in the germline (Robert and Bessereau 2007; ...
The vaccinia-related kinases (VRKs) are highly conserved throughout the animal kingdom and phosphorylate several chromatin proteins and transcription factors. In early Caenorhabditis elegans embryos, VRK-1 is required for proper nuclear envelope formation. In this work, we present the first investigation of the developmental role of VRKs by means of a novel C. elegans vrk-1 mutant allele. We found that VRK-1 is essential in hermaphrodites for formation of the vulva, uterus, and utse and for development and maintenance of the somatic gonad and thus the germ line. VRK-1 regulates anchor cell polarity and the timing of anchor cell invasion through the basement membranes separating vulval and somatic gonadal cells during the L3 larval stage. VRK-1 is also required for proper specification and proliferation of uterine cells and sex myoblasts. Expression of the fibroblast growth factor-like protein EGL-17 and its receptor EGL-15 is reduced in vrk-1 mutants, suggesting that VRK-1 might act at least ...
Mutations in the gene unc-53 of Caenorhabditis elegans result in behavioral and anatomical abnormalities. Immunocytochemistry and electron microscopy revealed neuroanatomical defects in all main longitudinal nervous tracts. Whole tracts were found to
Large-conductance calcium and voltage-activated potassium channels, termed SLO-1 (or BK), are pivotal players in the regulation of cell excitability across the animal phyla. Furthermore, emerging evidence indicates that these channels are key mediators of a number of neuroactive drugs, including the most recent new anthelmintic, the cyclo-octadepsipeptide emodepside. Detailed reviews of the structure, function and pharmacology of BK channels have recently been provided (Salkoff et al. in Nat Rev Neurosci 7:921-931, 2006; Ghatta et al. in Pharmacol Ther 110:103-116, 2006) and therefore these aspects will only briefly be covered here. The purpose of this review is to discuss how SLO-1 channels might function as regulators of neural transmission and network activity. In particular, we focus on the role of SLO-1 in the regulation of Caenorhabditis elegans behaviour and highlight the role of this channel as an effector for pleiotropic actions of neuroactive drugs, including emodepside. On the premise ...
Microsporidia comprise a phylum of obligate intracellular pathogens related to fungi that infect virtually all animals. Recently, the nematode Caenorhabditis elegans has been developed as a convenient model for studying microsporidia infection in a whole-animal host through the identification and characterization of a natural microsporidian pathogen of this commonly studied laboratory organism. The C. elegans natural microsporidian pathogen is named Nematocida parisii, and it causes a lethal intestinal infection in C. elegans. Comparison of the genomes of N. parisii and its closely related species Nematocida sp. 1, together with the genomes of other microsporidian species, has provided insight into the evolutionary events that led to the emergence of the large, specialized microsporidia phylum. Cell biology studies of N. parisii infection in C. elegans have shown how N. parisii restructures host intestinal cells and, in particular, how it hijacks host exocytosis for nonlytic exit to facilitate
RNA interference (RNAi) is a widespread and widely exploited phenomenon which has potential as a strategy for both the treatment of disease and pest control. RNAi results in down‐regulation of a specific gene in response to the production of small interfering RNAs (siRNAs). RNAi is one of a family of processes mediated by small non‐coding RNAs [1], [2]. In Caenorhabditis elegans, and in a number of other organisms, RNAi is systemic so that the introduction of dsRNA into one tissue triggers gene silencing in other tissues [3], [4], [5], [6], [7]. Furthermore, systemic RNAi enables C. elegans and other organisms to exhibit environmental RNAi [5]. For example, feeding C. elegans on bacteria expressing dsRNA initiates a widespread RNAi response [8], [9]. Studies in C. elegans and other organisms have provided mechanistic insights into RNAi [4], [10], [11], [12], [13], although the role of exogenous RNAi in the normal life of C. elegans and other animals remains unclear [14].. Whilst C. elegans ...
During the course of normal embryonic and post-embryonic development, 131 cells in a Caenorhabditis elegans hermaphrodite undergo programmed cell death. Loss of function mutations in either of the genes ced-3 or ced-4 abolish cell deaths, enabling these undead cells to survive and be incorporated into the adult with no obvious deleterious consequences. Ultrastructural reconstructions have shown that undead cells exhibit many differentiated characteristics. Most of the reconstructed cells appeared to be neurons with all the characteristic features associated with such cells, such as processes, synaptic vesicles and presynaptic specializations. However, clear morphological differences were seen among the undead neurons, suggesting a diversity of cell type. One of the reconstructed cells was a rectal epithelial cell, which had displaced its lineal sister that normally functions in this role. Removal of the ability to undergo programmed cell death by mutation therefore reveals a diversity of ...
We are studying the development of the intestine in the small free-living nematode worm Caenorhabditis elegans. The worm intestine develops as a simple clone of cells, entirely deriving from a single cell in the eight-cell embryo. We mainly focus on the transcription factor network that drives development of the intestine. From our work and that of others, we now know all the core transcription factors that control intestinal genes, from specification to differentiation, and they all are "GATA factors" similar to the factors that are central to the development of the human intestine. We are now trying to figure out how these factors actually work, i.e. to define the molecular and thermodynamic basis of developmental specificity. Does all the specificity reside in the DNA binding domain? And if so, how much does the binding free energy to an intestinal gene differ from the binding free energy to a gene expressed in a different lineage, e.g. the hypodermis (skin)? Are there other protein domains ...
LAG1 is a longevity gene, the first such gene to be identified and cloned from the yeast Saccharomyces cerevisiae. A close homolog of this gene, which we call LAC1, has been found in the yeast genome. We have cloned the human homolog of LAG1 with the ultimate goal of examining its possible function in human aging. In the process, we have also cloned a homolog from the nematode worm Caenorhabditis elegans. Both of these homologs, LAG1Hs and LAG1Ce-1, functionally complemented the lethality of a lag1delta lac1delta double deletion, despite low overall sequence similarity to the yeast proteins. The proteins shared a short sequence, the Lag1 motif, and a similar transmembrane domain profile. Another, more distant human homolog, TRAM, which lacks this motif, did not complement. LAG1Hs also restored the life span of the double deletion, demonstrating that it functions in establishing the longevity phenotype in yeast. LAG1Hs mapped to 19p12, and it was expressed in only three tissues: brain, skeletal ...
Caenorhabditis elegans MIG-13 protein: required for positioning of Q neuroblasts and their descendents along the anteroposterior axis; isolated from Caenorhabditis elegans; amino acid sequence in first source; GenBAnk AF150958
For the first days, we will introduce students to the nematode C. elegans. Students will work with different experimental set-ups that will allow us to explore a variety of C. elegans behavior. We will analyze C. elegans behavior in response to thermal, mechanical and chemical stimuli. The transparency of the animal makes it feasible to use genetically encoded calcium sensors to monitor neural activity in response to sensory stimuli. Transgenic expression of light-activated ion channels, allows us to turn neurons on and off. These optogenetic experiments will be used to define neural requirements of sensory processing. Students will use these techniques to determine 1) how C. elegans responds and remembers the temperature at which was raised; 2) analyze the neural dynamics of a compound motor sequence that is evoked by touch; 3) determine the neural requirements of calcium channels chemosensation. These experiments are an ideal introduction to Calcium imaging optogenetics in a genetically ...
Caenorhabditis elegans shares several molecular and physiological homologies with humans and thus plays a key role in studying biological processes. As a consequence, much progress has been made in automating the analysis of C. elegans. However, there is still a strong need to achieve more progress in automating the analysis of static images of adult worms. In this paper, a three-phase semi-automated system has been proposed. As a first phase, a novel segmentation framework, based on variational level sets and local pressure force function, has been introduced to handle effectively images corrupted with intensity inhomogeneity. Then, a set of robust invariant symbolic features for high-throughput screening of image-based C. elegans phenotypes are extracted. Finally, a classification model is applied to discriminate between the different subsets. The proposed system demonstrates its effectiveness in measuring morphological phenotypes in individual worms of C. elegans.. ...
A specific behavioural response of Caenorhabditis elegans, the rapid increase of locomotion in response to anoxia/reoxygenation called the O2-ON response, has been used to model key aspects of ischaemia/reperfusion injury. A genetic suppressor screen demonstrated a direct causal role of CYP (cytochrome P450)-13A12 in this response and suggested that CYP-eicosanoids, which in mammals influence the contractility of cardiomyocytes and vascular smooth muscle cells, might function in C. elegans as specific regulators of the body muscle cell activity. In the present study we show that co-expression of CYP-13A12 with the NADPH-CYP-reductase EMB-8 in insect cells resulted in the reconstitution of an active microsomal mono-oxygenase system that metabolized EPA (eicosapentaenoic acid) and also AA (arachidonic acid) to specific sets of regioisomeric epoxy and hydroxy derivatives. The main products included 17,18-EEQ (17,18-epoxyeicosatetraenoic acid) from EPA and 14,15-EET (14,15-epoxyeicosatrienoic acid) ...
Benzimidazole anti-microtubule drugs, such as benomyl, induce paralysis and slow the growth of the nematode Caenorhabditis elegans. We have identified 28 mutations in C. elegans that confer resistance to benzimidazoles. All resistant mutations map to a single locus, ben-1. Virtually all these mutations are genetically dominant. Molecular cloning and DNA sequence analysis established that ben-1 encodes a beta-tubulin. Some resistant mutants are completely deleted for the ben-1 gene. Since the deletion strains appear to be fully resistant to the drugs, the ben-1 product appears to be the only benzimidazole-sensitive beta-tubulin in C. elegans. Furthermore, since animals lacking ben-1 are viable and coordinated, the ben-1 beta-tubulin appears to be nonessential for growth and movement. The ben-1 function is likely to be redundant in the nematode genome. ...
Approximately 10% of Caenorhabditis elegans nervous system synapses are electrical, that is, gap junctions composed of innexins. The locomotory nervous system consists of several pairs of interneurons and three major classes of motor neurons, all with stereotypical patterns of connectivity that include gap junctions. Mutations in the two innexin genes unc-7 and unc-9 result in identical uncoordinated movement phenotypes, and their respective gene products were investigated for their contribution to electrical synapse connectivity. unc-7 encodes three innexin isoforms. Two of these, UNC-7S and UNC-7SR, are functionally equivalent and play an essential role in coordinated locomotion. UNC-7S and UNC-7SR are widely expressed and co-localize extensively with green fluorescent protein-tagged innexin UNC-9 in the ventral and dorsal nerve cords. A subset of UNC-7S/SR expression visualizes gap junctions formed between the AVB forward command interneurons and their B class motor neuron partners. Experiments
Many crucial events in metazoan development and physiology are governed by diffusible signals that trigger specific responses in highly restricted subsets of cells. This exquisite specificity of intercellular signaling requires precisely controlled expression of receptors and downstream signaling components that effect appropriate responses. The nematode Caenorhabditis elegans has proven a valuable model for the study of signaling specificity, notably for mechanisms of signaling through the Epidermal growth factor (EGF) receptor (for a review, see Moghal and Sternberg, 2003). The sole EGF-like ligand and EGF receptor in the C. elegans genome are encoded by the genes lin-3 and let-23, respectively (Hill and Sternberg, 1992; Aroian et al., 1990) (Wormbase WS210). Recently we described a role for LET-23 in the regulation of C. elegans behavior (Van Buskirk and Sternberg, 2007). Caenorhabditis elegans develops through four larval stages before adulthood, and each larval molt is preceded by ...
C. elegans worms. Light microscopy of Caenorhabditis elegans worms. This is a soil-dwelling hermaphrodite nematode worm and one of the most studied animals in biological and genetic research. A tendency to reproduce by self-fertilisation (resulting in identical offspring), along with the short time taken to reach maturity, make this tiny worm an ideal subject. - Stock Video Clip K002/8244
Fig. 7 Two-dimensional plot of track curvature versus centroid velocity.. In the drug environment, the worm is classified as active, semiactive, or inactive as demonstrated in Fig. 4, and the plot is accordingly segregated into the three areas of activity. We are primarily interested in combinations that induce inactivity in the worm. (A) In iteration 1, two combinations (that is, P1 and T3) are able to make the worm inactive. Besides in P3, the active worm does not succumb to any other combination and is classified as being active. (B) In iteration 2, only P1 makes the worm inactive. The rest of the combinations do not seem to affect the active worm. (C) In iteration 3, the worm is in a semiactive or active state for all combinations. (D) In iteration 4, three combinations (T1, T2, and T3) are able to make the worm inactive, and the winning combination is chosen as T3. ...
Normal locomotion of the nematode Caenorhabditis elegans requires transmission of contractile force through a series of mechanical linkages from the myofibrillar lattice of the body wall muscles, across an intervening extracellular matrix and epithel
Gene expression is regulated at multiple levels, including transcription and translation, as well as mRNA and protein stability. Although systems-level functions of transcription factors and microRNAs are rapidly being characterized, few studies have focused on the posttranscriptional gene regulation by RNA binding proteins (RBPs). RBPs are important to many aspects of gene regulation. Thus, it is essential to know which genes encode RBPs, which RBPs regulate which gene(s), and how RBP genes are themselves regulated. Here we provide a comprehensive compendium of RBPs from the nematode Caenorhabditis elegans (wRBP1.0). We predict that as many as 887 (4.4%) of C. elegans genes may encode RBPs ~250 of which likely function in a gene-specific manner. In addition, we find that RBPs, and most notably gene-specific RBPs, are themselves enriched for binding and modification by regulatory proteins, indicating the potential for extensive regulation of RBPs at many different levels. wRBP1.0 will provide a
Strains. Nematodes were grown at 20°C under standard conditions that included uncrowded conditions and the presence of ample food (the Escherichia coli strain OP50). Wild-type nematodes were C. elegans strain N2. Mutant strains were obtained from the Caenorhabditis Genetic Center.. cDNA clones and expression constructs. Using degenerate oligonucleotide primers designed to amplify conserved regions of ionotropic glutamate receptors, we amplified DNA fragments from first-strand mixed-stage C. elegans cDNA that encoded portions of glr-3 and glr-5. These partial gene products were used to screen cDNA libraries at high stringency. After screening ∼106 clones, we obtained several partial cDNAs for each gene, indicating that mRNA encoding these glutamate receptor subunits is present at relatively low levels. Hence, we were unable to isolate full-length cDNAs using this approach. We also searched the published C. elegans genome for genes related in sequence to glr-1, glr-3, andglr-5 and identified ...
A genetic screen for Caenorhabditis elegans mutants with enhanced susceptibility to killing by Pseudomonas aeruginosaled to the identification of two genes required for pathogen resistance: sek-1, which encodes a mitogen-activated protein (MAP) kinase kinase, and nsy-1, which encodes a MAP kinase kinase kinase. RNA interference assays and biochemical analysis established that a p38 ortholog, pmk-1, functions as the downstream MAP kinase required for pathogen defense. These data suggest that this MAP kinase signaling cassette represents an ancient feature of innate immune responses in evolutionarily diverse species. ...
Members of the Hox gene family encode transcription factors that specify positional identity along the anterior-posterior axis of nearly all metazoans. One among the Caenorhabditis elegans Hox genes is egl-5. A deletion allele of egl-5 was isolated in a screen for animals which fail to develop swollen tails when exposed to the bacterial pathogen Microbacterium nematophilum. We show that compromised rectal development, which occurs as a result of loss of egl-5 function, results in a failure of rectal epithelial cells to express the ERK MAP kinase mpk-1, which was previously shown to mediate tail-swelling in response to bacterial infection. Tissue-specific rescue experiments demonstrated that egl-5 and mpk-1 act autonomously in rectal cells in the morphological response. The weak egl-5 allele (n1439), which does not compromise rectal development, fails to affect tail-swelling. We find that this allele carries an inserted repeat element approximately 13.8 kb upstream of the egl-5 open reading frame, which
Buy or Rent Caenorhabditis elegans: Modern Biological Analysis of an Organism: Caenorhibditus Elegans: Modern Biological Analysis of an Organism as an eTextbook and get instant access. With VitalSource, you can save up to 80% compared to print.
Caenorhabditis elegans offers an array of advantages to investigate the roles of uptake transporters. Herein, an epifluorescent microscopy approach was developed to monitor the uptake of the autofluorescent anticancer drug, doxorubicin, into the pharynx of C. elegans by organic cation transporters.
Abstract. Studies of the molecular mechanisms that are involved in stress responses (environmental or physiological) have long been used to make links to disease states in humans. The nematode model organism, Caenorhabditis elegans, undergoes a state of hypometabolism called the dauer stage. This period of developmental arrest is characterized by a significant reduction in metabolic rate, triggered by ambient temperature increase and restricted oxygen/ nutrients. C. elegans employs a number of signal transduction cascades in order to adapt to these unfavourable conditions and survive for long times with severely reduced energy production. The suppression of cellular metabolism, providing energetic homeostasis, is critical to the survival of nematodes through the dauer period. This transition displays molecular mechanisms that are fundamental to control of hypometabolism across the animal kingdom. In general, mammalian systems are highly inelastic to environmental stresses (such as extreme ...
Cytoskeletal regulation is important in cell migration. The Caenorhabditis elegans gonadal distal tip cells (DTCs) offer a simple model with which to investigate the mechanism of cell migration in organogenesis. Here, we report that one of the spectraplakin isoforms, VAB-10B1, plays an essential role in cell and nuclear migration of DTCs by regulating the actin and microtubule (MT) cytoskeleton. In the vab-10(tk27) mutant, which lacks VAB-10B1, alignment of filamentous (F)-actin and MTs was weakly and severely disorganized, respectively, which resulted in a failure to translocate the DTC nucleus and a premature termination of DTC migration. An MT growing-tip marker, EBP-2-GFP, revealed that polarized outgrowth of MTs towards the nuclei of migrating DTCs was strikingly impaired in tk27 animals. A vab-10 mini-gene encoding only the actin- and MT-binding domains significantly rescued the gonadal defects, suggesting that VAB-10B1 has a role in linking actin and MT filaments. These results suggest ...
TY - JOUR. T1 - Cis-regulatory mechanisms of gene expression in an olfactory neuron type in Caenorhabditis elegans. AU - Nokes, Eva B.. AU - Van Der Linden, Alexander M.. AU - Winslow, Caron. AU - Mukhopadhyay, Saikat. AU - Ma, Kristin. AU - Sengupta, Piali. PY - 2009/12. Y1 - 2009/12. N2 - The generation of cellular diversity is dependent on the precise spatiotemporal regulation of gene expression by both cis- and trans-acting mechanisms. The developmental principles regulating expression of specific gene subsets in individual cell types are not fully understood. Here we define the cis-regulatory mechanisms driving expression of cell-selective and broadly expressed genes in vivo in the AWB olfactory neuron subtype in C. elegans. We identify an element that is necessary to drive expression of neuron-selective chemoreceptor genes in the AWB neurons, and show that this element functions in a context-dependent manner. We find that the expression of broadly expressed sensory neuronal genes in the ...
To survive, animals must properly sense their surrounding environment. The types of sensation that allow for detecting these changes can be categorized as tactile, thermal, aural, or olfactory. Olfaction is one of the most primitive senses, involving the detection of environmental chemical cues. Organisms must sense and discriminate between abiotic and biogenic cues, necessitating a system that can react and respond to changes quickly. The nematode, Caenorhabditis elegans, offers a unique set of tools for studying the biology of olfactory sensation.The olfactory system in C. elegans is comprised of 14 pairs of amphid neurons in the head and two pairs of phasmid neurons in the tail. The male nervous system contains an additional 89 neurons, many of which are exposed to the environment and contribute to olfaction. The cues sensed by these olfactory neurons initiate a multitude of responses, ranging from developmental changes to behavioral responses. Environmental cues might initiate entry into or exit
A search of the C. elegans genome for potential homologues of the yeast MEN/SIN genes revealed several candidate genes, although for some of these genes the sequence similarities were only limited and for TEM1, CDC15, and BFA1 no putative homologues could be identified (Table I). All candidate genes were tested in C. elegans for a possible function in a hypothetical MEN/SIN-like regulatory network, using RNAi to deplete the corresponding products. For depletion of putative MEN/SIN gene products, both RNAi feeding and injection methods (Montgomery and Fire, 1998; Timmons et al., 2001) were tried to maximize the probability of functional inactivation. The results of these experiments are summarized in Table I. A priori, we had expected that depletion of a gene product required for the regulation of mitotic exit or the onset of cytokinesis should result in embryonic lethality. However, of all components tested, only the depletion of the C. elegans homologue of the budding yeast Cdc14p phosphatase ...
Because C. elegans chromosomes are holocentric and lack centromeric heterochromatin, HP1 proteins are dispensable for chromosome segregation and mitotic viability in this organism [23, 25]. We have exploited this fact to examine in detail the role of one of the C. elegans HP1 homologues, HPL-2, in regulating developmental pathways of gene expression, a second physiological function ascribed to heterochromatin. By comparing the effects of hpl-2 deletion at different stages of development, we have shed light on a novel role for this HP1 family member in dauer diapause, longevity and lipid metabolism. These three processes have in common an extremely tight response to environmental factors. Thus, our data link a response to environmental factors to the epigenetic regulator HPL-2. At least some of the genes identified in this study are shown by CHIP-on chip to be bound by HPL-2, and are therefore likely to represent direct targets.. We show that hpl-2 plays a role in the choice between dauer and ...
Parkinsons disease (PD) is a neurodegenerative disorder with symptoms that progressively worsen with age. Pathologically, PD is characterized by the aggregation of α-synuclein in cells of the substantia nigra in the brain and loss of dopaminergic neurons. This pathology is associated with impaired movement and reduced cognitive function. The etiology of PD can be attributed to a combination of environmental and genetic factors. A popular animal model, the nematode roundworm Caenorhabditis elegans, has been frequently used to study the role of genetic and environmental factors in the molecular pathology and behavioral phenotypes associated with PD. The current review summarizes cellular markers and behavioral phenotypes in transgenic and toxin-induced PD models of C. elegans.
gi,17559712,ref,NP_506256.1, CaDHerin family member (cdh-6) [Caenorhabditis elegans] gi,7499172,pir,,T20968 hypothetical protein F15B9.7 - Caenorhabditis elegans gi,3875964,emb,CAB01427.1, Hypothetical protein F15B9.7 [Caenorhabditis elegans] gi,3880568,emb,CAB01449.1, C. elegans CDH-6 protein (corresponding sequence F15B9.7) [Caenorhabditis elegans ...
ALBERTSON, D. G., and J. N. THOMSON. 1976. The pharynx of Caenorhabditis elegans. Philos. Trans. R. Soc. London, Ser. B, 275: 299-325.. ANDERSON, R. V., and J. R. BYERS. 1975. Ultrastructure of the esophageal procorpus in the plant parasite nematode, Tylenchorhynchus dubius, and functional aspects in relation to feeding. Can. J. Zool. 53: 1581-1595. BALDWIN, J. G., H. HIRSCHMANN, and A. C. TRIANTAPHYL-LOU. 1977. Comparative fine structure of the esophagus of males of Heterodera glycines and Meloidogyne incognita. Nematologica, 23: 239-252. COOMANS, A. 1963. Stoma structure in members of the dorylaimina. Nematologica, 9: 587-601. COOMANS, A., L. DE CONINCK, and C. HEIP. 1978. Round table discussions: first workshop on systematics of marine free-living nematodes. Ann. Soc. Zool. Belg. 108:109-113. DE CONINCK, L. 1965. Structures cephalique and Appareil digestif, cavite buccale. In Traite de zoologie. Edited ...
Measurements of interference entail a comparison of the product of individual two-point recombination frequencies between markers with the corresponding double-crossover frequency. We used standard genetic crosses to measure the frequency of single and multiple crossover events. Because C. elegans is a hermaphroditic species, we assayed frequencies in hermaphrodite oogenesis, male spermatogenesis, and in an aggregate measure that combines hermaphrodite spermatogenesis and oogenesis (Figure 1, B, C, and E, respectively).. Figure 1B presents the set of results observed in oogenesis. The observed oocyte two-factor recombination frequencies in our experiments were 13.1% [in agreement with results reported by Hammarlund et al. (2005)] and 36.2%, respectively, for the unc-60(e723)-to-dpy-11(e224) (interval L) and dpy-11(e224)-to-rol-9(sc148) (interval R) intervals (95% C.I.s, 10.3%-16.42% and 31.9%-40.6%, respectively) (Clopper and Pearson 1934). In the absence of crossover interference, one would ...
Pun, P.B.L., Gruber, J., Tang, S.Y., Ng, L.F., Cheah, I., Halliwell, B., Ong, R.L.S., Fong, S. (2010). Ageing in nematodes: Do antioxidants extend lifespan in Caenorhabditis elegans?. Biogerontology 11 (1) : 17-30. [email protected] Repository. https://doi.org/10.1007/s10522-009-9223- ...
Extra copies of the SIR2 gene in yeast increase the number of times a mother yeast can reproduce by budding. This is the operational definition of aging in yeast (see article by Gems). Overexpression of the worm gene with the most similarity to yeast SIR2 called sir-2.1 also increased life-span in the worm Caenorhabditis elegans. The increased life-span required a functional forkhead transcription factor, DAF-16, whose activity is inhibited by the insulin-like pathway in the worm. Mutations in the insulin-like signaling pathway also affect worm life-span by a mechanism requiring DAF-16. Sir-2.1 appears to be a regulator of the insulin-like pathway based on several criteria, including synergism with the genetic mutants of the TGF-β pathway and a lack of synergism with mutants of the insulin-like receptor gene daf-2. In yeast, SIR2 alters chromatin structure, resulting in gene silencing. Tissenbaum and Guarente suggest that Sir-2.1 may repress the expression of factors involved in activating the ...
Amino Acid Sequence, Animals, Apoptosis/*physiology, Apoptosis Regulatory Proteins, Caenorhabditis/genetics, Caenorhabditis elegans/embryology/genetics/*physiology, Caenorhabditis elegans Proteins/genetics/metabolism/*physiology, DNA/genetics/radiation effects, DNA Damage, Gene Deletion, Gene Expression Regulation; Developmental/radiation effects, Heat-Shock Proteins/genetics, Models; Biological, Molecular Sequence Data, Mutation, Proto-Oncogene Proteins/genetics/metabolism, Repressor Proteins/genetics, Sequence Homology; Amino Acid, Tumor Suppressor Protein p53/genetics/physiology, X-Rays ...
C elegans Lin-3 protein: amino acid sequence given in first source; lin-3 encodes an inductive signal for vulval development; from Caenorhabditis elegans
Bacaj, T., M. Tevlin, Y. Lu, and S. Shaham. 2008. Glia are essential for sensory organ function in C. elegans. Science. 322(5902):744-747.. Heiman, M. G., and S. Shaham. 2007. Ancestral roles of glia suggested by the nervous system of Caenorhabditis elegans. Neuron Glia Biology. 3(1):55-61. (Request copy of article from the Markus Library). Shaham, S. 2006. Glia-neuron interactions in the nervous system of Caenorhabditis elegans. Current Opinion in Neurobiology. 16(5): 522-528.. Shaham, S. 2005. Glia-neuron interactions in nervous system function and development. Current Topics in Developmental Biology. 69:39-66.. Wang, Y., A. Apicella Jr., S. -K Lee, M. Ezcurra, R. D. Slone, M. Goldmit, W. R. Schafer, S. Shaham, M. Driscoll, and L. Bianchi. 2008. A glial DEG/ENaC channel functions with neuronal channel DEG-1 to mediate specific sensory functions in C. elegans. EMBO Journal. 27(18):2388-2399.. Wang, Y., A. Apicella Jr., S. -K Lee, M. Ezcurra, R. D. Slone, M. Goldmit, W. R. Schafer, S. Shaham, M. ...
RNA-mediated interference (RNAi) has emerged recently as one of the most powerful functional genomics tools. RNAi has been particularly effective in the nematode worm C. elegans where RNAi has been used to analyse the loss-of-function phenotypes of almost all predicted genes. In this review, we illustrate how RNAi has been used to analyse gene function in C. elegans as well as pointing to some future directions for using RNAi to examine genetic interactions in a systematic manner.. ...
We report that the effects of RJ and enzyme-treated RJ (eRJ) on life span and health span in Caenorhabditis elegans (C elegans) are modulated by the sophisticated interplays of DAF-16, SIR-2.1, HCF-1, and 14-3-3 proteins. Dietary supplementation with RJ or eRJ increased C. elegans life span in a dose-dependent manner. The RJ and eRJ consumption increased the tolerance of C elegans to oxidative stress, ultraviolet irradiation, and heat shock stress. Our genetic analyses showed that RJ/eRJ-mediated life-span extension requires insulin/IGF-1 signaling and the activities of DAF-16, SIR-2.1, HCF-1, and FTT-2, a 14-3-3 protein. Earlier studies reported that DAF-16/FOXO, SIR-2.1/SIRT1, FTT-2, and HCF-1 have extensive interplays in worms and mammals. Our present findings suggest that RJ/eRJ-mediated promotion of longevity and stress resistance in C elegans is dependent on these conserved interplays. ...
For many organisms the ability to transduce light into cellular signals is crucial for survival. Light stimulates DNA repair and metabolism changes in bacteria, avoidance responses in single-cell organisms, attraction responses in plants, and both visual and nonvisual perception in animals. Despite these widely differing responses, in all of nature there are only six known families of proteins that can transduce light. Although the roundworm Caenorhabditis elegans has none of the known light transduction systems, we show here that C. elegans strongly accelerates its locomotion in response to blue or shorter wavelengths of light, with maximal responsiveness to ultraviolet light. Our data suggest that C. elegans uses this light response to escape the lethal doses of sunlight that permeate its habitat. Short-wavelength light drives locomotion by bypassing two critical signals, cyclic adenosine monophosphate (cAMP) and diacylglycerol (DAG), that neurons use to shape and control behaviors. C. elegans ...
For many organisms the ability to transduce light into cellular signals is crucial for survival. Light stimulates DNA repair and metabolism changes in bacteria, avoidance responses in single-cell organisms, attraction responses in plants, and both visual and nonvisual perception in animals. Despite these widely differing responses, in all of nature there are only six known families of proteins that can transduce light. Although the roundworm Caenorhabditis elegans has none of the known light transduction systems, we show here that C. elegans strongly accelerates its locomotion in response to blue or shorter wavelengths of light, with maximal responsiveness to ultraviolet light. Our data suggest that C. elegans uses this light response to escape the lethal doses of sunlight that permeate its habitat. Short-wavelength light drives locomotion by bypassing two critical signals, cyclic adenosine monophosphate (cAMP) and diacylglycerol (DAG), that neurons use to shape and control behaviors. C. elegans ...
C. elegans provides a powerful model system in which to define the genes and molecular mechanisms underlying fundamental biological processes, such as oscillatory Ca2+ signaling. We describe here a novel isolated intestine preparation that allows physiological access to the intestinal epithelium and characterization of intracellular Ca2+ oscillations in wild-type, mutant, and transgenic worms as well as worms in which gene expression has been disrupted selectively by RNAi.. Isolated intestines exhibit spontaneous Ca2+ oscillations (e.g., Fig. 2). Oscillations were only observed in intestines left attached to the rectum and posterior end of the animal (Fig. 1 A), suggesting that oscillations may be triggered by a factor secreted from an unidentified posterior cell type. Alternatively, a pacemaker cell analogous to the interstitial cells of Cajal that regulate rhythmic smooth muscle contraction in the mammalian gut (Camborova et al., 2003) could be located in or adjacent to the posterior end of ...
Author SummaryEukaryotic genes contain introns, which are intervening sequences that are excised from a gene transcript with the concomitant ligation of flanking segments called exons. The process of removing introns is called splicing. It involves biochemical mechanisms that to date are too complex to be modeled comprehensively and accurately. However, abundant sequencing results can serve as a blueprint database exemplifying what this process accomplishes. Using this database, we employ discriminative machine learning techniques to predict the mature mRNA given the unspliced pre-mRNA. Our method utilizes support vector machines and recent advances in label sequence learning, originally developed for natural language processing. The system, called mSplicer, was trained and evaluated on the genome of the nematode C. elegans, a well-studied model organism. We were able to show that mSplicer correctly predicts the splice form in most cases. Surprisingly, our predictions on currently unconfirmed genes
BACKGROUND : The nematode Caenorhabditis elegans has been used extensively to identify the genetic requirements for proper nervous system development and function. Key to this process is the direction of vesicles to the growing axons and dendrites, which is required for growth-cone extension and synapse formation in the developing neurons. The contribution and mechanism of membrane traffic in neuronal development are not fully understood, however. RESULTS : We show that the C. elegans gene unc-69 is required for axon outgrowth, guidance, fasciculation and normal presynaptic organization. We identify UNC-69 as an evolutionarily conserved 108-amino-acid protein with a short coiled-coil domain. UNC-69 interacts physically with UNC-76, mutations in which produce similar defects to loss of unc-69 function. In addition, a weak reduction-of-function allele, unc-69(ju69), preferentially causes mislocalization of the synaptic vesicle marker synaptobrevin. UNC-69 and UNC-76 colocalize as puncta in ...
Description. C. elegans, one of the most attractive and popular genetic model organisms, is used to address questions and advance our understanding of several complex biological processes. The course will provide a general practical introduction to using C. elegans in research. It will cover the pros and cons of using C. elegans compared to other model organisms. The course participants will have hands on experience with popular techniques such as RNAi, genetic crosses, transgenic and GFP reporter strains. Thus, during the course the participants will not only be familiarized with using C. elegans as model organism but also be able to interact and network with experts in the field. The practical part of this course is complemented by lectures given by several internationally renowned C. elegans researchers.. The experiments will include the studies of the life cycle and early development of wild type worms and the phenotypic analysis of mutants.. It will cover:. Maintenance, decontamination and ...
Src homology 3 (SH3) domains bind peptides to mediate protein-protein interactions that assemble and regulate dynamic biological processes. We surveyed the repertoire of SH3 binding specificity using peptide phage display in a metazoan, the worm Caenorhabditis elegans, and discovered that it structurally mirrors that of the budding yeast Saccharomyces cerevisiae.We then mapped the worm SH3 interactome using stringent yeast two-hybrid and compared it with the equivalent map for yeast.We found that the wormSH3 interactome resembles the analogous yeast network because it is significantly enriched for proteins with roles in endocytosis. Nevertheless, orthologous SH3 domain mediated interactions are highly rewired. Our results suggest a model of network evolution where general function of the SH3 domain network is conserved over its specific form.
1PEV: Identification of functional residues on Caenorhabditis elegans actin-interacting protein 1 (UNC-78) for disassembly of actin depolymerizing factor/cofilin-bound actin filaments.
Our senses dull as we age; we dont see as well, hear as well, or smell or taste as well. Insights from aging in the worm Caenorhabditis elegans connect oxidative damage of potassium channels to this process. The potassium channel KVS-1 is present in the worms nervous system and in the ASE neurons that mediate the chemotactic response to food substances. Cai and Sesti found that, in a reconstituted system, KVS-1s electrophysiological properties were altered by oxidation (application of chloramine T or hydrogen peroxide). Oxidation increased KVS-1 conductance, which would decrease the excitability of the neuron, a change that was due to Cys113, because a C113S mutant channel was resistant to oxidation-mediated changes in electrophysiological properties. By expressing either the wild-type KVS-1 channel or the C113S-KVS-1 channel in kvs-1-knockout worms, the authors showed that the loss of chemotactic response due to exposure to oxidants was much more pronounced in the worms expressing wild-type ...
May 18, 2014 Researchers at MIT and the University of Vienna have created an imaging system that reveals neural activity throughout the brains of living animals. This technique, the first that can generate 3-D movies of entire brains at the millisecond timescale, could help scientists discover how neuronal networks process sensory information and generate behavior.. The team used the new system to simultaneously image the activity of every neuron in the worm Caenorhabditis elegans, as well as the entire brain of a zebrafish larva, offering a more complete picture of nervous system activity than has been previously possible.. "Looking at the activity of just one neuron in the brain doesnt tell you how that information is being computed; for that, you need to know what upstream neurons are doing. And to understand what the activity of a given neuron means, you have to be able to see what downstream neurons are doing," says Ed Boyden, an associate professor of biological engineering and brain and ...
The nematode Caenorhabditis elegans may hold the key to brain-like computational architectures: Si elegans will provide the scientific community with a reconfigurable, scalable and modular neuromimetic open-access computational platform to explore neural principles that give rise to complex behaviour and to derive a neuro-inspired technological blueprint for a new era of brain-like computational architectures.The Si elegans project started on April 1st 2013. ...
Sreekanth Chalasani uses an organism with a much simpler nervous system than humans to answer questions about neuroscience: the roundworm Caenorhabditis elegans. This animal has only 302 neurons and a few thousand connections between these cells. Each neuron is mapped and named, making it easier to study the effect of environment or gene changes at the resolution of individual cells. But despite its simplicity, the C. elegans nervous system has commonalities with a human brain: if you give a worm a dose of the antidepressant Prozac, for example, it becomes less fearful of predators; and if you mutate a gene linked to autism in humans, the worm shows less interest in other worms.. Among other studies, Chalasanis lab is asking how the roundworm nervous system, one of the simplest in nature, gives rise to such behaviors as fear and aggression. He is exploring what these tiny creatures can tell us about human aggressions and fears, emotions and behaviors often necessary for our survival, but which ...
It is significant that the majority of the processes involved in the integration of the CS and US in associative learning and in nonassociative memory formation ostensibly occurs within the AWC sensory neuron itself. Indeed, all the genes discussed in our model are known to be expressed in and required within or act on, in the case of ins-1, the AWC to mediate olfactory adaptation (Colbert et al., 1997; LEtoile et al., 2002; Palmitessa et al., 2005; Chalasani et al., 2010; Lin et al., 2010), lending support to the remarkable notion that the majority of processing occurs within the primary olfactory neuron. Indeed, this appears to be a common theme in a number of paradigms in C. elegans. For example, work by the Iino group has suggested that salt starvation associative learning requires insulin signaling within the salt-sensing ASE sensory neuron (Tomioka et al., 2006). Furthermore, food starvation associative learning leads to a modulation of the temperature at which the temperature-sensing AFD ...
To generate pmec-17LMP-1∷GFP, we fused GFP at the COOH terminus of the C. elegans LMP-1 protein. The translational fusion includes the entire LMP-1 coding sequence lacking the stop codon, a Gly-Ser-Ser-Pro-Gly-Leu-Ala-Lys-Gly-Pro-Lys-Gly linker, and GFP. The resulting chimera was expressed in touch receptor neurons under the control of the mec-17 promoter. The plasmid carrying the reporter fusion was constructed in two steps. First, the mec-17 promoter was amplified from N2 genomic DNA with the primers 5′ CGGGATCCGAATCGTCTCACAACTGATCC 3′ and 5′ AACTGCAGGTGACTACTTGAGACCTG 3′. A 1,900-bp PstI-BamHI fragment was cloned into the promoterless gfp vector pPD95.77 (Fire et al., 1990). Second, the LMP-1 coding region was amplified from genomic DNA using the primers 5′ CGGGATCCGACGCTGGCATATCCTTGTCTC 3′ and 5′ CGGGATCCAATTGAACTATGTTGAAATCG 3′. A BamHI PCR fragment was cloned downstream of the mec-17 promoter on the pPD95.77 plasmid vector. For RNAi experiments, we used HT115(DE3) ...
The purpose of the dataset C. elegans muscle aging is to deduce the age of the nemathode based on images of muscles. Images of C. elegans were taken ...
The purpose of the dataset C. elegans muscle aging is to deduce the age of the nemathode based on images of muscles. Images of C. elegans were taken ...
Author Summary X chromosomes differ in number between the sexes and differ from autosomes in their associated proteins and gene regulatory properties. In C. elegans both X chromosomes are partially silenced in hermaphrodite germlines. Germline-expressed and essential genes are autosome-enriched and are thought to have fled the X chromosome during evolution because silencing these genes would result in sterility or lethality. We discovered that the C. elegans DRM complex, which controls transcription of genes implicated in development and cancer, avoids the X chromosome. We first describe how DNA-binding components of the DRM complex together recognize DNA sequences upstream of its target genes, and we describe that DRM controls different target genes in the germline versus the soma. We show that the DRM binding motif, the genes bound by DRM, and the embryonic genes regulated by DRM are all under-represented on the X chromosome. Interestingly, compromising DRM function in the germline enhances X
Much of the material taken into cells by endocytosis is rapidly returned to the plasma membrane by the endocytic recycling pathway. Although recycling is vital for the correct localization of cell membrane receptors and lipids, the molecular mechanisms that regulate recycling are only partially understood. Here we show that in C. elegans, endocytic recycling is inhibited by NUM-1A, the nematode Numb homologue. NUM-1A::GFP fusion protein is localized to the baso-lateral surfaces of many polarized epithelial cells including the hypodermis and the intestine. We show that increased NUM-1A levels cause morphological defects in these cells similar to those caused by loss-of-function mutations in rme-1, a positive regulator of recycling both in C. elegans and mammals. We describe the isolation of worms lacking num-1A activity and show that, consistent with a model in which NUM-1A negatively regulates recycling in the intestine, loss of num-1A function bypasses the requirement for RME-1. Genetic ...
TY - JOUR. T1 - Global regulation of Hox gene expression in C. elegans by a SAM domain protein. AU - Zhang, Hong. AU - Azevedo, Ricardo B R. AU - Lints, Robyn. AU - Doyle, Christina. AU - Teng, Yingqi. AU - Haber, Daniel. AU - Emmons, Scott W.. PY - 2003/6/1. Y1 - 2003/6/1. N2 - Polycomb group (PcG)-mediated repression of C. elegans Hox genes has not been demonstrated, and genes homologous to components of one of the PcG complexes (PRC1) have not been identified in the C. elegans genome. We find that a mechanism of general Hox gene repression exists in C. elegans, carried out in part by SOP-2, a protein related to, but not orthologous with, any PcG protein. sop-2 mutations lead to widespread ectopic expression of Hox genes and homeotic transformations. SOP-2 contains a SAM domain, a self-associating protein domain found in other repressors, including a core component of PRC1 and ETS transcription factors. Phylogenetic analysis indicates that this domain is more closely related to those of the ...
The goal of this research is to develop methods for the precise modification of specific target genes in two important genetic model organisms, the nematode Caenorhabditis elegans and the zebrafish Danio rerio. Both nematodes and fish are powerful experimental systems that combine elegant developmental biology with large scale genetics. Both systems have contributed to our understanding of fundamental problems in cancer biology, including programmed cell death, the control of organogenesis, the interaction of cancer susceptibility genes with the environment, and the genetics of melanoma. An important limitation of these model systems is that techniques for site-specific manipulation of the genome are not currently available in either nematodes or fish. Thus, in contrast to murine embryonic stem cells and the yeast S. cerevisiae, it is not possible to knock out specific genes or to precisely control the time and place of gene expression. In the last two years, a powerful new approach to ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The sys-1 gene encodes a highly divergent β-catenin (6, 8). Several lines of evidence support the idea that SYS-1 is a functional β-catenin. First, transgenic SYS-1 can rescue a null mutant of bar-1, which encodes a typical β-catenin. Second, SYS-1 binds the β-catenin binding domain of POP-1/TCF. Third, SYS-1 acts as a transcriptional coactivator for POP-1 in a TOPFLASH reporter. Fourth, ceh-22 expression in distal SGP daughters depends on POP-1 binding sites in the ceh-22b promoter and also on SYS-1 and POP-1. Therefore, SYS-1 acts in many ways like a typical β-catenin.. Both SYS-1/β-catenin and POP-1/TCF control the SGP asymmetric cell division (7, 9). In pop-1 mutants, as in sys-1 mutants, the SGP daughters both adopt a proximal fate (Fig. 1B). Importantly, POP-1 is asymmetrically distributed to SGP daughters (10), a phenomenon that has been seen in many asymmetric cell divisions and has been dubbed "POP-1 asymmetry" (11). Although counterintuitive, nuclear POP-1 is reduced in distal ...
gi,17508791,ref,NP_492239.1, C-x8-C-x5-C-x3-H type zinc finger containing protein (76.1 kD) (1I793) [Caenorhabditis elegans] gi,7506947,pir,,T24365 hypothetical protein T02E1.3b - Caenorhabditis elegans gi,3879305,emb,CAB04666.1, Hypothetical protein T02E1.3b [Caenorhabditis elegans ...
Individual neurons in vertebrates are typically highly branched with a complex morphology of their processes (axons and dendrites). In C. elegans almost all neuronal processes are unbranched and extend in a stereotpical fashion. The example in Figure 3 shows a pair of sensory neurons (ASH) with cell bodies located in head ganglia. The two ASH neurons are chemosensory neurons. A single process, the dendrite, extends from the cell body towards the tip of the nose. A second process, the axon, grows first towards the ventral cord through the amphid commissure. It then turns anteriorly and loops in a halfcircle around the pharynx (not visible) within a large axon bundle - the nerve ring (note: the processes in the ventral cord in the figure belong to a second pair of neurons (PVQ) with cell bodies in the tail). The nerve ring is a horseshoe-shaped axon bundle containing neuronal processes of sensory and interneurons which form connections (synapses) as they run next to each other.. The invariant ...
With the aid of a pair of sensory neurons, the nematode worm C. elegans is able to detect the Earths magnetic field and use it to navigate towards food sources.
With the aid of a pair of sensory neurons, the nematode worm C. elegans is able to detect the Earths magnetic field and use it to navigate towards food sources.
The C. elegans grinder is an intricately designed, macromolecular structure located in the terminal bulb of the pharynx. It acts as the teeth of C. elegans, crushing bacteria before they are passed to the intestine. The ...
In the nematode Caenorhabditis elegans, inactivating mutations in the insulin/IGF-1 receptor, DAF-2, result in a 2-fold increase in lifespan mediated by DAF-16, a FOXO-family transcription factor. Downstream protein activities that directly regulate longevity during impaired insulin/IGF-1 signaling (IIS) are poorly characterized. Here, we use global cysteine-reactivity profiling to identify protein activity changes during impaired IIS. Upon confirming that cysteine reactivity is a good predictor of functionality in C. elegans, we profiled cysteine-reactivity changes between daf-2 and daf-16;daf-2 mutants, and identified 40 proteins that display a | 2-fold change. Subsequent RNAi-mediated knockdown studies revealed that lbp-3 and K02D7.1 knockdown caused significant increases in lifespan and dauer formation. The proteins encoded by these two genes, LBP-3 and K02D7.1, are implicated in intracellular fatty acid transport and purine metabolism, respectively. These studies demonstrate that cysteine
TY - JOUR. T1 - Cloning, characterization, and expression of the gene for the catalytic subunit of cAMP-dependent protein kinase in Caenorhabditis elegans. T2 - Identification of highly conserved and unique isoforms generated by alternative splicing. AU - Gross, Robert E.. AU - Bagchi, Srilata. AU - Lu, Xiangyi. AU - Rubin, Charles S.. PY - 1990. Y1 - 1990. N2 - The nematode Caenorhabditis elegans expresses substantial amounts of several forms (Mr values = 39,000-41,000) of the catalytic subunit (C) of cAMP-dependent protein kinase. Approximately 65% of the total cAMP-dependent phosphotransferase activity is recovered in particulate fractions of homogenates prepared from asynchronous populations of C. elegans. The C subunit is expressed at a low level in cytosolic and particulate compartments during embryogenesis. As the nematodes progress from late embryonic stages to the newly hatched, first larval (L1) stage, C subunit content increases 15-fold. High levels of C subunits are observed in ...
J. Pathol. 163:2155-2164. , 2001, Amyloid p protein forms ion channels: implications for Alzheimers disease pathophysiology. FASEB J. 15: 2433-2444. -C, Hall, D. , Mathis, C. , 2001, Visualization of fibrillar amyloid deposits in living, transgenic Caenorhabditis elegans animals using the sensitive amyloid dye, X-34. Neurobiol Aging 22:217-226. , 2004, Single chain variable fragments against B-amyloid (AB) can The Contribution of Microscopy to the Study of Alzheimers Disease 39 inhibit AB aggregation and prevent AB-induced neurotoxicity. Interestingly, a rapidly-formed but transient nanocrystalhne from of a 14-amino acid Ap peptide has been described by Otzen and Oliveberg (2004). Using TEM these workers showed that the nanocrystalline form of this peptide leads to the formation of a tangled aggregate (hours) and amyloid fibres (days). 2 Ap protofilaments Definition of the P-sheet-containing protofilament that can be formed by Ap and several other fibril-forming amyloidogenic peptides is by no ...
A formidable barrier to imaging studies of in vivo C. elegans sperm behavior has been the lack of bright, sperm-specific fluorescent markers. Use of dim sperm markers negatively influences the ability to perform confocal imaging in various ways, including but not limited to loss of signal deep into the gonad, which can be ~40 mm thick (Hubbard and Greenstein 2000); loss of spatial and temporal resolution, due to techniques commonly used to address imaging dim signals, such as signal accumulation; and increased phototoxicity and bleaching, due to increased excitation intensity. For in vivo imaging of the C. elegans hermaphrodite gonad, temporal resolution is limited by the rapidity of sheath contraction (McCarter et al. 1999) and the small physical size of sperm cells, parameters that already push the limits of many imaging systems. Researchers may find themselves trapped in the so-called "pyramid of frustration," which refers to the difficult position of balancing the conflicting demands of high ...
C. elegans biologists show an admirable desire to understand all facets of the worms biology, often wanting to relate their work to the context of C. elegans as a "real organism" that lives out in the wild world. However, some early perceptions about C. elegans biology are now known to be incorrect. Here we highlight four common misconceptions to, hopefully, eliminate the perpetuation of these myths.C. elegans is not a soil nematode: it is found in niches rich in decomposing organic matter. Despite old statements of C. elegans living in soil, no species of Caenorhabditis is found commonly in dirt - although Caenorhabditis are terrestrial when compared to marine nematodes. To understand why, it helps to think like a hungry worm. Like all species in the genus, C. elegans eats bacteria and some other microbes, and consequently C. elegans (and related species) occur in the wild with greatest prevalence in niches rich in decomposing organic matter that have abundant bacterial growth, such as rotting ...
Critical role in assembling adherens junctions; adapter protein involved in polarizing protein trafficking in epithelial cells. Necessary to maintain, not establish, the entire terminal web (organelle-depleted, intermediate filament-rich layer of cytoplasm that underlies the apical microvilli of polarized epithelial cells) or brush border assembly at the apical surface gut cells. Required for correct localization of ifb-2 intermediate filaments in the terminal web.
A mutation in the let-653 gene of Caenorhabditis elegansresults in larval death. The lethal arrest is concurrent with the appearance of a vacuole anterior to the lower pharyngeal bulb. The position...
Ultrasound neuro-modulation has gained increasing attention as a non-invasive method. In this paper, we present an ultrasound neuro-modulation chip, capable of initiating reversal behaviour and activating neurons of C. elegans under the stimulation of a single-shot, short-pulsed ultrasound. About 85.29% ± 6.
El nemátodo Caernorhabditis elegans ofrece la posibilidad de estudiar el desarrollo embrionario con una resolución celular. En esta tesis, describo el uso de un algoritmo semi-automático de seguimiento nuclear para analizar movimientos celulares en el embrión temprano, así como la manera en que el embrión responde a deformaciones mecánicas y a perturbaciones genéticas. Durante el proceso de gastrulación, observamos que ciertas células no solo ingresan al interior del embrión, pero también egresan hasta la superficie. Asimismo, identificamos linajes celulares que llevan a cabo ambos tipos de movimientos direccionales, esto es, primero internalizan y luego la continuan su movimiento hasta finalmente re-emerger en la superficie, "transgressing" o "tunneling" a través del embrión. Hemos descubierto que los movimientos estereotípicos de rotación en el embrión temprano, descritos previamente, son altamente variables en ausencia de compresión y esta variabilidad total en la rotación ...
C. elegans biologists show an admirable desire to understand all facets of the worms biology, often wanting to relate their work to the context of C. elegans as a "real organism" that lives out in the wild world. However, some early perceptions about C. elegans biology are now known to be incorrect. Here we highlight four common misconceptions to, hopefully, eliminate the perpetuation of these myths.C. elegans is not a soil nematode: it is found in niches rich in decomposing organic matter. Despite old statements of C. elegans living in soil, no species of Caenorhabditis is found commonly in dirt - although Caenorhabditis are terrestrial when compared to marine nematodes. To understand why, it helps to think like a hungry worm. Like all species in the genus, C. elegans eats bacteria and some other microbes, and consequently C. elegans (and related species) occur in the wild with greatest prevalence in niches rich in decomposing organic matter that have abundant bacterial growth, such as rotting ...
Please note: Your browser does not support the features used on Addgenes website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more ...
Acts downstream of PI3 kinase age-1 and kinase pdk-1 in the daf-2/insulin receptor-like transduction pathway (PubMed:15068796). Essential role in regulating development, stress response, and longevity (PubMed:15068796, PubMed:18782349). Phosphorylates Forkhead-related daf-16 and the longevity-promoting skn-1 transcription factors, which inhibits their entry into the nucleus and antagonizes their function (PubMed:18358814). Acts downstream of rict-1 to regulate fat storage, size, and development (PubMed:19240135, PubMed:19260765). Downstream of age-1 and together with akt-1/2, promotes cell survival during embryonic development (PubMed:25383666). Does not appear to play a role in immune function (PubMed:18782349).
In gene-centered yeast one-hybrid assays, two types of "DNA baits" are used to identify interacting TFs: single copy C. elegans genomic sequences such as gene promoters, and artificial baits such as (putative) cis-regulatory DNA elements [5]. EDGEdb contains information about i) DNA bait sequences and genomic coordinates; ii) all 934 predicted C. elegans TFs [19], i.e. their DNA binding domain, and, where available, dimerization partners and consensus binding sites; iii) protein-DNA interactions between DNA baits and TFs; and iv) where available, the transcriptional consequences of such protein-DNA interactions (see below). In total, the database contains 605 protein-DNA interactions between 115 C. elegans gene promoters and 176 TFs. In addition, the database contains protein-DNA interactions for 3 short DNA sequences that were either found by us or by other groups (referred to as "artificial baits", see e.g. ZTF-2 or DAF-12). Finally, the database contains 24 TF protein-protein dimer ...
Neuronal migration is essential to the formation of the central nervous system in vertebrates. In Caenorhabditis elegans, a screen was performed previously to identify mutations that affected the migration of the Q neuroblast descendants. One of the mutants isolated from this screen was mig-15. MIG-15, a Nck Interacting Kinase (NIK), is homologous to proteins found in a wide variety of organisms, including Drosophila, mice, and humans, in which NIK kinases have been implicated in cell migration. Interestingly, multiple components of the canonical Wnt signaling pathway had already been found to control the Q cell descendant migrations. Additionally, the MIG-15 homolog in Drosophila, Misshapen had also been found to work with Wnt signaling components in the non-canonical planar cell polarity pathway. To determine how MIG-15 was working to control the migrations of the Q cell descendants, a characterization of the Q neuroblast migration defects was performed. mig-15 mutants were found to affect the ...
unc-51(e369) mutation reduces mean but extends maximum lifespan. unc-51(e369) mutation reduces lifespan of eat-2 mutants to that of wild-type [2387]. ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
During the development of the nematode Caenorhabditis elegans cell death occurs in a highly reproducible manner, and this is one of the reasons why the worm
Mutations in the human Mid1 gene cause Opitz G/BBB syndrome, which is characterized by various midline closure defects. The Caenorhabditis elegans homolog of Mid1, madd-2, positively regulates signaling by the unc-40 Netrin receptor during the extension of muscle arms to the midline and in axon guidance and branching. During uterine development, a specialized cell called anchor cell (AC) breaches the basal laminae separating the uterus from the epidermis and invades the underlying vulval tissue. AC invasion is guided by an UNC-6 Netrin signal from the ventral nerve cord and an unknown guidance signal from the vulval cells. Using genetic epistasis analysis, we show that madd-2 regulates AC invasion downstream of or in parallel with the Netrin signaling pathway. Measurements of AC shape, polarity and dynamics indicate that MADD-2 prevents the formation of ectopic AC protrusions in the absence of guidance signals. We propose that MADD-2 represses the intrinsic invasive capacity of the AC, while the ...
In stark contrast to the wealth of detail about C. elegans developmental biology and molecular genetics, biologists lack basic data for understanding the abundance and distribution of Caenorhabditis species in natural areas that are unperturbed by human influence. Here we report the analysis of dense sampling from a small, remote site in the Amazonian rain forest of the Nouragues Natural Reserve in French Guiana. Sampling of rotting fruits and flowers revealed proliferating populations of Caenorhabditis, with up to three different species co-occurring within a single substrate sample, indicating remarkable overlap of local microhabitats. We isolated six species, representing the highest local species richness for Caenorhabditis encountered to date, including both tropically cosmopolitan and geographically restricted species not previously isolated elsewhere. We also documented the structure of within-species molecular diversity at multiple spatial scales, focusing on 57 C. briggsae isolates from French
Trehalose is a disaccharide of glucose found in diverse organisms and is suggested to act as a stress protectant against heat, cold, desiccation, anoxia, and oxidation. Here, we demonstrate that treatment of [nematode worms of the species] Caenorhabditis elegans with trehalose starting from the young-adult stage extended the mean life span by over 30% without any side effects. Surprisingly, trehalose treatment starting even from the old-adult stage shortly thereafter retarded the age-associated decline in survivorship and extended the remaining life span by 60%. Demographic analyses of age-specific mortality rates revealed that trehalose extended the life span by lowering age-independent vulnerability. Moreover, trehalose increased the reproductive span and retarded the age-associated decrease in pharyngeal-pumping rate and the accumulation of lipofuscin.. .... The life span-extending effect of trehalose was abolished in long-lived insulin/IGF-1-like receptor (daf-2) mutants. ... These findings ...
17 best ideas about human body muscles on pinterest , white stuff at muscles. Human Body Muscles delightful for you to the blog, within this time period Im going to demonstrate concerning Human body muscles.. And today, this is the 1st image, human body muscles, human body muscles and bones, human body muscles quiz, human body muscles worksheet, human body muscles diagram labeled, human body muscles labeled, human body muscles chart, human body muscles female, human body muscles names, human body muscles anatomy :. ...
PubMed Central Canada (PMC Canada) provides free access to a stable and permanent online digital archive of full-text, peer-reviewed health and life sciences research publications. It builds on PubMed Central (PMC), the U.S. National Institutes of Health (NIH) free digital archive of biomedical and life sciences journal literature and is a member of the broader PMC International (PMCI) network of e-repositories.
Cytolytic pore-forming toxins are important for the virulence of many disease-causing bacteria. How target cells molecularly respond to these toxins and whether or not they can mount a defense are poorly understood. By using microarrays, we demonstrate that the nematode Caenorhabditis elegans responds robustly to Cry5B, a member of the pore-forming Crystal toxin family made by Bacillus thuringiensis. This genomic response is distinct from that seen with a different stressor, the heavy metal cadmium. A p38 mitogen-activated protein kinase (MAPK) kinase and a c-Jun N-terminal-like MAPK are both transcriptionally up-regulated by Cry5B. Moreover, both MAPK pathways are functionally important because elimination of either leads to animals that are (i) hypersensitive to a low, chronic dose of toxin and (ii) hypersensitive to a high, brief dose of toxin such that the animal might naturally encounter in the wild. These results extend to mammalian cells because inhibition of p38 results in the hypersensitivity
ABSTRACT. Haemonchus contortus and Trichostrongylus colubriformis are among the most important parasitic nematodes of small ruminants. Caenorhabditis elegans, a free-living nematode, is used as a model for evaluating anthelmintic activity of a variety of test substances. Extracts of several medicinal plants are useful in vitro and in vivo against nematode development. Extracts of Curtisia dentata, a South African medicinal plant, and compounds isolated from leaves of this plant were investigated for anthelmintic activity against T. colubriformis, H. contortus and C. elegans. The acetone and dichloromethane extracts were active against all nematodes at concentrations as low as 160 μg/ml. Betulinic acid and lupeol were active against the parasitic nematodes only at the high concentrations of 1 000 and 200 μg/ml, respectively. All compounds were effective against C. elegans with active concentrations as low as 8 μg/ml. Betulinic acid was less active than lupeol and ursolic acid against C. ...
The potato cyst nematode Globodera pallida costs the UK potato industry over £50 million per annum. In order to invade a host plant, the infective J2 stage must hatch from eggs within the soil and migrate towards the root system. Orthologues of Caenorhabditis elegans genes involved in neurotransmission were identified in the G. pallida and G. rostochiensis genome assemblies. The complement of cys loop ligand gated ion channel genes was distinct compared to C. elegans and other parasitic nematodes. Orthologues of genes encoding subunits which comprise the C. elegans levamisole sensitive nicotinic acetylcholine receptor (cel-lev 1, cel-lev 8, cel-unc 29, cel-unc 63 and cel-unc 38) were searched for, and cel-lev 1 and cel-lev 8 orthologues were absent in both Globodera spp. Two orthologues were identified for cel-unc 29 and cel-unc 38. This suggested that the composition of the G. pallida L nAChR may differ. The use of C. elegans as a heterologous system to study the expression pattern of G. ...
Were not suggesting … that SMA patients should ask their doctors for Riluzole, but we are suggesting that this pathway would be useful for therapeutic development."PROVIDENCE, R.I. [Brown University] - There is no specific drug to treat spinal muscular atrophy (SMA), a family of motor neuron diseases that in its most severe form is the leading genetic cause of infant death in the United States and affects one in 6,000 people overall. But a new multispecies study involving a drug that treats amyotrophic lateral sclerosis (ALS) has pinpointed a mechanism of SMA that drug developers might be able to exploit for a new therapy. The research, published in the Journal of Neuroscience, reports that the drug Riluzole advanced neural cell development in a mammalian model of SMA and restored neuromuscular function and mobility in a Caenorhabditis elegans worm model of the disease. Riluzole has already been tested as a therapy in a very small study of severely affected SMA patients. It failed to help. ...

Implications of sequencing the nematode Caenorhabditis elegans genome for plant nematologyImplications of sequencing the nematode Caenorhabditis elegans genome for plant nematology

Caenorhabditis elegans. J. Nematol. 30:299-308.. 5. Bird, D.M., Opperman, C.H., Jones S.J.M., and Baillie, D.L. 1999. The ... Implications of sequencing the nematode Caenorhabditis elegans genome for plant nematology.. The Plant Health Instructor. DOI: ... Caenorhabditis elegans is a nematode. Science 282:2041-2046.. 7. Blaxter, M. and Bird, D. 1997. Parasitic nematodes. Pp. 851- ... Caenorhabditis elegans: Modern Biological Analysis of an Organism. Methods in Cell Biology. Vol. 48. Academic Press, NY 659 pp. ...
more infohttps://www.apsnet.org/publications/apsnetfeatures/Pages/Celegans.aspx

Neural control of Caenorhabditis elegans forward locomotion: the role of sensory feedback  - White Rose Research Online
		Neural control of Caenorhabditis elegans forward locomotion: the role of sensory feedback - White Rose Research Online

Bryden, J.A. and Cohen, N. (2008) Neural control of Caenorhabditis elegans forward locomotion: the role of sensory feedback. ... Neural control of Caenorhabditis elegans forward locomotion: the role of sensory feedback ... This paper presents a simple yet biologicallygrounded model for the neural control of Caenorhabditis elegans forward locomotion ... We identify a minimal circuit within the C. elegans ventral cord that is likely to be sufficient to generate and sustain ...
more infohttp://eprints.whiterose.ac.uk/7948/

The Caenorhabditis elegans GATA factor elt-1 is essential for differentiation and maintenance of hypodermal seam cells and for...The Caenorhabditis elegans GATA factor elt-1 is essential for differentiation and maintenance of hypodermal seam cells and for...

The Caenorhabditis elegans GATA factor elt-1 is essential for differentiation and maintenance of hypodermal seam cells and for ... The Caenorhabditis elegans GATA transcription factor elt-1 has previously been shown to have a central role in the ... The Caenorhabditis elegans GATA factor elt-1 is essential for differentiation and maintenance of hypodermal seam cells and for ... The Caenorhabditis elegans GATA factor elt-1 is essential for differentiation and maintenance of hypodermal seam cells and for ...
more infohttp://jcs.biologists.org/content/118/24/5709

Caenorhabditis elegans ModuleCaenorhabditis elegans Module

... For the first days, we will introduce students to the nematode C. elegans. Students will work ... You are here: Home / About NS&B / Caenorhabditis elegans Module. ... elegans behavior. We will analyze C. elegans behavior in ... Students will use these techniques to determine 1) how C. elegans responds and remembers the temperature at which was raised; 2 ... We are addressing this question by studying the escape response of the nematode C. elegans. We have shown that the escape ...
more infohttp://www.mbl.edu/nsb/about/caenorhabditis-elegans/

Caenorhabditis elegans | nematode | Britannica.comCaenorhabditis elegans | nematode | Britannica.com

... many studies focused initially on Caenorhabditis elegans, since this model organism has a relatively small genome amenable to ... The genome of C. elegans is approximately 100 million base pairs, whereas the human genome consists of more than 3 billion. ... Other articles where Caenorhabditis elegans is discussed: aging: Genetics and life span: … ... studies centred on the nematode Caenorhabditis elegans, a near-microscopic soil worm that had been identified by Brenner as an ...
more infohttps://www.britannica.com/animal/Caenorhabditis-elegans

Caenorhabditis elegans - Everything2.comCaenorhabditis elegans - Everything2.com

In fact, we know an adult C. elegans has exactly 959 somatic cells, and their full lineage all the way back to the zygote. ... Caenorhabiditis elegans is a free-living (non-parasitic) species of soil nematode which makes a good model organism for ... Mutations have been found in C. elegans that slow down its metabolic rate and at the same time increase its lifespan.. You can ... C. elegans has been thoroughly studied by geneticists, developmental biologists and neurologists. The worms can be used to ...
more infohttps://everything2.com/title/Caenorhabditis+elegans

Caenorhabditis elegans News, ResearchCaenorhabditis elegans News, Research

Caenorhabditis elegans News and Research. RSS Caenorhabditis elegans is a free-living, transparent nematode (roundworm), about ... The microscopic roundworm Caenorhabditis elegans, or C. elegans, is known to spend up to 20 minutes seeking out snacks in its ... Study unravels microscopic mysteries in the brains of C. elegans Its the small pieces that make the big picture, and in this ... a combination of pharmaceutical drugs that not only increases healthy lifespan in the microscopic worm Caenorhabditis elegans ( ...
more infohttps://www.news-medical.net/?tag=/Caenorhabditis+elegans

Roundworms: Caenorhabditis Elegans | Encyclopedia.comRoundworms: Caenorhabditis Elegans | Encyclopedia.com

Source for information on Roundworms: Caenorhabditis Elegans: Encyclopedia of Aging dictionary. ... CAENORHABDITIS ELEGANS Aging is a complex deteriorative process affecting the survival of both living and nonliving things. ... Brenner, S. The Genetics of Caenorhabditis Elegans. Genetics 77 (1974): 71-94. ... Johnson, T. E., and Wood, W. B. Genetic Analysis of the Life-Span of Caenorhabditis Elegans. Proceedings of the National ...
more infohttps://www.encyclopedia.com/education/encyclopedias-almanacs-transcripts-and-maps/roundworms-caenorhabditis-elegans

Caenorhabditis elegans Archives - BioTechniquesCaenorhabditis elegans Archives - BioTechniques

We use cookies to improve your experience on our site and to show you relevant information and advertising. By continuing to use our website, you are agreeing to the BioTechniques cookie policy and privacy policy. For more information about the cookies we collect from you and information about our policies, visit our cookie policy and privacy policy ...
more infohttps://www.biotechniques.com/tag/caenorhabditis-elegans/

Caenorhabditis elegans - WikipediaCaenorhabditis elegans - Wikipedia

Caenorhabditis elegans var. Bergerac[2] (for instance strain BO)[3]. *Caenorhabditis elegans var. Bristol[4] (for instance ... The Orsay virus is a virus that affects C. elegans, as well as the Caenorhabditis elegans Cer1 virus[50] and the Caenorhabditis ... "Caenorhabditis". Merriam-Webster Dictionary.. *^ Wood, WB (1988). The Nematode Caenorhabditis elegans. Cold Spring Harbor ... Caenorhabditis elegans (/ˌsiːnoʊræbˈdaɪtəs ˈɛləɡænz/[6]) is a free-living, transparent nematode, about 1 mm in length,[7] that ...
more infohttps://en.m.wikipedia.org/wiki/Caenorhabditis_elegans

The genetics of Caenorhabditis elegans.  - PubMed - NCBIThe genetics of Caenorhabditis elegans. - PubMed - NCBI

The genetics of Caenorhabditis elegans.. Brenner S.. Abstract. Methods are described for the isolation, complementation and ... mapping of mutants of Caenorhabditis elegans, a small free-living nematode worm. About 300 EMS-induced mutants affecting ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/4366476?dopt=Abstract

THE GENETICS OF CAENORHABDITIS ELEGANS | GeneticsTHE GENETICS OF CAENORHABDITIS ELEGANS | Genetics

Methods are described for the isolation, complementation and mapping of mutants of Caenorhabditis elegans, a small free-living ... the genetic units in C.elegans are large. ... THE GENETICS OF CAENORHABDITIS ELEGANS Message Subject (Your ...
more infohttps://www.genetics.org/content/77/1/71?ijkey=9d866fd4f291c980e2942f588373e48414e96dfd&keytype2=tf_ipsecsha

THE GENETICS OF CAENORHABDITIS ELEGANS | GeneticsTHE GENETICS OF CAENORHABDITIS ELEGANS | Genetics

Methods are described for the isolation, complementation and mapping of mutants of Caenorhabditis elegans, a small free-living ... the genetic units in C.elegans are large. ... THE GENETICS OF CAENORHABDITIS ELEGANS Message Subject (Your ...
more infohttp://www.genetics.org/content/77/1/71?ijkey=bfb268f67ee456f78631dda512057c9cb3634301&keytype2=tf_ipsecsha

Caenorhabditis elegans News, Research - Page 6Caenorhabditis elegans News, Research - Page 6

Caenorhabditis elegans News and Research. RSS Caenorhabditis elegans is a free-living, transparent nematode (roundworm), about ... The effect of spaceflight on a microscopic worm - Caenorhabditis elegans (C. elegans) - could help it to live longer. ... Removal of germ cells - the sperm and egg producing cells - increases longevity of the roundworm Caenorhabditis elegans. ... Locomotion of C. elegans worm to make big difference in biomedical research One might wonder why researchers would even care ...
more infohttps://www.news-medical.net/?tag=/Caenorhabditis-elegans&page=6

Caenorhabditis elegans - WikipediaCaenorhabditis elegans - Wikipedia

C. elegans har ikkje immunseller.[2] Det ytre laget av C. elegans vert laga og skilt ut av 12 seller med til saman 157 ... Hobert, Oliver (2010). «Neurogenesis in the nematode Caenorhabditis elegans». Worm Book. doi:10.1895/wormbook.1.12.2.. ... Caenorhabditis elegans er ein gjennomsiktig 1-2 millimeter lang rundmakk. Han finst i ròtnande frukter og stenglar og er ein ... Tuck, Simon (2014). «The control of cell growth and body size in Caenorhabditis elegans». Experimental Cell Research 321 (1): ...
more infohttps://nn.wikipedia.org/wiki/Caenorhabditis_elegans

Role of autophagy in Caenorhabditis elegans.  - PubMed - NCBIRole of autophagy in Caenorhabditis elegans. - PubMed - NCBI

Role of autophagy in Caenorhabditis elegans.. Kovacs AL1, Zhang H.. Author information. 1. Department of Anatomy, Cell and ... During Caenorhabditis elegans development, autophagy plays an important role in many physiological processes, including ... Caenorhabditis elegans Proteins/chemistry. *Caenorhabditis elegans Proteins/genetics. *Caenorhabditis elegans Proteins/ ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/20138173?dopt=Abstract

A circuit for navigation in Caenorhabditis elegans | PNASA circuit for navigation in Caenorhabditis elegans | PNAS

A circuit for navigation in Caenorhabditis elegans. Jesse M. Gray, Joseph J. Hill, and Cornelia I. Bargmann ... Caenorhabditis elegans explores its environment by interrupting its forward movement with occasional turns and reversals. Turns ... The presence of food affects many aspects of C. elegans locomotion (18-21). Here we use a systematic analysis of C. elegans ... In the nematode Caenorhabditis elegans, the escape circuit was defined by using a complete synaptic wiring diagram of the 302 ...
more infohttps://www.pnas.org/content/102/9/3184?ijkey=faea7722d91b5de39821847df213b97f473a8ea4&keytype2=tf_ipsecsha

Caenorhabditis elegans - encyclopedia article - CitizendiumCaenorhabditis elegans - encyclopedia article - Citizendium

The Caenorhabditis elegans offers potential for the design of a biological dosimeter. 5. C. elegans also has many ... Caenorhabditis elegans is a simple organism that is an small free living nematode. It is found in various parts of the world. A ... The Nematode Caenorhabditis Elegans. New York: Cold Spring Harbor Laboratory, 1988. 2. Wood William Barry; ed. The Nematode ... The C. elegans are part of the model system. The key attributes of C. elegans as an experimental system for biological systems ...
more infohttp://en.citizendium.org/wiki/Caenorhabditis_elegans

Mitochondrial Division in Caenorhabditis elegans | SpringerLinkMitochondrial Division in Caenorhabditis elegans | SpringerLink

We describe methods to use Caenorhabditis elegansas an alternative model for studying mitochondrial... ... 2005) Genetic analysis oflysosomal trafficking in Caenorhabditis elegans. Mol. Biol. Cell 16, 3273-3288.PubMedCrossRefGoogle ... Wood, W. B. (ed.) (1988) The Nematode Caenorhabditis elegans, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. ... Gandre S., van der Bliek A.M. (2007) Mitochondrial Division in Caenorhabditis elegans. In: Leister D., Herrmann J.M. (eds) ...
more infohttps://link.springer.com/protocol/10.1007/978-1-59745-365-3_34

SWISS-MODEL | Caenorhabditis elegansSWISS-MODEL | Caenorhabditis elegans

Caenorhabditis elegans is a free-living, transparent nematode, about 1 mm in length, that lives in temperate soil environments ... From left to right: i) The number of proteins in the reference proteome of Caenorhabditis elegans, ii) the total number of ... The bar plot shows the coverage for every protein in the reference proteome of Caenorhabditis elegans for which there is at ... The plot shows the evolution over years (x-axis) of the fraction of Caenorhabditis elegans reference proteome residues (y-axis ...
more infohttps://swissmodel.expasy.org/repository/species/6239

ROS in Aging Caenorhabditis elegans: Damage or Signaling?ROS in Aging Caenorhabditis elegans: Damage or Signaling?

... Patricia Back, Bart P. Braeckman, and Filip Matthijssens ... Patricia Back, Bart P. Braeckman, and Filip Matthijssens, "ROS in Aging Caenorhabditis elegans: Damage or Signaling?," ...
more infohttps://www.hindawi.com/journals/omcl/2012/608478/cta/

Sequence Complexity of Chromosome 3 in Caenorhabditis elegansSequence Complexity of Chromosome 3 in Caenorhabditis elegans

Caenorhabditis elegans,/i, (,i,C. elegans,/i,) is studied. The complexity of these sequences is compared with some random ... elegans,/i,. In particular, the sequences with highest and lowest fractal value are singled out. It is shown that the intrinsic ... The Caenorhabditis elegans (C. elegans) is a 1 mm length transparent nematode. Thanks to its simple organic structure, it was ... The nucleotide sequences complexity in chromosome 3 of Caenorhabditis elegans (C. elegans) is studied. The complexity of these ...
more infohttps://www.hindawi.com/journals/abi/2012/287486/

An Introduction to Caenorhabditis elegans | ProtocolAn Introduction to Caenorhabditis elegans | Protocol

Caenorhabditis elegans is a microscopic, soil-dwelling roundworm that has been powerfully used as a model organism since the ... An Introduction to Caenorhabditis elegans. JoVE, Cambridge, MA, (2018).. Caenorhabditis elegans, or worms to the scientists ... Caenorhabditis elegans belongs to the phylum Nematoda of the animal kingdom. C. elegans are multicellular organisms that are ... You just watched JoVEs introduction to Caenorhabditis elegans. In this video, we reviewed the characteristics of C. elegans ...
more infohttps://www.jove.com/science-education/5103/an-introduction-to-caenorhabditis-elegans

The Nematode Caenorhabditis elegans
	The Nematode Caenorhabditis elegans

C. elegans II [Cloth]. C. elegans II [Paper]. C. elegans Atlas [Concealed wire binding]. ... The Nematode Caenorhabditis elegans. (Cold Spring Harbor Monograph Series 17). Book Series: Cold Spring Harbor Monograph Series ... Subject Area(s): Developmental Biology; Molecular Biology; Neurobiology; Caenorhabditis elegans. Edited by William B. Wood, ... Biology of C. elegans. Introduction to C. elegans Biology (W.B. Wood); Genetics (R.K. Herman); The Genome (S.W. Emmons); The ...
more infohttps://www.cshlpress.com/default.tpl?action=full&cart=1570742357181091519&--eqskudatarq=39&typ=ps&newtitle=The%20Nematode%20Caenorhabditis%20elegans

The Nematode Caenorhabditis elegansThe Nematode Caenorhabditis elegans

C. elegans II [Cloth]. C. elegans II [Paper]. C. elegans Atlas [Concealed wire binding]. ... The Nematode Caenorhabditis elegans. (Cold Spring Harbor Monograph Series 17). Book Series: Cold Spring Harbor Monograph Series ... Subject Area(s): Developmental Biology; Molecular Biology; Neurobiology; Caenorhabditis elegans. Edited by William B. Wood, ... Biology of C. elegans. Introduction to C. elegans Biology (W.B. Wood); Genetics (R.K. Herman); The Genome (S.W. Emmons); The ...
more infohttps://www.cshlpress.com/default.tpl?cart=1560357184454041943&action=full&--eqskudatarq=39&typ=rl
  • humans led to the nematode Caenorhabditis elegans , a near-microscopic soil worm that begins life with just 1,090 cells. (britannica.com)
  • studies centred on the nematode Caenorhabditis elegans , a near-microscopic soil worm that had been identified by Brenner as an ideal organism on which to study programmed cell death. (britannica.com)
  • who was investigating the nematode Caenorhabditis elegans . (britannica.com)
  • in fact, the species described here, the nematode Caenorhabditis elegans, (see Figure 1) lives for only three weeks under normal conditions. (encyclopedia.com)
  • In the nematode Caenorhabditis elegans , the escape circuit was defined by using a complete synaptic wiring diagram of the 302 neurons in its nervous system ( 4 , 5 ). (pnas.org)
  • Wood, W. B. (ed.) (1988) The Nematode Caenorhabditis elegans, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (springer.com)
  • S. W. Emmons, M. R. Klass, and D. Hirsh, "Analysis of the constancy of DNA sequences during development and evolution of the nematode Caenorhabditis elegans ," Proceedings of the National Academy of Sciences of the United States of America , vol. 76, no. 3, pp. 1333-1337, 1979. (hindawi.com)
  • The chemotaxis behavior of the nematode Caenorhabditis elegans raises, in simplified form, the key question of how the nervous system transforms sensory input into motor output to regulate a goal-directed response. (jneurosci.org)
  • The nematode Caenorhabditis elegans provides an attractive opportunity to study neuronal aging. (jneurosci.org)
  • We describe experiments with two types of immunologic probes, rabbit sera and mouse monoclonal antibodies, directed against cytoplasmic granules that are unique to germ-line cells in the nematode, Caenorhabditis elegans , and that may correspond to the germ-line-specific structures seen by electron microscopy in C. elegans embryos. (springer.com)
  • Since then, with the help of a growing number of investigators, knowledge about the biology of "the worm" has accumulated at a steadily accelerating pace to the extent that C. elegans is now probably the most completely understood metazoan in terms of anatomy, genetics, development, and behavior. (cshlpress.com)
  • This "Book of the Worm" serves as a reference source for C. elegans investigators as well as an introductory monograph for other biologists. (cshlpress.com)
  • The nematode (worm) C. elegans is one of the widely studied animal model organisms in biology. (rsc.org)
  • In C. elegans , however, neither steps nor impulses have been achieved under normal assay conditions in which the worm is crawling on an agar surface. (jneurosci.org)
  • One such model organism is the nematode worm, Caenorhabditis elegans . (mdpi.com)
  • The C. elegans wiring diagram provides an opportunity to define many complete neuronal paths from sensory stimulus to behavior. (pnas.org)
  • The past few years have seen the completion of two major long-term projects that provide new insights into C. elegans development and lay important groundwork for future investigation: completion of the cell lineages of both sexes, from zygote to adult, and description of the complete anatomy at the level of electron microscope resolution, providing a complete "wiring diagram" of cell contacts in the animal. (cshlpress.com)
  • The simplicity and completely defined synaptic connectivity of C. elegans nervous system in combination with powerful genetic methods, optogenetics, calcium imaging and electrophysiology allows us to address how the nervous controls behavior with a cellular and molecular resolution that cannot be readily attained in any other system. (mbl.edu)
  • many studies focused initially on Caenorhabditis elegans , since this model organism has a relatively small genome amenable to basic genetic research. (britannica.com)
  • Timmons, L., Court, D. L., and Fire, A. (2001) Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans . (springer.com)
  • 2005) Genetic analysis oflysosomal trafficking in Caenorhabditis elegans . (springer.com)
  • Students will work with different experimental set-ups that will allow us to explore a variety of C. elegans behavior. (mbl.edu)
  • We will analyze C. elegans behavior in response to thermal, mechanical and chemical stimuli. (mbl.edu)
  • Specifically, I am using the learned thermotaxis behavior of C. elegans as a model to examine how learning impacts synaptic physiology and neural circuit activity. (mbl.edu)
  • We describe methods to use Caenorhabditis elegans as an alternative model for studying mitochondrial division, taking advantage of the many wonderful resources provided by the C. elegans community. (springer.com)
  • My studies are focused on this question and seek to understand the cell biology of synapses in the thermotaxis circuit of C. elegans , a model system that facilitates in vivo inspection of neuronal cell biology. (mbl.edu)
  • In the past decade, many efforts have been undertaken to establish interdisciplinary research collaborations between biologists, physicists and engineers in order to develop microfluidic devices to study the biology of C. elegans . (mdpi.com)
  • Another reason C. elegans is so easy to study is that it has a transparent body and each of its cells can be examined individually under a microscope without dissecting it. (everything2.com)
  • Princeton University researchers have discovered that learned behaviors can be inherited for multiple generations in C. elegans, transmitted from parent to progeny via eggs and sperm cells. (news-medical.net)
  • Wightman, B., Ha, I., and Ruvkun, G. (1993) Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans . (springer.com)
  • 1999) The rde-1 gene, RNA interference, and transposon silencing in C. elegans . (springer.com)
  • The common increase in SOD activity prompted cloning the C. elegans Cu/Zn SOD gene. (pnas.org)
  • The basic anatomy of C. elegans includes a mouth, pharynx , intestine , gonad , and collagenous cuticle. (wikipedia.org)
  • Numerous gut granules are present in the intestine of C. elegans , the functions of which are still not fully known, as are many other aspects of this nematode, despite the many years that it has been studied. (wikipedia.org)
  • As C. elegans feeds on bacteria (microbivory), the intestine of worms isolated from the wild is usually filled with a large number of bacteria. (wikipedia.org)
  • Surprisingly, when we examined neuronal process morphology in C. elegans more closely, we observed dramatic age-dependent changes in their structure. (jneurosci.org)
  • Caenorhabditis elegans is a free-living, transparent nematode (roundworm), about 1 mm in length, which lives in temperate soil environments. (news-medical.net)
  • C. elegans were previously considered a soil-living nematode, but in the last 10 years it was shown that natural habitats of C. elegans are microbe-rich, such as compost heaps, rotten plant material, and rotten fruits. (wikipedia.org)
  • Finally, and most important, many cell biological processes identified in C. elegans have been found to be conserved evolutionarily. (jneurosci.org)
  • We have shown that the escape response allows C. elegans increases it chances to escape from predacious fungi that use constricting rings to entrap nematodes. (mbl.edu)
  • ROS in Aging Caenorhabditis elegans: Damage or Signaling? (hindawi.com)
  • The dauer larva state and the age-1 mutation, both of which extend life-span in Caenorhabditis elegans, were tested for hyperresistance to cellular damage that may be relevant to aging. (pnas.org)
  • During Caenorhabditis elegans development, autophagy plays an important role in many physiological processes, including survival under starvation conditions, modulation of life span, and regulation of necrotic cell death caused by toxic ion-channel variants. (nih.gov)
  • For example, when C. elegans is grown on Bacillus megaterium or Pseudomonas mendocina, worms are more resistant to infection with the pathogenic bacterium Pseudomonas aeruginosa , which is a common bacterium in C. elegans' natural environment and therefore a potential natural pathogen. (wikipedia.org)
  • Caenorhabditis elegans in Chinese medicinal studies: Making the case for aging and neurodegeneration," Rejuvenation Research , vol. 17, no. 2, pp. 205-208, 2014. (hindawi.com)
  • Most of the studies on C. elegans are based on the N2 strain, which has adapted to laboratory conditions. (wikipedia.org)
  • Only recently, some studies addressed the role of commensal and mutualistic bacteria on C. elegans fitness. (wikipedia.org)
  • The ecology of C. elegans can only be fully understood in the light of the multiple interactions with the microorganisms, which it encounters in the wild. (wikipedia.org)
  • Caenorhabditis elegans explores its environment by interrupting its forward movement with occasional turns and reversals. (pnas.org)
  • Inhibition of polyglutamine-mediated proteotoxicity by Astragalus membranaceus polysaccharide through the DAF-16/FOXO transcription factor in Caenorhabditis elegans ," Biochemical Journal , vol. 441, no. 1, pp. 417-424, 2012. (hindawi.com)
  • We are addressing this question by studying the escape response of the nematode C. elegans . (mbl.edu)
  • We have developed a new method to synchronize animals that relies on the electrotactic response (electric field-induced motion) of C. elegans to sort them in parallel based on their age, size and phenotype. (rsc.org)
  • These bacteria can affect C. elegans either directly through specific metabolites, or they can cause a change in the environmental conditions and thus induce a physiological response in the host. (wikipedia.org)
  • Is the Subject Area "Caenorhabditis elegans" applicable to this article? (plos.org)